#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PRTFDC1	56952	broad.mit.edu	37	10	25226219	25226219	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr10:25226219delC	ENST00000320152.6	-	3	261	c.233delG	c.(232-234)ggtfs	p.G78fs	PRTFDC1_ENST00000376378.1_Frame_Shift_Del_p.G78fs|PRTFDC1_ENST00000376376.3_Frame_Shift_Del_p.G78fs	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	78					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						GAATTTGTAACCTCCTTTAAG	0.378																																						ENST00000320152.6	0.980000	6.900000e-01	9.300000e-01	7.600000e-01	0.840000	0.850073	0.840000	0.850000																										0				9						c.(232-234)ggtfs		phosphoribosyl transferase domain containing 1							145.0	137.0	139.0					10																	25226219		2203	4300	6503	SO:0001589	frameshift_variant	56952	0	0					g.chr10:25226219delC	AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.233delG	chr10.hg19:g.25226219delC	ENSP00000318602:p.Gly78fs	1					PRTFDC1_ENST00000376376.3_Frame_Shift_Del_p.G78fs|PRTFDC1_ENST00000376378.1_Frame_Shift_Del_p.G78fs	p.G78fs	NM_020200.5	NP_064585.1	0	1	1	1.612117	Q9NRG1	PRDC1_HUMAN		3	261	-			B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Frame_Shift_Del	DEL	ENST00000320152.6	1	1	hg19	c.233delG	CCDS7145.1	0																																																																																								0.234568		TCGA-HZ-A8P0-01A-11D-A36O-08	0.378	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2	1	0	1		20	2		0	0	0	2	96	0	96	96	1	1.960000	-3.323268	1	0.380000	NM_020200		0	79	83	0	312	310	0	0	1	1		0	0	96	0	0	1.000000	9.175640e-01		3	0	16	0	79	312
MUC6	4588	broad.mit.edu	37	11	1025891	1025892	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			-	T	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:1025891_1025892insT	ENST00000421673.2	-	22	2762_2763	c.2712_2713insA	c.(2710-2715)tcacagfs	p.Q905fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	905	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGGTGGGCTGTGAGTCGTTGA	0.658																																						ENST00000421673.2	1.000000	3.600000e-01	8.000000e-01	4.800000e-01	0.620000	0.644657	0.620000	0.600000																										0				80						c.(2710-2715)tcacagfs		mucin 6, oligomeric mucus/gel-forming																																				SO:0001589	frameshift_variant	4588	0	0					g.chr11:1025891_1025892insT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2713dupA	chr11.hg19:g.1025892_1025892dupT	ENSP00000406861:p.Gln905fs	0						p.Q905fs	NM_005961.2	NP_005952.2	1	2	3	2.036293	Q6W4X9	MUC6_HUMAN		22	2762_2763	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Ins	INS	ENST00000421673.2	0	1	hg19	c.2712_2713insA	CCDS44513.1	0																																																																																								0.385835		TCGA-HZ-A8P0-01A-11D-A36O-08	0.658	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	1	0	1		2	2		0	0	0	0	31	0	31	32	1	1.960000	-19.999290	1	0.380000	XM_290540		0	15	15	0	116	117	0	0	1	0		0	0	31	0	0	0.999910	9.999623e-01		0	0	147	0	15	116
STK11	6794	broad.mit.edu	37	19	1207092	1207092	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr19:1207092delC	ENST00000326873.7	+	1	1353	c.180delC	c.(178-180)tacfs	p.Y60fs	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	60	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)|p.Y60fs*1(3)|p.Y60*(2)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCTCTTACGGCAAGGTGA	0.622		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																												ENST00000326873.7	1.000000	9.600000e-01	1	9.900000e-01	0.990000	0.997862	0.990000	1.000000		14	yes	Rec	yes	Peutz-Jeghers syndrome	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	19p13.3	6794	D, Mis, N, F, S	serine/threonine kinase 11 gene (LKB1)				"""E, M, O"""	E, M, O		jejunal harmartoma, ovarian, testicular, pancreatic	NSCLC, pancreatic		28	Whole gene deletion(20)|Deletion - Frameshift(4)|Substitution - Nonsense(2)|Unknown(2)	p.0?(20)|p.?(3)|p.Y60fs*1(3)|p.Y60*(2)	cervix(15)|lung(8)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	328	GRCh37	CD064644|CM981863|CM991149	STK11	D|M		c.(178-180)tacfs		serine/threonine kinase 11							42.0	46.0	45.0					19																	1207092		2088	4198	6286	SO:0001589	frameshift_variant	6794	0	0		Peutz-Jeghers syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	g.chr19:1207092delC	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.180delC	chr19.hg19:g.1207092delC	ENSP00000324856:p.Tyr60fs	1	TSP Lung(3;<1E-08)				STK11_ENST00000585748.1_Intron	p.Y60fs	NM_000455.4	NP_000446.1	0	2	2	2.079930	Q15831	STK11_HUMAN		1	1353	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	1	1	hg19	c.180delC	CCDS45896.1	1																																																																																								0.380000		TCGA-HZ-A8P0-01A-11D-A36O-08	0.622	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	1	0	1		2	2	2	0	0	0	0	37	0	37	37	1	1.960000	-20.000000	1	0.380000	NM_000455		0	52	52	0	167	162	0	0	1	1	1	0	0	37	879	0	1.000000	1	1	21	324	72	962	52	167
ARHGAP22	58504	broad.mit.edu	37	10	49667870	49667870	+	Silent	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr10:49667870C>T	ENST00000249601.4	-	5	812	c.516G>A	c.(514-516)gcG>gcA	p.A172A	ARHGAP22_ENST00000374172.1_Silent_p.A63A|ARHGAP22_ENST00000435790.2_Silent_p.A178A|ARHGAP22_ENST00000374170.1_Silent_p.A82A|ARHGAP22_ENST00000417912.2_Silent_p.A188A|ARHGAP22_ENST00000417247.2_Silent_p.A82A	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	172	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCAGCAGGGGCGCCAGGCGGG	0.652																																						ENST00000249601.4	1.000000	7.300000e-01	1	8.200000e-01	0.910000	0.913408	0.910000	1.000000																										0				18						c.(514-516)gcG>gcA		Rho GTPase activating protein 22							50.0	51.0	50.0					10																	49667870		2203	4300	6503	SO:0001819	synonymous_variant	58504	0	0					g.chr10:49667870C>T	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.516G>A	chr10.hg19:g.49667870C>T		0					ARHGAP22_ENST00000417247.2_Silent_p.A82A|ARHGAP22_ENST00000435790.2_Silent_p.A178A|ARHGAP22_ENST00000417912.2_Silent_p.A188A|ARHGAP22_ENST00000374172.1_Silent_p.A63A|ARHGAP22_ENST00000374170.1_Silent_p.A82A	p.A172A	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	0	0	0	1.938979	Q7Z5H3	RHG22_HUMAN		5	812	-			A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Silent	SNP	ENST00000249601.4	1	1	hg19	c.516G>A	CCDS7227.1	1																																																																																								0.355509		TCGA-HZ-A8P0-01A-11D-A36O-08	0.652	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	1	0	1	2	2	2	2	0	0	0	0	86	86	86	84	1	1.960000	-20.000000	1	0.380000	NM_021226		0	67	67	0	300	292	1		1	0		0	0	86	0	0	1.000000	4.485014e-01	0	0	0	8	0	67	300
SLC18A3	6572	broad.mit.edu	37	10	50820227	50820227	+	Nonsense_Mutation	SNP	G	G	T	rs144340824		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr10:50820227G>T	ENST00000374115.3	+	1	1881	c.1441G>T	c.(1441-1443)Gag>Tag	p.E481*	CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	481					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CTCCCGTTCCGAGCGCGATGT	0.657																																						ENST00000374115.3	0.190000	2.000000e-02	1.400000e-01	5.000000e-02	0.080000	0.100316	0.080000	0.090000																										0				43						c.(1441-1443)Gag>Tag		solute carrier family 18 (vesicular acetylcholine transporter), member 3							63.0	52.0	56.0					10																	50820227		2203	4300	6503	SO:0001587	stop_gained	6572	0	0					g.chr10:50820227G>T	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1441G>T	chr10.hg19:g.50820227G>T	ENSP00000363229:p.Glu481*	0					CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000351556.3_5'Flank	p.E481*	NM_003055.2	NP_003046.2	0	0	0	1.938979	Q16572	VACHT_HUMAN		1	1881	+			B2R7S1	Nonsense_Mutation	SNP	ENST00000374115.3	0	1	hg19	c.1441G>T	CCDS7231.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.864615	0.98982	.	.	ENSG00000187714	ENST00000374115	.	.	.	4.87	4.87	0.63330	4.87	4.87	0.63330	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-18.4589	18.0047	0.89207	0.0:0.0:1.0:0.0	.	.	.	.	X	481	.	ENSP00000363229:E481X	E	+	1	0	0	SLC18A3	50490233	50490233	1.000000	0.71417	0.976000	0.42696	0.726000	0.41606	9.869000	0.99810	2.262000	0.75019	0.561000	0.74099	GAG	0.355509		TCGA-HZ-A8P0-01A-11D-A36O-08	0.657	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	0	0	0	2	2	2	2	0	0	0	0	63	63	63	63	1	1.960000	-4.014923	1	0.380000	NM_003055		0	5	4	0	294	292	0		1			0	0	63	0	0	0.936393	0	0	0	0	0	0	5	294
WAPAL	23063	broad.mit.edu	37	10	88260206	88260206	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr10:88260206T>G	ENST00000298767.5	-	3	1266	c.794A>C	c.(793-795)gAt>gCt	p.D265A		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	265	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						AAAATCGTCATCCTTCATCTC	0.363																																						ENST00000298767.5	1.000000	8.000000e-01	9.900000e-01	8.700000e-01	0.930000	0.933580	0.930000	0.990000																										0				31						c.(793-795)gAt>gCt		wings apart-like homolog (Drosophila)							83.0	80.0	81.0					10																	88260206		2203	4300	6503	SO:0001583	missense	23063	0	0					g.chr10:88260206T>G	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.794A>C	chr10.hg19:g.88260206T>G	ENSP00000298767:p.Asp265Ala	1						p.D265A	NM_015045.2	NP_055860.1	0	1	1	1.619202	Q7Z5K2	WAPL_HUMAN		3	1266	-			A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	1	1	hg19	c.794A>C	CCDS7375.1	1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.441746	0.25900	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.47528	0.84	5.77	3.4	0.38934	5.77	3.4	0.38934	.	0.535917	0.20186	N	0.097418	T	0.35740	0.0942	L	0.34521	1.04	0.80722	D	1	B;B;B	0.22683	0.043;0.043;0.073	B;B;B	0.21151	0.01;0.01;0.033	T	0.23404	-1.0189	10	0.72032	D	0.01	.	9.4528	0.38736	0.0:0.1534:0.0:0.8466	.	265;265;308	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	A	350;265;350	ENSP00000298767:D265A	ENSP00000298767:D265A	D	-	2	0	0	WAPAL	88250186	88250186	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	1.613000	0.36900	0.996000	0.38943	0.528000	0.53228	GAT	0.234568		TCGA-HZ-A8P0-01A-11D-A36O-08	0.363	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	1	0	1	2	2	2	2	0	0	0	0	82	82	82	80	1	1.960000	-20.000000	1	0.380000	NM_015045		0	81	80	0	256	253	1		1	1		0	0	82	0	0	1.000000	8.817855e-01	0	5	0	9	0	81	256
KDELC2	143888	broad.mit.edu	37	11	108356954	108356954	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:108356954C>T	ENST00000323468.5	-	3	679	c.614G>A	c.(613-615)cGg>cAg	p.R205Q	KDELC2_ENST00000375648.1_Missense_Mutation_p.R149Q|KDELC2_ENST00000434945.2_Missense_Mutation_p.R149Q|KDELC2_ENST00000532730.1_5'UTR	NM_153705.4	NP_714916.3	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2	205						endoplasmic reticulum (GO:0005783)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TAAAGATCTCCGGTAAACATG	0.378																																						ENST00000323468.5	1.000000	7.300000e-01	1	8.200000e-01	0.910000	0.912199	0.910000	1.000000																										0				13						c.(613-615)cGg>cAg		KDEL (Lys-Asp-Glu-Leu) containing 2							160.0	145.0	150.0					11																	108356954		1845	4093	5938	SO:0001583	missense	143888	4	120806	41				g.chr11:108356954C>T	AF533708	CCDS41711.1	11q32	2010-11-18			ENSG00000178202	ENSG00000178202			28496	protein-coding gene	gene with protein product						12975309	Standard	NM_153705		Approved	MGC33424	uc001pkj.2	Q7Z4H8	OTTHUMG00000166535	ENST00000323468.5:c.614G>A	chr11.hg19:g.108356954C>T	ENSP00000315386:p.Arg205Gln	0					KDELC2_ENST00000532730.1_5'UTR|KDELC2_ENST00000434945.2_Missense_Mutation_p.R149Q|KDELC2_ENST00000375648.1_Missense_Mutation_p.R149Q	p.R205Q	NM_153705.4	NP_714916.3	0	0	0	1.993013	Q7Z4H8	KDEL2_HUMAN		3	679	-		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	Q6UWW2|Q6ZUM9|Q8N7L8|Q8NE24	Missense_Mutation	SNP	ENST00000323468.5	1	1	hg19	c.614G>A	CCDS41711.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800251	0.90538	.	.	ENSG00000178202	ENST00000323468;ENST00000434945;ENST00000375648	T;T;T	0.23754	1.89;1.89;1.89	4.68	3.76	0.43208	4.68	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.53690	0.1812	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.58842	-0.7565	10	0.31617	T	0.26	-17.0817	14.0815	0.64925	0.0:0.926:0.0:0.074	.	205;149	Q7Z4H8;Q7Z4H8-2	KDEL2_HUMAN;.	Q	205;149;149	ENSP00000315386:R205Q;ENSP00000413429:R149Q;ENSP00000364799:R149Q	ENSP00000315386:R205Q	R	-	2	0	0	KDELC2	107862164	107862164	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.543000	0.82106	1.566000	0.49654	0.655000	0.94253	CGG	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.378	KDELC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390273.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.960000	-2.619481	1	0.380000	NM_153705		0	69	68	0	322	316	1		1	0		0	0	99	0	0	1.000000	9.039388e-01	0	1	0	20	0	69	322
APOA4	337	broad.mit.edu	37	11	116692155	116692155	+	Nonsense_Mutation	SNP	C	C	A	rs145184607		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:116692155C>A	ENST00000357780.3	-	3	733	c.619G>T	c.(619-621)Gaa>Taa	p.E207*		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	207	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		ACTTTGAATTCGTCAGCGTAG	0.622																																						ENST00000357780.3	0.090000	2.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.057759	0.050000	0.060000																										0				20						c.(619-621)Gaa>Taa		apolipoprotein A-IV							213.0	203.0	207.0					11																	116692155		2201	4294	6495	SO:0001587	stop_gained	337	0	0					g.chr11:116692155C>A		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.619G>T	chr11.hg19:g.116692155C>A	ENSP00000350425:p.Glu207*	0						p.E207*	NM_000482.3	NP_000473.2	0	0	0	1.993013	P06727	APOA4_HUMAN		3	733	-	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)	A8MSL6|Q14CW8|Q6Q787	Nonsense_Mutation	SNP	ENST00000357780.3	0	1	hg19	c.619G>T	CCDS31681.1	0	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417451	0.62622	.	.	ENSG00000110244	ENST00000357780	.	.	.	5.2	-0.358	0.12575	5.2	-0.358	0.12575	.	1.439250	0.04140	N	0.319406	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-6.1119	7.4216	0.27075	0.0:0.4561:0.2494:0.2944	.	.	.	.	X	207	.	ENSP00000350425:E207X	E	-	1	0	0	APOA4	116197365	116197365	0.000000	0.05858	0.009000	0.14445	0.413000	0.31143	0.036000	0.13819	-0.027000	0.13873	0.563000	0.77884	GAA	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.622	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2	0	0	1	2	2	2	2	1	1	1	0	301	301	301	300	1	1.960000	-2.287407	0	0.380000	NM_000482		0	11	11	0	1070	1050	0		1	0		1	0	301	0	0	0.998143	4.496430e-03	0	0	0	9	0	11	1070
DSCAML1	57453	broad.mit.edu	37	11	117387332	117387332	+	Silent	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:117387332G>A	ENST00000321322.6	-	8	1814	c.1813C>T	c.(1813-1815)Ctg>Ttg	p.L605L	DSCAML1_ENST00000527706.1_Silent_p.L335L	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	545	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TTGTCTGGCAGCAGCAGGGCA	0.582																																						ENST00000321322.6	0.250000	3.000000e-02	1.900000e-01	6.000000e-02	0.110000	0.131439	0.110000	0.100000																										0				110						c.(1813-1815)Ctg>Ttg		Down syndrome cell adhesion molecule like 1							93.0	76.0	82.0					11																	117387332		2201	4296	6497	SO:0001819	synonymous_variant	57453	0	0					g.chr11:117387332G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1813C>T	chr11.hg19:g.117387332G>A		0					DSCAML1_ENST00000527706.1_Silent_p.L335L	p.L605L	NM_020693.2	NP_065744.2	0	0	0	1.993013	Q8TD84	DSCL1_HUMAN		8	1814	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	0	1	hg19	c.1813C>T	CCDS8384.1	0																																																																																								0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.582	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	0	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.960000	-5.685554	1	0.380000	NM_020693		0	4	4	0	191	187	0		1			0	0	47	0	0	0.886308	0	0	0	0	0	0	4	191
OR5A1	219982	broad.mit.edu	37	11	59211572	59211572	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:59211572A>G	ENST00000302030.2	+	1	956	c.931A>G	c.(931-933)Aag>Gag	p.K311E		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						GTTGGAAAGGAAGAAAGTGTT	0.438																																						ENST00000302030.2	1.000000	7.800000e-01	1	8.500000e-01	0.940000	0.933889	0.940000	1.000000																										0				28						c.(931-933)Aag>Gag		olfactory receptor, family 5, subfamily A, member 1							148.0	148.0	148.0					11																	59211572		2201	4295	6496	SO:0001583	missense	219982	0	0					g.chr11:59211572A>G	AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.931A>G	chr11.hg19:g.59211572A>G	ENSP00000303096:p.Lys311Glu	0						p.K311E	NM_001004728.1	NP_001004728.1	0	0	0	2.000324	Q8NGJ0	OR5A1_HUMAN		1	956	+			B9EH58|Q6IFF2|Q96RB1	Missense_Mutation	SNP	ENST00000302030.2	1	1	hg19	c.931A>G	CCDS31561.1	1	.	.	.	.	.	.	.	.	.	.	A	7.443	0.641062	0.14386	.	.	ENSG00000172320	ENST00000302030	T	0.39406	1.08	5.02	2.68	0.31781	5.02	2.68	0.31781	.	0.762345	0.11693	N	0.538628	T	0.25901	0.0631	L	0.28115	0.83	0.09310	N	1	P	0.37122	0.583	B	0.30646	0.118	T	0.09930	-1.0652	10	0.52906	T	0.07	-1.0631	6.7823	0.23652	0.8103:0.0:0.1897:0.0	.	311	Q8NGJ0	OR5A1_HUMAN	E	311	ENSP00000303096:K311E	ENSP00000303096:K311E	K	+	1	0	0	OR5A1	58968148	58968148	0.998000	0.40836	0.001000	0.08648	0.222000	0.24845	4.557000	0.60782	0.351000	0.24027	0.528000	0.53228	AAG	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.438	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	1.960000	-20.000000	1	0.380000	NM_001004728		0	101	100	0	457	451	1		1			0	0	132	0	0	1.000000	0	0	0	0	0	0	101	457
MS4A3	932	broad.mit.edu	37	11	59837071	59837071	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:59837071C>T	ENST00000278865.3	+	6	611	c.538C>T	c.(538-540)Ctc>Ttc	p.L180F	MS4A3_ENST00000395032.2_Missense_Mutation_p.L57F|MS4A3_ENST00000534744.1_Missense_Mutation_p.L134F|MS4A3_ENST00000358152.2_Missense_Mutation_p.L134F	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	180						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				ACTGCTGATTCTCACCTTGCT	0.413																																						ENST00000278865.3	0.150000	4.000000e-02	1.300000e-01	6.000000e-02	0.090000	0.101400	0.090000	0.100000																										0				21						c.(538-540)Ctc>Ttc		membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)							274.0	253.0	260.0					11																	59837071		2201	4295	6496	SO:0001583	missense	932	0	0					g.chr11:59837071C>T	L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.538C>T	chr11.hg19:g.59837071C>T	ENSP00000278865:p.Leu180Phe	0					MS4A3_ENST00000534744.1_Missense_Mutation_p.L134F|MS4A3_ENST00000395032.2_Missense_Mutation_p.L57F|MS4A3_ENST00000358152.2_Missense_Mutation_p.L134F	p.L180F	NM_006138.4	NP_006129.4	0	0	0	2.000324	Q96HJ5	MS4A3_HUMAN		6	611	+		all_epithelial(135;0.245)	A8MTP8|Q8NHW2	Missense_Mutation	SNP	ENST00000278865.3	0	1	hg19	c.538C>T	CCDS31567.1	0	.	.	.	.	.	.	.	.	.	.	C	7.678	0.688406	0.14973	.	.	ENSG00000149516	ENST00000395032;ENST00000358152;ENST00000278865;ENST00000534744	T;T;T;T	0.02067	4.47;4.47;4.47;4.47	4.75	-0.38	0.12490	4.75	-0.38	0.12490	.	0.452259	0.22739	N	0.056237	T	0.01489	0.0048	N	0.20986	0.625	0.09310	N	1	B;P	0.38395	0.215;0.629	B;B	0.40199	0.097;0.322	T	0.40021	-0.9585	10	0.02654	T	1	-7.6657	7.4388	0.27171	0.0:0.5146:0.0:0.4854	.	134;180	Q96HJ5-2;Q96HJ5	.;MS4A3_HUMAN	F	57;134;180;134	ENSP00000378473:L57F;ENSP00000350872:L134F;ENSP00000278865:L180F;ENSP00000434117:L134F	ENSP00000278865:L180F	L	+	1	0	0	MS4A3	59593647	59593647	0.108000	0.22018	0.003000	0.11579	0.108000	0.19459	-0.073000	0.11468	-0.246000	0.09611	0.643000	0.83706	CTC	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.413	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394417.1	0	0	1	2	2	2	2	1	1	1	0	148	148	148	145	1	1.960000	-2.470769	0	0.380000			0	14	14	0	755	753	0		1			1	0	148	0	0	0.999749	0	0	0	0	0	0	14	755
