#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
IGSF22	283284	broad.mit.edu	37	11	18736168	18736168	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr11:18736168C>T	ENST00000513874.1	-	12	1674	c.1535G>A	c.(1534-1536)cGt>cAt	p.R512H	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	512								p.R512H(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TGTGGCCAGACGCTCTGGGGA	0.612																																						ENST00000513874.1	0.870000	0.230000	0.690000	0.350000	0.500000	0.525011	0.500000	0.470000																										2	Substitution - Missense(2)	p.R512H(2)	endometrium(2)	56						c.(1534-1536)cGt>cAt		immunoglobulin superfamily, member 22							54.0	55.0	55.0					11																	18736168		2063	4203	6266	SO:0001583	missense	283284	4	121016	33				g.chr11:18736168C>T	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1535G>A	chr11.hg19:g.18736168C>T	ENSP00000421191:p.Arg512His	0					RP11-1081L13.4_ENST00000527285.1_RNA	p.R512H	NM_173588.3	NP_775859	0	0	0	1.962427	Q8N9C0	IGS22_HUMAN		12	1674	-			A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	1	1	hg19	c.1535G>A	CCDS41625.2	0	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209186	0.58343	.	.	ENSG00000179057	ENST00000513874	T	0.55588	0.51	4.51	1.44	0.22558	4.51	1.44	0.22558	.	0.444637	0.16671	N	0.204344	T	0.52191	0.1719	L	0.39898	1.24	0.09310	N	1	D	0.76494	0.999	P	0.57101	0.813	T	0.40701	-0.9549	10	0.51188	T	0.08	.	6.6056	0.22724	0.0:0.6562:0.0:0.3438	.	512	D6RGV7	.	H	512	ENSP00000421191:R512H	ENSP00000322422:R512H	R	-	2	0	0	IGSF22	18692744	18692744	0.359000	0.24955	0.086000	0.20670	0.924000	0.55760	0.834000	0.27518	0.003000	0.14656	0.551000	0.68910	CGT	0.119033		TCGA-IB-7645-01A-22D-2201-08	0.612	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.990000	-10.002770	1	0.140000	NM_173588		0	8	8	0	221	217	0		1			0	0	64	0	0	0.988966	0	0	0	0	0	0	8	221
DDB1	1642	broad.mit.edu	37	11	61091514	61091514	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr11:61091514C>T	ENST00000301764.7	-	7	1255	c.858G>A	c.(856-858)gaG>gaA	p.E286E	DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	286	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						GTTCCTCCTTCTCCAAAAGCA	0.517								Nucleotide excision repair (NER)																														ENST00000301764.7	0.570000	0.260000	0.490000	0.320000	0.400000	0.411131	0.400000	0.400000																										0				48						c.(856-858)gaG>gaA	Nucleotide excision repair (NER)	damage-specific DNA binding protein 1, 127kDa							208.0	195.0	199.0					11																	61091514		2203	4299	6502	SO:0001819	synonymous_variant	1642	0	0					g.chr11:61091514C>T	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.858G>A	chr11.hg19:g.61091514C>T		0					DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	p.E286E	NM_001923.4	NP_001914.3	0	0	0	1.933406	Q16531	DDB1_HUMAN		7	1255	-			A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Silent	SNP	ENST00000301764.7	1	1	hg19	c.858G>A	CCDS31576.1	0																																																																																								0.104913		TCGA-IB-7645-01A-22D-2201-08	0.517	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	0	0	0	2	2	2	2	0	0	0	0	197	197	197	195	1	1.990000	-2.936624	1	0.140000	NM_001923		0	24	24	0	800	789	0		1	1		0	0	197	0	0	1.000000	9.912909e-01	0	6	0	243	0	24	800
DDB1	1642	broad.mit.edu	37	11	61091563	61091563	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr11:61091563C>G	ENST00000301764.7	-	7	1206	c.809G>C	c.(808-810)aGa>aCa	p.R270T	DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	270	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						CAGCAGGTATCTTGAGCCATT	0.493								Nucleotide excision repair (NER)																														ENST00000301764.7	0.500000	0.200000	0.420000	0.260000	0.330000	0.347206	0.330000	0.330000																										0				48						c.(808-810)aGa>aCa	Nucleotide excision repair (NER)	damage-specific DNA binding protein 1, 127kDa							162.0	161.0	162.0					11																	61091563		2203	4299	6502	SO:0001583	missense	1642	0	0					g.chr11:61091563C>G	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.809G>C	chr11.hg19:g.61091563C>G	ENSP00000301764:p.Arg270Thr	0					DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	p.R270T	NM_001923.4	NP_001914.3	0	0	0	1.933406	Q16531	DDB1_HUMAN		7	1206	-			A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	1	1	hg19	c.809G>C	CCDS31576.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.176730	0.94846	.	.	ENSG00000167986	ENST00000301764;ENST00000535174;ENST00000541513	T;T;T	0.44083	0.93;0.93;0.93	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.70868	0.3273	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.972;0.958;0.998	T	0.71234	-0.4653	10	0.40728	T	0.16	-16.3903	19.8965	0.96963	0.0:1.0:0.0:0.0	.	270;270;270	F5GY55;B7Z2A1;Q16531	.;.;DDB1_HUMAN	T	270;53;85	ENSP00000301764:R270T;ENSP00000446044:R53T;ENSP00000442660:R85T	ENSP00000301764:R270T	R	-	2	0	0	DDB1	60848139	60848139	1.000000	0.71417	0.613000	0.29037	0.952000	0.60782	7.818000	0.86416	2.717000	0.92951	0.655000	0.94253	AGA	0.104913		TCGA-IB-7645-01A-22D-2201-08	0.493	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	0	0	0	2	2	2	2	0	0	0	0	190	190	190	186	1	1.990000	-3.021983	1	0.140000	NM_001923		0	19	19	0	761	749	0		1	1		0	0	190	0	0	0.999989	9.327430e-01	0	7	0	178	0	19	761
NTM	50863	broad.mit.edu	37	11	132180047	132180047	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr11:132180047G>A	ENST00000374786.1	+	5	1182	c.703G>A	c.(703-705)Gtg>Atg	p.V235M	NTM_ENST00000427481.2_Missense_Mutation_p.V226M|NTM_ENST00000539799.1_Missense_Mutation_p.V235M|NTM_ENST00000374784.1_Missense_Mutation_p.V235M|NTM_ENST00000425719.2_Missense_Mutation_p.V235M|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_Missense_Mutation_p.V235M	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	235	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AGGTGTCCCCGTGGGACAAAA	0.468																																						ENST00000374786.1	1.000000	0.630000	1.000000	0.730000	0.860000	0.860817	0.860000	1.000000																										0				56						c.(703-705)Gtg>Atg		neurotrimin							141.0	142.0	142.0					11																	132180047		2201	4297	6498	SO:0001583	missense	50863	2	121412	37				g.chr11:132180047G>A	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.703G>A	chr11.hg19:g.132180047G>A	ENSP00000363918:p.Val235Met	0					NTM_ENST00000539799.1_Missense_Mutation_p.V235M|NTM_ENST00000425719.2_Missense_Mutation_p.V235M|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374784.1_Missense_Mutation_p.V235M|NTM_ENST00000374791.3_Missense_Mutation_p.V235M|NTM_ENST00000427481.2_Missense_Mutation_p.V226M	p.V235M	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	0	0	0	1.952570	Q9P121	NTRI_HUMAN		5	1182	+			A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	1	1	hg19	c.703G>A	CCDS8491.1	1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443598	0.83993	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	6.07	6.07	0.98685	6.07	6.07	0.98685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.053565	0.85682	D	0.000000	T	0.79741	0.4498	M	0.76938	2.355	0.58432	D	0.999997	D;P;P;P;P;P	0.57899	0.981;0.955;0.723;0.88;0.723;0.855	P;B;B;B;B;B	0.47786	0.557;0.418;0.216;0.418;0.294;0.294	T	0.80850	-0.1198	10	0.48119	T	0.1	-13.6786	16.051	0.80763	0.0:0.1333:0.8667:0.0	.	235;226;235;235;235;235	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	M	235;235;226;235;235;235	ENSP00000363923:V235M;ENSP00000437668:V235M;ENSP00000416320:V226M;ENSP00000363918:V235M;ENSP00000396722:V235M;ENSP00000363916:V235M	ENSP00000363916:V235M	V	+	1	0	0	NTM	131685257	131685257	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	3.772000	0.55325	2.884000	0.98904	0.655000	0.94253	GTG	0.113950		TCGA-IB-7645-01A-22D-2201-08	0.468	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	1	0	1	2	2	2	2	0	0	0	0	178	178	178	177	1	1.990000	-7.924103	1	0.140000	NM_016522		0	42	42	0	631	623	0		1	0		0	0	178	0	0	1.000000	9.850037e-01	0	0	0	100	0	42	631
KCNA6	3742	broad.mit.edu	37	12	4919409	4919409	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr12:4919409G>A	ENST00000280684.3	+	1	1068	c.202G>A	c.(202-204)Gga>Aga	p.G68R	KCNA6_ENST00000433855.1_Missense_Mutation_p.G68R|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	68					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CACGCTGCTCGGAGACCCTGG	0.617										HNSCC(72;0.22)																												ENST00000280684.3	0.670000	0.200000	0.540000	0.290000	0.400000	0.421043	0.400000	0.380000																										0				49						c.(202-204)Gga>Aga		potassium voltage-gated channel, shaker-related subfamily, member 6	Dalfampridine(DB06637)						44.0	45.0	45.0					12																	4919409		2203	4300	6503	SO:0001583	missense	3742	0	0					g.chr12:4919409G>A	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.202G>A	chr12.hg19:g.4919409G>A	ENSP00000280684:p.Gly68Arg	0	HNSCC(72;0.22)				RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.G68R	p.G68R			0	1	1	1.991314	P17658	KCNA6_HUMAN		1	1068	+				Missense_Mutation	SNP	ENST00000280684.3	1	1	hg19	c.202G>A	CCDS8534.1	0	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075087	0.76415	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	T;T	0.78364	-1.17;-1.17	4.57	3.68	0.42216	4.57	3.68	0.42216	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.056516	0.64402	D	0.000001	D	0.92750	0.7695	H	0.99368	4.535	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94196	0.7445	10	0.87932	D	0	.	11.8345	0.52316	0.085:0.0:0.915:0.0	.	68	P17658	KCNA6_HUMAN	R	68	ENSP00000408321:G68R;ENSP00000280684:G68R	ENSP00000280684:G68R	G	+	1	0	0	KCNA6	4789670	4789670	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	9.484000	0.97940	1.146000	0.42352	0.462000	0.41574	GGA	0.133938		TCGA-IB-7645-01A-22D-2201-08	0.617	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	80	1	1.990000	-3.206027	1	0.140000	NM_002235		0	10	10	0	352	344	0		1	0		0	0	84	0	0	0.996617	2.910003e-03	0	0	0	3	0	10	352
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.840000	1.000000	0.990000	0.990000	0.990287	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	0	0	1.977355	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.125305		TCGA-IB-7645-01A-22D-2201-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.990000	-8.307574	1	0.140000	NM_033360		324	14	13	7698	116	115	1	1	1	1	1	0	0	18	400	1	0.999789	9.463491e-01	1	19	28	25	581	14	116
KRT75	9119	broad.mit.edu	37	12	52827640	52827640	+	Missense_Mutation	SNP	C	C	T	rs201256120		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr12:52827640C>T	ENST00000252245.5	-	1	669	c.449G>A	c.(448-450)cGc>cAc	p.R150H		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	150	Coil 1A.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		GATCTGCTCGCGCTCCTCGGC	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		17797	0.001		0.0	False		,,,				2504	0.0					ENST00000252245.5	0.800000	0.400000	0.700000	0.480000	0.580000	0.597213	0.580000	0.580000																										0				28						c.(448-450)cGc>cAc		keratin 75							147.0	148.0	148.0					12																	52827640		2203	4300	6503	SO:0001583	missense	9119	3	121412	38				g.chr12:52827640C>T	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.449G>A	chr12.hg19:g.52827640C>T	ENSP00000252245:p.Arg150His	0						p.R150H	NM_004693.2	NP_004684.2	0	0	0	1.977355	O95678	K2C75_HUMAN		1	669	-			B4DQU4|Q9NSA9	Missense_Mutation	SNP	ENST00000252245.5	1	1	hg19	c.449G>A	CCDS8827.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	21.4	4.145521	0.77888	.	.	ENSG00000170454	ENST00000252245	D	0.90133	-2.62	5.74	4.72	0.59763	5.74	4.72	0.59763	Filament (1);	0.164522	0.29692	N	0.011442	D	0.94785	0.8316	H	0.94808	3.585	0.30984	N	0.722149	P	0.50943	0.94	P	0.52793	0.709	D	0.94024	0.7295	10	0.87932	D	0	.	9.8904	0.41288	0.0:0.7972:0.0:0.2028	.	150	O95678	K2C75_HUMAN	H	150	ENSP00000252245:R150H	ENSP00000252245:R150H	R	-	2	0	0	KRT75	51113907	51113907	0.984000	0.35163	0.608000	0.28969	0.884000	0.51177	2.211000	0.42825	1.168000	0.42723	0.655000	0.94253	CGC	0.125305		TCGA-IB-7645-01A-22D-2201-08	0.562	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	0	0	1	2	2	2	2	0	0	0	0	145	145	145	145	1	1.990000	-4.099637	1	0.140000	NM_004693		0	30	30	0	690	681	0		1			0	0	145	0	0	1.000000	0	0	0	0	0	0	30	690
KRT77	374454	broad.mit.edu	37	12	53097128	53097128	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr12:53097128T>C	ENST00000341809.3	-	1	119	c.91A>G	c.(91-93)Agt>Ggt	p.S31G	KRT77_ENST00000537195.1_5'UTR	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	31	Head.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						ACTGCCGGACTCCCACCACCA	0.532																																						ENST00000341809.3	0.690000	0.180000	0.550000	0.270000	0.390000	0.416926	0.390000	0.370000																										0				25						c.(91-93)Agt>Ggt		keratin 77							82.0	88.0	86.0					12																	53097128		2203	4300	6503	SO:0001583	missense	374454	0	0					g.chr12:53097128T>C	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.91A>G	chr12.hg19:g.53097128T>C	ENSP00000342710:p.Ser31Gly	0					KRT77_ENST00000537195.1_5'UTR	p.S31G	NM_175078.2	NP_778253.2	0	0	0	1.977355	Q7Z794	K2C1B_HUMAN		1	119	-			Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	1	1	hg19	c.91A>G	CCDS8837.1	0	.	.	.	.	.	.	.	.	.	.	T	9.588	1.125287	0.20959	.	.	ENSG00000189182	ENST00000341809	D	0.85629	-2.01	4.63	2.25	0.28309	4.63	2.25	0.28309	.	.	.	.	.	T	0.77725	0.4173	L	0.46741	1.465	0.34255	D	0.679289	B	0.06786	0.001	B	0.06405	0.002	T	0.72367	-0.4315	9	0.35671	T	0.21	.	7.0093	0.24853	0.0:0.2621:0.0:0.7379	.	31	Q7Z794	K2C1B_HUMAN	G	31	ENSP00000342710:S31G	ENSP00000342710:S31G	S	-	1	0	0	KRT77	51383395	51383395	0.000000	0.05858	0.349000	0.25694	0.480000	0.33159	0.067000	0.14510	0.377000	0.24735	0.482000	0.46254	AGT	0.125305		TCGA-IB-7645-01A-22D-2201-08	0.532	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.990000	-9.304051	1	0.140000	NM_175078		0	8	9	0	286	280	0		1			0	0	70	0	0	0.988875	0	0	0	0	0	0	8	286
DYRK2	8445	broad.mit.edu	37	12	68051338	68051338	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr12:68051338C>T	ENST00000344096.3	+	3	1064	c.651C>T	c.(649-651)caC>caT	p.H217H	DYRK2_ENST00000393555.3_Silent_p.H144H|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	217					cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		CCCACGATCACGTGGCTTACA	0.552																																						ENST00000344096.3	1.000000	0.540000	1.000000	0.700000	0.900000	0.869756	0.900000	1.000000																										0				30						c.(649-651)caC>caT		dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2							72.0	57.0	62.0					12																	68051338		2203	4300	6503	SO:0001819	synonymous_variant	8445	0	0					g.chr12:68051338C>T	Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.651C>T	chr12.hg19:g.68051338C>T		0					RP11-335O4.3_ENST00000425371.2_RNA|DYRK2_ENST00000393555.3_Silent_p.H144H	p.H217H	NM_006482.2	NP_006473.2	0	0	0	1.977355	Q92630	DYRK2_HUMAN	Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	3	1064	+			B2R9V9|Q9BRB5	Silent	SNP	ENST00000344096.3	1	1	hg19	c.651C>T	CCDS8978.1	1																																																																																								0.125305		TCGA-IB-7645-01A-22D-2201-08	0.552	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402218.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	1.990000	-19.540960	1	0.140000			0	16	16	0	233	229	0		1	1		0	0	47	0	0	0.999934	9.863065e-01	0	7	0	98	0	16	233
