#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
OSBPL1A	114876	broad.mit.edu	37	18	21745087	21745087	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr18:21745087delC	ENST00000319481.3	-	27	2898	c.2692delG	c.(2692-2694)gaafs	p.E898fs	RP11-799B12.4_ENST00000583267.1_lincRNA|OSBPL1A_ENST00000357041.4_Frame_Shift_Del_p.E516fs|OSBPL1A_ENST00000399443.3_Frame_Shift_Del_p.E385fs	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	898					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CTTTGTTTTTCCTCAAGTCGT	0.473																																						ENST00000319481.3	0.480000	0.280000	4.400000e-01	3.300000e-01	0.380000	0.388360	0.380000	0.390000																										0				36						c.(2692-2694)gaafs		oxysterol binding protein-like 1A							238.0	214.0	222.0					18																	21745087		2203	4300	6503	SO:0001589	frameshift_variant	114876	0	0					g.chr18:21745087delC	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2692delG	chr18.hg19:g.21745087delC	ENSP00000320291:p.Glu898fs	1					OSBPL1A_ENST00000357041.4_Frame_Shift_Del_p.E516fs|OSBPL1A_ENST00000399443.3_Frame_Shift_Del_p.E385fs|RP11-799B12.4_ENST00000583267.1_lincRNA	p.E898fs	NM_080597.3	NP_542164.2	1	2	3	2.061329	Q9BXW6	OSBL1_HUMAN		27	2898	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		B7Z7D3|Q9BZF5|Q9NW87	Frame_Shift_Del	DEL	ENST00000319481.3	0	1	hg19	c.2692delG	CCDS11884.1	0																																																																																								0.413793		TCGA-IB-7646-01A-11D-2154-08	0.473	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	1	0	0		33	2		0		0	2	148		148	146	1	2.940000	-6.859243	1	0.320000	NM_080597			58	67		1040	1015	0		1	0	0	0	0	148	0		0.996784	9.228337e-01	0	0	0	79	0	58	1040
SLC5A3	6526	broad.mit.edu	37	21	35469260	35469274	+	In_Frame_Del	DEL	ACGGGAAATCTGAAG	ACGGGAAATCTGAAG	-	rs145773467	byFrequency	TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr21:35469260_35469274delACGGGAAATCTGAAG	ENST00000381151.3	+	2	2275_2289	c.1763_1777delACGGGAAATCTGAAG	c.(1762-1779)aacgggaaatctgaagac>aac	p.GKSED589del	AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_In_Frame_Del_p.GKSED589del|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	589					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						ATCATTCCCAACGGGAAATCTGAAGACAGCATTAA	0.465																																						ENST00000381151.3	0.590000	0.310000	5.200000e-01	3.700000e-01	0.440000	0.449816	0.440000	0.440000																										0				20						c.(1762-1779)aacgggaaatctgaagac>aac		solute carrier family 5 (sodium/myo-inositol cotransporter), member 3																																				SO:0001651	inframe_deletion	6526	0	0					g.chr21:35469260_35469274delACGGGAAATCTGAAG		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1763_1777delACGGGAAATCTGAAG	chr21.hg19:g.35469260_35469274delACGGGAAATCTGAAG	ENSP00000370543:p.Gly589_Asp593del	1					MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_In_Frame_Del_p.GKSED589del	p.GKSED589del			0	1	1	1.551330	P53794	SC5A3_HUMAN		2	2275_2289	+			O43489	In_Frame_Del	DEL	ENST00000381151.3	1	1	hg19	c.1763_1777delACGGGAAATCTGAAG	CCDS33549.1	0																																																																																								0.196597		TCGA-IB-7646-01A-11D-2154-08	0.465	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1	1	0	0		2	2		0		0	0	89		89	89	1	2.940000	-10.652510	1	0.320000				36	58		393	413	0		1	0	0	0	0	89	0		1.000000	9.788634e-01	0	0	0	69	0	36	393
ANK3	288	broad.mit.edu	37	10	61833923	61833923	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr10:61833923C>T	ENST00000280772.2	-	37	6907	c.6716G>A	c.(6715-6717)cGt>cAt	p.R2239H	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2239					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTCTTTAACACGCATGCCTTT	0.413																																						ENST00000280772.2	0.270000	0.100000	2.300000e-01	1.300000e-01	0.170000	0.185958	0.170000	0.180000																										0				196						c.(6715-6717)cGt>cAt		ankyrin 3, node of Ranvier (ankyrin G)							210.0	196.0	201.0					10																	61833923		2203	4300	6503	SO:0001583	missense	288	2	121412	39				g.chr10:61833923C>T	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6716G>A	chr10.hg19:g.61833923C>T	ENSP00000280772:p.Arg2239His	1					ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	p.R2239H	NM_020987.3	NP_066267.2	0	2	2	1.796771	Q12955	ANK3_HUMAN		37	6907	-			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	1	1	hg19	c.6716G>A	CCDS7258.1	0	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804751	0.70682	.	.	ENSG00000151150	ENST00000280772	T	0.67523	-0.27	6.05	6.05	0.98169	6.05	6.05	0.98169	.	0.000000	0.42420	D	0.000701	T	0.64000	0.2559	L	0.56769	1.78	0.80722	D	1	P	0.52577	0.954	B	0.36666	0.23	T	0.69262	-0.5191	10	0.54805	T	0.06	.	20.6032	0.99464	0.0:1.0:0.0:0.0	.	2239	Q12955	ANK3_HUMAN	H	2239	ENSP00000280772:R2239H	ENSP00000280772:R2239H	R	-	2	0	0	ANK3	61503929	61503929	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.811000	0.86092	2.875000	0.98604	0.643000	0.83706	CGT	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	0	0	1		2	2	2	0		0	0	90		90	90	1	2.940000	-3.044431	1	0.320000	NM_020987			19	20		649	645	0		1			0	0	90	0		0.999990	0	0	0	0	0	0	19	649
SEC24C	9632	broad.mit.edu	37	10	75530836	75530836	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr10:75530836C>T	ENST00000339365.2	+	24	3430	c.3268C>T	c.(3268-3270)Cgg>Tgg	p.R1090W	SEC24C_ENST00000535742.1_Missense_Mutation_p.R338W|SEC24C_ENST00000411652.2_Missense_Mutation_p.R971W|FUT11_ENST00000394790.1_5'Flank|SEC24C_ENST00000345254.4_Missense_Mutation_p.R1090W|SEC24C_ENST00000540668.1_Missense_Mutation_p.R338W|FUT11_ENST00000372841.3_5'Flank	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	1090					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					CAAGGAGATTCGGCAGCTACT	0.488																																						ENST00000339365.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				32						c.(3268-3270)Cgg>Tgg		SEC24 family member C							154.0	151.0	152.0					10																	75530836		2203	4300	6503	SO:0001583	missense	9632	1	121412	37				g.chr10:75530836C>T	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.3268C>T	chr10.hg19:g.75530836C>T	ENSP00000343405:p.Arg1090Trp	1					FUT11_ENST00000372841.3_5'Flank|SEC24C_ENST00000540668.1_Missense_Mutation_p.R338W|SEC24C_ENST00000345254.4_Missense_Mutation_p.R1090W|SEC24C_ENST00000535742.1_Missense_Mutation_p.R338W|SEC24C_ENST00000411652.2_Missense_Mutation_p.R971W|FUT11_ENST00000394790.1_5'Flank	p.R1090W	NM_004922.3	NP_004913.2	0	2	2	1.796771	P53992	SC24C_HUMAN		24	3430	+	Prostate(51;0.0112)		B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	1	1	hg19	c.3268C>T	CCDS7332.1	1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909189	0.72868	.	.	ENSG00000176986	ENST00000535742;ENST00000345254;ENST00000540668;ENST00000339365;ENST00000411652	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.59662	0.2210	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.64410	0.925;0.925	T	0.64132	-0.6479	10	0.66056	D	0.02	-11.7174	15.3963	0.74798	0.1392:0.8608:0.0:0.0	.	971;1090	E7EP00;P53992	.;SC24C_HUMAN	W	338;1090;338;1090;971	ENSP00000446174:R338W;ENSP00000321845:R1090W;ENSP00000445023:R338W;ENSP00000343405:R1090W;ENSP00000402913:R971W	ENSP00000343405:R1090W	R	+	1	2	2	SEC24C	75200842	75200842	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.767000	0.62286	2.894000	0.99253	0.591000	0.81541	CGG	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.488	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1	1	0	1		2	2	2	0		0	0	102		102	102	1	2.940000	-20.000000	1	0.320000				185	185		413	408	1		1	1		0	0	102	0		1.000000	1	0	64	0	62	0	185	413