BEST1	7439	broad.mit.edu	37	11	61730184	61730184	+	Missense_Mutation	SNP	G	G	A	rs61747600		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:61730184G>A	ENST00000378043.4	+	10	2201	c.1558G>A	c.(1558-1560)Gat>Aat	p.D520N	BEST1_ENST00000301774.9_Missense_Mutation_p.D148N|FTH1_ENST00000529631.1_Intron|BEST1_ENST00000378042.3_Missense_Mutation_p.D433N|FTH1_ENST00000529191.1_Intron|BEST1_ENST00000534553.1_3'UTR|BEST1_ENST00000449131.2_Missense_Mutation_p.D460N	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	520					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						CTCAGAGAGCGATGGGGCCTT	0.468																																						ENST00000378043.4	1.000000	5.800000e-01	9.500000e-01	6.900000e-01	0.810000	0.821902	0.810000	1.000000																										0				25						c.(1558-1560)Gat>Aat		bestrophin 1							82.0	78.0	79.0					11																	61730184		2202	4299	6501	SO:0001583	missense	7439	1	121412	31				g.chr11:61730184G>A	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1558G>A	chr11.hg19:g.61730184G>A	ENSP00000367282:p.Asp520Asn	0					BEST1_ENST00000534553.1_3'UTR|BEST1_ENST00000301774.9_Missense_Mutation_p.D148N|FTH1_ENST00000529631.1_Intron|FTH1_ENST00000529191.1_Intron|BEST1_ENST00000449131.2_Missense_Mutation_p.D460N|BEST1_ENST00000378042.3_Missense_Mutation_p.D433N	p.D520N	NM_004183.3	NP_004174.1	0	0	0	2.000324	O76090	BEST1_HUMAN		10	2201	+			A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Missense_Mutation	SNP	ENST00000378043.4	1	1	hg19	c.1558G>A	CCDS31580.1	0	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099498	0.37048	.	.	ENSG00000167995	ENST00000378043;ENST00000378042;ENST00000301774;ENST00000449131	D;D;T;D	0.97404	-4.36;-4.1;-0.33;-4.37	5.34	1.03	0.20045	5.34	1.03	0.20045	.	1.615380	0.03680	N	0.245331	D	0.90195	0.6935	N	0.14661	0.345	0.09310	N	0.999994	P;B;P	0.38370	0.628;0.355;0.628	B;B;B	0.24848	0.04;0.018;0.056	D	0.86624	0.1881	10	0.23891	T	0.37	-0.3632	4.8606	0.13581	0.2543:0.2983:0.4474:0.0	rs61747600	433;520;460	O76090-4;O76090;O76090-3	.;BEST1_HUMAN;.	N	520;433;148;460	ENSP00000367282:D520N;ENSP00000367281:D433N;ENSP00000301774:D148N;ENSP00000399709:D460N	ENSP00000301774:D148N	D	+	1	0	0	BEST1	61486760	61486760	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.302000	0.19192	0.254000	0.21573	0.655000	0.94253	GAT	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.468	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	53	1	1.960000	-20.000000	1	0.380000	NM_004183		0	34	34	0	183	180	1		1	0		0	0	56	0	0	1.000000	1.241329e-01	0	0	0	4	0	34	183
HYOU1	10525	broad.mit.edu	37	11	118919004	118919004	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr11:118919004C>T	ENST00000404233.3	-	20	2456	c.2332G>A	c.(2332-2334)Gca>Aca	p.A778T	HYOU1_ENST00000525859.1_Missense_Mutation_p.A716T|HYOU1_ENST00000529972.1_Missense_Mutation_p.A716T|RP11-110I1.6_ENST00000531886.1_RNA	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	778					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CAGGTGGATGCGGCGCTGAGC	0.617																																						ENST00000404233.3	0.180000	3.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.105340	0.090000	0.100000																										0				33						c.(2332-2334)Gca>Aca		hypoxia up-regulated 1							88.0	86.0	87.0					11																	118919004		2200	4295	6495	SO:0001583	missense	10525	3	121412	37				g.chr11:118919004C>T	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.2332G>A	chr11.hg19:g.118919004C>T	ENSP00000384144:p.Ala778Thr	0					HYOU1_ENST00000525859.1_Missense_Mutation_p.A716T|RP11-110I1.6_ENST00000531886.1_RNA|HYOU1_ENST00000529972.1_Missense_Mutation_p.A716T	p.A778T	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	0	0	0	1.993013	Q9Y4L1	HYOU1_HUMAN		20	2456	-	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	0	1	hg19	c.2332G>A	CCDS8408.1	0	.	.	.	.	.	.	.	.	.	.	C	6.079	0.382934	0.11524	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000535579;ENST00000525859;ENST00000544701	T;T;T	0.14022	2.54;2.54;2.54	5.53	-0.593	0.11667	5.53	-0.593	0.11667	.	0.229106	0.44902	N	0.000409	T	0.08802	0.0218	L	0.37697	1.125	0.09310	N	0.999994	B;D;B;B	0.52996	0.104;0.957;0.023;0.023	B;B;B;B	0.43386	0.021;0.418;0.015;0.015	T	0.35549	-0.9784	10	0.06757	T	0.87	-4.1834	10.1432	0.42747	0.0:0.5981:0.0:0.4019	.	769;760;778;778	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	T	778;769;716;627;716;759	ENSP00000384144:A778T;ENSP00000437313:A716T;ENSP00000433397:A716T	ENSP00000278752:A769T	A	-	1	0	0	HYOU1	118424214	118424214	0.087000	0.21565	0.000000	0.03702	0.044000	0.14063	0.693000	0.25497	-0.257000	0.09459	-0.894000	0.02916	GCA	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.617	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.960000	-1.996603	0	0.380000	NM_006389		0	7	7	0	386	384	0		1	0		0	0	85	0	0	0.980471	7.364256e-01	0	0	0	142	0	7	386
TAS2R20	259295	broad.mit.edu	37	12	11149731	11149731	+	Silent	SNP	C	C	T	rs558939586		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr12:11149731C>T	ENST00000538986.1	-	1	743	c.744G>A	c.(742-744)tcG>tcA	p.S248S	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	248					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						AATTCCAAAACGATATGATTA	0.378																																						ENST00000538986.1	1.000000	7.200000e-01	1	8.100000e-01	0.900000	0.901639	0.900000	1.000000																										0				13						c.(742-744)tcG>tcA		taste receptor, type 2, member 20							117.0	116.0	116.0					12																	11149731		2203	4300	6503	SO:0001819	synonymous_variant	259295	11	121408	45				g.chr12:11149731C>T	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.744G>A	chr12.hg19:g.11149731C>T		0					TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	p.S248S	NM_176889.2	NP_795370.2	0	0	0	1.971689	P59543	T2R20_HUMAN		1	743	-			P59549|Q2HIZ4|Q496D8|Q645X9	Silent	SNP	ENST00000538986.1	1	1	hg19	c.744G>A	CCDS8639.1	1																																																																																								0.365534		TCGA-HZ-A8P0-01A-11D-A36O-08	0.378	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	1	0	1	2	2	2	2	0	0	0	0	106	106	106	105	1	1.960000	-20.000000	1	0.380000	NM_176889		0	76	75	0	355	353	1		1			0	0	106	0	0	1.000000	0	0	0	0	0	0	76	355
KRAS	3845	broad.mit.edu	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	T	A	rs17851045		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr12:25380275T>A	ENST00000256078.4	-	3	246	c.183A>T	c.(181-183)caA>caT	p.Q61H	KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H|KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(153)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTCCTCTTGACCTGCTG	0.423	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	8.500000e-01	1	9.500000e-01	0.990000	0.983073	0.990000	1.000000	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	153	Substitution - Missense(153)	p.Q61H(153)	large_intestine(74)|lung(26)|pancreas(18)|haematopoietic_and_lymphoid_tissue(9)|endometrium(7)|soft_tissue(3)|biliary_tract(3)|liver(3)|cervix(2)|skin(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)|NS(1)	25349						c.(181-183)caA>caT		Kirsten rat sarcoma viral oncogene homolog							109.0	98.0	102.0					12																	25380275		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25380275T>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.183A>T	chr12.hg19:g.25380275T>A	ENSP00000256078:p.Gln61His	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H	p.Q61H	NM_033360.2	NP_203524.1	0	0	0	1.998835	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	3	246	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.183A>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243092	0.79912	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.84146	-1.81;-1.81	5.77	5.77	0.91146	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.87265	0.6134	M	0.91140	3.18	0.80722	D	1	B;B	0.33413	0.411;0.09	B;B	0.32724	0.092;0.151	D	0.87829	0.2643	10	0.72032	D	0.01	.	9.9836	0.41828	0.0:0.0752:0.0:0.9248	rs17851045	61;61	P01116-2;P01116	.;RASK_HUMAN	H	61	ENSP00000308495:Q61H;ENSP00000256078:Q61H	ENSP00000256078:Q61H	Q	-	3	2	2	KRAS	25271542	25271542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.240000	0.43088	2.326000	0.78906	0.533000	0.62120	CAA	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.423	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.960000	-20.000000	1	0.380000	NM_033360		1372	72	69	6654	280	277	1	1	1	1	1	0	0	68	931	1	1.000000	9.732354e-01	1	6	197	19	939	72	280
ESPL1	9700	broad.mit.edu	37	12	53681786	53681786	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr12:53681786G>A	ENST00000257934.4	+	19	4298	c.4207G>A	c.(4207-4209)Gac>Aac	p.D1403N	ESPL1_ENST00000552462.1_Missense_Mutation_p.D1403N	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1403					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TGACTTGGAAGACCCTGTCTC	0.582											OREG0021863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(53;1069 1201 2587 5382)	ENST00000257934.4	1.000000	7.900000e-01	1	8.800000e-01	0.990000	0.958100	0.990000	1.000000																										0				70						c.(4207-4209)Gac>Aac		extra spindle pole bodies homolog 1 (S. cerevisiae)							48.0	49.0	49.0					12																	53681786		2196	4294	6490	SO:0001583	missense	9700	0	0					g.chr12:53681786G>A	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.4207G>A	chr12.hg19:g.53681786G>A	ENSP00000257934:p.Asp1403Asn	0		OREG0021863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	994	ESPL1_ENST00000552462.1_Missense_Mutation_p.D1403N	p.D1403N	NM_012291.4	NP_036423.4	0	0	0	1.998835	Q14674	ESPL1_HUMAN		19	4298	+				Missense_Mutation	SNP	ENST00000257934.4	1	1	hg19	c.4207G>A	CCDS8852.1	1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.645049	0.67358	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12039	2.72;2.72	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.429106	0.26935	N	0.021758	T	0.19565	0.0470	M	0.67953	2.075	0.38567	D	0.949859	P	0.44734	0.842	B	0.40329	0.326	T	0.02743	-1.1116	10	0.34782	T	0.22	.	16.9805	0.86326	0.0:0.0:1.0:0.0	.	1403	Q14674	ESPL1_HUMAN	N	1403;1078;1403	ENSP00000257934:D1403N;ENSP00000449831:D1403N	ENSP00000257934:D1403N	D	+	1	0	0	ESPL1	51968053	51968053	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	5.401000	0.66326	2.751000	0.94390	0.650000	0.86243	GAC	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.582	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	1	0	1	2	2	2	2	0	0	0	0	104	104	104	103	1	1.960000	-20.000000	1	0.380000	NM_012291		0	73	73	0	310	308	1		1	0		0	0	104	0	0	1.000000	3.734607e-02	0	0	0	2	0	73	310
ATP5B	506	broad.mit.edu	37	12	57037629	57037629	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr12:57037629C>T	ENST00000262030.3	-	4	649	c.599G>A	c.(598-600)gGc>gAc	p.G200D	ATP5B_ENST00000552919.1_Missense_Mutation_p.G200D|ATP5B_ENST00000550162.1_5'Flank|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	200					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACCAATTTTGCCACCCTTGGC	0.418																																						ENST00000262030.3	0.130000	1.000000e-02	1.000000e-01	3.000000e-02	0.060000	0.071926	0.060000	0.060000																										0				19						c.(598-600)gGc>gAc		ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide							122.0	106.0	111.0					12																	57037629		2203	4300	6503	SO:0001583	missense	506	0	0					g.chr12:57037629C>T	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.599G>A	chr12.hg19:g.57037629C>T	ENSP00000262030:p.Gly200Asp	0					ATP5B_ENST00000552919.1_Missense_Mutation_p.G200D|SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000550162.1_5'Flank	p.G200D	NM_001686.3	NP_001677.2	0	0	0	1.998835	P06576	ATPB_HUMAN		4	649	-			A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	0	1	hg19	c.599G>A	CCDS8924.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.996446|4.996446	0.93167|0.93167	.|.	.|.	ENSG00000110955|ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020|ENST00000552959	D;D;D|.	0.82433|.	-1.61;-1.61;-1.61|.	5.56|5.56	5.56|5.56	0.83823|0.83823	5.56|5.56	5.56|5.56	0.83823|0.83823	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.88822|.	0.6541|.	H|H	0.97315|0.97315	3.98|3.98	0.80722|0.80722	D|D	1|1	P|.	0.43542|.	0.81|.	P|.	0.60886|.	0.88|.	D|.	0.92479|.	0.5991|.	10|.	0.87932|.	D|.	0|.	-0.5245|-0.5245	18.303|18.303	0.90171|0.90171	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	200|.	P06576|.	ATPB_HUMAN|.	D|X	200;200;139|136	ENSP00000262030:G200D;ENSP00000450297:G200D;ENSP00000446677:G139D|.	ENSP00000262030:G200D|.	G|W	-|-	2|3	0|0	0|0	ATP5B|ATP5B	55323896|55323896	55323896|55323896	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.919000|0.919000	0.55068|0.55068	7.114000|7.114000	0.77103|0.77103	2.627000|2.627000	0.88993|0.88993	0.313000|0.313000	0.20887|0.20887	GGC|TGG	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.418	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	0	0	1	2	2	2	2	0	0	0	0	94	94	94	93	1	1.960000	-2.286737	0	0.380000	NM_001686		0	5	5	0	427	423	0		1	0		0	0	94	0	0	0.936349	9.911597e-01	0	1	0	804	0	5	427
STAB2	55576	broad.mit.edu	37	12	104147083	104147083	+	Silent	SNP	C	C	T	rs139125034	byFrequency	TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr12:104147083C>T	ENST00000388887.2	+	61	6870	c.6666C>T	c.(6664-6666)aaC>aaT	p.N2222N	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCTGTGCCAACGAAGCTGCGA	0.552																																						ENST00000388887.2	1.000000	8.000000e-01	1	9.200000e-01	0.990000	0.973909	0.990000	1.000000																										0				174						c.(6664-6666)aaC>aaT		stabilin 2		C		0,4406		0,0,2203	102.0	87.0	92.0		6666	-10.0	0.0	12	dbSNP_134	92	4,8596	3.7+/-12.6	0,4,4296	yes	coding-synonymous	STAB2	NM_017564.9		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		2222/2552	104147083	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	55576	31	121412	46				g.chr12:104147083C>T	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6666C>T	chr12.hg19:g.104147083C>T		0					RP11-341G23.4_ENST00000551299.1_RNA	p.N2222N	NM_017564.9	NP_060034.9	0	0	0	1.998835				61	6870	+				Silent	SNP	ENST00000388887.2	1	1	hg19	c.6666C>T	CCDS31888.1	1																																																																																								0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.552	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	1.960000	-3.381505	1	0.380000			0	48	46	0	188	185	1		1	0		0	0	34	0	0	1.000000	1.911326e-01	0	0	0	4	0	48	188
POTEG	404785	broad.mit.edu	37	14	19553823	19553823	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr14:19553823G>A	ENST00000409832.3	+	1	459	c.407G>A	c.(406-408)cGt>cAt	p.R136H		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	136								p.R136H(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TACCACGTCCGTCGAGAAGAT	0.577																																						ENST00000409832.3			0	0																														1	Substitution - Missense(1)	p.R136H(1)	ovary(1)	47						c.(406-408)cGt>cAt		POTE ankyrin domain family, member G							93.0	102.0	99.0					14																	19553823		1602	3367	4969	SO:0001583	missense	404785	18	119144	34				g.chr14:19553823G>A		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.407G>A	chr14.hg19:g.19553823G>A	ENSP00000386971:p.Arg136His							p.R136H	NM_001005356.2	NP_001005356.1					Q6S5H5	POTEG_HUMAN		1	459	+			A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	1	1	hg19	c.407G>A	CCDS32018.1		.	.	.	.	.	.	.	.	.	.	g	5.784	0.328972	0.10956	.	.	ENSG00000222036	ENST00000409832	T	0.53206	0.63	1.47	-2.95	0.05564	1.47	-2.95	0.05564	.	.	.	.	.	T	0.34687	0.0906	L	0.50333	1.59	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.24657	-1.0154	9	0.39692	T	0.17	.	4.5394	0.12049	0.0:0.4621:0.3049:0.2331	.	136	Q6S5H5	POTEG_HUMAN	H	136	ENSP00000386971:R136H	ENSP00000386971:R136H	R	+	2	0	0	POTEG	18623823	18623823	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.250000	0.08830	-0.851000	0.04147	-0.715000	0.03620	CGT			TCGA-HZ-A8P0-01A-11D-A36O-08	0.577	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	1	0	1	2	7	2	2	1	1	1	1	258	258	258	382	1	1.960000	-3.317601	1	0.380000	NM_001005356		0	45	22	0	871	479	0		1			1	0	258	0	0	0.999921	0	0	0	0	0	0	45	871
ZNF219	51222	broad.mit.edu	37	14	21561128	21561128	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr14:21561128C>A	ENST00000360947.3	-	3	739	c.328G>T	c.(328-330)Gag>Tag	p.E110*	ZNF219_ENST00000556101.1_5'Flank|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Nonsense_Mutation_p.E110*|ZNF219_ENST00000421093.2_Nonsense_Mutation_p.E110*	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	110					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		CGTGGGCGCTCGGGCTGGTGT	0.721											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000360947.3	0.510000	9.000000e-02	3.800000e-01	1.600000e-01	0.250000	0.277262	0.250000	0.240000																										0				8						c.(328-330)Gag>Tag		zinc finger protein 219							13.0	15.0	14.0					14																	21561128		2186	4272	6458	SO:0001587	stop_gained	51222	0	0					g.chr14:21561128C>A	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.328G>T	chr14.hg19:g.21561128C>A	ENSP00000354206:p.Glu110*	0		OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	749	ZNF219_ENST00000421093.2_Nonsense_Mutation_p.E110*|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Nonsense_Mutation_p.E110*|ZNF219_ENST00000556101.1_5'Flank	p.E110*	NM_016423.2	NP_057507.2	0	1	1	2.013854	Q9P2Y4	ZN219_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	3	739	-	all_cancers(95;0.00185)		D3DS16|Q53Y57|Q8IYC1|Q9BW28	Nonsense_Mutation	SNP	ENST00000360947.3	0	1	hg19	c.328G>T	CCDS9568.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.775484	0.96922	.	.	ENSG00000165804	ENST00000360947;ENST00000451119;ENST00000421093;ENST00000555270;ENST00000554478;ENST00000556174	.	.	.	4.99	4.99	0.66335	4.99	4.99	0.66335	.	0.244954	0.34291	N	0.004083	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.6504	13.6641	0.62384	0.0:1.0:0.0:0.0	.	.	.	.	X	110;110;110;110;156;110	.	ENSP00000354206:E110X	E	-	1	0	0	ZNF219	20630968	20630968	0.012000	0.17670	0.945000	0.38365	0.486000	0.33341	2.161000	0.42358	2.597000	0.87782	0.655000	0.94253	GAG	0.378820		TCGA-HZ-A8P0-01A-11D-A36O-08	0.721	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2	0	0	1	2	2	2	2	0	0	0	0	50	50	50	49	1	1.960000	-8.336414	1	0.380000			0	5	6	0	105	104	0		1	0		0	0	50	0	0	0.939005	2.680743e-01	0	0	0	19	0	5	105