LRRC43	254050	broad.mit.edu	37	12	122687867	122687867	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr12:122687867C>T	ENST00000339777.4	+	12	1877	c.1849C>T	c.(1849-1851)Ccg>Tcg	p.P617S	B3GNT4_ENST00000535274.1_5'Flank|B3GNT4_ENST00000546192.1_5'Flank|LRRC43_ENST00000425921.1_Missense_Mutation_p.P432S|B3GNT4_ENST00000324189.4_5'Flank	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	617										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		CTCAGAAAAGCCGAAAGCCGT	0.607																																						ENST00000339777.4	1.000000	0.500000	0.940000	0.620000	0.770000	0.778938	0.770000	1.000000																										0				19						c.(1849-1851)Ccg>Tcg		leucine rich repeat containing 43							88.0	95.0	93.0					12																	122687867		1915	4136	6051	SO:0001583	missense	254050	0	0					g.chr12:122687867C>T	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1849C>T	chr12.hg19:g.122687867C>T	ENSP00000344233:p.Pro617Ser	0					B3GNT4_ENST00000324189.4_5'Flank|B3GNT4_ENST00000546192.1_5'Flank|LRRC43_ENST00000425921.1_Missense_Mutation_p.P432S|B3GNT4_ENST00000535274.1_5'Flank	p.P617S	NM_152759.4	NP_689972.3	0	0	0	1.977355	Q8N309	LRC43_HUMAN		12	1877	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	1	1	hg19	c.1849C>T	CCDS45001.1	0	.	.	.	.	.	.	.	.	.	.	C	8.029	0.761252	0.15914	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.52526	0.66;1.08	4.59	-9.19	0.00685	4.59	-9.19	0.00685	.	3.517060	0.00721	N	0.000881	T	0.16938	0.0407	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34502	-0.9826	10	0.02654	T	1	0.2056	1.2819	0.02043	0.1967:0.3745:0.1692:0.2597	.	617	Q8N309	LRC43_HUMAN	S	617;488;432	ENSP00000344233:P617S;ENSP00000416628:P432S	ENSP00000289014:P488S	P	+	1	0	0	LRRC43	121253820	121253820	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.381000	0.02549	-2.550000	0.00480	-0.311000	0.09066	CCG	0.125305		TCGA-IB-7645-01A-22D-2201-08	0.607	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	1	0	1	2	2	2	2	0	0	0	0	111	111	111	110	1	1.990000	-5.699074	1	0.140000	NM_152759		0	22	22	0	379	375	0		1			0	0	111	0	0	0.999999	0	0	0	0	0	0	22	379
UGGT2	55757	broad.mit.edu	37	13	96592266	96592266	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr13:96592266T>C	ENST00000376747.3	-	16	1827	c.1757A>G	c.(1756-1758)cAt>cGt	p.H586R		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	586					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						AATATTAGCATGAGGAAATGT	0.333																																						ENST00000376747.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				60						c.(1756-1758)cAt>cGt		UDP-glucose glycoprotein glucosyltransferase 2							116.0	113.0	114.0					13																	96592266		2202	4300	6502	SO:0001583	missense	55757	0	0					g.chr13:96592266T>C	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.1757A>G	chr13.hg19:g.96592266T>C	ENSP00000365938:p.His586Arg	1						p.H586R	NM_020121.3	NP_064506.3	2	2	4	2.150644	Q9NYU1	UGGG2_HUMAN		16	1827	-			A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	1	1	hg19	c.1757A>G	CCDS9480.1	1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011877	0.35511	.	.	ENSG00000102595	ENST00000376747	T	0.29917	1.55	5.64	4.45	0.53987	5.64	4.45	0.53987	.	0.380232	0.32671	N	0.005790	T	0.26448	0.0646	L	0.48362	1.52	0.80722	D	1	B	0.14012	0.009	B	0.17098	0.017	T	0.04333	-1.0959	10	0.21014	T	0.42	-3.9518	11.5681	0.50818	0.0:0.0702:0.0:0.9298	.	586	Q9NYU1	UGGG2_HUMAN	R	586	ENSP00000365938:H586R	ENSP00000365938:H586R	H	-	2	0	0	UGGT2	95390267	95390267	1.000000	0.71417	0.970000	0.41538	0.974000	0.67602	3.189000	0.50965	0.960000	0.38005	0.459000	0.35465	CAT	0.203556		TCGA-IB-7645-01A-22D-2201-08	0.333	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.990000	-20.000000	1	0.140000	NM_020121		0	93	93	0	578	573	1		1	1		0	0	79	0	0	1.000000	9.135322e-01	0	8	0	20	0	93	578
MYO16	23026	broad.mit.edu	37	13	109704657	109704657	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr13:109704657A>G	ENST00000357550.2	+	24	2857	c.2816A>G	c.(2815-2817)aAt>aGt	p.N939S	MYO16_ENST00000356711.2_Missense_Mutation_p.N939S|MYO16_ENST00000457511.2_Missense_Mutation_p.N451S	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GCTAGTGAAAATGTCGTGATC	0.373																																						ENST00000357550.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				121						c.(2815-2817)aAt>aGt		myosin XVI							107.0	92.0	97.0					13																	109704657		2203	4300	6503	SO:0001583	missense	23026	0	0					g.chr13:109704657A>G		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2816A>G	chr13.hg19:g.109704657A>G	ENSP00000350160:p.Asn939Ser	1					MYO16_ENST00000356711.2_Missense_Mutation_p.N939S|MYO16_ENST00000457511.2_Missense_Mutation_p.N451S	p.N939S	NM_001198950.1	NP_001185879.1	2	2	4	2.150644			BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)	24	2857	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)			Missense_Mutation	SNP	ENST00000357550.2	1	1	hg19	c.2816A>G	CCDS32008.1	1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904230	0.52333	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000375857;ENST00000457511	D;D;D	0.86627	-2.15;-2.15;-2.15	5.96	5.96	0.96718	5.96	5.96	0.96718	Myosin head, motor domain (2);	0.000000	0.43260	U	0.000582	D	0.84005	0.5377	L	0.50993	1.605	0.51767	D	0.99993	P;B;P	0.40282	0.453;0.291;0.711	B;B;B	0.38056	0.172;0.1;0.264	T	0.83210	-0.0074	9	.	.	.	.	15.6089	0.76699	1.0:0.0:0.0:0.0	.	451;939;939	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	S	939;939;727;451	ENSP00000349145:N939S;ENSP00000350160:N939S;ENSP00000401633:N451S	.	N	+	2	0	0	MYO16	108502658	108502658	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.917000	0.69989	2.279000	0.76181	0.533000	0.62120	AAT	0.203556		TCGA-IB-7645-01A-22D-2201-08	0.373	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.990000	-20.000000	1	0.140000	NM_015011		0	53	52	0	395	390	1		1			0	0	69	0	0	1.000000	0	0	0	0	0	0	53	395
OR4Q3	441669	broad.mit.edu	37	14	20216249	20216249	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr14:20216249C>T	ENST00000331723.1	+	1	663	c.663C>T	c.(661-663)atC>atT	p.I221I		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTATGCTATCATCCTGATCA	0.507																																						ENST00000331723.1	1.000000	0.340000	1.000000	0.440000	0.580000	0.643825	0.580000	0.540000																										0				47						c.(661-663)atC>atT		olfactory receptor, family 4, subfamily Q, member 3							192.0	156.0	168.0					14																	20216249		2203	4300	6503	SO:0001819	synonymous_variant	441669	0	0					g.chr14:20216249C>T	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.663C>T	chr14.hg19:g.20216249C>T		0						p.I221I	NM_172194.1	NP_751944.1	1	2	3	2.057628	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	1	663	+	all_cancers(95;0.00108)		Q6IEX4	Silent	SNP	ENST00000331723.1	1	1	hg19	c.663C>T	CCDS32020.1	0																																																																																								0.155372		TCGA-IB-7645-01A-22D-2201-08	0.507	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2	1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.990000	-3.856611	1	0.140000			0	18	18	0	465	463	0		1			0	0	80	0	0	0.999982	0	0	0	0	0	0	18	465
C16orf89	146556	broad.mit.edu	37	16	5112524	5112524	+	Missense_Mutation	SNP	G	G	A	rs561235172		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr16:5112524G>A	ENST00000315997.5	-	2	461	c.260C>T	c.(259-261)cCg>cTg	p.P87L	C16orf89_ENST00000474471.3_Missense_Mutation_p.P87L|C16orf89_ENST00000350219.4_Missense_Mutation_p.P125L|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Missense_Mutation_p.P125L|C16orf89_ENST00000472572.3_Missense_Mutation_p.P87L	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	87						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)	p.P125L(2)|p.P87L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						CAGGCTCAGCGGCTGCAGCAG	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		16852	0.001		0.0	False		,,,				2504	0.0					ENST00000315997.5	1.000000	0.480000	1.000000	0.600000	0.760000	0.781301	0.760000	1.000000																										3	Substitution - Missense(3)	p.P125L(2)|p.P87L(1)	lung(3)	12						c.(259-261)cCg>cTg		chromosome 16 open reading frame 89							53.0	57.0	55.0					16																	5112524		1920	4138	6058	SO:0001583	missense	146556	3	120850	38				g.chr16:5112524G>A		CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.260C>T	chr16.hg19:g.5112524G>A	ENSP00000324672:p.Pro87Leu	0					C16orf89_ENST00000422873.1_Missense_Mutation_p.P125L|C16orf89_ENST00000472572.3_Missense_Mutation_p.P87L|C16orf89_ENST00000350219.4_Missense_Mutation_p.P125L|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000474471.3_Missense_Mutation_p.P87L	p.P87L	NM_152459.4	NP_689672.4	1	2	3	2.043292	Q6UX73	CP089_HUMAN		2	461	-			B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	ENST00000315997.5	1	1	hg19	c.260C>T	CCDS42116.2	0	.	.	.	.	.	.	.	.	.	.	G	6.069	0.381079	0.11466	.	.	ENSG00000153446	ENST00000474471;ENST00000472572;ENST00000477550;ENST00000422873;ENST00000350219;ENST00000315997	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	4.98	0.777	0.18538	4.98	0.777	0.18538	.	0.331114	0.28268	N	0.015977	T	0.22936	0.0554	L	0.56769	1.78	0.23879	N	0.996585	B;B	0.30211	0.179;0.273	B;B	0.25140	0.026;0.058	T	0.14615	-1.0466	10	0.49607	T	0.09	-14.0929	4.1243	0.10119	0.266:0.0:0.5735:0.1606	.	87;125	Q6UX73;G3V0F0	CP089_HUMAN;.	L	87;87;87;125;125;87	ENSP00000417158:P87L;ENSP00000420566:P87L;ENSP00000390402:P125L;ENSP00000283478:P125L;ENSP00000324672:P87L	ENSP00000324672:P87L	P	-	2	0	0	C16orf89	5052525	5052525	0.000000	0.05858	0.119000	0.21687	0.049000	0.14656	-0.083000	0.11286	-0.062000	0.13088	-1.263000	0.01449	CCG	0.152459		TCGA-IB-7645-01A-22D-2201-08	0.562	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1	1	0	1	2	2	2	2	0	0	0	0	106	106	106	105	1	1.990000	-3.021364	1	0.140000	NM_152459		0	22	18	0	418	412	0		1	0		0	0	106	0	0	0.999999	7.611367e-01	0	0	0	54	0	22	418
ADAD2	161931	broad.mit.edu	37	16	84228111	84228111	+	Missense_Mutation	SNP	C	C	T	rs577228328		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr16:84228111C>T	ENST00000315906.5	+	2	534	c.482C>T	c.(481-483)gCg>gTg	p.A161V	ADAD2_ENST00000268624.3_Missense_Mutation_p.A233V|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	161	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						GCGGGCACTGCGAATAGCAAG	0.652																																						ENST00000315906.5	1.000000	0.550000	1.000000	0.850000	0.990000	0.943035	0.990000	1.000000																										0				13						c.(481-483)gCg>gTg		adenosine deaminase domain containing 2							37.0	36.0	37.0					16																	84228111		2200	4300	6500	SO:0001583	missense	161931	1	121348	26				g.chr16:84228111C>T	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.482C>T	chr16.hg19:g.84228111C>T	ENSP00000325153:p.Ala161Val	1					RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.A233V|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	p.A161V	NM_001145400.1	NP_001138872.1	2	2	4	2.105371	Q8NCV1	ADAD2_HUMAN		2	534	+			B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	0	1	hg19	c.482C>T	CCDS45536.1	1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922921	0.33908	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.77098	-1.07;-1.07	4.15	0.639	0.17747	4.15	0.639	0.17747	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.434885	0.19591	N	0.110615	T	0.72558	0.3475	L	0.29908	0.895	0.09310	N	1	D;P	0.61697	0.99;0.951	P;B	0.51945	0.685;0.32	T	0.66160	-0.5993	10	0.56958	D	0.05	-10.474	11.4451	0.50118	0.0:0.4186:0.5814:0.0	.	161;233	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	V	161;233	ENSP00000325153:A161V;ENSP00000268624:A233V	ENSP00000268624:A233V	A	+	2	0	0	ADAD2	82785612	82785612	0.040000	0.19996	0.001000	0.08648	0.003000	0.03518	0.694000	0.25512	0.449000	0.26747	0.511000	0.50034	GCG	0.185606		TCGA-IB-7645-01A-22D-2201-08	0.652	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.990000	-5.394511	1	0.140000	NM_139174		0	7	7	0	88	88	1		1	0		0	0	20	0	0	0.981954	0	0	0	0	1	0	7	88
KRT40	125115	broad.mit.edu	37	17	39137358	39137358	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr17:39137358C>A	ENST00000398486.2	-	6	893	c.733G>T	c.(733-735)Gag>Tag	p.E245*	KRT40_ENST00000377755.4_Nonsense_Mutation_p.E245*	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	245	Linker 12.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				GTGTCCAGCTCCACACTGAGG	0.522																																						ENST00000398486.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999990	0.990000	1.000000																										0				9						c.(733-735)Gag>Tag		keratin 40							113.0	122.0	119.0					17																	39137358		2065	4208	6273	SO:0001587	stop_gained	125115	0	0					g.chr17:39137358C>A	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.733G>T	chr17.hg19:g.39137358C>A	ENSP00000381500:p.Glu245*	0					KRT40_ENST00000377755.4_Nonsense_Mutation_p.E245*	p.E245*	NM_182497.3	NP_872303.2	1	2	3	2.067548	Q6A162	K1C40_HUMAN		6	893	-		Breast(137;0.00043)	Q6IFU5	Nonsense_Mutation	SNP	ENST00000398486.2	0	1	hg19	c.733G>T	CCDS42320.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.889692	0.97068	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	.	.	.	5.4	5.4	0.78164	5.4	5.4	0.78164	.	0.000000	0.34156	N	0.004215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	14.1854	0.65603	0.0:0.8505:0.1495:0.0	.	.	.	.	X	245	.	ENSP00000366984:E245X	E	-	1	0	0	KRT40	36390884	36390884	0.999000	0.42202	1.000000	0.80357	0.908000	0.53690	3.920000	0.56446	2.688000	0.91661	0.655000	0.94253	GAG	0.157689		TCGA-IB-7645-01A-22D-2201-08	0.522	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	1	0	1	2	2	2	2	0	0	0	0	161	161	161	159	1	1.990000	-19.966000	1	0.140000	NM_182497		0	69	69	0	596	588	1		1			0	0	161	0	0	1.000000	0	0	0	0	0	0	69	596
GHDC	84514	broad.mit.edu	37	17	40341794	40341794	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr17:40341794A>G	ENST00000301671.8	-	9	1961	c.1520T>C	c.(1519-1521)tTc>tCc	p.F507S	GHDC_ENST00000428494.2_Missense_Mutation_p.F468S|GHDC_ENST00000593209.1_Intron|GHDC_ENST00000414034.3_3'UTR|GHDC_ENST00000587427.1_Missense_Mutation_p.F507S			Q8N2G8	GHDC_HUMAN	GH3 domain containing	507						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CGCAGGGGGGAAGGGGGAGGA	0.716																																						ENST00000301671.8	1.000000	0.270000	1.000000	0.540000	0.990000	0.828199	0.990000	1.000000																										0				13						c.(1519-1521)tTc>tCc		GH3 domain containing							9.0	10.0	10.0					17																	40341794		2176	4279	6455	SO:0001583	missense	84514	0	0					g.chr17:40341794A>G	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.1520T>C	chr17.hg19:g.40341794A>G	ENSP00000301671:p.Phe507Ser	0					GHDC_ENST00000587427.1_Missense_Mutation_p.F507S|GHDC_ENST00000593209.1_Intron|GHDC_ENST00000414034.3_3'UTR|GHDC_ENST00000428494.2_Missense_Mutation_p.F468S	p.F507S			1	2	3	2.067548	Q8N2G8	GHDC_HUMAN		9	1961	-		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	ENST00000301671.8	0	1	hg19	c.1520T>C	CCDS11422.1	1	.	.	.	.	.	.	.	.	.	.	A	0.719	-0.784245	0.02907	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000301671	.	.	.	4.76	-1.19	0.09585	4.76	-1.19	0.09585	.	0.485347	0.21148	N	0.079375	T	0.18800	0.0451	L	0.36672	1.1	0.24617	N	0.993693	B;B	0.18610	0.029;0.026	B;B	0.19391	0.023;0.025	T	0.13124	-1.0521	9	0.21540	T	0.41	-0.9573	0.3415	0.00334	0.3859:0.2118:0.159:0.2434	.	468;507	E9PDB5;Q8N2G8	.;GHDC_HUMAN	S	451;468;507	.	ENSP00000301671:F507S	F	-	2	0	0	GHDC	37595320	37595320	0.344000	0.24827	0.053000	0.19242	0.068000	0.16541	0.663000	0.25053	-0.432000	0.07297	0.454000	0.30748	TTC	0.157689		TCGA-IB-7645-01A-22D-2201-08	0.716	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	1	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.990000	-7.298126	1	0.140000	NM_032484		0	3	3	0	52	49	0		1	0		0	0	8	0	0	0.794392	2.595335e-01	0	0	0	14	0	3	52
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.620000	0.970000	0.750000	0.880000	0.868627	0.880000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	24185	GRCh37	CM941329	TP53	M		c.(586-588)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	7157	1	121412	40	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578263G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	chr17.hg19:g.7578263G>A	ENSP00000269305:p.Arg196*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*	p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.888955	P04637	P53_HUMAN		6	775	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.586C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	2	TP53	7518988	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	0.075269		TCGA-IB-7645-01A-22D-2201-08	0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.990000	-2.806911	1	0.140000	NM_000546		0	21	21	0	235	232	0		1	0	1	0	0	49	1283	0	0.999998	9.385822e-01	1	1	111	54	1448	21	235
