#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TFAP2C	7022	broad.mit.edu	37	20	55212855	55212856	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr20:55212855_55212856delCA	ENST00000201031.2	+	7	1382_1383	c.1139_1140delCA	c.(1138-1140)ccafs	p.P380fs	TFAP2C_ENST00000544508.1_Frame_Shift_Del_p.P211fs	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	380	H-S-H (helix-span-helix), dimerization.				cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			AGGCTCGCCCCAGTCTTGGAGA	0.55																																						ENST00000201031.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999876	0.990000	1.000000																										0				13						c.(1138-1140)ccafs		transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)																																				SO:0001589	frameshift_variant	7022	0	0					g.chr20:55212855_55212856delCA		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.1139_1140delCA	chr20.hg19:g.55212855_55212856delCA	ENSP00000201031:p.Pro380fs	1					TFAP2C_ENST00000544508.1_Frame_Shift_Del_p.P211fs	p.P380fs	NM_003222.3	NP_003213.1	3	4	7	2.450645	Q92754	AP2C_HUMAN	Colorectal(105;0.229)	7	1382_1383	+			B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Frame_Shift_Del	DEL	ENST00000201031.2	1	1	hg19	c.1139_1140delCA	CCDS13454.1	1																																																																																								0.715808		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.550	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079823.2	1	0	1		2	2		0		0	0	81		81	79	1	3.450000	-2.687192	1	0.520000	NM_003222			116	113		486	471	0		1	0	0	0	0	81	0		1	9.850540e-02	0	0	0	3	0	116	486
KIF1A	547	broad.mit.edu	37	2	241700765	241700776	+	In_Frame_Del	DEL	CCAGCTCACACT	CCAGCTCACACT	-			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:241700765_241700776delCCAGCTCACACT	ENST00000320389.7	-	23	2266_2277	c.2108_2119delAGTGTGAGCTGG	c.(2107-2121)gagtgtgagctggcg>gcg	p.ECEL703del	KIF1A_ENST00000498729.2_In_Frame_Del_p.ECEL712del	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	703					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GCCCAGAGCGCCAGCTCACACTCCCGCTCTGT	0.632																																						ENST00000320389.7	1.000000	5.800000e-01	1.000000	0.710000	0.870000	0.861717	0.870000	1.000000																										0				66						c.(2107-2121)gagtgtgagctggcg>gcg		kinesin family member 1A																																				SO:0001651	inframe_deletion	547	0	0					g.chr2:241700765_241700776delCCAGCTCACACT	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2108_2119delAGTGTGAGCTGG	chr2.hg19:g.241700765_241700776delCCAGCTCACACT	ENSP00000322791:p.Glu703_Leu706del	1					KIF1A_ENST00000498729.2_In_Frame_Del_p.ECEL712del	p.ECEL703del	NM_004321.6	NP_004312.2	2	3	5	2.294524	Q12756	KIF1A_HUMAN		23	2266_2277	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	In_Frame_Del	DEL	ENST00000320389.7	0	1	hg19	c.2108_2119delAGTGTGAGCTGG	CCDS46561.1	1																																																																																								0.694151		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.632	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	1	0	1		2	2		0		0	0	23		23	22	1	3.450000	-20.000000	1	0.520000	NM_138483			29	37		184	185	0		1	0	0	0	0	23	0		1	2.002584e-02	0	0	0	2	0	29	184
CFAP36	112942	broad.mit.edu	37	2	55772051	55772052	+	Frame_Shift_Del	DEL	AG	AG	-	rs373330967		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			AG	-	AG	AG		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:55772051_55772052delAG	ENST00000349456.4	+	10	1084_1085	c.936_937delAG	c.(934-939)acagagfs	p.E313fs	CCDC104_ENST00000339012.3_Frame_Shift_Del_p.E338fs|CCDC104_ENST00000407816.3_Frame_Shift_Del_p.E284fs			Q96G28	CFA36_HUMAN		313										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGGAAATGACAGAGAAACCAGA	0.332																																						ENST00000349456.4	1.000000	2.100000e-01	1.000000	0.300000	0.440000	0.552407	0.440000	0.390000																										0				14						c.(934-939)acagagfs																																						SO:0001589	frameshift_variant	0	0	0					g.chr2:55772051_55772052delAG																												ENST00000349456.4:c.936_937delAG	chr2.hg19:g.55772053_55772054delAG	ENSP00000295117:p.Glu313fs	1					CCDC104_ENST00000407816.3_Frame_Shift_Del_p.E284fs|CCDC104_ENST00000339012.3_Frame_Shift_Del_p.E338fs	p.E313fs			3	4	7	2.336558	Q96G28	CFA36_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)	10	1084_1085	+			Q53SF0|Q53ST9|Q6UY34	Frame_Shift_Del	DEL	ENST00000349456.4	0	1	hg19	c.936_937delAG	CCDS1854.2	0																																																																																								0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.332	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319610.2	1	0	0		2	2		0		0	0	22		22	22	1	3.450000	-3.146440	1	0.520000				11	11		168	168	0		1	1	0	0	0	22	0		9.984974e-01	9.999847e-01	0	30	0	324	0	11	168
WTAP	9589	broad.mit.edu	37	6	160163179	160163180	+	Splice_Site	INS	-	-	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			-	T	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr6:160163179_160163180insT	ENST00000358372.4	+	4	1902		c.e4+1		SOD2_ENST00000546087.1_Intron|WTAP_ENST00000337387.4_Splice_Site	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein						cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		GATCTTAACTGTAAGTTTGAGT	0.282																																						ENST00000358372.4	1.000000	4.300000e-01	0.850000	0.510000	0.620000	0.667416	0.620000	0.590000																										0				18						c.e4+1		Wilms tumor 1 associated protein																																				SO:0001630	splice_region_variant	9589	0	0					g.chr6:160163179_160163180insT	AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.145+1->T	chr6.hg19:g.160163180_160163180dupT		0					SOD2_ENST00000546087.1_Intron|WTAP_ENST00000337387.4_Splice_Site		NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	2	2	4	2.056728	Q15007	FL2D_HUMAN		4	1902	+		Breast(66;0.000776)|Ovarian(120;0.0303)	Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Splice_Site	INS	ENST00000358372.4	0	1	hg19		CCDS5266.1	0																																																																																								0.661017		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.282	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042905.1	1	0	1		2	2		0		0	0	71		71	70	1	3.450000	-20.000000	1	0.520000	NM_152857	Intron		34	34		277	275	0		1	0	0	0	0	71	0		1	1	0	0	0	246	0	34	277
CUBN	8029	broad.mit.edu	37	10	16877170	16877170	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr10:16877170G>A	ENST00000377833.4	-	64	10270	c.10205C>T	c.(10204-10206)gCa>gTa	p.A3402V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3402	CUB 26. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTTGCCAAATGCCTTGTGATA	0.438																																						ENST00000377833.4	1.000000	5.000000e-01	0.830000	0.580000	0.680000	0.711963	0.680000	0.670000																										0				241						c.(10204-10206)gCa>gTa		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						131.0	118.0	123.0					10																	16877170		2203	4300	6503	SO:0001583	missense	8029	2	121412	31				g.chr10:16877170G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10205C>T	chr10.hg19:g.16877170G>A	ENSP00000367064:p.Ala3402Val	1						p.A3402V	NM_001081.3	NP_001072.2	2	2	4	2.106617	O60494	CUBN_HUMAN		64	10270	-			B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	1	1	hg19	c.10205C>T	CCDS7113.1	0	.	.	.	.	.	.	.	.	.	.	G	6.678	0.493742	0.12702	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.19105	2.17	4.84	2.92	0.33932	4.84	2.92	0.33932	CUB (5);	0.738516	0.11552	N	0.552718	T	0.24236	0.0587	L	0.47716	1.5	0.24037	N	0.996099	P	0.40360	0.714	B	0.43990	0.438	T	0.10291	-1.0636	10	0.30854	T	0.27	.	11.3802	0.49752	0.0:0.1371:0.7202:0.1427	.	3402	O60494	CUBN_HUMAN	V	3402;243	ENSP00000367064:A3402V	ENSP00000367064:A3402V	A	-	2	0	0	CUBN	16917176	16917176	0.660000	0.27420	0.004000	0.12327	0.008000	0.06430	2.533000	0.45667	0.593000	0.29745	-0.314000	0.08810	GCA	0.669513		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	0	0	1		2	2	2	0		0	0	76		76	73	1	3.450000	-3.318805	1	0.520000	NM_001081			44	43		324	322	1		1	0		0	0	76	0		1	0	0	0	0	1	0	44	324
KRTAP5-3	387266	broad.mit.edu	37	11	1629414	1629414	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:1629414C>T	ENST00000399685.1	-	1	279	c.202G>A	c.(202-204)Ggc>Agc	p.G68S		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	68	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		CCACAAGAGCCACAGACCCCC	0.667																																						ENST00000399685.1	1.000000	1.900000e-01	1.000000	0.240000	0.300000	0.458100	0.300000	0.280000																										0				8						c.(202-204)Ggc>Agc		keratin associated protein 5-3							56.0	75.0	69.0					11																	1629414		2192	4296	6488	SO:0001583	missense	387266	0	0					g.chr11:1629414C>T	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.202G>A	chr11.hg19:g.1629414C>T	ENSP00000382592:p.Gly68Ser	1						p.G68S	NM_001012708.2	NP_001012726.1	1	2	3	1.531864	Q6L8H2	KRA53_HUMAN		1	279	-		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	Q6PL44|Q701N3	Missense_Mutation	SNP	ENST00000399685.1	1	1	hg19	c.202G>A	CCDS41591.1	0	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.519678	0.00967	.	.	ENSG00000196224	ENST00000399685	T	0.01548	4.78	3.39	3.39	0.38822	3.39	3.39	0.38822	.	.	.	.	.	T	0.03564	0.0102	M	0.66439	2.03	0.20975	N	0.999817	P	0.46142	0.873	P	0.46452	0.517	T	0.17653	-1.0362	9	0.06757	T	0.87	.	12.6532	0.56774	0.0:1.0:0.0:0.0	.	68	Q6L8H2	KRA53_HUMAN	S	68	ENSP00000382592:G68S	ENSP00000382592:G68S	G	-	1	0	0	KRTAP5-3	1585990	1585990	0.942000	0.31987	0.997000	0.53966	0.006000	0.05464	0.591000	0.23969	1.616000	0.50265	0.289000	0.19496	GGC	0.583839		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.667	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1	1	0	1		2	2	2	0		0	0	99		99	96	1	3.450000	-7.318248	1	0.520000				31	30		452	425	0		1			0	0	99	0		1	0	0	0	0	0	0	31	452
OSBPL5	114879	broad.mit.edu	37	11	3129166	3129166	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:3129166C>T	ENST00000263650.7	-	8	860	c.701G>A	c.(700-702)tGg>tAg	p.W234*	OSBPL5_ENST00000389989.3_Nonsense_Mutation_p.W166*|OSBPL5_ENST00000348039.5_Nonsense_Mutation_p.W166*|OSBPL5_ENST00000525498.1_Nonsense_Mutation_p.W145*|OSBPL5_ENST00000542243.1_Intron	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	234	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GGCGTCCAGCCAGCAGCGACC	0.697																																						ENST00000263650.7	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				25						c.(700-702)tGg>tAg		oxysterol binding protein-like 5							28.0	34.0	32.0					11																	3129166		2201	4294	6495	SO:0001587	stop_gained	114879	0	0					g.chr11:3129166C>T	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.701G>A	chr11.hg19:g.3129166C>T	ENSP00000263650:p.Trp234*	1					OSBPL5_ENST00000525498.1_Nonsense_Mutation_p.W145*|OSBPL5_ENST00000348039.5_Nonsense_Mutation_p.W166*|OSBPL5_ENST00000542243.1_Intron|OSBPL5_ENST00000389989.3_Nonsense_Mutation_p.W166*	p.W234*	NM_020896.3	NP_065947.1	1	2	3	1.845570	Q9H0X9	OSBL5_HUMAN		8	860	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Nonsense_Mutation	SNP	ENST00000263650.7	0	1	hg19	c.701G>A	CCDS31344.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989428	0.74589	.	.	ENSG00000021762	ENST00000263650;ENST00000389989;ENST00000525498;ENST00000348039	.	.	.	4.2	4.2	0.49525	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0922	16.7016	0.85350	0.0:1.0:0.0:0.0	.	.	.	.	X	234;166;145;166	.	ENSP00000263650:W234X	W	-	2	0	0	OSBPL5	3085742	3085742	1.000000	0.71417	1.000000	0.80357	0.254000	0.26022	7.116000	0.77119	2.156000	0.67533	0.455000	0.32223	TGG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.697	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2	1	0	1		2	2	2	0		0	0	11		11	11	1	3.450000	-20.000000	1	0.520000				43	43		60	58	1		1	0		0	0	11	0		1	9.984169e-01	0	0	0	18	0	43	60
NELL1	4745	broad.mit.edu	37	11	21556023	21556023	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:21556023C>T	ENST00000357134.5	+	16	1901	c.1749C>T	c.(1747-1749)gaC>gaT	p.D583D	NELL1_ENST00000298925.5_Silent_p.D611D|NELL1_ENST00000325319.5_Silent_p.D526D|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000532434.1_Intron	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	583	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GTTTCCATGACGATGGGACCT	0.527																																						ENST00000357134.5	1.000000	7.300000e-01	1.000000	0.830000	0.930000	0.923167	0.930000	1.000000																										0				70						c.(1747-1749)gaC>gaT		NEL-like 1 (chicken)							183.0	149.0	161.0					11																	21556023		2203	4300	6503	SO:0001819	synonymous_variant	4745	1	121410	31				g.chr11:21556023C>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1749C>T	chr11.hg19:g.21556023C>T		1					NELL1_ENST00000298925.5_Silent_p.D611D|NELL1_ENST00000532434.1_Intron|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000325319.5_Silent_p.D526D	p.D583D	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	1	2	3	1.837416	Q92832	NELL1_HUMAN		16	1901	+			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	ENST00000357134.5	1	1	hg19	c.1749C>T	CCDS7855.1	1																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.527	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	1	0	0		2	2	2	0		0	0	65		65	63	1	3.450000	-20.000000	1	0.520000	NM_006157			63	63		263	258	0		1			0	0	65	0		1	0	0	0	0	0	0	63	263
PRR5L	79899	broad.mit.edu	37	11	36472814	36472814	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:36472814T>A	ENST00000378867.3	+	9	996	c.641T>A	c.(640-642)gTg>gAg	p.V214E	PRR5L_ENST00000311599.5_Missense_Mutation_p.V141E|PRR5L_ENST00000530639.1_Missense_Mutation_p.V214E|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000527487.1_Intron	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	214					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						GAGGAGCTGGTGAAGCAAGTG	0.527																																						ENST00000378867.3	1.000000	7.200000e-01	1.000000	0.810000	0.900000	0.905818	0.900000	1.000000																										0				19						c.(640-642)gTg>gAg		proline rich 5 like							188.0	158.0	168.0					11																	36472814		2202	4298	6500	SO:0001583	missense	79899	0	0					g.chr11:36472814T>A		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.641T>A	chr11.hg19:g.36472814T>A	ENSP00000368144:p.Val214Glu	1					PRR5L_ENST00000530639.1_Missense_Mutation_p.V214E|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000527487.1_Intron|PRR5L_ENST00000311599.5_Missense_Mutation_p.V141E	p.V214E	NM_024841.4	NP_079117.3	1	2	3	1.837416	Q6MZQ0	PRR5L_HUMAN		9	996	+			A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	ENST00000378867.3	1	1	hg19	c.641T>A	CCDS31463.1	1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.144704	0.77888	.	.	ENSG00000135362	ENST00000530639;ENST00000311599;ENST00000378867	T;T;T	0.35973	1.41;1.28;1.41	5.16	4.02	0.46733	5.16	4.02	0.46733	.	0.070757	0.56097	D	0.000027	T	0.51652	0.1687	M	0.72894	2.215	0.53688	D	0.999979	D;D	0.71674	0.99;0.998	P;P	0.58266	0.836;0.759	T	0.54166	-0.8334	10	0.87932	D	0	-8.0315	10.571	0.45200	0.0:0.0773:0.0:0.9227	.	86;214	Q6MZQ0-3;Q6MZQ0	.;PRR5L_HUMAN	E	214;141;214	ENSP00000435050:V214E;ENSP00000310103:V141E;ENSP00000368144:V214E	ENSP00000310103:V141E	V	+	2	0	0	PRR5L	36429390	36429390	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.302000	0.59092	0.810000	0.34279	0.260000	0.18958	GTG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.527	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389209.1	0	0	1		19	2	2	1		1	1	65		65	63	1	3.450000	-20.000000	1	0.520000	NM_024841			69	67		298	291	1		1	0		1	0	65	0		1	9.460282e-02	0	0	0	3	0	69	298
RAG1	5896	broad.mit.edu	37	11	36595176	36595176	+	Nonsense_Mutation	SNP	C	C	T	rs193922464		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:36595176C>T	ENST00000299440.5	+	2	434	c.322C>T	c.(322-324)Cga>Tga	p.R108*		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	108	Interaction with importin alpha-1.				adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AGCCAACCTTCGACATCTCTG	0.463									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	ENST00000299440.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				65						c.(322-324)Cga>Tga		recombination activating gene 1		C	stop/ARG	0,4404		0,0,2202	109.0	104.0	106.0		322	3.2	0.7	11		106	1,8595	1.2+/-3.3	0,1,4297	no	stop-gained	RAG1	NM_000448.2		0,1,6499	TT,TC,CC		0.0116,0.0,0.0077		108/1044	36595176	1,12999	2202	4298	6500	SO:0001587	stop_gained	5896	3	121412	40	Familial Hemophagocytic Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	g.chr11:36595176C>T	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.322C>T	chr11.hg19:g.36595176C>T	ENSP00000299440:p.Arg108*	1						p.R108*	NM_000448.2	NP_000439	1	2	3	1.837416	P15918	RAG1_HUMAN		2	434	+	all_lung(20;0.226)	all_hematologic(20;0.107)	E9PPC4|Q8IY72|Q8NER2	Nonsense_Mutation	SNP	ENST00000299440.5	0	1	hg19	c.322C>T	CCDS7902.1	1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.280336	0.59758	0.0	1.16E-4	ENSG00000166349	ENST00000534663;ENST00000299440	.	.	.	6.14	3.2	0.36748	6.14	3.2	0.36748	.	0.352416	0.29522	N	0.011917	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	10.0601	0.42270	0.3752:0.5616:0.0:0.0632	.	.	.	.	X	108	.	ENSP00000299440:R108X	R	+	1	2	2	RAG1	36551752	36551752	.	.	0.743000	0.31040	0.340000	0.28889	.	.	0.439000	0.26476	-0.156000	0.13503	CGA	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.463	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	1	0	1		2	2	2	0		0	0	69		69	67	1	3.450000	-19.963560	1	0.520000	NM_000448			147	142		224	219	1		1			0	0	69	0		1	0	0	0	0	0	0	147	224
FOLH1	2346	broad.mit.edu	37	11	49221961	49221961	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:49221961G>C	ENST00000256999.2	-	3	517	c.257C>G	c.(256-258)aCa>aGa	p.T86R	FOLH1_ENST00000340334.7_Missense_Mutation_p.T71R|FOLH1_ENST00000356696.3_Missense_Mutation_p.T86R|FOLH1_ENST00000533034.1_Missense_Mutation_p.T71R|FOLH1_ENST00000343844.4_Intron	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	86					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GTTTTGTTCTGTTCCTGCTAA	0.348																																						ENST00000256999.2	0.430000	1.100000e-01	0.340000	0.170000	0.240000	0.260197	0.240000	0.240000																										0				60						c.(256-258)aCa>aGa		folate hydrolase (prostate-specific membrane antigen) 1	Capromab(DB00089)						73.0	74.0	74.0					11																	49221961		2201	4296	6497	SO:0001583	missense	2346	0	0					g.chr11:49221961G>C	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.257C>G	chr11.hg19:g.49221961G>C	ENSP00000256999:p.Thr86Arg	1					FOLH1_ENST00000343844.4_Intron|FOLH1_ENST00000340334.7_Missense_Mutation_p.T71R|FOLH1_ENST00000533034.1_Missense_Mutation_p.T71R|FOLH1_ENST00000356696.3_Missense_Mutation_p.T86R	p.T86R	NM_004476.1	NP_004467.1	1	2	3	1.837416	Q04609	FOLH1_HUMAN		3	517	-			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	0	1	hg19	c.257C>G	CCDS7946.1	0	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161035	0.78226	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724;ENST00000529117	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	4.78	4.78	0.61160	4.78	4.78	0.61160	.	0.000000	0.56097	D	0.000031	T	0.73606	0.3608	M	0.90019	3.08	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.943;0.997;0.997	D;D;P;D;D	0.97110	1.0;1.0;0.791;0.964;0.962	T	0.78499	-0.2180	10	0.52906	T	0.07	.	15.3468	0.74343	0.0:0.0:1.0:0.0	.	71;71;71;86;86	Q04609-9;Q04609-7;A4UU13;Q04609-8;Q04609	.;.;.;.;FOLH1_HUMAN	R	86;86;71;71;86;29	ENSP00000256999:T86R;ENSP00000349129:T86R;ENSP00000344131:T71R;ENSP00000431463:T71R;ENSP00000431577:T29R	ENSP00000256999:T86R	T	-	2	0	0	FOLH1	49178537	49178537	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.854000	0.75440	2.496000	0.84212	0.508000	0.49915	ACA	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	1	0	1		2	2	2	0		0	0	25		25	26	1	3.450000	-10.941140	1	0.520000	NM_004476			8	7		157	151	0		1			0	0	25	0		9.879661e-01	0	0	0	0	0	0	8	157
OR4C13	283092	broad.mit.edu	37	11	49974001	49974001	+	Silent	SNP	G	G	A	rs148894043	byFrequency	TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:49974001G>A	ENST00000555099.1	+	1	59	c.27G>A	c.(25-27)gaG>gaA	p.E9E		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						ATGTGACAGAGTTTATTCTAT	0.299																																						ENST00000555099.1	1.000000	8.100000e-01	1.000000	0.890000	0.980000	0.960823	0.980000	1.000000																										0				43						c.(25-27)gaG>gaA		olfactory receptor, family 4, subfamily C, member 13							92.0	93.0	93.0					11																	49974001		2201	4296	6497	SO:0001819	synonymous_variant	283092	0	0					g.chr11:49974001G>A	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.27G>A	chr11.hg19:g.49974001G>A		1						p.E9E	NM_001001955.2	NP_001001955.2	1	2	3	1.837416	Q8NGP0	OR4CD_HUMAN		1	59	+			A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	1	1	hg19	c.27G>A	CCDS31495.1	1																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.299	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	1	0	1		2	2	2	0		0	0	91		91	89	1	3.450000	-3.180657	1	0.520000	NM_001001955			92	92		358	353	1		1			0	0	91	0		1	0	0	0	0	0	0	92	358
OR4D9	390199	broad.mit.edu	37	11	59282719	59282719	+	Missense_Mutation	SNP	G	G	T	rs201267082	byFrequency	TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr11:59282719G>T	ENST00000329328.3	+	1	334	c.334G>T	c.(334-336)Gtt>Ttt	p.V112F		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						GGGAGCAGACGTTTTTTCTCT	0.488																																						ENST00000329328.3	0.940000	5.600000e-01	0.850000	0.650000	0.740000	0.755365	0.740000	0.750000																										0				26						c.(334-336)Gtt>Ttt		olfactory receptor, family 4, subfamily D, member 9							87.0	84.0	85.0					11																	59282719		2201	4295	6496	SO:0001583	missense	390199	0	0					g.chr11:59282719G>T	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.334G>T	chr11.hg19:g.59282719G>T	ENSP00000328563:p.Val112Phe	1						p.V112F	NM_001004711.1	NP_001004711.1	1	2	3	1.837416	Q8NGE8	OR4D9_HUMAN		1	334	+			Q6IFF3	Missense_Mutation	SNP	ENST00000329328.3	1	0	hg19	c.334G>T	CCDS31564.1	0	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279950	0.23392	.	.	ENSG00000172742	ENST00000329328	T	0.00406	7.55	4.06	0.928	0.19443	4.06	0.928	0.19443	GPCR, rhodopsin-like superfamily (1);	0.211163	0.23577	U	0.046697	T	0.00300	0.0009	N	0.12746	0.255	0.09310	N	1	P	0.51351	0.944	P	0.55260	0.772	T	0.55749	-0.8092	10	0.87932	D	0	-7.0011	2.6652	0.05046	0.3837:0.0:0.4112:0.205	.	112	Q8NGE8	OR4D9_HUMAN	F	112	ENSP00000328563:V112F	ENSP00000328563:V112F	V	+	1	0	0	OR4D9	59039295	59039295	0.000000	0.05858	0.019000	0.16419	0.070000	0.16714	-1.393000	0.02521	0.250000	0.21479	0.557000	0.71058	GTT	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.488	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	0	0	1		2	2	2	0		0	0	79		79	76	1	3.450000	-3.230748	1	0.520000	NM_001004711			49	49		269	264	1		1			0	0	79	0		1	0	0	0	0	0	0	49	269
TDG	6996	broad.mit.edu	37	12	104377099	104377099	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:104377099G>T	ENST00000392872.3	+	7	958	c.724G>T	c.(724-726)Gtt>Ttt	p.V242F	AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Missense_Mutation_p.V38F|TDG_ENST00000544861.1_Missense_Mutation_p.V99F|TDG_ENST00000266775.9_Missense_Mutation_p.V238F	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	242					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TAGTAAAGAAGTTTTTGGAGT	0.284								Base excision repair (BER), DNA glycosylases																														ENST00000392872.3	0.260000	9.000000e-02	0.210000	0.120000	0.160000	0.173574	0.160000	0.160000																										0				24						c.(724-726)Gtt>Ttt	Base excision repair (BER), DNA glycosylases	thymine-DNA glycosylase							46.0	49.0	48.0					12																	104377099		2167	4277	6444	SO:0001583	missense	6996	0	0					g.chr12:104377099G>T	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.724G>T	chr12.hg19:g.104377099G>T	ENSP00000376611:p.Val242Phe	1					TDG_ENST00000544861.1_Missense_Mutation_p.V99F|TDG_ENST00000542036.1_Missense_Mutation_p.V38F|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000266775.9_Missense_Mutation_p.V238F	p.V242F	NM_003211.4	NP_003202.3	0	3	3	1.818911	Q13569	TDG_HUMAN		7	958	+			Q8IUZ6|Q8IZM3	Missense_Mutation	SNP	ENST00000392872.3	1	1	hg19	c.724G>T	CCDS9095.1	0	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539433	0.65085	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000537100;ENST00000542036	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.92;0.92	5.4	5.4	0.78164	5.4	5.4	0.78164	Uracil-DNA glycosylase-like (3);	0.258187	0.39083	N	0.001468	T	0.55737	0.1939	N	0.25380	0.74	0.40131	D	0.976715	D;P;B	0.71674	0.998;0.934;0.233	P;P;B	0.60789	0.879;0.545;0.151	T	0.59804	-0.7385	10	0.62326	D	0.03	-28.8349	12.5149	0.56026	0.0764:0.0:0.9236:0.0	.	38;242;242	B4DI29;B2R848;Q13569	.;.;TDG_HUMAN	F	242;238;99;235;38	ENSP00000376611:V242F;ENSP00000266775:V238F;ENSP00000445899:V99F;ENSP00000439825:V235F;ENSP00000439054:V38F	ENSP00000266775:V238F	V	+	1	0	0	TDG	102901229	102901229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.522000	0.45572	2.518000	0.84900	0.563000	0.77884	GTT	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.284	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2	0	0	1		2	2	2	0		0	0	101		101	100	1	3.450000	-3.663674	1	0.520000				16	15		456	452	0		1	0		0	0	101	0		9.999294e-01	2.398531e-01	0	0	0	26	0	16	456
KCNA1	3736	broad.mit.edu	37	12	5021899	5021899	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:5021899C>A	ENST00000382545.3	+	2	2462	c.1355C>A	c.(1354-1356)tCt>tAt	p.S452Y	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	452				S -> Y (in Ref. 1; AAA36139). {ECO:0000305}.	potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	ATGAGCAAGTCTGAGTACATG	0.483																																						ENST00000382545.3	1.000000	7.800000e-01	0.990000	0.840000	0.910000	0.916958	0.910000	1.000000																										0				63						c.(1354-1356)tCt>tAt		potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)						200.0	195.0	196.0					12																	5021899		2203	4300	6503	SO:0001583	missense	3736	0	0					g.chr12:5021899C>A	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1355C>A	chr12.hg19:g.5021899C>A	ENSP00000371985:p.Ser452Tyr	1					KCNA1_ENST00000543874.2_Intron	p.S452Y	NM_000217.2	NP_000208.2	2	3	5	2.618221	Q09470	KCNA1_HUMAN		2	2462	+			A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	1	1	hg19	c.1355C>A	CCDS8535.1	1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.790696	0.70452	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.96716	-4.1	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.98157	0.9391	M	0.87269	2.87	0.80722	D	1	D	0.63880	0.993	D	0.63033	0.91	D	0.98623	1.0668	10	0.87932	D	0	.	18.5892	0.91202	0.0:1.0:0.0:0.0	.	452	Q09470	KCNA1_HUMAN	Y	452	ENSP00000371985:S452Y	ENSP00000228858:S452Y	S	+	2	0	0	KCNA1	4892160	4892160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	TCT	0.730337		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.483	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	0	0	1		2	2	2	0		0	0	163		163	161	1	3.450000	-20.000000	1	0.520000	NM_000217			160	158		1033	1027	1		1			0	0	163	0		1	0	0	0	0	0	0	160	1033