NPAS3	64067	broad.mit.edu	37	14	34269465	34269465	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr14:34269465A>T	ENST00000356141.4	+	12	1952	c.1952A>T	c.(1951-1953)gAg>gTg	p.E651V	NPAS3_ENST00000346562.2_Missense_Mutation_p.E619V|NPAS3_ENST00000548645.1_Missense_Mutation_p.E621V|NPAS3_ENST00000357798.5_Missense_Mutation_p.E638V|NPAS3_ENST00000551492.1_Missense_Mutation_p.E656V			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	651					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		ATCAAGACGGAGATCTCAGAA	0.627																																						ENST00000356141.4	1.000000	7.200000e-01	1	8.400000e-01	0.980000	0.940499	0.980000	1.000000																										0				40						c.(1951-1953)gAg>gTg		neuronal PAS domain protein 3							60.0	59.0	59.0					14																	34269465		2203	4300	6503	SO:0001583	missense	64067	0	0					g.chr14:34269465A>T	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1952A>T	chr14.hg19:g.34269465A>T	ENSP00000348460:p.Glu651Val	0					NPAS3_ENST00000357798.5_Missense_Mutation_p.E638V|NPAS3_ENST00000548645.1_Missense_Mutation_p.E621V|NPAS3_ENST00000551492.1_Missense_Mutation_p.E656V|NPAS3_ENST00000346562.2_Missense_Mutation_p.E619V	p.E651V			0	1	1	2.013854	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	12	1952	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	1	1	hg19	c.1952A>T	CCDS53891.1	1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.362475	0.61403	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.72167	-0.63;2.95;2.97;2.97;2.95;2.82	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.135165	0.50627	D	0.000116	T	0.75488	0.3856	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.80764	0.994;0.987;0.994;0.994	T	0.79055	-0.1960	10	0.72032	D	0.01	.	14.8262	0.70113	1.0:0.0:0.0:0.0	.	621;651;619;638	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	V	625;656;619;621;651;638	ENSP00000448373:E625V;ENSP00000450392:E656V;ENSP00000319610:E619V;ENSP00000448916:E621V;ENSP00000348460:E651V;ENSP00000350446:E638V	ENSP00000319610:E619V	E	+	2	0	0	NPAS3	33339216	33339216	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.019000	0.93662	1.887000	0.54652	0.454000	0.30748	GAG	0.378820		TCGA-HZ-A8P0-01A-11D-A36O-08	0.627	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.960000	-20.000000	1	0.380000			0	36	35	0	155	153	0		1			0	0	52	0	0	1.000000	0	0	0	0	0	0	36	155
BTBD7	55727	broad.mit.edu	37	14	93761248	93761248	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr14:93761248C>A	ENST00000334746.5	-	3	425	c.118G>T	c.(118-120)Gaa>Taa	p.E40*	BTBD7_ENST00000393170.2_5'Flank|BTBD7_ENST00000554565.1_Intron|BTBD7_ENST00000555525.1_Nonsense_Mutation_p.E40*|BTBD7_ENST00000298896.3_Nonsense_Mutation_p.E40*	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	40					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		AACTTTGATTCGCAACCATAG	0.348																																						ENST00000334746.5	0.150000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.081431	0.070000	0.070000																										0				35						c.(118-120)Gaa>Taa		BTB (POZ) domain containing 7							57.0	61.0	60.0					14																	93761248		2201	4300	6501	SO:0001587	stop_gained	55727	0	0					g.chr14:93761248C>A	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.118G>T	chr14.hg19:g.93761248C>A	ENSP00000335615:p.Glu40*	0					BTBD7_ENST00000554565.1_Intron|BTBD7_ENST00000555525.1_Nonsense_Mutation_p.E40*|BTBD7_ENST00000298896.3_Nonsense_Mutation_p.E40*|BTBD7_ENST00000393170.2_5'Flank	p.E40*	NM_001002860.2	NP_001002860.2	0	1	1	2.013854	Q9P203	BTBD7_HUMAN		3	425	-		all_cancers(154;0.08)	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Nonsense_Mutation	SNP	ENST00000334746.5	0	1	hg19	c.118G>T	CCDS32146.1	0	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505722	0.85282	.	.	ENSG00000011114	ENST00000334746;ENST00000298896;ENST00000555525;ENST00000554968	.	.	.	5.9	5.9	0.94986	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	.	.	.	X	40	.	ENSP00000298896:E40X	E	-	1	0	0	BTBD7	92831001	92831001	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.487000	0.81328	2.804000	0.96469	0.655000	0.94253	GAA	0.378820		TCGA-HZ-A8P0-01A-11D-A36O-08	0.348	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	0	0	1	2	2	2	2	0	0	0	0	91	91	91	90	1	1.960000	-2.694294	1	0.380000	NM_001002860		0	6	6	0	442	438	0		1	0		0	0	91	0	0	0.964226	2.651224e-03	0	0	0	5	0	6	442
DICER1	23405	broad.mit.edu	37	14	95590833	95590833	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr14:95590833C>T	ENST00000526495.1	-	10	1367	c.1076G>A	c.(1075-1077)tGt>tAt	p.C359Y	DICER1_ENST00000393063.1_Missense_Mutation_p.C359Y|DICER1_ENST00000527414.1_Missense_Mutation_p.C359Y|DICER1_ENST00000541352.1_Missense_Mutation_p.C359Y|DICER1_ENST00000343455.3_Missense_Mutation_p.C359Y			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	359	Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GTGCTCTTCACATAGTGCATG	0.373			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													ENST00000526495.1	1.000000	8.400000e-01	1	9.200000e-01	0.990000	0.975102	0.990000	1.000000			yes	Rec	yes	Familial Pleuropulmonary Blastoma	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	14q32.13	23405	Mis F, N	"""dicer 1, ribonuclease type III """				"""E, M, O"""	E, M, O		pleuropulmonary blastoma	sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma		0				75						c.(1075-1077)tGt>tAt		dicer 1, ribonuclease type III							139.0	141.0	141.0					14																	95590833		2203	4300	6503	SO:0001583	missense	23405	0	0		Familial Multinodular Goiter ;DICER 1 syndrome	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	g.chr14:95590833C>T	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1076G>A	chr14.hg19:g.95590833C>T	ENSP00000437256:p.Cys359Tyr	0					DICER1_ENST00000343455.3_Missense_Mutation_p.C359Y|DICER1_ENST00000541352.1_Missense_Mutation_p.C359Y|DICER1_ENST00000527414.1_Missense_Mutation_p.C359Y|DICER1_ENST00000393063.1_Missense_Mutation_p.C359Y	p.C359Y			0	1	1	2.013854	Q9UPY3	DICER_HUMAN		10	1367	-		all_cancers(154;0.0621)|all_epithelial(191;0.223)	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	1	1	hg19	c.1076G>A	CCDS9931.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387947	0.82902	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.54	5.54	0.83059	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.58061	0.2096	M	0.63843	1.955	0.80722	D	1	D	0.60575	0.988	D	0.63192	0.912	T	0.50415	-0.8831	10	0.09338	T	0.73	-18.0875	19.4888	0.95042	0.0:1.0:0.0:0.0	.	359	Q9UPY3	DICER_HUMAN	Y	359	ENSP00000343745:C359Y;ENSP00000437256:C359Y;ENSP00000376783:C359Y;ENSP00000435681:C359Y;ENSP00000444719:C359Y	ENSP00000343745:C359Y	C	-	2	0	0	DICER1	94660586	94660586	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	7.267000	0.78462	2.607000	0.88179	0.585000	0.79938	TGT	0.378820		TCGA-HZ-A8P0-01A-11D-A36O-08	0.373	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1	1	0	1	2	2	2	2	0	0	0	0	123	123	123	121	1	1.960000	-20.000000	1	0.380000			0	104	102	0	431	429	1		1	1		0	0	123	0	0	1.000000	1.740028e-01	0	2	0	2	0	104	431
LDHAL6B	92483	broad.mit.edu	37	15	59499545	59499545	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr15:59499545G>A	ENST00000307144.4	+	1	504	c.406G>A	c.(406-408)Gca>Aca	p.A136T	MYO1E_ENST00000288235.4_Intron	NM_033195.2	NP_149972.1	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	136					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)	10						CTTTGTCACAGCAAACTCCAA	0.428																																						ENST00000307144.4	0.110000	1.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.058366	0.050000	0.050000																										0				10						c.(406-408)Gca>Aca		lactate dehydrogenase A-like 6B							106.0	104.0	105.0					15																	59499545		2191	4290	6481	SO:0001583	missense	92483	0	0					g.chr15:59499545G>A	AY009108	CCDS10171.1	15q21.3	2011-01-27	2004-07-27	2004-07-28	ENSG00000171989	ENSG00000171989			21481	protein-coding gene	gene with protein product			"""lactate dehydrogenase A-like 6"""	LDHAL6		15870898	Standard	NM_033195		Approved	LDHL, LDH6B	uc002agb.4	Q9BYZ2	OTTHUMG00000132714	ENST00000307144.4:c.406G>A	chr15.hg19:g.59499545G>A	ENSP00000302393:p.Ala136Thr	0					MYO1E_ENST00000288235.4_Intron	p.A136T	NM_033195.2	NP_149972.1	0	0	0	1.991875	Q9BYZ2	LDH6B_HUMAN		1	504	+			Q6DUY4|Q96LI2	Missense_Mutation	SNP	ENST00000307144.4	0	1	hg19	c.406G>A	CCDS10171.1	0	.	.	.	.	.	.	.	.	.	.	G	17.91	3.503507	0.64298	.	.	ENSG00000171989	ENST00000307144	D	0.88431	-2.38	1.47	1.47	0.22746	1.47	1.47	0.22746	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.64402	U	0.000005	D	0.87051	0.6081	M	0.79693	2.465	0.53005	D	0.999961	P	0.39311	0.667	B	0.37943	0.261	D	0.85352	0.1102	10	0.62326	D	0.03	.	8.4578	0.32910	0.0:0.0:1.0:0.0	.	136	Q9BYZ2	LDH6B_HUMAN	T	136	ENSP00000302393:A136T	ENSP00000302393:A136T	A	+	1	0	0	LDHAL6B	57286837	57286837	1.000000	0.71417	0.083000	0.20561	0.047000	0.14425	6.111000	0.71541	0.784000	0.33661	0.305000	0.20034	GCA	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.428	LDHAL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256015.1	0	0	1	2	13	2	2	1	1	1	1	176	176	176	175	1	1.960000	-2.010238	0	0.380000	NM_033195		0	6	6	0	617	605	0		0			1	0	176	0	0	0.075100	0	0	0	0	0	0	6	617
SLCO3A1	28232	broad.mit.edu	37	15	92690367	92690367	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr15:92690367C>T	ENST00000318445.6	+	8	1880	c.1666C>T	c.(1666-1668)Ccc>Tcc	p.P556S	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.P556S|RP11-152L20.3_ENST00000561674.1_RNA|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	556					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GGCACAGACACCCTCAGTCAT	0.582																																						ENST00000318445.6	1.000000	8.100000e-01	1	9.100000e-01	0.990000	0.967863	0.990000	1.000000																										0				25						c.(1666-1668)Ccc>Tcc		solute carrier organic anion transporter family, member 3A1	Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)						127.0	104.0	112.0					15																	92690367		2198	4298	6496	SO:0001583	missense	28232	0	0					g.chr15:92690367C>T	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1666C>T	chr15.hg19:g.92690367C>T	ENSP00000320634:p.Pro556Ser	0					SLCO3A1_ENST00000424469.2_Missense_Mutation_p.P556S|SLCO3A1_ENST00000555549.1_3'UTR|RP11-152L20.3_ENST00000561674.1_RNA	p.P556S	NM_013272.3	NP_037404.2	0	0	0	1.991875	Q9UIG8	SO3A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0841)	8	1880	+	Lung NSC(78;0.0158)|all_lung(78;0.0255)		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	1	1	hg19	c.1666C>T	CCDS10371.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978773	0.74360	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	T;T	0.42131	0.98;0.98	6.03	6.03	0.97812	6.03	6.03	0.97812	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.66506	2.035	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	T	0.56798	-0.7919	10	0.31617	T	0.26	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	498;556;556	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	S	556;556;275	ENSP00000320634:P556S;ENSP00000387846:P556S	ENSP00000320634:P556S	P	+	1	0	0	SLCO3A1	90491371	90491371	1.000000	0.71417	0.972000	0.41901	0.765000	0.43378	7.305000	0.78891	2.861000	0.98227	0.655000	0.94253	CCC	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.582	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	70	1	1.960000	-20.000000	1	0.380000	NM_013272		0	69	68	0	284	280	1		1	1		0	0	71	0	0	1.000000	9.949985e-01	0	2	0	34	0	69	284
GTF3C1	2975	broad.mit.edu	37	16	27481702	27481702	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr16:27481702C>A	ENST00000356183.4	-	31	4556	c.4541G>T	c.(4540-4542)cGa>cTa	p.R1514L	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R1514L	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1514					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCTTGGAAATCGCCACGTAAA	0.502																																						ENST00000356183.4	0.120000	1.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.066536	0.050000	0.050000																										0				80						c.(4540-4542)cGa>cTa		general transcription factor IIIC, polypeptide 1, alpha 220kDa							102.0	111.0	108.0					16																	27481702		2197	4300	6497	SO:0001583	missense	2975	0	0					g.chr16:27481702C>A	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4541G>T	chr16.hg19:g.27481702C>A	ENSP00000348510:p.Arg1514Leu	0					GTF3C1_ENST00000561623.1_Missense_Mutation_p.R1514L	p.R1514L	NM_001520.3	NP_001511.2	1	2	3	2.030199	Q12789	TF3C1_HUMAN		31	4556	-			B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	0	1	hg19	c.4541G>T	CCDS32414.1	0	.	.	.	.	.	.	.	.	.	.	C	30	5.050089	0.93740	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26957	1.7	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.54029	0.1833	M	0.76574	2.34	0.48288	D	0.999624	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.53837	-0.8382	10	0.54805	T	0.06	-10.7008	19.1435	0.93455	0.0:1.0:0.0:0.0	.	1514;1514	Q12789;Q12789-3	TF3C1_HUMAN;.	L	1514;1510	ENSP00000348510:R1514L	ENSP00000348510:R1514L	R	-	2	0	0	GTF3C1	27389203	27389203	1.000000	0.71417	0.982000	0.44146	0.971000	0.66376	6.537000	0.73847	2.614000	0.88457	0.585000	0.79938	CGA	0.382347		TCGA-HZ-A8P0-01A-11D-A36O-08	0.502	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	0	0	1	2	2	2	2	0	0	0	0	190	190	190	190	1	1.960000	-2.537684	1	0.380000	NM_001520		0	6	6	0	636	631	0		1	0		0	0	190	0	0	0.964242	8.426084e-02	0	0	0	43	0	6	636
RNF40	9810	broad.mit.edu	37	16	30778186	30778186	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr16:30778186A>G	ENST00000324685.6	+	11	1853	c.1418A>G	c.(1417-1419)aAc>aGc	p.N473S	RNF40_ENST00000357890.5_Missense_Mutation_p.N373S|RNF40_ENST00000402121.3_Missense_Mutation_p.N165S|RNF40_ENST00000563683.1_Missense_Mutation_p.N433S	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	473					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			CTGGCGGCCAACGAGCAGGCG	0.602																																						ENST00000324685.6	1.000000	3.800000e-01	8.500000e-01	5.100000e-01	0.660000	0.679717	0.660000	1.000000																										0				30						c.(1417-1419)aAc>aGc		ring finger protein 40, E3 ubiquitin protein ligase							60.0	43.0	49.0					16																	30778186		2197	4300	6497	SO:0001583	missense	9810	0	0					g.chr16:30778186A>G	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1418A>G	chr16.hg19:g.30778186A>G	ENSP00000325677:p.Asn473Ser	0					RNF40_ENST00000402121.3_Missense_Mutation_p.N165S|RNF40_ENST00000357890.5_Missense_Mutation_p.N373S|RNF40_ENST00000563683.1_Missense_Mutation_p.N433S	p.N473S	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	1	2	3	2.030199	O75150	BRE1B_HUMAN	Colorectal(24;0.198)	11	1853	+			Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	1	1	hg19	c.1418A>G	CCDS10691.1	0	.	.	.	.	.	.	.	.	.	.	A	27.1	4.804399	0.90623	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.26957	1.7;1.7;1.7	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.54935	0.1889	M	0.84948	2.725	0.80722	D	1	D;D;D;D	0.71674	0.977;0.998;0.995;0.995	P;D;D;D	0.69654	0.883;0.919;0.965;0.939	T	0.62096	-0.6926	10	0.72032	D	0.01	-18.9766	15.0705	0.72034	1.0:0.0:0.0:0.0	.	165;373;473;473	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	S	473;373;165	ENSP00000325677:N473S;ENSP00000350563:N373S;ENSP00000384942:N165S	ENSP00000325677:N473S	N	+	2	0	0	RNF40	30685687	30685687	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.711000	0.91396	2.199000	0.70637	0.533000	0.62120	AAC	0.382347		TCGA-HZ-A8P0-01A-11D-A36O-08	0.602	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	1	0	1	2	2	2	2	0	0	0	0	26	26	26	25	1	1.960000	-20.000000	1	0.380000	NM_014771		0	14	14	0	99	95	1		1	1		0	0	26	0	0	0.999767	9.948492e-01	0	17	0	49	0	14	99
FOXF1	2294	broad.mit.edu	37	16	86544628	86544628	+	Silent	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr16:86544628C>A	ENST00000262426.4	+	1	496	c.453C>A	c.(451-453)ctC>ctA	p.L151L	FENDRR_ENST00000595886.1_lincRNA	NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	151					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						GCCAGGCGCTCAAGCCCATGT	0.667																																						ENST00000262426.4	0.160000	2.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.091615	0.070000	0.070000																										0				12						c.(451-453)ctC>ctA		forkhead box F1							42.0	52.0	49.0					16																	86544628		2198	4298	6496	SO:0001819	synonymous_variant	2294	0	0					g.chr16:86544628C>A	U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.453C>A	chr16.hg19:g.86544628C>A		0					FENDRR_ENST00000595886.1_lincRNA	p.L151L	NM_001451.2	NP_001442.2	1	2	3	2.030831	Q12946	FOXF1_HUMAN		1	496	+			B2RAF4|Q5FWE5	Silent	SNP	ENST00000262426.4	0	1	hg19	c.453C>A	CCDS10957.2	0																																																																																								0.382347		TCGA-HZ-A8P0-01A-11D-A36O-08	0.667	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	0	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	1.960000	-2.844498	1	0.380000	NM_001451		0	6	7	0	438	433	0		1	0		0	0	113	0	0	0.964221	3.842601e-02	0	0	0	19	0	6	438
SERPINF2	5345	broad.mit.edu	37	17	1648635	1648635	+	Silent	SNP	C	C	T	rs185025710	byFrequency	TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr17:1648635C>T	ENST00000324015.3	+	4	188	c.111C>T	c.(109-111)agC>agT	p.S37S	SERPINF2_ENST00000382061.4_Silent_p.S37S|SERPINF2_ENST00000450523.2_Silent_p.S37S	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	37					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	AGCTAACTAGCGGGCCGAACC	0.657													C|||	28	0.00559105	0.0	0.0	5008	,	,		10061	0.0248		0.001	False		,,,				2504	0.002					ENST00000324015.3	1.000000	6.800000e-01	1	8.000000e-01	0.930000	0.913506	0.930000	1.000000																										0				12						c.(109-111)agC>agT		serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	Ocriplasmin(DB08888)	C	,,	1,4405	2.1+/-5.4	0,1,2202	41.0	38.0	39.0		111,111,111	-8.6	0.0	17		39	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	SERPINF2	NM_000934.3,NM_001165920.1,NM_001165921.1	,,	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	,,	37/492,37/492,37/428	1648635	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	5345	169	121386	51				g.chr17:1648635C>T	D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.111C>T	chr17.hg19:g.1648635C>T		0					SERPINF2_ENST00000382061.4_Silent_p.S37S|SERPINF2_ENST00000450523.2_Silent_p.S37S	p.S37S	NM_000934.3	NP_000925.2	0	0	0	1.987048	P08697	A2AP_HUMAN		4	188	+			B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Silent	SNP	ENST00000324015.3	1	0	hg19	c.111C>T	CCDS11011.1	1																																																																																								0.370431		TCGA-HZ-A8P0-01A-11D-A36O-08	0.657	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207078.3	1	0	1	2	2	2	2	0	0	0	0	41	41	41	39	1	1.960000	-2.990709	1	0.380000	NM_000934		0	38	38	0	172	168	0		1	0		0	0	41	0	0	1.000000	3.454690e-02	0	1	0	1	0	38	172
NLK	51701	broad.mit.edu	37	17	26495642	26495642	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr17:26495642G>A	ENST00000407008.3	+	6	1724	c.1006G>A	c.(1006-1008)Gga>Aga	p.G336R		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	336	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		AGAACTACTAGGACGAAGAAT	0.413																																						ENST00000407008.3	1.000000	8.500000e-01	1	9.500000e-01	0.990000	0.983682	0.990000	1.000000																										0				14						c.(1006-1008)Gga>Aga		nemo-like kinase							130.0	125.0	126.0					17																	26495642		2203	4300	6503	SO:0001583	missense	51701	0	0					g.chr17:26495642G>A	AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.1006G>A	chr17.hg19:g.26495642G>A	ENSP00000384625:p.Gly336Arg	0						p.G336R	NM_016231.4	NP_057315.3	1	2	3	2.018854	Q9UBE8	NLK_HUMAN		6	1724	+	all_lung(13;0.000343)|Lung NSC(42;0.00184)		B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	ENST00000407008.3	1	1	hg19	c.1006G>A	CCDS11224.2	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200775	0.79015	.	.	ENSG00000087095	ENST00000407008	T	0.41758	0.99	6.08	6.08	0.98989	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	N	0.12920	0.275	0.80722	D	1	B	0.26081	0.141	B	0.35353	0.201	T	0.22556	-1.0213	10	0.56958	D	0.05	-13.0763	19.6516	0.95815	0.0:0.0:1.0:0.0	.	336	Q9UBE8	NLK_HUMAN	R	336	ENSP00000384625:G336R	ENSP00000384625:G336R	G	+	1	0	0	NLK	23519769	23519769	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	GGA	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.413	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255607.3	1	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	1.960000	-3.457728	1	0.380000	NM_016231		0	70	69	0	274	271	1		1	1		0	0	82	0	0	1.000000	6.887126e-01	0	2	0	9	0	70	274