ITGB4	3691	broad.mit.edu	37	17	73728266	73728266	+	Missense_Mutation	SNP	G	G	T	rs561481314		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr17:73728266G>T	ENST00000200181.3	+	12	1587	c.1400G>T	c.(1399-1401)cGc>cTc	p.R467L	ITGB4_ENST00000449880.2_Missense_Mutation_p.R467L|ITGB4_ENST00000450894.3_Missense_Mutation_p.R467L|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000339591.3_Missense_Mutation_p.R467L|ITGB4_ENST00000579662.1_Missense_Mutation_p.R467L	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	467	Cysteine-rich tandem repeats.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGTCAGCTCGCTGCAGCTTC	0.637																																						ENST00000200181.3	1.000000	0.210000	1.000000	0.300000	0.420000	0.525808	0.420000	0.370000																										0				43						c.(1399-1401)cGc>cTc		integrin, beta 4							129.0	107.0	115.0					17																	73728266		2203	4300	6503	SO:0001583	missense	3691	0	0					g.chr17:73728266G>T		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1400G>T	chr17.hg19:g.73728266G>T	ENSP00000200181:p.Arg467Leu	0					ITGB4_ENST00000579662.1_Missense_Mutation_p.R467L|ITGB4_ENST00000339591.3_Missense_Mutation_p.R467L|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000450894.3_Missense_Mutation_p.R467L|ITGB4_ENST00000449880.2_Missense_Mutation_p.R467L	p.R467L	NM_000213.3	NP_000204.3	1	2	3	2.067548	P16144	ITB4_HUMAN	all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)	12	1587	+	all_cancers(13;1.5e-07)		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	1	1	hg19	c.1400G>T	CCDS11727.1	0	.	.	.	.	.	.	.	.	.	.	G	9.585	1.124722	0.20959	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.74737	-0.87;-0.81;-0.81	5.16	-6.43	0.01926	5.16	-6.43	0.01926	.	0.616465	0.14523	N	0.314320	T	0.43122	0.1233	N	0.11927	0.2	0.20196	N	0.999928	B;B;B;B;P	0.42735	0.015;0.109;0.432;0.306;0.788	B;B;B;B;B	0.37692	0.007;0.047;0.256;0.131;0.198	T	0.47018	-0.9149	10	0.49607	T	0.09	.	1.7767	0.03023	0.3493:0.0822:0.3089:0.2596	.	427;467;467;467;467	B4E3N0;P16144-5;P16144-3;A0AVL6;P16144	.;.;.;.;ITB4_HUMAN	L	383;467;467;467	ENSP00000200181:R467L;ENSP00000344079:R467L;ENSP00000400217:R467L	ENSP00000200181:R467L	R	+	2	0	0	ITGB4	71239861	71239861	0.000000	0.05858	0.132000	0.22025	0.612000	0.37316	-0.551000	0.06027	-1.057000	0.03201	-0.136000	0.14681	CGC	0.157689		TCGA-IB-7645-01A-22D-2201-08	0.637	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	1.990000	-3.222717	1	0.140000			0	11	12	0	413	405	1		1	1		0	0	84	0	0	0.998222	9.978833e-01	0	78	0	326	0	11	413
ADCYAP1	116	broad.mit.edu	37	18	909532	909532	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr18:909532C>T	ENST00000579794.1	+	4	705	c.427C>T	c.(427-429)Cgc>Tgc	p.R143C	ADCYAP1_ENST00000450565.3_Missense_Mutation_p.R143C|RP11-672L10.2_ENST00000581719.2_RNA|RP11-672L10.3_ENST00000582554.1_RNA	NM_001117.3	NP_001108.2	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary)	143					activation of adenylate cyclase activity (GO:0007190)|ATP metabolic process (GO:0046034)|behavioral fear response (GO:0001662)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|cellular response to glucocorticoid stimulus (GO:0071385)|female pregnancy (GO:0007565)|histamine secretion (GO:0001821)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of acute inflammatory response to non-antigenic stimulus (GO:0002878)|negative regulation of cell cycle (GO:0045786)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of Rho GTPase activity (GO:0034259)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|pituitary gland development (GO:0021983)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of somatostatin secretion (GO:0090274)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)|regulation of postsynaptic membrane potential (GO:0060078)|regulation of protein localization (GO:0032880)|response to ethanol (GO:0045471)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|terminal bouton (GO:0043195)	neuropeptide hormone activity (GO:0005184)|peptide hormone receptor binding (GO:0051428)|pituitary adenylate cyclase activating polypeptide activity (GO:0016521)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						CAGCTACAGCCGCTACCGGAA	0.577																																						ENST00000579794.1	0.690000	0.330000	0.600000	0.400000	0.490000	0.507415	0.490000	0.490000																										0				12						c.(427-429)Cgc>Tgc		adenylate cyclase activating polypeptide 1 (pituitary)							83.0	100.0	94.0					18																	909532		2203	4300	6503	SO:0001583	missense	116	0	0					g.chr18:909532C>T	S83513	CCDS11825.1	18p11	2013-02-28			ENSG00000141433	ENSG00000141433		"""Endogenous ligands"""	241	protein-coding gene	gene with protein product	"""prepro-PACAP"""	102980				1730060	Standard	NM_001099733		Approved	PACAP	uc010dkh.4	P18509	OTTHUMG00000131479	ENST00000579794.1:c.427C>T	chr18.hg19:g.909532C>T	ENSP00000462647:p.Arg143Cys	0					ADCYAP1_ENST00000450565.3_Missense_Mutation_p.R143C|RP11-672L10.2_ENST00000581719.2_RNA|RP11-672L10.3_ENST00000582554.1_RNA	p.R143C	NM_001117.3	NP_001108.2	0	1	1	1.999386	P18509	PACA_HUMAN		4	705	+			B2R7N4|Q52LQ0	Missense_Mutation	SNP	ENST00000579794.1	1	1	hg19	c.427C>T	CCDS11825.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.334375	0.95758	.	.	ENSG00000141433	ENST00000450565;ENST00000400219;ENST00000269200	.	.	.	5.17	5.17	0.71159	5.17	5.17	0.71159	Glucagon/GIP/secretin/VIP (4);	0.000000	0.85682	D	0.000000	D	0.85647	0.5745	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88814	0.3294	9	0.87932	D	0	.	18.6597	0.91468	0.0:1.0:0.0:0.0	.	143	P18509	PACA_HUMAN	C	282;143;143	.	ENSP00000269200:R143C	R	+	1	0	0	ADCYAP1	899532	899532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.011000	0.70760	2.391000	0.81399	0.650000	0.86243	CGC	0.135765		TCGA-IB-7645-01A-22D-2201-08	0.577	ADCYAP1-003	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440765.3	0	0	1	2	2	2	2	0	0	0	0	184	184	184	181	1	1.990000	-2.764386	1	0.140000	NM_001117		0	26	27	0	722	710	0		1	0		0	0	184	0	0	1.000000	5.863339e-02	0	0	0	11	0	26	722
DNMT1	1786	broad.mit.edu	37	19	10283847	10283847	+	Silent	SNP	A	A	C	rs61758429		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr19:10283847A>C	ENST00000340748.4	-	8	874	c.639T>G	c.(637-639)gtT>gtG	p.V213V	DNMT1_ENST00000359526.4_Silent_p.V229V|DNMT1_ENST00000540357.1_Silent_p.V213V			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	213	Interaction with DNMT3B.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GCGGTCTAGCAACTCTGTCAA	0.448																																						ENST00000340748.4	0.590000	0.110000	0.440000	0.190000	0.290000	0.321178	0.290000	0.280000																										0				70						c.(637-639)gtT>gtG		DNA (cytosine-5-)-methyltransferase 1	Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)						110.0	95.0	100.0					19																	10283847		2203	4300	6503	SO:0001819	synonymous_variant	1786	4	121412	38				g.chr19:10283847A>C	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.639T>G	chr19.hg19:g.10283847A>C		0					DNMT1_ENST00000359526.4_Silent_p.V229V|DNMT1_ENST00000540357.1_Silent_p.V213V	p.V213V			0	0	0	1.946505	P26358	DNMT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)	8	874	-			A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	0	1	hg19	c.639T>G	CCDS12228.1	0																																																																																								0.111387		TCGA-IB-7645-01A-22D-2201-08	0.448	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	0	0	0	2	2	2	2	0	0	0	0	70	70	70	70	1	1.990000	-6.874494	1	0.140000	NM_001379		0	5	5	0	243	241	0		1	0		0	0	70	0	0	0.936836	4.151969e-01	0	0	0	61	0	5	243
MYO9B	4650	broad.mit.edu	37	19	17322900	17322900	+	Silent	SNP	G	G	A	rs534850014		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr19:17322900G>A	ENST00000594824.1	+	40	6402	c.6255G>A	c.(6253-6255)ccG>ccA	p.P2085P	MYO9B_ENST00000397274.2_3'UTR|MYO9B_ENST00000595618.1_3'UTR			Q13459	MYO9B_HUMAN	myosin IXB	2085	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GCTGGGCACCGGGTGCCCGGG	0.716													G|||	1	0.000199681	0.0	0.0	5008	,	,		8731	0.0		0.0	False		,,,				2504	0.001					ENST00000594824.1	1.000000	0.250000	1.000000	0.480000	0.810000	0.769595	0.810000	1.000000																										0				39						c.(6253-6255)ccG>ccA		myosin IXB							5.0	6.0	6.0					19																	17322900		1701	3904	5605	SO:0001819	synonymous_variant	4650	14	116348	36				g.chr19:17322900G>A		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.6255G>A	chr19.hg19:g.17322900G>A		0					MYO9B_ENST00000397274.2_3'UTR|MYO9B_ENST00000595618.1_3'UTR	p.P2085P			0	0	0	1.946505	Q13459	MYO9B_HUMAN		40	6402	+			O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	0	1	hg19	c.6255G>A		0																																																																																								0.111387		TCGA-IB-7645-01A-22D-2201-08	0.716	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1	0	0	1	2	2	2	2	0	0	0	0	15	15	15	14	1	1.990000	-7.396224	1	0.140000			0	3	3	0	46	44	0		1	0		0	0	15	0	0	0.799167	0	0	0	0	1	0	3	46
GATAD2A	54815	broad.mit.edu	37	19	19609403	19609403	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr19:19609403C>A	ENST00000360315.3	+	8	1388	c.1076C>A	c.(1075-1077)aCg>aAg	p.T359K	GATAD2A_ENST00000358713.3_Missense_Mutation_p.T359K|GATAD2A_ENST00000252577.5_Missense_Mutation_p.T359K|GATAD2A_ENST00000429563.2_Missense_Mutation_p.T186K|GATAD2A_ENST00000537887.1_5'UTR|GATAD2A_ENST00000404158.1_Missense_Mutation_p.T359K	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	359	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						CTGGAGAAGACGCTACTCGAG	0.647																																						ENST00000360315.3	0.830000	0.180000	0.640000	0.290000	0.440000	0.472941	0.440000	0.410000																										0				13						c.(1075-1077)aCg>aAg		GATA zinc finger domain containing 2A							38.0	40.0	39.0					19																	19609403		2203	4300	6503	SO:0001583	missense	54815	0	0					g.chr19:19609403C>A	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1076C>A	chr19.hg19:g.19609403C>A	ENSP00000353463:p.Thr359Lys	0					GATAD2A_ENST00000404158.1_Missense_Mutation_p.T359K|GATAD2A_ENST00000358713.3_Missense_Mutation_p.T359K|GATAD2A_ENST00000429563.2_Missense_Mutation_p.T186K|GATAD2A_ENST00000537887.1_5'UTR|GATAD2A_ENST00000252577.5_Missense_Mutation_p.T359K	p.T359K	NM_017660.3	NP_060130.3	0	0	0	1.946505	Q86YP4	P66A_HUMAN		8	1388	+			B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	0	1	hg19	c.1076C>A	CCDS12402.2	0	.	.	.	.	.	.	.	.	.	.	C	31	5.086125	0.94100	.	.	ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000404158;ENST00000358713;ENST00000429563	T;T;T;T	0.54279	1.11;1.04;1.11;0.58	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.74176	0.3682	M	0.77313	2.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.74290	-0.3713	9	.	.	.	-12.7933	18.3542	0.90351	0.0:1.0:0.0:0.0	.	186;378;359	B4DKZ7;B5MC40;Q86YP4	.;.;P66A_HUMAN	K	359;359;378;359;186	ENSP00000353463:T359K;ENSP00000252577:T359K;ENSP00000351552:T359K;ENSP00000388416:T186K	.	T	+	2	0	0	GATAD2A	19470403	19470403	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	7.796000	0.85898	2.691000	0.91804	0.650000	0.86243	ACG	0.111387		TCGA-IB-7645-01A-22D-2201-08	0.647	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	0	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	1.990000	-7.980274	1	0.140000	NM_017660		0	6	5	0	188	165	0		1	1		0	0	48	0	0	0.948959	8.312715e-01	0	6	0	98	0	6	188
ZNF93	81931	broad.mit.edu	37	19	20044700	20044700	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr19:20044700C>T	ENST00000343769.5	+	4	964	c.936C>T	c.(934-936)ccC>ccT	p.P312P	AC007204.2_ENST00000592245.1_lincRNA	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						GAGAGAAGCCCTACGTTTGTG	0.368																																						ENST00000343769.5	0.610000	0.130000	0.460000	0.210000	0.320000	0.344100	0.320000	0.290000																										0				24						c.(934-936)ccC>ccT		zinc finger protein 93							35.0	38.0	37.0					19																	20044700		2203	4299	6502	SO:0001819	synonymous_variant	81931	0	0					g.chr19:20044700C>T	M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.936C>T	chr19.hg19:g.20044700C>T		0					AC007204.2_ENST00000592245.1_lincRNA	p.P312P	NM_031218.3	NP_112495.2	0	0	0	1.946505	P35789	ZNF93_HUMAN		4	964	+			A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Silent	SNP	ENST00000343769.5	0	1	hg19	c.936C>T	CCDS32973.1	0																																																																																								0.111387		TCGA-IB-7645-01A-22D-2201-08	0.368	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460808.2	0	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.990000	-7.055372	1	0.140000	NM_031218		0	6	6	0	265	260	0		1	0		0	0	43	0	0	0.963392	1.028871e-02	0	0	0	6	0	6	265
GRIK5	2901	broad.mit.edu	37	19	42563599	42563599	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr19:42563599G>A	ENST00000262895.3	-	5	588	c.589C>T	c.(589-591)Cgg>Tgg	p.R197W	GRIK5_ENST00000301218.4_Missense_Mutation_p.R197W|GRIK5_ENST00000593562.1_Missense_Mutation_p.R197W	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	197					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GTGGGGTCCCGGCTGTCGTCC	0.602																																						ENST00000262895.3	1.000000	0.740000	1.000000	0.900000	0.990000	0.965084	0.990000	1.000000																										0				35						c.(589-591)Cgg>Tgg		glutamate receptor, ionotropic, kainate 5							147.0	115.0	126.0					19																	42563599		2203	4300	6503	SO:0001583	missense	2901	2	121412	36				g.chr19:42563599G>A		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.589C>T	chr19.hg19:g.42563599G>A	ENSP00000262895:p.Arg197Trp	0					GRIK5_ENST00000301218.4_Missense_Mutation_p.R197W|GRIK5_ENST00000593562.1_Missense_Mutation_p.R197W	p.R197W	NM_002088.4	NP_002079.3	1	2	3	2.093694	Q16478	GRIK5_HUMAN		5	588	-		Prostate(69;0.059)	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	1	1	hg19	c.589C>T	CCDS12595.1	1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.894921	0.52121	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	D;D	0.83163	-1.69;-1.69	4.64	4.64	0.57946	4.64	4.64	0.57946	Extracellular ligand-binding receptor (1);	0.635417	0.15154	N	0.277543	T	0.71005	0.3289	N	0.16478	0.41	0.40112	D	0.976504	B	0.18166	0.026	B	0.15052	0.012	T	0.69143	-0.5223	10	0.59425	D	0.04	.	10.6544	0.45667	0.0:0.0:0.6912:0.3088	.	197	Q16478	GRIK5_HUMAN	W	197	ENSP00000262895:R197W;ENSP00000301218:R197W	ENSP00000262895:R197W	R	-	1	2	2	GRIK5	47255439	47255439	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.442000	0.52900	2.289000	0.77006	0.561000	0.74099	CGG	0.165697		TCGA-IB-7645-01A-22D-2201-08	0.602	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1	1	0	1	2	2	2	2	0	0	0	0	98	98	98	98	1	1.990000	-3.221879	1	0.140000			0	34	35	0	451	445	0		1	0		0	0	98	0	0	1.000000	1.858812e-01	0	0	0	11	0	34	451
NLRP5	126206	broad.mit.edu	37	19	56538511	56538511	+	Silent	SNP	G	G	T	rs368367207		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr19:56538511G>T	ENST00000390649.3	+	7	912	c.912G>T	c.(910-912)gcG>gcT	p.A304A		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	304	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGTGCTGGGCGCAAGGTGGAC	0.562																																						ENST00000390649.3	1.000000	0.510000	1.000000	0.850000	0.990000	0.941516	0.990000	1.000000																										0				25						c.(910-912)gcG>gcT		NLR family, pyrin domain containing 5							48.0	54.0	52.0					19																	56538511		2111	4222	6333	SO:0001819	synonymous_variant	126206	1	121032	30				g.chr19:56538511G>T	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.912G>T	chr19.hg19:g.56538511G>T		1						p.A304A	NM_153447.4	NP_703148.4	2	2	4	2.109478	P59047	NALP5_HUMAN		7	912	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	0	1	hg19	c.912G>T	CCDS12938.1	1																																																																																								0.187760		TCGA-IB-7645-01A-22D-2201-08	0.562	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.990000	-9.747625	1	0.140000	NM_153447		0	5	5	0	60	60	0		1			0	0	22	0	0	0.940103	0	0	0	0	0	0	5	60