PDE3A	5139	broad.mit.edu	37	12	20787935	20787935	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:20787935C>A	ENST00000359062.3	+	8	1986	c.1946C>A	c.(1945-1947)cCt>cAt	p.P649H	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	649					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CTGAGAGAGCCTCTGAGGAAA	0.443																																						ENST00000359062.3	0.880000	4.400000e-01	0.770000	0.530000	0.640000	0.659389	0.640000	0.650000																										0				58						c.(1945-1947)cCt>cAt		phosphodiesterase 3A, cGMP-inhibited	Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)						140.0	119.0	126.0					12																	20787935		2203	4300	6503	SO:0001583	missense	5139	0	0					g.chr12:20787935C>A		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1946C>A	chr12.hg19:g.20787935C>A	ENSP00000351957:p.Pro649His	1					PDE3A_ENST00000544307.1_3'UTR	p.P649H	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	2	3	5	2.618221	Q14432	PDE3A_HUMAN		8	1986	+	Esophageal squamous(101;0.125)	Breast(259;0.134)	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	1	1	hg19	c.1946C>A	CCDS31754.1	0	.	.	.	.	.	.	.	.	.	.	C	4.426	0.078860	0.08533	.	.	ENSG00000172572	ENST00000359062	T	0.61859	0.07	5.64	3.77	0.43336	5.64	3.77	0.43336	.	7739.210000	0.00166	N	0.000000	T	0.51227	0.1662	N	0.22421	0.69	0.09310	N	1	P	0.34837	0.472	B	0.33295	0.161	T	0.53114	-0.8484	10	0.52906	T	0.07	.	14.0504	0.64732	0.454:0.546:0.0:0.0	.	649	Q14432	PDE3A_HUMAN	H	649	ENSP00000351957:P649H	ENSP00000351957:P649H	P	+	2	0	0	PDE3A	20679202	20679202	0.242000	0.23868	0.016000	0.15963	0.040000	0.13550	0.863000	0.27913	0.699000	0.31761	-0.175000	0.13238	CCT	0.730337		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.443	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2	1	0	1		2	2	2	0		0	0	34		34	33	1	3.450000	-3.075756	1	0.520000				29	29		280	278	0		1	0		0	0	34	0		1	4.997669e-02	0	0	0	4	0	29	280
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	2	3	5	2.618221	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.730337		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	69		69	66	1	3.450000	-20.000000	1	0.520000	NM_033360			64	64		189	188	1		1	1	1	0	0	69	379		1	9.968643e-01	1	12	181	17	568	64	189
PKP2	5318	broad.mit.edu	37	12	33031332	33031332	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:33031332T>C	ENST00000070846.6	-	3	506	c.482A>G	c.(481-483)tAc>tGc	p.Y161C	PKP2_ENST00000340811.4_Missense_Mutation_p.Y161C	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	161					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GCTGTGCGTGTAGTGAGCCCT	0.592																																						ENST00000070846.6	0.390000	1.800000e-01	0.340000	0.230000	0.270000	0.287138	0.270000	0.300000																										0				50						c.(481-483)tAc>tGc		plakophilin 2							108.0	107.0	108.0					12																	33031332		2203	4297	6500	SO:0001583	missense	5318	1	121410	34				g.chr12:33031332T>C	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.482A>G	chr12.hg19:g.33031332T>C	ENSP00000070846:p.Tyr161Cys	1					PKP2_ENST00000340811.4_Missense_Mutation_p.Y161C	p.Y161C	NM_004572.3	NP_004563.2	2	3	5	2.618221	Q99959	PKP2_HUMAN		3	506	-	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	1	1	hg19	c.482A>G	CCDS8731.1	0	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522175	0.44866	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.86030	-2.05;-2.06	4.98	4.98	0.66077	4.98	4.98	0.66077	.	0.558681	0.16641	N	0.205627	D	0.89403	0.6705	L	0.59436	1.845	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.956;0.972	T	0.81169	-0.1055	10	0.59425	D	0.04	-5.6232	9.1145	0.36748	0.1628:0.0:0.0:0.8372	.	161;161;161	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	C	161	ENSP00000342800:Y161C;ENSP00000070846:Y161C	ENSP00000070846:Y161C	Y	-	2	0	0	PKP2	32922599	32922599	0.061000	0.20836	0.007000	0.13788	0.021000	0.10359	2.011000	0.40922	1.865000	0.54081	0.529000	0.55759	TAC	0.730337		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.592	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	0	0	1		23	2	2	0		0	1	110		110	114	1	3.450000	-20.000000	1	0.520000	NM_004572			34	34		798	785	0		1	0		0	0	110	0		9.401543e-01	6.065670e-01	0	0	0	49	0	34	798
TMEM117	84216	broad.mit.edu	37	12	44782272	44782272	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:44782272G>T	ENST00000266534.3	+	8	1489	c.1362G>T	c.(1360-1362)caG>caT	p.Q454H	TMEM117_ENST00000551577.1_3'UTR|TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000536799.1_Missense_Mutation_p.Q350H	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	454						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		AAAACACCCAGGCTTCAGTAG	0.443																																						ENST00000266534.3	0.270000	9.000000e-02	0.230000	0.120000	0.170000	0.180543	0.170000	0.180000																										0				23						c.(1360-1362)caG>caT		transmembrane protein 117							141.0	138.0	139.0					12																	44782272		2203	4300	6503	SO:0001583	missense	84216	0	0					g.chr12:44782272G>T	BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.1362G>T	chr12.hg19:g.44782272G>T	ENSP00000266534:p.Gln454His	1					TMEM117_ENST00000536799.1_Missense_Mutation_p.Q350H|TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_3'UTR	p.Q454H	NM_032256.1	NP_115632.1	0	3	3	1.818911	Q9H0C3	TM117_HUMAN		8	1489	+	Lung SC(27;0.192)			Missense_Mutation	SNP	ENST00000266534.3	1	1	hg19	c.1362G>T	CCDS8745.1	0	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087281	0.36855	.	.	ENSG00000139173	ENST00000266534;ENST00000536799;ENST00000417623	T	0.46819	0.86	5.73	2.5	0.30297	5.73	2.5	0.30297	.	0.052666	0.85682	D	0.000000	T	0.38081	0.1027	L	0.41236	1.265	0.39169	D	0.962561	B;B	0.11235	0.004;0.002	B;B	0.12156	0.007;0.002	T	0.33007	-0.9885	10	0.48119	T	0.1	-10.3341	12.0236	0.53358	0.2193:0.0:0.7807:0.0	.	350;454	F5H3Q2;Q9H0C3	.;TM117_HUMAN	H	454;350;202	ENSP00000266534:Q454H	ENSP00000266534:Q454H	Q	+	3	2	2	TMEM117	43068539	43068539	1.000000	0.71417	0.994000	0.49952	0.887000	0.51463	1.298000	0.33412	0.774000	0.33427	-0.142000	0.14014	CAG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.443	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403969.1	1	0	1		2	2	2	0		0	0	68		68	66	1	3.450000	-3.294724	1	0.520000	NM_032256			14	14		386	383	0		1	0		0	0	68	0		9.997521e-01	8.522116e-02	0	0	0	13	0	14	386
FMNL3	91010	broad.mit.edu	37	12	50044493	50044493	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:50044493G>A	ENST00000293590.5	-	17	2199	c.1966C>T	c.(1966-1968)Cgc>Tgc	p.R656C	FMNL3_ENST00000352151.5_Missense_Mutation_p.R605C|FMNL3_ENST00000550488.1_Missense_Mutation_p.R656C|FMNL3_ENST00000335154.5_Missense_Mutation_p.R656C			Q8IVF7	FMNL3_HUMAN	formin-like 3	656	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						TCAGCCGAGCGGCCAGCCTTG	0.582																																						ENST00000293590.5	1.000000	7.700000e-01	1.000000	0.880000	0.990000	0.956598	0.990000	1.000000																										0				39						c.(1966-1968)Cgc>Tgc		formin-like 3							101.0	98.0	99.0					12																	50044493		2051	4215	6266	SO:0001583	missense	91010	1	121006	39				g.chr12:50044493G>A	AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.1966C>T	chr12.hg19:g.50044493G>A	ENSP00000293590:p.Arg656Cys	1					FMNL3_ENST00000352151.5_Missense_Mutation_p.R605C|FMNL3_ENST00000335154.5_Missense_Mutation_p.R656C|FMNL3_ENST00000550488.1_Missense_Mutation_p.R656C	p.R656C			0	3	3	1.818911	Q8IVF7	FMNL3_HUMAN		17	2199	-			B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	ENST00000293590.5	1	1	hg19	c.1966C>T		1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085302	0.76642	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	5.12	5.12	0.69794	5.12	5.12	0.69794	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.050640	0.64402	D	0.000001	T	0.24774	0.0601	L	0.27053	0.805	0.53688	D	0.999977	D;D;D	0.76494	0.998;0.996;0.999	D;P;P	0.64042	0.921;0.736;0.848	T	0.00383	-1.1774	10	0.51188	T	0.08	.	11.2905	0.49247	0.0:0.0:0.72:0.28	.	605;656;656	Q8IVF7-2;Q8IVF7-3;Q8IVF7	.;.;FMNL3_HUMAN	C	656;656;605;656	ENSP00000335655:R656C;ENSP00000447479:R656C;ENSP00000344311:R605C;ENSP00000293590:R656C	ENSP00000293590:R656C	R	-	1	0	0	FMNL3	48330760	48330760	0.983000	0.35010	1.000000	0.80357	0.980000	0.70556	1.336000	0.33850	2.834000	0.97654	0.650000	0.86243	CGC	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.582	FMNL3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	39		39	37	1	3.450000	-3.759405	1	0.520000	NM_175736			50	48		191	185	1		1	0		0	0	39	0		1	9.627637e-01	0	0	0	23	0	50	191
GPR133	283383	broad.mit.edu	37	12	131593364	131593364	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr12:131593364G>A	ENST00000261654.5	+	18	2542	c.1983G>A	c.(1981-1983)gtG>gtA	p.V661V	GPR133_ENST00000543617.1_Silent_p.V180V|GPR133_ENST00000376682.4_Silent_p.V347V|GPR133_ENST00000535015.1_Silent_p.V693V	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	661					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ACAGCATGGTGATCAAGGTCT	0.612																																						ENST00000261654.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				67						c.(1981-1983)gtG>gtA		G protein-coupled receptor 133							176.0	160.0	166.0					12																	131593364		2203	4300	6503	SO:0001819	synonymous_variant	283383	0	0					g.chr12:131593364G>A	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1983G>A	chr12.hg19:g.131593364G>A		1					GPR133_ENST00000535015.1_Silent_p.V693V|GPR133_ENST00000376682.4_Silent_p.V347V|GPR133_ENST00000543617.1_Silent_p.V180V	p.V661V	NM_198827.3	NP_942122.2	0	3	3	1.818911	Q6QNK2	GP133_HUMAN		18	2542	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	1	1	hg19	c.1983G>A	CCDS9272.1	1																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.612	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	1	0	1		2	2	2	0		0	0	82		82	80	1	3.450000	-20.000000	1	0.520000	NM_198827			267	263		175	171	1		1	0		0	0	82	0		1	9.813348e-01	0	0	0	7	0	267	175
TM9SF2	9375	broad.mit.edu	37	13	100153955	100153955	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr13:100153955G>A	ENST00000376387.4	+	1	285	c.95G>A	c.(94-96)cGg>cAg	p.R32Q	LINC00449_ENST00000366259.2_RNA	NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	32					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					GGCCCGCGCCGGAGCGGCGCT	0.667																																						ENST00000376387.4	0.180000	2.000000e-02	0.140000	0.050000	0.090000	0.101143	0.090000	0.080000																										0				17						c.(94-96)cGg>cAg		transmembrane 9 superfamily member 2							39.0	46.0	44.0					13																	100153955		2200	4298	6498	SO:0001583	missense	9375	0	0					g.chr13:100153955G>A	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.95G>A	chr13.hg19:g.100153955G>A	ENSP00000365567:p.Arg32Gln	1					LINC00449_ENST00000366259.2_RNA	p.R32Q	NM_004800.1	NP_004791.1	2	2	4	2.218602	Q99805	TM9S2_HUMAN		1	285	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)		A8K399|Q2TAY5	Missense_Mutation	SNP	ENST00000376387.4	0	1	hg19	c.95G>A	CCDS9493.1	0	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177171	0.38413	.	.	ENSG00000125304	ENST00000376387	T	0.41400	1.0	4.66	-3.93	0.04143	4.66	-3.93	0.04143	.	0.587551	0.19001	N	0.125345	T	0.21550	0.0519	N	0.14661	0.345	0.09310	N	1	B;P	0.35908	0.052;0.527	B;B	0.21360	0.004;0.034	T	0.01460	-1.1349	10	0.23302	T	0.38	1.5671	21.9879	0.99964	0.0:0.8332:0.1668:0.0	.	32;32	E9PHW5;Q99805	.;TM9S2_HUMAN	Q	32	ENSP00000365567:R32Q	ENSP00000365567:R32Q	R	+	2	0	0	TM9SF2	98951956	98951956	0.018000	0.18449	0.552000	0.28243	0.996000	0.88848	-0.549000	0.06041	-0.599000	0.05798	0.655000	0.94253	CGG	0.684211		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.667	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3	0	0	1		22	13	2	1		1	1	56		56	53	1	3.450000	-2.923173	1	0.520000				6	6		396	378	0		0	0		1	0	56	0		1.034487e-03	1.306445e-03	0	0	0	195	0	6	396
MRPL57	78988	broad.mit.edu	37	13	21751133	21751133	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr13:21751133C>T	ENST00000309594.4	+	2	156	c.78C>T	c.(76-78)ttC>ttT	p.F26F	SKA3_ENST00000314759.5_5'Flank|SKA3_ENST00000400018.3_5'Flank	NM_024026.4	NP_076931.1	Q9BQC6	RT63_HUMAN		26					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			kidney(1)|lung(2)|skin(1)|urinary_tract(1)	5		all_cancers(29;2.76e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.43e-05)|Epithelial(112;0.000285)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|Lung(94;0.0932)		GGCCGCGGTTCGTGTCGTTGC	0.662																																						ENST00000309594.4	0.980000	5.500000e-01	0.870000	0.650000	0.750000	0.766580	0.750000	0.760000																										0				5						c.(76-78)ttC>ttT									25.0	27.0	26.0					13																	21751133		2173	4265	6438	SO:0001819	synonymous_variant	0	0	0					g.chr13:21751133C>T																												ENST00000309594.4:c.78C>T	chr13.hg19:g.21751133C>T		1					SKA3_ENST00000314759.5_5'Flank|SKA3_ENST00000400018.3_5'Flank	p.F26F	NM_024026.4	NP_076931.1	2	2	4	2.218602	Q9BQC6	RT63_HUMAN		2	156	+		all_cancers(29;2.76e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)	A2A332	Silent	SNP	ENST00000309594.4	1	1	hg19	c.78C>T	CCDS9296.1	0																																																																																								0.684211		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.662	MRP63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044105.2	1	0	1		2	2	2	0		0	0	48		48	46	1	3.450000	-20.000000	1	0.520000				42	42		283	267	0		1	1		0	0	48	0		1	1	0	69	0	221	0	42	283
COL4A2	1284	broad.mit.edu	37	13	111102671	111102671	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr13:111102671G>A	ENST00000360467.5	+	20	1515	c.1209G>A	c.(1207-1209)ccG>ccA	p.P403P		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	403	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GAGGCCTGCCGGGTGAGATGG	0.632																																						ENST00000360467.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				80						c.(1207-1209)ccG>ccA		collagen, type IV, alpha 2							56.0	60.0	59.0					13																	111102671		1924	4136	6060	SO:0001819	synonymous_variant	1284	5	120848	37				g.chr13:111102671G>A	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1209G>A	chr13.hg19:g.111102671G>A		1						p.P403P	NM_001846.2	NP_001837.2	2	2	4	2.218602	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)	20	1515	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	ENST00000360467.5	1	1	hg19	c.1209G>A	CCDS41907.1	1																																																																																								0.684211		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.632	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	1	0	1		2	2	2	0		0	0	41		41	40	1	3.450000	-7.973366	1	0.520000	NM_001846			99	98		224	217	0		1	0		0	0	41	0		1	1	0	0	0	153	0	99	224
EML1	2009	broad.mit.edu	37	14	100405553	100405553	+	Silent	SNP	G	G	A	rs553895497		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr14:100405553G>A	ENST00000262233.6	+	21	2350	c.2211G>A	c.(2209-2211)tcG>tcA	p.S737S	EML1_ENST00000334192.4_Silent_p.S756S|EML1_ENST00000327921.9_Silent_p.S725S	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	737	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CAGAAGGCTCGGACGGAACCG	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17878	0.0		0.0	False		,,,				2504	0.0					ENST00000262233.6	0.940000	5.400000e-01	0.840000	0.630000	0.720000	0.739545	0.720000	0.720000																										0				42						c.(2209-2211)tcG>tcA		echinoderm microtubule associated protein like 1							110.0	98.0	102.0					14																	100405553		2203	4300	6503	SO:0001819	synonymous_variant	2009	3	121412	37				g.chr14:100405553G>A	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.2211G>A	chr14.hg19:g.100405553G>A		1					EML1_ENST00000327921.9_Silent_p.S725S|EML1_ENST00000334192.4_Silent_p.S756S	p.S737S	NM_004434.2	NP_004425.2	1	2	3	1.848437	O00423	EMAL1_HUMAN		21	2350	+		Melanoma(154;0.0879)|all_epithelial(191;0.216)	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Silent	SNP	ENST00000262233.6	1	1	hg19	c.2211G>A	CCDS32155.1	0																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.582	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	1	0	1		2	2	2	0		0	0	63		63	61	1	3.450000	-2.753200	1	0.520000	NM_001008707			42	40		237	230	1		1	0		0	0	63	0		1	1.147296e-01	0	0	0	4	0	42	237
DCAF5	8816	broad.mit.edu	37	14	69522129	69522129	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr14:69522129C>T	ENST00000341516.5	-	9	1421	c.1274G>A	c.(1273-1275)cGa>cAa	p.R425Q	DCAF5_ENST00000554215.1_Missense_Mutation_p.R343Q|DCAF5_ENST00000557386.1_Missense_Mutation_p.R424Q|DCAF5_ENST00000556847.1_Missense_Mutation_p.R343Q|DCAF5_ENST00000553293.1_5'UTR	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	425					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						CTCGATCTCTCGGCGTACCAG	0.587																																						ENST00000341516.5	0.190000	2.000000e-02	0.140000	0.050000	0.090000	0.102132	0.090000	0.090000																										0				29						c.(1273-1275)cGa>cAa		DDB1 and CUL4 associated factor 5							73.0	68.0	69.0					14																	69522129		2203	4300	6503	SO:0001583	missense	8816	0	0					g.chr14:69522129C>T	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1274G>A	chr14.hg19:g.69522129C>T	ENSP00000341351:p.Arg425Gln	1					DCAF5_ENST00000554215.1_Missense_Mutation_p.R343Q|DCAF5_ENST00000557386.1_Missense_Mutation_p.R424Q|DCAF5_ENST00000556847.1_Missense_Mutation_p.R343Q|DCAF5_ENST00000553293.1_5'UTR	p.R425Q	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	1	2	3	1.848437	Q96JK2	DCAF5_HUMAN		9	1421	-			B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	0	1	hg19	c.1274G>A	CCDS32106.1	0	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141952	0.77775	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.75938	-0.98;-0.81;-0.81;-0.3	5.68	5.68	0.88126	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.72922	0.3521	L	0.34521	1.04	0.80722	D	1	P;P	0.49358	0.923;0.875	P;B	0.47891	0.56;0.357	T	0.71906	-0.4451	10	0.38643	T	0.18	-8.3451	19.7989	0.96497	0.0:1.0:0.0:0.0	.	424;425	G3V4J7;Q96JK2	.;DCAF5_HUMAN	Q	425;343;343;424	ENSP00000341351:R425Q;ENSP00000451551:R343Q;ENSP00000452052:R343Q;ENSP00000451845:R424Q	ENSP00000341351:R425Q	R	-	2	0	0	DCAF5	68591882	68591882	1.000000	0.71417	0.959000	0.39883	0.993000	0.82548	7.336000	0.79245	2.683000	0.91414	0.561000	0.74099	CGA	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.587	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	0	0	1		2	2	2	0		0	0	46		46	46	1	3.450000	-3.286065	1	0.520000	NM_003861			5	6		277	268	0		1	0		0	0	46	0		9.332525e-01	1.449018e-01	0	0	0	31	0	5	277
PGF	5228	broad.mit.edu	37	14	75416111	75416111	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr14:75416111G>A	ENST00000405431.2	-	3	263	c.264C>T	c.(262-264)ggC>ggT	p.G88G	PGF_ENST00000555567.1_Silent_p.G88G|PGF_ENST00000553716.1_Silent_p.G88G|PGF_ENST00000238607.6_Silent_p.G87G			P49763	PLGF_HUMAN	placental growth factor	88					branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of morphogenesis of a branching structure (GO:0060688)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.00668)	Aflibercept(DB08885)	GATTCTCATCGCCGCAGCAGC	0.632																																					GBM(127;389 2301 5452 48547)	ENST00000405431.2	0.380000	1.200000e-01	0.310000	0.170000	0.230000	0.244542	0.230000	0.240000																										0				8						c.(262-264)ggC>ggT		placental growth factor	Aflibercept(DB08885)						68.0	57.0	61.0					14																	75416111		2203	4300	6503	SO:0001819	synonymous_variant	5228	2	121404	35				g.chr14:75416111G>A	S72960	CCDS9835.1, CCDS55932.1, CCDS73664.1	14q24.3	2013-02-18	2008-03-20		ENSG00000119630	ENSG00000119630			8893	protein-coding gene	gene with protein product	"""placenta growth factor"""	601121	"""placental growth factor-like"", ""placental growth factor, vascular endothelial growth factor-related protein"""	PGFL		7681160	Standard	NM_002632		Approved	PLGF, PlGF-2, PlGF, SHGC-10760, D12S1900	uc001xqz.3	P49763	OTTHUMG00000171496	ENST00000405431.2:c.264C>T	chr14.hg19:g.75416111G>A		1					PGF_ENST00000553716.1_Silent_p.G88G|PGF_ENST00000238607.6_Silent_p.G87G|PGF_ENST00000555567.1_Silent_p.G88G	p.G88G			1	2	3	1.848437	P49763	PLGF_HUMAN		3	263	-			Q07101|Q9BV78|Q9Y6S8	Silent	SNP	ENST00000405431.2	1	1	hg19	c.264C>T	CCDS9835.1	0																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.632	PGF-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414064.1	1	0	1		2	2	2	0		0	0	45		45	43	1	3.450000	-3.303761	1	0.520000	NM_002632			12	11		243	239	0		1	1		0	0	45	0		9.990742e-01	6.128936e-01	0	3	0	39	0	12	243
PTPN21	11099	broad.mit.edu	37	14	89016677	89016677	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr14:89016677G>A	ENST00000556564.1	-	2	369	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L	PTPN21_ENST00000554628.1_5'UTR|RP11-507K2.3_ENST00000556328.1_RNA|PTPN21_ENST00000328736.3_Silent_p.L29L	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	29	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TTATTAAGCAGTTGGATCCGG	0.567																																						ENST00000556564.1	1.000000	8.400000e-01	1.000000	0.930000	0.990000	0.978001	0.990000	1.000000																										0				45						c.(85-87)Ctg>Ttg		protein tyrosine phosphatase, non-receptor type 21							120.0	115.0	116.0					14																	89016677		2203	4300	6503	SO:0001819	synonymous_variant	11099	0	0					g.chr14:89016677G>A	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.85C>T	chr14.hg19:g.89016677G>A		1					RP11-507K2.3_ENST00000556328.1_RNA|PTPN21_ENST00000328736.3_Silent_p.L29L|PTPN21_ENST00000554628.1_5'UTR	p.L29L	NM_007039.3	NP_008970.2	1	2	3	1.848437	Q16825	PTN21_HUMAN		2	369	-				Silent	SNP	ENST00000556564.1	1	1	hg19	c.85C>T	CCDS9884.1	1																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.567	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1	0	0	1		2	2	2	1		1	0	61		61	58	1	3.450000	-20.000000	1	0.520000				88	86		324	319	1		1	0		1	0	61	0		1	5.380857e-01	0	1	0	7	0	88	324
XRCC3	7517	broad.mit.edu	37	14	104169592	104169592	+	Missense_Mutation	SNP	C	C	T	rs546280840		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr14:104169592C>T	ENST00000553264.1	-	5	1275	c.479G>A	c.(478-480)cGg>cAg	p.R160Q	XRCC3_ENST00000555832.1_5'Flank|XRCC3_ENST00000445556.1_Missense_Mutation_p.R160Q|XRCC3_ENST00000554974.1_Intron|XRCC3_ENST00000352127.7_Missense_Mutation_p.R160Q|XRCC3_ENST00000554913.1_Missense_Mutation_p.R160Q|XRCC3_ENST00000555055.1_Missense_Mutation_p.R160Q			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	160					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|response to organic substance (GO:0010033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		AGTGCGCAGCCGCGGCTGCTG	0.622								Direct reversal of damage;Homologous recombination					C|||	1	0.000199681	0.0008	0.0	5008	,	,		18134	0.0		0.0	False		,,,				2504	0.0					ENST00000553264.1	1.000000	4.100000e-01	1.000000	0.610000	0.870000	0.832140	0.870000	1.000000																										0				4						c.(478-480)cGg>cAg	Direct reversal of damage;Homologous recombination	X-ray repair complementing defective repair in Chinese hamster cells 3							38.0	30.0	32.0					14																	104169592		2186	4291	6477	SO:0001583	missense	7517	1	117758	24				g.chr14:104169592C>T	AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215			12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675				7603995	Standard	NM_001100118		Approved		uc001ynz.4	O43542		ENST00000553264.1:c.479G>A	chr14.hg19:g.104169592C>T	ENSP00000451974:p.Arg160Gln	1					XRCC3_ENST00000554913.1_Missense_Mutation_p.R160Q|XRCC3_ENST00000554974.1_Intron|XRCC3_ENST00000555055.1_Missense_Mutation_p.R160Q|XRCC3_ENST00000445556.1_Missense_Mutation_p.R160Q|XRCC3_ENST00000352127.7_Missense_Mutation_p.R160Q|XRCC3_ENST00000555832.1_5'Flank	p.R160Q			1	2	3	1.862466	O43542	XRCC3_HUMAN		5	1275	-		Melanoma(154;0.155)|all_epithelial(191;0.19)	O43568|Q9BU18	Missense_Mutation	SNP	ENST00000553264.1	0	1	hg19	c.479G>A	CCDS9984.1	1	.	.	.	.	.	.	.	.	.	.	C	8.476	0.858680	0.17178	.	.	ENSG00000126215	ENST00000554913;ENST00000352127;ENST00000553264;ENST00000555055;ENST00000445556	T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13	4.7	-3.94	0.04130	4.7	-3.94	0.04130	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);DNA recombination and repair protein Rad51, C-terminal (1);	1.857050	0.02717	N	0.113582	T	0.30759	0.0775	N	0.22421	0.69	0.09310	N	1	B	0.18461	0.028	B	0.16289	0.015	T	0.24297	-1.0164	10	0.31617	T	0.26	-22.7782	12.9742	0.58529	0.0:0.165:0.0:0.835	.	160	O43542	XRCC3_HUMAN	Q	160	ENSP00000451362:R160Q;ENSP00000343392:R160Q;ENSP00000451974:R160Q;ENSP00000452598:R160Q;ENSP00000412990:R160Q	ENSP00000343392:R160Q	R	-	2	0	0	XRCC3	103239345	103239345	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.699000	0.01906	-0.879000	0.04002	-0.367000	0.07326	CGG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.622	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414631.1	1	0	1		2	2	2	0		0	0	14		14	14	1	3.450000	-15.119890	1	0.520000	NM_005432			7	7		33	32	1		1	1		0	0	14	0		9.824204e-01	5.169388e-01	0	3	0	6	0	7	33
MYO5A	4644	broad.mit.edu	37	15	52672018	52672018	+	Splice_Site	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr15:52672018C>T	ENST00000399231.3	-	17	2343		c.e17+1		MYO5A_ENST00000399233.2_Splice_Site|MYO5A_ENST00000553916.1_Splice_Site|MYO5A_ENST00000356338.6_Splice_Site|MYO5A_ENST00000358212.6_Splice_Site	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)						actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GCCAGGCTCACCGTGAGGGGA	0.453																																						ENST00000399231.3	1.000000	6.100000e-01	1.000000	0.690000	0.790000	0.821572	0.790000	0.770000																										0				57						c.e17+1		myosin VA (heavy chain 12, myoxin)							105.0	108.0	107.0					15																	52672018		1920	4133	6053	SO:0001630	splice_region_variant	4644	0	0					g.chr15:52672018C>T		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.2099+1G>A	chr15.hg19:g.52672018C>T		1					MYO5A_ENST00000399233.2_Splice_Site|MYO5A_ENST00000553916.1_Splice_Site|MYO5A_ENST00000356338.6_Splice_Site|MYO5A_ENST00000358212.6_Splice_Site		NM_000259.3	NP_000250	1	3	4	1.900892	Q9Y4I1	MYO5A_HUMAN		17	2343	-			A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Splice_Site	SNP	ENST00000399231.3	1	1	hg19		CCDS42037.1	0	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385741	0.82792	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	.	.	.	4.99	4.0	0.46444	4.99	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1161	0.72404	0.0:0.8581:0.1419:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	MYO5A	50459310	50459310	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	7.818000	0.86416	2.464000	0.83262	0.650000	0.86243	.	0.634146		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.453	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	1	0	1		26	2	2	1		1	1	58		58	56	1	3.450000	-20.000000	1	0.520000	NM_000259	Intron		75	75		422	419	1		1			1	0	58	0		9.999999e-01	0	0	0	0	0	0	75	422
ZSCAN10	84891	broad.mit.edu	37	16	3140385	3140385	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr16:3140385C>T	ENST00000252463.2	-	5	972	c.885G>A	c.(883-885)gcG>gcA	p.A295A	ZSCAN10_ENST00000575108.1_5'UTR|ZSCAN10_ENST00000538082.2_Silent_p.A213A	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	295					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						CCCCGCAGTCCGCGCAGATGA	0.632																																						ENST00000252463.2	1.000000	9.700000e-01	1.000000	0.990000	0.990000	0.998228	0.990000	1.000000																										0				24						c.(883-885)gcG>gcA		zinc finger and SCAN domain containing 10							50.0	52.0	52.0					16																	3140385		2165	4244	6409	SO:0001819	synonymous_variant	84891	1	121256	32				g.chr16:3140385C>T	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.885G>A	chr16.hg19:g.3140385C>T		1					ZSCAN10_ENST00000538082.2_Silent_p.A213A|ZSCAN10_ENST00000575108.1_5'UTR	p.A295A	NM_032805.1	NP_116194.1	2	4	6	1.959311	Q96SZ4	ZSC10_HUMAN		5	972	-			B3KQD3|H0YFS6|Q1WWM2	Silent	SNP	ENST00000252463.2	1	1	hg19	c.885G>A	CCDS10493.1	1																																																																																								0.645390		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.632	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	1	0	1		19	2	2	1		1	1	69		69	67	1	3.450000	-3.838453	1	0.520000	NM_032805			90	87		312	300	1		1			1	0	69	0		1	0	0	0	0	0	0	90	312