TBC1D3F	84218	broad.mit.edu	37	17	36288204	36288204	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr17:36288204G>T	ENST00000327454.6	+	6	436	c.290G>T	c.(289-291)cGa>cTa	p.R97L	TBC1D3F_ENST00000378174.5_Missense_Mutation_p.R97L|TBC1D3F_ENST00000505415.1_Missense_Mutation_p.R97L|TBC1D3F_ENST00000539424.1_Missense_Mutation_p.R17L	NM_032258.2	NP_115634.2	A6NER0	TBC3F_HUMAN	TBC1 domain family, member 3F	97						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)	p.R97Q(1)|p.R97L(1)		liver(1)|pancreas(1)	2						CTCATAGATCGAGCGTACAAG	0.547																																						ENST00000327454.6	0.060000	0	5.000000e-02	1.000000e-02	0.030000	0.035171	0.030000	0.040000																										2	Substitution - Missense(2)	p.R97Q(1)|p.R97L(1)	lung(1)|endometrium(1)	2						c.(289-291)cGa>cTa		TBC1 domain family, member 3F																																				SO:0001583	missense	84218	302	118610	46				g.chr17:36288204G>T			17q12	2014-09-16				ENSG00000275954			18257	protein-coding gene	gene with protein product		610809				16863688	Standard	NM_032258		Approved			A6NER0	OTTHUMG00000188428	ENST00000327454.6:c.290G>T	chr17.hg19:g.36288204G>T	ENSP00000329256:p.Arg97Leu	0					TBC1D3F_ENST00000505415.1_Missense_Mutation_p.R97L|TBC1D3F_ENST00000539424.1_Missense_Mutation_p.R17L|TBC1D3F_ENST00000378174.5_Missense_Mutation_p.R97L	p.R97L	NM_032258.2	NP_115634.2	1	2	3	2.018854	A6NER0	TBC3F_HUMAN		6	436	+				Missense_Mutation	SNP	ENST00000327454.6	0	1	hg19	c.290G>T	CCDS45657.1	0	.	.	.	.	.	.	.	.	.	.	g	10.29	1.309800	0.23821	.	.	ENSG00000185128	ENST00000327454;ENST00000378174;ENST00000505415;ENST00000539424	T;T;T;T	0.03330	3.97;3.97;3.97;3.97	.	.	.	.	.	.	Rab-GAP/TBC domain (2);	0.212784	0.34460	U	0.003960	T	0.05547	0.0146	M	0.79614	2.46	0.39492	D	0.968062	B;B;B;B	0.19935	0.007;0.04;0.001;0.004	B;B;B;B	0.19148	0.024;0.011;0.007;0.002	T	0.15723	-1.0427	9	0.48119	T	0.1	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	97;97;97;97	B9A6J9;A6NFD7;P0C7X1;A6NER0	.;.;TBC3H_HUMAN;TBC3F_HUMAN	L	97;97;97;17	ENSP00000329256:R97L;ENSP00000367416:R97L;ENSP00000421962:R97L;ENSP00000443859:R17L	ENSP00000329256:R97L	R	+	2	0	0	TBC1D3F	33362586	33362586	1.000000	0.71417	0.076000	0.20297	0.076000	0.17211	3.336000	0.52113	0.119000	0.18210	0.121000	0.15741	CGA	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.547	TBC1D3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256100.3	0	0	1	2	3	2	2	0	0	0	1	505	505	505	742	1	1.960000	-1.920210	0	0.380000	NM_032258.2		0	10	2	0	1636	234	0		0	0		0	0	505	0	0	0.215910	7.108719e-04	0	0	0	6	0	10	1636
GPR179	440435	broad.mit.edu	37	17	36485562	36485562	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr17:36485562G>T	ENST00000342292.4	-	11	3910	c.3890C>A	c.(3889-3891)tCa>tAa	p.S1297*	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1297					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TATGGGCTCTGATTTTCCCCG	0.582																																						ENST00000342292.4	0.210000	3.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.108491	0.090000	0.090000																										0				60						c.(3889-3891)tCa>tAa		G protein-coupled receptor 179							45.0	47.0	46.0					17																	36485562		1921	4137	6058	SO:0001587	stop_gained	440435	0	0					g.chr17:36485562G>T		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3890C>A	chr17.hg19:g.36485562G>T	ENSP00000345060:p.Ser1297*	0					GPR179_ENST00000584976.1_5'Flank	p.S1297*	NM_001004334.2	NP_001004334.2	1	2	3	2.018854	Q6PRD1	GP179_HUMAN		11	3910	-	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)		Nonsense_Mutation	SNP	ENST00000342292.4	0	1	hg19	c.3890C>A	CCDS42308.1	0	.	.	.	.	.	.	.	.	.	.	G	38	6.866372	0.97897	.	.	ENSG00000188888	ENST00000342292	.	.	.	4.97	4.97	0.65823	4.97	4.97	0.65823	.	1.494310	0.04246	N	0.337834	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1238	15.2627	0.73637	0.0:0.0:1.0:0.0	.	.	.	.	X	1297	.	ENSP00000345060:S1297X	S	-	2	0	0	GPR179	33739088	33739088	0.000000	0.05858	0.039000	0.18376	0.039000	0.13416	0.770000	0.26618	2.575000	0.86900	0.462000	0.41574	TCA	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.582	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2	0	0	1	2	2	2	2	0	0	0	0	64	64	64	62	1	1.960000	-3.380250	1	0.380000			0	5	5	0	283	282	0		1			0	0	64	0	0	0.937504	0	0	0	0	0	0	5	283
NDEL1	81565	broad.mit.edu	37	17	8370257	8370257	+	Silent	SNP	C	C	T	rs138863036	byFrequency	TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr17:8370257C>T	ENST00000334527.7	+	9	1151	c.954C>T	c.(952-954)aaC>aaT	p.N318N	NDEL1_ENST00000380025.4_Missense_Mutation_p.R268W|NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000402554.3_3'UTR|NDEL1_ENST00000299734.7_Intron	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	318	Interaction with CENPF.|Interaction with NEFL. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						GGGCAGTAAACGGCTTTGACC	0.537													C|||	7	0.00139776	0.0038	0.0029	5008	,	,		19481	0.0		0.0	False		,,,				2504	0.0					ENST00000334527.7	1.000000	6.000000e-01	9.100000e-01	6.900000e-01	0.790000	0.804888	0.790000	1.000000																										0				13						c.(952-954)aaC>aaT		nudE neurodevelopment protein 1-like 1		C	,	6,4400	11.4+/-27.6	0,6,2197	123.0	117.0	119.0		,954	-0.2	1.0	17	dbSNP_134	119	0,8600		0,0,4300	no	utr-3,coding-synonymous	NDEL1	NM_001025579.1,NM_030808.3	,	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	,	,318/346	8370257	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	81565	40	121412	50				g.chr17:8370257C>T	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.954C>T	chr17.hg19:g.8370257C>T		0					NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000380025.4_Missense_Mutation_p.R268W|NDEL1_ENST00000299734.7_Intron|NDEL1_ENST00000402554.3_3'UTR	p.N318N	NM_030808.4	NP_110435.1	0	0	0	1.987048	Q9GZM8	NDEL1_HUMAN		9	1151	+			B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Silent	SNP	ENST00000334527.7	1	1	hg19	c.954C>T	CCDS11143.1	0																																																																																								0.370431		TCGA-HZ-A8P0-01A-11D-A36O-08	0.537	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	0	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	1.960000	-4.780038	1	0.380000	NM_030808		0	50	48	0	274	270	1		1	1		0	0	78	0	0	1.000000	9.999875e-01	0	15	0	79	0	50	274
PTRF	284119	broad.mit.edu	37	17	40557270	40557270	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr17:40557270G>T	ENST00000357037.5	-	2	1027	c.608C>A	c.(607-609)tCg>tAg	p.S203*		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CGCCTCGTCCGACGAAAGCTC	0.662																																						ENST00000357037.5	0.130000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.070993	0.060000	0.060000																										0				17						c.(607-609)tCg>tAg		polymerase I and transcript release factor							83.0	88.0	86.0					17																	40557270		2203	4300	6503	SO:0001587	stop_gained	284119	0	0					g.chr17:40557270G>T	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.608C>A	chr17.hg19:g.40557270G>T	ENSP00000349541:p.Ser203*	0						p.S203*	NM_012232.5	NP_036364.2	1	2	3	2.018854				2	1027	-		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		Nonsense_Mutation	SNP	ENST00000357037.5	0	1	hg19	c.608C>A	CCDS11425.1	0	.	.	.	.	.	.	.	.	.	.	G	37	5.978629	0.97168	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	.	.	.	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.067530	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.0007	19.0756	0.93159	0.0:0.0:1.0:0.0	.	.	.	.	X	203;158	.	ENSP00000349541:S203X	S	-	2	0	0	PTRF	37810796	37810796	1.000000	0.71417	0.965000	0.40720	0.906000	0.53458	7.396000	0.79891	2.511000	0.84671	0.446000	0.29264	TCG	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.662	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	0	0	1	2	14	7	2	1	1	1	1	173	173	173	172	1	1.960000	-2.474199	0	0.380000	NM_012232		0	8	7	0	657	647	0		0	0		1	0	173	0	0	0.131638	8.995252e-02	0	0	0	255	0	8	657
ZNF181	339318	broad.mit.edu	37	19	35232318	35232318	+	Silent	SNP	T	T	G	rs2607243		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr19:35232318T>G	ENST00000492450.1	+	4	1121	c.1032T>G	c.(1030-1032)acT>acG	p.T344T	ZNF181_ENST00000459757.2_Silent_p.T343T|ZNF181_ENST00000392232.3_Silent_p.T388T			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GAATTCATACTCAAGAAAAAC	0.388																																						ENST00000492450.1	1.000000	5.000000e-02	2.100000e-01	9.000000e-02	0.140000	0.180646	0.140000	0.130000																										0				22						c.(1030-1032)acT>acG		zinc finger protein 181							69.0	69.0	69.0					19																	35232318		2203	4300	6503	SO:0001819	synonymous_variant	339318	0	0					g.chr19:35232318T>G	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1032T>G	chr19.hg19:g.35232318T>G		0					ZNF181_ENST00000392232.3_Silent_p.T388T|ZNF181_ENST00000459757.2_Silent_p.T343T	p.T344T			1	2	3	2.047715	Q2M3W8	ZN181_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.138)	4	1121	+	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		B7ZKX3|Q49A75	Silent	SNP	ENST00000492450.1	0	1	hg19	c.1032T>G	CCDS32990.2	0																																																																																								0.385835		TCGA-HZ-A8P0-01A-11D-A36O-08	0.388	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	0	0	1	2	2	2	2	0	0	0	0	47	47	47	45	1	1.960000	-2.557237	1	0.380000	NM_001029997		0	7	7	0	276	271	0		1	0		0	0	47	0	0	0.979704	2.704974e-02	0	0	0	9	0	7	276
PLEKHG2	64857	broad.mit.edu	37	19	39908691	39908691	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr19:39908691G>T	ENST00000409794.3	+	9	1879	c.1029G>T	c.(1027-1029)atG>atT	p.M343I	PLEKHG2_ENST00000425673.1_Missense_Mutation_p.M343I|PLEKHG2_ENST00000378550.1_Missense_Mutation_p.M343I|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.M284I|PLEKHG2_ENST00000409797.2_Missense_Mutation_p.M343I	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	343	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCTCTCGGATGCTGCTGGTGG	0.612																																						ENST00000409794.3	1.000000	2.900000e-01	8.600000e-01	4.300000e-01	0.610000	0.641673	0.610000	1.000000																										0				40						c.(1027-1029)atG>atT		pleckstrin homology domain containing, family G (with RhoGef domain) member 2							19.0	19.0	19.0					19																	39908691		2203	4298	6501	SO:0001583	missense	64857	0	0					g.chr19:39908691G>T	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.1029G>T	chr19.hg19:g.39908691G>T	ENSP00000386733:p.Met343Ile	0					PLEKHG2_ENST00000409797.2_Missense_Mutation_p.M343I|PLEKHG2_ENST00000378550.1_Missense_Mutation_p.M343I|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.M343I|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.M284I	p.M343I	NM_022835.2	NP_073746.2	1	2	3	2.047715	Q9H7P9	PKHG2_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)	9	1879	+	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	0	1	hg19	c.1029G>T	CCDS33022.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.10|19.10	3.761628|3.761628	0.69763|0.69763	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000205135|ENST00000409794;ENST00000425673;ENST00000378550;ENST00000458508;ENST00000409797	.|D;D;D;D;D	.|0.87412	.|-2.25;-2.25;-2.25;-2.25;-2.25	4.65|4.65	4.65|4.65	0.58169|0.58169	4.65|4.65	4.65|4.65	0.58169|0.58169	.|Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88235|0.88235	0.6382|0.6382	L|L	0.52573|0.52573	1.65|1.65	0.49915|0.49915	D|D	0.999832|0.999832	.|B;B;B;B	.|0.31599	.|0.33;0.136;0.222;0.198	.|P;B;B;B	.|0.44897	.|0.463;0.214;0.183;0.343	D|D	0.85506|0.85506	0.1194|0.1194	5|10	.|0.30854	.|T	.|0.27	.|.	16.8319|16.8319	0.85946|0.85946	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|343;343;284;343	.|Q9H7P9-3;Q9H7P9;E7ESZ3;Q9H7P9-2	.|.;PKHG2_HUMAN;.;.	F|I	240|343;343;343;284;343	.|ENSP00000386733:M343I;ENSP00000392906:M343I;ENSP00000367812:M343I;ENSP00000408857:M284I;ENSP00000386492:M343I	.|ENSP00000367812:M343I	C|M	+|+	2|3	0|0	0|0	PLEKHG2|PLEKHG2	44600531|44600531	44600531|44600531	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.688000|0.688000	0.40055|0.40055	3.401000|3.401000	0.52601|0.52601	2.606000|2.606000	0.88127|0.88127	0.556000|0.556000	0.70494|0.70494	TGC|ATG	0.385835		TCGA-HZ-A8P0-01A-11D-A36O-08	0.612	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	0	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.960000	-14.568410	1	0.380000	NM_022835		0	8	8	0	64	63	1		1	0		0	0	17	0	0	0.990209	6.827786e-01	0	0	0	20	0	8	64
MYADM	91663	broad.mit.edu	37	19	54377360	54377360	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr19:54377360G>T	ENST00000391769.2	+	3	857	c.577G>T	c.(577-579)Gac>Tac	p.D193Y	MYADM_ENST00000391771.1_Missense_Mutation_p.D193Y|MYADM_ENST00000391768.2_Missense_Mutation_p.D193Y|MYADM_ENST00000336967.3_Missense_Mutation_p.D193Y|MYADM_ENST00000391770.4_Missense_Mutation_p.D193Y|AC008440.5_ENST00000413496.2_RNA	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	193	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		GTTCATCAGCGACCCCAACCT	0.642																																						ENST00000391769.2	0.150000	3.000000e-02	1.200000e-01	5.000000e-02	0.070000	0.088182	0.070000	0.080000																										0				12						c.(577-579)Gac>Tac		myeloid-associated differentiation marker							163.0	136.0	145.0					19																	54377360		2203	4300	6503	SO:0001583	missense	91663	0	0					g.chr19:54377360G>T	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.577G>T	chr19.hg19:g.54377360G>T	ENSP00000375649:p.Asp193Tyr	1					MYADM_ENST00000336967.3_Missense_Mutation_p.D193Y|MYADM_ENST00000391771.1_Missense_Mutation_p.D193Y|MYADM_ENST00000391770.4_Missense_Mutation_p.D193Y|MYADM_ENST00000391768.2_Missense_Mutation_p.D193Y|AC008440.5_ENST00000413496.2_RNA	p.D193Y	NM_001020821.1	NP_001018657.1	0	1	1	1.688809	Q96S97	MYADM_HUMAN		3	857	+	Ovarian(34;0.19)		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	0	1	hg19	c.577G>T	CCDS12866.1	0	.	.	.	.	.	.	.	.	.	.	G	3.909	-0.020465	0.07634	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82	4.21	-5.25	0.02781	4.21	-5.25	0.02781	Marvel (1);MARVEL-like domain (1);	1.023760	0.07811	N	0.958108	T	0.27098	0.0664	L	0.41710	1.295	0.09310	N	1	P	0.42941	0.794	P	0.46076	0.503	T	0.41431	-0.9509	10	0.56958	D	0.05	-2.8128	14.9568	0.71120	0.1028:0.0:0.8972:0.0	.	193	Q96S97	MYADM_HUMAN	Y	193;193;193;193;193;156;193;193	ENSP00000398269:D193Y;ENSP00000337222:D193Y;ENSP00000375650:D193Y;ENSP00000416919:D193Y;ENSP00000375651:D193Y;ENSP00000375649:D193Y;ENSP00000375648:D193Y	ENSP00000337222:D193Y	D	+	1	0	0	MYADM	59069172	59069172	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.121000	0.15667	-1.181000	0.02730	-0.657000	0.03884	GAC	0.241683		TCGA-HZ-A8P0-01A-11D-A36O-08	0.642	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	0	0	1	2	2	2	2	0	0	0	0	165	165	165	164	1	1.960000	-2.525760	1	0.380000	NM_138373		0	8	8	0	426	423	0		1	0		0	0	165	0	0	0.989105	7.787326e-01	0	0	0	153	0	8	426
NLRP13	126204	broad.mit.edu	37	19	56416346	56416346	+	Silent	SNP	C	C	T	rs375756102		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr19:56416346C>T	ENST00000342929.3	-	8	2579	c.2580G>A	c.(2578-2580)gcG>gcA	p.A860A	NLRP13_ENST00000588751.1_Silent_p.A860A	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	860							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GAGTCAGGGCCGCACACAATA	0.468													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17211	0.0		0.0	False		,,,				2504	0.0					ENST00000342929.3	1.000000	6.200000e-01	9.600000e-01	7.300000e-01	0.850000	0.851212	0.850000	1.000000																										0				109						c.(2578-2580)gcG>gcA		NLR family, pyrin domain containing 13		C		1,4405	2.1+/-5.4	0,1,2202	125.0	101.0	109.0		2580	-4.4	0.0	19		109	0,8600		0,0,4300	no	coding-synonymous	NLRP13	NM_176810.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		860/1044	56416346	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	126204	5	121412	38				g.chr19:56416346C>T	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2580G>A	chr19.hg19:g.56416346C>T		1					NLRP13_ENST00000588751.1_Silent_p.A860A	p.A860A	NM_176810.2	NP_789780.2	0	1	1	1.686526	Q86W25	NAL13_HUMAN		8	2579	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	Q7RTR5	Silent	SNP	ENST00000342929.3	1	1	hg19	c.2580G>A	CCDS33119.1	1																																																																																								0.238142		TCGA-HZ-A8P0-01A-11D-A36O-08	0.468	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.960000	-3.542038	1	0.380000	NM_176810		0	31	31	0	116	116	1		1			0	0	39	0	0	1.000000	0	0	0	0	0	0	31	116
PHGDH	26227	broad.mit.edu	37	1	120263916	120263916	+	Missense_Mutation	SNP	G	G	A	rs142988234		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:120263916G>A	ENST00000369409.4	+	2	398	c.262G>A	c.(262-264)Gca>Aca	p.A88T	PHGDH_ENST00000369407.3_Missense_Mutation_p.A54T	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	88					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		TCTGGAGGCCGCAACAAGGAA	0.587																																						ENST00000369409.4	0.150000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.081371	0.070000	0.070000																										0				18						c.(262-264)Gca>Aca		phosphoglycerate dehydrogenase		G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	124.0	111.0	115.0		262	5.9	0.2	1	dbSNP_134	115	0,8600		0,0,4300	no	missense	PHGDH	NM_006623.3	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	88/534	120263916	1,13005	2203	4300	6503	SO:0001583	missense	26227	3	121412	38				g.chr1:120263916G>A	BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.262G>A	chr1.hg19:g.120263916G>A	ENSP00000358417:p.Ala88Thr	0					PHGDH_ENST00000369407.3_Missense_Mutation_p.A54T	p.A88T	NM_006623.3	NP_006614.2	0	0	0	1.976828	O43175	SERA_HUMAN		2	398	+	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)	B2RD08|Q5SZU3|Q9BQ01	Missense_Mutation	SNP	ENST00000369409.4	0	1	hg19	c.262G>A	CCDS904.1	0	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748004	0.89663	2.27E-4	0.0	ENSG00000092621	ENST00000369409;ENST00000369407	D;D	0.88586	-2.4;-2.4	5.92	5.92	0.95590	5.92	5.92	0.95590	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95999	0.8697	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96332	0.9244	10	0.87932	D	0	-11.8066	18.8845	0.92370	0.0:0.0:1.0:0.0	.	54;88	Q5SZU1;O43175	.;SERA_HUMAN	T	88;54	ENSP00000358417:A88T;ENSP00000358415:A54T	ENSP00000358415:A54T	A	+	1	0	0	PHGDH	120065439	120065439	1.000000	0.71417	0.192000	0.23308	0.339000	0.28857	9.628000	0.98415	2.813000	0.96785	0.561000	0.74099	GCA	0.367992		TCGA-HZ-A8P0-01A-11D-A36O-08	0.587	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	102	1	1.960000	-1.914139	0	0.380000	NM_006623		0	5	5	0	372	367	0		1	0		0	0	104	0	0	0.935726	1.809369e-01	0	0	0	48	0	5	372