CROCC	9696	broad.mit.edu	37	1	17250968	17250968	+	Silent	SNP	C	C	T	rs571516644	byFrequency	TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:17250968C>T	ENST00000375541.5	+	3	414	c.345C>T	c.(343-345)agC>agT	p.S115S	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ATGCGGTCAGCGAGAGGGTGG	0.647													c|||	4	0.000798722	0.0	0.0	5008	,	,		28321	0.001		0.0	False		,,,				2504	0.0031					ENST00000375541.5	1.000000	0.270000	1.000000	0.440000	0.670000	0.686562	0.670000	1.000000																										0				62						c.(343-345)agC>agT		ciliary rootlet coiled-coil, rootletin							48.0	34.0	39.0					1																	17250968		2202	4299	6501	SO:0001819	synonymous_variant	9696	20	121368	38				g.chr1:17250968C>T	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.345C>T	chr1.hg19:g.17250968C>T		0					CROCC_ENST00000467938.1_Intron	p.S115S	NM_014675.3	NP_055490.3	1	2	3	2.008615				3	414	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		Silent	SNP	ENST00000375541.5	1	1	hg19	c.345C>T	CCDS30616.1	0																																																																																								0.145384		TCGA-IB-7645-01A-22D-2201-08	0.647	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.990000	-4.195441	1	0.140000	NM_014675		0	6	6	0	134	133	0		1			0	0	31	0	0	0.965253	0	0	0	0	0	0	6	134
KPRP	448834	broad.mit.edu	37	1	152732688	152732688	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:152732688C>T	ENST00000606109.1	+	1	652	c.624C>T	c.(622-624)ttC>ttT	p.F208F	KPRP_ENST00000368773.1_Silent_p.F208F			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	208	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCCCCAGTTCCAGTTGAGGC	0.562																																						ENST00000606109.1	1.000000	0.740000	1.000000	0.850000	0.970000	0.940170	0.970000	1.000000																										0				60						c.(622-624)ttC>ttT		keratinocyte proline-rich protein							161.0	160.0	160.0					1																	152732688		2203	4300	6503	SO:0001819	synonymous_variant	448834	0	0					g.chr1:152732688C>T	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.624C>T	chr1.hg19:g.152732688C>T		1					KPRP_ENST00000368773.1_Silent_p.F208F	p.F208F			1	2	3	2.179986	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	1	652	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)			Silent	SNP	ENST00000606109.1	1	1	hg19	c.624C>T	CCDS30862.1	1																																																																																								0.196262		TCGA-IB-7645-01A-22D-2201-08	0.562	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	0	0	1	2	2	2	2	0	0	0	0	208	208	208	205	1	1.990000	-9.648430	1	0.140000	NM_001025231		0	57	54	0	840	826	0		1			0	0	208	0	0	1.000000	0	0	0	0	0	0	57	840
MYOG	4656	broad.mit.edu	37	1	203054999	203054999	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:203054999C>T	ENST00000241651.4	-	1	165	c.91G>A	c.(91-93)Gaa>Aaa	p.E31K		NM_002479.5	NP_002470.2	P15173	MYOG_HUMAN	myogenin (myogenic factor 4)	31					cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lithium ion (GO:0071285)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|negative regulation of cell proliferation (GO:0008285)|ossification (GO:0001503)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of muscle atrophy (GO:0014737)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myoblast fusion (GO:1901739)|regulation of satellite cell proliferation (GO:0014842)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|striated muscle atrophy (GO:0014891)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E31K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|urinary_tract(1)	12						CCTGGTGGTTCGAAGCCCTGG	0.637																																						ENST00000241651.4	0.760000	0.200000	0.590000	0.300000	0.430000	0.453646	0.430000	0.400000																										1	Substitution - Missense(1)	p.E31K(1)	large_intestine(1)	12						c.(91-93)Gaa>Aaa		myogenin (myogenic factor 4)							50.0	47.0	48.0					1																	203054999		2203	4300	6503	SO:0001583	missense	4656	5	121412	37				g.chr1:203054999C>T	BC053899	CCDS1433.1	1q31-q41	2013-05-21			ENSG00000122180	ENSG00000122180		"""Basic helix-loop-helix proteins"""	7612	protein-coding gene	gene with protein product		159980		MYF4		10329008	Standard	NM_002479		Approved	bHLHc3	uc001gzd.4	P15173	OTTHUMG00000042127	ENST00000241651.4:c.91G>A	chr1.hg19:g.203054999C>T	ENSP00000241651:p.Glu31Lys	1						p.E31K	NM_002479.5	NP_002470.2	1	2	3	2.183099	P15173	MYOG_HUMAN		1	165	-			Q53XW6	Missense_Mutation	SNP	ENST00000241651.4	1	1	hg19	c.91G>A	CCDS1433.1	0	.	.	.	.	.	.	.	.	.	.	c	26.8	4.774527	0.90108	.	.	ENSG00000122180	ENST00000241651	T	0.80214	-1.35	5.68	5.68	0.88126	5.68	5.68	0.88126	Myogenic basic muscle-specific protein (2);	0.401828	0.27654	N	0.018407	T	0.78672	0.4320	M	0.74258	2.255	0.58432	D	0.999994	B	0.33612	0.419	B	0.27170	0.077	T	0.79926	-0.1597	10	0.66056	D	0.02	.	13.0541	0.58969	0.0:0.9267:0.0:0.0733	.	31	P15173	MYOG_HUMAN	K	31	ENSP00000241651:E31K	ENSP00000241651:E31K	E	-	1	0	0	MYOG	201321622	201321622	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	5.539000	0.67199	2.679000	0.91253	0.558000	0.71614	GAA	0.196262		TCGA-IB-7645-01A-22D-2201-08	0.637	MYOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100279.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	1.990000	-3.587750	1	0.140000	NM_002479		0	8	8	0	289	281	0		1			0	0	70	0	0	0.988403	0	0	0	0	0	0	8	289
CR1	1378	broad.mit.edu	37	1	207669664	207669664	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:207669664G>A	ENST00000367049.4	+	1	52	c.52G>A	c.(52-54)Ggt>Agt	p.G18S	CR1_ENST00000367052.1_Missense_Mutation_p.G18S|CR1_ENST00000400960.2_Missense_Mutation_p.G18S|CR1_ENST00000367050.4_3'UTR|CR1_ENST00000367051.1_Missense_Mutation_p.G18S|CR1_ENST00000367053.1_Missense_Mutation_p.G18S	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	18					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCCGGCGCCCGGTCTCCCCTT	0.662																																						ENST00000367049.4	1.000000	0.580000	1.000000	0.800000	0.990000	0.929065	0.990000	1.000000																										0				82						c.(52-54)Ggt>Agt		complement component (3b/4b) receptor 1 (Knops blood group)							19.0	24.0	22.0					1																	207669664		1836	4070	5906	SO:0001583	missense	1378	0	0					g.chr1:207669664G>A	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.52G>A	chr1.hg19:g.207669664G>A	ENSP00000356016:p.Gly18Ser	1					CR1_ENST00000367051.1_Missense_Mutation_p.G18S|CR1_ENST00000367052.1_Missense_Mutation_p.G18S|CR1_ENST00000367053.1_Missense_Mutation_p.G18S|CR1_ENST00000367050.4_3'UTR|CR1_ENST00000400960.2_Missense_Mutation_p.G18S	p.G18S	NM_000651.4	NP_000642.3	1	2	3	2.183099	P17927	CR1_HUMAN		1	52	+			Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	1	1	hg19	c.52G>A	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	G	4.819	0.152215	0.09185	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.30448	1.55;1.68;1.55;1.55;1.71;1.53	3.35	-6.11	0.02131	3.35	-6.11	0.02131	.	.	.	.	.	T	0.10723	0.0262	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.34725	-0.9817	9	0.10902	T	0.67	.	6.0568	0.19816	0.0:0.1689:0.4:0.4311	.	18;18;18;18	Q5SR44;E9PQN4;P17927;E9PDY4	.;.;CR1_HUMAN;.	S	18	ENSP00000356019:G18S;ENSP00000356018:G18S;ENSP00000356020:G18S;ENSP00000383744:G18S;ENSP00000436139:G18S;ENSP00000356016:G18S	ENSP00000356016:G18S	G	+	1	0	0	CR1	205736287	205736287	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.223000	0.01214	-1.493000	0.01835	-0.203000	0.12734	GGT	0.196262		TCGA-IB-7645-01A-22D-2201-08	0.662	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	47	1	1.990000	-15.055510	1	0.140000	NM_000573		0	11	11	0	148	139	0		1	0		0	0	51	0	0	0.997955	0	0	0	0	1	0	11	148
LAMB3	3914	broad.mit.edu	37	1	209799234	209799234	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:209799234C>T	ENST00000356082.4	-	14	1869	c.1735G>A	c.(1735-1737)Gtg>Atg	p.V579M	LAMB3_ENST00000367030.3_Missense_Mutation_p.V579M|MIR4260_ENST00000583107.1_RNA|LAMB3_ENST00000391911.1_Missense_Mutation_p.V579M	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	579	Domain II.|Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGGCAGGCCACGCACACCGGG	0.667																																						ENST00000356082.4	1.000000	0.360000	1.000000	0.550000	0.800000	0.788214	0.800000	1.000000																										0				45						c.(1735-1737)Gtg>Atg		laminin, beta 3							31.0	32.0	32.0					1																	209799234		2202	4300	6502	SO:0001583	missense	3914	1	121386	25				g.chr1:209799234C>T	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1735G>A	chr1.hg19:g.209799234C>T	ENSP00000348384:p.Val579Met	1					LAMB3_ENST00000391911.1_Missense_Mutation_p.V579M|LAMB3_ENST00000367030.3_Missense_Mutation_p.V579M|MIR4260_ENST00000583107.1_RNA	p.V579M	NM_000228.2	NP_000219.2	1	2	3	2.183099	Q13751	LAMB3_HUMAN		14	1869	-			D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	1	1	hg19	c.1735G>A	CCDS1487.1	0	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988775	0.35131	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.55588	0.51;0.51;0.51	5.24	3.17	0.36434	5.24	3.17	0.36434	EGF-like, laminin (2);	0.654291	0.16212	N	0.224446	T	0.57080	0.2029	L	0.38953	1.18	0.22479	N	0.999064	D	0.89917	1.0	D	0.66602	0.945	T	0.41520	-0.9504	10	0.46703	T	0.11	.	8.3866	0.32503	0.0:0.6207:0.2998:0.0795	.	579	Q13751	LAMB3_HUMAN	M	579	ENSP00000375778:V579M;ENSP00000348384:V579M;ENSP00000355997:V579M	ENSP00000348384:V579M	V	-	1	0	0	LAMB3	207865857	207865857	0.030000	0.19436	0.901000	0.35422	0.169000	0.22640	0.404000	0.20999	1.160000	0.42584	0.456000	0.33151	GTG	0.196262		TCGA-IB-7645-01A-22D-2201-08	0.667	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	1	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	1.990000	-10.628510	1	0.140000	NM_000228		0	7	7	0	131	130	1		1	1		0	0	38	0	0	0.980483	9.953411e-01	0	51	0	145	0	7	131
DLGAP3	58512	broad.mit.edu	37	1	35370343	35370343	+	Silent	SNP	C	C	T	rs142633506	byFrequency	TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:35370343C>T	ENST00000373347.1	-	3	910	c.642G>A	c.(640-642)ccG>ccA	p.P214P	DLGAP3_ENST00000235180.4_Silent_p.P214P|DLGAP3_ENST00000495979.1_5'Flank			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	214					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CTCCAGAGCCCGGGCCGGGGT	0.652													c|||	2	0.000399361	0.0	0.0	5008	,	,		13404	0.002		0.0	False		,,,				2504	0.0					ENST00000373347.1	1.000000	0.710000	1.000000	0.870000	0.990000	0.956571	0.990000	1.000000																										0				46						c.(640-642)ccG>ccA		discs, large (Drosophila) homolog-associated protein 3				0,4406		0,0,2203	39.0	40.0	40.0		642	-5.5	0.2	1	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DLGAP3	NM_001080418.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		214/980	35370343	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	58512	18	121412	44				g.chr1:35370343C>T	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.642G>A	chr1.hg19:g.35370343C>T		0					DLGAP3_ENST00000235180.4_Silent_p.P214P|DLGAP3_ENST00000495979.1_5'Flank	p.P214P			1	2	3	2.008615	O95886	DLGP3_HUMAN		3	910	-		Myeloproliferative disorder(586;0.0393)	Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	1	1	hg19	c.642G>A	CCDS30670.1	1																																																																																								0.145384		TCGA-IB-7645-01A-22D-2201-08	0.652	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	1.990000	-2.966613	1	0.140000	NM_021234		0	24	24	0	301	296	0		1			0	0	64	0	0	1.000000	0	0	0	0	0	0	24	301
BMP8A	353500	broad.mit.edu	37	1	39988771	39988771	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:39988771C>T	ENST00000331593.5	+	6	1387	c.1041C>T	c.(1039-1041)caC>caT	p.H347H	RP11-69E11.4_ENST00000458207.1_RNA|RP11-69E11.4_ENST00000431553.1_RNA|RP11-69E11.4_ENST00000331856.2_RNA|RP11-69E11.4_ENST00000441741.1_RNA|RP11-69E11.4_ENST00000417869.1_RNA|RP11-69E11.4_ENST00000440190.1_RNA|RP11-69E11.4_ENST00000450157.1_RNA	NM_181809.3	NP_861525.2	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8a	347					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|diet induced thermogenesis (GO:0002024)|growth (GO:0040007)|negative regulation of insulin secretion (GO:0046676)|ossification (GO:0001503)|regulation of energy homeostasis (GO:2000505)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(1)|skin(1)	5	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCACCAACCACGCCATCCTGC	0.677																																						ENST00000331593.5	1.000000	0.310000	0.600000	0.380000	0.470000	0.511683	0.470000	0.460000																										0				5						c.(1039-1041)caC>caT		bone morphogenetic protein 8a							175.0	148.0	157.0					1																	39988771		2203	4300	6503	SO:0001819	synonymous_variant	353500	6	121412	42				g.chr1:39988771C>T	AY303954	CCDS437.1	1p35-p32	2014-01-30			ENSG00000183682	ENSG00000183682		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	21650	protein-coding gene	gene with protein product							Standard	NM_181809		Approved		uc001cdi.3	Q7Z5Y6	OTTHUMG00000008394	ENST00000331593.5:c.1041C>T	chr1.hg19:g.39988771C>T		0					RP11-69E11.4_ENST00000458207.1_RNA|RP11-69E11.4_ENST00000441741.1_RNA|RP11-69E11.4_ENST00000450157.1_RNA|RP11-69E11.4_ENST00000331856.2_RNA|RP11-69E11.4_ENST00000440190.1_RNA|RP11-69E11.4_ENST00000431553.1_RNA|RP11-69E11.4_ENST00000417869.1_RNA	p.H347H	NM_181809.3	NP_861525.2	1	2	3	2.008615	Q7Z5Y6	BMP8A_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)	6	1387	+	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	Q5T3A5	Silent	SNP	ENST00000331593.5	1	1	hg19	c.1041C>T	CCDS437.1	0																																																																																								0.145384		TCGA-IB-7645-01A-22D-2201-08	0.677	BMP8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023079.1	0	0	1	2	2	2	2	0	0	0	0	205	205	205	201	1	1.990000	-3.633741	1	0.140000	NM_181809		0	26	25	0	786	768	0		1	0		0	0	205	0	0	1.000000	6.358229e-01	0	0	0	66	0	26	786
SLC44A5	204962	broad.mit.edu	37	1	75685021	75685021	+	Missense_Mutation	SNP	G	G	A	rs202241076		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:75685021G>A	ENST00000370855.5	-	16	1300	c.1187C>T	c.(1186-1188)gCg>gTg	p.A396V	SLC44A5_ENST00000370859.3_Missense_Mutation_p.A396V|SLC44A5_ENST00000535611.1_Missense_Mutation_p.A266V	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	396					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A396V(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CCCCGATGTCGCCAAGAAACT	0.393													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17063	0.0		0.0	False		,,,				2504	0.0					ENST00000370855.5	1.000000	0.300000	0.790000	0.420000	0.570000	0.603655	0.570000	0.520000																										1	Substitution - Missense(1)	p.A396V(1)	large_intestine(1)	61						c.(1186-1188)gCg>gTg		solute carrier family 44, member 5							86.0	80.0	82.0					1																	75685021		2203	4300	6503	SO:0001583	missense	204962	10	121392	41				g.chr1:75685021G>A	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1187C>T	chr1.hg19:g.75685021G>A	ENSP00000359892:p.Ala396Val	0					SLC44A5_ENST00000535611.1_Missense_Mutation_p.A266V|SLC44A5_ENST00000370859.3_Missense_Mutation_p.A396V	p.A396V	NM_152697.4	NP_689910.2	1	2	3	2.008615	Q8NCS7	CTL5_HUMAN		16	1300	-			B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	1	1	hg19	c.1187C>T	CCDS667.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	19.18	3.778685	0.70107	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.22945	1.93;1.93;1.93	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.216170	0.47852	D	0.000216	T	0.40398	0.1115	M	0.83118	2.625	0.80722	D	1	D;D;D;D;D	0.65815	0.99;0.991;0.99;0.995;0.988	P;P;P;P;P	0.57324	0.818;0.745;0.818;0.807;0.629	T	0.24941	-1.0146	10	0.27082	T	0.32	-12.0802	18.7654	0.91869	0.0:0.0:1.0:0.0	.	390;435;396;396;435	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	V	396;435;396;266;389	ENSP00000359896:A396V;ENSP00000359892:A396V;ENSP00000443090:A266V	ENSP00000359892:A396V	A	-	2	0	0	SLC44A5	75457609	75457609	1.000000	0.71417	0.998000	0.56505	0.103000	0.19146	7.142000	0.77339	2.504000	0.84457	0.655000	0.94253	GCG	0.145384		TCGA-IB-7645-01A-22D-2201-08	0.393	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	0	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	1.990000	-3.026999	1	0.140000	NM_152697		0	12	12	0	306	304	0		1	1		0	0	89	0	0	0.999128	1.612779e-02	0	3	0	2	0	12	306