NLRC5	84166	broad.mit.edu	37	16	57092011	57092011	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr16:57092011A>G	ENST00000262510.6	+	28	4006	c.3781A>G	c.(3781-3783)Aga>Gga	p.R1261G	NLRC5_ENST00000539144.1_Missense_Mutation_p.R1232G|NLRC5_ENST00000436936.1_Missense_Mutation_p.R1261G|NLRC5_ENST00000308149.7_Missense_Mutation_p.R1232G|RP11-322D14.2_ENST00000562970.1_RNA	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1261					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CAGCGGACTCAGATGCCTTCT	0.572																																						ENST00000262510.6	0.400000	4.000000e-02	0.290000	0.100000	0.180000	0.204825	0.180000	0.180000																										0				75						c.(3781-3783)Aga>Gga		NLR family, CARD domain containing 5							61.0	50.0	53.0					16																	57092011		2198	4300	6498	SO:0001583	missense	84166	0	0					g.chr16:57092011A>G	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3781A>G	chr16.hg19:g.57092011A>G	ENSP00000262510:p.Arg1261Gly	1					NLRC5_ENST00000539144.1_Missense_Mutation_p.R1232G|NLRC5_ENST00000308149.7_Missense_Mutation_p.R1232G|NLRC5_ENST00000436936.1_Missense_Mutation_p.R1261G|RP11-322D14.2_ENST00000562970.1_RNA	p.R1261G	NM_032206.4	NP_115582.4	2	4	6	2.969935	Q86WI3	NLRC5_HUMAN		28	4006	+		all_neural(199;0.225)	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	0	1	hg19	c.3781A>G	CCDS10773.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.659|7.659	0.684568|0.684568	0.14973|0.14973	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000538805;ENST00000399221|ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110	.|T;T;T;T;T	.|0.53423	.|0.62;5.54;0.62;5.54;0.62	4.68|4.68	2.39|2.39	0.29439|0.29439	4.68|4.68	2.39|2.39	0.29439|0.29439	.|.	.|.	.|.	.|.	.|.	T|T	0.44371|0.44371	0.1290|0.1290	M|M	0.68952|0.68952	2.095|2.095	0.09310|0.09310	N|N	1|1	.|P;P;B;B	.|0.36465	.|0.554;0.515;0.302;0.094	.|B;B;B;B	.|0.35550	.|0.205;0.156;0.08;0.054	T|T	0.28004|0.28004	-1.0057|-1.0057	5|9	.|0.49607	.|T	.|0.09	.|.	8.9296|8.9296	0.35661|0.35661	0.6488:0.3512:0.0:0.0|0.6488:0.3512:0.0:0.0	.|.	.|945;1232;1261;1261	.|Q9H6Y0;Q86WI3-4;Q86WI3-6;Q86WI3	.|.;.;.;NLRC5_HUMAN	R|G	1012;12|1261;1232;1261;704;1232;737	.|ENSP00000262510:R1261G;ENSP00000308886:R1232G;ENSP00000389739:R1261G;ENSP00000441727:R1232G;ENSP00000441597:R737G	.|ENSP00000262510:R1261G	Q|R	+|+	2|1	0|2	0|2	NLRC5|NLRC5	55649512|55649512	55649512|55649512	0.968000|0.968000	0.33430|0.33430	0.285000|0.285000	0.24819|0.24819	0.051000|0.051000	0.14879|0.14879	1.064000|1.064000	0.30579|0.30579	0.292000|0.292000	0.22492|0.22492	0.449000|0.449000	0.29647|0.29647	CAG|AGA	0.764706		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.572	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	0	0	1		2	2	2	0		0	0	28		28	28	1	3.450000	-5.915690	1	0.520000	NM_032206			4	4		185	183	0		1	0		0	0	28	0		8.887450e-01	1.025561e-01	0	0	0	20	0	4	185
DRC7	84229	broad.mit.edu	37	16	57764951	57764951	+	Missense_Mutation	SNP	C	C	T	rs568917398		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr16:57764951C>T	ENST00000360716.3	+	18	2721	c.2500C>T	c.(2500-2502)Cgc>Tgc	p.R834C	CCDC135_ENST00000394337.4_Missense_Mutation_p.R834C|CCDC135_ENST00000336825.8_Missense_Mutation_p.R769C			Q8IY82	CC135_HUMAN		834					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GGCCATGTTCCGCATCCGCAT	0.597													c|||	1	0.000199681	0.0008	0.0	5008	,	,		21079	0.0		0.0	False		,,,				2504	0.0					ENST00000360716.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				30						c.(2500-2502)Cgc>Tgc									102.0	90.0	94.0					16																	57764951		2198	4300	6498	SO:0001583	missense	0	7	121404	38				g.chr16:57764951C>T																												ENST00000360716.3:c.2500C>T	chr16.hg19:g.57764951C>T	ENSP00000353942:p.Arg834Cys	1					CCDC135_ENST00000336825.8_Missense_Mutation_p.R769C|CCDC135_ENST00000394337.4_Missense_Mutation_p.R834C	p.R834C			2	4	6	2.969935	Q8IY82	CC135_HUMAN		18	2721	+			A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	1	1	hg19	c.2500C>T	CCDS10787.1	1	.	.	.	.	.	.	.	.	.	.	c	12.08	1.831476	0.32329	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.55413	0.52;0.52;0.52	5.04	4.09	0.47781	5.04	4.09	0.47781	.	0.274751	0.35646	N	0.003074	T	0.73613	0.3609	M	0.85197	2.74	0.58432	D	0.999999	B;D	0.89917	0.056;1.0	B;D	0.91635	0.026;0.999	T	0.77892	-0.2418	10	0.66056	D	0.02	-22.0214	12.618	0.56588	0.0:0.9179:0.0:0.0821	.	769;834	Q8IY82-2;Q8IY82	.;CC135_HUMAN	C	834;769;834	ENSP00000377869:R834C;ENSP00000338938:R769C;ENSP00000353942:R834C	ENSP00000338938:R769C	R	+	1	0	0	CCDC135	56322452	56322452	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	2.268000	0.43338	1.275000	0.44379	-0.156000	0.13503	CGC	0.764706		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.597	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2	1	0	1		2	2	2	0		0	0	53		53	49	1	3.450000	-10.327270	1	0.520000				108	107		224	221	1		1	0		0	0	53	0		1	0	0	0	0	1	0	108	224
CNGB1	1258	broad.mit.edu	37	16	57945695	57945695	+	Silent	SNP	G	G	A	rs528283367		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr16:57945695G>A	ENST00000251102.8	-	25	2514	c.2454C>T	c.(2452-2454)ctC>ctT	p.L818L	CNGB1_ENST00000564448.1_Silent_p.L812L	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	818					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GAGTGGAGCCGAGGCCCTGAT	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		20647	0.0		0.001	False		,,,				2504	0.0				Colon(156;1293 1853 16336 28962 38659)	ENST00000251102.8	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				54						c.(2452-2454)ctC>ctT		cyclic nucleotide gated channel beta 1							56.0	58.0	57.0					16																	57945695		1958	4152	6110	SO:0001819	synonymous_variant	1258	1	120900	35				g.chr16:57945695G>A	AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.2454C>T	chr16.hg19:g.57945695G>A		1					CNGB1_ENST00000564448.1_Silent_p.L812L	p.L818L	NM_001297.4	NP_001288.3	2	4	6	2.969935	Q14028	CNGB1_HUMAN		25	2514	-			H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	ENST00000251102.8	1	1	hg19	c.2454C>T	CCDS42169.1	1																																																																																								0.764706		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.547	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	1	0	1		2	2	2	0		0	0	25		25	24	1	3.450000	-9.821425	1	0.520000	NM_001297			86	84		172	168	1		1			0	0	25	0		1	0	0	0	0	0	0	86	172
OSGIN1	29948	broad.mit.edu	37	16	83994666	83994666	+	Silent	SNP	G	G	A	rs376376327		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr16:83994666G>A	ENST00000343939.2	+	6	1109	c.726G>A	c.(724-726)caG>caA	p.Q242Q	OSGIN1_ENST00000393306.1_Silent_p.Q159Q|OSGIN1_ENST00000565123.1_Silent_p.Q159Q|OSGIN1_ENST00000361711.3_Silent_p.Q159Q			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	242					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						ACTGGATGCAGAAGAAGCGAA	0.572																																						ENST00000343939.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.998691	0.990000	1.000000																										0				12						c.(724-726)caG>caA		oxidative stress induced growth inhibitor 1		G	,,	0,4400		0,0,2200	64.0	65.0	65.0		726,477,477	0.1	0.2	16		65	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	OSGIN1	NM_013370.3,NM_182980.2,NM_182981.2	,,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,,	242/561,159/478,159/478	83994666	1,12999	2200	4300	6500	SO:0001819	synonymous_variant	29948	1	121366	26				g.chr16:83994666G>A	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.726G>A	chr16.hg19:g.83994666G>A		1					OSGIN1_ENST00000565123.1_Silent_p.Q159Q|OSGIN1_ENST00000393306.1_Silent_p.Q159Q|OSGIN1_ENST00000361711.3_Silent_p.Q159Q	p.Q242Q			3	4	7	2.477696	Q9UJX0	OSGI1_HUMAN		6	1109	+			Q52M33|Q86UQ1|Q96S88|Q9BZ70	Silent	SNP	ENST00000343939.2	1	1	hg19	c.726G>A		1																																																																																								0.717979		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.572	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	1	0	1		2	2	2	0		0	0	52		52	51	1	3.450000	-20.000000	1	0.520000	NM_013370			58	57		246	239	1		1	1		0	0	52	0		1	9.991971e-01	0	19	0	29	0	58	246
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	24185	GRCh37	CM062017|CM951224	TP53	M	rs28934578	c.(523-525)cGc>cAc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	7157	1	121412	41	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578406C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	chr17.hg19:g.7578406C>T	ENSP00000269305:p.Arg175His	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.474757	P04637	P53_HUMAN		5	713	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.524G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	0	TP53	7519131	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	0.520000		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	6	0		0	0	61		61	59	1	3.450000	-19.938370	1	0.520000	NM_000546			82	82		80	78	1		1	1	1	0	1	61	1065		1	1	1	40	516	14	452	82	80
TMEM132E	124842	broad.mit.edu	37	17	32953262	32953262	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr17:32953262C>T	ENST00000321639.5	+	2	512	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	62						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCGGGAGGCGCGGCCCCCGTC	0.731																																						ENST00000321639.5	1.000000	4.500000e-01	1.000000	0.680000	0.970000	0.875631	0.970000	1.000000																										0				57						c.(184-186)Cgg>Tgg		transmembrane protein 132E							10.0	11.0	11.0					17																	32953262		2174	4249	6423	SO:0001583	missense	124842	0	0					g.chr17:32953262C>T	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.184C>T	chr17.hg19:g.32953262C>T	ENSP00000316532:p.Arg62Trp	1						p.R62W	NM_207313.1	NP_997196.1	2	2	4	2.230651	Q6IEE7	T132E_HUMAN		2	512	+			Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	0	1	hg19	c.184C>T	CCDS11283.1	1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387866	0.61956	.	.	ENSG00000181291	ENST00000321639	T	0.11495	2.77	4.82	3.81	0.43845	4.82	3.81	0.43845	.	0.445588	0.24391	N	0.038924	T	0.09512	0.0234	N	0.19112	0.55	0.21020	N	0.999805	D	0.60160	0.987	P	0.47705	0.555	T	0.11108	-1.0601	10	0.66056	D	0.02	-27.4389	8.5268	0.33309	0.1556:0.5772:0.2672:0.0	.	62	Q6IEE7	T132E_HUMAN	W	62	ENSP00000316532:R62W	ENSP00000316532:R62W	R	+	1	2	2	TMEM132E	29977375	29977375	0.834000	0.29399	0.889000	0.34880	0.942000	0.58702	1.415000	0.34748	0.913000	0.36797	0.478000	0.44815	CGG	0.684211		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.731	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	0	0	1		2	2	2	0		0	0	10		10	10	1	3.450000	-14.857570	1	0.520000	NM_207313			7	7		37	36	0		1			0	0	10	0		9.822264e-01	0	0	0	0	0	0	7	37
TEX19	400629	broad.mit.edu	37	17	80320465	80320465	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr17:80320465T>C	ENST00000333437.4	+	2	749	c.439T>C	c.(439-441)Tgg>Cgg	p.W147R		NM_207459.3	NP_997342.1	Q8NA77	TEX19_HUMAN	testis expressed 19	147					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6						GGGTCTTCCCTGGAGATTTGA	0.597																																						ENST00000333437.4	1.000000	8.900000e-01	1.000000	0.990000	0.990000	0.990828	0.990000	1.000000																										0				6						c.(439-441)Tgg>Cgg		testis expressed 19							51.0	51.0	51.0					17																	80320465		2203	4297	6500	SO:0001583	missense	400629	0	0					g.chr17:80320465T>C	BC016939	CCDS11809.1	17q25.3	2009-04-14			ENSG00000182459	ENSG00000182459			33802	protein-coding gene	gene with protein product		615647					Standard	NM_207459		Approved	FLJ35767	uc002keq.3	Q8NA77	OTTHUMG00000132857	ENST00000333437.4:c.439T>C	chr17.hg19:g.80320465T>C	ENSP00000331500:p.Trp147Arg	1						p.W147R	NM_207459.3	NP_997342.1	0	4	4	2.260794	Q8NA77	TEX19_HUMAN		2	749	+				Missense_Mutation	SNP	ENST00000333437.4	1	1	hg19	c.439T>C	CCDS11809.1	1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901393	0.33535	.	.	ENSG00000182459	ENST00000333437	.	.	.	3.55	3.55	0.40652	3.55	3.55	0.40652	.	.	.	.	.	T	0.58524	0.2128	L	0.34521	1.04	0.36261	D	0.85455	D	0.89917	1.0	D	0.87578	0.998	T	0.66376	-0.5939	8	0.87932	D	0	-12.8215	8.7547	0.34639	0.0:0.0:0.0:1.0	.	147	Q8NA77	TEX19_HUMAN	R	147	.	ENSP00000331500:W147R	W	+	1	0	0	TEX19	77913754	77913754	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	1.553000	0.36255	1.836000	0.53414	0.460000	0.39030	TGG	0.684211		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.597	TEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256331.1	1	0	1		2	2	2	0		0	0	66		66	63	1	3.450000	-20.000000	1	0.520000	NM_207459			79	78		340	332	1		1			0	0	66	0		1	0	0	0	0	0	0	79	340
MIB1	57534	broad.mit.edu	37	18	19353645	19353645	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr18:19353645G>A	ENST00000261537.6	+	4	856	c.592G>A	c.(592-594)Gat>Aat	p.D198N	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	198	MIB/HERC2 2. {ECO:0000255|PROSITE- ProRule:PRU00749}.				blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TGTCCTCTGGGATAATGGTGC	0.428																																						ENST00000261537.6	0.740000	2.900000e-01	0.600000	0.380000	0.480000	0.497724	0.480000	0.490000																										0				27						c.(592-594)Gat>Aat		mindbomb E3 ubiquitin protein ligase 1							101.0	86.0	91.0					18																	19353645		2203	4300	6503	SO:0001583	missense	57534	0	0					g.chr18:19353645G>A	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.592G>A	chr18.hg19:g.19353645G>A	ENSP00000261537:p.Asp198Asn	1					MIB1_ENST00000578646.1_3'UTR	p.D198N	NM_020774.2	NP_065825.1	1	9	10	4.179110	Q86YT6	MIB1_HUMAN	STAD - Stomach adenocarcinoma(5;0.212)	4	856	+			B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	1	1	hg19	c.592G>A	CCDS11871.1	0	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795298	0.90453	.	.	ENSG00000101752	ENST00000261537	T	0.39406	1.08	5.36	5.36	0.76844	5.36	5.36	0.76844	Mib-herc2 (2);	0.000000	0.85682	D	0.000000	T	0.66197	0.2765	M	0.79258	2.445	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.63444	-0.6636	10	0.30078	T	0.28	-20.2918	19.0873	0.93209	0.0:0.0:1.0:0.0	.	198	Q86YT6	MIB1_HUMAN	N	198	ENSP00000261537:D198N	ENSP00000261537:D198N	D	+	1	0	0	MIB1	17607643	17607643	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.864000	0.99589	2.508000	0.84585	0.655000	0.94253	GAT	0.842022		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.428	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	0	0	1		2	2	2	0		0	0	38		38	38	1	3.450000	-19.971710	1	0.520000	NM_020774			23	23		544	539	0		1	0		0	0	38	0		9.999993e-01	2.378788e-01	0	0	0	22	0	23	544
HDHD2	84064	broad.mit.edu	37	18	44661018	44661018	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr18:44661018C>T	ENST00000300605.6	-	3	311	c.159G>A	c.(157-159)aaG>aaA	p.K53K	HDHD2_ENST00000587841.1_Intron	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	53						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						ACAGGTCTTGCTTGCTCTCTT	0.403																																						ENST00000300605.6	0.800000	5.200000e-01	0.740000	0.590000	0.660000	0.668812	0.660000	0.660000																										0				6						c.(157-159)aaG>aaA		haloacid dehalogenase-like hydrolase domain containing 2							164.0	164.0	164.0					18																	44661018		2203	4300	6503	SO:0001819	synonymous_variant	84064	0	0					g.chr18:44661018C>T	AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.159G>A	chr18.hg19:g.44661018C>T		1					HDHD2_ENST00000587841.1_Intron	p.K53K	NM_032124.4	NP_115500.1	0	1	1	1.095673	Q9H0R4	HDHD2_HUMAN		3	311	-			A8K7T3|Q96NV4	Silent	SNP	ENST00000300605.6	1	1	hg19	c.159G>A	CCDS32829.1	0																																																																																								0.351351		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.403	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	1	0	1		2	2	2	0		0	0	101		101	98	1	3.450000	-20.000000	1	0.520000	NM_032124			65	65		212	206	1		1	1		0	0	101	0		1	7.194426e-01	0	4	0	6	0	65	212
ATF5	22809	broad.mit.edu	37	19	50436260	50436260	+	Missense_Mutation	SNP	G	G	A	rs376565297	byFrequency	TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr19:50436260G>A	ENST00000423777.2	+	3	1137	c.760G>A	c.(760-762)Gca>Aca	p.A254T	CTC-326K19.6_ENST00000451973.1_Intron|MIR4751_ENST00000578027.1_RNA|ATF5_ENST00000595125.1_Missense_Mutation_p.A254T	NM_001193646.1	NP_001180575.1	Q9Y2D1	ATF5_HUMAN	activating transcription factor 5	254	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|olfactory bulb interneuron development (GO:0021891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription corepressor activity (GO:0003714)			NS(1)|endometrium(2)|large_intestine(1)|skin(3)	7		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00221)|OV - Ovarian serous cystadenocarcinoma(262;0.017)	Pseudoephedrine(DB00852)	GAAGGAACGGGCAGAGTCCGT	0.667													G|||	4	0.000798722	0.003	0.0	5008	,	,		14028	0.0		0.0	False		,,,				2504	0.0				GBM(48;768 989 9196 9511 26329)	ENST00000423777.2	1.000000	2.400000e-01	1.000000	0.340000	0.480000	0.562129	0.480000	0.440000																										0				7						c.(760-762)Gca>Aca		activating transcription factor 5	Pseudoephedrine(DB00852)	G	THR/ALA,THR/ALA	1,4403		0,1,2201	37.0	40.0	39.0		760,760	4.5	0.9	19		39	0,8600		0,0,4300	no	missense,missense	ATF5	NM_001193646.1,NM_012068.5	58,58	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	254/283,254/283	50436260	1,13003	2202	4300	6502	SO:0001583	missense	22809	9	121408	35				g.chr19:50436260G>A	AF101388	CCDS12789.1	19q13.33	2013-09-20			ENSG00000169136	ENSG00000169136		"""basic leucine zipper proteins"""	790	protein-coding gene	gene with protein product		606398				10373550	Standard	NM_012068		Approved		uc002prd.3	Q9Y2D1	OTTHUMG00000183065	ENST00000423777.2:c.760G>A	chr19.hg19:g.50436260G>A	ENSP00000396954:p.Ala254Thr	1					MIR4751_ENST00000578027.1_RNA|ATF5_ENST00000595125.1_Missense_Mutation_p.A254T|CTC-326K19.6_ENST00000451973.1_Intron	p.A254T	NM_001193646.1	NP_001180575.1	3	5	8	3.069081	Q9Y2D1	ATF5_HUMAN		3	1137	+		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)	B3KND3|Q9BSA1|Q9UNQ3	Missense_Mutation	SNP	ENST00000423777.2	1	1	hg19	c.760G>A	CCDS12789.1	0	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734599	0.69189	2.27E-4	0.0	ENSG00000169136	ENST00000423777	T	0.56776	0.44	4.54	4.54	0.55810	4.54	4.54	0.55810	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.071375	0.53938	D	0.000044	T	0.66992	0.2846	M	0.69358	2.11	0.48511	D	0.999666	D	0.69078	0.997	D	0.72338	0.977	T	0.68880	-0.5292	10	0.56958	D	0.05	-6.7244	10.1231	0.42632	0.0:0.0:0.8:0.2	.	254	Q9Y2D1	ATF5_HUMAN	T	254	ENSP00000396954:A254T	ENSP00000396954:A254T	A	+	1	0	0	ATF5	55128072	55128072	1.000000	0.71417	0.950000	0.38849	0.353000	0.29299	7.197000	0.77814	2.079000	0.62486	0.448000	0.29417	GCA	0.773926		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.667	ATF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464915.2	1	0	1		2	2	2	0		0	0	22		22	22	1	3.450000	-14.630450	1	0.520000				12	11		218	211	1		1	1		0	0	22	0		9.989952e-01	9.551694e-01	0	12	0	87	0	12	218
ZNF28	7576	broad.mit.edu	37	19	53303834	53303834	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr19:53303834A>T	ENST00000457749.2	-	4	1383	c.1264T>A	c.(1264-1266)Tat>Aat	p.Y422N	ZNF28_ENST00000414252.2_Missense_Mutation_p.Y369N|ZNF28_ENST00000360272.4_Missense_Mutation_p.Y369N|ZNF28_ENST00000438150.2_Missense_Mutation_p.Y369N	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TATGAATTATATGCAAAAGCC	0.353																																						ENST00000457749.2	1.000000	1.000000e-02	1.000000	0.030000	0.070000	0.249742	0.070000	0.060000																										0				34						c.(1264-1266)Tat>Aat		zinc finger protein 28							117.0	124.0	122.0					19																	53303834		2203	4300	6503	SO:0001583	missense	7576	0	0					g.chr19:53303834A>T	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1264T>A	chr19.hg19:g.53303834A>T	ENSP00000397693:p.Tyr422Asn	1					ZNF28_ENST00000414252.2_Missense_Mutation_p.Y369N|ZNF28_ENST00000360272.4_Missense_Mutation_p.Y369N|ZNF28_ENST00000438150.2_Missense_Mutation_p.Y369N	p.Y422N	NM_006969.3	NP_008900.3	3	5	8	3.069081	P17035	ZNF28_HUMAN		4	1383	-			A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	0	1	hg19	c.1264T>A	CCDS33093.2	0	.	.	.	.	.	.	.	.	.	.	-	3.848	-0.032494	0.07543	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.08458	3.09;3.09;3.09;3.09;3.09	1.75	-3.5	0.04710	1.75	-3.5	0.04710	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04998	0.0134	N	0.25647	0.755	0.09310	N	1	B	0.23128	0.08	B	0.25140	0.058	T	0.40213	-0.9575	9	0.30854	T	0.27	.	4.1215	0.10108	0.3639:0.3121:0.324:0.0	.	422	P17035	ZNF28_HUMAN	N	369;422;369;369;369	ENSP00000412143:Y369N;ENSP00000397693:Y422N;ENSP00000353410:Y369N;ENSP00000444965:Y369N;ENSP00000375661:Y369N	ENSP00000353410:Y369N	Y	-	1	0	0	ZNF28	57995646	57995646	0.000000	0.05858	0.000000	0.03702	0.132000	0.20833	-11.752000	0.00003	-1.516000	0.01782	0.165000	0.16767	TAT	0.773926		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.353	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	0	0	1		2	2	2	0		0	0	158		158	157	1	3.450000	-3.315119	1	0.520000	NM_006969			10	10		1165	1150	0		1	0		0	0	158	0		9.966350e-01	2.406038e-02	0	1	0	24	0	10	1165
NLRP12	91662	broad.mit.edu	37	19	54314230	54314230	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr19:54314230T>C	ENST00000324134.6	-	3	851	c.683A>G	c.(682-684)cAc>cGc	p.H228R	NLRP12_ENST00000535162.1_Missense_Mutation_p.H228R|NLRP12_ENST00000345770.5_Missense_Mutation_p.H228R|NLRP12_ENST00000391775.3_Missense_Mutation_p.H228R|NLRP12_ENST00000354278.3_Missense_Mutation_p.H228R|NLRP12_ENST00000351894.4_Missense_Mutation_p.H228R|NLRP12_ENST00000391773.1_Missense_Mutation_p.H228R|NLRP12_ENST00000391772.1_Missense_Mutation_p.H228R	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	228	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CATCACCTTGTGTGCCAGCAT	0.577																																						ENST00000324134.6	1.000000	1.300000e-01	1.000000	0.180000	0.260000	0.399713	0.260000	0.250000																										0				80						c.(682-684)cAc>cGc		NLR family, pyrin domain containing 12							91.0	69.0	77.0					19																	54314230		2203	4300	6503	SO:0001583	missense	91662	0	0					g.chr19:54314230T>C	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.683A>G	chr19.hg19:g.54314230T>C	ENSP00000319377:p.His228Arg	1					NLRP12_ENST00000535162.1_Missense_Mutation_p.H228R|NLRP12_ENST00000354278.3_Missense_Mutation_p.H228R|NLRP12_ENST00000391772.1_Missense_Mutation_p.H228R|NLRP12_ENST00000345770.5_Missense_Mutation_p.H228R|NLRP12_ENST00000391773.1_Missense_Mutation_p.H228R|NLRP12_ENST00000351894.4_Missense_Mutation_p.H228R|NLRP12_ENST00000391775.3_Missense_Mutation_p.H228R	p.H228R	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	3	5	8	3.069081	P59046	NAL12_HUMAN		3	851	-	Ovarian(34;0.19)		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	1	1	hg19	c.683A>G	CCDS12864.1	0	.	.	.	.	.	.	.	.	.	.	T	0.687	-0.795867	0.02862	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	4.47	1.18	0.20946	4.47	1.18	0.20946	NACHT nucleoside triphosphatase (1);	0.313100	0.23263	N	0.050104	T	0.42359	0.1199	N	0.01493	-0.835	0.80722	D	1	B;B;B;B	0.26935	0.134;0.064;0.134;0.164	B;B;B;B	0.26517	0.031;0.031;0.031;0.07	T	0.45101	-0.9284	10	0.02654	T	1	.	7.0128	0.24871	0.0:0.2972:0.0:0.7028	.	228;228;228;228	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	R	228	ENSP00000319377:H228R;ENSP00000438030:H228R;ENSP00000340473:H228R;ENSP00000346231:H228R;ENSP00000375655:H228R;ENSP00000375653:H228R;ENSP00000375652:H228R	ENSP00000319377:H228R	H	-	2	0	0	NLRP12	59006042	59006042	0.996000	0.38824	0.973000	0.42090	0.891000	0.51852	0.716000	0.25836	0.224000	0.20940	0.254000	0.18369	CAC	0.773926		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.577	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	0	0	0		25	2	2	1		1	1	58		58	56	1	3.450000	-13.396060	1	0.520000	NM_144687			14	14		463	461	0		0			1	0	58	0		4.776192e-02	0	0	0	0	0	0	14	463
FUT6	2528	broad.mit.edu	37	19	5831521	5831521	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr19:5831521C>T	ENST00000318336.4	-	3	2252	c.1058G>A	c.(1057-1059)gGc>gAc	p.G353D	FUT6_ENST00000286955.5_Missense_Mutation_p.G353D|FUT6_ENST00000592563.1_Intron|FUT6_ENST00000527106.1_Missense_Mutation_p.G353D|FUT6_ENST00000524754.1_Missense_Mutation_p.G353D	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	353					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						AGCCGCTATGCCGCGTGTCTG	0.632																																						ENST00000318336.4	1.000000	2.000000e-02	1.000000	0.040000	0.070000	0.278948	0.070000	0.060000																										0				6						c.(1057-1059)gGc>gAc		fucosyltransferase 6 (alpha (1,3) fucosyltransferase)							70.0	80.0	77.0					19																	5831521		2203	4300	6503	SO:0001583	missense	2528	0	0					g.chr19:5831521C>T		CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.1058G>A	chr19.hg19:g.5831521C>T	ENSP00000313398:p.Gly353Asp	1					FUT6_ENST00000592563.1_Intron|FUT6_ENST00000527106.1_Missense_Mutation_p.G353D|FUT6_ENST00000524754.1_Missense_Mutation_p.G353D|FUT6_ENST00000286955.5_Missense_Mutation_p.G353D	p.G353D	NM_000150.2	NP_000141.1	0	4	4	1.734322	P51993	FUT6_HUMAN		3	2252	-			A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	ENST00000318336.4	0	1	hg19	c.1058G>A	CCDS12152.1	0	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544153	0.27563	.	.	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	3.23	3.23	0.37069	3.23	3.23	0.37069	.	.	.	.	.	T	0.04634	0.0126	N	0.00182	-1.905	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	9	0.06236	T	0.91	.	12.6777	0.56903	0.0:1.0:0.0:0.0	.	353	P51993	FUT6_HUMAN	D	353	ENSP00000431708:G353D;ENSP00000432954:G353D;ENSP00000313398:G353D;ENSP00000286955:G353D	ENSP00000286955:G353D	G	-	2	0	0	FUT6	5782521	5782521	0.004000	0.15560	0.326000	0.25389	0.012000	0.07955	0.883000	0.28200	1.743000	0.51761	0.436000	0.28706	GGC	0.593909		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.632	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394218.2	0	0	1		2	2	2	0		0	0	92		92	84	1	3.450000	-1.912481	0	0.520000	NM_000150			6	6		411	384	0		1	0		0	0	92	0		9.573416e-01	1.048388e-01	0	0	0	32	0	6	411
ZNF543	125919	broad.mit.edu	37	19	57839619	57839619	+	Silent	SNP	T	T	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr19:57839619T>C	ENST00000321545.4	+	4	1134	c.789T>C	c.(787-789)gcT>gcC	p.A263A		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GTGGGAAGGCTTTTAACCGCA	0.522																																						ENST00000321545.4	1.000000	1.000000e-02	1.000000	0.050000	0.100000	0.267594	0.100000	0.070000																										0				28						c.(787-789)gcT>gcC		zinc finger protein 543							67.0	66.0	66.0					19																	57839619		2203	4300	6503	SO:0001819	synonymous_variant	125919	1	121412	33				g.chr19:57839619T>C	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.789T>C	chr19.hg19:g.57839619T>C		1						p.A263A	NM_213598.3	NP_998763.2	3	5	8	3.109811	Q08ER8	ZN543_HUMAN		4	1134	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Silent	SNP	ENST00000321545.4	0	1	hg19	c.789T>C	CCDS33130.1	0																																																																																								0.777200		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.522	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	0	0	1		2	2	2	0		0	0	49		49	47	1	3.450000	-2.588949	1	0.520000	XM_064865			5	5		468	461	0		1	0		0	0	49	0		9.353779e-01	6.160546e-03	0	0	0	9	0	5	468