FMO5	2330	broad.mit.edu	37	1	146672844	146672844	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:146672844G>A	ENST00000254090.4	-	7	1461	c.1073C>T	c.(1072-1074)cCt>cTt	p.P358L	RP11-337C18.8_ENST00000607149.1_RNA|FMO5_ENST00000369272.3_Intron|RP11-337C18.8_ENST00000606757.1_RNA|FMO5_ENST00000441068.2_Missense_Mutation_p.P358L|RP11-337C18.10_ENST00000606856.1_RNA	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	358						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					CAGGTTAGGAGGGAAGACCTT	0.468																																						ENST00000254090.4	1.000000	8.000000e-02	2.400000e-01	1.100000e-01	0.160000	0.206445	0.160000	0.160000																										0				25						c.(1072-1074)cCt>cTt		flavin containing monooxygenase 5							127.0	124.0	125.0					1																	146672844		2203	4300	6503	SO:0001583	missense	2330	0	0					g.chr1:146672844G>A	Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.1073C>T	chr1.hg19:g.146672844G>A	ENSP00000254090:p.Pro358Leu	1					FMO5_ENST00000441068.2_Missense_Mutation_p.P358L|RP11-337C18.10_ENST00000606856.1_RNA|RP11-337C18.8_ENST00000607149.1_RNA|RP11-337C18.8_ENST00000606757.1_RNA|FMO5_ENST00000369272.3_Intron	p.P358L	NM_001461.2	NP_001452.2	1	3	4	2.706172	P49326	FMO5_HUMAN		7	1461	-	all_hematologic(923;0.0487)		B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	0	1	hg19	c.1073C>T	CCDS926.1	0	.	.	.	.	.	.	.	.	.	.	.	25.6	4.659505	0.88154	.	.	ENSG00000131781	ENST00000441068;ENST00000254090	T;T	0.66815	-0.23;-0.23	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.097121	0.64402	D	0.000001	T	0.81259	0.4785	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81786	-0.0773	10	0.72032	D	0.01	-16.718	18.3732	0.90420	0.0:0.0:1.0:0.0	.	358;358	P49326;C9JJD1	FMO5_HUMAN;.	L	358	ENSP00000416011:P358L;ENSP00000254090:P358L	ENSP00000254090:P358L	P	-	2	0	0	FMO5	145139468	145139468	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	9.828000	0.99408	2.941000	0.99782	0.655000	0.94253	CCT	0.544453		TCGA-HZ-A8P0-01A-11D-A36O-08	0.468	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	0	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	1.960000	-3.257086	1	0.380000	NM_001461		0	11	11	0	477	472	0		1	0		0	0	74	0	0	0.998272	4.712206e-02	0	0	0	14	0	11	477
SV2A	9900	broad.mit.edu	37	1	149882423	149882423	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:149882423C>T	ENST00000369146.3	-	4	1400	c.910G>A	c.(910-912)Ggc>Agc	p.G304S	SV2A_ENST00000369145.1_Missense_Mutation_p.G304S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	304					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GCGTACACGCCACCAATCATC	0.562																																						ENST00000369146.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.998988	0.990000	1.000000																										0				55						c.(910-912)Ggc>Agc		synaptic vesicle glycoprotein 2A	Levetiracetam(DB01202)						63.0	60.0	61.0					1																	149882423		2203	4300	6503	SO:0001583	missense	9900	0	0					g.chr1:149882423C>T	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.910G>A	chr1.hg19:g.149882423C>T	ENSP00000358142:p.Gly304Ser	1					SV2A_ENST00000369145.1_Missense_Mutation_p.G304S	p.G304S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	1	3	4	2.706172	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)	4	1400	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	1	1	hg19	c.910G>A	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.232995	0.95207	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.74106	-0.81;-0.81	4.99	4.99	0.66335	4.99	4.99	0.66335	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	L	0.52905	1.665	0.80722	D	1	D	0.69078	0.997	D	0.71414	0.973	T	0.71613	-0.4540	10	0.19147	T	0.46	-14.7314	15.8174	0.78615	0.0:1.0:0.0:0.0	.	304	Q7L0J3	SV2A_HUMAN	S	304	ENSP00000358142:G304S;ENSP00000358141:G304S	ENSP00000358141:G304S	G	-	1	0	0	SV2A	148149047	148149047	1.000000	0.71417	0.976000	0.42696	0.963000	0.63663	7.651000	0.83577	2.591000	0.87537	0.585000	0.79938	GGC	0.544453		TCGA-HZ-A8P0-01A-11D-A36O-08	0.562	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.960000	-3.348764	1	0.380000			0	51	49	0	228	228	1		1	0		0	0	60	0	0	1.000000	3.794461e-01	0	0	0	7	0	51	228
GABPB2	126626	broad.mit.edu	37	1	151063024	151063024	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:151063024C>T	ENST00000368918.3	+	3	582	c.251C>T	c.(250-252)gCg>gTg	p.A84V	GABPB2_ENST00000368917.1_Missense_Mutation_p.A84V|GABPB2_ENST00000368916.1_Missense_Mutation_p.A84V	NM_144618.2	NP_653219.1	Q8TAK5	GABP2_HUMAN	GA binding protein transcription factor, beta subunit 2	84					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(3)|liver(2)|lung(7)	15				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		GATGGACATGCGCACATCGTG	0.488																																						ENST00000368918.3	1.000000	1.000000e-02	1.200000e-01	3.000000e-02	0.060000	0.110124	0.060000	0.080000																										0				15						c.(250-252)gCg>gTg		GA binding protein transcription factor, beta subunit 2							100.0	94.0	96.0					1																	151063024		2203	4300	6503	SO:0001583	missense	126626	3	121412	38				g.chr1:151063024C>T		CCDS983.1	1q21.2	2013-01-10			ENSG00000143458	ENSG00000143458		"""Ankyrin repeat domain containing"""	28441	protein-coding gene	gene with protein product						7958862	Standard	NM_144618		Approved	MGC29891	uc001ewr.2	Q8TAK5	OTTHUMG00000012193	ENST00000368918.3:c.251C>T	chr1.hg19:g.151063024C>T	ENSP00000357914:p.Ala84Val	1					GABPB2_ENST00000368916.1_Missense_Mutation_p.A84V|GABPB2_ENST00000368917.1_Missense_Mutation_p.A84V	p.A84V	NM_144618.2	NP_653219.1	1	3	4	2.706172	Q8TAK5	GABP2_HUMAN		3	582	+			B1AVJ8|D3DV14|Q8NAR5	Missense_Mutation	SNP	ENST00000368918.3	0	1	hg19	c.251C>T	CCDS983.1	0	.	.	.	.	.	.	.	.	.	.	C	9.007	0.981617	0.18812	.	.	ENSG00000143458	ENST00000368918;ENST00000368917;ENST00000446567;ENST00000368916	T;T;T	0.62498	0.02;0.02;0.02	5.46	3.31	0.37934	5.46	3.31	0.37934	Ankyrin repeat-containing domain (4);	0.357560	0.33144	N	0.005223	T	0.11836	0.0288	N	0.03050	-0.425	0.09310	N	1	P;B	0.39404	0.672;0.126	B;B	0.20184	0.028;0.008	T	0.10428	-1.0630	10	0.33141	T	0.24	6.5452	9.7477	0.40457	0.0:0.8043:0.0:0.1957	.	100;84	B4DXA3;Q8TAK5	.;GABP2_HUMAN	V	84;84;100;84	ENSP00000357914:A84V;ENSP00000357913:A84V;ENSP00000357912:A84V	ENSP00000357912:A84V	A	+	2	0	0	GABPB2	149329648	149329648	0.001000	0.12720	0.005000	0.12908	0.348000	0.29142	1.370000	0.34238	0.664000	0.31047	0.650000	0.86243	GCG	0.544453		TCGA-HZ-A8P0-01A-11D-A36O-08	0.488	GABPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033700.2	0	0	1	2	2	2	2	0	0	0	0	86	86	86	86	1	1.960000	-2.385675	0	0.380000	NM_144618		0	5	5	0	558	550	0		1	0		0	0	86	0	0	0.935117	1.726632e-02	0	0	0	18	0	5	558
HRNR	388697	broad.mit.edu	37	1	152192788	152192788	+	Silent	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:152192788G>A	ENST00000368801.2	-	3	1392	c.1317C>T	c.(1315-1317)tcC>tcT	p.S439S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	439					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGTTGGCCGGAGCTGGGAG	0.617																																						ENST00000368801.2	1.000000	1.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.117195	0.070000	0.080000																										0				192						c.(1315-1317)tcC>tcT		hornerin							93.0	97.0	96.0					1																	152192788		2203	4300	6503	SO:0001819	synonymous_variant	388697	4	121412	41				g.chr1:152192788G>A	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1317C>T	chr1.hg19:g.152192788G>A		1					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.S439S	NM_001009931.1	NP_001009931.1	1	3	4	2.706172	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	1392	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	0	1	hg19	c.1317C>T	CCDS30859.1	0																																																																																								0.544453		TCGA-HZ-A8P0-01A-11D-A36O-08	0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	0	0	1	2	2	2	2	0	0	0	0	152	152	152	151	1	1.960000	-2.168665	0	0.380000	XM_373868		0	6	6	0	597	585	0		1			0	0	152	0	0	0.962874	0	0	0	0	0	0	6	597
CCT3	7203	broad.mit.edu	37	1	156280946	156280946	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:156280946C>T	ENST00000295688.3	-	12	1476	c.1196G>A	c.(1195-1197)cGc>cAc	p.R399H	CCT3_ENST00000368261.3_Missense_Mutation_p.R354H|CCT3_ENST00000472765.2_Missense_Mutation_p.R354H|CCT3_ENST00000368259.2_Missense_Mutation_p.R361H	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	399					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GAGAACATTGCGACACACTTG	0.537																																						ENST00000295688.3	1.000000	5.500000e-01	8.900000e-01	6.400000e-01	0.750000	0.770939	0.750000	0.740000																										0				22						c.(1195-1197)cGc>cAc		chaperonin containing TCP1, subunit 3 (gamma)							76.0	73.0	74.0					1																	156280946		2203	4300	6503	SO:0001583	missense	7203	2	121412	36				g.chr1:156280946C>T	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1196G>A	chr1.hg19:g.156280946C>T	ENSP00000295688:p.Arg399His	1					CCT3_ENST00000472765.2_Missense_Mutation_p.R354H|CCT3_ENST00000368259.2_Missense_Mutation_p.R361H|CCT3_ENST00000368261.3_Missense_Mutation_p.R354H	p.R399H	NM_005998.4	NP_005989.3	1	3	4	2.706172	P49368	TCPG_HUMAN		12	1476	-	Hepatocellular(266;0.158)		A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	1	1	hg19	c.1196G>A	CCDS1140.2	0	.	.	.	.	.	.	.	.	.	.	C	33	5.252956	0.95336	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	H	0.96805	3.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.73708	0.96;0.981;0.972	D	0.94427	0.7646	10	0.72032	D	0.01	-9.7785	17.4945	0.87713	0.0:1.0:0.0:0.0	.	361;398;399	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	H	399;361;354;354	ENSP00000295688:R399H;ENSP00000357242:R361H;ENSP00000357244:R354H;ENSP00000431543:R354H	ENSP00000295688:R399H	R	-	2	0	0	CCT3	154547570	154547570	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.441000	0.80485	2.726000	0.93360	0.650000	0.86243	CGC	0.544453		TCGA-HZ-A8P0-01A-11D-A36O-08	0.537	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	1	0	1	2	18	22	2	1	1	1	1	71	71	71	71	1	1.960000	-3.221884	1	0.380000	NM_005998		0	40	41	0	342	338	1		1	1		1	0	71	0	0	0.999147	9.998671e-01	0	80	0	425	0	40	342
PRG4	10216	broad.mit.edu	37	1	186269304	186269304	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:186269304A>C	ENST00000445192.2	+	3	203	c.158A>C	c.(157-159)tAc>tCc	p.Y53S	PRG4_ENST00000367483.4_Intron|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_Missense_Mutation_p.Y53S|PRG4_ENST00000367486.3_Missense_Mutation_p.Y53S	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	53	SMB 1. {ECO:0000255|PROSITE- ProRule:PRU00350}.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TGTCAACACTACATGGAGTGC	0.483																																						ENST00000445192.2	1.000000	6.800000e-01	9.400000e-01	7.500000e-01	0.840000	0.849195	0.840000	0.820000																										0				102						c.(157-159)tAc>tCc		proteoglycan 4							170.0	161.0	164.0					1																	186269304		2203	4300	6503	SO:0001583	missense	10216	0	0					g.chr1:186269304A>C	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.158A>C	chr1.hg19:g.186269304A>C	ENSP00000399679:p.Tyr53Ser	1					PRG4_ENST00000367485.4_Missense_Mutation_p.Y53S|PRG4_ENST00000367483.4_Intron|PRG4_ENST00000367486.3_Missense_Mutation_p.Y53S|PRG4_ENST00000367484.3_Intron	p.Y53S	NM_005807.3	NP_005798.2	1	3	4	2.706172	Q92954	PRG4_HUMAN		3	203	+			Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	1	1	hg19	c.158A>C	CCDS1369.1	0	.	.	.	.	.	.	.	.	.	.	A	12.19	1.862154	0.32884	.	.	ENSG00000116690	ENST00000367486;ENST00000367485;ENST00000445192	T;T;T	0.42900	0.96;0.96;0.96	5.57	4.38	0.52667	5.57	4.38	0.52667	Somatomedin B domain (4);	0.178558	0.27122	N	0.020830	T	0.59074	0.2167	M	0.66439	2.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	T	0.62248	-0.6894	10	0.87932	D	0	-5.8319	9.7406	0.40416	0.7331:0.0:0.0:0.2669	.	53;53	Q92954-3;Q92954	.;PRG4_HUMAN	S	53	ENSP00000356456:Y53S;ENSP00000356455:Y53S;ENSP00000399679:Y53S	ENSP00000356455:Y53S	Y	+	2	0	0	PRG4	184535927	184535927	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.078000	0.41567	2.117000	0.64856	0.528000	0.53228	TAC	0.544453		TCGA-HZ-A8P0-01A-11D-A36O-08	0.483	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	1	0	1	2	2	2	2	0	0	0	0	136	136	136	135	1	1.960000	-20.000000	1	0.380000	NM_005807		0	96	96	0	724	717	1		1	0		0	0	136	0	0	1.000000	0	0	0	0	1	0	96	724
MYBPH	4608	broad.mit.edu	37	1	203138179	203138180	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:203138179_203138180GC>AT	ENST00000255416.4	-	9	1328_1329	c.1271_1272GC>AT	c.(1270-1272)gGC>gAT	p.G424D		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	424	Ig-like C2-type 2.				cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		ATTTGGGGTTGCCCTGGATCTC	0.564																																					NSCLC(32;174 1025 14462 23899 42933)	ENST00000255416.4	1.000000	6.900000e-01|6.800000e-01	9.800000e-01|9.600000e-01	7.800000e-01|7.600000e-01	0.870000|0.850000	0.876196|0.860739	0.870000|0.850000	1.000000																										0				20						c.(1270-1272)ggC>ggT|c.(1270-1272)gGc>gAc		myosin binding protein H																																				SO:0001583	missense	4608	0	0					g.chr1:203138179G>A|g.chr1:203138180C>T	BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.1271_1272delinsAT	chr1.hg19:g.203138179_203138180delinsAT	ENSP00000255416:p.Gly424Asp	1						p.G424G|p.G424D	NM_004997.2	NP_004988.2	1	3	4	2.728117	Q13203	MYBPH_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.153)	9	1329|1328	-			Q16886|Q86YC5	Silent|Missense_Mutation	SNP	ENST00000255416.4	1	1	hg19	c.1272C>T|c.1271G>A	CCDS30975.1	1																									|5.36	|5.36	|0.76844																																												|0			|201404803														0.545721		TCGA-HZ-A8P0-01A-11D-A36O-08	0.564	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100264.1	1	0	1	2	2	2	2	0	0	0	0	136	136|138	136|138	135|137	1	1.960000	-20.000000	1	0.380000	NM_004997		0	78|75	78|75	0	566|557	557|548	1		1			0	0	136|138	0	0	1.000000	0	0	0	0	0	0	75	557
USH2A	7399	broad.mit.edu	37	1	216495296	216495296	+	Missense_Mutation	SNP	C	C	T	rs375741757		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:216495296C>T	ENST00000307340.3	-	9	1959	c.1573G>A	c.(1573-1575)Gat>Aat	p.D525N	USH2A_ENST00000366943.2_Missense_Mutation_p.D525N|USH2A_ENST00000366942.3_Missense_Mutation_p.D525N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	525	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCGCAGTTATCGGCATGACCA	0.443										HNSCC(13;0.011)																												ENST00000307340.3	1.000000	5.900000e-01	9.400000e-01	6.900000e-01	0.800000	0.814860	0.800000	1.000000																										0				527						c.(1573-1575)Gat>Aat		Usher syndrome 2A (autosomal recessive, mild)		C	ASN/ASP,ASN/ASP	0,4406		0,0,2203	152.0	135.0	141.0		1573,1573	-0.1	0.0	1		141	1,8599		0,1,4299	no	missense,missense	USH2A	NM_007123.5,NM_206933.2	23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	525/1547,525/5203	216495296	1,13005	2203	4300	6503	SO:0001583	missense	7399	7	121402	39				g.chr1:216495296C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1573G>A	chr1.hg19:g.216495296C>T	ENSP00000305941:p.Asp525Asn	1	HNSCC(13;0.011)				USH2A_ENST00000366943.2_Missense_Mutation_p.D525N|USH2A_ENST00000366942.3_Missense_Mutation_p.D525N	p.D525N	NM_206933.2	NP_996816	1	3	4	2.728117	O75445	USH2A_HUMAN		9	1959	-			Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	1	1	hg19	c.1573G>A	CCDS31025.1	0	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803455	0.31869	0.0	1.16E-4	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.63417	-0.04;-0.04;-0.04	5.65	-0.114	0.13564	5.65	-0.114	0.13564	EGF-like, laminin (3);	0.531595	0.15476	N	0.260375	T	0.42517	0.1206	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.20368	0.021;0.044	B;B	0.14023	0.009;0.01	T	0.24728	-1.0152	10	0.37606	T	0.19	.	8.3498	0.32295	0.0:0.6291:0.1083:0.2626	.	525;525	O75445-2;O75445	.;USH2A_HUMAN	N	525	ENSP00000305941:D525N;ENSP00000355910:D525N;ENSP00000355909:D525N	ENSP00000305941:D525N	D	-	1	0	0	USH2A	214561919	214561919	0.100000	0.21855	0.000000	0.03702	0.160000	0.22226	1.178000	0.31981	0.053000	0.16036	0.557000	0.71058	GAT	0.545721		TCGA-HZ-A8P0-01A-11D-A36O-08	0.443	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.960000	-3.075756	1	0.380000	NM_007123		0	43	42	0	343	338	1		1			0	0	50	0	0	1.000000	0	0	0	0	0	0	43	343
DISP1	84976	broad.mit.edu	37	1	223176847	223176847	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:223176847G>T	ENST00000284476.6	+	8	2272	c.2108G>T	c.(2107-2109)cGa>cTa	p.R703L		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	703					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		GAAGCATCTCGAATTTTTTTC	0.418																																						ENST00000284476.6	1.000000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.100331	0.060000	0.080000																										0				69						c.(2107-2109)cGa>cTa		dispatched homolog 1 (Drosophila)							128.0	129.0	129.0					1																	223176847		2203	4300	6503	SO:0001583	missense	84976	0	0					g.chr1:223176847G>T	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2108G>T	chr1.hg19:g.223176847G>T	ENSP00000284476:p.Arg703Leu	1						p.R703L	NM_032890.3	NP_116279.2	1	3	4	2.728117	Q96F81	DISP1_HUMAN		8	2272	+			Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	0	1	hg19	c.2108G>T	CCDS1536.1	0	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711729	0.68730	.	.	ENSG00000154309	ENST00000284476	D	0.86030	-2.06	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.104774	0.64402	D	0.000005	D	0.91195	0.7226	L	0.59436	1.845	0.54753	D	0.999989	D	0.61697	0.99	D	0.69307	0.963	D	0.90102	0.4185	10	0.49607	T	0.09	-28.8962	20.2983	0.98569	0.0:0.0:1.0:0.0	.	703	Q96F81	DISP1_HUMAN	L	703	ENSP00000284476:R703L	ENSP00000284476:R703L	R	+	2	0	0	DISP1	221243470	221243470	1.000000	0.71417	0.236000	0.24074	0.984000	0.73092	6.665000	0.74442	2.802000	0.96397	0.655000	0.94253	CGA	0.545721		TCGA-HZ-A8P0-01A-11D-A36O-08	0.418	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	0	0	1	2	2	2	2	0	0	0	0	166	166	166	165	1	1.960000	-2.329120	0	0.380000	NM_032890		0	8	8	0	864	853	0		1	0		0	0	166	0	0	0.988820	3.969421e-03	0	0	0	9	0	8	864
TTC13	79573	broad.mit.edu	37	1	231044752	231044752	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:231044752G>A	ENST00000366661.4	-	21	2331	c.2324C>T	c.(2323-2325)tCg>tTg	p.S775L	TTC13_ENST00000414259.1_Missense_Mutation_p.S722L|TTC13_ENST00000366662.4_Missense_Mutation_p.S721L	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	775										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		CACGATGACCGAGTAAGCAAT	0.423																																						ENST00000366661.4	1.000000	6.500000e-01	9.300000e-01	7.300000e-01	0.820000	0.833296	0.820000	0.830000																										0				39						c.(2323-2325)tCg>tTg		tetratricopeptide repeat domain 13							120.0	124.0	123.0					1																	231044752		2203	4300	6503	SO:0001583	missense	79573	1	121412	31				g.chr1:231044752G>A		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.2324C>T	chr1.hg19:g.231044752G>A	ENSP00000355621:p.Ser775Leu	1					TTC13_ENST00000366662.4_Missense_Mutation_p.S721L|TTC13_ENST00000414259.1_Missense_Mutation_p.S722L	p.S775L	NM_024525.4	NP_078801.3	1	3	4	2.740950	Q8NBP0	TTC13_HUMAN		21	2331	-	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	1	1	hg19	c.2324C>T	CCDS1588.1	0	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262382	0.59431	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	T;T;T	0.42900	0.96;1.0;1.0	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.063181	0.64402	D	0.000003	T	0.30324	0.0761	N	0.25647	0.755	0.80722	D	1	B;P;P;P	0.50066	0.343;0.76;0.846;0.931	B;B;B;B	0.34652	0.009;0.122;0.187;0.184	T	0.11372	-1.0590	10	0.40728	T	0.16	-11.9623	19.4529	0.94875	0.0:0.0:1.0:0.0	.	700;722;721;775	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	L	775;721;722	ENSP00000355621:S775L;ENSP00000355622:S721L;ENSP00000416631:S722L	ENSP00000355621:S775L	S	-	2	0	0	TTC13	229111375	229111375	1.000000	0.71417	0.972000	0.41901	0.954000	0.61252	8.920000	0.92779	2.595000	0.87683	0.655000	0.94253	TCG	0.548237		TCGA-HZ-A8P0-01A-11D-A36O-08	0.423	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	1	0	1	2	2	2	2	0	0	0	0	122	122	122	122	1	1.960000	-3.017764	1	0.380000	NM_024525		0	75	74	0	581	573	1		1	1		0	0	122	0	0	1.000000	9.765735e-01	0	9	0	39	0	75	581