OR2T10	127069	broad.mit.edu	37	1	248756293	248756293	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr1:248756293G>C	ENST00000330500.2	-	1	807	c.777C>G	c.(775-777)taC>taG	p.Y259*	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGGGAGCATGTAGTTGTAAA	0.438																																						ENST00000330500.2	1.000000	0.850000	1.000000	0.990000	0.990000	0.990400	0.990000	1.000000																										0				26						c.(775-777)taC>taG		olfactory receptor, family 2, subfamily T, member 10							65.0	68.0	67.0					1																	248756293		2050	4236	6286	SO:0001587	stop_gained	127069	0	0					g.chr1:248756293G>C		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.777C>G	chr1.hg19:g.248756293G>C	ENSP00000329210:p.Tyr259*	1					Y_RNA_ENST00000364732.1_RNA	p.Y259*	NM_001004693.1	NP_001004693.1	1	2	3	2.183099	Q8NGZ9	O2T10_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)	1	807	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		B2RNK7	Nonsense_Mutation	SNP	ENST00000330500.2	0	1	hg19	c.777C>G	CCDS31121.1	1	.	.	.	.	.	.	.	.	.	.	.	8.049	0.765657	0.15983	.	.	ENSG00000184022	ENST00000330500	.	.	.	2.35	1.41	0.22369	2.35	1.41	0.22369	.	.	.	.	.	.	.	.	.	.	.	0.48830	D	0.999716	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6709	0.12689	0.4638:0.0:0.5362:0.0	.	.	.	.	X	259	.	ENSP00000329210:Y259X	Y	-	3	2	2	OR2T10	246822916	246822916	0.000000	0.05858	0.755000	0.31263	0.104000	0.19210	-0.746000	0.04829	0.183000	0.20059	-0.409000	0.06214	TAC	0.196262		TCGA-IB-7645-01A-22D-2201-08	0.438	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.990000	-20.000000	1	0.140000	NM_001004693		0	24	24	0	262	260	0		1			0	0	45	0	0	1.000000	0	0	0	0	0	0	24	262
ACOT8	10005	broad.mit.edu	37	20	44470483	44470483	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr20:44470483C>A	ENST00000217455.4	-	6	1044	c.954G>T	c.(952-954)aaG>aaT	p.K318N	SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000342644.5_Intron	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8	318					acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				CTGGCTACAGCTTGCTCTCTG	0.597																																						ENST00000217455.4	1.000000	0.220000	1.000000	0.440000	0.790000	0.746488	0.790000	1.000000																										0				10						c.(952-954)aaG>aaT		acyl-CoA thioesterase 8							36.0	39.0	38.0					20																	44470483		2203	4300	6503	SO:0001583	missense	10005	0	0					g.chr20:44470483C>A	AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.954G>T	chr20.hg19:g.44470483C>A	ENSP00000217455:p.Lys318Asn	0					SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000342644.5_Intron	p.K318N	NM_005469.3	NP_005460.2	1	2	3	2.030310	O14734	ACOT8_HUMAN		6	1044	-		Myeloproliferative disorder(115;0.0122)	O15261|Q17RX4	Missense_Mutation	SNP	ENST00000217455.4	0	1	hg19	c.954G>T	CCDS13378.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.55|14.55	2.567729|2.567729	0.45798|0.45798	.|.	.|.	ENSG00000101473|ENSG00000101473	ENST00000217455|ENST00000487205	.|.	.|.	.|.	5.02|5.02	3.08|3.08	0.35506|0.35506	5.02|5.02	3.08|3.08	0.35506|0.35506	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69975|0.69975	0.3171|0.3171	M|M	0.75085|0.75085	2.285|2.285	0.58432|0.58432	D|D	0.999998|0.999998	P|.	0.52577|.	0.954|.	P|.	0.47981|.	0.563|.	T|T	0.67941|0.67941	-0.5540|-0.5540	9|5	0.87932|.	D|.	0|.	.|.	10.304|10.304	0.43670|0.43670	0.0:0.7778:0.0:0.2222|0.0:0.7778:0.0:0.2222	.|.	318|.	O14734|.	ACOT8_HUMAN|.	N|I	318|208	.|.	ENSP00000217455:K318N|.	K|S	-|-	3|2	2|0	2|0	ACOT8|ACOT8	43903890|43903890	43903890|43903890	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.245000|0.245000	0.25701|0.25701	1.271000|1.271000	0.33098|0.33098	0.694000|0.694000	0.31654|0.31654	0.561000|0.561000	0.74099|0.74099	AAG|AGC	0.150114		TCGA-IB-7645-01A-22D-2201-08	0.597	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080338.2	0	0	0	2	2	2	2	0	0	0	0	22	22	22	22	1	1.990000	-7.172712	1	0.140000	NM_183386		0	3	2	0	63	61	0		1	0		0	0	22	0	0	0.797565	8.346854e-01	0	0	0	71	0	3	63
UBASH3A	53347	broad.mit.edu	37	21	43838614	43838614	+	Silent	SNP	C	C	T	rs147873921		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr21:43838614C>T	ENST00000319294.6	+	7	973	c.942C>T	c.(940-942)agC>agT	p.S314S	UBASH3A_ENST00000398367.1_Silent_p.S276S|RNU6-1149P_ENST00000516810.1_RNA|UBASH3A_ENST00000291535.6_Silent_p.S276S	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	314	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S314R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						ACGAAGCCAGCGAGGGCTGGG	0.592																																						ENST00000319294.6	1.000000	0.430000	0.890000	0.560000	0.710000	0.729180	0.710000	1.000000																										1	Substitution - Missense(1)	p.S314R(1)	endometrium(1)	28						c.(940-942)agC>agT		ubiquitin associated and SH3 domain containing A		C	,	1,4405	2.1+/-5.4	0,1,2202	71.0	71.0	71.0		828,942	-1.1	1.0	21	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	UBASH3A	NM_001001895.2,NM_018961.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	276/624,314/662	43838614	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	53347	4	121412	40				g.chr21:43838614C>T	AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.942C>T	chr21.hg19:g.43838614C>T		0					RNU6-1149P_ENST00000516810.1_RNA|UBASH3A_ENST00000398367.1_Silent_p.S276S|UBASH3A_ENST00000291535.6_Silent_p.S276S	p.S314S	NM_018961.3	NP_061834.1	0	0	0	1.955375	P57075	UBS3A_HUMAN		7	973	+			G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Silent	SNP	ENST00000319294.6	1	1	hg19	c.942C>T	CCDS13687.1	0																																																																																								0.115226		TCGA-IB-7645-01A-22D-2201-08	0.592	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	1.990000	-18.525560	1	0.140000	NM_001001895		0	17	17	0	313	305	0		1	0		0	0	99	0	0	0.999961	1.761426e-01	0	0	0	14	0	17	313
THSD7B	80731	broad.mit.edu	37	2	138030171	138030171	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:138030171T>A	ENST00000409968.1	+	11	2513	c.2335T>A	c.(2335-2337)Tgc>Agc	p.C779S	THSD7B_ENST00000272643.3_Missense_Mutation_p.C779S|THSD7B_ENST00000413152.2_Missense_Mutation_p.C748S|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	779	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGGCCAGGAATGCCCAGATAC	0.393																																						ENST00000409968.1	1.000000	0.240000	0.910000	0.400000	0.620000	0.645698	0.620000	1.000000																										0				134						c.(2335-2337)Tgc>Agc		thrombospondin, type I, domain containing 7B							120.0	125.0	123.0					2																	138030171		1942	4137	6079	SO:0001583	missense	80731	0	0					g.chr2:138030171T>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2335T>A	chr2.hg19:g.138030171T>A	ENSP00000387145:p.Cys779Ser	0					THSD7B_ENST00000272643.3_Missense_Mutation_p.C779S|THSD7B_ENST00000413152.2_Missense_Mutation_p.C748S|THSD7B_ENST00000543459.1_Intron	p.C779S			0	0	0	1.963329	Q9C0I4	THS7B_HUMAN		11	2513	+				Missense_Mutation	SNP	ENST00000409968.1	0	1	hg19	c.2335T>A		0	.	.	.	.	.	.	.	.	.	.	T	26.9	4.780563	0.90195	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.25579	1.79;1.79;1.79	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	M	0.91561	3.22	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.964	T	0.67696	-0.5604	10	0.51188	T	0.08	.	14.9927	0.71401	0.0:0.0:0.0:1.0	.	779;748	Q9C0I4;C9JKN6	THS7B_HUMAN;.	S	779;779;748	ENSP00000387145:C779S;ENSP00000272643:C779S;ENSP00000413841:C748S	ENSP00000272643:C779S	C	+	1	0	0	THSD7B	137746641	137746641	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.047000	0.76599	2.171000	0.68590	0.533000	0.62120	TGC	0.119033		TCGA-IB-7645-01A-22D-2201-08	0.393	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	0	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.990000	-8.835941	1	0.140000	XM_046570.9		0	5	5	0	111	111	0		1	0		0	0	22	0	0	0.938939	1.113720e-01	0	0	0	11	0	5	111
APOB	338	broad.mit.edu	37	2	21233909	21233909	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:21233909T>C	ENST00000233242.1	-	26	5958	c.5831A>G	c.(5830-5832)cAt>cGt	p.H1944R		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1944					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGTAATCATGAGAGAAAGT	0.468																																						ENST00000233242.1	0.750000	0.380000	0.660000	0.460000	0.550000	0.566061	0.550000	0.550000																										0				305						c.(5830-5832)cAt>cGt		apolipoprotein B							177.0	166.0	170.0					2																	21233909		2203	4300	6503	SO:0001583	missense	338	0	0					g.chr2:21233909T>C	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5831A>G	chr2.hg19:g.21233909T>C	ENSP00000233242:p.His1944Arg	0						p.H1944R	NM_000384.2	NP_000375	0	0	0	1.956022	P04114	APOB_HUMAN		26	5958	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	1	1	hg19	c.5831A>G	CCDS1703.1	0	.	.	.	.	.	.	.	.	.	.	T	13.08	2.130700	0.37630	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.03094	4.05	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000016	T	0.18130	0.0435	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.68765	0.96	T	0.00239	-1.1888	10	0.62326	D	0.03	.	15.5233	0.75881	0.0:0.0:0.0:1.0	.	1944	P04114	APOB_HUMAN	R	1944	ENSP00000233242:H1944R	ENSP00000233242:H1944R	H	-	2	0	0	APOB	21087414	21087414	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.315000	0.51951	2.065000	0.61736	0.454000	0.30748	CAT	0.116499		TCGA-IB-7645-01A-22D-2201-08	0.468	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1	0	0	1	2	2	2	2	0	0	0	0	186	186	186	184	1	1.990000	-4.661664	1	0.140000			0	32	32	0	769	762	0		1			0	0	186	0	0	1.000000	0	0	0	0	0	0	32	769
LRP2	4036	broad.mit.edu	37	2	170177381	170177381	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:170177381C>T	ENST00000263816.3	-	2	378	c.93G>A	c.(91-93)gcG>gcA	p.A31A	LRP2_ENST00000443831.1_Silent_p.A31A	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	31	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A31A(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGCGAAAATGCGCACTGTCAC	0.388																																						ENST00000263816.3	0.970000	0.390000	0.810000	0.500000	0.640000	0.664811	0.640000	0.640000																										1	Substitution - coding silent(1)	p.A31A(1)	breast(1)	315						c.(91-93)gcG>gcA		low density lipoprotein receptor-related protein 2	"""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"						113.0	96.0	102.0					2																	170177381		2203	4300	6503	SO:0001819	synonymous_variant	4036	3	121412	39				g.chr2:170177381C>T		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.93G>A	chr2.hg19:g.170177381C>T		0					LRP2_ENST00000443831.1_Silent_p.A31A	p.A31A	NM_004525.2	NP_004516.2	0	0	0	1.963329	P98164	LRP2_HUMAN		2	378	-			O00711|Q16215	Silent	SNP	ENST00000263816.3	1	1	hg19	c.93G>A	CCDS2232.1	0																																																																																								0.119033		TCGA-IB-7645-01A-22D-2201-08	0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	1	0	1	2	2	2	2	0	0	0	0	73	73	73	71	1	1.990000	-4.253675	1	0.140000	NM_004525		0	17	17	0	350	346	0		1			0	0	73	0	0	0.999965	0	0	0	0	0	0	17	350
FN1	2335	broad.mit.edu	37	2	216271856	216271856	+	Missense_Mutation	SNP	G	G	A	rs371435589		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:216271856G>A	ENST00000359671.1	-	18	2972	c.2707C>T	c.(2707-2709)Cgc>Tgc	p.R903C	FN1_ENST00000336916.4_Missense_Mutation_p.R903C|FN1_ENST00000346544.3_Missense_Mutation_p.R903C|FN1_ENST00000357009.2_Missense_Mutation_p.R903C|FN1_ENST00000421182.1_Missense_Mutation_p.R903C|FN1_ENST00000446046.1_Missense_Mutation_p.R903C|FN1_ENST00000345488.5_Missense_Mutation_p.R903C|FN1_ENST00000356005.4_Missense_Mutation_p.R903C|FN1_ENST00000357867.4_Missense_Mutation_p.R903C|FN1_ENST00000443816.1_Missense_Mutation_p.R903C|FN1_ENST00000354785.4_Missense_Mutation_p.R903C|FN1_ENST00000432072.2_Missense_Mutation_p.R903C|FN1_ENST00000323926.6_Missense_Mutation_p.R903C			P02751	FINC_HUMAN	fibronectin 1	903	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TTACCTGAGCGTGGGGTGCCA	0.408																																						ENST00000359671.1	0.840000	0.330000	0.700000	0.430000	0.550000	0.574281	0.550000	0.550000																									FN1/ALK(2)	0				109						c.(2707-2709)Cgc>Tgc		fibronectin 1	Ocriplasmin(DB08888)						112.0	111.0	112.0					2																	216271856		2203	4300	6503	SO:0001583	missense	2335	0	0					g.chr2:216271856G>A		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2707C>T	chr2.hg19:g.216271856G>A	ENSP00000352696:p.Arg903Cys	0					FN1_ENST00000357867.4_Missense_Mutation_p.R903C|FN1_ENST00000345488.5_Missense_Mutation_p.R903C|FN1_ENST00000336916.4_Missense_Mutation_p.R903C|FN1_ENST00000432072.2_Missense_Mutation_p.R903C|FN1_ENST00000446046.1_Missense_Mutation_p.R903C|FN1_ENST00000357009.2_Missense_Mutation_p.R903C|FN1_ENST00000346544.3_Missense_Mutation_p.R903C|FN1_ENST00000356005.4_Missense_Mutation_p.R903C|FN1_ENST00000323926.6_Missense_Mutation_p.R903C|FN1_ENST00000421182.1_Missense_Mutation_p.R903C|FN1_ENST00000443816.1_Missense_Mutation_p.R903C|FN1_ENST00000354785.4_Missense_Mutation_p.R903C	p.R903C			0	0	0	1.976401	P02751	FINC_HUMAN		18	2972	-		Renal(323;0.127)	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	1	1	hg19	c.2707C>T		0	.	.	.	.	.	.	.	.	.	.	G	11.57	1.676889	0.29783	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.49139	0.79;2.17;2.35;0.88;2.42;2.06;2.39;2.05;2.35;2.09;1.56;0.87;1.46	5.47	4.59	0.56863	5.47	4.59	0.56863	.	0.100271	0.45361	D	0.000372	T	0.61009	0.2313	L	0.47716	1.5	0.09310	N	0.999992	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;1.0;0.987;1.0;1.0;0.976;0.996	P;P;D;D;P;P;D;D;P;P	0.70487	0.888;0.886;0.962;0.969;0.899;0.781;0.915;0.969;0.814;0.814	T	0.56920	-0.7899	10	0.87932	D	0	.	14.258	0.66065	0.0:0.0:0.7303:0.2697	.	903;903;903;903;903;903;903;903;903;903	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	C	903	ENSP00000394423:R903C;ENSP00000323534:R903C;ENSP00000338200:R903C;ENSP00000350534:R903C;ENSP00000346839:R903C;ENSP00000352696:R903C;ENSP00000265312:R903C;ENSP00000273049:R903C;ENSP00000349509:R903C;ENSP00000410422:R903C;ENSP00000415018:R903C;ENSP00000399538:R903C;ENSP00000348285:R903C	ENSP00000265313:R903C	R	-	1	0	0	FN1	215980101	215980101	0.331000	0.24713	0.660000	0.29694	0.056000	0.15407	2.273000	0.43381	1.272000	0.44329	0.655000	0.94253	CGC	0.125305		TCGA-IB-7645-01A-22D-2201-08	0.408	FN1-204	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.990000	-4.058689	1	0.140000	NM_212476		0	17	17	0	414	408	0		1	0		0	0	96	0	0	0.999963	1	0	0	0	2342	0	17	414
REG3A	5068	broad.mit.edu	37	2	79384703	79384703	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:79384703C>T	ENST00000409839.3	-	5	491	c.455G>A	c.(454-456)aGc>aAc	p.S152N	AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.S152N|REG3A_ENST00000305165.2_Missense_Mutation_p.S152N	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	152	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						CTTACCTGTGCTTCTCGACAG	0.512																																						ENST00000409839.3	0.790000	0.370000	0.680000	0.460000	0.560000	0.578771	0.560000	0.560000																										0				50						c.(454-456)aGc>aAc		regenerating islet-derived 3 alpha							106.0	108.0	107.0					2																	79384703		2203	4300	6503	SO:0001583	missense	5068	0	0					g.chr2:79384703C>T	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.455G>A	chr2.hg19:g.79384703C>T	ENSP00000386630:p.Ser152Asn	0					REG3A_ENST00000305165.2_Missense_Mutation_p.S152N|REG3A_ENST00000393878.1_Missense_Mutation_p.S152N|AC011754.1_ENST00000415201.1_RNA	p.S152N	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	0	0	0	1.956022	Q06141	REG3A_HUMAN		5	491	-				Missense_Mutation	SNP	ENST00000409839.3	1	1	hg19	c.455G>A	CCDS1965.1	0	.	.	.	.	.	.	.	.	.	.	C	3.186	-0.166825	0.06461	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.18810	2.19;2.19;2.19	3.87	-7.73	0.01245	3.87	-7.73	0.01245	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	1.045080	0.07478	N	0.903419	T	0.11367	0.0277	L	0.38733	1.17	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19976	-1.0289	10	0.15499	T	0.54	.	4.6128	0.12411	0.0829:0.1018:0.2213:0.594	.	152	Q06141	REG3A_HUMAN	N	152	ENSP00000386630:S152N;ENSP00000377456:S152N;ENSP00000304311:S152N	ENSP00000304311:S152N	S	-	2	0	0	REG3A	79238211	79238211	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.756000	0.00374	-3.453000	0.00160	-1.185000	0.01705	AGC	0.116499		TCGA-IB-7645-01A-22D-2201-08	0.512	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	0	0	1	2	2	2	2	0	0	0	0	134	134	134	124	1	1.990000	-4.259523	1	0.140000	NM_002580		0	26	24	0	613	578	0		1	0		0	0	134	0	0	1.000000	6.480576e-01	0	0	0	53	0	26	613