VPS13D	55187	broad.mit.edu	37	1	12364627	12364627	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:12364627C>T	ENST00000358136.3	+	26	6411	c.6281C>T	c.(6280-6282)aCg>aTg	p.T2094M	VPS13D_ENST00000356315.4_Missense_Mutation_p.T2094M	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ACGACAAGCACGGAGGAGCCC	0.522																																						ENST00000358136.3	1.000000	5.400000e-01	1.000000	0.670000	0.810000	0.818492	0.810000	1.000000																										0				130						c.(6280-6282)aCg>aTg		vacuolar protein sorting 13 homolog D (S. cerevisiae)							63.0	59.0	60.0					1																	12364627		2203	4300	6503	SO:0001583	missense	55187	0	0					g.chr1:12364627C>T	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.6281C>T	chr1.hg19:g.12364627C>T	ENSP00000350854:p.Thr2094Met	1					VPS13D_ENST00000356315.4_Missense_Mutation_p.T2094M	p.T2094M	NM_015378.2	NP_056193.2	2	2	4	2.143394				26	6411	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		Missense_Mutation	SNP	ENST00000358136.3	1	1	hg19	c.6281C>T	CCDS30588.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.278|3.278	-0.147578|-0.147578	0.06627|0.06627	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|T;T	.|0.53206	.|0.63;0.64	5.94|5.94	1.31|1.31	0.21738|0.21738	5.94|5.94	1.31|1.31	0.21738|0.21738	.|.	.|1.074530	.|0.07029	.|N	.|0.828020	T|T	0.27798|0.27798	0.0684|0.0684	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.13145	.|0.007;0.002	.|B;B	.|0.09377	.|0.004;0.002	T|T	0.21655|0.21655	-1.0239|-1.0239	5|10	.|0.33940	.|T	.|0.23	.|.	8.7283|8.7283	0.34483|0.34483	0.0:0.6002:0.0:0.3998|0.0:0.6002:0.0:0.3998	.|.	.|2094;2094	.|Q5THJ4-2;Q5THJ4	.|.;VP13D_HUMAN	W|M	917|2094	.|ENSP00000348666:T2094M;ENSP00000350854:T2094M	.|ENSP00000348666:T2094M	R|T	+|+	1|2	2|0	2|0	VPS13D|VPS13D	12287214|12287214	12287214|12287214	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	0.256000|0.256000	0.18351|0.18351	0.362000|0.362000	0.24319|0.24319	-0.224000|-0.224000	0.12420|0.12420	CGG|ACG	0.675325		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.522	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	1	0	1		2	2	2	0		0	0	25		25	24	1	3.450000	-20.000000	1	0.520000	NM_015378			26	26		160	156	1		1	0		0	0	25	0		9.999999e-01	1.551381e-01	0	0	0	5	0	26	160
COL11A1	1301	broad.mit.edu	37	1	103400665	103400665	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:103400665G>C	ENST00000370096.3	-	45	3755	c.3443C>G	c.(3442-3444)cCt>cGt	p.P1148R	COL11A1_ENST00000358392.2_Missense_Mutation_p.P1160R|COL11A1_ENST00000512756.1_Missense_Mutation_p.P1032R|COL11A1_ENST00000353414.4_Missense_Mutation_p.P1109R	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1148	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGGACCGGGAGGGCCCTGCAG	0.448																																						ENST00000370096.3	1.000000	4.000000e-01	0.920000	0.530000	0.690000	0.714249	0.690000	1.000000																										0				258						c.(3442-3444)cCt>cGt		collagen, type XI, alpha 1							30.0	32.0	31.0					1																	103400665		2203	4300	6503	SO:0001583	missense	1301	0	0					g.chr1:103400665G>C	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3443C>G	chr1.hg19:g.103400665G>C	ENSP00000359114:p.Pro1148Arg	1					COL11A1_ENST00000512756.1_Missense_Mutation_p.P1032R|COL11A1_ENST00000358392.2_Missense_Mutation_p.P1160R|COL11A1_ENST00000353414.4_Missense_Mutation_p.P1109R	p.P1148R	NM_001854.3	NP_001845.3	2	2	4	2.124937	P12107	COBA1_HUMAN		45	3755	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	1	1	hg19	c.3443C>G	CCDS778.1	0	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171191	0.57584	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.98684	-5.07;-5.07;-5.07;-5.07	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	L	0.41492	1.28	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.989;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.996;0.967;0.999;0.997;0.997	D	0.99935	1.1349	10	0.87932	D	0	.	19.4476	0.94854	0.0:0.0:1.0:0.0	.	1032;1109;1160;1148;368	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	R	1148;1160;1109;368;1032	ENSP00000359114:P1148R;ENSP00000351163:P1160R;ENSP00000302551:P1109R;ENSP00000426533:P1032R	ENSP00000302551:P1109R	P	-	2	0	0	COL11A1	103173253	103173253	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	9.813000	0.99286	2.588000	0.87417	0.655000	0.94253	CCT	0.673025		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.448	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	1	0	1		2	2	2	0		0	0	25		25	23	1	3.450000	-19.999440	1	0.520000	NM_080630			15	14		113	110	1		1	0		0	0	25	0		9.998797e-01	3.060848e-01	0	0	0	9	0	15	113
CENPF	1063	broad.mit.edu	37	1	214815002	214815002	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:214815002G>A	ENST00000366955.3	+	12	3489	c.3321G>A	c.(3319-3321)caG>caA	p.Q1107Q		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGACAGTGCAGCAAGCTCTGA	0.373																																					Colon(80;575 1284 11000 14801 43496)	ENST00000366955.3	0.210000	1.000000e-02	0.160000	0.050000	0.090000	0.108930	0.090000	0.100000																										0				126						c.(3319-3321)caG>caA		centromere protein F, 350/400kDa							80.0	82.0	81.0					1																	214815002		2203	4300	6503	SO:0001819	synonymous_variant	1063	0	0					g.chr1:214815002G>A	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3321G>A	chr1.hg19:g.214815002G>A		1						p.Q1107Q	NM_016343.3	NP_057427.3	2	3	5	2.588351	P49454	CENPF_HUMAN		12	3489	+			Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	0	1	hg19	c.3321G>A	CCDS31023.1	0																																																																																								0.730337		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.373	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	0	0	1		2	2	2	0		0	0	39		39	39	1	3.450000	-3.325794	1	0.520000	NM_016343			5	5		367	362	0		1	0		0	0	39	0		9.357022e-01	7.702465e-03	0	0	0	8	0	5	367
TP53BP2	7159	broad.mit.edu	37	1	223986037	223986037	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:223986037C>T	ENST00000343537.7	-	12	2119	c.1828G>A	c.(1828-1830)Gtg>Atg	p.V610M	TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391879.2_Intron|TP53BP2_ENST00000391878.2_Missense_Mutation_p.V481M	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	604					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		CTTGCTGCCACGGTCTGGGGT	0.527																																						ENST00000343537.7	0.370000	1.600000e-01	0.320000	0.210000	0.250000	0.267459	0.250000	0.250000																										0				29						c.(1828-1830)Gtg>Atg		tumor protein p53 binding protein 2							114.0	119.0	117.0					1																	223986037		2203	4300	6503	SO:0001583	missense	7159	0	0					g.chr1:223986037C>T	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.1828G>A	chr1.hg19:g.223986037C>T	ENSP00000341957:p.Val610Met	1					TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.V481M|TP53BP2_ENST00000391879.2_Intron	p.V610M	NM_001031685.2	NP_001026855.2	2	3	5	2.588351	Q13625	ASPP2_HUMAN		12	2119	-			B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	1	1	hg19	c.1828G>A	CCDS44319.1	0	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229638	0.79688	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.56941	0.43;0.62	5.88	5.88	0.94601	5.88	5.88	0.94601	.	0.055023	0.64402	D	0.000001	T	0.67477	0.2897	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.85130	0.997;0.49	T	0.61352	-0.7080	10	0.33940	T	0.23	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	610;604	B4DG66;Q13625	.;ASPP2_HUMAN	M	481;610	ENSP00000375750:V481M;ENSP00000341957:V610M	ENSP00000341957:V610M	V	-	1	0	0	TP53BP2	222052660	222052660	0.997000	0.39634	0.966000	0.40874	0.972000	0.66771	3.655000	0.54460	2.782000	0.95742	0.655000	0.94253	GTG	0.730337		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.527	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	1	0	1		2	2	2	0		0	0	110		110	107	1	3.450000	-3.849560	1	0.520000	NM_001031685, NM_005426			30	30		761	748	0		1	1	1	0	0	110	993		1	8.394246e-01	1	5	79	81	1853	30	761
FCN3	8547	broad.mit.edu	37	1	27697110	27697110	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:27697110C>T	ENST00000270879.4	-	7	640	c.635G>A	c.(634-636)gGc>gAc	p.G212D	FCN3_ENST00000354982.2_Missense_Mutation_p.G201D	NM_003665.2	NP_003656.2	O75636	FCN3_HUMAN	ficolin (collagen/fibrinogen domain containing) 3	212	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	7		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.42e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TGAGAACTTGCCCAGTGCCAG	0.582																																						ENST00000270879.4	1.000000	1.000000e-02	0.140000	0.040000	0.080000	0.161743	0.080000	0.080000																										0				7						c.(634-636)gGc>gAc		ficolin (collagen/fibrinogen domain containing) 3							107.0	105.0	106.0					1																	27697110		2203	4300	6503	SO:0001583	missense	8547	0	0					g.chr1:27697110C>T	D88587	CCDS300.1, CCDS301.1	1p36.11	2014-09-17	2013-09-12		ENSG00000142748	ENSG00000142748		"""Fibrinogen C domain containing"""	3625	protein-coding gene	gene with protein product	"""Hakata antigen"""	604973	"""ficolin (collagen/fibrinogen domain-containing) 3 (Hakata antigen)"""			9694814, 10330454	Standard	NM_003665		Approved	FCNH, HAKA1	uc001boa.3	O75636	OTTHUMG00000005722	ENST00000270879.4:c.635G>A	chr1.hg19:g.27697110C>T	ENSP00000270879:p.Gly212Asp	1					FCN3_ENST00000354982.2_Missense_Mutation_p.G201D	p.G212D	NM_003665.2	NP_003656.2	2	2	4	2.124937	O75636	FCN3_HUMAN		7	640	-		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	Q6IBJ5|Q8WW86	Missense_Mutation	SNP	ENST00000270879.4	0	1	hg19	c.635G>A	CCDS300.1	0	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159905	0.78226	.	.	ENSG00000142748	ENST00000270879;ENST00000354982;ENST00000498393	T;T	0.76186	-1.0;-1.0	4.84	2.93	0.34026	4.84	2.93	0.34026	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.324971	0.25288	N	0.031759	T	0.81432	0.4821	L	0.56769	1.78	0.25196	N	0.990097	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	T	0.70916	-0.4742	10	0.59425	D	0.04	.	10.1394	0.42725	0.0:0.8212:0.0:0.1788	.	201;212	Q6UXM4;O75636	.;FCN3_HUMAN	D	212;201;90	ENSP00000270879:G212D;ENSP00000347077:G201D	ENSP00000270879:G212D	G	-	2	0	0	FCN3	27569697	27569697	0.046000	0.20272	0.975000	0.42487	0.386000	0.30323	0.596000	0.24044	1.198000	0.43158	0.558000	0.71614	GGC	0.673025		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.582	FCN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000015667.1	0	0	1		2	2	2	0		0	0	71		71	70	1	3.450000	-2.070124	0	0.520000				6	6		440	430	0		1	0		0	0	71	0		9.624207e-01	1.619075e-03	0	0	0	4	0	6	440
GPR3	2827	broad.mit.edu	37	1	27720926	27720926	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:27720926C>T	ENST00000374024.3	+	2	723	c.624C>T	c.(622-624)atC>atT	p.I208I		NM_005281.3	NP_005272.1	P46089	GPR3_HUMAN	G protein-coupled receptor 3	208					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|regulation of meiosis (GO:0040020)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(3)|ovary(1)|skin(1)	8		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.81e-26)|Colorectal(126;1.24e-08)|KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;4.45e-06)|Lung(427;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|LUSC - Lung squamous cell carcinoma(448;0.008)|READ - Rectum adenocarcinoma(331;0.0419)		TGTTTGGCATCATGCTGCAGC	0.577																																						ENST00000374024.3	1.000000	9.000000e-02	0.260000	0.130000	0.180000	0.255630	0.180000	0.190000																										0				8						c.(622-624)atC>atT		G protein-coupled receptor 3							214.0	185.0	195.0					1																	27720926		2203	4300	6503	SO:0001819	synonymous_variant	2827	0	0					g.chr1:27720926C>T	BC032702	CCDS303.1	1p36.1-p35	2012-08-21			ENSG00000181773	ENSG00000181773		"""GPCR / Class A : Orphans"""	4484	protein-coding gene	gene with protein product		600241				7851889	Standard	NM_005281		Approved	ACCA	uc001bod.4	P46089	OTTHUMG00000003397	ENST00000374024.3:c.624C>T	chr1.hg19:g.27720926C>T		1						p.I208I	NM_005281.3	NP_005272.1	2	2	4	2.124937	P46089	GPR3_HUMAN		2	723	+		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)	A8K570	Silent	SNP	ENST00000374024.3	1	1	hg19	c.624C>T	CCDS303.1	0																																																																																								0.673025		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.577	GPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009522.1	0	0	1		2	2	2	0		0	0	99		99	95	1	3.450000	-3.222301	1	0.520000	NM_005281			14	14		429	423	0		1			0	0	99	0		9.997344e-01	0	0	0	0	0	0	14	429
LRRC7	57554	broad.mit.edu	37	1	70257750	70257750	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:70257750C>T	ENST00000035383.5	+	2	244	c.214C>T	c.(214-216)Cga>Tga	p.R72*	LRRC7_ENST00000370958.1_Nonsense_Mutation_p.R110*|LRRC7_ENST00000310961.5_Nonsense_Mutation_p.R77*|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	72						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.R72G(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCAAGCTCTACGAAAACTAAG	0.294																																						ENST00000035383.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.R72G(1)	ovary(1)	162						c.(214-216)Cga>Tga		leucine rich repeat containing 7							95.0	103.0	100.0					1																	70257750		2202	4295	6497	SO:0001587	stop_gained	57554	0	0					g.chr1:70257750C>T		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.214C>T	chr1.hg19:g.70257750C>T	ENSP00000035383:p.Arg72*	1					LRRC7_ENST00000370958.1_Nonsense_Mutation_p.R110*|LRRC7_ENST00000310961.5_Nonsense_Mutation_p.R77*|LRRC7_ENST00000415775.2_5'UTR	p.R72*	NM_020794.2	NP_065845.1	2	2	4	2.124937	Q96NW7	LRRC7_HUMAN		2	244	+			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Nonsense_Mutation	SNP	ENST00000035383.5	0	1	hg19	c.214C>T	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.592986	0.97688	.	.	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	.	.	.	5.68	2.7	0.31948	5.68	2.7	0.31948	.	0.148908	0.46758	D	0.000280	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3006	0.60324	0.4547:0.5453:0.0:0.0	.	.	.	.	X	77;110;72;72	.	ENSP00000035383:R72X	R	+	1	2	2	LRRC7	70030338	70030338	0.999000	0.42202	0.999000	0.59377	0.997000	0.91878	2.305000	0.43664	0.277000	0.22141	0.561000	0.74099	CGA	0.673025		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.294	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	1	0	1		20	2	2	0		0	1	83		83	81	1	3.450000	-20.000000	1	0.520000	NM_020794			134	134		352	350	1		1			0	0	83	0		1	0	0	0	0	0	0	134	352
LRRC7	57554	broad.mit.edu	37	1	70541973	70541973	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:70541973C>A	ENST00000035383.5	+	22	4360	c.4330C>A	c.(4330-4332)Cca>Aca	p.P1444T	LRRC7_ENST00000310961.5_Missense_Mutation_p.P1402T|LRRC7_ENST00000415775.2_Missense_Mutation_p.P728T	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1444						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GGATGGATATCCAGAGCAGGT	0.463																																						ENST00000035383.5	1.000000	5.600000e-01	0.980000	0.670000	0.800000	0.813251	0.800000	1.000000																										0				162						c.(4330-4332)Cca>Aca		leucine rich repeat containing 7							60.0	61.0	60.0					1																	70541973		2203	4300	6503	SO:0001583	missense	57554	0	0					g.chr1:70541973C>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4330C>A	chr1.hg19:g.70541973C>A	ENSP00000035383:p.Pro1444Thr	1					LRRC7_ENST00000310961.5_Missense_Mutation_p.P1402T|LRRC7_ENST00000415775.2_Missense_Mutation_p.P728T	p.P1444T	NM_020794.2	NP_065845.1	2	2	4	2.124937	Q96NW7	LRRC7_HUMAN		22	4360	+			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	1	1	hg19	c.4330C>A	CCDS645.1	0	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575374	0.65878	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.36520	1.25;1.31;2.41	6.16	6.16	0.99307	6.16	6.16	0.99307	PDZ/DHR/GLGF (1);	0.129386	0.53938	D	0.000049	T	0.20414	0.0491	N	0.08118	0	0.54753	D	0.999982	P;P;P	0.44429	0.787;0.835;0.608	B;P;B	0.47645	0.372;0.553;0.18	T	0.04930	-1.0917	10	0.37606	T	0.19	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	728;1397;1444	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	T	1402;1444;728;1220	ENSP00000309245:P1402T;ENSP00000035383:P1444T;ENSP00000394867:P728T	ENSP00000035383:P1444T	P	+	1	0	0	LRRC7	70314561	70314561	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.176000	0.71955	2.937000	0.99478	0.650000	0.86243	CCA	0.673025		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.463	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	1	0	1		2	2	2	0		0	0	25		25	25	1	3.450000	-20.000000	1	0.520000	NM_020794			32	32		198	195	1		1			0	0	25	0		1	0	0	0	0	0	0	32	198
OR2M4	26245	broad.mit.edu	37	1	248403055	248403055	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr1:248403055G>A	ENST00000306687.1	+	1	825	c.825G>A	c.(823-825)tcG>tcA	p.S275S		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	275					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGATGGTGTCGGCCTTCTACA	0.488																																						ENST00000306687.1	1.000000	7.900000e-01	1.000000	0.910000	0.990000	0.969736	0.990000	1.000000																										0				50						c.(823-825)tcG>tcA		olfactory receptor, family 2, subfamily M, member 4							122.0	105.0	111.0					1																	248403055		2203	4300	6503	SO:0001819	synonymous_variant	26245	0	0					g.chr1:248403055G>A	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.825G>A	chr1.hg19:g.248403055G>A		1						p.S275S	NM_017504.1	NP_059974.1	3	4	7	2.496828	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)	1	825	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		Q15611|Q8NG82	Silent	SNP	ENST00000306687.1	1	1	hg19	c.825G>A	CCDS31108.1	1																																																																																								0.720117		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.488	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	1	0	1		2	2	2	0		0	0	46		46	46	1	3.450000	-2.565258	1	0.520000	NM_017504			54	53		298	294	1		1			0	0	46	0		1	0	0	0	0	0	0	54	298
NKX2-4	644524	broad.mit.edu	37	20	21376877	21376877	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr20:21376877C>T	ENST00000351817.4	-	2	1365	c.737G>A	c.(736-738)cGg>cAg	p.R246Q	RP11-227D2.3_ENST00000419666.2_RNA|RP11-227D2.3_ENST00000552439.1_RNA	NM_033176.1	NP_149416.1	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	246					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|upper_aerodigestive_tract(1)	3						CTTGGCCTGCCGTTTCATCTT	0.711																																						ENST00000351817.4	1.000000	4.700000e-01	1.000000	0.650000	0.880000	0.844835	0.880000	1.000000																										0				3						c.(736-738)cGg>cAg		NK2 homeobox 4							33.0	32.0	32.0					20																	21376877		2203	4300	6503	SO:0001583	missense	644524	1	121008	27				g.chr20:21376877C>T		CCDS42855.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125816	ENSG00000125816		"""Homeoboxes / ANTP class : NKL subclass"""	7837	protein-coding gene	gene with protein product		607808	"""NK-2 (Drosophila) homolog D"", ""NK2 transcription factor related, locus 4 (Drosophila)"""	NKX2D		1346742, 10818213	Standard	NM_033176		Approved	NKX2.4	uc010gcz.3	Q9H2Z4	OTTHUMG00000032022	ENST00000351817.4:c.737G>A	chr20.hg19:g.21376877C>T	ENSP00000345147:p.Arg246Gln	1					RP11-227D2.3_ENST00000419666.2_RNA|RP11-227D2.3_ENST00000552439.1_RNA	p.R246Q	NM_033176.1	NP_149416.1	2	2	4	1.603688	Q9H2Z4	NKX24_HUMAN		2	1365	-			Q5VZV8	Missense_Mutation	SNP	ENST00000351817.4	1	1	hg19	c.737G>A	CCDS42855.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394647	0.83011	.	.	ENSG00000125816	ENST00000351817	D	0.96396	-4.0	3.49	3.49	0.39957	3.49	3.49	0.39957	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.56097	U	0.000036	D	0.97885	0.9305	M	0.84156	2.68	0.58432	D	0.999993	D	0.69078	0.997	D	0.72982	0.979	D	0.98753	1.0721	10	0.87932	D	0	.	14.7591	0.69593	0.0:1.0:0.0:0.0	.	246	Q9H2Z4	NKX24_HUMAN	Q	246	ENSP00000345147:R246Q	ENSP00000345147:R246Q	R	-	2	0	0	NKX2-4	21324877	21324877	1.000000	0.71417	0.998000	0.56505	0.688000	0.40055	7.095000	0.76952	1.781000	0.52344	0.484000	0.47621	CGG	0.565217		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.711	NKX2-4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078270.2	1	0	1		2	2	2	0		0	0	19		19	19	1	3.450000	-19.943030	1	0.520000				11	11		46	43	0		1			0	0	19	0		9.984898e-01	0	0	0	0	0	0	11	46
SLC12A5	57468	broad.mit.edu	37	20	44685548	44685548	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr20:44685548C>T	ENST00000454036.2	+	24	3241	c.3192C>T	c.(3190-3192)aaC>aaT	p.N1064N	SLC12A5_ENST00000243964.3_Silent_p.N1041N	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1064					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	AGTGGGAGAACTTGTAAGTGC	0.493																																						ENST00000454036.2	1.000000	6.700000e-01	1.000000	0.770000	0.910000	0.897559	0.910000	1.000000																										0				80						c.(3190-3192)aaC>aaT		solute carrier family 12 (potassium/chloride transporter), member 5	Bumetanide(DB00887)|Potassium Chloride(DB00761)						171.0	161.0	165.0					20																	44685548		2203	4300	6503	SO:0001819	synonymous_variant	57468	0	0					g.chr20:44685548C>T	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3192C>T	chr20.hg19:g.44685548C>T		1					SLC12A5_ENST00000243964.3_Silent_p.N1041N	p.N1064N	NM_001134771.1	NP_001128243.1	3	4	7	2.450645	Q9H2X9	S12A5_HUMAN		24	3241	+		Myeloproliferative disorder(115;0.0122)	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	1	1	hg19	c.3192C>T	CCDS46610.1	1																																																																																								0.715808		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.493	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1	1	0	1		2	2	2	0		0	0	69		69	68	1	3.450000	-20.000000	1	0.520000				54	53		353	348	1		1			0	0	69	0		1	0	0	0	0	0	0	54	353
SLC2A10	81031	broad.mit.edu	37	20	45354423	45354423	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr20:45354423G>A	ENST00000359271.2	+	2	998	c.748G>A	c.(748-750)Gtg>Atg	p.V250M		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	250					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GCAGCCCAACGTGCTGTGCTA	0.622																																						ENST00000359271.2	1.000000	6.300000e-01	1.000000	0.720000	0.810000	0.842551	0.810000	0.790000																										0				34						c.(748-750)Gtg>Atg		solute carrier family 2 (facilitated glucose transporter), member 10							114.0	103.0	107.0					20																	45354423		2203	4300	6503	SO:0001583	missense	81031	3	121412	40				g.chr20:45354423G>A	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.748G>A	chr20.hg19:g.45354423G>A	ENSP00000352216:p.Val250Met	1						p.V250M	NM_030777.3	NP_110404.1	3	4	7	2.450645	O95528	GTR10_HUMAN		2	998	+		Myeloproliferative disorder(115;0.0122)	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	1	1	hg19	c.748G>A	CCDS13402.1	0	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586473	0.66105	.	.	ENSG00000197496	ENST00000359271	T	0.76448	-1.02	5.86	4.89	0.63831	5.86	4.89	0.63831	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.057050	0.64402	D	0.000002	D	0.86146	0.5863	M	0.76170	2.325	0.49798	D	0.999825	D	0.89917	1.0	D	0.76071	0.987	D	0.87084	0.2168	10	0.87932	D	0	-18.7043	10.4704	0.44633	0.0688:0.0:0.7961:0.1351	.	250	O95528	GTR10_HUMAN	M	250	ENSP00000352216:V250M	ENSP00000352216:V250M	V	+	1	0	0	SLC2A10	44787830	44787830	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	4.571000	0.60879	1.432000	0.47375	0.655000	0.94253	GTG	0.715808		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.622	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2	1	0	1		2	2	2	0		0	0	102		102	100	1	3.450000	-20.000000	1	0.520000				83	83		603	593	1		1	0		0	0	102	0		1	5.219725e-01	0	0	0	14	0	83	603
TIAM1	7074	broad.mit.edu	37	21	32493062	32493062	+	Missense_Mutation	SNP	G	G	A	rs201116117		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr21:32493062G>A	ENST00000286827.3	-	29	4871	c.4400C>T	c.(4399-4401)cCg>cTg	p.P1467L	TIAM1_ENST00000541036.1_Missense_Mutation_p.P1407L	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1467					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTCTTTCTCCGGGCTGCTTGC	0.577																																						ENST00000286827.3	1.000000	4.800000e-01	1.000000	0.570000	0.680000	0.728872	0.680000	0.660000																										0				115						c.(4399-4401)cCg>cTg		T-cell lymphoma invasion and metastasis 1							47.0	51.0	49.0					21																	32493062		2203	4300	6503	SO:0001583	missense	7074	11	121412	43				g.chr21:32493062G>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4400C>T	chr21.hg19:g.32493062G>A	ENSP00000286827:p.Pro1467Leu	1					TIAM1_ENST00000541036.1_Missense_Mutation_p.P1407L	p.P1467L	NM_003253.2	NP_003244.2	1	2	3	1.721172	Q13009	TIAM1_HUMAN		29	4871	-			B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	1	1	hg19	c.4400C>T	CCDS13609.1	0	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789061	0.90367	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.42131	0.98;1.01	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.126543	0.53938	D	0.000041	T	0.49525	0.1562	L	0.50333	1.59	0.80722	D	1	D;D	0.58970	0.981;0.984	P;B	0.49637	0.617;0.413	T	0.51012	-0.8759	10	0.51188	T	0.08	.	18.6336	0.91369	0.0:0.0:1.0:0.0	.	1407;1467	F5GZ53;Q13009	.;TIAM1_HUMAN	L	1467;1407	ENSP00000286827:P1467L;ENSP00000441570:P1407L	ENSP00000286827:P1467L	P	-	2	0	0	TIAM1	31414933	31414933	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.421000	0.80204	2.377000	0.81083	0.655000	0.94253	CCG	0.598326		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.577	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	1	0	1		2	2	2	0		0	0	42		42	41	1	3.450000	-2.545005	1	0.520000	NM_003253			38	37		227	219	1		1	0		0	0	42	0		1	2.730592e-01	0	0	0	7	0	38	227
TIAM1	7074	broad.mit.edu	37	21	32589921	32589921	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr21:32589921C>A	ENST00000286827.3	-	10	2561	c.2090G>T	c.(2089-2091)tGg>tTg	p.W697L	TIAM1_ENST00000541036.1_Missense_Mutation_p.W697L|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	697					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						ATCCAGACCCCACAGAGAAGA	0.532																																						ENST00000286827.3	1.000000	4.700000e-01	1.000000	0.540000	0.620000	0.683808	0.620000	0.610000																										0				115						c.(2089-2091)tGg>tTg		T-cell lymphoma invasion and metastasis 1							185.0	161.0	169.0					21																	32589921		2203	4300	6503	SO:0001583	missense	7074	0	0					g.chr21:32589921C>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2090G>T	chr21.hg19:g.32589921C>A	ENSP00000286827:p.Trp697Leu	1					TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Missense_Mutation_p.W697L	p.W697L	NM_003253.2	NP_003244.2	1	2	3	1.721172	Q13009	TIAM1_HUMAN		10	2561	-			B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	1	1	hg19	c.2090G>T	CCDS13609.1	0	.	.	.	.	.	.	.	.	.	.	C	19.86	3.906475	0.72868	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.32988	1.43;1.43	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.124926	0.64402	D	0.000016	T	0.33556	0.0867	L	0.54323	1.7	0.80722	D	1	B;B;B;B	0.32573	0.101;0.061;0.376;0.104	B;B;B;B	0.30401	0.098;0.045;0.115;0.11	T	0.08953	-1.0697	10	0.46703	T	0.11	.	19.3868	0.94560	0.0:1.0:0.0:0.0	.	697;697;538;697	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	L	697;538;697	ENSP00000286827:W697L;ENSP00000441570:W697L	ENSP00000286827:W697L	W	-	2	0	0	TIAM1	31511792	31511792	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.569000	0.82380	2.803000	0.96430	0.655000	0.94253	TGG	0.598326		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.532	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	0	0	1		2	2	2	0		0	0	112		112	107	1	3.450000	-2.619883	1	0.520000	NM_003253			57	57		374	364	1		1	0		0	0	112	0		1	1.820968e-02	0	0	0	2	0	57	374