SLC6A9	6536	broad.mit.edu	37	1	44463406	44463406	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:44463406C>A	ENST00000360584.2	-	14	2123	c.1932G>T	c.(1930-1932)ttG>ttT	p.L644F	SLC6A9_ENST00000475075.2_Missense_Mutation_p.L460F|SLC6A9_ENST00000357730.2_Missense_Mutation_p.L590F|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000372310.3_Missense_Mutation_p.L571F	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	644					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	TGGCATTTTTCAAACGCTGCA	0.647																																						ENST00000360584.2	0.120000	2.000000e-02	9.000000e-02	3.000000e-02	0.060000	0.069056	0.060000	0.060000																										0				22						c.(1930-1932)ttG>ttT		solute carrier family 6 (neurotransmitter transporter, glycine), member 9	Glycine(DB00145)						89.0	103.0	98.0					1																	44463406		2203	4300	6503	SO:0001583	missense	6536	0	0					g.chr1:44463406C>A	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.1932G>T	chr1.hg19:g.44463406C>A	ENSP00000353791:p.Leu644Phe	0					SLC6A9_ENST00000475075.2_Missense_Mutation_p.L460F|SLC6A9_ENST00000357730.2_Missense_Mutation_p.L590F|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372310.3_Missense_Mutation_p.L571F|SLC6A9_ENST00000372307.3_Intron	p.L644F	NM_201649.3	NP_964012.2	0	0	0	2.007290	P48067	SC6A9_HUMAN		14	2123	-	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Missense_Mutation	SNP	ENST00000360584.2	0	1	hg19	c.1932G>T	CCDS41317.1	0	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547710	0.45383	.	.	ENSG00000196517	ENST00000372310;ENST00000475075;ENST00000360584;ENST00000357730	T;T;T;T	0.75821	-0.9;-0.95;-0.97;-0.93	4.92	4.92	0.64577	4.92	4.92	0.64577	.	0.000000	0.64402	D	0.000001	T	0.75817	0.3901	L	0.40543	1.245	0.80722	D	1	D;B;B;D	0.65815	0.986;0.251;0.063;0.995	P;B;B;P	0.57425	0.655;0.098;0.073;0.82	T	0.75975	-0.3128	10	0.49607	T	0.09	.	11.4173	0.49960	0.0:0.9164:0.0:0.0836	.	575;571;590;644	B7Z3W8;P48067-2;P48067-3;P48067	.;.;.;SC6A9_HUMAN	F	571;460;644;590	ENSP00000361384:L571F;ENSP00000434460:L460F;ENSP00000353791:L644F;ENSP00000350362:L590F	ENSP00000350362:L590F	L	-	3	2	2	SLC6A9	44235993	44235993	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.373000	0.59537	2.553000	0.86117	0.609000	0.83330	TTG	0.377635		TCGA-HZ-A8P0-01A-11D-A36O-08	0.647	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	0	0	1	2	2	2	2	0	0	0	0	140	140	140	139	1	1.960000	-2.879119	1	0.380000	NM_201649		0	7	7	0	597	591	0		1	0		0	0	140	0	0	0.979996	3.891117e-03	0	0	0	7	0	7	597
OR2M5	127059	broad.mit.edu	37	1	248309316	248309316	+	Silent	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr1:248309316C>A	ENST00000366476.1	+	1	867	c.867C>A	c.(865-867)atC>atA	p.I289I		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ATCCCCTCATCTACAGCCTCC	0.493																																						ENST00000366476.1	1.000000	8.200000e-01	1	9.100000e-01	0.990000	0.968151	0.990000	1.000000																										0				49						c.(865-867)atC>atA		olfactory receptor, family 2, subfamily M, member 5							90.0	83.0	85.0					1																	248309316		2203	4300	6503	SO:0001819	synonymous_variant	127059	0	0					g.chr1:248309316C>A		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.867C>A	chr1.hg19:g.248309316C>A		1						p.I289I	NM_001004690.1	NP_001004690.1	1	3	4	2.740950	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)	1	867	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)			Silent	SNP	ENST00000366476.1	1	1	hg19	c.867C>A	CCDS31105.1	1																																																																																								0.548237		TCGA-HZ-A8P0-01A-11D-A36O-08	0.493	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	1	0	1	2	2	2	2	0	0	0	0	135	135	135	133	1	1.960000	-20.000000	1	0.380000	NM_001004690		0	99	98	0	612	602	0		1			0	0	135	0	0	1.000000	0	0	0	0	0	0	99	612
CXCR4	7852	broad.mit.edu	37	2	136873279	136873279	+	Silent	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr2:136873279C>T	ENST00000241393.3	-	2	323	c.219G>A	c.(217-219)acG>acA	p.T73T	CXCR4_ENST00000409817.1_Silent_p.T77T|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	73					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)	p.T77T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TGTACTTGTCCGTCATGCTTC	0.517																																						ENST00000241393.3	1.000000	7.500000e-01	1	8.400000e-01	0.930000	0.926951	0.930000	1.000000																										1	Substitution - coding silent(1)	p.T77T(1)	lung(1)	25						c.(217-219)acG>acA		chemokine (C-X-C motif) receptor 4	Framycetin(DB00452)|Plerixafor(DB06809)						188.0	179.0	182.0					2																	136873279		2203	4300	6503	SO:0001819	synonymous_variant	7852	0	0					g.chr2:136873279C>T	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.219G>A	chr2.hg19:g.136873279C>T		0					CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Silent_p.T77T	p.T73T	NM_003467.2	NP_003458.1	0	0	0	1.995583	P61073	CXCR4_HUMAN		2	323	-			B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Silent	SNP	ENST00000241393.3	1	1	hg19	c.219G>A	CCDS46420.1	1																																																																																								0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.517	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1	1	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	1.960000	-2.675627	1	0.380000			0	76	76	0	346	341	1		1	1		0	0	110	0	0	1.000000	1	0	10	0	156	0	76	346
NEB	4703	broad.mit.edu	37	2	152466350	152466350	+	Silent	SNP	T	T	C			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr2:152466350T>C	ENST00000172853.10	-	77	11721	c.11574A>G	c.(11572-11574)gcA>gcG	p.A3858A	NEB_ENST00000397345.3_Silent_p.A4101A|NEB_ENST00000409198.1_Silent_p.A3858A|NEB_ENST00000427231.2_Silent_p.A4101A|NEB_ENST00000603639.1_Silent_p.A4101A|NEB_ENST00000604864.1_Silent_p.A4101A			P20929	NEBU_HUMAN	nebulin	3858					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGGCCTTTTTTGCTTGGATAA	0.448																																						ENST00000172853.10	1.000000	8.100000e-01	1	8.800000e-01	0.960000	0.954296	0.960000	1.000000																										0				301						c.(11572-11574)gcA>gcG		nebulin							210.0	197.0	201.0					2																	152466350		1952	4143	6095	SO:0001819	synonymous_variant	4703	0	0					g.chr2:152466350T>C	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11574A>G	chr2.hg19:g.152466350T>C		0					NEB_ENST00000603639.1_Silent_p.A4101A|NEB_ENST00000409198.1_Silent_p.A3858A|NEB_ENST00000427231.2_Silent_p.A4101A|NEB_ENST00000604864.1_Silent_p.A4101A|NEB_ENST00000397345.3_Silent_p.A4101A	p.A3858A			0	0	0	1.995583	P20929	NEBU_HUMAN		77	11721	-			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	1	1	hg19	c.11574A>G		1																																																																																								0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.448	NEB-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	166	166	166	161	1	1.960000	-20.000000	1	0.380000	NM_004543		0	116	113	0	506	499	1		1			0	0	166	0	0	1.000000	0	0	0	0	0	0	116	506
SCN1A	6323	broad.mit.edu	37	2	166911170	166911170	+	Missense_Mutation	SNP	C	C	A	rs121917935		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr2:166911170C>A	ENST00000303395.4	-	4	579	c.580G>T	c.(580-582)Gat>Tat	p.D194Y	SCN1A_ENST00000409050.1_Missense_Mutation_p.D194Y|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.D194Y|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.D194Y			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	194			D -> N (in EIEE6; dbSNP:rs121917935). {ECO:0000269|PubMed:17054684, ECO:0000269|PubMed:19589774}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAGTGAAATCGAGCCAGTTC	0.338																																						ENST00000303395.4	0.210000	3.000000e-02	1.500000e-01	6.000000e-02	0.100000	0.112055	0.100000	0.100000																										0				200	GRCh37	CM067004	SCN1A	M	rs121917935	c.(580-582)Gat>Tat		sodium channel, voltage-gated, type I, alpha subunit	Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)						67.0	70.0	69.0					2																	166911170		2202	4299	6501	SO:0001583	missense	6323	0	0					g.chr2:166911170C>A	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.580G>T	chr2.hg19:g.166911170C>A	ENSP00000303540:p.Asp194Tyr	0					AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.D194Y|SCN1A_ENST00000409050.1_Missense_Mutation_p.D194Y|SCN1A_ENST00000423058.2_Missense_Mutation_p.D194Y|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA	p.D194Y			0	0	0	1.995583	P35498	SCN1A_HUMAN		4	579	-			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	0	1	hg19	c.580G>T	CCDS54413.1	0	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620307	0.87460	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.99399	-5.83;-5.83;-5.83;-5.83	5.24	5.24	0.73138	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99837	0.9926	H	0.99855	4.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.989;1.0;0.999	D	0.96333	0.9245	10	0.87932	D	0	.	19.1745	0.93599	0.0:1.0:0.0:0.0	.	194;194;194	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	Y	194	ENSP00000407030:D194Y;ENSP00000303540:D194Y;ENSP00000364554:D194Y;ENSP00000386312:D194Y	ENSP00000303540:D194Y	D	-	1	0	0	SCN1A	166619416	166619416	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.726000	0.84824	2.597000	0.87782	0.561000	0.74099	GAT	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.960000	-2.719573	1	0.380000	NM_006920		0	5	5	0	271	265	0		1			0	0	60	0	0	0.934433	0	0	0	0	0	0	5	271
ITGAV	3685	broad.mit.edu	37	2	187506230	187506230	+	Silent	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr2:187506230G>T	ENST00000261023.3	+	12	1348	c.1074G>T	c.(1072-1074)acG>acT	p.T358T	ITGAV_ENST00000433736.2_Silent_p.T312T|AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000374907.3_Silent_p.T322T	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	358					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	ACTTCCAGACGACAAAGCTGA	0.498																																					Melanoma(58;108 1995 6081)	ENST00000261023.3	0.090000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.050504	0.040000	0.040000																										0				47						c.(1072-1074)acG>acT		integrin, alpha V	Antithymocyte globulin(DB00098)						202.0	198.0	199.0					2																	187506230		2203	4300	6503	SO:0001819	synonymous_variant	3685	0	0					g.chr2:187506230G>T		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1074G>T	chr2.hg19:g.187506230G>T		0					ITGAV_ENST00000374907.3_Silent_p.T322T|ITGAV_ENST00000433736.2_Silent_p.T312T|AC017101.10_ENST00000453665.1_RNA	p.T358T	NM_002210.3	NP_002201	0	0	0	1.995583	P06756	ITAV_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	12	1348	+			A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	ENST00000261023.3	0	1	hg19	c.1074G>T	CCDS2292.1	0																																																																																								0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.498	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	0	0	1	2	2	2	2	0	0	0	0	209	209	209	209	1	1.960000	-2.213597	0	0.380000	NM_002210		0	7	8	0	818	814	0		1	0		0	0	209	0	0	0.980384	5.568517e-02	0	0	0	38	0	7	818
CD207	50489	broad.mit.edu	37	2	71060828	71060828	+	Missense_Mutation	SNP	G	G	A	rs370455494		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr2:71060828G>A	ENST00000410009.3	-	3	559	c.514C>T	c.(514-516)Cgg>Tgg	p.R172W		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	172					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						TGGAGTGCCCGGATCTTTGTA	0.428																																						ENST00000410009.3	1.000000	7.300000e-01	1	8.400000e-01	0.970000	0.938314	0.970000	1.000000																										0				20						c.(514-516)Cgg>Tgg		CD207 molecule, langerin		G	TRP/ARG	0,3698		0,0,1849	82.0	73.0	75.0		514	4.1	0.0	2		75	1,8199		0,1,4099	no	missense	CD207	NM_015717.3	101	0,1,5948	AA,AG,GG		0.0122,0.0,0.0084	probably-damaging	172/329	71060828	1,11897	1849	4100	5949	SO:0001583	missense	50489	2	120810	35				g.chr2:71060828G>A	AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.514C>T	chr2.hg19:g.71060828G>A	ENSP00000386378:p.Arg172Trp	0						p.R172W	NM_015717.3	NP_056532	0	0	0	2.001662	Q9UJ71	CLC4K_HUMAN		3	559	-				Missense_Mutation	SNP	ENST00000410009.3	1	1	hg19	c.514C>T		1	.	.	.	.	.	.	.	.	.	.	G	6.526	0.465360	0.12402	0.0	1.22E-4	ENSG00000116031	ENST00000410009	T	0.29917	1.55	4.12	4.12	0.48240	4.12	4.12	0.48240	.	1.382280	0.04510	N	0.382668	T	0.25568	0.0622	L	0.27053	0.805	0.09310	N	1	D	0.67145	0.996	B	0.39590	0.304	T	0.32719	-0.9896	10	0.59425	D	0.04	.	12.1703	0.54155	0.0:0.0:1.0:0.0	.	172	Q9UJ71	CLC4K_HUMAN	W	172	ENSP00000386378:R172W	ENSP00000386378:R172W	R	-	1	2	2	CD207	70914336	70914336	0.043000	0.20138	0.029000	0.17559	0.004000	0.04260	1.111000	0.31159	2.568000	0.86640	0.655000	0.94253	CGG	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.428	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000329959.4	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.960000	-3.489613	1	0.380000	NM_015717		0	45	45	0	196	193	1		1	0		0	0	58	0	0	1.000000	0	0	0	0	1	0	45	196
SPHKAP	80309	broad.mit.edu	37	2	228860288	228860288	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr2:228860288G>A	ENST00000392056.3	-	8	4617	c.4571C>T	c.(4570-4572)gCc>gTc	p.A1524V	SPHKAP_ENST00000344657.5_Missense_Mutation_p.A1524V	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1524						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTCCTCATTGGCAAGCTGGGT	0.572																																						ENST00000392056.3	0.120000	2.000000e-02	9.000000e-02	3.000000e-02	0.060000	0.070522	0.060000	0.060000																										0				185						c.(4570-4572)gCc>gTc		SPHK1 interactor, AKAP domain containing							187.0	159.0	168.0					2																	228860288		2203	4300	6503	SO:0001583	missense	80309	0	0					g.chr2:228860288G>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4571C>T	chr2.hg19:g.228860288G>A	ENSP00000375909:p.Ala1524Val	0					SPHKAP_ENST00000344657.5_Missense_Mutation_p.A1524V	p.A1524V	NM_001142644.1	NP_001136116.1	0	0	0	1.995583	Q2M3C7	SPKAP_HUMAN		8	4617	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	0	1	hg19	c.4571C>T	CCDS46537.1	0	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664572	0.47572	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.13901	2.55;2.56	6.06	4.04	0.47022	6.06	4.04	0.47022	.	0.287377	0.39020	N	0.001482	T	0.14227	0.0344	L	0.49126	1.545	0.43292	D	0.995273	B;P	0.42908	0.18;0.793	B;B	0.39971	0.044;0.315	T	0.02596	-1.1136	10	0.48119	T	0.1	.	11.0015	0.47609	0.1936:0.0:0.8064:0.0	.	1524;1524	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	V	1524	ENSP00000375909:A1524V;ENSP00000339886:A1524V	ENSP00000339886:A1524V	A	-	2	0	0	SPHKAP	228568532	228568532	1.000000	0.71417	0.908000	0.35775	0.542000	0.35054	2.352000	0.44080	1.570000	0.49709	0.655000	0.94253	GCC	0.375252		TCGA-HZ-A8P0-01A-11D-A36O-08	0.572	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	0	0	1	2	14	2	2	1	1	1	1	159	159	159	157	1	1.960000	-2.642522	1	0.380000	NM_030623		0	7	9	0	582	573	0		0			1	0	159	0	0	0.087473	0	0	0	0	0	0	7	582
GAR1	54433	broad.mit.edu	37	4	110740164	110740164	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr4:110740164C>A	ENST00000226796.6	+	4	641	c.377C>A	c.(376-378)tCa>tAa	p.S126*	GAR1_ENST00000394631.3_Nonsense_Mutation_p.S126*	NM_018983.3	NP_061856.1	Q9NY12	GAR1_HUMAN	GAR1 ribonucleoprotein	126					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA snoRNP complex (GO:0031429)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cation channel activity (GO:0005261)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	9						TAGTATTTTTCAGTTAAGTTG	0.299																																						ENST00000226796.6	0.230000	6.000000e-02	1.800000e-01	9.000000e-02	0.130000	0.138889	0.130000	0.120000																										0				9						c.(376-378)tCa>tAa		GAR1 ribonucleoprotein							78.0	84.0	82.0					4																	110740164		2202	4299	6501	SO:0001587	stop_gained	54433	0	0					g.chr4:110740164C>A	AJ276003	CCDS34050.1	4q	2013-07-31	2013-07-31	2008-10-13	ENSG00000109534	ENSG00000109534			14264	protein-coding gene	gene with protein product		606468	"""nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)"", ""GAR1 ribonucleoprotein homolog (yeast)"""	NOLA1		10757788	Standard	XM_005263069		Approved		uc003hzu.3	Q9NY12	OTTHUMG00000161108	ENST00000226796.6:c.377C>A	chr4.hg19:g.110740164C>A	ENSP00000226796:p.Ser126*	0					GAR1_ENST00000394631.3_Nonsense_Mutation_p.S126*	p.S126*	NM_018983.3	NP_061856.1	1	2	3	2.016802	Q9NY12	GAR1_HUMAN		4	641	+			Q5MJQ2	Nonsense_Mutation	SNP	ENST00000226796.6	0	1	hg19	c.377C>A	CCDS34050.1	0	.	.	.	.	.	.	.	.	.	.	C	38	7.040121	0.98021	.	.	ENSG00000109534	ENST00000394631;ENST00000226796	.	.	.	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9407	0.92604	0.0:1.0:0.0:0.0	.	.	.	.	X	126	.	ENSP00000226796:S126X	S	+	2	0	0	GAR1	110959613	110959613	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.681000	0.74523	2.573000	0.86826	0.591000	0.81541	TCA	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.299	GAR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363810.2	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.960000	-2.995502	1	0.380000			0	10	10	0	404	401	0		1	0		0	0	85	0	0	0.996846	4.445618e-01	0	0	0	58	0	10	404
PLRG1	5356	broad.mit.edu	37	4	155458483	155458483	+	Silent	SNP	A	A	C			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr4:155458483A>C	ENST00000499023.2	-	14	1566	c.1440T>G	c.(1438-1440)gcT>gcG	p.A480A	PLRG1_ENST00000302078.5_Silent_p.A471A|PLRG1_ENST00000393905.2_Silent_p.A480A	NM_001201564.1|NM_002669.3	NP_001188493.1|NP_002660.1	O43660	PLRG1_HUMAN	pleiotropic regulator 1	480					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|protein localization to nucleus (GO:0034504)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|skin(1)|urinary_tract(1)	22	all_hematologic(180;0.215)	Renal(120;0.0854)				TATCAGCTTCAGCTGTTAGTA	0.408																																						ENST00000499023.2	1.000000	6.600000e-01	9.800000e-01	7.500000e-01	0.860000	0.864340	0.860000	1.000000																										0				22						c.(1438-1440)gcT>gcG		pleiotropic regulator 1							110.0	108.0	109.0					4																	155458483		2203	4300	6503	SO:0001819	synonymous_variant	5356	6	121402	38				g.chr4:155458483A>C	AF044333	CCDS34083.1, CCDS56341.1	4q31.2-q32.1	2013-01-10	2011-05-19		ENSG00000171566	ENSG00000171566		"""WD repeat domain containing"""	9089	protein-coding gene	gene with protein product	"""transport and golgi organization 4 homolog (Drosophila)"""	605961	"""pleiotropic regulator 1 (PRL1, Arabidopsis homolog)"", ""pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)"""				Standard	NM_002669		Approved	PRL1, Prp46, PRPF46, Cwc1, TANGO4	uc003iny.3	O43660	OTTHUMG00000161411	ENST00000499023.2:c.1440T>G	chr4.hg19:g.155458483A>C		0					PLRG1_ENST00000302078.5_Silent_p.A471A|PLRG1_ENST00000393905.2_Silent_p.A480A	p.A480A	NM_001201564.1|NM_002669.3	NP_001188493.1|NP_002660.1	1	2	3	2.016802	O43660	PLRG1_HUMAN		14	1566	-	all_hematologic(180;0.215)	Renal(120;0.0854)	B3KMK4|Q3KQY5|Q8WUD8	Silent	SNP	ENST00000499023.2	1	1	hg19	c.1440T>G	CCDS34083.1	1																																																																																								0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.408	PLRG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364824.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.960000	-20.000000	1	0.380000	NM_002669		0	52	51	0	265	263	1		1	1		0	0	65	0	0	1.000000	9.999927e-01	0	21	0	71	0	52	265