GLRX3	10539	broad.mit.edu	37	10	131959074	131959074	+	Silent	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr10:131959074C>T	ENST00000368644.1	+	4	313	c.291C>T	c.(289-291)atC>atT	p.I97I	GLRX3_ENST00000331244.5_Silent_p.I97I	NM_001199868.1	NP_001186797.1	O76003	GLRX3_HUMAN	glutaredoxin 3	97	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|regulation of the force of heart contraction (GO:0002026)	extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	electron carrier activity (GO:0009055)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(5)|lung(7)	13		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		CTCAGAAAATCGACCGATTAG	0.378																																						ENST00000368644.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				13						c.(289-291)atC>atT		glutaredoxin 3							80.0	75.0	77.0					10																	131959074		2203	4300	6503	SO:0001819	synonymous_variant	10539	1	121412	30				g.chr10:131959074C>T	AJ010841	CCDS7661.1	10q26	2009-05-29	2007-08-16	2007-08-16	ENSG00000108010	ENSG00000108010			15987	protein-coding gene	gene with protein product	"""glutaredoxin 4"""	612754	"""thioredoxin-like 2"""	TXNL2		10636891, 11124703	Standard	NM_006541		Approved	PICOT, bA500G10.4, GRX3, GLRX4, GRX4	uc001lkm.2	O76003	OTTHUMG00000019267	ENST00000368644.1:c.291C>T	chr10.hg19:g.131959074C>T		1					GLRX3_ENST00000331244.5_Silent_p.I97I	p.I97I	NM_001199868.1	NP_001186797.1	0	2	2	1.802623	O76003	GLRX3_HUMAN		4	313	+		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)	B3KMP7|B3KMQ5|D3DRG2|Q5JV01|Q96CE0|Q9P1B0|Q9P1B1	Silent	SNP	ENST00000368644.1	1	1	hg19	c.291C>T	CCDS7661.1	1																																																																																								0.320000		TCGA-IB-7646-01A-11D-2154-08	0.378	GLRX3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051021.1	1	0	1		2	2	2	0		0	0	39		39	39	1	2.940000	-20.000000	1	0.320000	NM_006541			102	99		202	200	1		1	1		0	0	39	0		1.000000	1	0	146	0	59	0	102	202
EFEMP2	30008	broad.mit.edu	37	11	65638816	65638816	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr11:65638816G>T	ENST00000307998.6	-	4	409	c.179C>A	c.(178-180)aCc>aAc	p.T60N	EFEMP2_ENST00000528176.1_Missense_Mutation_p.T60N	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	60	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		CTCAGGGATGGTCAGACACTC	0.642																																						ENST00000307998.6	1.000000	0.690000	9.700000e-01	7.700000e-01	0.860000	0.871719	0.860000	1.000000																										0				21						c.(178-180)aCc>aAc		EGF containing fibulin-like extracellular matrix protein 2							88.0	96.0	94.0					11																	65638816		2201	4296	6497	SO:0001583	missense	30008	0	0					g.chr11:65638816G>T	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.179C>A	chr11.hg19:g.65638816G>T	ENSP00000309953:p.Thr60Asn	1					EFEMP2_ENST00000528176.1_Missense_Mutation_p.T60N	p.T60N	NM_016938.4	NP_058634.4	1	2	3	2.069473	O95967	FBLN4_HUMAN		4	409	-			A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	1	1	hg19	c.179C>A	CCDS8116.1	1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812097	0.70797	.	.	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624;ENST00000527378	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	4.93	4.93	0.64822	4.93	4.93	0.64822	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);	0.000000	0.40640	N	0.001054	D	0.94666	0.8280	M	0.69358	2.11	0.52501	D	0.999956	D;D	0.69078	0.997;0.997	D;P	0.80764	0.994;0.898	D	0.92380	0.5912	10	0.16896	T	0.51	.	15.6604	0.77182	0.0:0.0:1.0:0.0	.	60;60	E9PRU1;O95967	.;FBLN4_HUMAN	N	60	ENSP00000434151:T60N;ENSP00000309953:T60N;ENSP00000435419:T60N;ENSP00000435963:T60N	ENSP00000309953:T60N	T	-	2	0	0	EFEMP2	65395392	65395392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.893000	0.63199	2.553000	0.86117	0.655000	0.94253	ACC	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.642	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	1	0	1		2	2	2	0		0	0	92		92	92	1	2.940000	-20.000000	1	0.320000	NM_016938			72	71		528	526	1		1	0		0	0	92	0		1.000000	1	0	0	0	267	0	72	528
CTSF	8722	broad.mit.edu	37	11	66333389	66333389	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr11:66333389C>A	ENST00000310325.5	-	7	986	c.877G>T	c.(877-879)Ggc>Tgc	p.G293C	ACTN3_ENST00000502692.1_RNA|CTSF_ENST00000533168.1_5'Flank|ACTN3_ENST00000513398.1_RNA	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	293					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CAGCAGGAGCCACACATGCCC	0.622																																						ENST00000310325.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				19						c.(877-879)Ggc>Tgc		cathepsin F							50.0	49.0	49.0					11																	66333389		2200	4295	6495	SO:0001583	missense	8722	0	0					g.chr11:66333389C>A	AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.877G>T	chr11.hg19:g.66333389C>A	ENSP00000310832:p.Gly293Cys	1					ACTN3_ENST00000513398.1_RNA|ACTN3_ENST00000502692.1_RNA|CTSF_ENST00000533168.1_5'Flank	p.G293C	NM_003793.3	NP_003784.2	1	2	3	2.069473	Q9UBX1	CATF_HUMAN		7	986	-			B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	ENST00000310325.5	1	1	hg19	c.877G>T	CCDS8144.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.9|27.9	4.870856|4.870856	0.91587|0.91587	.|.	.|.	ENSG00000174080|ENSG00000174080	ENST00000310325|ENST00000524994	D|.	0.93659|.	-3.26|.	5.54|5.54	5.54|5.54	0.83059|0.83059	5.54|5.54	5.54|5.54	0.83059|0.83059	Peptidase C1A, papain C-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90957|0.90957	0.7157|0.7157	H|H	0.99058|0.99058	4.415|4.415	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.94151|0.94151	0.7405|0.7405	10|5	0.87932|.	D|.	0|.	.|.	17.339|17.339	0.87291|0.87291	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	293|.	Q9UBX1|.	CATF_HUMAN|.	C|L	293|140	ENSP00000310832:G293C|.	ENSP00000310832:G293C|.	G|W	-|-	1|2	0|0	0|0	CTSF|CTSF	66089965|66089965	66089965|66089965	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	4.866000|4.866000	0.63005|0.63005	2.779000|2.779000	0.95612|0.95612	0.591000|0.591000	0.81541|0.81541	GGC|TGG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.622	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393047.1	1	0	1		2	2	2	0		0	0	32		32	31	1	2.940000	-20.000000	1	0.320000	NM_003793			76	74		174	171	1		1	0		0	0	32	0		1.000000	1	0	0	0	119	0	76	174