COL18A1	80781	broad.mit.edu	37	21	46932271	46932271	+	Missense_Mutation	SNP	G	G	A	rs573442861		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr21:46932271G>A	ENST00000359759.4	+	41	5245	c.5224G>A	c.(5224-5226)Gtg>Atg	p.V1742M	SLC19A1_ENST00000567670.1_Intron|SLC19A1_ENST00000468508.1_5'Flank|COL18A1_ENST00000400337.2_Missense_Mutation_p.V1327M|COL18A1_ENST00000355480.5_Missense_Mutation_p.V1507M			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1742	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGCCTACATCGTGCTCTGCAT	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		14990	0.001		0.0	False		,,,				2504	0.0					ENST00000359759.4	1.000000	1.600000e-01	0.590000	0.250000	0.380000	0.440891	0.380000	0.340000																										0				25						c.(5224-5226)Gtg>Atg		collagen, type XVIII, alpha 1							26.0	30.0	29.0					21																	46932271		2118	4224	6342	SO:0001583	missense	80781	3	120986	31				g.chr21:46932271G>A		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.5224G>A	chr21.hg19:g.46932271G>A	ENSP00000352798:p.Val1742Met	1					SLC19A1_ENST00000567670.1_Intron|SLC19A1_ENST00000468508.1_5'Flank|COL18A1_ENST00000355480.5_Missense_Mutation_p.V1507M|COL18A1_ENST00000400337.2_Missense_Mutation_p.V1327M	p.V1742M			2	2	4	2.120256	P39060	COIA1_HUMAN		41	5245	+			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	0	1	hg19	c.5224G>A		0	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041922	0.55003	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	4.41	3.52	0.40303	4.41	3.52	0.40303	Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	0.000000	0.85682	U	0.000000	T	0.77418	0.4127	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.99;0.996;0.994	T	0.80417	-0.1391	10	0.87932	D	0	.	10.9067	0.47084	0.0934:0.0:0.9066:0.0	.	1742;1324;1507;1327	P39060;D3DSM4;P39060-1;P39060-2	COIA1_HUMAN;.;.;.	M	1327;1327;1507;1742;1742;675	ENSP00000383191:V1327M;ENSP00000347665:V1507M;ENSP00000352798:V1742M;ENSP00000339118:V675M	ENSP00000339118:V675M	V	+	1	0	0	COL18A1	45756699	45756699	1.000000	0.71417	0.357000	0.25798	0.012000	0.07955	5.167000	0.64972	1.005000	0.39183	0.549000	0.68633	GTG	0.671862		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.692	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1	1	0	1		2	2	2	0		0	0	21		21	20	1	3.450000	-10.821990	1	0.520000				7	7		107	106	0		1	1		0	0	21	0		9.811088e-01	9.999822e-01	0	14	0	437	0	7	107
CELSR1	9620	broad.mit.edu	37	22	46931761	46931761	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr22:46931761G>C	ENST00000262738.3	-	1	1306	c.1307C>G	c.(1306-1308)cCg>cGg	p.P436R	CELSR1_ENST00000395964.1_Missense_Mutation_p.P436R|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	436	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GAGCGGGCCCGGATTGCGCCC	0.667																																						ENST00000262738.3	1.000000	5.200000e-01	1.000000	0.650000	0.820000	0.823533	0.820000	1.000000																										0				95						c.(1306-1308)cCg>cGg		cadherin, EGF LAG seven-pass G-type receptor 1							45.0	28.0	34.0					22																	46931761		2202	4294	6496	SO:0001583	missense	9620	0	0					g.chr22:46931761G>C	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1307C>G	chr22.hg19:g.46931761G>C	ENSP00000262738:p.Pro436Arg	1					CELSR1_ENST00000395964.1_Missense_Mutation_p.P436R|CELSR1_ENST00000497509.1_5'Flank	p.P436R	NM_014246.1	NP_055061.1	2	2	4	1.612139	Q9NYQ6	CELR1_HUMAN		1	1306	-		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	1	1	hg19	c.1307C>G	CCDS14076.1	0	.	.	.	.	.	.	.	.	.	.	G	14.61	2.585708	0.46110	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.51574	0.7;0.7	4.65	3.62	0.41486	4.65	3.62	0.41486	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	U	0.000004	T	0.68072	0.2961	M	0.78637	2.42	0.39149	D	0.96218	D	0.89917	1.0	D	0.97110	1.0	T	0.74137	-0.3762	10	0.66056	D	0.02	.	13.7659	0.62995	0.0:0.0:0.8449:0.1551	.	436	Q9NYQ6	CELR1_HUMAN	R	436	ENSP00000262738:P436R;ENSP00000379293:P436R	ENSP00000262738:P436R	P	-	2	0	0	CELSR1	45310425	45310425	1.000000	0.71417	0.997000	0.53966	0.534000	0.34807	9.205000	0.95048	0.943000	0.37553	0.462000	0.41574	CCG	0.569275		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.667	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	1	0	1		2	2	2	0		0	0	30		30	27	1	3.450000	-20.000000	1	0.520000	NM_014246			22	21		99	96	1		1	1		0	0	30	0		9.999991e-01	7.062757e-01	0	6	0	7	0	22	99
GLI2	2736	broad.mit.edu	37	2	121742187	121742187	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:121742187G>A	ENST00000452319.1	+	12	1884	c.1824G>A	c.(1822-1824)ccG>ccA	p.P608P	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Silent_p.P608P|GLI2_ENST00000314490.11_Silent_p.P280P					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TCCGCACACCGCTGCTCAAAG	0.652																																						ENST00000452319.1	1.000000	5.500000e-01	1.000000	0.650000	0.780000	0.812330	0.780000	0.740000																										0				64						c.(1822-1824)ccG>ccA		GLI family zinc finger 2							77.0	71.0	73.0					2																	121742187		2203	4300	6503	SO:0001819	synonymous_variant	2736	3	121410	35				g.chr2:121742187G>A		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1824G>A	chr2.hg19:g.121742187G>A		1					GLI2_ENST00000361492.4_Silent_p.P608P|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Silent_p.P280P	p.P608P			3	4	7	2.341448				12	1884	+	Renal(3;0.0496)	Prostate(154;0.0623)		Silent	SNP	ENST00000452319.1	1	1	hg19	c.1824G>A	CCDS33283.1	0																																																																																								0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.652	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	1	0	1		2	2	2	0		0	0	52		52	50	1	3.450000	-16.738570	1	0.520000	NM_005270			41	40		302	301	1		1	0	0	0	0	52	0		1	1.504223e-02	0	0	0	2	1	41	302
NCKAP5	344148	broad.mit.edu	37	2	133540781	133540781	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:133540781G>A	ENST00000409261.1	-	14	3976	c.3603C>T	c.(3601-3603)atC>atT	p.I1201I	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Silent_p.I1201I|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1201										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CACCCGCTGTGATCTCCATGC	0.478																																						ENST00000409261.1	1.000000	7.600000e-01	1.000000	0.900000	0.990000	0.964995	0.990000	1.000000																										0				118						c.(3601-3603)atC>atT		NCK-associated protein 5							85.0	84.0	84.0					2																	133540781		1949	4148	6097	SO:0001819	synonymous_variant	344148	0	0					g.chr2:133540781G>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3603C>T	chr2.hg19:g.133540781G>A		1					NCKAP5_ENST00000317721.6_Silent_p.I1201I|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank	p.I1201I	NM_207363.2	NP_997246.2	3	4	7	2.341448	O14513	NCKP5_HUMAN		14	3976	-			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	ENST00000409261.1	1	1	hg19	c.3603C>T	CCDS46418.1	1																																																																																								0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.478	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	1	0	1		2	2	2	0		0	0	50		50	49	1	3.450000	-20.000000	1	0.520000	NM_207481			44	44		227	221	1		1			0	0	50	0		1	0	0	0	0	0	0	44	227
THSD7B	80731	broad.mit.edu	37	2	138400061	138400061	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:138400061G>A	ENST00000409968.1	+	21	3981	c.3803G>A	c.(3802-3804)cGa>cAa	p.R1268Q	THSD7B_ENST00000272643.3_Missense_Mutation_p.R1271Q|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.R1240Q			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1270	TSP type-1 16. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATTTTAGGTCGAATGAGCCGG	0.478																																						ENST00000409968.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				134						c.(3802-3804)cGa>cAa		thrombospondin, type I, domain containing 7B							121.0	118.0	119.0					2																	138400061		1894	4125	6019	SO:0001583	missense	80731	1	120828	36				g.chr2:138400061G>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3803G>A	chr2.hg19:g.138400061G>A	ENSP00000387145:p.Arg1268Gln	1					THSD7B_ENST00000272643.3_Missense_Mutation_p.R1271Q|THSD7B_ENST00000413152.2_Missense_Mutation_p.R1240Q|THSD7B_ENST00000543459.1_Intron	p.R1268Q			3	4	7	2.341448	Q9C0I4	THS7B_HUMAN		21	3981	+				Missense_Mutation	SNP	ENST00000409968.1	1	1	hg19	c.3803G>A		1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609124	0.28623	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.51325	0.71;0.71;0.71	5.29	-0.929	0.10444	5.29	-0.929	0.10444	.	1.100800	0.06637	N	0.760367	T	0.21103	0.0508	N	0.03281	-0.365	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.46582	-0.9181	10	0.02654	T	1	.	10.7598	0.46258	0.6294:0.0:0.3706:0.0	.	1240	C9JKN6	.	Q	1268;1271;1240	ENSP00000387145:R1268Q;ENSP00000272643:R1271Q;ENSP00000413841:R1240Q	ENSP00000272643:R1271Q	R	+	2	0	0	THSD7B	138116531	138116531	0.970000	0.33590	0.992000	0.48379	0.992000	0.81027	-0.041000	0.12084	-0.106000	0.12110	-0.258000	0.10820	CGA	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.478	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	0	0	1		2	2	2	0		0	0	56		56	56	1	3.450000	-12.574930	1	0.520000	XM_046570.9			161	158		353	349	1		1	0		0	0	56	0		1	0	0	0	0	1	0	161	353
TTN	7273	broad.mit.edu	37	2	179397543	179397543	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:179397543C>T	ENST00000591111.1	-	308	99100	c.98876G>A	c.(98875-98877)tGg>tAg	p.W32959*	TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.W25535*|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.W25727*|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.W34600*|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.W32032*|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.W25660*|TTN-AS1_ENST00000589434.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32959					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAACTGTTCCCATCTTGAAAG	0.428																																						ENST00000591111.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				1448						c.(98875-98877)tGg>tAg		titin							108.0	102.0	104.0					2																	179397543		1990	4160	6150	SO:0001587	stop_gained	7273	0	0					g.chr2:179397543C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98876G>A	chr2.hg19:g.179397543C>T	ENSP00000465570:p.Trp32959*	1					TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.W32032*|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.W25535*|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.W34600*|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.W25727*|TTN_ENST00000359218.5_Nonsense_Mutation_p.W25660*|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000450692.2_RNA	p.W32959*			3	4	7	2.341448	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	308	99100	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.98876G>A		1	.	.	.	.	.	.	.	.	.	.	C	73	115.725762	0.99999	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.81	5.81	0.92471	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6737	0.95921	0.0:1.0:0.0:0.0	.	.	.	.	X	32032;25535;25727;25660;25532	.	ENSP00000340554:W25727X	W	-	2	0	0	TTN	179105789	179105789	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.794000	0.85869	2.757000	0.94681	0.462000	0.41574	TGG	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0		0	0	52		52	52	1	3.450000	-8.959370	1	0.520000	NM_133378			80	79		163	159	1		1			0	0	52	0		1	0	0	0	0	0	0	80	163
PID1	55022	broad.mit.edu	37	2	229890591	229890591	+	Silent	SNP	G	G	A	rs139231184	byFrequency	TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:229890591G>A	ENST00000354069.6	-	3	540	c.510C>T	c.(508-510)acC>acT	p.T170T	PID1_ENST00000392055.3_Silent_p.T137T|PID1_ENST00000409462.1_Silent_p.T88T|PID1_ENST00000392054.3_Silent_p.T168T|PID1_ENST00000482518.2_Intron			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	170	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		TGTGGTCGGCGGTGCAGTAGG	0.582																																						ENST00000354069.6	1.000000	1.000000e-02	1.000000	0.040000	0.080000	0.296901	0.080000	0.080000																										0				26						c.(508-510)acC>acT		phosphotyrosine interaction domain containing 1		G	,	1,4405	2.1+/-5.4	0,1,2202	143.0	130.0	134.0		411,504	-11.7	0.1	2	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PID1	NM_001100818.1,NM_017933.4	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	137/218,168/249	229890591	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	55022	19	121412	46				g.chr2:229890591G>A	AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.510C>T	chr2.hg19:g.229890591G>A		1					PID1_ENST00000482518.2_Intron|PID1_ENST00000392054.3_Silent_p.T168T|PID1_ENST00000409462.1_Silent_p.T88T|PID1_ENST00000392055.3_Silent_p.T137T	p.T170T			3	4	7	2.238105	Q7Z2X4	PCLI1_HUMAN		3	540	-		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)	B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Silent	SNP	ENST00000354069.6	0	1	hg19	c.510C>T		0																																																																																								0.689521		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.582	PID1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000331810.2	0	0	1		35	2	2	1		1	2	51		51	49	1	3.450000	-2.267164	0	0.520000	NM_017933			5	5		435	429	0		0	0		1	0	51	0		3.166707e-07	8.772374e-03	0	0	0	10	0	5	435
PER2	8864	broad.mit.edu	37	2	239185809	239185809	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:239185809C>T	ENST00000254657.3	-	3	535	c.256G>A	c.(256-258)Gca>Aca	p.A86T	PER2_ENST00000440245.1_Missense_Mutation_p.A86T|PER2_ENST00000254658.3_Missense_Mutation_p.A86T|PER2_ENST00000355768.2_Missense_Mutation_p.A86T	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	86					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.A86T(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCAGATTTTGCCATCATCAGG	0.383																																						ENST00000254657.3	1.000000	0	1.000000	0.020000	0.040000	0.223318	0.040000	0.040000																										1	Substitution - Missense(1)	p.A86T(1)	urinary_tract(1)	37						c.(256-258)Gca>Aca		period circadian clock 2							227.0	239.0	235.0					2																	239185809		2203	4300	6503	SO:0001583	missense	8864	0	0					g.chr2:239185809C>T	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.256G>A	chr2.hg19:g.239185809C>T	ENSP00000254657:p.Ala86Thr	1					PER2_ENST00000254658.3_Missense_Mutation_p.A86T|PER2_ENST00000440245.1_Missense_Mutation_p.A86T|PER2_ENST00000355768.2_Missense_Mutation_p.A86T	p.A86T	NM_022817.2	NP_073728.1	2	3	5	2.294524	O15055	PER2_HUMAN		3	535	-		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	0	1	hg19	c.256G>A	CCDS2528.1	0	.	.	.	.	.	.	.	.	.	.	C	0.421	-0.908299	0.02434	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768;ENST00000431832	T;T;T;T;T	0.53423	2.72;0.68;1.71;0.68;0.62	4.96	2.12	0.27331	4.96	2.12	0.27331	.	0.345872	0.34110	N	0.004259	T	0.34308	0.0893	L	0.34521	1.04	0.20074	N	0.999938	B;B;B;B	0.10296	0.003;0.0;0.001;0.0	B;B;B;B	0.12837	0.008;0.001;0.005;0.001	T	0.18053	-1.0349	10	0.31617	T	0.26	-1.2378	11.0032	0.47618	0.0:0.7639:0.0:0.2361	.	86;86;86;86	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	T	86	ENSP00000254657:A86T;ENSP00000254658:A86T;ENSP00000397516:A86T;ENSP00000348013:A86T;ENSP00000405891:A86T	ENSP00000254657:A86T	A	-	1	0	0	PER2	238850548	238850548	0.693000	0.27728	0.002000	0.10522	0.041000	0.13682	0.717000	0.25851	-0.004000	0.14419	-0.797000	0.03246	GCA	0.694151		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.383	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	0	0	1		19	2	2	1		1	1	293		293	291	1	3.450000	-1.723641	0	0.520000	NM_022817			9	9		1570	1558	0		0	0		1	0	293	0		4.091860e-02	3.797202e-02	0	0	0	47	0	9	1570
FARP2	9855	broad.mit.edu	37	2	242312551	242312551	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:242312551T>A	ENST00000264042.3	+	2	199	c.29T>A	c.(28-30)gTc>gAc	p.V10D	FARP2_ENST00000545004.1_Missense_Mutation_p.V10D|FARP2_ENST00000373287.4_Missense_Mutation_p.V10D|FARP2_ENST00000479427.1_3'UTR	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	10					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ACATACAGAGTCCTGCAGACT	0.463																																						ENST00000264042.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				43						c.(28-30)gTc>gAc		FERM, RhoGEF and pleckstrin domain protein 2							57.0	59.0	58.0					2																	242312551		2203	4300	6503	SO:0001583	missense	9855	0	0					g.chr2:242312551T>A	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.29T>A	chr2.hg19:g.242312551T>A	ENSP00000264042:p.Val10Asp	1					FARP2_ENST00000373287.4_Missense_Mutation_p.V10D|FARP2_ENST00000479427.1_3'UTR|FARP2_ENST00000545004.1_Missense_Mutation_p.V10D	p.V10D	NM_014808.2	NP_055623.1	2	3	5	2.294524	O94887	FARP2_HUMAN		2	199	+		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	1	1	hg19	c.29T>A	CCDS33424.1	1	.	.	.	.	.	.	.	.	.	.	T	12.23	1.876107	0.33162	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000418082;ENST00000445489	T;D;D;T;T	0.83591	-1.11;-1.73;-1.74;-0.31;-1.13	5.65	-2.92	0.05615	5.65	-2.92	0.05615	.	0.515409	0.19294	N	0.117813	T	0.80737	0.4680	L	0.57536	1.79	0.27964	N	0.936655	P;P;P	0.46512	0.879;0.773;0.664	P;P;B	0.48270	0.572;0.572;0.235	T	0.76250	-0.3028	10	0.49607	T	0.09	.	11.2139	0.48815	0.0:0.4967:0.0:0.5033	.	10;10;10	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	D	10	ENSP00000264042:V10D;ENSP00000443876:V10D;ENSP00000362384:V10D;ENSP00000393376:V10D;ENSP00000388167:V10D	ENSP00000264042:V10D	V	+	2	0	0	FARP2	241961224	241961224	0.907000	0.30839	0.057000	0.19452	0.532000	0.34746	1.218000	0.32467	-0.815000	0.04346	0.460000	0.39030	GTC	0.694151		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.463	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1	1	0	1		2	2	2	0		0	0	32		32	32	1	3.450000	-20.000000	1	0.520000				99	98		178	173	1		1	1		0	0	32	0		1	9.929730e-01	0	6	0	11	0	99	178
SOX11	6664	broad.mit.edu	37	2	5833216	5833216	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:5833216G>A	ENST00000322002.3	+	1	418	c.363G>A	c.(361-363)cgG>cgA	p.R121R	AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000420221.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	121					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		ACCGGCCCCGGAAAAAGCCCA	0.692																																						ENST00000322002.3	1.000000	6.000000e-02	1.000000	0.130000	0.240000	0.406537	0.240000	0.180000																										0				13						c.(361-363)cgG>cgA		SRY (sex determining region Y)-box 11							17.0	23.0	21.0					2																	5833216		2197	4300	6497	SO:0001819	synonymous_variant	6664	0	0					g.chr2:5833216G>A		CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.363G>A	chr2.hg19:g.5833216G>A		1					AC108025.2_ENST00000420221.1_RNA|AC108025.2_ENST00000453678.1_RNA|AC107057.2_ENST00000458264.1_RNA	p.R121R	NM_003108.3	NP_003099.1	3	4	7	2.336558	P35716	SOX11_HUMAN		1	418	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		Q4ZFV8	Silent	SNP	ENST00000322002.3	0	1	hg19	c.363G>A	CCDS1654.1	0																																																																																								0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.692	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206698.1	0	0	1		2	2	2	0		0	0	26		26	24	1	3.450000	-6.722651	1	0.520000	NM_003108			4	4		136	133	0		1			0	0	26	0		8.863296e-01	0	0	0	0	0	0	4	136
OTOF	9381	broad.mit.edu	37	2	26689975	26689975	+	Missense_Mutation	SNP	G	G	A	rs560665036		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:26689975G>A	ENST00000272371.2	-	35	4480	c.4354C>T	c.(4354-4356)Cgc>Tgc	p.R1452C	OTOF_ENST00000403946.3_Missense_Mutation_p.R1452C|OTOF_ENST00000402415.3_Missense_Mutation_p.R762C|OTOF_ENST00000339598.3_Missense_Mutation_p.R685C|OTOF_ENST00000338581.6_Missense_Mutation_p.R685C	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1452					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCTTGAAGCGTCCCACAATG	0.642																																					GBM(102;732 1451 20652 24062 31372)	ENST00000272371.2	1.000000	7.700000e-01	1.000000	0.920000	0.990000	0.971698	0.990000	1.000000																										0				106						c.(4354-4356)Cgc>Tgc		otoferlin							52.0	48.0	49.0					2																	26689975		2203	4300	6503	SO:0001583	missense	9381	1	121412	34				g.chr2:26689975G>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4354C>T	chr2.hg19:g.26689975G>A	ENSP00000272371:p.Arg1452Cys	1					OTOF_ENST00000402415.3_Missense_Mutation_p.R762C|OTOF_ENST00000339598.3_Missense_Mutation_p.R685C|OTOF_ENST00000338581.6_Missense_Mutation_p.R685C|OTOF_ENST00000403946.3_Missense_Mutation_p.R1452C	p.R1452C	NM_194248.2	NP_919224.1	3	4	7	2.336558	Q9HC10	OTOF_HUMAN		35	4480	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	1	1	hg19	c.4354C>T	CCDS1725.1	1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597730	0.46318	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.80480	-1.13;-1.13;-1.12;-1.38;-1.38	4.69	-0.734	0.11140	4.69	-0.734	0.11140	.	0.045494	0.85682	D	0.000000	T	0.68504	0.3008	L	0.41236	1.265	0.80722	D	1	B;B;B;B	0.33171	0.397;0.026;0.4;0.026	B;B;B;B	0.20955	0.013;0.032;0.03;0.032	T	0.66172	-0.5990	10	0.59425	D	0.04	-20.9378	14.53	0.67917	0.0:0.0:0.3367:0.6633	.	1452;685;762;685	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	C	685;685;762;1452;1452	ENSP00000345137:R685C;ENSP00000344521:R685C;ENSP00000383906:R762C;ENSP00000272371:R1452C;ENSP00000385255:R1452C	ENSP00000272371:R1452C	R	-	1	0	0	OTOF	26543479	26543479	0.984000	0.35163	0.971000	0.41717	0.920000	0.55202	0.944000	0.29043	0.077000	0.16863	0.561000	0.74099	CGC	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.642	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3	1	0	1		2	2	2	0		0	0	49		49	49	1	3.450000	-20.000000	1	0.520000				36	34		178	173	1		1			0	0	49	0		1	0	0	0	0	0	0	36	178
PLEKHH2	130271	broad.mit.edu	37	2	43937444	43937444	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:43937444G>T	ENST00000282406.4	+	13	2299	c.2189G>T	c.(2188-2190)gGt>gTt	p.G730V		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	730	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.			G -> C (in Ref. 1; CAI46132). {ECO:0000305}.	negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTTAAAGGTGGTGAATTACTT	0.363																																						ENST00000282406.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999995	0.990000	1.000000																										0				56						c.(2188-2190)gGt>gTt		pleckstrin homology domain containing, family H (with MyTH4 domain) member 2							112.0	125.0	121.0					2																	43937444		2203	4300	6503	SO:0001583	missense	130271	0	0					g.chr2:43937444G>T	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2189G>T	chr2.hg19:g.43937444G>T	ENSP00000282406:p.Gly730Val	1						p.G730V	NM_172069.3	NP_742066.2	3	4	7	2.336558	Q8IVE3	PKHH2_HUMAN		13	2299	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	1	1	hg19	c.2189G>T	CCDS1812.1	1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832003	0.71258	.	.	ENSG00000152527	ENST00000282406	T	0.76578	-1.03	5.02	4.11	0.48088	5.02	4.11	0.48088	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.056676	0.64402	D	0.000001	D	0.88429	0.6434	M	0.82433	2.59	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.99;1.0;0.999	D	0.90058	0.4154	10	0.87932	D	0	-10.151	15.0911	0.72195	0.0:0.1426:0.8574:0.0	.	730;167;730	Q8IVE3;Q8IVE3-2;Q8IVE3-3	PKHH2_HUMAN;.;.	V	730	ENSP00000282406:G730V	ENSP00000282406:G730V	G	+	2	0	0	PLEKHH2	43790948	43790948	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	6.354000	0.73036	1.043000	0.40175	0.563000	0.77884	GGT	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.363	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	1	0	1		2	2	2	0		0	0	67		67	66	1	3.450000	-20.000000	1	0.520000	NM_172069			108	107		379	374	1		1	1		0	0	67	0		1	8.747230e-01	0	8	0	7	0	108	379
ABCG8	64241	broad.mit.edu	37	2	44102445	44102445	+	Missense_Mutation	SNP	C	C	T	rs202028007		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:44102445C>T	ENST00000272286.2	+	11	1739	c.1649C>T	c.(1648-1650)gCg>gTg	p.A550V		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	550	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CTGGCCGCCGCGGCCCTGCTC	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		16315	0.001		0.0	False		,,,				2504	0.0					ENST00000272286.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				45						c.(1648-1650)gCg>gTg		ATP-binding cassette, sub-family G (WHITE), member 8	Ezetimibe(DB00973)						67.0	66.0	66.0					2																	44102445		2203	4300	6503	SO:0001583	missense	64241	2	121412	36				g.chr2:44102445C>T	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1649C>T	chr2.hg19:g.44102445C>T	ENSP00000272286:p.Ala550Val	1						p.A550V	NM_022437.2	NP_071882.1	3	4	7	2.336558	Q9H221	ABCG8_HUMAN		11	1739	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	1	1	hg19	c.1649C>T	CCDS1815.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.22	2.768002	0.49680	.	.	ENSG00000143921	ENST00000272286	T	0.74947	-0.89	4.73	3.85	0.44370	4.73	3.85	0.44370	ABC-2 type transporter (1);	0.167185	0.52532	D	0.000066	T	0.81650	0.4867	M	0.65975	2.015	0.22968	N	0.998499	D;D	0.71674	0.998;0.998	P;P	0.61658	0.827;0.892	T	0.73528	-0.3954	10	0.42905	T	0.14	.	12.9331	0.58299	0.0:0.9209:0.0:0.0791	.	549;550	Q9H221-2;Q9H221	.;ABCG8_HUMAN	V	550	ENSP00000272286:A550V	ENSP00000272286:A550V	A	+	2	0	0	ABCG8	43955949	43955949	0.954000	0.32549	0.001000	0.08648	0.001000	0.01503	5.484000	0.66844	0.984000	0.38629	0.462000	0.41574	GCG	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.617	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	1	0	1		2	2	2	0		0	0	56		56	52	1	3.450000	-20.000000	1	0.520000	NM_022437			113	111		238	235	1		1	0	0	0	0	56	0		1	1.049119e-01	0	0	0	2	1	113	238
PSME4	23198	broad.mit.edu	37	2	54133825	54133825	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:54133825C>T	ENST00000404125.1	-	26	2908	c.2853G>A	c.(2851-2853)cgG>cgA	p.R951R	PSME4_ENST00000421748.2_Silent_p.R95R	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	951					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CAGTTAGTGTCCGTAGCTAAG	0.308																																						ENST00000404125.1	1.000000	1.300000e-01	1.000000	0.180000	0.250000	0.424000	0.250000	0.220000																										0				60						c.(2851-2853)cgG>cgA		proteasome (prosome, macropain) activator subunit 4							123.0	122.0	122.0					2																	54133825		2203	4300	6503	SO:0001819	synonymous_variant	23198	0	0					g.chr2:54133825C>T	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2853G>A	chr2.hg19:g.54133825C>T		1					PSME4_ENST00000421748.2_Silent_p.R95R	p.R951R	NM_014614.2	NP_055429.2	3	4	7	2.336558	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)	26	2908	-			Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	1	1	hg19	c.2853G>A	CCDS33197.2	0																																																																																								0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.308	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	0	0	1		2	2	2	0		0	0	51		51	50	1	3.450000	-3.408037	1	0.520000	XM_040158			14	14		370	368	0		1	0		0	0	51	0		9.997571e-01	3.380292e-01	0	1	0	30	0	14	370