SORBS2	8470	broad.mit.edu	37	4	186544436	186544436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr4:186544436G>T	ENST00000284776.7	-	13	2644	c.2135C>A	c.(2134-2136)tCg>tAg	p.S712*	SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000431808.1_Nonsense_Mutation_p.S712*|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000355634.5_Nonsense_Mutation_p.S812*|SORBS2_ENST00000418609.1_Nonsense_Mutation_p.S616*	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	712					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CTTAGGAGCCGAATTTTTTTT	0.448																																					Esophageal Squamous(153;41 2433 9491 36028)	ENST00000284776.7	0.100000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.054186	0.040000	0.050000																										0				53						c.(2134-2136)tCg>tAg		sorbin and SH3 domain containing 2							126.0	139.0	135.0					4																	186544436		2203	4300	6503	SO:0001587	stop_gained	8470	0	0					g.chr4:186544436G>T		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2135C>A	chr4.hg19:g.186544436G>T	ENSP00000284776:p.Ser712*	0					SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000431808.1_Nonsense_Mutation_p.S712*|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000418609.1_Nonsense_Mutation_p.S616*|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000355634.5_Nonsense_Mutation_p.S812*|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000393528.3_Intron	p.S712*	NM_021069.4	NP_066547.1	1	2	3	2.016802	O94875	SRBS2_HUMAN		13	2644	-		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Nonsense_Mutation	SNP	ENST00000284776.7	0	1	hg19	c.2135C>A	CCDS3845.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.837571	0.97009	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	.	.	.	5.88	5.0	0.66597	5.88	5.0	0.66597	.	0.741300	0.13760	N	0.364655	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1252	11.2173	0.48833	0.0951:0.0:0.9049:0.0	.	.	.	.	X	712;712;616;812	.	ENSP00000284776:S712X	S	-	2	0	0	SORBS2	186781430	186781430	0.872000	0.30054	0.002000	0.10522	0.045000	0.14185	4.786000	0.62425	1.371000	0.46172	0.561000	0.74099	TCG	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.448	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	0	0	1	2	13	2	2	1	1	1	1	237	237	237	233	1	1.960000	-2.135062	0	0.380000	NM_003603		0	7	7	0	769	763	0		0			1	0	237	0	0	0.125135	0	0	0	0	0	0	7	769
ST8SIA4	7903	broad.mit.edu	37	5	100191950	100191950	+	Silent	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr5:100191950C>A	ENST00000231461.5	-	4	964	c.654G>T	c.(652-654)ctG>ctT	p.L218L		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	218					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CACTGTCATTCAGCATGGAAA	0.398																																						ENST00000231461.5	0.150000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.082552	0.070000	0.080000																										0				25						c.(652-654)ctG>ctT		ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4							200.0	180.0	187.0					5																	100191950		2203	4300	6503	SO:0001819	synonymous_variant	7903	0	0					g.chr5:100191950C>A	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.654G>T	chr5.hg19:g.100191950C>A		0						p.L218L	NM_005668.4	NP_005659.1	0	0	0	2.008297	Q92187	SIA8D_HUMAN		4	964	-		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)	A8KA07|G3V104|Q8N1F4|Q92693	Silent	SNP	ENST00000231461.5	0	1	hg19	c.654G>T	CCDS4091.1	0																																																																																								0.377635		TCGA-HZ-A8P0-01A-11D-A36O-08	0.398	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	0	0	1	2	2	2	2	0	0	0	0	99	99	99	98	1	1.960000	-2.647119	1	0.380000	NM_005668		0	6	6	0	435	424	0		1	0		0	0	99	0	0	0.962386	2.733852e-03	0	0	0	5	0	6	435
FAT2	2196	broad.mit.edu	37	5	150947407	150947407	+	Missense_Mutation	SNP	G	G	T	rs200331562		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr5:150947407G>T	ENST00000261800.5	-	1	1098	c.1086C>A	c.(1084-1086)ttC>ttA	p.F362L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	362					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGCCTTCTCGAATTTGAGGG	0.547																																						ENST00000261800.5	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.060000	0.077177	0.060000	0.060000																										0				196						c.(1084-1086)ttC>ttA		FAT atypical cadherin 2							75.0	81.0	79.0					5																	150947407		2203	4300	6503	SO:0001583	missense	2196	0	0					g.chr5:150947407G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1086C>A	chr5.hg19:g.150947407G>T	ENSP00000261800:p.Phe362Leu	0						p.F362L	NM_001447.2	NP_001438.1	0	0	0	2.008297	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	1	1098	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	0	1	hg19	c.1086C>A	CCDS4317.1	0	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097914	0.56075	.	.	ENSG00000086570	ENST00000261800	T	0.65178	-0.14	5.49	-3.3	0.05003	5.49	-3.3	0.05003	Cadherin (1);Cadherin-like (1);	0.000000	0.64402	D	0.000005	T	0.73697	0.3620	M	0.79123	2.44	0.49915	D	0.999835	D	0.76494	0.999	D	0.79108	0.992	T	0.73636	-0.3920	10	0.54805	T	0.06	.	12.1639	0.54119	0.6671:0.0:0.3329:0.0	.	362	Q9NYQ8	FAT2_HUMAN	L	362	ENSP00000261800:F362L	ENSP00000261800:F362L	F	-	3	2	2	FAT2	150927600	150927600	0.783000	0.28701	0.420000	0.26596	0.667000	0.39255	0.121000	0.15667	-0.646000	0.05452	-0.997000	0.02515	TTC	0.377635		TCGA-HZ-A8P0-01A-11D-A36O-08	0.547	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	0	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	1.960000	-3.015943	1	0.380000	NM_001447		0	6	6	0	466	462	0		1			0	0	83	0	0	0.964259	0	0	0	0	0	0	6	466
PTPRK	5796	broad.mit.edu	37	6	128294292	128294292	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr6:128294292C>A	ENST00000368215.3	-	29	4140	c.4141G>T	c.(4141-4143)Ggg>Tgg	p.G1381W	PTPRK_ENST00000368207.3_Missense_Mutation_p.G1414W|PTPRK_ENST00000368226.4_Missense_Mutation_p.G1382W|PTPRK_ENST00000368210.3_Missense_Mutation_p.G1400W|PTPRK_ENST00000532331.1_Missense_Mutation_p.G1404W|PTPRK_ENST00000368213.5_Missense_Mutation_p.G1388W|PTPRK_ENST00000368227.3_Missense_Mutation_p.G1399W			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1381	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CCACTTCGCCCGCCACCATTT	0.428																																						ENST00000368215.3	0.140000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.075828	0.060000	0.060000																									PTPRK/RSPO3(10)	0				72						c.(4141-4143)Ggg>Tgg		protein tyrosine phosphatase, receptor type, K							98.0	97.0	97.0					6																	128294292		2203	4300	6503	SO:0001583	missense	5796	0	0					g.chr6:128294292C>A	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.4141G>T	chr6.hg19:g.128294292C>A	ENSP00000357198:p.Gly1381Trp	0					PTPRK_ENST00000368227.3_Missense_Mutation_p.G1399W|PTPRK_ENST00000368226.4_Missense_Mutation_p.G1382W|PTPRK_ENST00000532331.1_Missense_Mutation_p.G1404W|PTPRK_ENST00000368213.5_Missense_Mutation_p.G1388W|PTPRK_ENST00000368207.3_Missense_Mutation_p.G1414W|PTPRK_ENST00000368210.3_Missense_Mutation_p.G1400W	p.G1381W			0	0	0	1.981112	Q15262	PTPRK_HUMAN		29	4140	-			B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	0	1	hg19	c.4141G>T		0	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517548	0.85495	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.52	5.52	0.82312	5.52	5.52	0.82312	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.71434	0.3339	H	0.98936	4.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.83626	0.0142	10	0.87932	D	0	.	19.7822	0.96420	0.0:1.0:0.0:0.0	.	1404;1388;1381;1382	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	W	1382;1399;1404;1388;1400;1381;1414	ENSP00000357209:G1382W;ENSP00000357210:G1399W;ENSP00000432973:G1404W;ENSP00000357196:G1388W;ENSP00000357193:G1400W;ENSP00000357198:G1381W;ENSP00000357190:G1414W	ENSP00000357190:G1414W	G	-	1	0	0	PTPRK	128335985	128335985	1.000000	0.71417	0.945000	0.38365	0.728000	0.41692	7.776000	0.85560	2.750000	0.94351	0.655000	0.94253	GGG	0.367992		TCGA-HZ-A8P0-01A-11D-A36O-08	0.428	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	97	1	1.960000	-1.822784	0	0.380000			0	6	6	0	467	313	0		1	0		0	0	131	0	0	0.897156	3.920894e-01	0	0	0	94	0	6	467
BRD2	6046	broad.mit.edu	37	6	32945220	32945220	+	Splice_Site	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr6:32945220G>A	ENST00000374825.4	+	8	2903	c.1202G>A	c.(1201-1203)cGg>cAg	p.R401Q	BRD2_ENST00000374831.4_Splice_Site_p.R401Q|BRD2_ENST00000449085.2_Splice_Site_p.R354Q|BRD2_ENST00000395287.1_Splice_Site_p.R401Q|BRD2_ENST00000395289.2_Splice_Site_p.R401Q|BRD2_ENST00000443797.2_Splice_Site_p.R281Q	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	401	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CTTCTGCAGCGGAAGATGGAG	0.527																																						ENST00000374825.4	0.100000	0	7.000000e-02	2.000000e-02	0.040000	0.051917	0.040000	0.040000																										0				5						c.(1201-1203)cGg>cAg		bromodomain containing 2							219.0	185.0	197.0					6																	32945220		1511	2709	4220	SO:0001630	splice_region_variant	6046	0	0					g.chr6:32945220G>A	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1201-1G>A	chr6.hg19:g.32945220G>A		0					BRD2_ENST00000395289.2_Splice_Site_p.R401Q|BRD2_ENST00000374831.4_Splice_Site_p.R401Q|BRD2_ENST00000443797.2_Splice_Site_p.R281Q|BRD2_ENST00000449085.2_Splice_Site_p.R354Q|BRD2_ENST00000395287.1_Splice_Site_p.R401Q	p.R401Q	NM_005104.3	NP_005095.1	0	0	0	1.972772	P25440	BRD2_HUMAN		8	2903	+			A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Splice_Site	SNP	ENST00000374825.4	0	1	hg19	c.1202G>A	CCDS4762.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.70|16.70	3.196084|3.196084	0.58126|0.58126	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|T;T;T;T;T;T	.|0.27402	.|1.67;1.67;1.67;1.67;1.67;1.67	5.25|5.25	5.25|5.25	0.73442|0.73442	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Bromodomain (5);Bromodomain, conserved site (1);	.|0.000000	.|0.45606	.|D	.|0.000343	T|T	0.06735|0.06735	0.0172|0.0172	N|N	0.16790|0.16790	0.44|0.44	0.58432|0.58432	D|D	0.999994|0.999994	.|P;B	.|0.38992	.|0.653;0.185	.|B;B	.|0.21708	.|0.036;0.012	T|T	0.13202|0.13202	-1.0518|-1.0518	5|10	.|0.33141	.|T	.|0.24	-13.4946|-13.4946	9.6958|9.6958	0.40156|0.40156	0.0911:0.0:0.9089:0.0|0.0911:0.0:0.9089:0.0	.|.	.|401;401	.|A2AAU0;P25440	.|.;BRD2_HUMAN	R|Q	407|401;401;401;281;401;354	.|ENSP00000363958:R401Q;ENSP00000363964:R401Q;ENSP00000378704:R401Q;ENSP00000413495:R281Q;ENSP00000378702:R401Q;ENSP00000409145:R354Q	.|ENSP00000363958:R401Q	G|R	+|+	1|2	0|0	0|0	BRD2|BRD2	33053198|33053198	33053198|33053198	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.760000|1.760000	0.38430|0.38430	2.730000|2.730000	0.93505|0.93505	0.643000|0.643000	0.83706|0.83706	GGA|CGG	0.365534		TCGA-HZ-A8P0-01A-11D-A36O-08	0.527	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2	0	0	1	2	2	2	2	0	0	0	0	163	163	163	162	1	1.960000	-2.025574	0	0.380000		Missense_Mutation	0	5	5	0	585	582	0		1	0		0	0	163	0	0	0.936940	6.299104e-01	0	0	0	231	0	5	585
KLHL31	401265	broad.mit.edu	37	6	53519025	53519025	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr6:53519025G>A	ENST00000407079.1	-	1	1045	c.1046C>T	c.(1045-1047)aCg>aTg	p.T349M	KLHL31_ENST00000370905.3_Missense_Mutation_p.T349M			Q9H511	KLH31_HUMAN	kelch-like family member 31	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					TGGCATTTCCGTAAGCTTGCT	0.483																																						ENST00000407079.1	0.150000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.083919	0.070000	0.070000																										0				20						c.(1045-1047)aCg>aTg		kelch-like family member 31							105.0	100.0	102.0					6																	53519025		2203	4300	6503	SO:0001583	missense	401265	0	0					g.chr6:53519025G>A		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1046C>T	chr6.hg19:g.53519025G>A	ENSP00000384644:p.Thr349Met	0					KLHL31_ENST00000370905.3_Missense_Mutation_p.T349M	p.T349M			0	0	0	1.981112	Q9H511	KLH31_HUMAN		1	1045	-	Lung NSC(77;0.0158)		A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	0	1	hg19	c.1046C>T	CCDS34478.1	0	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453374	0.63290	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.68025	-0.3;-0.3	5.25	5.25	0.73442	5.25	5.25	0.73442	Galactose oxidase, beta-propeller (1);	0.095468	0.64402	D	0.000001	T	0.75852	0.3906	M	0.82716	2.605	0.58432	D	0.999994	D	0.76494	0.999	P	0.57283	0.817	T	0.80621	-0.1301	10	0.87932	D	0	.	15.4902	0.75600	0.0:0.1482:0.8518:0.0	.	349	Q9H511	KLH31_HUMAN	M	349	ENSP00000359942:T349M;ENSP00000384644:T349M	ENSP00000359942:T349M	T	-	2	0	0	KLHL31	53626984	53626984	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	7.818000	0.86416	2.467000	0.83353	0.561000	0.74099	ACG	0.367992		TCGA-HZ-A8P0-01A-11D-A36O-08	0.483	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	0	0	1	2	2	2	2	0	0	0	0	101	101	101	99	1	1.960000	-2.509507	1	0.380000	NM_001003760		0	6	6	0	421	417	0		1	0		0	0	101	1	0	0.964195	3.035724e-04	0	0	0	2	0	6	421
TNFAIP3	7128	broad.mit.edu	37	6	138199962	138199962	+	Silent	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr6:138199962C>T	ENST00000237289.4	+	7	1446	c.1380C>T	c.(1378-1380)gcC>gcT	p.A460A		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	460	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.P450fs*21(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CTCATTCGGCCCCACCGACAG	0.642			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	ENST00000237289.4	0.980000	5.000000e-01	8.600000e-01	6.000000e-01	0.720000	0.737023	0.720000	0.720000				Rec	yes			Rec	yes		6	6q23	6q23	7128	D, N, F	"""tumor necrosis factor, alpha-induced protein 3"""				L	L			marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma		26	Whole gene deletion(25)|Deletion - Frameshift(1)	p.0?(25)|p.P450fs*21(1)	haematopoietic_and_lymphoid_tissue(26)	225						c.(1378-1380)gcC>gcT		tumor necrosis factor, alpha-induced protein 3							24.0	27.0	26.0					6																	138199962		2203	4300	6503	SO:0001819	synonymous_variant	7128	0	0					g.chr6:138199962C>T	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1380C>T	chr6.hg19:g.138199962C>T		0						p.A460A	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	0	0	0	1.981112	P21580	TNAP3_HUMAN		7	1446	+	Breast(32;0.135)|Colorectal(23;0.24)		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Silent	SNP	ENST00000237289.4	1	1	hg19	c.1380C>T	CCDS5187.1	0																																																																																								0.367992		TCGA-HZ-A8P0-01A-11D-A36O-08	0.642	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1	1	0	1	2	2	2	2	0	0	0	0	40	40	40	39	1	1.960000	-20.000000	1	0.380000			0	28	28	0	171	167	1		1	1		0	0	40	0	0	1.000000	9.121458e-01	0	2	0	25	0	28	171
RIMS2	9699	broad.mit.edu	37	8	105026833	105026833	+	Silent	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr8:105026833G>A	ENST00000436393.2	+	17	2785	c.2544G>A	c.(2542-2544)acG>acA	p.T848T	RIMS2_ENST00000406091.3_Silent_p.T1108T|RIMS2_ENST00000507740.1_Silent_p.T922T|RIMS2_ENST00000262231.10_Silent_p.T947T			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1170	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAAAGGGAACGTTGGATAGAA	0.438										HNSCC(12;0.0054)																												ENST00000436393.2	1.000000	8.200000e-01	1	9.400000e-01	0.990000	0.978832	0.990000	1.000000																										0				144						c.(2542-2544)acG>acA		regulating synaptic membrane exocytosis 2							72.0	74.0	74.0					8																	105026833		1895	4110	6005	SO:0001819	synonymous_variant	9699	0	0					g.chr8:105026833G>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2544G>A	chr8.hg19:g.105026833G>A		0	HNSCC(12;0.0054)				RIMS2_ENST00000507740.1_Silent_p.T922T|RIMS2_ENST00000406091.3_Silent_p.T1108T|RIMS2_ENST00000262231.10_Silent_p.T947T	p.T848T			1	2	3	2.024273	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)	17	2785	+			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	1	1	hg19	c.2544G>A		1																																																																																								0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.438	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.960000	-20.000000	1	0.380000	NM_001100117		0	48	48	0	186	184	0		1			0	0	48	0	0	1.000000	0	0	0	0	0	0	48	186
FAM83H	286077	broad.mit.edu	37	8	144812372	144812372	+	Silent	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr8:144812372C>T	ENST00000388913.3	-	2	506	c.381G>A	c.(379-381)caG>caA	p.Q127Q	MIR4664_ENST00000583819.1_RNA	NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	127					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGGGCGGTGGCTGCACCAAGG	0.642																																						ENST00000388913.3	1.000000	9.200000e-01	1	9.900000e-01	0.990000	0.995601	0.990000	1.000000																										0				21						c.(379-381)caG>caA		family with sequence similarity 83, member H							30.0	35.0	34.0					8																	144812372		2015	4157	6172	SO:0001819	synonymous_variant	286077	0	0					g.chr8:144812372C>T	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.381G>A	chr8.hg19:g.144812372C>T		0					MIR4664_ENST00000583819.1_RNA	p.Q127Q	NM_198488.3	NP_940890	1	2	3	2.024273	Q6ZRV2	FA83H_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)	2	506	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	1	1	hg19	c.381G>A	CCDS6410.2	1																																																																																								0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.642	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	1	0	1	2	2	2	2	0	0	0	0	44	44	44	43	1	1.960000	-20.000000	1	0.380000	NM_198488		0	39	38	0	126	125	1		1	1		0	0	44	0	0	1.000000	9.997998e-01	0	18	0	28	0	39	126
ZDHHC2	51201	broad.mit.edu	37	8	17067927	17067927	+	Silent	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr8:17067927C>T	ENST00000262096.8	+	10	1583	c.888C>T	c.(886-888)tgC>tgT	p.C296C		NM_016353.4	NP_057437.1	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	296					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|recycling endosome membrane (GO:0055038)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|pancreas(1)|stomach(1)	8				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		TTCCAACTTGCCTTGTTAACC	0.368																																						ENST00000262096.8	0.310000	4.000000e-02	2.200000e-01	8.000000e-02	0.140000	0.155412	0.140000	0.120000																										0				8						c.(886-888)tgC>tgT		zinc finger, DHHC-type containing 2							79.0	74.0	75.0					8																	17067927		1833	4105	5938	SO:0001819	synonymous_variant	51201	0	0					g.chr8:17067927C>T	AB023584	CCDS47810.1	8p22	2008-05-15			ENSG00000104219	ENSG00000104219		"""Zinc fingers, DHHC-type"""	18469	protein-coding gene	gene with protein product						10918388	Standard	NM_016353		Approved	ZNF372	uc003wxe.3	Q9UIJ5	OTTHUMG00000163860	ENST00000262096.8:c.888C>T	chr8.hg19:g.17067927C>T		0						p.C296C	NM_016353.4	NP_057437.1	1	2	3	2.024273	Q9UIJ5	ZDHC2_HUMAN		10	1583	+			D3DSP5	Silent	SNP	ENST00000262096.8	0	1	hg19	c.888C>T	CCDS47810.1	0																																																																																								0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.368	ZDHHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376014.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.960000	-3.214261	1	0.380000	NM_016353		0	4	4	0	162	161	0		1	0		0	0	46	0	0	0.889923	6.644295e-01	0	0	0	85	0	4	162