MRGPRF	116535	broad.mit.edu	37	11	68773653	68773653	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr11:68773653G>A	ENST00000309099.6	-	3	507	c.125C>T	c.(124-126)cCg>cTg	p.P42L	MRGPRF_ENST00000441623.1_Missense_Mutation_p.P42L|RP11-554A11.5_ENST00000562506.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	42						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGCCGGAGGCGGCAGCATCGC	0.632																																						ENST00000309099.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				7						c.(124-126)cCg>cTg		MAS-related GPR, member F							40.0	48.0	45.0					11																	68773653		2200	4294	6494	SO:0001583	missense	116535	0	0					g.chr11:68773653G>A	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.125C>T	chr11.hg19:g.68773653G>A	ENSP00000309782:p.Pro42Leu	1					MRGPRF_ENST00000441623.1_Missense_Mutation_p.P42L|RP11-554A11.5_ENST00000562506.1_RNA	p.P42L	NM_145015.4	NP_659452.3	1	2	3	2.069473	Q96AM1	MRGRF_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)	3	507	-			B3KV43|Q8NBK8	Missense_Mutation	SNP	ENST00000309099.6	1	1	hg19	c.125C>T	CCDS8188.1	1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332758	0.41297	.	.	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543	T;T	0.05447	3.44;3.44	4.35	4.35	0.52113	4.35	4.35	0.52113	.	0.000000	0.44483	D	0.000457	T	0.08447	0.0210	N	0.19112	0.55	0.09310	N	0.999993	D	0.69078	0.997	P	0.56088	0.791	T	0.36237	-0.9756	10	0.19590	T	0.45	-45.2304	12.2679	0.54689	0.0:0.0:1.0:0.0	.	42	Q96AM1	MRGRF_HUMAN	L	42	ENSP00000403660:P42L;ENSP00000309782:P42L	ENSP00000309782:P42L	P	-	2	0	0	MRGPRF	68530229	68530229	0.661000	0.27430	0.135000	0.22099	0.425000	0.31504	1.452000	0.35156	2.261000	0.74972	0.561000	0.74099	CCG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.632	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396875.1	1	0	1		2	2	2	0		0	0	36		36	35	1	2.940000	-20.000000	1	0.320000	NM_145015			72	70		193	190	1		1	0		0	0	36	0		1.000000	8.414213e-01	0	0	0	11	0	72	193
P2RY6	5031	broad.mit.edu	37	11	73008405	73008405	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr11:73008405C>T	ENST00000393590.2	+	2	1141	c.842C>T	c.(841-843)gCg>gTg	p.A281V	P2RY6_ENST00000540342.1_Missense_Mutation_p.A281V|P2RY6_ENST00000393591.1_Missense_Mutation_p.A281V|P2RY6_ENST00000538328.1_Missense_Mutation_p.A281V|P2RY6_ENST00000349767.2_Missense_Mutation_p.A281V|P2RY6_ENST00000542092.1_Missense_Mutation_p.A281V|P2RY6_ENST00000540124.1_Missense_Mutation_p.A281V|P2RY6_ENST00000393592.2_Missense_Mutation_p.A281V	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	281					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						GCCTTTGCAGCGGCCTACAAA	0.602																																						ENST00000393590.2	1.000000	0.730000	1	8.300000e-01	0.940000	0.926770	0.940000	1.000000																										0				14						c.(841-843)gCg>gTg		pyrimidinergic receptor P2Y, G-protein coupled, 6							55.0	56.0	55.0					11																	73008405		2199	4292	6491	SO:0001583	missense	5031	2	121396	41				g.chr11:73008405C>T		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.842C>T	chr11.hg19:g.73008405C>T	ENSP00000377215:p.Ala281Val	1					P2RY6_ENST00000393592.2_Missense_Mutation_p.A281V|P2RY6_ENST00000393591.1_Missense_Mutation_p.A281V|P2RY6_ENST00000540342.1_Missense_Mutation_p.A281V|P2RY6_ENST00000538328.1_Missense_Mutation_p.A281V|P2RY6_ENST00000349767.2_Missense_Mutation_p.A281V|P2RY6_ENST00000540124.1_Missense_Mutation_p.A281V|P2RY6_ENST00000542092.1_Missense_Mutation_p.A281V	p.A281V	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	1	2	3	2.069473	Q15077	P2RY6_HUMAN		2	1141	+			Q15754	Missense_Mutation	SNP	ENST00000393590.2	1	1	hg19	c.842C>T	CCDS8220.1	1	.	.	.	.	.	.	.	.	.	.	C	0.097	-1.157720	0.01686	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000538328	T;T;T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63	4.81	3.9	0.45041	4.81	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.302347	0.31734	N	0.007143	T	0.03608	0.0103	N	0.02247	-0.625	0.09310	N	1	B	0.24651	0.108	B	0.16289	0.015	T	0.41875	-0.9484	10	0.02654	T	1	.	6.2522	0.20852	0.0:0.7162:0.0:0.2838	.	281	Q15077	P2RY6_HUMAN	V	281	ENSP00000443427:A281V;ENSP00000445652:A281V;ENSP00000309771:A281V;ENSP00000377217:A281V;ENSP00000377216:A281V;ENSP00000442551:A281V;ENSP00000377215:A281V;ENSP00000442990:A281V	ENSP00000309771:A281V	A	+	2	0	0	P2RY6	72686053	72686053	0.964000	0.33143	0.016000	0.15963	0.306000	0.27790	3.836000	0.55813	1.383000	0.46405	0.655000	0.94253	GCG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.602	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1	1	0	1		2	2	2	0		0	0	76		76	75	1	2.940000	-20.000000	1	0.320000				64	64		428	419	1		1	0		0	0	76	0		1.000000	1.318110e-01	0	1	0	4	0	64	428
ARHGEF17	9828	broad.mit.edu	37	11	73020596	73020596	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr11:73020596G>C	ENST00000263674.3	+	1	1263	c.913G>C	c.(913-915)Gac>Cac	p.D305H	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	305					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						ATTGGATCAGGACTGCAGGCC	0.632																																						ENST00000263674.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				32						c.(913-915)Gac>Cac		Rho guanine nucleotide exchange factor (GEF) 17							39.0	49.0	45.0					11																	73020596		2199	4291	6490	SO:0001583	missense	9828	0	0					g.chr11:73020596G>C	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.913G>C	chr11.hg19:g.73020596G>C	ENSP00000263674:p.Asp305His	1					RP11-800A3.7_ENST00000546324.1_RNA	p.D305H	NM_014786.3	NP_055601.2	1	2	3	2.069473	Q96PE2	ARHGH_HUMAN		1	1263	+			B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	1	1	hg19	c.913G>C	CCDS8221.1	1	.	.	.	.	.	.	.	.	.	.	G	9.597	1.127584	0.20959	.	.	ENSG00000110237	ENST00000263674	T	0.59083	0.29	4.48	2.59	0.31030	4.48	2.59	0.31030	.	0.431022	0.17191	N	0.183499	T	0.37812	0.1017	N	0.19112	0.55	0.09310	N	1	B	0.25169	0.119	B	0.26517	0.07	T	0.19679	-1.0298	10	0.29301	T	0.29	-5.789	6.67	0.23064	0.3027:0.0:0.6973:0.0	.	305	Q96PE2	ARHGH_HUMAN	H	305	ENSP00000263674:D305H	ENSP00000263674:D305H	D	+	1	0	0	ARHGEF17	72698244	72698244	0.179000	0.23135	0.263000	0.24496	0.767000	0.43475	2.280000	0.43443	0.353000	0.24079	0.313000	0.20887	GAC	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.632	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	1	0	1		2	2	2	0		0	0	71		71	69	1	2.940000	-20.000000	1	0.320000	NM_014786			136	135		319	313	1		1	0		0	0	71	0		1.000000	8.474749e-01	0	1	0	9	0	136	319
DRD2	1813	broad.mit.edu	37	11	113281640	113281640	+	Missense_Mutation	SNP	C	C	T	rs200352240		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr11:113281640C>T	ENST00000362072.3	-	8	1485	c.1141G>A	c.(1141-1143)Gtg>Atg	p.V381M	RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000346454.3_Missense_Mutation_p.V352M|DRD2_ENST00000538967.1_Missense_Mutation_p.V383M|DRD2_ENST00000542968.1_Missense_Mutation_p.V381M|DRD2_ENST00000355319.2_Missense_Mutation_p.V383M|DRD2_ENST00000544518.1_Missense_Mutation_p.V380M	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	381					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATGATGAACACGCCTGGGGGA	0.617																																						ENST00000362072.3	1.000000	0.620000	1	7.400000e-01	0.870000	0.866728	0.870000	1.000000																										0				39						c.(1141-1143)Gtg>Atg		dopamine receptor D2	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)						120.0	90.0	101.0					11																	113281640		2201	4296	6497	SO:0001583	missense	1813	4	121408	32				g.chr11:113281640C>T	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.1141G>A	chr11.hg19:g.113281640C>T	ENSP00000354859:p.Val381Met	1					DRD2_ENST00000346454.3_Missense_Mutation_p.V352M|RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000538967.1_Missense_Mutation_p.V383M|DRD2_ENST00000544518.1_Missense_Mutation_p.V380M|DRD2_ENST00000355319.2_Missense_Mutation_p.V383M|DRD2_ENST00000542968.1_Missense_Mutation_p.V381M	p.V381M	NM_000795.3	NP_000786.1	1	2	3	2.069473	P14416	DRD2_HUMAN		8	1485	-		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)	Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	1	0	hg19	c.1141G>A	CCDS8361.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250906	0.80135	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	5.66	4.72	0.59763	5.66	4.72	0.59763	GPCR, rhodopsin-like superfamily (1);	0.111037	0.64402	D	0.000009	D	0.87947	0.6306	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.74674	0.984;0.917;0.979	D	0.90416	0.4413	10	0.87932	D	0	.	15.7176	0.77681	0.1378:0.8622:0.0:0.0	.	380;352;381	F8VUV1;P14416-2;P14416	.;.;DRD2_HUMAN	M	383;352;381;380;381;383	ENSP00000347474:V383M;ENSP00000278597:V352M;ENSP00000354859:V381M;ENSP00000441068:V380M;ENSP00000442172:V381M;ENSP00000438215:V383M	ENSP00000278597:V352M	V	-	1	0	0	DRD2	112786850	112786850	1.000000	0.71417	0.998000	0.56505	0.554000	0.35429	6.075000	0.71261	1.321000	0.45227	0.655000	0.94253	GTG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.617	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	1	0	1		2	2	2	0		0	0	44		44	43	1	2.940000	-20.000000	1	0.320000	NM_000795			35	35		257	249	0		1			0	0	44	0		1.000000	0	0	0	0	0	0	35	257