TMEM131	23505	broad.mit.edu	37	2	98430514	98430515	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:98430514_98430515GC>TA	ENST00000186436.5	-	15	1764_1765	c.1536_1537GC>TA	c.(1534-1539)atGCac>atTAac	p.512_513MH>IN		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	512						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TTATCAATGTGCATGGATGATG	0.347																																						ENST00000186436.5	1.000000	0.520000|0.610000	1.000000	0.790000|0.900000	0.990000	0.926955|0.957335	0.990000	1.000000																										0				57						c.(1537-1539)Cac>Aac|c.(1534-1536)atG>atT		transmembrane protein 131																																				SO:0001583	missense	23505	0	0					g.chr2:98430514G>T|g.chr2:98430515C>A	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1536_1537delinsTA	chr2.hg19:g.98430514_98430515delinsTA	ENSP00000186436:p.M512_H513delinsIN	0						p.H513N|p.M512I	NM_015348.1	NP_056163.1	0	0	0	1.963329	Q92545	TM131_HUMAN		15	1765|1764	-				Missense_Mutation	SNP	ENST00000186436.5	0	1|0	hg19	c.1537C>A|c.1536G>T	CCDS46368.1	1																									5.81	5.81|1.59	0.92471|0.23543																																												0			97796946|97796947														0.119033		TCGA-IB-7645-01A-22D-2201-08	0.347	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	1	0	1	2	2	2	2	0	0	0	0	16	16|17	16|17	16|17	1	1.990000	-11.504210|-6.232596	1	0.140000	XM_371542		0	6|7	6|7	0	60	60	1		1	1		0	0	16|17	0	0	0.967376|0.982577	9.183996e-01|9.501763e-01	0	12	0	36|37	0	6	60
CCDC108	255101	broad.mit.edu	37	2	219890812	219890812	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr2:219890812C>T	ENST00000341552.5	-	14	2364	c.2281G>A	c.(2281-2283)Gca>Aca	p.A761T	CCDC108_ENST00000453220.1_Missense_Mutation_p.A761T|CCDC108_ENST00000441968.1_Missense_Mutation_p.A761T	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	761						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCCTCGTGCCCGCACCGTC	0.597																																						ENST00000341552.5	0.930000	0.300000	0.750000	0.420000	0.570000	0.593751	0.570000	0.550000																										0				80						c.(2281-2283)Gca>Aca		coiled-coil domain containing 108							81.0	72.0	75.0					2																	219890812		2203	4300	6503	SO:0001583	missense	255101	0	0					g.chr2:219890812C>T	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2281G>A	chr2.hg19:g.219890812C>T	ENSP00000340776:p.Ala761Thr	0					CCDC108_ENST00000441968.1_Missense_Mutation_p.A761T|CCDC108_ENST00000453220.1_Missense_Mutation_p.A761T	p.A761T	NM_194302.2	NP_919278.2	0	0	0	1.976401	Q6ZU64	CC108_HUMAN		14	2364	-		Renal(207;0.0915)	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	1	1	hg19	c.2281G>A	CCDS2430.2	0	.	.	.	.	.	.	.	.	.	.	C	7.441	0.640609	0.14386	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.05580	3.42;3.42;3.42	4.87	3.09	0.35607	4.87	3.09	0.35607	.	0.461082	0.18270	N	0.146344	T	0.04363	0.0120	L	0.38838	1.175	0.09310	N	1	B	0.28512	0.214	B	0.24701	0.055	T	0.42275	-0.9461	10	0.15952	T	0.53	-1.4645	3.8598	0.08991	0.1251:0.5849:0.1362:0.1538	.	761	Q6ZU64	CC108_HUMAN	T	761	ENSP00000340776:A761T;ENSP00000413377:A761T;ENSP00000409117:A761T	ENSP00000340776:A761T	A	-	1	0	0	CCDC108	219599056	219599056	0.004000	0.15560	0.001000	0.08648	0.273000	0.26683	1.552000	0.36244	0.671000	0.31185	-0.224000	0.12420	GCA	0.125305		TCGA-IB-7645-01A-22D-2201-08	0.597	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.990000	-4.037210	1	0.140000	NM_194302		0	11	10	0	263	262	0		1			0	0	70	0	0	0.998361	0	0	0	0	0	0	11	263
SCN5A	6331	broad.mit.edu	37	3	38591931	38591931	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr3:38591931C>G	ENST00000333535.4	-	28	6081	c.5932G>C	c.(5932-5934)Gac>Cac	p.D1978H	SCN5A_ENST00000451551.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000423572.2_Missense_Mutation_p.D1977H|SCN5A_ENST00000443581.1_Missense_Mutation_p.D1977H|SCN5A_ENST00000425664.1_Missense_Mutation_p.D1960H|SCN5A_ENST00000450102.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000414099.2_Missense_Mutation_p.D1960H|SCN5A_ENST00000449557.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000455624.2_Missense_Mutation_p.D1945H|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000413689.1_Missense_Mutation_p.D1978H			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1978					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGACACTGTCATAGGAGGGT	0.602																																						ENST00000333535.4	0.680000	0.170000	0.530000	0.260000	0.370000	0.401396	0.370000	0.360000																										0				107						c.(5932-5934)Gac>Cac		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						42.0	47.0	45.0					3																	38591931		2022	4172	6194	SO:0001583	missense	6331	5	120936	16				g.chr3:38591931C>G	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5932G>C	chr3.hg19:g.38591931C>G	ENSP00000328968:p.Asp1978His	1					SCN5A_ENST00000450102.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000451551.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000413689.1_Missense_Mutation_p.D1978H|SCN5A_ENST00000423572.2_Missense_Mutation_p.D1977H|SCN5A_ENST00000455624.2_Missense_Mutation_p.D1945H|SCN5A_ENST00000443581.1_Missense_Mutation_p.D1977H|SCN5A_ENST00000425664.1_Missense_Mutation_p.D1960H|SCN5A_ENST00000449557.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000414099.2_Missense_Mutation_p.D1960H	p.D1978H			0	1	1	1.883446	Q14524	SCN5A_HUMAN		28	6081	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	0	1	hg19	c.5932G>C	CCDS46796.1	0	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565807	0.65651	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96856	-4.02;-4.03;-4.03;-4.08;-4.03;-4.02;-4.03;-4.15;-4.08;-4.08	4.95	4.95	0.65309	4.95	4.95	0.65309	.	0.058474	0.64402	D	0.000003	D	0.95529	0.8547	N	0.08118	0	0.54753	D	0.999986	D;D;P;D;D;D	0.89917	0.959;1.0;0.64;0.999;0.958;1.0	P;D;B;D;P;D	0.85130	0.496;0.997;0.387;0.973;0.693;0.996	D	0.97067	0.9775	10	0.62326	D	0.03	.	18.3714	0.90408	0.0:1.0:0.0:0.0	.	1924;1945;1960;1978;1977;1978	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	H	1960;1977;1978;1924;1977;1960;1978;1945;1924;1924	ENSP00000398962:D1960H;ENSP00000398266:D1977H;ENSP00000410257:D1978H;ENSP00000388797:D1924H;ENSP00000397915:D1977H;ENSP00000416634:D1960H;ENSP00000328968:D1978H;ENSP00000399524:D1945H;ENSP00000403355:D1924H;ENSP00000413996:D1924H	ENSP00000328968:D1978H	D	-	1	0	0	SCN5A	38566935	38566935	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	4.781000	0.62389	2.573000	0.86826	0.655000	0.94253	GAC	0.082177		TCGA-IB-7645-01A-22D-2201-08	0.602	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	0	0	1	2	18	2	2	1	1	1	1	45	45	45	44	1	1.990000	-2.700491	1	0.140000	NM_198056		0	7	6	0	246	238	0		0			1	0	45	0	0	0.014791	0	0	0	0	0	0	7	246
PBRM1	55193	broad.mit.edu	37	3	52649473	52649473	+	Splice_Site	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr3:52649473C>T	ENST00000296302.7	-	15	1820		c.e15-1		PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CATTATAAACCTACATTCCAA	0.338			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	ENST00000296302.7	1.000000	0.650000	1.000000	0.790000	0.940000	0.911759	0.940000	1.000000				Rec	yes			Rec	yes		3	3p21	3p21	55193	Mis, N, F, S, D, O	polybromo 1				E	E			clear cell renal carcinoma, breast		0				335						c.e15-1		polybromo 1							78.0	74.0	75.0					3																	52649473		2203	4300	6503	SO:0001630	splice_region_variant	55193	0	0					g.chr3:52649473C>T	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1819-1G>A	chr3.hg19:g.52649473C>T		1					PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site				0	1	1	1.883446	Q86U86	PB1_HUMAN		15	1820	-			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	1	1	hg19			1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806869	0.50421	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.69	5.69	0.88448	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8084	0.96538	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	PBRM1	52624513	52624513	1.000000	0.71417	0.998000	0.56505	0.452000	0.32318	7.487000	0.81328	2.687000	0.91594	0.462000	0.41574	.	0.082177		TCGA-IB-7645-01A-22D-2201-08	0.338	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.990000	-2.774731	1	0.140000	NM_018165	Intron	0	22	22	0	252	248	0		1	0	1	0	0	53	690	0	0.999999	0	1	0	88	1	873	22	252
MUC20	200958	broad.mit.edu	37	3	195453211	195453211	+	Silent	SNP	C	C	T	rs373456247		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr3:195453211C>T	ENST00000447234.2	+	2	1863	c.1737C>T	c.(1735-1737)gcC>gcT	p.A579A	MUC20_ENST00000436408.1_Silent_p.A579A|MUC20_ENST00000445522.2_Silent_p.A544A|MUC20_ENST00000320736.6_Silent_p.A408A	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	579	Involved in oligomerization.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CCTCGGAAGCCGCCCTCAAGA	0.602																																						ENST00000447234.2	0.630000	0.180000	0.500000	0.270000	0.370000	0.391917	0.370000	0.360000																										0				23						c.(1735-1737)gcC>gcT		mucin 20, cell surface associated		C	,	1,4069		0,1,2034	62.0	60.0	60.0		1119,1224	-1.7	0.0	3		60	0,8398		0,0,4199	no	coding-synonymous,coding-synonymous	MUC20	NM_001098516.1,NM_152673.2	,	0,1,6233	TT,TC,CC		0.0,0.0246,0.0080	,	373/504,408/539	195453211	1,12467	2035	4199	6234	SO:0001819	synonymous_variant	200958	3	121004	31				g.chr3:195453211C>T	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1737C>T	chr3.hg19:g.195453211C>T		1					MUC20_ENST00000320736.6_Silent_p.A408A|MUC20_ENST00000445522.2_Silent_p.A544A|MUC20_ENST00000436408.1_Silent_p.A579A	p.A579A	NM_001282506.1	NP_001269435.1	1	3	4	2.491544	Q8N307	MUC20_HUMAN	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	2	1863	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Silent	SNP	ENST00000447234.2	0	1	hg19	c.1737C>T		0																																																																																								0.245614		TCGA-IB-7645-01A-22D-2201-08	0.602	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	104	1	1.990000	-8.872527	1	0.140000	NM_152673		0	10	10	0	442	438	0		1	1		0	0	104	0	0	0.996809	5.530227e-01	0	5	0	72	0	10	442
NDST3	9348	broad.mit.edu	37	4	119161830	119161830	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr4:119161830T>C	ENST00000296499.5	+	11	2673	c.2270T>C	c.(2269-2271)gTt>gCt	p.V757A		NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	757	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AGATGGCTTGTTTATTTCCCC	0.458																																						ENST00000296499.5	1.000000	0.650000	1.000000	0.830000	0.990000	0.939037	0.990000	1.000000																										0				54						c.(2269-2271)gTt>gCt		N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3							82.0	76.0	78.0					4																	119161830		2203	4300	6503	SO:0001583	missense	9348	0	0					g.chr4:119161830T>C	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.2270T>C	chr4.hg19:g.119161830T>C	ENSP00000296499:p.Val757Ala	0						p.V757A	NM_004784.2	NP_004775.1	1	2	3	2.043156	O95803	NDST3_HUMAN		11	2673	+			B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	1	1	hg19	c.2270T>C	CCDS3708.1	1	.	.	.	.	.	.	.	.	.	.	T	8.239	0.806313	0.16467	.	.	ENSG00000164100	ENST00000296499	T	0.50548	0.74	5.49	2.98	0.34508	5.49	2.98	0.34508	Sulfotransferase domain (1);	0.452871	0.23700	N	0.045428	T	0.11067	0.0270	N	0.00595	-1.35	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27673	-1.0067	10	0.09084	T	0.74	.	1.7572	0.02984	0.2575:0.2262:0.0:0.5164	.	757	O95803	NDST3_HUMAN	A	757	ENSP00000296499:V757A	ENSP00000296499:V757A	V	+	2	0	0	NDST3	119381278	119381278	0.999000	0.42202	1.000000	0.80357	0.971000	0.66376	2.840000	0.48215	2.212000	0.71576	0.533000	0.62120	GTT	0.152459		TCGA-IB-7645-01A-22D-2201-08	0.458	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	1	0	1	2	2	2	2	0	0	0	0	58	58	58	55	1	1.990000	-19.999940	1	0.140000	NM_004784		0	20	21	0	269	263	0		1			0	0	58	0	0	0.999995	0	0	0	0	0	0	20	269
TRPC3	7222	broad.mit.edu	37	4	122853995	122853995	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr4:122853995C>T	ENST00000379645.3	-	2	491	c.418G>A	c.(418-420)Gtc>Atc	p.V140I	TRPC3_ENST00000513531.1_Missense_Mutation_p.V67I|TRPC3_ENST00000264811.5_Missense_Mutation_p.V67I	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	55					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ACGCAGTTGACGTTCAGCGTC	0.637																																						ENST00000379645.3	1.000000	0.200000	0.940000	0.300000	0.450000	0.530438	0.450000	0.400000																										0				51						c.(418-420)Gtc>Atc		transient receptor potential cation channel, subfamily C, member 3							62.0	58.0	59.0					4																	122853995		2203	4300	6503	SO:0001583	missense	7222	1	121410	26				g.chr4:122853995C>T	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.418G>A	chr4.hg19:g.122853995C>T	ENSP00000368966:p.Val140Ile	0					TRPC3_ENST00000264811.5_Missense_Mutation_p.V67I|TRPC3_ENST00000513531.1_Missense_Mutation_p.V67I	p.V140I	NM_001130698.1	NP_001124170.1	1	2	3	2.043156	Q13507	TRPC3_HUMAN		2	491	-			A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	1	1	hg19	c.418G>A	CCDS47130.1	0	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344029	0.61073	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531;ENST00000502968	T;T;T;T	0.70631	-0.5;-0.5;-0.5;0.24	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	N	0.11698	0.16	0.48395	D	0.999648	B;P	0.39404	0.322;0.672	B;B	0.41466	0.131;0.358	T	0.55321	-0.8159	10	0.06236	T	0.91	-30.807	20.3932	0.98965	0.0:1.0:0.0:0.0	.	67;140	E9PCJ9;Q5G1L5	.;.	I	67;140;67;67	ENSP00000264811:V67I;ENSP00000368966:V140I;ENSP00000426899:V67I;ENSP00000422214:V67I	ENSP00000264811:V67I	V	-	1	0	0	TRPC3	123073445	123073445	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.313000	0.51935	2.824000	0.97209	0.655000	0.94253	GTC	0.152459		TCGA-IB-7645-01A-22D-2201-08	0.637	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	1.990000	-8.654845	1	0.140000	NM_003305		0	8	8	0	279	273	0		1			0	0	75	0	0	0.988704	0	0	0	0	0	0	8	279
JAKMIP1	152789	broad.mit.edu	37	4	6114531	6114531	+	Missense_Mutation	SNP	G	G	A	rs148302835	byFrequency	TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr4:6114531G>A	ENST00000282924.5	-	2	532	c.47C>T	c.(46-48)aCg>aTg	p.T16M	JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.T16M|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.T16M|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.T16M|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.T16M	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	16	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CACCGCGTCCGTCTCCATCTC	0.607													G|||	5	0.000998403	0.0038	0.0	5008	,	,		20644	0.0		0.0	False		,,,				2504	0.0					ENST00000282924.5	1.000000	0.880000	1.000000	0.990000	0.990000	0.992786	0.990000	1.000000																										0				42						c.(46-48)aCg>aTg		janus kinase and microtubule interacting protein 1		G	MET/THR,MET/THR	6,4400	9.9+/-24.2	0,6,2197	127.0	101.0	110.0		47,47	0.9	0.1	4	dbSNP_134	110	0,8600		0,0,4300	yes	missense,missense	JAKMIP1	NM_001099433.1,NM_144720.3	81,81	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	benign,benign	16/832,16/627	6114531	6,13000	2203	4300	6503	SO:0001583	missense	152789	31	121412	47				g.chr4:6114531G>A	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.47C>T	chr4.hg19:g.6114531G>A	ENSP00000282924:p.Thr16Met	0					JAKMIP1_ENST00000410077.2_Missense_Mutation_p.T16M|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.T16M|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.T16M|JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.T16M	p.T16M	NM_144720.3	NP_653321.1	1	2	3	2.043156	Q96N16	JKIP1_HUMAN		2	532	-			A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	1	1	hg19	c.47C>T	CCDS3385.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.194	0.034762	0.08101	0.001362	0.0	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.30448	1.94;1.53;1.94;1.94;1.53	3.94	0.904	0.19302	3.94	0.904	0.19302	.	0.626666	0.14992	N	0.286656	T	0.10637	0.0260	N	0.02011	-0.69	0.09310	N	1	B;B;B;B;B	0.15719	0.014;0.002;0.014;0.014;0.005	B;B;B;B;B	0.09377	0.003;0.002;0.004;0.003;0.004	T	0.27020	-1.0086	10	0.33940	T	0.23	.	7.349	0.26680	0.507:0.0:0.493:0.0	.	16;16;16;16;16	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	M	16	ENSP00000386711:T16M;ENSP00000387042:T16M;ENSP00000282924:T16M;ENSP00000386925:T16M;ENSP00000386745:T16M	ENSP00000282924:T16M	T	-	2	0	0	JAKMIP1	6165432	6165432	0.008000	0.16893	0.117000	0.21633	0.587000	0.36485	1.445000	0.35079	0.316000	0.23135	0.591000	0.81541	ACG	0.152459		TCGA-IB-7645-01A-22D-2201-08	0.607	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.990000	-20.000000	1	0.140000	NM_144720		0	31	31	0	329	326	0		1	0		0	0	79	0	0	1.000000	1.226326e-01	0	0	0	7	0	31	329