ZNF638	27332	broad.mit.edu	37	2	71629120	71629120	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:71629120A>G	ENST00000409544.1	+	16	3362	c.2732A>G	c.(2731-2733)aAt>aGt	p.N911S	ZNF638_ENST00000264447.4_Missense_Mutation_p.N911S|ZNF638_ENST00000355812.3_Missense_Mutation_p.N911S	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	911	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						CTTGTCTCTAATTTGCCTAAT	0.269																																						ENST00000409544.1	1.000000	2.000000e-01	1.000000	0.280000	0.390000	0.517522	0.390000	0.350000																										0				63						c.(2731-2733)aAt>aGt		zinc finger protein 638							84.0	88.0	87.0					2																	71629120		2202	4296	6498	SO:0001583	missense	27332	0	0					g.chr2:71629120A>G	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2732A>G	chr2.hg19:g.71629120A>G	ENSP00000386433:p.Asn911Ser	1					ZNF638_ENST00000264447.4_Missense_Mutation_p.N911S|ZNF638_ENST00000355812.3_Missense_Mutation_p.N911S	p.N911S	NM_001252612.1	NP_001239541.1	3	4	7	2.336558	Q14966	ZN638_HUMAN		16	3362	+			B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	1	1	hg19	c.2732A>G	CCDS1917.1	0	.	.	.	.	.	.	.	.	.	.	A	15.94	2.981481	0.53827	.	.	ENSG00000075292	ENST00000394137;ENST00000355812;ENST00000264447;ENST00000409544	T;T;T	0.56275	0.47;1.49;1.49	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.272209	0.41500	D	0.000865	T	0.50769	0.1635	M	0.65975	2.015	0.80722	D	1	B;B;P;B	0.35272	0.361;0.287;0.493;0.361	B;B;B;B	0.33454	0.079;0.085;0.164;0.079	T	0.51132	-0.8744	10	0.33940	T	0.23	-4.9239	13.8977	0.63783	1.0:0.0:0.0:0.0	.	911;911;911;911	A8K583;Q14966-4;Q14966-3;Q14966	.;.;.;ZN638_HUMAN	S	490;911;911;911	ENSP00000348066:N911S;ENSP00000264447:N911S;ENSP00000386433:N911S	ENSP00000264447:N911S	N	+	2	0	0	ZNF638	71482628	71482628	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.314000	0.65804	2.167000	0.68274	0.477000	0.44152	AAT	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.269	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	1	0	1		2	2	2	0		0	0	39		39	38	1	3.450000	-16.376160	1	0.520000	NM_014497			13	13		223	219	0		1	0		0	0	39	0		9.995261e-01	1.368502e-01	0	1	0	10	0	13	223
CD8B	926	broad.mit.edu	37	2	87085345	87085345	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:87085345T>G	ENST00000390655.6	-	2	296	c.238A>C	c.(238-240)Atc>Ctc	p.I80L	CD8B_ENST00000393759.2_Missense_Mutation_p.I80L|CD8B_ENST00000393761.2_Missense_Mutation_p.I80L|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000349455.3_Missense_Mutation_p.I80L|CD8B_ENST00000331469.2_Missense_Mutation_p.I80L	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	80	Ig-like V-type.				immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TCACCGTGGATAGTCCCTTTT	0.552																																						ENST00000390655.6	1.000000	5.200000e-01	1.000000	0.610000	0.720000	0.766754	0.720000	0.690000																										0				13						c.(238-240)Atc>Ctc		CD8b molecule							108.0	97.0	101.0					2																	87085345		2203	4300	6503	SO:0001583	missense	926	0	0					g.chr2:87085345T>G		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.238A>C	chr2.hg19:g.87085345T>G	ENSP00000375070:p.Ile80Leu	1					CD8B_ENST00000349455.3_Missense_Mutation_p.I80L|CD8B_ENST00000393761.2_Missense_Mutation_p.I80L|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000393759.2_Missense_Mutation_p.I80L|CD8B_ENST00000331469.2_Missense_Mutation_p.I80L	p.I80L	NM_004931.4	NP_004922.1	3	4	7	2.336558	P10966	CD8B_HUMAN		2	296	-			P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	ENST00000390655.6	1	1	hg19	c.238A>C	CCDS1997.1	0	.	.	.	.	.	.	.	.	.	.	T	8.426	0.847470	0.17034	.	.	ENSG00000172116	ENST00000393761;ENST00000393759;ENST00000349455;ENST00000331469;ENST00000390655;ENST00000445248	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	4.35	-6.41	0.01938	4.35	-6.41	0.01938	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.220850	0.00873	N	0.002047	T	0.41096	0.1144	N	0.17474	0.49	0.09310	N	1	B;B;B;B;B;B	0.24132	0.016;0.001;0.004;0.002;0.001;0.098	B;B;B;B;B;B	0.15484	0.007;0.003;0.004;0.002;0.003;0.013	T	0.20042	-1.0287	10	0.28530	T	0.3	0.0063	7.5745	0.27928	0.1156:0.284:0.0:0.6004	.	80;80;80;80;80;80	Q496E2;Q53QL8;P10966;P10966-3;P10966-2;P10966-6	.;.;CD8B_HUMAN;.;.;.	L	80	ENSP00000377358:I80L;ENSP00000377356:I80L;ENSP00000340592:I80L;ENSP00000331172:I80L;ENSP00000375070:I80L	ENSP00000331172:I80L	I	-	1	0	0	CD8B	86938856	86938856	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.673000	0.01951	-1.420000	0.02009	-2.142000	0.00338	ATC	0.702048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.552	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	1	0	1		2	2	2	0		0	0	68		68	70	1	3.450000	-20.000000	1	0.520000	NM_172099			48	43		388	342	1		1	0		0	0	68	0		1	3.527135e-02	0	1	0	2	0	48	388
FARP2	9855	broad.mit.edu	37	2	242373703	242373703	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr2:242373703T>A	ENST00000264042.3	+	10	1168	c.998T>A	c.(997-999)gTc>gAc	p.V333D	FARP2_ENST00000545004.1_Missense_Mutation_p.V333D|FARP2_ENST00000373287.4_Missense_Mutation_p.V333D	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	333					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GCAAAAGCCGTCTTCTTCAGC	0.468																																						ENST00000264042.3	1.000000	6.800000e-01	1.000000	0.780000	0.910000	0.903476	0.910000	1.000000																										0				43						c.(997-999)gTc>gAc		FERM, RhoGEF and pleckstrin domain protein 2							95.0	99.0	98.0					2																	242373703		2203	4300	6503	SO:0001583	missense	9855	0	0					g.chr2:242373703T>A	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.998T>A	chr2.hg19:g.242373703T>A	ENSP00000264042:p.Val333Asp	1					FARP2_ENST00000373287.4_Missense_Mutation_p.V333D|FARP2_ENST00000545004.1_Missense_Mutation_p.V333D	p.V333D	NM_014808.2	NP_055623.1	2	3	5	2.294524	O94887	FARP2_HUMAN		10	1168	+		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	1	1	hg19	c.998T>A	CCDS33424.1	1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347971	0.82132	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000413432	D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01	5.2	5.2	0.72013	5.2	5.2	0.72013	FERM adjacent (FA) (1);	0.066906	0.64402	D	0.000010	D	0.91828	0.7414	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.72625	0.978;0.968;0.978	D	0.91344	0.5099	10	0.35671	T	0.21	.	15.0632	0.71970	0.0:0.0:0.0:1.0	.	333;333;333	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	D	333;333;333;20	ENSP00000264042:V333D;ENSP00000443876:V333D;ENSP00000362384:V333D;ENSP00000412772:V20D	ENSP00000264042:V333D	V	+	2	0	0	FARP2	242022376	242022376	1.000000	0.71417	0.158000	0.22627	0.695000	0.40330	6.019000	0.70818	1.956000	0.56807	0.455000	0.32223	GTC	0.694151		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.468	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1	1	0	0		2	2	2	0		0	0	53		53	52	1	3.450000	-19.999950	1	0.520000				52	50		304	300	1		1	1		0	0	53	0		1	9.804798e-01	0	8	0	31	0	52	304
SLC6A1	6529	broad.mit.edu	37	3	11067497	11067497	+	Silent	SNP	C	C	T	rs144034291		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:11067497C>T	ENST00000287766.4	+	9	1309	c.888C>T	c.(886-888)taC>taT	p.Y296Y	SLC6A1_ENST00000536032.1_Silent_p.Y118Y	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	296					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TCTTCTCATACGGGCTGGGCC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		17698	0.0		0.001	False		,,,				2504	0.0					ENST00000287766.4	1.000000	6.300000e-01	0.960000	0.710000	0.810000	0.829110	0.810000	0.800000																										0				26						c.(886-888)taC>taT		solute carrier family 6 (neurotransmitter transporter), member 1	Clobazam(DB00349)|Tiagabine(DB00906)	C		1,4405	2.1+/-5.4	0,1,2202	108.0	110.0	109.0		888	-3.3	1.0	3	dbSNP_134	109	0,8600		0,0,4300	no	coding-synonymous	SLC6A1	NM_003042.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		296/600	11067497	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6529	2	121412	38				g.chr3:11067497C>T		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.888C>T	chr3.hg19:g.11067497C>T		1					SLC6A1_ENST00000536032.1_Silent_p.Y118Y	p.Y296Y	NM_003042.3	NP_003033.3	1	3	4	2.097128	P30531	SC6A1_HUMAN		9	1309	+		Ovarian(110;0.0392)	Q8N4K8	Silent	SNP	ENST00000287766.4	1	1	hg19	c.888C>T	CCDS2603.1	0																																																																																								0.668325		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.532	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	1	0	1		2	2	2	0		0	0	74		74	73	1	3.450000	-3.319375	1	0.520000	NM_003042			63	63		375	366	1		1			0	0	74	0		1	0	0	0	0	0	0	63	375
ALCAM	214	broad.mit.edu	37	3	105290748	105290748	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:105290748A>G	ENST00000306107.5	+	15	2217	c.1717A>G	c.(1717-1719)Aag>Gag	p.K573E	ALCAM_ENST00000389927.4_Missense_Mutation_p.K295E|ALCAM_ENST00000472644.2_Missense_Mutation_p.K560E|ALCAM_ENST00000486979.2_Missense_Mutation_p.K522E	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	573					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						AGAAAACAAAAAGTTAGAAGA	0.353																																						ENST00000306107.5	1.000000	4.400000e-01	0.810000	0.530000	0.640000	0.678496	0.640000	0.640000																										0				28						c.(1717-1719)Aag>Gag		activated leukocyte cell adhesion molecule							72.0	69.0	70.0					3																	105290748		2203	4299	6502	SO:0001583	missense	214	0	0					g.chr3:105290748A>G	AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1717A>G	chr3.hg19:g.105290748A>G	ENSP00000305988:p.Lys573Glu	1					ALCAM_ENST00000389927.4_Missense_Mutation_p.K295E|ALCAM_ENST00000486979.2_Missense_Mutation_p.K522E|ALCAM_ENST00000472644.2_Missense_Mutation_p.K560E	p.K573E	NM_001627.3	NP_001618.2	1	3	4	2.115187	Q13740	CD166_HUMAN		15	2217	+			B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Missense_Mutation	SNP	ENST00000306107.5	1	1	hg19	c.1717A>G	CCDS33810.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.78|18.78	3.696782|3.696782	0.68386|0.68386	.|.	.|.	ENSG00000170017|ENSG00000170017	ENST00000306107;ENST00000472644;ENST00000486979;ENST00000389927|ENST00000465413	T;T;T;T|T	0.58060|0.25579	0.42;0.58;0.36;1.15|1.79	5.42|5.42	5.42|5.42	0.78866|0.78866	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.31451|0.31451	0.0797|0.0797	L|L	0.36672|0.36672	1.1|1.1	0.53688|0.53688	D|D	0.999979|0.999979	D;D;D|.	0.63880|.	0.993;0.993;0.993|.	D;D;D|.	0.70935|.	0.956;0.956;0.971|.	T|T	0.02282|0.02282	-1.1183|-1.1183	10|8	0.44086|0.29301	T|T	0.13|0.29	-17.4549|-17.4549	15.7464|15.7464	0.77949|0.77949	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	295;560;573|.	Q6ZS95;B4DTU0;Q13740|.	.;.;CD166_HUMAN|.	E|R	573;560;522;295|333	ENSP00000305988:K573E;ENSP00000419236:K560E;ENSP00000418213:K522E;ENSP00000374577:K295E|ENSP00000418937:K333R	ENSP00000305988:K573E|ENSP00000418937:K333R	K|K	+|+	1|2	0|0	0|0	ALCAM|ALCAM	106773438|106773438	106773438|106773438	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.000000|6.000000	0.70678|0.70678	2.176000|2.176000	0.68965|0.68965	0.455000|0.455000	0.32223|0.32223	AAG|AAA	0.670692		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.353	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353764.1	1	0	1		2	2	2	0		0	0	54		54	53	1	3.450000	-13.006490	1	0.520000	NM_001627			31	31		245	243	1		1	1		0	0	54	0		1	9.372080e-01	0	5	0	34	0	31	245
BFSP2	8419	broad.mit.edu	37	3	133119141	133119141	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:133119141C>T	ENST00000302334.2	+	1	303	c.214C>T	c.(214-216)Cgt>Tgt	p.R72C		NM_003571.2	NP_003562.1	Q13515	BFSP2_HUMAN	beaded filament structural protein 2, phakinin	72	Head.				cell maturation (GO:0048469)|intermediate filament cytoskeleton organization (GO:0045104)|lens fiber cell development (GO:0070307)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|urinary_tract(1)	13						CTTGGGTGCCCGTGTGACCCG	0.667																																						ENST00000302334.2	1.000000	6.300000e-01	1.000000	0.730000	0.850000	0.859407	0.850000	1.000000																										0				13						c.(214-216)Cgt>Tgt		beaded filament structural protein 2, phakinin							45.0	51.0	49.0					3																	133119141		2203	4299	6502	SO:0001583	missense	8419	0	0					g.chr3:133119141C>T	U48224	CCDS33859.1	3q22.1	2013-01-16			ENSG00000170819	ENSG00000170819		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1041	protein-coding gene	gene with protein product		603212					Standard	NM_003571		Approved	CP47, CP49, LIFL-L, phakinin	uc003epn.1	Q13515	OTTHUMG00000159719	ENST00000302334.2:c.214C>T	chr3.hg19:g.133119141C>T	ENSP00000304987:p.Arg72Cys	1						p.R72C	NM_003571.2	NP_003562.1	1	3	4	2.115187	Q13515	BFSP2_HUMAN		1	303	+			Q14D32|Q9HBW5	Missense_Mutation	SNP	ENST00000302334.2	1	1	hg19	c.214C>T	CCDS33859.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.344701	0.95807	.	.	ENSG00000170819	ENST00000302334	D	0.84223	-1.82	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.205916	0.34507	N	0.003911	D	0.90752	0.7097	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	P	0.60173	0.87	D	0.88493	0.3077	10	0.35671	T	0.21	-9.7541	20.3789	0.98926	0.0:1.0:0.0:0.0	.	72	Q13515	BFSP2_HUMAN	C	72	ENSP00000304987:R72C	ENSP00000304987:R72C	R	+	1	0	0	BFSP2	134601831	134601831	1.000000	0.71417	0.933000	0.37362	0.992000	0.81027	6.977000	0.76141	2.826000	0.97356	0.563000	0.77884	CGT	0.670692		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.667	BFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357031.1	1	0	1		2	2	2	0		0	0	40		40	38	1	3.450000	-2.546063	1	0.520000				47	46		267	261	1		1			0	0	40	0		1	0	0	0	0	0	0	47	267
SLC9A9	285195	broad.mit.edu	37	3	143100949	143100949	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:143100949C>T	ENST00000316549.6	-	13	1685	c.1477G>A	c.(1477-1479)Gtg>Atg	p.V493M	SLC9A9-AS2_ENST00000490153.1_RNA	NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	493					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						TCCAGGTCCACGCCAACTCTG	0.438																																						ENST00000316549.6	1.000000	7.700000e-01	1.000000	0.840000	0.930000	0.929360	0.930000	1.000000																										0				57						c.(1477-1479)Gtg>Atg		solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9							187.0	182.0	183.0					3																	143100949		2203	4300	6503	SO:0001583	missense	285195	10	121412	45				g.chr3:143100949C>T	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1477G>A	chr3.hg19:g.143100949C>T	ENSP00000320246:p.Val493Met	1					SLC9A9-AS2_ENST00000490153.1_RNA	p.V493M	NM_173653.3	NP_775924.1	1	3	4	2.115187	Q8IVB4	SL9A9_HUMAN		13	1685	-			A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	1	1	hg19	c.1477G>A	CCDS33872.1	1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026124	0.54683	.	.	ENSG00000181804	ENST00000316549	T	0.30714	1.52	5.11	4.24	0.50183	5.11	4.24	0.50183	.	0.350509	0.24330	N	0.039471	T	0.33177	0.0854	M	0.80332	2.49	0.46542	D	0.999099	P	0.38420	0.63	B	0.33750	0.169	T	0.29336	-1.0015	10	0.66056	D	0.02	.	9.1529	0.36973	0.0:0.9029:0.0:0.0971	.	493	Q8IVB4	SL9A9_HUMAN	M	493	ENSP00000320246:V493M	ENSP00000320246:V493M	V	-	1	0	0	SLC9A9	144583639	144583639	0.990000	0.36364	0.987000	0.45799	0.986000	0.74619	1.403000	0.34612	1.376000	0.46267	0.655000	0.94253	GTG	0.670692		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.438	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	0	0	1		2	2	2	0		0	0	108		108	106	1	3.450000	-20.000000	1	0.520000	NM_173653			105	103		530	523	0		1	0		0	0	108	0		1	2.790805e-02	0	0	0	2	0	105	530
PFKFB4	5210	broad.mit.edu	37	3	48563059	48563059	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:48563059T>A	ENST00000232375.3	-	10	1143	c.1031A>T	c.(1030-1032)tAt>tTt	p.Y344F	PFKFB4_ENST00000383734.2_Intron|PFKFB4_ENST00000536104.1_Missense_Mutation_p.Y333F|PFKFB4_ENST00000541519.1_Missense_Mutation_p.Y310F|PFKFB4_ENST00000545984.1_3'UTR|PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000416568.1_Missense_Mutation_p.Y337F	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	344	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CTCCAGTGGATAATTATCCTG	0.557																																						ENST00000232375.3	1.000000	2.900000e-01	0.750000	0.400000	0.530000	0.579526	0.530000	0.490000																										0				14						c.(1030-1032)tAt>tTt		6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4							76.0	66.0	69.0					3																	48563059		2203	4300	6503	SO:0001583	missense	5210	0	0					g.chr3:48563059T>A	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.1031A>T	chr3.hg19:g.48563059T>A	ENSP00000232375:p.Tyr344Phe	1					PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000416568.1_Missense_Mutation_p.Y337F|PFKFB4_ENST00000541519.1_Missense_Mutation_p.Y310F|PFKFB4_ENST00000536104.1_Missense_Mutation_p.Y333F|PFKFB4_ENST00000545984.1_3'UTR|PFKFB4_ENST00000383734.2_Intron	p.Y344F	NM_004567.2	NP_004558.1	1	3	4	2.097128	Q16877	F264_HUMAN		10	1143	-			Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	ENST00000232375.3	1	1	hg19	c.1031A>T	CCDS2771.1	0	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822425	0.32237	.	.	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000541519	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.1	4.1	0.47936	4.1	4.1	0.47936	Histidine phosphatase superfamily, clade-1 (2);	0.252467	0.41097	D	0.000943	T	0.48960	0.1529	N	0.12663	0.25	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.17722	0.019;0.001;0.017	T	0.44787	-0.9305	10	0.37606	T	0.19	-5.5052	7.0254	0.24936	0.2025:0.0:0.0:0.7974	.	333;337;344	B7Z5C3;Q66S35;Q16877	.;.;F264_HUMAN	F	344;333;337;310	ENSP00000232375:Y344F;ENSP00000438908:Y333F;ENSP00000388394:Y337F;ENSP00000437446:Y310F	ENSP00000232375:Y344F	Y	-	2	0	0	PFKFB4	48538063	48538063	0.498000	0.26075	1.000000	0.80357	0.990000	0.78478	3.035000	0.49759	1.844000	0.53588	0.383000	0.25322	TAT	0.668325		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.557	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257503.2	1	0	1		2	2	2	0		0	0	29		29	29	1	3.450000	-19.802350	1	0.520000	NM_004567			14	14		142	139	0		1	0		0	0	29	0		9.997703e-01	2.663005e-02	0	0	0	3	0	14	142
UBA7	7318	broad.mit.edu	37	3	49842859	49842859	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:49842859A>T	ENST00000333486.3	-	24	3079	c.2921T>A	c.(2920-2922)cTg>cAg	p.L974Q	MIR5193_ENST00000584510.1_RNA	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	974					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTGCTGAACCAGTTCTGTCAC	0.617																																						ENST00000333486.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				33						c.(2920-2922)cTg>cAg		ubiquitin-like modifier activating enzyme 7							93.0	83.0	86.0					3																	49842859		2203	4300	6503	SO:0001583	missense	7318	0	0					g.chr3:49842859A>T	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.2921T>A	chr3.hg19:g.49842859A>T	ENSP00000333266:p.Leu974Gln	1					MIR5193_ENST00000584510.1_RNA	p.L974Q	NM_003335.2	NP_003326.2	1	3	4	2.097128	P41226	UBA7_HUMAN		24	3079	-			Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	1	1	hg19	c.2921T>A	CCDS2805.1	1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.255794	0.59321	.	.	ENSG00000182179	ENST00000333486	T	0.57752	0.38	5.36	5.36	0.76844	5.36	5.36	0.76844	Ubiquitin-activating enzyme e1, C-terminal (1);	0.261023	0.25634	N	0.029323	T	0.72358	0.3450	M	0.80183	2.485	0.45150	D	0.998165	D	0.89917	1.0	D	0.83275	0.996	T	0.76377	-0.2981	10	0.87932	D	0	-1.9099	11.7536	0.51862	1.0:0.0:0.0:0.0	.	974	P41226	UBA7_HUMAN	Q	974	ENSP00000333266:L974Q	ENSP00000333266:L974Q	L	-	2	0	0	UBA7	49817863	49817863	0.105000	0.21958	0.392000	0.26245	0.872000	0.50106	2.681000	0.46926	2.026000	0.59711	0.460000	0.39030	CTG	0.668325		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.617	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	1	0	1		2	2	2	0		0	0	27		27	27	1	3.450000	-20.000000	1	0.520000	NM_003335			94	92		119	118	1		1	1		0	0	27	0		1	1	0	115	0	74	0	94	119
CADM2	253559	broad.mit.edu	37	3	85961592	85961592	+	Missense_Mutation	SNP	G	G	A	rs150681488		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:85961592G>A	ENST00000407528.2	+	5	634	c.572G>A	c.(571-573)cGa>cAa	p.R191Q	CADM2_ENST00000383699.3_Missense_Mutation_p.R200Q|CADM2_ENST00000405615.2_Missense_Mutation_p.R193Q	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	191	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CTGGACTTCCGAGTGGACCGG	0.433																																						ENST00000407528.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				38						c.(571-573)cGa>cAa		cell adhesion molecule 2		G	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	100.0	80.0	87.0		572,599,578	4.6	1.0	3	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	CADM2	NM_001167674.1,NM_001167675.1,NM_153184.3	43,43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	191/436,200/405,193/438	85961592	1,13005	2203	4300	6503	SO:0001583	missense	253559	2	121412	36				g.chr3:85961592G>A	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.572G>A	chr3.hg19:g.85961592G>A	ENSP00000384575:p.Arg191Gln	1					CADM2_ENST00000405615.2_Missense_Mutation_p.R193Q|CADM2_ENST00000383699.3_Missense_Mutation_p.R200Q	p.R191Q	NM_001167674.1	NP_001161146.1	1	3	4	2.115187	Q8N3J6	CADM2_HUMAN		5	634	+		Lung NSC(201;0.0148)	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	1	1	hg19	c.572G>A	CCDS54614.1	1	.	.	.	.	.	.	.	.	.	.	G	9.166	1.020020	0.19433	0.0	1.16E-4	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.76578	-1.03;-1.03;-1.03	5.5	4.62	0.57501	5.5	4.62	0.57501	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.280225	0.38058	N	0.001838	T	0.43411	0.1246	N	0.01874	-0.695	0.32061	N	0.595716	B;B;B	0.11235	0.002;0.003;0.004	B;B;B	0.08055	0.002;0.002;0.003	T	0.49606	-0.8922	10	0.07030	T	0.85	.	3.7449	0.08544	0.2201:0.0:0.5739:0.206	.	193;200;191	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	Q	200;191;193	ENSP00000373200:R200Q;ENSP00000384575:R191Q;ENSP00000384193:R193Q	ENSP00000373200:R200Q	R	+	2	0	0	CADM2	86044282	86044282	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.202000	0.58446	2.583000	0.87209	0.591000	0.81541	CGA	0.670692		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.433	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	1	0	1		2	2	2	0		0	0	46		46	45	1	3.450000	-9.060599	1	0.520000	NM_153184			72	70		143	139	1		1			0	0	46	0		1	0	0	0	0	0	0	72	143
MCF2L2	23101	broad.mit.edu	37	3	183017842	183017842	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr3:183017842T>A	ENST00000328913.3	-	11	1553	c.1256A>T	c.(1255-1257)aAa>aTa	p.K419I	MCF2L2_ENST00000447025.2_Missense_Mutation_p.K419I|MCF2L2_ENST00000414362.2_Missense_Mutation_p.K419I|MCF2L2_ENST00000473233.1_Missense_Mutation_p.K419I	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	419							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			AATGTCCCATTTTTTCTTGTT	0.458																																						ENST00000328913.3	1.000000	2.500000e-01	1.000000	0.310000	0.380000	0.496381	0.380000	0.360000																										0				72						c.(1255-1257)aAa>aTa		MCF.2 cell line derived transforming sequence-like 2							139.0	130.0	133.0					3																	183017842		2203	4300	6503	SO:0001583	missense	23101	0	0					g.chr3:183017842T>A	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1256A>T	chr3.hg19:g.183017842T>A	ENSP00000328118:p.Lys419Ile	1					MCF2L2_ENST00000473233.1_Missense_Mutation_p.K419I|MCF2L2_ENST00000414362.2_Missense_Mutation_p.K419I|MCF2L2_ENST00000447025.2_Missense_Mutation_p.K419I	p.K419I	NM_015078.2	NP_055893	1	2	3	1.723513	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)	11	1553	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	1	1	hg19	c.1256A>T	CCDS3243.1	0	.	.	.	.	.	.	.	.	.	.	T	15.08	2.726819	0.48833	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000437431;ENST00000414362	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	4.59	0.741	0.18336	4.59	0.741	0.18336	.	0.117224	0.56097	D	0.000033	T	0.47116	0.1428	M	0.82630	2.6	0.32472	N	0.542635	P;D	0.63880	0.904;0.993	P;P	0.57371	0.465;0.819	T	0.58561	-0.7615	10	0.56958	D	0.05	.	8.7236	0.34456	0.0:0.2264:0.0:0.7736	.	419;419	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	I	419;419;419;19;419	ENSP00000328118:K419I;ENSP00000420070:K419I;ENSP00000388190:K419I;ENSP00000414131:K419I	ENSP00000328118:K419I	K	-	2	0	0	MCF2L2	184500536	184500536	0.996000	0.38824	0.541000	0.28102	0.201000	0.24016	2.616000	0.46376	-0.021000	0.14009	-0.290000	0.09829	AAA	0.595687		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.458	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	1	0	1		2	2	2	0		0	0	75		75	74	1	3.450000	-9.043142	1	0.520000	NM_015078			28	28		322	321	0		1			0	0	75	0		1	0	0	0	0	0	0	28	322
LRBA	987	broad.mit.edu	37	4	151738335	151738335	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr4:151738335A>G	ENST00000357115.3	-	31	5489	c.5246T>C	c.(5245-5247)gTc>gCc	p.V1749A	LRBA_ENST00000507224.1_Missense_Mutation_p.V1749A|LRBA_ENST00000510413.1_Missense_Mutation_p.V1749A|LRBA_ENST00000535741.1_Missense_Mutation_p.V1749A	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1749						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AACCACACTGACAGCATTGGT	0.398																																						ENST00000357115.3	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.998214	0.990000	1.000000																										0				91						c.(5245-5247)gTc>gCc		LPS-responsive vesicle trafficking, beach and anchor containing							193.0	177.0	183.0					4																	151738335		2203	4300	6503	SO:0001583	missense	987	0	0					g.chr4:151738335A>G	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5246T>C	chr4.hg19:g.151738335A>G	ENSP00000349629:p.Val1749Ala	1					LRBA_ENST00000510413.1_Missense_Mutation_p.V1749A|LRBA_ENST00000507224.1_Missense_Mutation_p.V1749A|LRBA_ENST00000535741.1_Missense_Mutation_p.V1749A	p.V1749A	NM_006726.4	NP_006717.2	1	2	3	1.835097	P50851	LRBA_HUMAN		31	5489	-	all_hematologic(180;0.151)		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	1	1	hg19	c.5246T>C	CCDS3773.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.2|23.2	4.384896|4.384896	0.82792|0.82792	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.|T;T;T;T	.|0.58060	.|0.77;0.92;0.77;0.36	5.95|5.95	5.95|5.95	0.96441|0.96441	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.860939	.|0.10195	.|N	.|0.704143	T|T	0.72875|0.72875	0.3515|0.3515	M|M	0.72479|0.72479	2.2|2.2	0.58432|0.58432	D|D	0.999994|0.999994	.|P;D	.|0.67145	.|0.745;0.996	.|B;D	.|0.76071	.|0.251;0.987	T|T	0.63184|0.63184	-0.6694|-0.6694	5|10	.|0.27082	.|T	.|0.32	.|.	16.4323|16.4323	0.83853|0.83853	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1749;1749	.|P50851;P50851-2	.|LRBA_HUMAN;.	P|A	402|1749	.|ENSP00000446299:V1749A;ENSP00000421552:V1749A;ENSP00000349629:V1749A;ENSP00000422180:V1749A	.|ENSP00000349629:V1749A	S|V	-|-	1|2	0|0	0|0	LRBA|LRBA	151957785|151957785	151957785|151957785	0.999000|0.999000	0.42202|0.42202	0.971000|0.971000	0.41717|0.41717	0.980000|0.980000	0.70556|0.70556	4.766000|4.766000	0.62279|0.62279	2.281000|2.281000	0.76405|0.76405	0.528000|0.528000	0.53228|0.53228	TCA|GTC	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.398	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1	1	0	1		18	2	2	0		0	1	66		66	64	1	3.450000	-20.000000	1	0.520000				84	84		260	255	1		1	1		0	0	66	0		1	9.757865e-01	0	6	0	15	0	84	260