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999248	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	2	2	4	2.071951	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.431058		TCGA-IB-7646-01A-11D-2154-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	12		12	12	1	2.940000	-16.436940	1	0.320000	NM_033360			22	21		82	82	1		1	1	1	0	0	12	404		1.000000	9.990578e-01	1	16	123	30	445	22	82
PRICKLE1	144165	broad.mit.edu	37	12	42854329	42854329	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr12:42854329T>C	ENST00000455697.1	-	8	2063	c.1778A>G	c.(1777-1779)gAg>gGg	p.E593G	PRICKLE1_ENST00000445766.2_Missense_Mutation_p.E593G|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.E593G|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.E593G|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.E593G	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	593					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CTTTAAGGACTCTGCACTCCT	0.438																																						ENST00000455697.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				47						c.(1777-1779)gAg>gGg		prickle homolog 1 (Drosophila)							139.0	132.0	135.0					12																	42854329		2203	4300	6503	SO:0001583	missense	144165	0	0					g.chr12:42854329T>C	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1778A>G	chr12.hg19:g.42854329T>C	ENSP00000401060:p.Glu593Gly	0					PRICKLE1_ENST00000552240.1_Missense_Mutation_p.E593G|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.E593G|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.E593G|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.E593G|RP11-328C8.4_ENST00000547824.1_RNA	p.E593G	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	2	2	4	2.071951	Q96MT3	PRIC1_HUMAN		8	2063	-	all_cancers(12;4.25e-05)|Breast(8;0.176)		Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	1	1	hg19	c.1778A>G	CCDS8742.1	1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.284911	0.59867	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.198871	0.52532	D	0.000063	T	0.62648	0.2445	L	0.61218	1.895	0.52501	D	0.999951	P	0.36222	0.544	B	0.27887	0.084	T	0.68398	-0.5419	10	0.87932	D	0	-11.3229	16.0186	0.80464	0.0:0.0:0.0:1.0	.	593	Q96MT3	PRIC1_HUMAN	G	593	ENSP00000401060:E593G;ENSP00000398947:E593G;ENSP00000448359:E593G;ENSP00000345064:E593G;ENSP00000449819:E593G	ENSP00000345064:E593G	E	-	2	0	0	PRICKLE1	41140596	41140596	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	4.756000	0.62205	2.244000	0.73946	0.528000	0.53228	GAG	0.431058		TCGA-IB-7646-01A-11D-2154-08	0.438	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1	1	0	1		2	2	2	0		0	0	91		91	91	1	2.940000	-20.000000	1	0.320000				170	166		692	688	1		1	1	1	0	0	91	434		1.000000	9.745311e-01	1	8	208	18	474	170	692
BEST3	144453	broad.mit.edu	37	12	70048804	70048804	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr12:70048804G>C	ENST00000330891.5	-	10	2116	c.1890C>G	c.(1888-1890)atC>atG	p.I630M	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000488961.1_Missense_Mutation_p.I417M|BEST3_ENST00000553096.1_Missense_Mutation_p.I524M	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	630					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			CCACAATGTTGATCCCACTGA	0.468																																						ENST00000330891.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				12						c.(1888-1890)atC>atG		bestrophin 3							88.0	86.0	87.0					12																	70048804		1911	4138	6049	SO:0001583	missense	144453	0	0					g.chr12:70048804G>C	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1890C>G	chr12.hg19:g.70048804G>C	ENSP00000332413:p.Ile630Met	0					BEST3_ENST00000331471.4_Intron|BEST3_ENST00000488961.1_Missense_Mutation_p.I417M|BEST3_ENST00000553096.1_Missense_Mutation_p.I524M	p.I630M	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	2	2	4	2.084218	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)	10	2116	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	1	1	hg19	c.1890C>G	CCDS8992.2	1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473125	0.26423	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98090	-4.39;-4.71;-4.68	5.53	2.67	0.31697	5.53	2.67	0.31697	.	0.874202	0.10059	N	0.721139	D	0.94006	0.8080	L	0.32530	0.975	0.09310	N	1	B;B	0.18461	0.022;0.028	B;B	0.19148	0.006;0.024	D	0.88148	0.2849	10	0.44086	T	0.13	-1.6889	5.3228	0.15891	0.2378:0.2019:0.5603:0.0	.	630;417	Q8N1M1;B5MDI8	BEST3_HUMAN;.	M	417;630;524	ENSP00000433213:I417M;ENSP00000332413:I630M;ENSP00000449548:I524M	ENSP00000332413:I630M	I	-	3	3	3	BEST3	68335071	68335071	0.078000	0.21339	0.076000	0.20297	0.118000	0.20060	0.955000	0.29188	1.323000	0.45263	0.563000	0.77884	ATC	0.434088		TCGA-IB-7646-01A-11D-2154-08	0.468	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	1	0	1		2	2	2	0		0	0	42		42	42	1	2.940000	-5.269355	1	0.320000	NM_152439			89	89		269	267	1		1			0	0	42	0		1.000000	0	0	0	0	0	0	89	269
NUAK1	9891	broad.mit.edu	37	12	106461627	106461627	+	Silent	SNP	G	G	A	rs143829749		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr12:106461627G>A	ENST00000261402.2	-	7	2318	c.939C>T	c.(937-939)agC>agT	p.S313S		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	313					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						AGTCACACACGCTGCTCTTAT	0.587																																						ENST00000261402.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				37						c.(937-939)agC>agT		NUAK family, SNF1-like kinase, 1		G		1,4405	2.1+/-5.4	0,1,2202	76.0	65.0	69.0		939	-3.0	0.8	12	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NUAK1	NM_014840.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		313/662	106461627	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9891	7	121412	40				g.chr12:106461627G>A	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.939C>T	chr12.hg19:g.106461627G>A		0						p.S313S	NM_014840.2	NP_055655.1	2	2	4	2.086181	O60285	NUAK1_HUMAN		7	2318	-			A7MD39|Q96KA8	Silent	SNP	ENST00000261402.2	1	1	hg19	c.939C>T	CCDS31892.1	1																																																																																								0.434088		TCGA-IB-7646-01A-11D-2154-08	0.587	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405767.2	1	0	1		2	2	2	0		0	0	45		45	45	1	2.940000	-3.878179	1	0.320000	NM_014840			71	71		264	262	1		1	1		0	0	45	0		1.000000	9.729789e-01	0	2	0	22	0	71	264