KIAA1109	84162	broad.mit.edu	37	4	123168391	123168391	+	Silent	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr4:123168391G>A	ENST00000264501.4	+	35	5764	c.5391G>A	c.(5389-5391)aaG>aaA	p.K1797K	KIAA1109_ENST00000388738.3_Silent_p.K1797K|KIAA1109_ENST00000455637.1_Silent_p.K1797K			Q2LD37	K1109_HUMAN	KIAA1109	1797					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.K1797N(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ATGCCACAAAGATGCAGCCTC	0.393																																						ENST00000264501.4	1.000000	0.260000	0.940000	0.370000	0.510000	0.574547	0.510000	0.460000																										1	Substitution - Missense(1)	p.K1797N(1)	large_intestine(1)	172						c.(5389-5391)aaG>aaA		KIAA1109							90.0	85.0	87.0					4																	123168391		1890	4125	6015	SO:0001819	synonymous_variant	84162	0	0					g.chr4:123168391G>A	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.5391G>A	chr4.hg19:g.123168391G>A		0					KIAA1109_ENST00000455637.1_Silent_p.K1797K|KIAA1109_ENST00000388738.3_Silent_p.K1797K	p.K1797K			1	2	3	2.043156	Q2LD37	K1109_HUMAN		35	5764	+			Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	1	1	hg19	c.5391G>A	CCDS43267.1	0	.	.	.	.	.	.	.	.	.	.	G	9.151	1.016388	0.19355	.	.	ENSG00000138688	ENST00000446180	.	.	.	5.77	3.8	0.43715	5.77	3.8	0.43715	.	.	.	.	.	T	0.47930	0.1472	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43245	-0.9403	4	.	.	.	.	4.272	0.10791	0.4492:0.0:0.5508:0.0	.	.	.	.	K	370	.	.	R	+	2	0	0	KIAA1109	123387841	123387841	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.004000	0.49513	1.449000	0.47699	0.585000	0.79938	AGA	0.152459		TCGA-IB-7645-01A-22D-2201-08	0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.990000	-12.036700	1	0.140000	NM_020797		0	12	12	0	361	356	0		1	1		0	0	60	0	0	0.999077	1.077092e-01	0	4	0	12	0	12	361
ICE1	23379	broad.mit.edu	37	5	5469027	5469027	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr5:5469027A>G	ENST00000296564.7	+	15	6370	c.6148A>G	c.(6148-6150)Atg>Gtg	p.M2050V		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2050					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TAATAAAGCAATGCAGTTAGT	0.363																																						ENST00000296564.7	1.000000	0.420000	0.890000	0.540000	0.690000	0.711453	0.690000	1.000000																										0				35						c.(6148-6150)Atg>Gtg									130.0	125.0	127.0					5																	5469027		1850	4088	5938	SO:0001583	missense	0	1	120808	34				g.chr5:5469027A>G																												ENST00000296564.7:c.6148A>G	chr5.hg19:g.5469027A>G	ENSP00000296564:p.Met2050Val	0						p.M2050V	NM_015325.2	NP_056140.1	1	2	3	2.004972	Q9Y2F5	ICE1_HUMAN		15	6370	+			Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	1	1	hg19	c.6148A>G	CCDS47187.1	0	.	.	.	.	.	.	.	.	.	.	A	15.69	2.909390	0.52439	.	.	ENSG00000164151	ENST00000296564	T	0.11169	2.8	5.86	5.86	0.93980	5.86	5.86	0.93980	.	.	.	.	.	T	0.12220	0.0297	L	0.54323	1.7	0.36006	D	0.837716	P	0.42078	0.77	B	0.38683	0.279	T	0.11397	-1.0589	9	0.66056	D	0.02	-3.4778	9.5036	0.39033	0.8427:0.0:0.0:0.1573	.	2050	Q9Y2F5	K0947_HUMAN	V	2050	ENSP00000296564:M2050V	ENSP00000296564:M2050V	M	+	1	0	0	KIAA0947	5522027	5522027	0.998000	0.40836	0.931000	0.37212	0.985000	0.73830	4.050000	0.57404	2.244000	0.73946	0.528000	0.53228	ATG	0.144789		TCGA-IB-7645-01A-22D-2201-08	0.363	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.990000	-19.666210	1	0.140000			0	19	19	0	387	384	1		1	1		0	0	68	0	0	0.999991	7.996910e-01	0	13	0	50	0	19	387
C7	730	broad.mit.edu	37	5	40947725	40947725	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr5:40947725G>A	ENST00000313164.9	+	8	1119	c.760G>A	c.(760-762)Gag>Aag	p.E254K		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	254	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				GCTGGTTGTTGAGAACACTGT	0.408																																						ENST00000313164.9	1.000000	0.250000	0.940000	0.410000	0.620000	0.649246	0.620000	1.000000																										0										c.(760-762)Gag>Aag		complement component 7							57.0	55.0	56.0					5																	40947725		1851	4102	5953	SO:0001583	missense	730	0	0					g.chr5:40947725G>A	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.760G>A	chr5.hg19:g.40947725G>A	ENSP00000322061:p.Glu254Lys	0						p.E254K	NM_000587.2	NP_000578.2	1	2	3	2.004972	P10643	CO7_HUMAN		8	1119	+		Ovarian(839;0.0112)	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	0	1	hg19	c.760G>A	CCDS47201.1	0	.	.	.	.	.	.	.	.	.	.	G	0.158	-1.083866	0.01888	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	D	0.81821	-1.54	5.9	4.05	0.47172	5.9	4.05	0.47172	Membrane attack complex component/perforin (MACPF) domain (3);	0.235442	0.44483	D	0.000452	T	0.50480	0.1618	N	0.01464	-0.85	0.25030	N	0.991275	B	0.10296	0.003	B	0.15052	0.012	T	0.39272	-0.9622	10	0.02654	T	1	-10.741	10.8024	0.46495	0.1164:0.5032:0.3804:0.0	.	254	P10643	CO7_HUMAN	K	254	ENSP00000322061:E254K	ENSP00000322061:E254K	E	+	1	0	0	C7	40983482	40983482	1.000000	0.71417	0.982000	0.44146	0.213000	0.24496	1.445000	0.35079	1.452000	0.47756	-0.219000	0.12488	GAG	0.144789		TCGA-IB-7645-01A-22D-2201-08	0.408	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1	0	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.990000	-3.098626	1	0.140000			0	6	6	0	144	142	0		1	0		0	0	22	0	0	0.964486	9.999865e-01	0	0	0	821	0	6	144
SVOPL	136306	broad.mit.edu	37	7	138341226	138341226	+	Silent	SNP	C	C	T	rs371993600		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr7:138341226C>T	ENST00000419765.3	-	6	534	c.501G>A	c.(499-501)acG>acA	p.T167T	SVOPL_ENST00000421622.1_Intron|SVOPL_ENST00000436657.1_Silent_p.T15T|SVOPL_ENST00000288513.5_Silent_p.T15T	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	167						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						CTCGGTATTTCGTGGGCAAAA	0.353																																						ENST00000419765.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				19						c.(499-501)acG>acA		SVOP-like		C	,	1,4405	2.1+/-5.4	0,1,2202	136.0	125.0	129.0		501,45	-6.6	1.0	7		129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SVOPL	NM_001139456.1,NM_174959.2	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	167/493,15/341	138341226	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	136306	4	121412	43				g.chr7:138341226C>T	BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.501G>A	chr7.hg19:g.138341226C>T		1					SVOPL_ENST00000436657.1_Silent_p.T15T|SVOPL_ENST00000288513.5_Silent_p.T15T|SVOPL_ENST00000421622.1_Intron	p.T167T	NM_001139456.1	NP_001132928.1	2	2	4	2.152758	Q8N434	SVOPL_HUMAN		6	534	-				Silent	SNP	ENST00000419765.3	1	1	hg19	c.501G>A	CCDS47721.1	1																																																																																								0.203556		TCGA-IB-7645-01A-22D-2201-08	0.353	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342092.4	1	0	1	2	17	2	2	1	1	1	1	136	136	136	135	1	1.990000	-3.221883	1	0.140000	NM_174959		0	71	70	0	591	585	1		1			1	0	136	0	0	1.000000	0	0	0	0	0	0	71	591
MRPS24	64951	broad.mit.edu	37	7	43909090	43909090	+	Missense_Mutation	SNP	G	G	A	rs368968590		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr7:43909090G>A	ENST00000317534.5	-	1	66	c.5C>T	c.(4-6)gCg>gTg	p.A2V	MRPS24_ENST00000467084.1_Intron|URGCP-MRPS24_ENST00000603700.1_Intron	NM_032014.2	NP_114403.1	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24	2					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5						CACGGAGGCCGCCATCTTGGG	0.697																																						ENST00000317534.5	1.000000	0.520000	1.000000	0.990000	0.990000	0.958449	0.990000	1.000000																										0				5						c.(4-6)gCg>gTg		mitochondrial ribosomal protein S24		G	,VAL/ALA	1,4233		0,1,2116	6.0	7.0	7.0		,5	3.8	0.5	7		7	0,8342		0,0,4171	no	intron,missense	MRPS24,URGCP-MRPS24	NM_001204871.1,NM_032014.2	,64	0,1,6287	AA,AG,GG		0.0,0.0236,0.0080	,benign	,2/168	43909090	1,12575	2117	4171	6288	SO:0001583	missense	64951	6	116506	33				g.chr7:43909090G>A	AB061207	CCDS5473.1	7p14	2012-09-13			ENSG00000062582	ENSG00000062582		"""Mitochondrial ribosomal proteins / small subunits"""	14510	protein-coding gene	gene with protein product		611986				8127713, 11279123	Standard	NM_032014		Approved	MRP-S24, HSPC335	uc003tit.1	Q96EL2	OTTHUMG00000023175	ENST00000317534.5:c.5C>T	chr7.hg19:g.43909090G>A	ENSP00000318158:p.Ala2Val	1					MRPS24_ENST00000467084.1_Intron|URGCP-MRPS24_ENST00000603700.1_Intron	p.A2V	NM_032014.2	NP_114403.1	2	2	4	2.152758	Q96EL2	RT24_HUMAN		1	66	-			A4D1U9|P82668|Q96Q23|Q9P047	Missense_Mutation	SNP	ENST00000317534.5	0	1	hg19	c.5C>T	CCDS5473.1	1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633037	0.29068	2.36E-4	0.0	ENSG00000062582	ENST00000317534	T	0.46451	0.87	4.7	3.81	0.43845	4.7	3.81	0.43845	.	0.564481	0.18229	N	0.147626	T	0.33760	0.0874	L	0.41961	1.31	0.30449	N	0.77543	B	0.15719	0.014	B	0.12156	0.007	T	0.28870	-1.0030	10	0.45353	T	0.12	.	8.895	0.35458	0.106:0.0:0.894:0.0	.	2	Q96EL2	RT24_HUMAN	V	2	ENSP00000318158:A2V	ENSP00000318158:A2V	A	-	2	0	0	MRPS24	43875615	43875615	1.000000	0.71417	0.496000	0.27539	0.158000	0.22134	2.644000	0.46613	0.938000	0.37419	0.655000	0.94253	GCG	0.203556		TCGA-IB-7645-01A-22D-2201-08	0.697	MRPS24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250949.1	0	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.990000	-8.279320	1	0.140000	NM_032014		0	3	3	0	28	26	0		1			0	0	10	0	0	0.790858	0	0	0	0	0	0	3	28
PKD1L1	168507	broad.mit.edu	37	7	47944116	47944116	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr7:47944116G>A	ENST00000289672.2	-	12	1840	c.1790C>T	c.(1789-1791)aCg>aTg	p.T597M		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	597	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGAGGGGGACGTGAGCCGATT	0.542																																						ENST00000289672.2	1.000000	0.320000	1.000000	0.450000	0.640000	0.691713	0.640000	0.570000																									BBS9/PKD1L1(2)	0				142						c.(1789-1791)aCg>aTg		polycystic kidney disease 1 like 1							105.0	80.0	88.0					7																	47944116		2203	4300	6503	SO:0001583	missense	168507	0	0					g.chr7:47944116G>A	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1790C>T	chr7.hg19:g.47944116G>A	ENSP00000289672:p.Thr597Met	1						p.T597M	NM_138295.3	NP_612152.1	2	2	4	2.152758	Q8TDX9	PK1L1_HUMAN		12	1840	-			Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	1	1	hg19	c.1790C>T	CCDS34633.1	0	.	.	.	.	.	.	.	.	.	.	G	3.658	-0.070119	0.07228	.	.	ENSG00000158683	ENST00000289672	T	0.68181	-0.31	4.9	-3.89	0.04193	4.9	-3.89	0.04193	PKD/Chitinase domain (1);PKD domain (2);	3.200300	0.00966	N	0.003172	T	0.54447	0.1859	L	0.29908	0.895	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.41413	-0.9510	10	0.32370	T	0.25	0.1517	10.9535	0.47343	0.5301:0.0:0.4699:0.0	.	597	Q8TDX9	PK1L1_HUMAN	M	597	ENSP00000289672:T597M	ENSP00000289672:T597M	T	-	2	0	0	PKD1L1	47910641	47910641	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-0.434000	0.06939	-0.854000	0.04131	-1.177000	0.01723	ACG	0.203556		TCGA-IB-7645-01A-22D-2201-08	0.542	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	0	0	1	2	2	2	2	0	0	0	0	65	65	65	64	1	1.990000	-12.570700	1	0.140000	NM_138295		0	12	12	0	318	312	0		1	0		0	0	65	0	0	0.999059	0	0	0	0	1	0	12	318
TRPV6	55503	broad.mit.edu	37	7	142569526	142569526	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr7:142569526C>A	ENST00000359396.3	-	15	2357	c.2112G>T	c.(2110-2112)agG>agT	p.R704S		NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	704	Interaction with calmodulin.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					GCAGGTCTCTCCTCAGGGTCC	0.577																																						ENST00000359396.3	1.000000	0.780000	1.000000	0.950000	0.990000	0.976903	0.990000	1.000000																										0				42						c.(2110-2112)agG>agT		transient receptor potential cation channel, subfamily V, member 6							70.0	70.0	70.0					7																	142569526		2203	4300	6503	SO:0001583	missense	55503	0	0					g.chr7:142569526C>A	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.2112G>T	chr7.hg19:g.142569526C>A	ENSP00000352358:p.Arg704Ser	1						p.R704S	NM_018646.3	NP_061116	2	2	4	2.152758	Q9H1D0	TRPV6_HUMAN		15	2357	-	Melanoma(164;0.059)		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	1	1	hg19	c.2112G>T	CCDS5874.1	1	.	.	.	.	.	.	.	.	.	.	C	10.40	1.340406	0.24339	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	T	0.76968	-1.06	5.3	1.03	0.20045	5.3	1.03	0.20045	.	0.665359	0.16004	N	0.234172	T	0.61286	0.2335	L	0.36672	1.1	0.09310	N	1	B	0.20887	0.049	B	0.16722	0.016	T	0.40831	-0.9542	10	0.18710	T	0.47	-7.6958	4.8576	0.13566	0.142:0.5057:0.2751:0.0771	.	704	Q9H1D0	TRPV6_HUMAN	S	704;536	ENSP00000352358:R704S	ENSP00000310825:R536S	R	-	3	2	2	TRPV6	142279648	142279648	0.000000	0.05858	0.000000	0.03702	0.654000	0.38779	0.010000	0.13242	0.183000	0.20059	0.561000	0.74099	AGG	0.203556		TCGA-IB-7645-01A-22D-2201-08	0.577	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	1	0	1	2	2	2	2	0	0	0	0	105	105	105	102	1	1.990000	-2.966612	1	0.140000	NM_014274		0	31	31	0	407	402	0		1	0		0	0	105	0	0	1.000000	2.439050e-01	0	0	0	13	0	31	407
PKHD1L1	93035	broad.mit.edu	37	8	110457259	110457259	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr8:110457259C>A	ENST00000378402.5	+	38	5265	c.5161C>A	c.(5161-5163)Ctt>Att	p.L1721I		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1721	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGCCCAACAGCTTGTGGATGT	0.438										HNSCC(38;0.096)																												ENST00000378402.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				263						c.(5161-5163)Ctt>Att		polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1							200.0	192.0	195.0					8																	110457259		1918	4133	6051	SO:0001583	missense	93035	0	0					g.chr8:110457259C>A	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5161C>A	chr8.hg19:g.110457259C>A	ENSP00000367655:p.Leu1721Ile	0	HNSCC(38;0.096)					p.L1721I	NM_177531.4	NP_803875.2	1	2	3	2.031294	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)	38	5265	+			Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	1	1	hg19	c.5161C>A	CCDS47911.1	1	.	.	.	.	.	.	.	.	.	.	C	7.230	0.599079	0.13939	.	.	ENSG00000205038	ENST00000378402	T	0.78003	-1.14	6.17	5.27	0.74061	6.17	5.27	0.74061	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.524512	0.19441	N	0.114191	T	0.74816	0.3766	L	0.54323	1.7	0.09310	N	1	P	0.35527	0.507	B	0.40602	0.334	T	0.64647	-0.6358	10	0.22706	T	0.39	.	12.7395	0.57243	0.2809:0.7191:0.0:0.0	.	1721	Q86WI1	PKHL1_HUMAN	I	1721	ENSP00000367655:L1721I	ENSP00000367655:L1721I	L	+	1	0	0	PKHD1L1	110526435	110526435	0.000000	0.05858	0.659000	0.29680	0.463000	0.32649	-0.229000	0.09098	2.941000	0.99782	0.655000	0.94253	CTT	0.172997		TCGA-IB-7645-01A-22D-2201-08	0.438	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	0	0	1	2	2	2	2	0	0	0	0	200	200	200	200	1	1.990000	-20.000000	1	0.140000	NM_177531		0	124	122	0	884	876	1		1			0	0	200	0	0	1.000000	0	0	0	0	0	0	124	884