SLC12A2	6558	broad.mit.edu	37	5	127487026	127487026	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr5:127487026C>G	ENST00000262461.2	+	14	2390	c.2201C>G	c.(2200-2202)gCt>gGt	p.A734G	SLC12A2_ENST00000343225.4_Missense_Mutation_p.A734G	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	734					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	AACTGGTGGGCTGCATTGCTA	0.378																																						ENST00000262461.2	0.890000	5.400000e-01	0.800000	0.620000	0.700000	0.718624	0.700000	0.720000																										0				48						c.(2200-2202)gCt>gGt		solute carrier family 12 (sodium/potassium/chloride transporter), member 2	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)						210.0	200.0	203.0					5																	127487026		2203	4300	6503	SO:0001583	missense	6558	0	0					g.chr5:127487026C>G		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2201C>G	chr5.hg19:g.127487026C>G	ENSP00000262461:p.Ala734Gly	1					SLC12A2_ENST00000343225.4_Missense_Mutation_p.A734G	p.A734G	NM_001046.2	NP_001037.1	1	2	3	1.848393	P55011	S12A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	14	2390	+		all_cancers(142;0.0972)|Prostate(80;0.151)	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	1	1	hg19	c.2201C>G	CCDS4144.1	0	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168369	0.78339	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98968	-5.28;-5.28	4.7	4.7	0.59300	4.7	4.7	0.59300	Amino acid permease domain (1);	0.124211	0.53938	D	0.000048	D	0.99017	0.9664	M	0.90252	3.1	0.80722	D	1	D;D	0.56746	0.971;0.977	P;P	0.54544	0.641;0.755	D	0.99734	1.1013	10	0.87932	D	0	.	18.2088	0.89864	0.0:1.0:0.0:0.0	.	734;734	P55011-3;P55011	.;S12A2_HUMAN	G	734	ENSP00000262461:A734G;ENSP00000340878:A734G	ENSP00000262461:A734G	A	+	2	0	0	SLC12A2	127514925	127514925	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.626000	0.88956	0.655000	0.94253	GCT	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.378	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	1	0	1		2	2	2	0		0	0	79		79	79	1	3.450000	-20.000000	1	0.520000	NM_001046			55	54		320	319	1		1	1		0	0	79	0		1	9.610810e-01	0	3	0	30	0	55	320
PCDHGB4	8641	broad.mit.edu	37	5	140769477	140769477	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr5:140769477C>T	ENST00000519479.1	+	1	2026	c.2026C>T	c.(2026-2028)Cgc>Tgc	p.R676C	PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	676					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATCACTGACCGCCCCGACCC	0.622																																						ENST00000519479.1	1.000000	7.200000e-01	0.970000	0.800000	0.880000	0.888580	0.880000	1.000000																										0				37						c.(2026-2028)Cgc>Tgc		protocadherin gamma subfamily B, 4							127.0	139.0	135.0					5																	140769477		2161	4253	6414	SO:0001583	missense	8641	0	0					g.chr5:140769477C>T	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2026C>T	chr5.hg19:g.140769477C>T	ENSP00000428288:p.Arg676Cys	1					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_5'Flank	p.R676C	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	1	2	3	1.848393	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2026	+			O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	1	0	hg19	c.2026C>T	CCDS54928.1	1	.	.	.	.	.	.	.	.	.	.	.	14.95	2.687676	0.48097	.	.	ENSG00000253953	ENST00000519479	T	0.51574	0.7	5.4	-1.69	0.08186	5.4	-1.69	0.08186	.	.	.	.	.	T	0.59046	0.2165	M	0.79258	2.445	0.09310	N	1	D;D	0.69078	0.991;0.997	P;P	0.55615	0.78;0.489	T	0.56829	-0.7914	9	0.41790	T	0.15	.	12.3444	0.55111	0.2819:0.24:0.4781:0.0	.	676;676	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	C	676	ENSP00000428288:R676C	ENSP00000428288:R676C	R	+	1	0	0	PCDHGB4	140749661	140749661	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.066000	0.11598	-0.317000	0.08677	0.563000	0.77884	CGC	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.622	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	0	0	1		16	2	2	2		2	1	116		116	115	1	3.450000	-3.230914	1	0.520000	NM_003736			92	92		410	403	1		1			2	0	116	0		1	0	0	0	0	0	0	92	410
RBM27	54439	broad.mit.edu	37	5	145651191	145651191	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr5:145651191G>A	ENST00000265271.5	+	19	3108	c.2942G>A	c.(2941-2943)gGa>gAa	p.G981E	RBM27_ENST00000506502.1_Missense_Mutation_p.G926E	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	981					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTAACAGTTGGAGGATTCATT	0.443																																						ENST00000265271.5	0.740000	3.800000e-01	0.650000	0.460000	0.540000	0.558597	0.540000	0.540000																										0				39						c.(2941-2943)gGa>gAa		RNA binding motif protein 27							141.0	136.0	138.0					5																	145651191		1568	3582	5150	SO:0001583	missense	54439	0	0					g.chr5:145651191G>A	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2942G>A	chr5.hg19:g.145651191G>A	ENSP00000265271:p.Gly981Glu	1					RBM27_ENST00000506502.1_Missense_Mutation_p.G926E	p.G981E	NM_018989.1	NP_061862.1	1	2	3	1.848393	Q9P2N5	RBM27_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	19	3108	+			Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	1	1	hg19	c.2942G>A	CCDS43378.1	0	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225732	0.39300	.	.	ENSG00000091009	ENST00000265271	T	0.41065	1.01	4.93	3.02	0.34903	4.93	3.02	0.34903	.	0.351548	0.27019	N	0.021331	T	0.26048	0.0635	N	0.22421	0.69	0.32293	N	0.566076	B	0.19583	0.037	B	0.13407	0.009	T	0.18935	-1.0321	10	0.30854	T	0.27	-10.6489	10.0237	0.42059	0.0:0.1252:0.635:0.2397	.	981	Q9P2N5	RBM27_HUMAN	E	981	ENSP00000265271:G981E	ENSP00000265271:G981E	G	+	2	0	0	RBM27	145631384	145631384	0.676000	0.27567	1.000000	0.80357	0.993000	0.82548	2.866000	0.48420	2.445000	0.82738	0.650000	0.86243	GGA	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.443	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	1	0	1		2	2	2	0		0	0	63		63	62	1	3.450000	-3.221916	1	0.520000	XM_291128			31	31		244	240	1		1	1		0	0	63	0		1	7.703714e-01	0	3	0	21	0	31	244
C5orf42	65250	broad.mit.edu	37	5	37187926	37187926	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr5:37187926C>A	ENST00000508244.1	-	21	3923	c.3830G>T	c.(3829-3831)tGt>tTt	p.C1277F	C5orf42_ENST00000274258.7_Missense_Mutation_p.C158F|C5orf42_ENST00000425232.2_Missense_Mutation_p.C1277F			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1277						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ACACAGAGCACAAAGTTCTCT	0.358																																						ENST00000508244.1	1.000000	1.700000e-01	1.000000	0.250000	0.370000	0.477581	0.370000	0.330000																										0				79						c.(3829-3831)tGt>tTt		chromosome 5 open reading frame 42							81.0	77.0	78.0					5																	37187926		2203	4300	6503	SO:0001583	missense	65250	0	0					g.chr5:37187926C>A		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3830G>T	chr5.hg19:g.37187926C>A	ENSP00000421690:p.Cys1277Phe	1					C5orf42_ENST00000274258.7_Missense_Mutation_p.C158F|C5orf42_ENST00000425232.2_Missense_Mutation_p.C1277F	p.C1277F			0	5	5	1.749031	Q9H799	CE042_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)	21	3923	-	all_lung(31;0.000616)		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	1	1	hg19	c.3830G>T	CCDS34146.2	0	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644168	0.87859	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.75367	-0.77;-0.77;-0.93;-0.85	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.81697	0.4877	L	0.32530	0.975	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.83156	-0.0101	10	0.87932	D	0	.	19.7365	0.96208	0.0:1.0:0.0:0.0	.	1277;158	E9PH94;Q9H799	.;CE042_HUMAN	F	1277;1277;158;325;158	ENSP00000421690:C1277F;ENSP00000389014:C1277F;ENSP00000274258:C158F;ENSP00000424223:C325F	ENSP00000274258:C158F	C	-	2	0	0	C5orf42	37223683	37223683	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	6.568000	0.73987	2.749000	0.94314	0.491000	0.48974	TGT	0.600931		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.358	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	1	0	1		2	2	2	0		0	0	29		29	29	1	3.450000	-13.689020	1	0.520000	NM_023073			9	9		117	116	0		1	0		0	0	29	0		9.945717e-01	6.661822e-03	0	0	0	2	0	9	117
HCN1	348980	broad.mit.edu	37	5	45262241	45262241	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr5:45262241C>T	ENST00000303230.4	-	8	2512	c.2455G>A	c.(2455-2457)Gtg>Atg	p.V819M		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	819					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ACCGCCGTCACGGGTTGAGGG	0.677																																						ENST00000303230.4	0.680000	2.100000e-01	0.550000	0.300000	0.410000	0.431201	0.410000	0.390000																										0				156						c.(2455-2457)Gtg>Atg		hyperpolarization activated cyclic nucleotide-gated potassium channel 1							31.0	33.0	32.0					5																	45262241		2203	4300	6503	SO:0001583	missense	348980	0	0					g.chr5:45262241C>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2455G>A	chr5.hg19:g.45262241C>T	ENSP00000307342:p.Val819Met	1						p.V819M	NM_021072.3	NP_066550.2	1	2	3	1.854437	O60741	HCN1_HUMAN		8	2512	-				Missense_Mutation	SNP	ENST00000303230.4	0	1	hg19	c.2455G>A	CCDS3952.1	0	.	.	.	.	.	.	.	.	.	.	C	3.532	-0.095427	0.07010	.	.	ENSG00000164588	ENST00000303230	D	0.97430	-4.38	5.02	3.2	0.36748	5.02	3.2	0.36748	.	0.562530	0.16681	N	0.203943	D	0.91851	0.7421	N	0.19112	0.55	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	D	0.85041	0.0923	10	0.62326	D	0.03	.	6.1826	0.20480	0.0:0.6436:0.1339:0.2225	.	819	O60741	HCN1_HUMAN	M	819	ENSP00000307342:V819M	ENSP00000307342:V819M	V	-	1	0	0	HCN1	45297998	45297998	0.033000	0.19621	0.118000	0.21660	0.722000	0.41435	1.321000	0.33678	0.596000	0.29794	0.655000	0.94253	GTG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.677	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	0	0	1		18	2	2	1		1	1	18		18	17	1	3.450000	-15.543950	1	0.520000	NM_021072			10	8		111	106	0		0			1	0	18	0		5.435040e-02	0	0	0	0	0	0	10	111
GRIA1	2890	broad.mit.edu	37	5	153026597	153026597	+	Silent	SNP	G	G	A	rs370782311		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr5:153026597G>A	ENST00000285900.5	+	3	673	c.330G>A	c.(328-330)acG>acA	p.T110T	GRIA1_ENST00000340592.5_Silent_p.T110T|GRIA1_ENST00000448073.4_Silent_p.T120T|GRIA1_ENST00000521843.2_Silent_p.T41T|GRIA1_ENST00000518783.1_Silent_p.T120T|GRIA1_ENST00000518142.1_Intron|GRIA1_ENST00000518862.1_3'UTR	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	110					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.T110T(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GCTTCATTACGCCGAGCTTTC	0.498																																						ENST00000285900.5	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.998293	0.990000	1.000000																										2	Substitution - coding silent(2)	p.T110T(2)	endometrium(2)	81						c.(328-330)acG>acA		glutamate receptor, ionotropic, AMPA 1	Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	G	,	1,4405		0,1,2202	169.0	154.0	159.0		330,330	-8.9	0.0	5		159	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GRIA1	NM_000827.3,NM_001114183.1	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	110/907,110/907	153026597	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	2890	0	0					g.chr5:153026597G>A		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.330G>A	chr5.hg19:g.153026597G>A		1					GRIA1_ENST00000518142.1_Intron|GRIA1_ENST00000340592.5_Silent_p.T110T|GRIA1_ENST00000448073.4_Silent_p.T120T|GRIA1_ENST00000521843.2_Silent_p.T41T|GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000518783.1_Silent_p.T120T	p.T110T	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	1	2	3	1.848393	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	3	673	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	1	1	hg19	c.330G>A	CCDS4322.1	1																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.498	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3	1	0	1		2	2	2	0		0	0	75		75	73	1	3.450000	-20.000000	1	0.520000				109	109		348	346	1		1			0	0	75	0		1	0	0	0	0	0	0	109	348
PLEKHG1	57480	broad.mit.edu	37	6	151054871	151054871	+	Silent	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr6:151054871G>A	ENST00000358517.2	+	2	265	c.54G>A	c.(52-54)tcG>tcA	p.S18S	PLEKHG1_ENST00000367328.1_Silent_p.S18S			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	18							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CATCATCCTCGGCCTCTTCCC	0.542																																						ENST00000358517.2	1.000000	2.000000e-02	0.190000	0.050000	0.090000	0.228851	0.090000	0.070000																										0				53						c.(52-54)tcG>tcA		pleckstrin homology domain containing, family G (with RhoGef domain) member 1							97.0	97.0	97.0					6																	151054871		2203	4300	6503	SO:0001819	synonymous_variant	57480	0	0					g.chr6:151054871G>A	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.54G>A	chr6.hg19:g.151054871G>A		0					PLEKHG1_ENST00000367328.1_Silent_p.S18S	p.S18S			2	2	4	2.056728	Q9ULL1	PKHG1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.0923)	2	265	+			Q5T1F2	Silent	SNP	ENST00000358517.2	0	1	hg19	c.54G>A	CCDS34552.1	0																																																																																								0.661017		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.542	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1	0	0	1		2	2	2	0		0	0	69		69	69	1	3.450000	-2.655910	1	0.520000				6	6		410	402	0		1	0	0	0	0	69	0		9.630802e-01	5.152734e-02	0	0	0	21	1	6	410
DSP	1832	broad.mit.edu	37	6	7571743	7571743	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr6:7571743C>G	ENST00000379802.3	+	14	2170	c.1829C>G	c.(1828-1830)tCt>tGt	p.S610C	DSP_ENST00000418664.2_Missense_Mutation_p.S610C	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	610	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAAATACAGTCTCAGTTCACC	0.488																																						ENST00000379802.3	1.000000	2.200000e-01	0.470000	0.270000	0.320000	0.428115	0.320000	0.320000																										0				101						c.(1828-1830)tCt>tGt		desmoplakin							195.0	180.0	185.0					6																	7571743		2203	4300	6503	SO:0001583	missense	1832	0	0					g.chr6:7571743C>G	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1829C>G	chr6.hg19:g.7571743C>G	ENSP00000369129:p.Ser610Cys	0					DSP_ENST00000418664.2_Missense_Mutation_p.S610C	p.S610C	NM_004415.2	NP_004406.2	2	2	4	2.044431	P15924	DESP_HUMAN		14	2170	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	1	1	hg19	c.1829C>G	CCDS4501.1	0	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988573	0.53934	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	T;T	0.75050	-0.57;-0.9	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.352625	0.24412	N	0.038749	T	0.51126	0.1656	N	0.14661	0.345	0.35388	D	0.790495	B;B	0.28055	0.199;0.199	B;B	0.26864	0.074;0.074	T	0.58707	-0.7589	10	0.72032	D	0.01	.	19.7154	0.96115	0.0:1.0:0.0:0.0	.	657;610	Q4LE79;P15924	.;DESP_HUMAN	C	610;610;415	ENSP00000369129:S610C;ENSP00000396591:S610C	ENSP00000369129:S610C	S	+	2	0	0	DSP	7516742	7516742	0.998000	0.40836	0.964000	0.40570	0.988000	0.76386	3.766000	0.55280	2.664000	0.90586	0.655000	0.94253	TCT	0.659768		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.488	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	1	0	1		2	2	2	0		0	0	124		124	123	1	3.450000	-7.284908	1	0.520000	NM_004415			42	42		682	673	0		1	0		0	0	124	0		1	9.252693e-01	0	1	0	72	0	42	682
RNF39	80352	broad.mit.edu	37	6	30043491	30043491	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr6:30043491C>T	ENST00000244360.6	-	1	173	c.76G>A	c.(76-78)Gca>Aca	p.A26T	RNF39_ENST00000376751.3_Missense_Mutation_p.A26T	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	26						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										TTAACTTTTGCCGCTTTCCGC	0.602																																					NSCLC(8;188 360 1520 20207 31481)	ENST00000244360.6	1.000000	2.000000e-02	0.240000	0.050000	0.100000	0.241452	0.100000	0.080000																										0										c.(76-78)Gca>Aca		ring finger protein 39							51.0	53.0	53.0					6																	30043491		2203	4300	6503	SO:0001583	missense	80352	0	0					g.chr6:30043491C>T	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.76G>A	chr6.hg19:g.30043491C>T	ENSP00000244360:p.Ala26Thr	0					RNF39_ENST00000376751.3_Missense_Mutation_p.A26T	p.A26T	NM_025236.3	NP_079512.2	2	2	4	2.044431	Q9H2S5	RNF39_HUMAN		1	173	-			A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	0	1	hg19	c.76G>A	CCDS4673.1	0	.	.	.	.	.	.	.	.	.	.	c	17.05	3.290422	0.59976	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.70749	-0.03;-0.51	3.51	0.223	0.15292	3.51	0.223	0.15292	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.09377	0.002;0.004	T	0.17137	-1.0379	9	0.66056	D	0.02	.	2.3362	0.04248	0.1257:0.4139:0.293:0.1674	.	26;26	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	T	26	ENSP00000365942:A26T;ENSP00000244360:A26T	ENSP00000244360:A26T	A	-	1	0	0	RNF39	30151470	30151470	0.000000	0.05858	0.000000	0.03702	0.834000	0.47266	-0.148000	0.10219	0.251000	0.21505	0.436000	0.28706	GCA	0.659768		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.602	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	0	0	1		17	2	2	1		1	1	79		79	76	1	3.450000	-2.312564	0	0.520000	NM_170769			6	6		373	368	0		0	0		1	0	79	0		1.452191e-02	1.241839e-02	0	0	0	9	0	6	373
COL19A1	1310	broad.mit.edu	37	6	70831785	70831785	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr6:70831785T>C	ENST00000322773.4	+	17	1394	c.1292T>C	c.(1291-1293)aTa>aCa	p.I431T	COL19A1_ENST00000393344.1_Missense_Mutation_p.I53T	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	431	Collagen-like 3.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CCTCCTGGAATACAAGGAATA	0.269																																						ENST00000322773.4	1.000000	1.000000e-02	0.170000	0.050000	0.080000	0.221878	0.080000	0.070000																										0				109						c.(1291-1293)aTa>aCa		collagen, type XIX, alpha 1							66.0	73.0	71.0					6																	70831785		2200	4275	6475	SO:0001583	missense	1310	0	0					g.chr6:70831785T>C		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1292T>C	chr6.hg19:g.70831785T>C	ENSP00000316030:p.Ile431Thr	0					COL19A1_ENST00000393344.1_Missense_Mutation_p.I53T	p.I431T	NM_001858.4	NP_001849.2	2	2	4	2.056728	Q14993	COJA1_HUMAN		17	1394	+			Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	0	1	hg19	c.1292T>C	CCDS4970.1	0	.	.	.	.	.	.	.	.	.	.	T	9.437	1.087165	0.20390	.	.	ENSG00000082293	ENST00000322773;ENST00000393344;ENST00000455415	D;T;T	0.96136	-3.92;1.4;1.4	5.32	1.21	0.21127	5.32	1.21	0.21127	.	1.367040	0.04335	N	0.353095	T	0.80602	0.4654	L	0.35542	1.07	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.72475	-0.4282	10	0.10636	T	0.68	.	2.6339	0.04952	0.1426:0.0899:0.1479:0.6195	.	431	Q14993	COJA1_HUMAN	T	431;53;5	ENSP00000316030:I431T;ENSP00000377013:I53T;ENSP00000416556:I5T	ENSP00000316030:I431T	I	+	2	0	0	COL19A1	70888506	70888506	0.027000	0.19231	0.069000	0.20011	0.880000	0.50808	0.635000	0.24629	0.501000	0.28013	0.533000	0.62120	ATA	0.661017		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.269	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1	0	0	1		2	2	2	0		0	0	90		90	90	1	3.450000	-3.323001	1	0.520000				7	7		517	506	0		1			0	0	90	0		9.792159e-01	0	0	0	0	0	0	7	517
TIAM2	26230	broad.mit.edu	37	6	155450620	155450620	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr6:155450620G>A	ENST00000461783.3	+	6	1536	c.263G>A	c.(262-264)gGt>gAt	p.G88D	TIAM2_ENST00000529824.2_Missense_Mutation_p.G88D|TIAM2_ENST00000456144.1_Missense_Mutation_p.G88D|TIAM2_ENST00000360366.4_Missense_Mutation_p.G88D|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000318981.5_Missense_Mutation_p.G88D			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	88					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GTCTCCAGAGGTGTTGCCTAC	0.552																																						ENST00000461783.3	1.000000	2.400000e-01	0.720000	0.330000	0.440000	0.519246	0.440000	0.400000																										0				65						c.(262-264)gGt>gAt		T-cell lymphoma invasion and metastasis 2							72.0	65.0	68.0					6																	155450620		2203	4300	6503	SO:0001583	missense	26230	0	0					g.chr6:155450620G>A		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.263G>A	chr6.hg19:g.155450620G>A	ENSP00000437188:p.Gly88Asp	0					TIAM2_ENST00000360366.4_Missense_Mutation_p.G88D|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000318981.5_Missense_Mutation_p.G88D|TIAM2_ENST00000456144.1_Missense_Mutation_p.G88D|TIAM2_ENST00000529824.2_Missense_Mutation_p.G88D	p.G88D			2	2	4	2.056728	Q8IVF5	TIAM2_HUMAN		6	1536	+		Ovarian(120;0.196)	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	1	1	hg19	c.263G>A	CCDS34558.1	0	.	.	.	.	.	.	.	.	.	.	G	9.868	1.198064	0.22037	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000535583;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.06933	3.33;3.24;3.3;3.33;3.32;3.3	5.33	4.46	0.54185	5.33	4.46	0.54185	.	0.114029	0.64402	N	0.000011	T	0.03915	0.0110	M	0.62723	1.935	0.80722	D	1	B	0.30021	0.265	B	0.24006	0.05	T	0.15263	-1.0443	10	0.51188	T	0.08	.	7.9497	0.30008	0.0808:0.0:0.7604:0.1588	.	88	Q8IVF5	TIAM2_HUMAN	D	88;334;88;88;88;88;88;88	ENSP00000437188:G88D;ENSP00000434901:G88D;ENSP00000407746:G88D;ENSP00000327315:G88D;ENSP00000353528:G88D;ENSP00000433348:G88D	ENSP00000327315:G88D	G	+	2	0	0	TIAM2	155492312	155492312	0.975000	0.34042	0.131000	0.22000	0.014000	0.08584	2.069000	0.41481	1.230000	0.43646	0.561000	0.74099	GGT	0.661017		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.552	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	1	0	1		2	2	2	0		0	0	30		30	30	1	3.450000	-18.966090	1	0.520000	NM_012454			14	14		172	171	0		1	0		0	0	30	0		9.997830e-01	1.905473e-02	0	1	0	2	0	14	172
MUC17	140453	broad.mit.edu	37	7	100679220	100679220	+	Missense_Mutation	SNP	C	C	T	rs374713003		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr7:100679220C>T	ENST00000306151.4	+	3	4587	c.4523C>T	c.(4522-4524)aCg>aTg	p.T1508M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1508	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCAATCTCAACGCCTAGTGAA	0.473																																						ENST00000306151.4	1.000000	4.200000e-01	1.000000	0.480000	0.540000	0.643524	0.540000	0.530000																										0				343						c.(4522-4524)aCg>aTg		mucin 17, cell surface associated		G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	209.0	197.0	201.0		4523	-0.1	0.0	7		201	1,8599	1.2+/-3.3	0,1,4299	no	missense	MUC17	NM_001040105.1	81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	1508/4494	100679220	2,13004	2203	4300	6503	SO:0001583	missense	140453	23	121374	48				g.chr7:100679220C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4523C>T	chr7.hg19:g.100679220C>T	ENSP00000302716:p.Thr1508Met	1						p.T1508M	NM_001040105.1	NP_001035194.1	3	5	8	2.700920	Q685J3	MUC17_HUMAN		3	4587	+	Lung NSC(181;0.136)|all_lung(186;0.182)		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	1	1	hg19	c.4523C>T	CCDS34711.1	0	.	.	.	.	.	.	.	.	.	.	c	0.032	-1.330977	0.01298	2.27E-4	1.16E-4	ENSG00000169876	ENST00000306151	T	0.03330	3.97	0.922	-0.0705	0.13747	0.922	-0.0705	0.13747	.	.	.	.	.	T	0.04092	0.0114	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.53185	0.72	T	0.45454	-0.9260	9	0.32370	T	0.25	.	4.9293	0.13909	0.0:0.6094:0.3906:0.0	.	1508	Q685J3	MUC17_HUMAN	M	1508	ENSP00000302716:T1508M	ENSP00000302716:T1508M	T	+	2	0	0	MUC17	100465940	100465940	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.062000	0.14389	0.011000	0.14865	-1.865000	0.00557	ACG	0.741658		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	1	0	0		2	2	2	0		0	0	196		196	184	1	3.450000	-18.445280	1	0.520000	NM_001040105			100	99		1257	1152	0		1	0		0	0	196	0		1	5.565760e-03	0	0	0	2	0	100	1257
NUP205	23165	broad.mit.edu	37	7	135304378	135304378	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr7:135304378A>G	ENST00000285968.6	+	29	4197	c.4171A>G	c.(4171-4173)Att>Gtt	p.I1391V		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1391					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TTTTGCTTCTATTGGAGATTC	0.368																																						ENST00000285968.6	0.410000	1.400000e-01	0.330000	0.190000	0.250000	0.269284	0.250000	0.260000																										0				93						c.(4171-4173)Att>Gtt		nucleoporin 205kDa							59.0	59.0	59.0					7																	135304378		2203	4300	6503	SO:0001583	missense	23165	0	0					g.chr7:135304378A>G	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4171A>G	chr7.hg19:g.135304378A>G	ENSP00000285968:p.Ile1391Val	1						p.I1391V	NM_015135.2	NP_055950	0	1	1	1.358100	Q92621	NU205_HUMAN		29	4197	+			A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	1	1	hg19	c.4171A>G	CCDS34759.1	0	.	.	.	.	.	.	.	.	.	.	A	6.227	0.410051	0.11812	.	.	ENSG00000155561	ENST00000285968	T	0.29142	1.58	5.67	2.02	0.26589	5.67	2.02	0.26589	.	0.133675	0.64402	N	0.000002	T	0.12347	0.0300	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14755	-1.0461	10	0.14656	T	0.56	-22.4023	6.4248	0.21764	0.6149:0.1191:0.266:0.0	.	1391	Q92621	NU205_HUMAN	V	1391	ENSP00000285968:I1391V	ENSP00000285968:I1391V	I	+	1	0	0	NUP205	134954918	134954918	1.000000	0.71417	0.984000	0.44739	0.990000	0.78478	4.161000	0.58170	0.107000	0.17824	0.397000	0.26171	ATT	0.464286		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.368	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1	1	0	0		2	2	2	0		0	0	43		43	42	1	3.450000	-18.283880	1	0.520000				13	13		163	159	0		1	1		0	0	43	0		9.995314e-01	1.571301e-01	0	2	0	7	0	13	163
DNAH11	8701	broad.mit.edu	37	7	21599227	21599227	+	Silent	SNP	G	G	A	rs373971291		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr7:21599227G>A	ENST00000409508.3	+	4	730	c.699G>A	c.(697-699)ccG>ccA	p.P233P	DNAH11_ENST00000328843.6_Silent_p.P233P	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	233	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GTAGGCCACCGTCAAACGAAA	0.308									Kartagener syndrome																													ENST00000409508.3	1.000000	3.700000e-01	0.950000	0.500000	0.670000	0.698269	0.670000	1.000000																										0				230						c.(697-699)ccG>ccA		dynein, axonemal, heavy chain 11		G		0,3650		0,0,1825	60.0	58.0	59.0		699	-3.4	0.0	7		59	1,8153		0,1,4076	no	coding-synonymous	DNAH11	NM_003777.3		0,1,5901	AA,AG,GG		0.0123,0.0,0.0085		233/4524	21599227	1,11803	1825	4077	5902	SO:0001819	synonymous_variant	8701	3	120704	32	Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21599227G>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.699G>A	chr7.hg19:g.21599227G>A		1					DNAH11_ENST00000328843.6_Silent_p.P233P	p.P233P	NM_001277115.1	NP_001264044.1	1	4	5	2.427488	Q96DT5	DYH11_HUMAN		4	730	+			Q9UJ82	Silent	SNP	ENST00000409508.3	1	1	hg19	c.699G>A		0																																																																																								0.711365		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.308	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1		2	2	2	0		0	0	29		29	29	1	3.450000	-7.815694	1	0.520000	NM_003777			14	14		129	127	1		1	0		0	0	29	0		9.997843e-01	0	0	1	0	0	0	14	129
CCL24	6369	broad.mit.edu	37	7	75441265	75441265	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr7:75441265C>T	ENST00000416943.1	-	4	302	c.209G>A	c.(208-210)gGc>gAc	p.G70D	CCL24_ENST00000222902.2_Missense_Mutation_p.G70D	NM_002991.2	NP_002982.2	O00175	CCL24_HUMAN	chemokine (C-C motif) ligand 24	70					cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of inflammatory response (GO:0050729)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3						GAACTGCTGGCCCTTCTTGGT	0.612																																						ENST00000416943.1	0.280000	5.000000e-02	0.210000	0.090000	0.140000	0.155358	0.140000	0.130000																										0				3						c.(208-210)gGc>gAc		chemokine (C-C motif) ligand 24							83.0	69.0	74.0					7																	75441265		2203	4300	6503	SO:0001583	missense	6369	0	0					g.chr7:75441265C>T	U85768	CCDS34670.1	7q11.23	2013-02-25	2002-08-22	2002-08-23	ENSG00000106178	ENSG00000106178		"""Chemokine ligands"", ""Endogenous ligands"""	10623	protein-coding gene	gene with protein product	"""CK-beta-6"", ""myeloid progenitor inhibitory factor 2"", ""eotaxin-2"""	602495	"""small inducible cytokine subfamily A (Cys-Cys), member 24"""	SCYA24		9104803, 9598329	Standard	NM_002991		Approved	Ckb-6, MPIF-2, eotaxin-2, MPIF2	uc011kga.2	O00175	OTTHUMG00000156635	ENST00000416943.1:c.209G>A	chr7.hg19:g.75441265C>T	ENSP00000400533:p.Gly70Asp	1					CCL24_ENST00000222902.2_Missense_Mutation_p.G70D	p.G70D	NM_002991.2	NP_002982.2	2	2	4	2.209518	O00175	CCL24_HUMAN		4	302	-			B2R5K2	Missense_Mutation	SNP	ENST00000416943.1	0	1	hg19	c.209G>A	CCDS34670.1	0	.	.	.	.	.	.	.	.	.	.	C	9.453	1.091082	0.20471	.	.	ENSG00000106178	ENST00000222902;ENST00000416943	T;T	0.05925	3.37;3.37	4.15	3.26	0.37387	4.15	3.26	0.37387	Chemokine interleukin-8-like domain (3);	0.680432	0.13196	N	0.406384	T	0.08670	0.0215	L	0.61036	1.89	0.27743	N	0.944416	B	0.29716	0.255	B	0.30716	0.119	T	0.15235	-1.0444	10	0.36615	T	0.2	.	8.3206	0.32126	0.0:0.8859:0.0:0.1141	.	70	O00175	CCL24_HUMAN	D	70	ENSP00000222902:G70D;ENSP00000400533:G70D	ENSP00000222902:G70D	G	-	2	0	0	CCL24	75279201	75279201	0.659000	0.27411	0.245000	0.24217	0.370000	0.29829	1.945000	0.40273	0.862000	0.35528	0.555000	0.69702	GGC	0.684211		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.612	CCL24-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344886.1	0	0	1		2	2	2	0		0	0	57		57	56	1	3.450000	-6.821953	1	0.520000	NM_002991			6	6		255	251	0		1	0		0	0	57	0		9.637746e-01	4.924807e-02	0	0	0	13	0	6	255