ING1	3621	broad.mit.edu	37	13	111368263	111368263	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr13:111368263A>G	ENST00000375774.3	+	1	935	c.473A>G	c.(472-474)gAc>gGc	p.D158G	ING1_ENST00000464141.1_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000375775.3_Intron|ING1_ENST00000333219.7_Intron|ING1_ENST00000338450.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	158					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TGCAGTTCGGACCGCCTCCCG	0.711																																						ENST00000375774.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				12						c.(472-474)gAc>gGc		inhibitor of growth family, member 1							13.0	21.0	18.0					13																	111368263		1765	3634	5399	SO:0001583	missense	3621	0	0					g.chr13:111368263A>G		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.473A>G	chr13.hg19:g.111368263A>G	ENSP00000364929:p.Asp158Gly	1					ING1_ENST00000333219.7_Intron|ING1_ENST00000338450.7_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron	p.D158G	NM_005537.4	NP_005528.3	0	2	2	1.787785	Q9UK53	ING1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.188)	1	935	+	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	1	1	hg19	c.473A>G	CCDS9517.1	1	.	.	.	.	.	.	.	.	.	.	A	0.643	-0.812678	0.02798	.	.	ENSG00000153487	ENST00000375774	T	0.55930	0.49	3.31	-2.11	0.07187	3.31	-2.11	0.07187	.	.	.	.	.	T	0.24967	0.0606	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13019	-1.0525	9	0.31617	T	0.26	.	3.314	0.07026	0.4814:0.0:0.3271:0.1915	.	158	Q9UK53	ING1_HUMAN	G	158	ENSP00000364929:D158G	ENSP00000364929:D158G	D	+	2	0	0	ING1	110166264	110166264	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-3.845000	0.00352	-0.273000	0.09246	-0.252000	0.11476	GAC	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.711	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	1	0	1		2	2	2	0		0	0	24		24	22	1	2.940000	-20.000000	1	0.320000	NM_005537			62	59		144	140	0		1			0	0	24	0		1.000000	0	0	0	0	0	0	62	144
MYH6	4624	broad.mit.edu	37	14	23869987	23869987	+	Silent	SNP	G	G	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr14:23869987G>C	ENST00000356287.3	-	12	1370	c.1341C>G	c.(1339-1341)acC>acG	p.T447T	MYH6_ENST00000405093.3_Silent_p.T447T			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	447	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TGGTCTCCAGGGTGGCGTTGA	0.582																																						ENST00000356287.3	1.000000	0.740000	1	8.500000e-01	0.960000	0.940197	0.960000	1.000000																										0				119						c.(1339-1341)acC>acG		myosin, heavy chain 6, cardiac muscle, alpha							134.0	106.0	116.0					14																	23869987		2203	4300	6503	SO:0001819	synonymous_variant	4624	0	0					g.chr14:23869987G>C	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1341C>G	chr14.hg19:g.23869987G>C		1					MYH6_ENST00000405093.3_Silent_p.T447T	p.T447T			1	2	3	2.050034	P13533	MYH6_HUMAN		12	1370	-	all_cancers(95;2.54e-05)		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	1	1	hg19	c.1341C>G	CCDS9600.1	1																																																																																								0.413793		TCGA-IB-7646-01A-11D-2154-08	0.582	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3	1	0	1		2	2	2	0		0	0	65		65	65	1	2.940000	-2.966728	1	0.320000				55	54		356	353	1		1		0	0	0	65	0		1.000000	0	0	0	0	0	1	55	356
LTB4R	1241	broad.mit.edu	37	14	24785420	24785420	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr14:24785420C>T	ENST00000396789.4	+	2	2288	c.563C>T	c.(562-564)aCg>aTg	p.T188M	LTB4R_ENST00000345363.3_Missense_Mutation_p.T188M|LTB4R_ENST00000396782.2_Missense_Mutation_p.T188M	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	188					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		GAGGCTGTCACGGGCTTCCTG	0.667																																						ENST00000396789.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				8						c.(562-564)aCg>aTg		leukotriene B4 receptor							49.0	52.0	51.0					14																	24785420		2203	4300	6503	SO:0001583	missense	1241	0	0					g.chr14:24785420C>T	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.563C>T	chr14.hg19:g.24785420C>T	ENSP00000380008:p.Thr188Met	1					LTB4R_ENST00000345363.3_Missense_Mutation_p.T188M|LTB4R_ENST00000396782.2_Missense_Mutation_p.T188M	p.T188M	NM_181657.3	NP_858043.1	1	2	3	2.050034	Q15722	LT4R1_HUMAN		2	2288	+			Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	1	1	hg19	c.563C>T	CCDS9626.1	1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957500	0.53400	.	.	ENSG00000213903	ENST00000345363;ENST00000396789;ENST00000556141;ENST00000396782	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.74	5.74	0.90152	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.204720	0.41938	U	0.000790	T	0.37073	0.0990	N	0.25332	0.735	0.35269	D	0.780254	D	0.61697	0.99	P	0.55011	0.766	T	0.41716	-0.9493	10	0.35671	T	0.21	.	10.7916	0.46436	0.0:0.9141:0.0:0.0859	.	188	Q15722	LT4R1_HUMAN	M	188;188;88;188	ENSP00000307445:T188M;ENSP00000380008:T188M;ENSP00000451929:T88M;ENSP00000380002:T188M	ENSP00000307445:T188M	T	+	2	0	0	LTB4R	23855260	23855260	0.004000	0.15560	0.997000	0.53966	0.955000	0.61496	1.769000	0.38522	2.709000	0.92574	0.655000	0.94253	ACG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.667	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4	1	0	1		2	2	2	0		0	0	55		55	53	1	2.940000	-20.000000	1	0.320000				139	138		333	329	1		1	0		0	0	55	0		1.000000	5.686495e-01	0	1	0	5	0	139	333
LRFN5	145581	broad.mit.edu	37	14	42360832	42360832	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr14:42360832G>A	ENST00000298119.4	+	4	2954	c.1765G>A	c.(1765-1767)Gtg>Atg	p.V589M	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	589						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GCCCCAGTCCGTGTCCAAACA	0.463										HNSCC(30;0.082)																												ENST00000298119.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				120						c.(1765-1767)Gtg>Atg		leucine rich repeat and fibronectin type III domain containing 5							117.0	99.0	105.0					14																	42360832		2203	4300	6503	SO:0001583	missense	145581	1	121412	30				g.chr14:42360832G>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1765G>A	chr14.hg19:g.42360832G>A	ENSP00000298119:p.Val589Met	0	HNSCC(30;0.082)				LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	p.V589M	NM_152447.3	NP_689660.2	2	2	4	2.084219	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	4	2954	+			B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	1	1	hg19	c.1765G>A	CCDS9678.1	1	.	.	.	.	.	.	.	.	.	.	G	3.589	-0.084060	0.07097	.	.	ENSG00000165379	ENST00000298119	T	0.46819	0.86	5.95	-8.33	0.00992	5.95	-8.33	0.00992	.	0.719510	0.12218	N	0.488691	T	0.15435	0.0372	N	0.08118	0	0.33496	D	0.589311	P	0.37370	0.592	B	0.22880	0.042	T	0.20672	-1.0268	10	0.42905	T	0.14	.	7.3406	0.26635	0.2434:0.0993:0.5598:0.0975	.	589	Q96NI6	LRFN5_HUMAN	M	589	ENSP00000298119:V589M	ENSP00000298119:V589M	V	+	1	0	0	LRFN5	41430582	41430582	0.000000	0.05858	0.103000	0.21229	0.809000	0.45718	-0.726000	0.04936	-1.450000	0.01936	-0.157000	0.13467	GTG	0.441524		TCGA-IB-7646-01A-11D-2154-08	0.463	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	1	0	1		2	2	2	0		0	0	53		53	53	1	2.940000	-20.000000	1	0.320000	NM_152447			79	78		251	247	1		1	0		0	0	53	0		1.000000	0	0	0	0	1	0	79	251