ZNF7	7553	broad.mit.edu	37	8	146067242	146067242	+	Silent	SNP	C	C	T	rs376157890		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr8:146067242C>T	ENST00000528372.1	+	5	990	c.750C>T	c.(748-750)taC>taT	p.Y250Y	ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000529819.1_3'UTR|ZNF7_ENST00000446747.2_Silent_p.Y261Y|ZNF7_ENST00000544249.1_Silent_p.Y154Y|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000325241.6_Silent_p.Y250Y			P17097	ZNF7_HUMAN	zinc finger protein 7	250					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AGAAGCCGTACGAATGTGCAG	0.438																																						ENST00000528372.1	1.000000	8.600000e-01	1	9.500000e-01	0.990000	0.983633	0.990000	1.000000																										0				25						c.(748-750)taC>taT		zinc finger protein 7		C		1,4405	2.1+/-5.4	0,1,2202	79.0	79.0	79.0		750	-1.4	0.0	8		79	0,8600		0,0,4300	no	coding-synonymous	ZNF7	NM_003416.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		250/687	146067242	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7553	3	121412	38				g.chr8:146067242C>T	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.750C>T	chr8.hg19:g.146067242C>T		0					ZNF7_ENST00000446747.2_Silent_p.Y261Y|ZNF7_ENST00000325241.6_Silent_p.Y250Y|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000544249.1_Silent_p.Y154Y|ZNF7_ENST00000529819.1_3'UTR|ZNF7_ENST00000525266.1_Intron	p.Y250Y			1	2	3	2.068953	P17097	ZNF7_HUMAN	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	5	990	+	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	B4DT08|D3DWN6|P17015|Q8N8Y4	Silent	SNP	ENST00000528372.1	1	1	hg19	c.750C>T	CCDS6435.1	1																																																																																								0.389283		TCGA-HZ-A8P0-01A-11D-A36O-08	0.438	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.960000	-20.000000	1	0.380000	NM_003416		0	81	81	0	328	326	0		1	1		0	0	91	0	0	1.000000	9.782079e-01	0	3	0	24	0	81	328
FOXD4	2298	broad.mit.edu	37	9	117739	117739	+	Silent	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:117739G>T	ENST00000382500.2	-	1	678	c.381C>A	c.(379-381)ctC>ctA	p.L127L		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	127					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGATGCCGCTGAGCGTGAGGC	0.637																																						ENST00000382500.2			0	0																														0				14						c.(379-381)ctC>ctA		forkhead box D4							58.0	88.0	78.0					9																	117739		2136	4237	6373	SO:0001819	synonymous_variant	2298	0	0					g.chr9:117739G>T	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.381C>A	chr9.hg19:g.117739G>T								p.L127L	NM_207305.4	NP_997188.2					Q12950	FOXD4_HUMAN	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	1	678	-	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Silent	SNP	ENST00000382500.2	0	1	hg19	c.381C>A	CCDS34975.1																																																																																											TCGA-HZ-A8P0-01A-11D-A36O-08	0.637	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	0	0	1	2	2	2	2	0	0	0	0	365	365	365	406	1	1.960000	-2.352727	0	0.380000	NM_207305		0	9	8	0	858	655	0		1			0	0	365	0	0	0.982023	0	0	0	0	0	0	9	858
TNC	3371	broad.mit.edu	37	9	117846677	117846677	+	Missense_Mutation	SNP	G	G	A	rs149181557	byFrequency	TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:117846677G>A	ENST00000350763.4	-	4	2353	c.1942C>T	c.(1942-1944)Cgg>Tgg	p.R648W	TNC_ENST00000346706.3_Missense_Mutation_p.R648W|TNC_ENST00000423613.2_Missense_Mutation_p.R648W|TNC_ENST00000542877.1_Missense_Mutation_p.R648W|TNC_ENST00000535648.1_Missense_Mutation_p.R648W|TNC_ENST00000340094.3_Missense_Mutation_p.R648W|TNC_ENST00000537320.1_Missense_Mutation_p.R648W|TNC_ENST00000345230.3_Missense_Mutation_p.R648W|TNC_ENST00000341037.4_Missense_Mutation_p.R648W	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	648	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TCTGTGACCCGCATCTCATTG	0.562													G|||	2	0.000399361	0.0	0.0	5008	,	,		19774	0.0		0.002	False		,,,				2504	0.0					ENST00000350763.4	1.000000	7.800000e-01	1	8.800000e-01	0.990000	0.956309	0.990000	1.000000																										0				120						c.(1942-1944)Cgg>Tgg		tenascin C		G	TRP/ARG	0,4406		0,0,2203	161.0	145.0	150.0		1942	3.9	1.0	9	dbSNP_134	150	2,8598	2.2+/-6.3	0,2,4298	yes	missense	TNC	NM_002160.3	101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	648/2202	117846677	2,13004	2203	4300	6503	SO:0001583	missense	3371	11	121412	45				g.chr9:117846677G>A		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1942C>T	chr9.hg19:g.117846677G>A	ENSP00000265131:p.Arg648Trp	0					TNC_ENST00000535648.1_Missense_Mutation_p.R648W|TNC_ENST00000346706.3_Missense_Mutation_p.R648W|TNC_ENST00000345230.3_Missense_Mutation_p.R648W|TNC_ENST00000423613.2_Missense_Mutation_p.R648W|TNC_ENST00000340094.3_Missense_Mutation_p.R648W|TNC_ENST00000341037.4_Missense_Mutation_p.R648W|TNC_ENST00000542877.1_Missense_Mutation_p.R648W|TNC_ENST00000537320.1_Missense_Mutation_p.R648W	p.R648W	NM_002160.3	NP_002151.2	1	2	3	2.017164	P24821	TENA_HUMAN		4	2353	-			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	1	1	hg19	c.1942C>T	CCDS6811.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	19.75	3.885200	0.72410	0.0	2.33E-4	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.57595	3.61;0.39;3.61;0.39;0.39;0.39;0.39;0.39;0.39	5.93	3.91	0.45181	5.93	3.91	0.45181	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.343669	0.29459	N	0.012097	T	0.67420	0.2891	M	0.64404	1.975	0.38978	D	0.958897	D;D	0.89917	1.0;1.0	D;D	0.79784	0.987;0.993	T	0.72228	-0.4354	10	0.66056	D	0.02	.	12.0794	0.53662	0.0:0.1008:0.6328:0.2664	.	648;648	E9PC84;P24821	.;TENA_HUMAN	W	648	ENSP00000344400:R648W;ENSP00000438152:R648W;ENSP00000344555:R648W;ENSP00000345861:R648W;ENSP00000265131:R648W;ENSP00000339553:R648W;ENSP00000411406:R648W;ENSP00000443478:R648W;ENSP00000442242:R648W	ENSP00000344400:R648W	R	-	1	2	2	TNC	116886498	116886498	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.409000	0.34680	1.470000	0.48102	0.655000	0.94253	CGG	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.562	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	1	0	1	2	2	2	6	0	0	0	0	104	104	104	104	1	1.960000	-3.094673	1	0.380000	NM_002160		0	63	62	0	270	267	1		1	0	1	0	1	104	1206	0	1.000000	8.570096e-01	1	0	199	17	1153	63	270
OR1J2	26740	broad.mit.edu	37	9	125273336	125273336	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:125273336C>T	ENST00000335302.5	+	1	256	c.256C>T	c.(256-258)Cgg>Tgg	p.R86W		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						GATGGACATGCGGACTAAGTA	0.428																																						ENST00000335302.5	0.130000	1.000000e-02	9.000000e-02	3.000000e-02	0.060000	0.068554	0.060000	0.060000																										0				26						c.(256-258)Cgg>Tgg		olfactory receptor, family 1, subfamily J, member 2							192.0	157.0	169.0					9																	125273336		2203	4300	6503	SO:0001583	missense	26740	1	121374	20				g.chr9:125273336C>T		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.256C>T	chr9.hg19:g.125273336C>T	ENSP00000335575:p.Arg86Trp	0						p.R86W	NM_054107.1	NP_473448.1	1	2	3	2.017164	Q8NGS2	OR1J2_HUMAN		1	256	+			A3KFL9|Q6IF14|Q96R90|Q9NZP1	Missense_Mutation	SNP	ENST00000335302.5	0	1	hg19	c.256C>T	CCDS35121.1	0	.	.	.	.	.	.	.	.	.	.	C	11.47	1.649512	0.29336	.	.	ENSG00000197233	ENST00000335302;ENST00000444856	T	0.01963	4.53	4.71	2.82	0.32997	4.71	2.82	0.32997	GPCR, rhodopsin-like superfamily (1);	0.410669	0.17409	U	0.175258	T	0.01254	0.0041	N	0.02830	-0.485	0.20821	N	0.999849	B	0.02656	0.0	B	0.04013	0.001	T	0.46978	-0.9152	10	0.54805	T	0.06	.	8.7949	0.34874	0.0:0.7496:0.0:0.2504	.	86	Q8NGS2	OR1J2_HUMAN	W	86	ENSP00000335575:R86W	ENSP00000335575:R86W	R	+	1	2	2	OR1J2	124313157	124313157	0.000000	0.05858	0.273000	0.24645	0.016000	0.09150	-1.634000	0.02020	1.232000	0.43678	0.650000	0.86243	CGG	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.428	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053932.1	0	0	1	2	15	2	2	1	1	1	1	135	135	135	135	1	1.960000	-2.002432	0	0.380000			0	6	6	0	529	524	0		0			1	0	135	0	0	0.035303	0	0	0	0	0	0	6	529
USP20	10868	broad.mit.edu	37	9	132623286	132623286	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:132623286C>A	ENST00000315480.4	+	7	559	c.401C>A	c.(400-402)tCa>tAa	p.S134*	USP20_ENST00000372429.3_Nonsense_Mutation_p.S134*|USP20_ENST00000358355.1_Nonsense_Mutation_p.S134*			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	134					endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GAGTCTGAGTCAGAGGACGAT	0.577																																						ENST00000315480.4	0.130000	2.000000e-02	9.000000e-02	3.000000e-02	0.060000	0.069569	0.060000	0.060000																										0				11						c.(400-402)tCa>tAa		ubiquitin specific peptidase 20							115.0	117.0	116.0					9																	132623286		1918	4134	6052	SO:0001587	stop_gained	10868	0	0					g.chr9:132623286C>A	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.401C>A	chr9.hg19:g.132623286C>A	ENSP00000313811:p.Ser134*	0					USP20_ENST00000372429.3_Nonsense_Mutation_p.S134*|USP20_ENST00000358355.1_Nonsense_Mutation_p.S134*	p.S134*			1	2	3	2.017164	Q9Y2K6	UBP20_HUMAN		7	559	+		Ovarian(14;0.00556)	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Nonsense_Mutation	SNP	ENST00000315480.4	0	1	hg19	c.401C>A	CCDS43892.1	0	.	.	.	.	.	.	.	.	.	.	C	38	6.955403	0.97960	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	.	.	.	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.893214	0.09824	N	0.751070	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	14.3494	0.66691	0.0:0.8522:0.1478:0.0	.	.	.	.	X	134	.	ENSP00000313811:S134X	S	+	2	0	0	USP20	131663107	131663107	1.000000	0.71417	0.996000	0.52242	0.842000	0.47809	4.459000	0.60102	2.665000	0.90641	0.561000	0.74099	TCA	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.577	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2	0	0	1	2	2	2	2	0	0	0	0	174	174	174	174	1	1.960000	-2.745178	1	0.380000			0	7	7	0	596	590	0		1	0		0	0	174	0	0	0.979995	1.162114e-02	0	0	0	12	0	7	596
CDKN2A	1029	broad.mit.edu	37	9	21971186	21971186	+	Nonsense_Mutation	SNP	G	G	A	rs121913387		TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:21971186G>A	ENST00000304494.5	-	2	442	c.172C>T	c.(172-174)Cga>Tga	p.R58*	CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P72L|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P72L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R7*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P113L|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R58*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	58			R -> Q (in dbSNP:rs36204273).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R58*(78)|p.?(45)|p.M53_R58del(3)|p.P113L(3)|p.R58fs*59(2)|p.M54fs*61(2)|p.R58fs*88(2)|p.0(1)|p.V28_V51del(1)|p.A57_R58>V*(1)|p.P113fs*>61(1)|p.R58fs*62(1)|p.R58fs*61(1)|p.G55fs*86(1)|p.R58R(1)|p.A57fs*85(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TCCGCCACTCGGGCGCTGCCC	0.677		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	0.850000	2.300000e-01	6.900000e-01	3.500000e-01	0.500000	0.524357	0.500000	0.480000		17																								1459	Whole gene deletion(1316)|Substitution - Nonsense(78)|Unknown(45)|Deletion - Frameshift(10)|Deletion - In frame(4)|Substitution - Missense(3)|Insertion - Frameshift(1)|Substitution - coding silent(1)|Complex - compound substitution(1)	p.0?(1315)|p.R58*(78)|p.?(45)|p.M53_R58del(3)|p.P113L(3)|p.R58fs*59(2)|p.M54fs*61(2)|p.R58fs*88(2)|p.0(1)|p.V28_V51del(1)|p.A57_R58>V*(1)|p.P113fs*>61(1)|p.R58fs*62(1)|p.R58fs*61(1)|p.G55fs*86(1)|p.R58R(1)|p.A57fs*85(1)	haematopoietic_and_lymphoid_tissue(284)|skin(201)|central_nervous_system(167)|lung(154)|urinary_tract(94)|upper_aerodigestive_tract(78)|bone(74)|oesophagus(65)|soft_tissue(58)|pleura(51)|ovary(38)|pancreas(37)|kidney(32)|breast(32)|stomach(14)|thyroid(13)|NS(12)|biliary_tract(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(4)|thymus(4)|endometrium(3)|vulva(2)|prostate(2)|cervix(1)	4199	GRCh37	CM940227	CDKN2A	M	rs121913387	c.(172-174)Cga>Tga		cyclin-dependent kinase inhibitor 2A							7.0	9.0	8.0					9																	21971186		2034	4092	6126	SO:0001587	stop_gained	1029	0	0					g.chr9:21971186G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.172C>T	chr9.hg19:g.21971186G>A	ENSP00000307101:p.Arg58*	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.P72L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P72L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P113L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R58*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R7*	p.R58*	NM_000077.4	NP_000068.1	0	1	1	1.661914	P42771	CD2A1_HUMAN		2	442	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.172C>T	CCDS6510.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.1|28.1	4.893482|4.893482	0.91889|0.91889	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|.	0.75367|.	-0.93;-0.89|.	5.79|5.79	2.71|2.71	0.32032|0.32032	5.79|5.79	2.71|2.71	0.32032|0.32032	.|.	0.409080|.	0.18162|.	N|.	0.149742|.	T|.	0.29288|.	0.0729|.	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	P|.	0.44006|.	0.824|.	B|.	0.33121|.	0.158|.	T|.	0.21381|.	-1.0247|.	10|.	0.72032|0.13470	D|T	0.01|0.59	-3.0019|-3.0019	9.6681|9.6681	0.39996|0.39996	0.0:0.1288:0.474:0.3972|0.0:0.1288:0.474:0.3972	.|.	113|.	Q8N726|.	CD2A2_HUMAN|.	L|X	113;72|58	ENSP00000355153:P113L;ENSP00000432664:P72L|.	ENSP00000355153:P113L|ENSP00000307101:R58X	P|R	-|-	2|1	0|2	0|2	CDKN2A|CDKN2A	21961186|21961186	21961186|21961186	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.277000|0.277000	0.26821|0.26821	0.096000|0.096000	0.15147|0.15147	0.738000|0.738000	0.32606|0.32606	0.555000|0.555000	0.69702|0.69702	CCG|CGA	0.234568		TCGA-HZ-A8P0-01A-11D-A36O-08	0.677	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	1.960000	-2.996906	1	0.380000	NM_000077		0	7	7	0	52	52	0		1	1	1	0	0	11	17	0	0.982864	7.373807e-01	7.759876e-01	19	9	2	14	7	52
SPTLC1	10558	broad.mit.edu	37	9	94812277	94812277	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:94812277G>T	ENST00000262554.2	-	9	858	c.853C>A	c.(853-855)Cat>Aat	p.H285N		NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	285					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	CCTCGGCCATGCTCTCCTAGG	0.383																																						ENST00000262554.2	0.110000	2.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.064605	0.050000	0.060000																										0				14						c.(853-855)Cat>Aat		serine palmitoyltransferase, long chain base subunit 1	L-Serine(DB00133)						162.0	152.0	155.0					9																	94812277		2203	4300	6503	SO:0001583	missense	10558	0	0					g.chr9:94812277G>T	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.853C>A	chr9.hg19:g.94812277G>T	ENSP00000262554:p.His285Asn	0						p.H285N	NM_006415.2	NP_006406.1	0	0	0	2.008917	O15269	SPTC1_HUMAN		9	858	-			A8K681|Q5VWB4|Q96IX6	Missense_Mutation	SNP	ENST00000262554.2	0	1	hg19	c.853C>A	CCDS6692.1	0	.	.	.	.	.	.	.	.	.	.	G	4.415	0.076812	0.08485	.	.	ENSG00000090054	ENST00000262554	D	0.94687	-3.49	4.66	3.73	0.42828	4.66	3.73	0.42828	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.104209	0.64402	D	0.000004	D	0.89181	0.6642	L	0.31120	0.905	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.12837	0.006;0.008	D	0.84518	0.0626	10	0.20519	T	0.43	-8.1887	13.3483	0.60587	0.0782:0.0:0.9218:0.0	.	285;285	Q6NUL7;O15269	.;SPTC1_HUMAN	N	285	ENSP00000262554:H285N	ENSP00000262554:H285N	H	-	1	0	0	SPTLC1	93852098	93852098	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.383000	0.59600	2.411000	0.81874	0.551000	0.68910	CAT	0.377635		TCGA-HZ-A8P0-01A-11D-A36O-08	0.383	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	0	0	1	2	2	2	2	0	0	0	0	138	138	138	136	1	1.960000	-2.664656	1	0.380000	NM_006415		0	7	7	0	639	633	0		1	0		0	0	138	0	0	0.980027	1.819409e-01	0	0	0	62	0	7	639
CACNA1B	774	broad.mit.edu	37	9	140968501	140968501	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A8P0-01A-11D-A36O-08	TCGA-HZ-A8P0-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	df4c13c2-bf8e-4723-8a7c-341a512c02b7	041a6dc6-65d1-43d9-adb2-89c69d4b3e65	g.chr9:140968501G>A	ENST00000371372.1	+	34	4985	c.4840G>A	c.(4840-4842)Gcc>Acc	p.A1614T	CACNA1B_ENST00000277549.5_Missense_Mutation_p.A808T|CACNA1B_ENST00000371363.1_Missense_Mutation_p.A1612T|CACNA1B_ENST00000371365.2_5'Flank|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A1615T|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A1614T|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A1613T	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1614					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.A1614S(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTCATCTACGCCATCATCGG	0.622																																						ENST00000371372.1	1.000000	7.300000e-01	1	8.100000e-01	0.900000	0.900328	0.900000	1.000000																										1	Substitution - Missense(1)	p.A1614S(1)	NS(1)	80						c.(4840-4842)Gcc>Acc		calcium channel, voltage-dependent, N type, alpha 1B subunit	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)						116.0	122.0	120.0					9																	140968501		2195	4298	6493	SO:0001583	missense	774	1	121378	33				g.chr9:140968501G>A	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4840G>A	chr9.hg19:g.140968501G>A	ENSP00000360423:p.Ala1614Thr	0					CACNA1B_ENST00000371365.2_5'Flank|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A1614T|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A808T|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A1615T|CACNA1B_ENST00000371363.1_Missense_Mutation_p.A1612T|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A1613T	p.A1614T	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	1	2	3	2.017164	Q00975	CAC1B_HUMAN		34	4985	+	all_cancers(76;0.166)		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	1	1	hg19	c.4840G>A	CCDS59522.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.943318	0.97128	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91;-4.91;-4.91	5.18	5.18	0.71444	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.99251	0.9739	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.99084	1.0838	10	0.87932	D	0	.	19.0507	0.93043	0.0:0.0:1.0:0.0	.	1613;1612	B1AQK7;B1AQK6	.;.	T	1614;1614;808;1612;1613;1615	ENSP00000360423:A1614T;ENSP00000277551:A1614T;ENSP00000277549:A808T;ENSP00000360414:A1612T;ENSP00000360408:A1613T;ENSP00000360406:A1615T	ENSP00000277549:A808T	A	+	1	0	0	CACNA1B	140088322	140088322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.624000	0.98398	2.584000	0.87258	0.561000	0.74099	GCC	0.381176		TCGA-HZ-A8P0-01A-11D-A36O-08	0.622	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	1	0	1	2	2	2	2	0	0	0	0	158	158	158	155	1	1.960000	-3.345227	1	0.380000	NM_000718		0	84	83	0	406	402	1		1			0	0	158	0	0	1.000000	0	0	0	0	0	0	84	406