FZD1	8321	broad.mit.edu	37	7	90894600	90894600	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr7:90894600C>T	ENST00000287934.2	+	1	818	c.405C>T	c.(403-405)ccC>ccT	p.P135P		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	135	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			CCATCATGCCCAACCTGCTGG	0.617																																						ENST00000287934.2	1.000000	1.900000e-01	1.000000	0.250000	0.330000	0.482991	0.330000	0.320000																										0				24						c.(403-405)ccC>ccT		frizzled class receptor 1							168.0	144.0	152.0					7																	90894600		2203	4300	6503	SO:0001819	synonymous_variant	8321	0	0					g.chr7:90894600C>T	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.405C>T	chr7.hg19:g.90894600C>T		1						p.P135P	NM_003505.1	NP_003496.1	3	6	9	2.774697	Q9UP38	FZD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0134)	1	818	+	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		A4D1E8|O94815|Q549T8	Silent	SNP	ENST00000287934.2	1	1	hg19	c.405C>T	CCDS5620.1	0																																																																																								0.748691		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.617	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	0	0	1		2	2	2	0		0	0	45		45	42	1	3.450000	-2.741919	1	0.520000	NM_003505			23	23		530	519	0		1	0		0	0	45	0		9.999992e-01	1.081264e-01	0	0	0	13	0	23	530
PTPRN2	5799	broad.mit.edu	37	7	157370783	157370783	+	Missense_Mutation	SNP	G	G	A	rs567734269	byFrequency	TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr7:157370783G>A	ENST00000389418.4	-	18	2555	c.2546C>T	c.(2545-2547)gCg>gTg	p.A849V	PTPRN2_ENST00000404321.2_Missense_Mutation_p.A872V|PTPRN2_ENST00000409483.1_Missense_Mutation_p.A811V|PTPRN2_ENST00000389416.4_Missense_Mutation_p.A832V|PTPRN2_ENST00000389413.3_Missense_Mutation_p.A820V	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	849	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GCCGTTCTCCGCGAGGGGTGT	0.622													G|||	2	0.000399361	0.0	0.0	5008	,	,		16184	0.002		0.0	False		,,,				2504	0.0					ENST00000389418.4	1.000000	1.300000e-01	1.000000	0.190000	0.270000	0.406292	0.270000	0.240000																										0				86						c.(2545-2547)gCg>gTg		protein tyrosine phosphatase, receptor type, N polypeptide 2							85.0	70.0	75.0					7																	157370783		2203	4300	6503	SO:0001583	missense	5799	0	0					g.chr7:157370783G>A	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2546C>T	chr7.hg19:g.157370783G>A	ENSP00000374069:p.Ala849Val	1					PTPRN2_ENST00000389413.3_Missense_Mutation_p.A820V|PTPRN2_ENST00000409483.1_Missense_Mutation_p.A811V|PTPRN2_ENST00000404321.2_Missense_Mutation_p.A872V|PTPRN2_ENST00000389416.4_Missense_Mutation_p.A832V	p.A849V	NM_002847.3	NP_002838.2	0	2	2	1.385510	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	18	2555	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	1	1	hg19	c.2546C>T	CCDS5947.1	0	.	.	.	.	.	.	.	.	.	.	G	2.966	-0.213558	0.06140	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.33	5.33	0.75918	5.33	5.33	0.75918	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.607774	0.16155	N	0.227082	T	0.48114	0.1482	N	0.00134	-2.025	0.09310	N	1	B;B;B;B;B	0.17667	0.02;0.009;0.003;0.023;0.009	B;B;B;B;B	0.08055	0.002;0.003;0.002;0.002;0.003	T	0.26744	-1.0094	10	0.02654	T	1	.	14.2668	0.66123	0.0732:0.0:0.9268:0.0	.	872;811;820;832;849	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	V	811;820;832;849;872	ENSP00000387114:A811V;ENSP00000374064:A820V;ENSP00000374067:A832V;ENSP00000374069:A849V;ENSP00000385464:A872V	ENSP00000374064:A820V	A	-	2	0	0	PTPRN2	157063544	157063544	0.929000	0.31497	0.190000	0.23270	0.069000	0.16628	5.203000	0.65174	2.488000	0.83962	0.655000	0.94253	GCG	0.520000		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.622	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1	1	0	1		2	2	2	0		0	0	51		51	50	1	3.450000	-13.738760	1	0.520000				10	10		145	138	0		1	0		0	0	51	0		9.964335e-01	1.557914e-01	0	0	0	10	0	10	145
DLGAP2	9228	broad.mit.edu	37	8	1645335	1645335	+	Missense_Mutation	SNP	C	C	T	rs373082856		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr8:1645335C>T	ENST00000421627.2	+	11	2713	c.2579C>T	c.(2578-2580)cCg>cTg	p.P860L		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	939					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		ATGCCGAGGCCGACGTCGCAG	0.667																																						ENST00000421627.2	1.000000	3.100000e-01	0.790000	0.420000	0.560000	0.605760	0.560000	0.530000																										0				41						c.(2578-2580)cCg>cTg		discs, large (Drosophila) homolog-associated protein 2		C	LEU/PRO	0,4008		0,0,2004	23.0	28.0	26.0		2579	4.9	0.1	8		26	2,8302		0,2,4150	no	missense	DLGAP2	NM_004745.3	98	0,2,6154	TT,TC,CC		0.0241,0.0,0.0162	probably-damaging	860/976	1645335	2,12310	2004	4152	6156	SO:0001583	missense	9228	4	120886	34				g.chr8:1645335C>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2579C>T	chr8.hg19:g.1645335C>T	ENSP00000400258:p.Pro860Leu	0						p.P860L	NM_004745.3	NP_004736.2	2	2	4	1.551692	Q9P1A6	DLGP2_HUMAN		11	2713	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	1	1	hg19	c.2579C>T	CCDS47760.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.12|19.12	3.766620|3.766620	0.69878|0.69878	0.0|0.0	2.41E-4|2.41E-4	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.22945|.	1.93|.	4.91|4.91	4.91|4.91	0.64330|0.64330	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83695|.	0.5310|.	M|M	0.88105|0.88105	2.93|2.93	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.992|.	D;D|.	0.97110|.	1.0;0.976|.	D|.	0.86683|.	0.1918|.	10|.	0.87932|.	D|.	0|.	-12.8537|-12.8537	18.0887|18.0887	0.89466|0.89466	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	925;939|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	L|X	891;860|863	ENSP00000400258:P860L|.	ENSP00000348366:P891L|.	P|R	+|+	2|1	0|2	0|2	DLGAP2|DLGAP2	1632742|1632742	1632742|1632742	1.000000|1.000000	0.71417|0.71417	0.060000|0.060000	0.19600|0.19600	0.254000|0.254000	0.26022|0.26022	7.404000|7.404000	0.79996|0.79996	2.270000|2.270000	0.75569|0.75569	0.561000|0.561000	0.74099|0.74099	CCG|CGA	0.552573		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	1	0	1		2	2	2	0		0	0	28		28	25	1	3.450000	-19.982970	1	0.520000	NM_004745			13	13		88	84	1		1			0	0	28	0		9.995480e-01	0	0	0	0	0	0	13	88
RP1	6101	broad.mit.edu	37	8	55533656	55533656	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr8:55533656G>A	ENST00000220676.1	+	2	278	c.130G>A	c.(130-132)Gga>Aga	p.G44R		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	44	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTACAAGAGCGGAGACCCCCA	0.547																																					Colon(91;1014 1389 7634 14542 40420)	ENST00000220676.1	0.340000	1.100000e-01	0.270000	0.150000	0.200000	0.219123	0.200000	0.210000																										0				169						c.(130-132)Gga>Aga		retinitis pigmentosa 1 (autosomal dominant)							106.0	95.0	99.0					8																	55533656		2203	4300	6503	SO:0001583	missense	6101	0	0					g.chr8:55533656G>A	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.130G>A	chr8.hg19:g.55533656G>A	ENSP00000220676:p.Gly44Arg	1						p.G44R	NM_006269.1	NP_006260.1	1	2	3	1.801915	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)	2	278	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)		Missense_Mutation	SNP	ENST00000220676.1	1	1	hg19	c.130G>A	CCDS6160.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.162331	0.94727	.	.	ENSG00000104237	ENST00000220676	D	0.95272	-3.66	5.44	5.44	0.79542	5.44	5.44	0.79542	Doublecortin domain (4);	0.000000	0.56097	D	0.000023	D	0.98182	0.9399	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99164	1.0862	10	0.87932	D	0	-18.28	19.2628	0.93974	0.0:0.0:1.0:0.0	.	44	P56715	RP1_HUMAN	R	44	ENSP00000220676:G44R	ENSP00000220676:G44R	G	+	1	0	0	RP1	55696209	55696209	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.790000	0.99075	2.545000	0.85829	0.650000	0.86243	GGA	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.547	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	1	0	1		2	2	2	0		0	0	75		75	74	1	3.450000	-3.013260	1	0.520000	NM_006269			13	13		294	287	0		1			0	0	75	0		9.994793e-01	0	0	0	0	0	0	13	294
NECAB1	64168	broad.mit.edu	37	8	91929840	91929840	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr8:91929840C>T	ENST00000417640.2	+	6	815	c.478C>T	c.(478-480)Caa>Taa	p.Q160*		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	160						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			TACTGAGGAGCAAACCCGTCA	0.383																																						ENST00000417640.2	1.000000	1.900000e-01	0.440000	0.250000	0.330000	0.368991	0.330000	0.320000																										0				12						c.(478-480)Caa>Taa		N-terminal EF-hand calcium binding protein 1							114.0	112.0	113.0					8																	91929840		1860	4099	5959	SO:0001587	stop_gained	64168	0	0					g.chr8:91929840C>T	AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.478C>T	chr8.hg19:g.91929840C>T	ENSP00000387380:p.Gln160*	1						p.Q160*	NM_022351.4	NP_071746.1	1	2	3	1.792031	Q8N987	NECA1_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0499)	6	815	+			Q6NUS7|Q96AZ7|Q9HBW8	Nonsense_Mutation	SNP	ENST00000417640.2	0	1	hg19	c.478C>T	CCDS47889.1	0	.	.	.	.	.	.	.	.	.	.	C	39	7.736388	0.98462	.	.	ENSG00000123119	ENST00000417640	.	.	.	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.110120	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.9093	18.6331	0.91368	0.0:1.0:0.0:0.0	.	.	.	.	X	160	.	ENSP00000387380:Q160X	Q	+	1	0	0	NECAB1	91999016	91999016	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.953000	0.75995	2.386000	0.81285	0.467000	0.42956	CAA	0.614272		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.383	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376728.1	1	0	1		2	2	2	0		0	0	42		42	42	1	3.450000	-6.173016	1	0.520000	NM_022351			15	15		209	208	0		1			0	0	42	0		9.998848e-01	0	0	0	0	0	0	15	209
FAM135B	51059	broad.mit.edu	37	8	139165088	139165088	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr8:139165088C>A	ENST00000395297.1	-	13	1800	c.1630G>T	c.(1630-1632)Gag>Tag	p.E544*		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	544										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGTCCATCCTCTGGACCTGGA	0.512										HNSCC(54;0.14)																												ENST00000395297.1	0.590000	2.600000e-01	0.500000	0.330000	0.410000	0.422811	0.410000	0.420000																										0				238						c.(1630-1632)Gag>Tag		family with sequence similarity 135, member B							79.0	77.0	78.0					8																	139165088		1949	4157	6106	SO:0001587	stop_gained	51059	0	0					g.chr8:139165088C>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1630G>T	chr8.hg19:g.139165088C>A	ENSP00000378710:p.Glu544*	1	HNSCC(54;0.14)					p.E544*	NM_015912.3	NP_056996.2	1	2	3	1.883033	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)	13	1800	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B5MDB3|O95879|Q2WGJ7|Q3KP46	Nonsense_Mutation	SNP	ENST00000395297.1	0	1	hg19	c.1630G>T	CCDS6375.2	0	.	.	.	.	.	.	.	.	.	.	C	40	8.288310	0.98745	.	.	ENSG00000147724	ENST00000395297	.	.	.	5.45	4.57	0.56435	5.45	4.57	0.56435	.	0.787170	0.12180	N	0.492215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-4.7828	13.4045	0.60903	0.0:0.9248:0.0:0.0752	.	.	.	.	X	544	.	ENSP00000276737:E544X	E	-	1	0	0	FAM135B	139234270	139234270	0.116000	0.22171	0.386000	0.26170	0.934000	0.57294	1.547000	0.36190	1.446000	0.47643	0.655000	0.94253	GAG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.512	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	1	0	1		2	2	2	0		0	0	57		57	57	1	3.450000	-3.221886	1	0.520000	NM_015912			22	22		239	238	0		1			0	0	57	0		9.999990e-01	0	0	0	0	0	0	22	239
COL15A1	1306	broad.mit.edu	37	9	101802811	101802811	+	Silent	SNP	C	C	T	rs146647282	byFrequency	TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr9:101802811C>T	ENST00000375001.3	+	23	2907	c.2484C>T	c.(2482-2484)gaC>gaT	p.D828D		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	828	Collagen-like 3.|Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				AGGGGCCGGACGGGTTGCCTG	0.587																																						ENST00000375001.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				107						c.(2482-2484)gaC>gaT		collagen, type XV, alpha 1		C		0,4406		0,0,2203	179.0	155.0	163.0		2484	-5.3	0.0	9	dbSNP_134	163	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous	COL15A1	NM_001855.3		0,7,6496	TT,TC,CC		0.0814,0.0,0.0538		828/1389	101802811	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	1306	57	121412	51				g.chr9:101802811C>T	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2484C>T	chr9.hg19:g.101802811C>T		1						p.D828D	NM_001855.3	NP_001846.3	0	3	3	1.817473	P39059	COFA1_HUMAN		23	2907	+		Acute lymphoblastic leukemia(62;0.0562)	Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	1	1	hg19	c.2484C>T	CCDS35081.1	1																																																																																								0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.587	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	0	0	1		2	2	2	0		0	0	70		70	70	1	3.450000	-3.075755	1	0.520000	NM_001855			169	167		144	143	1		1	0		0	0	70	0		1	1	0	0	0	100	0	169	144
ASTN2	23245	broad.mit.edu	37	9	119976795	119976795	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr9:119976795T>A	ENST00000313400.4	-	3	957	c.857A>T	c.(856-858)gAg>gTg	p.E286V	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.E286V|ASTN2_ENST00000361209.2_Missense_Mutation_p.E286V			O75129	ASTN2_HUMAN	astrotactin 2	286					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GATGGGAGTCTCCCGGATGGG	0.617																																						ENST00000313400.4	0.550000	2.100000e-01	0.460000	0.280000	0.360000	0.376610	0.360000	0.360000																										0				102						c.(856-858)gAg>gTg		astrotactin 2							83.0	78.0	80.0					9																	119976795		2203	4300	6503	SO:0001583	missense	23245	0	0					g.chr9:119976795T>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.857A>T	chr9.hg19:g.119976795T>A	ENSP00000314038:p.Glu286Val	1					ASTN2_ENST00000373996.3_Missense_Mutation_p.E286V|ASTN2_ENST00000361209.2_Missense_Mutation_p.E286V|ASTN2_ENST00000361477.3_5'UTR	p.E286V			0	3	3	1.826005	O75129	ASTN2_HUMAN		3	957	-			A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	1	1	hg19	c.857A>T		0	.	.	.	.	.	.	.	.	.	.	T	17.28	3.349878	0.61183	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.22743	2.09;2.08;2.13;1.94	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000002	T	0.31544	0.0800	N	0.24115	0.695	0.58432	D	0.999995	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.83275	0.996;0.991;0.96	T	0.05616	-1.0874	9	.	.	.	-22.8697	14.6696	0.68934	0.0:0.0:0.0:1.0	.	286;286;286	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	V	286;286;13;286	ENSP00000314038:E286V;ENSP00000363108:E286V;ENSP00000363098:E13V;ENSP00000354504:E286V	.	E	-	2	0	0	ASTN2	119016616	119016616	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.662000	0.83803	1.935000	0.56089	0.533000	0.62120	GAG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.617	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	38		38	38	1	3.450000	-19.995220	1	0.520000	NM_014010			17	16		212	205	0		1			0	0	38	0		9.999605e-01	0	0	0	0	0	0	17	212
GPR21	2844	broad.mit.edu	37	9	125797611	125797611	+	Nonsense_Mutation	SNP	C	C	T	rs370055199		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr9:125797611C>T	ENST00000373642.1	+	1	806	c.766C>T	c.(766-768)Cga>Tga	p.R256*	RABGAP1_ENST00000373647.4_Intron|RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373643.5_Intron	NM_005294.1	NP_005285.1	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	256					G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|negative regulation of insulin receptor signaling pathway (GO:0046627)|positive regulation of multicellular organism growth (GO:0040018)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	15						GGTCCTGTTTCGAATCACTAG	0.507																																						ENST00000373642.1	0.370000	1.800000e-01	0.320000	0.220000	0.260000	0.277564	0.260000	0.270000																										0				15						c.(766-768)Cga>Tga		G protein-coupled receptor 21		C	stop/ARG,	0,4406		0,0,2203	180.0	158.0	165.0		766,	5.0	1.0	9		165	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,intron	GPR21,RABGAP1	NM_005294.1,NM_012197.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	256/350,	125797611	1,13005	2203	4300	6503	SO:0001587	stop_gained	2844	1	121412	27				g.chr9:125797611C>T	BC066885	CCDS6849.1	9q33	2012-08-21			ENSG00000188394	ENSG00000188394		"""GPCR / Class A : Orphans"""	4476	protein-coding gene	gene with protein product		601909					Standard	NM_005294		Approved		uc011lzk.3	Q99679	OTTHUMG00000020631	ENST00000373642.1:c.766C>T	chr9.hg19:g.125797611C>T	ENSP00000362746:p.Arg256*	1					RABGAP1_ENST00000373647.4_Intron|RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373643.5_Intron	p.R256*	NM_005294.1	NP_005285.1	0	3	3	1.826005	Q99679	GPR21_HUMAN		1	806	+			B2R8W9|Q6NXU2	Nonsense_Mutation	SNP	ENST00000373642.1	0	1	hg19	c.766C>T	CCDS6849.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.225223|4.225223	0.79576|0.79576	0.0|0.0	1.16E-4|1.16E-4	ENSG00000188394|ENSG00000188394	ENST00000373642|ENST00000412269	.|.	.|.	.|.	5.93|5.93	5.03|5.03	0.67393|0.67393	5.93|5.93	5.03|5.03	0.67393|0.67393	.|.	0.000000|.	0.64402|.	U|.	0.000006|.	.|T	.|0.66356	.|0.2781	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61456	.|-0.7059	.|5	0.30854|0.19590	T|T	0.27|0.45	-4.8434|-4.8434	16.7619|16.7619	0.85514|0.85514	0.1297:0.8703:0.0:0.0|0.1297:0.8703:0.0:0.0	.|.	.|.	.|.	.|.	X|L	256|248	.|.	ENSP00000362746:R256X|ENSP00000389239:S248L	R|S	+|+	1|2	2|0	2|0	GPR21|GPR21	124837432|124837432	124837432|124837432	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	3.714000|3.714000	0.54889|0.54889	1.491000|1.491000	0.48482|0.48482	0.591000|0.591000	0.81541|0.81541	CGA|TCG	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.507	GPR21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053965.1	1	0	1		21	2	2	1		1	1	94		94	91	1	3.450000	-5.803027	1	0.520000	NM_005294			33	33		558	555	0		1			1	0	94	0		9.633839e-01	0	0	0	0	0	0	33	558
NTNG2	84628	broad.mit.edu	37	9	135102349	135102349	+	Missense_Mutation	SNP	G	G	A	rs557724992		TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chr9:135102349G>A	ENST00000393229.3	+	4	1747	c.971G>A	c.(970-972)cGc>cAc	p.R324H	NTNG2_ENST00000372179.3_Missense_Mutation_p.R324H|NTNG2_ENST00000393228.4_Missense_Mutation_p.R324H|NTNG2_ENST00000360670.3_Missense_Mutation_p.R324H	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	324	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		AAGAATTTCCGCACCCGGTCC	0.677																																						ENST00000393229.3	1.000000	4.000000e-01	0.860000	0.530000	0.680000	0.697501	0.680000	1.000000																										0				29						c.(970-972)cGc>cAc		netrin G2							40.0	37.0	38.0					9																	135102349		2203	4299	6502	SO:0001583	missense	84628	7	121348	37				g.chr9:135102349G>A	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.971G>A	chr9.hg19:g.135102349G>A	ENSP00000376921:p.Arg324His	1					NTNG2_ENST00000372179.3_Missense_Mutation_p.R324H|NTNG2_ENST00000393228.4_Missense_Mutation_p.R324H|NTNG2_ENST00000360670.3_Missense_Mutation_p.R324H	p.R324H	NM_032536.2	NP_115925.2	0	3	3	1.826005	Q96CW9	NTNG2_HUMAN		4	1747	+			Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	ENST00000393229.3	0	1	hg19	c.971G>A	CCDS6946.1	0	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910498	0.52439	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670;ENST00000372179	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	4.75	4.75	0.60458	4.75	4.75	0.60458	EGF-like, laminin (3);	0.249770	0.32852	N	0.005578	T	0.25975	0.0633	N	0.01473	-0.845	0.42692	D	0.99358	P	0.50066	0.931	B	0.36608	0.229	T	0.34329	-0.9833	10	0.10636	T	0.68	.	16.7144	0.85394	0.0:0.0:1.0:0.0	.	324	Q96CW9	NTNG2_HUMAN	H	324	ENSP00000376921:R324H;ENSP00000376920:R324H;ENSP00000353888:R324H;ENSP00000361252:R324H	ENSP00000353888:R324H	R	+	2	0	0	NTNG2	134092170	134092170	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.158000	0.77470	2.184000	0.69523	0.313000	0.20887	CGC	0.619048		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.677	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	1	0	1		2	2	2	0		0	0	18		18	18	1	3.450000	-19.999960	1	0.520000	NM_032536			15	14		93	87	1		1	0		0	0	18	0		9.998537e-01	0	0	0	0	1	0	15	93
KIAA1210	57481	broad.mit.edu	37	X	118284525	118284525	+	Silent	SNP	C	C	A			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chrX:118284525C>A	ENST00000402510.2	-	1	17	c.18G>T	c.(16-18)acG>acT	p.T6T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	6								p.T6T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						AGCCTCGAGGCGTCCAGCCGG	0.652																																						ENST00000402510.2	1.000000	9.400000e-01	1.000000	0.970000	0.980000	0.988033	0.980000	0.990000																										1	Substitution - coding silent(1)	p.T6T(1)	lung(1)	64						c.(16-18)acG>acT		KIAA1210							57.0	66.0	63.0					X																	118284525		2017	4144	6161	SO:0001819	synonymous_variant	57481	0	0					g.chrX:118284525C>A	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.18G>T	chrX.hg19:g.118284525C>A								p.T6T	NM_020721.1	NP_065772.1	0	1	1		Q9ULL0	K1210_HUMAN		1	17	-			B7ZCI8|Q5JPN4	Silent	SNP	ENST00000402510.2	1	1	hg19	c.18G>T	CCDS48156.1	1																																																																																								0.520000		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.652	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	1	0	1		2	2	2	0		0	0	32		32	30	1	3.450000	-20.000000	1	0.520000	NM_020721			131	129		67	66	1		1			0	0	32	0		1	0	0	0	0	0	0	131	67
PCDH11X	27328	broad.mit.edu	37	X	91132649	91132649	+	Silent	SNP	C	C	T			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chrX:91132649C>T	ENST00000373094.1	+	2	2255	c.1410C>T	c.(1408-1410)ttC>ttT	p.F470F	PCDH11X_ENST00000504220.2_Silent_p.F470F|PCDH11X_ENST00000361655.2_Silent_p.F470F|PCDH11X_ENST00000298274.8_Silent_p.F470F|PCDH11X_ENST00000395337.2_Silent_p.F470F|PCDH11X_ENST00000406881.1_Silent_p.F470F|PCDH11X_ENST00000361724.1_Silent_p.F470F|PCDH11X_ENST00000373088.1_Silent_p.F470F|PCDH11X_ENST00000373097.1_Silent_p.F470F	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CCCAGTCTTTCGTAACTGTTT	0.433																																					NSCLC(38;925 1092 2571 38200 45895)	ENST00000373094.1	1.000000	9.400000e-01	1.000000	0.970000	0.980000	0.988797	0.980000	0.990000																										0				159						c.(1408-1410)ttC>ttT		protocadherin 11 X-linked							63.0	57.0	59.0					X																	91132649		2203	4298	6501	SO:0001819	synonymous_variant	27328	3	121410	34				g.chrX:91132649C>T	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1410C>T	chrX.hg19:g.91132649C>T							PCDH11X_ENST00000298274.8_Silent_p.F470F|PCDH11X_ENST00000361724.1_Silent_p.F470F|PCDH11X_ENST00000373088.1_Silent_p.F470F|PCDH11X_ENST00000395337.2_Silent_p.F470F|PCDH11X_ENST00000504220.2_Silent_p.F470F|PCDH11X_ENST00000361655.2_Silent_p.F470F|PCDH11X_ENST00000406881.1_Silent_p.F470F|PCDH11X_ENST00000373097.1_Silent_p.F470F	p.F470F	NM_032968.3	NP_116750.1	0	1	1		Q9BZA7	PC11X_HUMAN		2	2255	+			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	1	1	hg19	c.1410C>T	CCDS14461.1	1																																																																																								0.520000		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.433	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	0	0	1		13	2	2	1		1	1	42		42	55	1	3.450000	-20.000000	1	0.520000	NM_032969			146	129		78	71	0		1			1	0	42	0		1	0	0	0	0	0	0	146	78
L1CAM	3897	broad.mit.edu	37	X	153138054	153138054	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A9TJ-01A-11D-A40W-08	TCGA-HZ-A9TJ-10A-01D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ec6e4492-5846-4ef8-bfb8-0db49299854f	24e4448a-09eb-432b-aa22-61c71daa11f6	g.chrX:153138054C>G	ENST00000370060.1	-	4	379	c.190G>C	c.(190-192)Gaa>Caa	p.E64Q	L1CAM_ENST00000370055.1_Missense_Mutation_p.E59Q|L1CAM_ENST00000361699.4_Missense_Mutation_p.E64Q|L1CAM_ENST00000361981.3_Missense_Mutation_p.E59Q|L1CAM_ENST00000543994.1_Missense_Mutation_p.E66Q|L1CAM_ENST00000538883.1_Missense_Mutation_p.E66Q|L1CAM_ENST00000370057.3_Missense_Mutation_p.E64Q	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	64	Ig-like C2-type 1.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACTGCACTTCGGGCTTGCCA	0.602																																						ENST00000370060.1	0.700000	4.600000e-01	0.650000	0.520000	0.580000	0.587045	0.580000	0.580000																										0				81						c.(190-192)Gaa>Caa		L1 cell adhesion molecule							91.0	70.0	77.0					X																	153138054		2203	4300	6503	SO:0001583	missense	3897	0	0					g.chrX:153138054C>G	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.190G>C	chrX.hg19:g.153138054C>G	ENSP00000359077:p.Glu64Gln						L1CAM_ENST00000361981.3_Missense_Mutation_p.E59Q|L1CAM_ENST00000361699.4_Missense_Mutation_p.E64Q|L1CAM_ENST00000538883.1_Missense_Mutation_p.E66Q|L1CAM_ENST00000370055.1_Missense_Mutation_p.E59Q|L1CAM_ENST00000370057.3_Missense_Mutation_p.E64Q|L1CAM_ENST00000543994.1_Missense_Mutation_p.E66Q	p.E64Q	NM_001278116.1	NP_001265045.1	0	1	1		P32004	L1CAM_HUMAN		4	379	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	1	1	hg19	c.190G>C	CCDS14733.1	0	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329577	0.24167	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699;ENST00000439496;ENST00000407935;ENST00000420165;ENST00000458029	T;T;T;T;T;T;T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65	4.69	1.83	0.25207	4.69	1.83	0.25207	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.182154	0.37095	N	0.002256	T	0.11196	0.0273	N	0.21240	0.645	0.09310	N	1	B;B;B	0.18741	0.03;0.008;0.01	B;B;B	0.30179	0.112;0.046;0.076	T	0.26849	-1.0091	10	0.35671	T	0.21	.	13.9763	0.64275	0.0:0.3682:0.6318:0.0	.	59;64;64	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	Q	64;66;64;66;59;59;64;64;59;59;64	ENSP00000359077:E64Q;ENSP00000438430:E66Q;ENSP00000359074:E64Q;ENSP00000439645:E66Q;ENSP00000354712:E59Q;ENSP00000359072:E59Q;ENSP00000355380:E64Q;ENSP00000402407:E64Q;ENSP00000384902:E59Q;ENSP00000392524:E59Q;ENSP00000396079:E64Q	ENSP00000355380:E64Q	E	-	1	0	0	L1CAM	152791248	152791248	0.001000	0.12720	0.195000	0.23364	0.913000	0.54294	-0.399000	0.07250	0.066000	0.16515	0.529000	0.55759	GAA	0.520000		TCGA-HZ-A9TJ-01A-11D-A40W-08	0.602	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	1	0	1		2	2	2	0		0	0	24		24	23	1	3.450000	-6.848788	1	0.520000	NM_024003			64	64		146	145	1		1	0	1	0	0	24	528		1	2.255235e-01	1	1	267	2	493	64	146