KLHL28	54813	broad.mit.edu	37	14	45398354	45398354	+	Silent	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr14:45398354G>A	ENST00000396128.4	-	5	1712	c.1593C>T	c.(1591-1593)gtC>gtT	p.V531V	KLHL28_ENST00000355081.2_Silent_p.V545V	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	531										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGTGACCACCGACGACATAAA	0.423																																						ENST00000396128.4	1.000000	0.910000	1	9.900000e-01	0.990000	0.993984	0.990000	1.000000																										0				22						c.(1591-1593)gtC>gtT		kelch-like family member 28							139.0	118.0	125.0					14																	45398354		2203	4300	6503	SO:0001819	synonymous_variant	54813	2	121410	35				g.chr14:45398354G>A	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.1593C>T	chr14.hg19:g.45398354G>A		0					KLHL28_ENST00000355081.2_Silent_p.V545V	p.V531V	NM_017658.3	NP_060128.2	2	2	4	2.084219	Q9NXS3	KLH28_HUMAN		5	1712	-			Q0VAL5	Silent	SNP	ENST00000396128.4	1	1	hg19	c.1593C>T	CCDS9680.1	1																																																																																								0.441524		TCGA-IB-7646-01A-11D-2154-08	0.423	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3	1	0	1		2	2	2	0		0	0	91		91	89	1	2.940000	-3.222020	1	0.320000				88	87		516	515	1		1	0		0	0	91	0		1.000000	8.817923e-01	0	1	0	23	0	88	516
CPSF2	53981	broad.mit.edu	37	14	92628035	92628035	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr14:92628035C>T	ENST00000298875.4	+	16	2581	c.2296C>T	c.(2296-2298)Caa>Taa	p.Q766*		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	766					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		CTGCCTTTGTCAAGATTTTTA	0.318																																					Ovarian(78;28 1788 18702 44111)	ENST00000298875.4			0	0																														0				24						c.(2296-2298)Caa>Taa		cleavage and polyadenylation specific factor 2, 100kDa							80.0	77.0	78.0					14																	92628035		2203	4298	6501	SO:0001587	stop_gained	53981	0	0					g.chr14:92628035C>T	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.2296C>T	chr14.hg19:g.92628035C>T	ENSP00000298875:p.Gln766*							p.Q766*	NM_017437.2	NP_059133.1					Q9P2I0	CPSF2_HUMAN		16	2581	+		all_cancers(154;0.0766)	B3KME1|Q6NSJ1|Q9H3W7	Nonsense_Mutation	SNP	ENST00000298875.4	0	1	hg19	c.2296C>T	CCDS9902.1		.	.	.	.	.	.	.	.	.	.	C	40	8.417780	0.98803	.	.	ENSG00000165934	ENST00000298875	.	.	.	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.136439	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	14.6844	0.69040	0.0:0.7349:0.265:0.0	.	.	.	.	X	766	.	ENSP00000298875:Q766X	Q	+	1	0	0	CPSF2	91697788	91697788	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.426000	0.52778	2.683000	0.91414	0.655000	0.94253	CAA			TCGA-IB-7646-01A-11D-2154-08	0.318	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1	1	0	1		2	2	2	0		0	0	34		34	34	1	2.940000	-3.221908	1	0.320000				39	38		290	289	0		1	1		0	0	34	0		1.000000	9.999885e-01	0	11	0	119	0	39	290
TEKT5	146279	broad.mit.edu	37	16	10721628	10721628	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr16:10721628C>T	ENST00000283025.2	-	7	1341	c.1270G>A	c.(1270-1272)Gac>Aac	p.D424N	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	424						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						TGCAGGGTGTCGTCGATGGTG	0.542																																						ENST00000283025.2	1.000000	0.130000	1	2.000000e-01	0.310000	0.456251	0.310000	0.260000																										0				34						c.(1270-1272)Gac>Aac		tektin 5							50.0	43.0	45.0					16																	10721628		2197	4300	6497	SO:0001583	missense	146279	2	121410	31				g.chr16:10721628C>T		CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1270G>A	chr16.hg19:g.10721628C>T	ENSP00000283025:p.Asp424Asn	1					TEKT5_ENST00000574923.1_5'UTR	p.D424N	NM_144674.1	NP_653275.1	1	3	4	2.076180	Q96M29	TEKT5_HUMAN		7	1341	-			A1L3Z3	Missense_Mutation	SNP	ENST00000283025.2	0	1	hg19	c.1270G>A	CCDS10542.1	0	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688739	0.48097	.	.	ENSG00000153060	ENST00000283025	T	0.02525	4.26	5.18	5.18	0.71444	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000009	T	0.04724	0.0128	L	0.49513	1.565	0.58432	D	0.999996	B	0.25521	0.128	B	0.26517	0.07	T	0.43718	-0.9374	10	0.36615	T	0.2	-37.626	15.4575	0.75327	0.0:1.0:0.0:0.0	.	424	Q96M29	TEKT5_HUMAN	N	424	ENSP00000283025:D424N	ENSP00000283025:D424N	D	-	1	0	0	TEKT5	10629129	10629129	1.000000	0.71417	0.981000	0.43875	0.308000	0.27856	5.521000	0.67086	2.432000	0.82394	0.505000	0.49811	GAC	0.426451		TCGA-IB-7646-01A-11D-2154-08	0.542	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	0	0	1		2	2	2	0		0	0	30		30	29	1	2.940000	-9.566960	1	0.320000	NM_144674			8	8		220	215	0		1			0	0	30	0		0.988761	0	0	0	0	0	0	8	220
GTF3C1	2975	broad.mit.edu	37	16	27544625	27544625	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr16:27544625A>C	ENST00000356183.4	-	5	851	c.836T>G	c.(835-837)cTg>cGg	p.L279R	GTF3C1_ENST00000561623.1_Missense_Mutation_p.L279R	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	279					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTCTTCCCTCAGCTTTCCCAG	0.552																																						ENST00000356183.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				80						c.(835-837)cTg>cGg		general transcription factor IIIC, polypeptide 1, alpha 220kDa							125.0	110.0	115.0					16																	27544625		2197	4300	6497	SO:0001583	missense	2975	0	0					g.chr16:27544625A>C	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.836T>G	chr16.hg19:g.27544625A>C	ENSP00000348510:p.Leu279Arg	1					GTF3C1_ENST00000561623.1_Missense_Mutation_p.L279R	p.L279R	NM_001520.3	NP_001511.2	1	3	4	2.095233	Q12789	TF3C1_HUMAN		5	851	-			B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	1	1	hg19	c.836T>G	CCDS32414.1	1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.454282	0.84209	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.28069	1.63	5.96	5.96	0.96718	5.96	5.96	0.96718	.	0.082944	0.49305	D	0.000153	T	0.45296	0.1335	L	0.29908	0.895	0.48632	D	0.999681	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.981	T	0.43956	-0.9359	10	0.87932	D	0	-3.0653	16.1077	0.81236	1.0:0.0:0.0:0.0	.	279;279	Q12789;Q12789-3	TF3C1_HUMAN;.	R	279;277	ENSP00000348510:L279R	ENSP00000348510:L279R	L	-	2	0	0	GTF3C1	27452126	27452126	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	7.664000	0.83830	2.285000	0.76669	0.528000	0.53228	CTG	0.434088		TCGA-IB-7646-01A-11D-2154-08	0.552	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	1	0	1		2	2	2	0		0	0	59		59	58	1	2.940000	-20.000000	1	0.320000	NM_001520			91	91		247	243	1		1	1		0	0	59	0		1.000000	9.999644e-01	0	19	0	25	0	91	247
CYLD	1540	broad.mit.edu	37	16	50813757	50813757	+	Silent	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr16:50813757G>A	ENST00000427738.3	+	8	1525	c.1320G>A	c.(1318-1320)ctG>ctA	p.L440L	CYLD_ENST00000568704.2_Intron|CYLD_ENST00000398568.2_Silent_p.L437L|CYLD_ENST00000311559.9_Silent_p.L440L|CYLD_ENST00000564326.1_Silent_p.L437L|CYLD_ENST00000566206.1_Silent_p.L437L|CYLD_ENST00000569418.1_Silent_p.L437L|CYLD_ENST00000540145.1_Silent_p.L440L			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	440	Interaction with TRAF2.|Interaction with TRIP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				CACTTTCTCTGTCAGCCCAGT	0.507			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																													ENST00000427738.3	1.000000	0.880000	1	9.900000e-01	0.990000	0.990632	0.990000	1.000000			yes	Rec	yes	Familial cylindromatosis	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	16q12-q13	1540	Mis, N, F, S	familial cylindromatosis gene				E	E		cylindroma	cylindroma		0				62						c.(1318-1320)ctG>ctA		cylindromatosis (turban tumor syndrome)							134.0	131.0	132.0					16																	50813757		1985	4173	6158	SO:0001819	synonymous_variant	1540	0	0		Multiple Trichoepithelioma, Familial;Familial Cylindromatosis	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	g.chr16:50813757G>A	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1320G>A	chr16.hg19:g.50813757G>A		1					CYLD_ENST00000398568.2_Silent_p.L437L|CYLD_ENST00000566206.1_Silent_p.L437L|CYLD_ENST00000568704.2_Intron|CYLD_ENST00000564326.1_Silent_p.L437L|CYLD_ENST00000540145.1_Silent_p.L440L|CYLD_ENST00000569418.1_Silent_p.L437L|CYLD_ENST00000311559.9_Silent_p.L440L	p.L440L			1	3	4	2.095233	Q9NQC7	CYLD_HUMAN		8	1525	+		all_cancers(37;0.0156)	O94934|Q7L3N6|Q96EH0|Q9NZX9	Silent	SNP	ENST00000427738.3	1	1	hg19	c.1320G>A	CCDS45482.1	1																																																																																								0.434088		TCGA-IB-7646-01A-11D-2154-08	0.507	CYLD-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422998.2	1	0	1		2	2	2	0		0	0	108		108	108	1	2.940000	-20.000000	1	0.320000				83	83		492	490	1		1	1		0	0	108	0		1.000000	9.930824e-01	0	14	0	33	0	83	492