CA8	767	broad.mit.edu	37	8	61139438	61139438	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr8:61139438C>G	ENST00000317995.4	-	5	834	c.570G>C	c.(568-570)caG>caC	p.Q190H	CA8_ENST00000528666.1_5'UTR	NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	190					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	TTACCTTATACTGAATATCTT	0.393																																						ENST00000317995.4	1.000000	0.400000	1.000000	0.570000	0.810000	0.796770	0.810000	1.000000																										0				16						c.(568-570)caG>caC		carbonic anhydrase VIII	Zonisamide(DB00909)						58.0	60.0	59.0					8																	61139438		2203	4300	6503	SO:0001583	missense	767	0	0					g.chr8:61139438C>G	L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.570G>C	chr8.hg19:g.61139438C>G	ENSP00000314407:p.Gln190His	0					CA8_ENST00000528666.1_5'UTR	p.Q190H	NM_004056.4	NP_004047.3	1	2	3	2.031294	P35219	CAH8_HUMAN		5	834	-		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)	A8K0A5|B3KQZ7|Q32MY2	Missense_Mutation	SNP	ENST00000317995.4	1	1	hg19	c.570G>C	CCDS6174.1	0	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740653	0.49045	.	.	ENSG00000178538	ENST00000317995	T	0.68331	-0.32	5.83	2.55	0.30701	5.83	2.55	0.30701	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.171104	0.53938	D	0.000047	T	0.56746	0.2006	M	0.66297	2.02	0.48830	D	0.999712	P	0.37525	0.598	B	0.32022	0.139	T	0.54186	-0.8331	10	0.87932	D	0	.	5.3935	0.16257	0.1324:0.6131:0.0:0.2545	.	190	P35219	CAH8_HUMAN	H	190	ENSP00000314407:Q190H	ENSP00000314407:Q190H	Q	-	3	2	2	CA8	61301992	61301992	0.975000	0.34042	1.000000	0.80357	0.997000	0.91878	0.168000	0.16622	0.195000	0.20347	0.650000	0.86243	CAG	0.172997		TCGA-IB-7645-01A-22D-2201-08	0.393	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.990000	-13.675850	1	0.140000			0	11	11	0	220	218	0		1	1		0	0	34	0	0	0.998375	1.820623e-01	0	2	0	13	0	11	220
PSKH2	85481	broad.mit.edu	37	8	87060706	87060706	+	Silent	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr8:87060706C>T	ENST00000276616.2	-	3	1217	c.1143G>A	c.(1141-1143)ctG>ctA	p.L381L		NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	381							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			AAAGCGCAGACAGTGGCGATT	0.433																																						ENST00000276616.2	1.000000	0.110000	1.000000	0.180000	0.270000	0.433277	0.270000	0.230000																										0				47						c.(1141-1143)ctG>ctA		protein serine kinase H2							99.0	100.0	99.0					8																	87060706		2203	4300	6503	SO:0001819	synonymous_variant	85481	0	0					g.chr8:87060706C>T	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.1143G>A	chr8.hg19:g.87060706C>T		0						p.L381L	NM_033126.1	NP_149117.1	1	2	3	2.031294	Q96QS6	KPSH2_HUMAN	STAD - Stomach adenocarcinoma(118;0.129)	3	1217	-			A0AV22	Silent	SNP	ENST00000276616.2	0	1	hg19	c.1143G>A	CCDS6240.1	0																																																																																								0.172997		TCGA-IB-7645-01A-22D-2201-08	0.433	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	0	0	0	2	21	2	2	1	1	1	1	79	79	79	79	1	1.990000	-6.710205	1	0.140000	NM_033126		0	8	8	0	506	498	0		0			1	0	79	0	0	0.009778	0	0	0	0	0	0	8	506
GSDMC	56169	broad.mit.edu	37	8	130789715	130789715	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr8:130789715C>T	ENST00000276708.4	-	2	1000	c.119G>A	c.(118-120)cGa>cAa	p.R40Q		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	40						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						CTTCTTCTTTCGTAATATAAC	0.398																																						ENST00000276708.4	1.000000	0.570000	1.000000	0.690000	0.850000	0.853224	0.850000	1.000000																										0				26						c.(118-120)cGa>cAa		gasdermin C							153.0	141.0	145.0					8																	130789715		2203	4300	6503	SO:0001583	missense	56169	4	121412	39				g.chr8:130789715C>T	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.119G>A	chr8.hg19:g.130789715C>T	ENSP00000276708:p.Arg40Gln	0						p.R40Q	NM_031415.2	NP_113603.1	1	2	3	2.031294	Q9BYG8	GSDMC_HUMAN		2	1000	-			Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	1	1	hg19	c.119G>A	CCDS6360.1	1	.	.	.	.	.	.	.	.	.	.	C	5.027	0.190676	0.09547	.	.	ENSG00000147697	ENST00000276708	T	0.23348	1.91	3.9	-0.272	0.12919	3.9	-0.272	0.12919	.	0.803958	0.10809	N	0.631858	T	0.07954	0.0199	N	0.11255	0.115	0.09310	N	1	P	0.35684	0.515	B	0.22753	0.041	T	0.26643	-1.0097	10	0.12430	T	0.62	.	3.0092	0.06039	0.1923:0.4599:0.0:0.3478	.	40	Q9BYG8	GSDMC_HUMAN	Q	40	ENSP00000276708:R40Q	ENSP00000276708:R40Q	R	-	2	0	0	GSDMC	130858897	130858897	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.989000	0.01480	-0.177000	0.10690	-0.424000	0.05967	CGA	0.172997		TCGA-IB-7645-01A-22D-2201-08	0.398	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1	1	0	1	2	2	2	2	0	0	0	0	131	131	131	131	1	1.990000	-6.257532	1	0.140000			0	34	32	0	598	590	0		1	0		0	0	131	0	0	1.000000	3.129735e-03	0	0	0	2	0	34	598
NTRK2	4915	broad.mit.edu	37	9	87635240	87635240	+	Silent	SNP	C	C	A			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chr9:87635240C>A	ENST00000323115.4	+	16	2597	c.2244C>A	c.(2242-2244)acC>acA	p.T748T	NTRK2_ENST00000376214.1_Silent_p.T764T|NTRK2_ENST00000376213.1_Silent_p.T748T|NTRK2_ENST00000277120.3_Silent_p.T764T			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	748	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	AGATTTTCACCTATGGCAAAC	0.557										TSP Lung(25;0.17)																												ENST00000323115.4	0.760000	0.370000	0.660000	0.450000	0.540000	0.561078	0.540000	0.540000																										0				46						c.(2242-2244)acC>acA		neurotrophic tyrosine kinase, receptor, type 2	Amitriptyline(DB00321)						129.0	118.0	122.0					9																	87635240		2203	4300	6503	SO:0001819	synonymous_variant	4915	0	0					g.chr9:87635240C>A	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.2244C>A	chr9.hg19:g.87635240C>A		1	TSP Lung(25;0.17)				NTRK2_ENST00000376214.1_Silent_p.T764T|NTRK2_ENST00000277120.3_Silent_p.T764T|NTRK2_ENST00000376213.1_Silent_p.T748T	p.T748T			0	1	1	1.886600	Q16620	NTRK2_HUMAN		16	2597	+			B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Silent	SNP	ENST00000323115.4	1	1	hg19	c.2244C>A	CCDS35050.1	0																																																																																								0.081491		TCGA-IB-7645-01A-22D-2201-08	0.557	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1	1	0	1	2	2	2	2	0	0	0	0	156	156	156	155	1	1.990000	-2.630835	1	0.140000			0	27	27	0	627	620	0		1	0		0	0	156	0	0	1.000000	0	0	0	0	1	0	27	627
FAM122C	159091	broad.mit.edu	37	X	133948871	133948871	+	Missense_Mutation	SNP	C	C	T	rs201102053		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chrX:133948871C>T	ENST00000370784.4	+	2	587	c.181C>T	c.(181-183)Cgc>Tgc	p.R61C	FAM122C_ENST00000445123.1_5'UTR|FAM122C_ENST00000414371.2_Missense_Mutation_p.R97C|FAM122C_ENST00000370785.3_Missense_Mutation_p.R61C	NM_001170779.1	NP_001164250.1	Q6P4D5	F222C_HUMAN	family with sequence similarity 122C	61								p.R61C(2)		endometrium(2)|kidney(1)|lung(2)	5	Acute lymphoblastic leukemia(192;0.000127)					TAGGAATCGACGCTCTCTGGT	0.388													C|||	1	0.000264901	0.0	0.0014	3775	,	,		12560	0.0		0.0	False		,,,				2504	0.0					ENST00000370784.4	0.440000	0.140000	0.360000	0.200000	0.270000	0.284295	0.270000	0.260000																										2	Substitution - Missense(2)	p.R61C(2)	endometrium(2)	5						c.(181-183)Cgc>Tgc		family with sequence similarity 122C		C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,3835		0,0,1632,571	113.0	110.0	111.0		181,289,181,181,181,181	4.5	0.0	X		111	1,6727		0,1,2427,1872	no	missense,missense,missense,missense,missense,missense	FAM122C	NM_001170779.1,NM_001170780.1,NM_001170782.1,NM_001170783.1,NM_001170784.1,NM_138819.3	180,180,180,180,180,180	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	61/196,97/116,61/97,61/80,61/80,61/153	133948871	1,10562	2203	4300	6503	SO:0001583	missense	159091	1	121406	38				g.chrX:133948871C>T	BC017868	CCDS14644.1, CCDS55500.1, CCDS55501.1, CCDS76028.1	Xq26.3	2008-02-05	2006-07-11		ENSG00000156500	ENSG00000156500			25202	protein-coding gene	gene with protein product						12477932	Standard	NM_138819		Approved	RP3-473B4.1	uc004exz.2	Q6P4D5	OTTHUMG00000022716	ENST00000370784.4:c.181C>T	chrX.hg19:g.133948871C>T	ENSP00000359820:p.Arg61Cys						FAM122C_ENST00000414371.2_Missense_Mutation_p.R97C|FAM122C_ENST00000445123.1_5'UTR|FAM122C_ENST00000370785.3_Missense_Mutation_p.R61C	p.R61C	NM_001170779.1	NP_001164250.1	0	1	1		Q6P4D5	F222C_HUMAN		2	587	+	Acute lymphoblastic leukemia(192;0.000127)		F5H036|Q8WVK9	Missense_Mutation	SNP	ENST00000370784.4	1	1	hg19	c.181C>T	CCDS55501.1	0	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523793	0.27299	0.0	1.49E-4	ENSG00000156500	ENST00000414371;ENST00000370784;ENST00000370785	T;T;T	0.55588	0.51;0.51;0.51	5.37	4.5	0.54988	5.37	4.5	0.54988	.	0.409996	0.29480	N	0.012036	T	0.26340	0.0643	N	0.08118	0	0.22571	N	0.998978	B;P;P;P	0.38048	0.386;0.616;0.616;0.616	B;B;B;B	0.19666	0.016;0.016;0.016;0.026	T	0.13899	-1.0492	10	0.66056	D	0.02	-9.8706	10.5203	0.44914	0.1931:0.8069:0.0:0.0	.	97;61;61;61	F5H036;Q6P4D5;Q6P4D5-2;Q6P187	.;F222C_HUMAN;.;.	C	97;61;61	ENSP00000402477:R97C;ENSP00000359820:R61C;ENSP00000359821:R61C	ENSP00000359820:R61C	R	+	1	0	0	FAM122C	133776537	133776537	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.685000	0.25378	1.031000	0.39867	0.579000	0.79373	CGC	0.140000		TCGA-IB-7645-01A-22D-2201-08	0.388	FAM122C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	1.990000	-3.039538	1	0.140000	NM_138819		0	12	12	0	633	620	0		1	0		0	0	106	0	0	0.999008	3.289173e-02	0	0	0	14	0	12	633
FAM9A	171482	broad.mit.edu	37	X	8763195	8763195	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chrX:8763195C>T	ENST00000543214.1	-	7	890	c.755G>A	c.(754-756)gGa>gAa	p.G252E	FAM9A_ENST00000381003.3_Missense_Mutation_p.G252E	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	252	Glu-rich.|Poly-Gly.					nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				tcctcctcctccttcttctcc	0.463																																						ENST00000543214.1	1.000000	0.330000	1.000000	0.580000	0.930000	0.835612	0.930000	1.000000																										0				18						c.(754-756)gGa>gAa		family with sequence similarity 9, member A							42.0	36.0	38.0					X																	8763195		2193	4278	6471	SO:0001583	missense	171482	0	0					g.chrX:8763195C>T		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.755G>A	chrX.hg19:g.8763195C>T	ENSP00000440163:p.Gly252Glu						FAM9A_ENST00000381003.3_Missense_Mutation_p.G252E	p.G252E	NM_001171186.1	NP_001164657.1	0	1	1		Q8IZU1	FAM9A_HUMAN		7	890	-		Hepatocellular(5;0.219)	B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	0	1	hg19	c.755G>A	CCDS14131.1	1	.	.	.	.	.	.	.	.	.	.	t	0	-2.786172	0.00078	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.507	-1.01	0.10169	0.507	-1.01	0.10169	.	.	.	.	.	T	0.15046	0.0363	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19160	-1.0314	7	0.87932	D	0	.	.	.	.	.	252	Q8IZU1	FAM9A_HUMAN	E	252	.	ENSP00000370391:G252E	G	-	2	0	0	FAM9A	8723195	8723195	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-1.395000	0.02516	-1.592000	0.01619	-1.314000	0.01303	GGA	0.140000		TCGA-IB-7645-01A-22D-2201-08	0.463	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	0	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	1.990000	-3.205564	1	0.140000	NM_174951		0	4	4	0	58	57	0		1			0	0	11	0	0	0.888768	0	0	0	0	0	0	4	58
RS1	6247	broad.mit.edu	37	X	18674869	18674869	+	Missense_Mutation	SNP	C	C	T	rs146477940	byFrequency	TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chrX:18674869C>T	ENST00000379984.3	-	3	128	c.88G>A	c.(88-90)Gag>Aag	p.E30K		NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	30					adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					CAGGGGTCCTCGCCTTCATCC	0.557																																						ENST00000379984.3	1.000000	0.660000	1.000000	0.780000	0.910000	0.899801	0.910000	1.000000																										0				15						c.(88-90)Gag>Aag		retinoschisin 1		C	LYS/GLU	1,3834		0,1,0,1631,571	150.0	114.0	126.0		88	5.2	1.0	X	dbSNP_134	126	1,6727		0,0,1,2428,1871	no	missense	RS1	NM_000330.3	56	0,1,1,4059,2442	TT,TC,T,CC,C		0.0149,0.0261,0.0189	benign	30/225	18674869	2,10561	2203	4300	6503	SO:0001583	missense	6247	13	121412	46				g.chrX:18674869C>T	AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.88G>A	chrX.hg19:g.18674869C>T	ENSP00000369320:p.Glu30Lys							p.E30K	NM_000330.3	NP_000321.1	0	1	1		O15537	XLRS1_HUMAN		3	128	-	Hepatocellular(33;0.183)		Q0QD39	Missense_Mutation	SNP	ENST00000379984.3	1	1	hg19	c.88G>A	CCDS14187.1	1	.	.	.	.	.	.	.	.	.	.	C	9.345	1.064013	0.20067	2.61E-4	1.49E-4	ENSG00000102104	ENST00000379984	D	0.98249	-4.82	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.496244	0.22178	N	0.063545	D	0.94381	0.8193	L	0.46157	1.445	0.26249	N	0.978759	B	0.31040	0.305	B	0.19148	0.024	D	0.85724	0.1327	10	0.06625	T	0.88	.	8.4044	0.32605	0.1599:0.6651:0.175:0.0	.	30	O15537	XLRS1_HUMAN	K	30	ENSP00000369320:E30K	ENSP00000369320:E30K	E	-	1	0	0	RS1	18584790	18584790	0.808000	0.29022	0.995000	0.50966	0.113000	0.19764	1.244000	0.32778	2.264000	0.75181	0.600000	0.82982	GAG	0.140000		TCGA-IB-7645-01A-22D-2201-08	0.557	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055949.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	1.990000	-2.774726	1	0.140000			0	39	39	0	568	565	0		1			0	0	132	0	0	1.000000	0	0	0	0	0	0	39	568
P2RY4	5030	broad.mit.edu	37	X	69478844	69478844	+	Missense_Mutation	SNP	C	C	T	rs201727833		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chrX:69478844C>T	ENST00000374519.2	-	1	810	c.631G>A	c.(631-633)Gtg>Atg	p.V211M		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	211					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						AGGCAGGGCACGCCAAAGAGC	0.587													C|||	1	0.000264901	0.0	0.0	3775	,	,		15288	0.0		0.001	False		,,,				2504	0.0					ENST00000374519.2	1.000000	0.290000	0.850000	0.430000	0.610000	0.640619	0.610000	1.000000																										0				18						c.(631-633)Gtg>Atg		pyrimidinergic receptor P2Y, G-protein coupled, 4							79.0	71.0	74.0					X																	69478844		2203	4300	6503	SO:0001583	missense	5030	6	121410	36				g.chrX:69478844C>T	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.631G>A	chrX.hg19:g.69478844C>T	ENSP00000363643:p.Val211Met							p.V211M	NM_002565.3	NP_002556.1	0	1	1		P51582	P2RY4_HUMAN		1	810	-			Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	ENST00000374519.2	1	1	hg19	c.631G>A	CCDS14398.1	0	1	6.027727546714888E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.92	2.081633	0.36758	.	.	ENSG00000186912	ENST00000374519	T	0.26373	1.74	4.43	-1.97	0.07503	4.43	-1.97	0.07503	GPCR, rhodopsin-like superfamily (1);	0.845492	0.10248	U	0.697532	T	0.20455	0.0492	L	0.38953	1.18	0.09310	N	1	P	0.47106	0.89	P	0.49421	0.61	T	0.11567	-1.0582	10	0.44086	T	0.13	.	0.2633	0.00221	0.2575:0.2715:0.2178:0.2532	.	211	P51582	P2RY4_HUMAN	M	211	ENSP00000363643:V211M	ENSP00000363643:V211M	V	-	1	0	0	P2RY4	69395569	69395569	0.000000	0.05858	0.069000	0.20011	0.928000	0.56348	-0.525000	0.06214	-0.351000	0.08249	-0.239000	0.12128	GTG	0.140000		TCGA-IB-7645-01A-22D-2201-08	0.587	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	1	0	1	2	2	2	2	0	0	0	0	53	53	53	43	1	1.990000	-10.573020	1	0.140000	NM_002565		0	8	8	0	182	152	0		1			0	0	53	0	0	0.980037	0	0	0	0	0	0	8	182
ATP2B3	492	broad.mit.edu	37	X	152807149	152807149	+	Silent	SNP	C	C	T	rs200024105		TCGA-IB-7645-01A-22D-2201-08	TCGA-IB-7645-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b74b488-3cd3-4671-96b6-80e55d4f6d42	ff33181b-4653-4048-b933-5153a016c9c5	g.chrX:152807149C>T	ENST00000349466.2	+	4	755	c.429C>T	c.(427-429)ggC>ggT	p.G143G	ATP2B3_ENST00000370186.1_Silent_p.G143G|ATP2B3_ENST00000370181.2_Silent_p.G143G|ATP2B3_ENST00000263519.4_Silent_p.G143G|ATP2B3_ENST00000393842.1_Silent_p.G143G|ATP2B3_ENST00000359149.3_Silent_p.G143G			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	143					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGTCGGGAGGCGCAGAAGATG	0.607																																						ENST00000349466.2	1.000000	0.480000	0.920000	0.600000	0.750000	0.762548	0.750000	1.000000																										0				50						c.(427-429)ggC>ggT		ATPase, Ca++ transporting, plasma membrane 3							83.0	67.0	73.0					X																	152807149		2203	4300	6503	SO:0001819	synonymous_variant	492	2	121408	33				g.chrX:152807149C>T	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.429C>T	chrX.hg19:g.152807149C>T							ATP2B3_ENST00000263519.4_Silent_p.G143G|ATP2B3_ENST00000370181.2_Silent_p.G143G|ATP2B3_ENST00000370186.1_Silent_p.G143G|ATP2B3_ENST00000359149.3_Silent_p.G143G|ATP2B3_ENST00000393842.1_Silent_p.G143G	p.G143G			0	1	1		Q16720	AT2B3_HUMAN		4	755	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	1	1	hg19	c.429C>T	CCDS35440.1	0																																																																																								0.140000		TCGA-IB-7645-01A-22D-2201-08	0.607	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	74	1	1.990000	-19.997570	1	0.140000	NM_021949		0	21	21	0	379	374	0		1			0	0	76	0	0	0.999997	0	0	0	0	0	0	21	379