KRT38	8687	broad.mit.edu	37	17	39596736	39596736	+	Silent	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr17:39596736G>A	ENST00000246646.3	-	1	437	c.438C>T	c.(436-438)acC>acT	p.T146T		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	146	Linker 1.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				CGGGGCACACGGTGGACTCGT	0.612																																						ENST00000246646.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				29						c.(436-438)acC>acT		keratin 38							122.0	103.0	109.0					17																	39596736		2203	4300	6503	SO:0001819	synonymous_variant	8687	1	121412	30				g.chr17:39596736G>A	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.438C>T	chr17.hg19:g.39596736G>A		1						p.T146T	NM_006771.3	NP_006762.3	2	2	4	2.339107	O76015	KRT38_HUMAN		1	437	-		Breast(137;0.000496)	A2RRM5|Q6A164	Silent	SNP	ENST00000246646.3	1	1	hg19	c.438C>T	CCDS11392.1	1																																																																																								0.484848		TCGA-IB-7646-01A-11D-2154-08	0.612	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	1	0	1		2	2	2	0		0	0	87		87	86	1	2.940000	-4.109453	1	0.320000	NM_006771			132	132		441	436	1		1			0	0	87	0		1.000000	0	0	0	0	0	0	132	441
DHX40	79665	broad.mit.edu	37	17	57650476	57650476	+	Splice_Site	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr17:57650476G>A	ENST00000251241.4	+	4	573		c.e4-1		DHX40_ENST00000425628.3_Splice_Site|DHX40_ENST00000451169.2_Splice_Site	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40								ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTGAACATTAGGAGACAGCAA	0.368																																						ENST00000251241.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				20						c.e4-1		DEAH (Asp-Glu-Ala-His) box polypeptide 40							81.0	86.0	84.0					17																	57650476		2203	4296	6499	SO:0001630	splice_region_variant	79665	0	0					g.chr17:57650476G>A	AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.427-1G>A	chr17.hg19:g.57650476G>A		1					DHX40_ENST00000451169.2_Splice_Site|DHX40_ENST00000425628.3_Splice_Site		NM_024612.4	NP_078888.4	2	2	4	2.320145	Q8IX18	DHX40_HUMAN		4	573	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Splice_Site	SNP	ENST00000251241.4	1	1	hg19		CCDS11617.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491702	0.84962	.	.	ENSG00000108406	ENST00000251241;ENST00000538926;ENST00000425628;ENST00000451169	.	.	.	6.06	6.06	0.98353	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	DHX40	55005258	55005258	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.301000	0.96167	2.882000	0.98803	0.655000	0.94253	.	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.368	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446095.1	1	0	1		2	2	2	0		0	0	82		82	97	1	2.940000	-4.495206	1	0.320000	NM_024612	Intron		185	161		622	539	0		1	1		0	0	82	0		1.000000	4.169214e-01	0	6	0	0	0	185	622
TP53	7157	broad.mit.edu	37	17	7577517	7577517	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr17:7577517A>G	ENST00000269305.4	-	7	953	c.764T>C	c.(763-765)aTc>aCc	p.I255T	TP53_ENST00000420246.2_Missense_Mutation_p.I255T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.I255T|TP53_ENST00000359597.4_Missense_Mutation_p.I255T|TP53_ENST00000413465.2_Missense_Mutation_p.I255T|TP53_ENST00000455263.2_Missense_Mutation_p.I255T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	255	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I255S(10)|p.0?(8)|p.I255T(7)|p.I255del(7)|p.I255N(7)|p.I255fs*8(1)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCAGTGTGATGATGGTGAG	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		44	Substitution - Missense(24)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(2)|Unknown(1)	p.I255S(10)|p.0?(8)|p.I255T(7)|p.I255del(7)|p.I255N(7)|p.I255fs*8(1)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)	breast(10)|pancreas(6)|ovary(4)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|oesophagus(2)|lung(2)|thyroid(1)|stomach(1)|liver(1)|endometrium(1)|skin(1)	24185						c.(763-765)aTc>aCc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						145.0	104.0	118.0					17																	7577517		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577517A>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.764T>C	chr17.hg19:g.7577517A>G	ENSP00000269305:p.Ile255Thr	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.I255T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.I255T|TP53_ENST00000420246.2_Missense_Mutation_p.I255T|TP53_ENST00000359597.4_Missense_Mutation_p.I255T|TP53_ENST00000413465.2_Missense_Mutation_p.I255T	p.I255T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.820247	P04637	P53_HUMAN		7	953	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.764T>C	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	A	16.48	3.136463	0.56936	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99812	-6.88;-6.88;-6.88;-6.88;-6.88;-6.88;-6.88	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.058771	0.64402	D	0.000004	D	0.99704	0.9887	M	0.82630	2.6	0.58432	D	0.999994	D;D;D;D;D	0.89917	0.999;0.981;0.998;0.999;1.0	D;P;D;D;D	0.87578	0.995;0.901;0.992;0.998;0.997	D	0.97329	0.9949	10	0.87932	D	0	-21.9257	12.3101	0.54924	1.0:0.0:0.0:0.0	.	255;255;255;255;255	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	T	255;255;255;255;255;255;244;123	ENSP00000410739:I255T;ENSP00000352610:I255T;ENSP00000269305:I255T;ENSP00000398846:I255T;ENSP00000391127:I255T;ENSP00000391478:I255T;ENSP00000425104:I123T	ENSP00000269305:I255T	I	-	2	0	0	TP53	7518242	7518242	1.000000	0.71417	0.998000	0.56505	0.393000	0.30537	9.087000	0.94110	2.074000	0.62210	0.379000	0.24179	ATC	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	49		49	49	1	2.940000	-20.000000	1	0.320000	NM_000546			59	59		161	161	1		1	1	1	0	0	49	708		1.000000	1	1	67	341	38	526	59	161
QRICH2	84074	broad.mit.edu	37	17	74283929	74283929	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr17:74283929C>G	ENST00000262765.5	-	6	3529	c.3350G>C	c.(3349-3351)gGg>gCg	p.G1117A		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1117										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CAGTTCCTTCCCTGCTTCTTG	0.562																																						ENST00000262765.5	0.520000	0.210000	4.400000e-01	2.800000e-01	0.350000	0.365462	0.350000	0.360000																										0				62						c.(3349-3351)gGg>gCg		glutamine rich 2							237.0	160.0	186.0					17																	74283929		2203	4300	6503	SO:0001583	missense	84074	0	0					g.chr17:74283929C>G	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3350G>C	chr17.hg19:g.74283929C>G	ENSP00000262765:p.Gly1117Ala	1						p.G1117A	NM_032134.1	NP_115510.1	2	2	4	2.325129	Q9H0J4	QRIC2_HUMAN		6	3529	-			A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	1	1	hg19	c.3350G>C	CCDS32741.1	0	.	.	.	.	.	.	.	.	.	.	C	10.70	1.423478	0.25639	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.61158	2.14;0.13	4.8	2.41	0.29592	4.8	2.41	0.29592	.	.	.	.	.	T	0.52901	0.1763	N	0.20986	0.625	0.09310	N	1	D;D	0.55605	0.972;0.972	P;P	0.58210	0.831;0.835	T	0.34477	-0.9827	9	0.33141	T	0.24	-11.7068	6.6966	0.23203	0.0:0.6871:0.0:0.3129	.	1117;1117	B5MD94;Q9H0J4	.;QRIC2_HUMAN	A	1117;125;1117	ENSP00000262765:G1117A;ENSP00000394461:G125A	ENSP00000262765:G1117A	G	-	2	0	0	QRICH2	71795524	71795524	0.004000	0.15560	0.622000	0.29159	0.024000	0.10985	0.401000	0.20948	1.001000	0.39076	0.462000	0.41574	GGG	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.562	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	0	0	1		2	2	2	0		0	0	71		71	71	1	2.940000	-2.780968	1	0.320000	NM_032134			20	18		451	445	0		1			0	0	71	0		0.999995	0	0	0	0	0	0	20	451
OSBPL1A	114876	broad.mit.edu	37	18	21745034	21745034	+	Silent	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr18:21745034C>T	ENST00000319481.3	-	27	2951	c.2745G>A	c.(2743-2745)aaG>aaA	p.K915K	RP11-799B12.4_ENST00000583267.1_lincRNA|OSBPL1A_ENST00000357041.4_Silent_p.K533K|OSBPL1A_ENST00000399443.3_Silent_p.K402K	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	915					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CGCACCTCGTCTTCCAGTCCT	0.522																																						ENST00000319481.3	0.870000	0.600000	8.100000e-01	6.600000e-01	0.730000	0.740882	0.730000	0.730000																										0				36						c.(2743-2745)aaG>aaA		oxysterol binding protein-like 1A							245.0	223.0	230.0					18																	21745034		2203	4300	6503	SO:0001819	synonymous_variant	114876	0	0					g.chr18:21745034C>T	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2745G>A	chr18.hg19:g.21745034C>T		1					OSBPL1A_ENST00000357041.4_Silent_p.K533K|OSBPL1A_ENST00000399443.3_Silent_p.K402K|RP11-799B12.4_ENST00000583267.1_lincRNA	p.K915K	NM_080597.3	NP_542164.2	1	2	3	2.061329	Q9BXW6	OSBL1_HUMAN		27	2951	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	1	0	hg19	c.2745G>A	CCDS11884.1	0																																																																																								0.413793		TCGA-IB-7646-01A-11D-2154-08	0.522	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	1	0	0		2	2	2	0		0	0	167		167	165	1	2.940000	-20.000000	1	0.320000	NM_080597			109	115		964	948	0		1	0		0	0	167	0		1.000000	9.874380e-01	0	0	0	61	0	109	964
TMEM200C	645369	broad.mit.edu	37	18	5892008	5892008	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr18:5892008G>A	ENST00000581347.2	-	3	700	c.55C>T	c.(55-57)Cgc>Tgc	p.R19C	RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.R19C			A6NKL6	T200C_HUMAN	transmembrane protein 200C	19						integral component of membrane (GO:0016021)		p.R19S(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						CTTGGGGGGCGGAGTGGATCC	0.607																																						ENST00000581347.2	1.000000	0.560000	1	7.200000e-01	0.900000	0.878285	0.900000	1.000000																										1	Substitution - Missense(1)	p.R19S(1)	stomach(1)	12						c.(55-57)Cgc>Tgc		transmembrane protein 200C							62.0	66.0	65.0					18																	5892008		2058	4208	6266	SO:0001583	missense	645369	0	0					g.chr18:5892008G>A		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.55C>T	chr18.hg19:g.5892008G>A	ENSP00000463375:p.Arg19Cys	1					RP11-945C19.4_ENST00000577694.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.R19C|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA	p.R19C			1	2	3	2.061329	A6NKL6	T200C_HUMAN		3	700	-				Missense_Mutation	SNP	ENST00000581347.2	0	1	hg19	c.55C>T	CCDS45825.1	1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361603	0.61403	.	.	ENSG00000206432	ENST00000383490	.	.	.	4.3	4.3	0.51218	4.3	4.3	0.51218	.	0.061497	0.64402	D	0.000004	T	0.74854	0.3771	M	0.65498	2.005	0.49130	D	0.99975	D	0.89917	1.0	D	0.70935	0.971	T	0.77629	-0.2516	9	0.87932	D	0	-9.4438	12.267	0.54684	0.0:0.0:0.6997:0.3003	.	19	A6NKL6	T200C_HUMAN	C	19	.	ENSP00000372982:R19C	R	-	1	0	0	TMEM200C	5882008	5882008	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	2.903000	0.48711	2.376000	0.81061	0.557000	0.71058	CGC	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.607	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441917.4	1	0	1		2	2	2	0		0	0	17		17	17	1	2.940000	-3.080264	1	0.320000	NM_001080209			18	18		127	126	1		1	0		0	0	17	0		0.999986	8.514661e-02	0	0	0	4	0	18	127
OSBPL1A	114876	broad.mit.edu	37	18	21745037	21745037	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr18:21745037C>A	ENST00000319481.3	-	27	2948	c.2742G>T	c.(2740-2742)tgG>tgT	p.W914C	RP11-799B12.4_ENST00000583267.1_lincRNA|OSBPL1A_ENST00000357041.4_Missense_Mutation_p.W532C|OSBPL1A_ENST00000399443.3_Missense_Mutation_p.W401C	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	914					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					ACCTCGTCTTCCAGTCCTCTT	0.522																																						ENST00000319481.3	0.910000	0.640000	8.500000e-01	7.000000e-01	0.770000	0.781353	0.770000	0.780000																										0				36						c.(2740-2742)tgG>tgT		oxysterol binding protein-like 1A							249.0	226.0	234.0					18																	21745037		2203	4300	6503	SO:0001583	missense	114876	0	0					g.chr18:21745037C>A	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2742G>T	chr18.hg19:g.21745037C>A	ENSP00000320291:p.Trp914Cys	1					OSBPL1A_ENST00000357041.4_Missense_Mutation_p.W532C|OSBPL1A_ENST00000399443.3_Missense_Mutation_p.W401C|RP11-799B12.4_ENST00000583267.1_lincRNA	p.W914C	NM_080597.3	NP_542164.2	1	2	3	2.061329	Q9BXW6	OSBL1_HUMAN		27	2948	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	1	0	hg19	c.2742G>T	CCDS11884.1	0	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290514	0.80914	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.41758	0.99;0.99;0.99	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.78767	0.4335	H	0.97611	4.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86277	0.1665	10	0.87932	D	0	-11.1594	19.6244	0.95672	0.0:1.0:0.0:0.0	.	914	Q9BXW6	OSBL1_HUMAN	C	914;401;532	ENSP00000320291:W914C;ENSP00000382372:W401C;ENSP00000349545:W532C	ENSP00000320291:W914C	W	-	3	0	0	OSBPL1A	19999035	19999035	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.783000	0.85696	2.631000	0.89168	0.491000	0.48974	TGG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.522	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	1	0	0		2	2	2	0		0	0	166		166	163	1	2.940000	-20.000000	1	0.320000	NM_080597			119	118		991	971	0		1	0		0	0	166	0		1.000000	9.889558e-01	0	0	0	59	0	119	991
TMEM38A	79041	broad.mit.edu	37	19	16797152	16797152	+	Missense_Mutation	SNP	G	G	A	rs78725797		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr19:16797152G>A	ENST00000187762.2	+	5	699	c.608G>A	c.(607-609)cGc>cAc	p.R203H		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	203						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						CAGCAGACCCGCTGGCTCCCA	0.562																																						ENST00000187762.2	1.000000	0.060000	3.800000e-01	1.200000e-01	0.190000	0.309946	0.190000	0.170000																										0				15						c.(607-609)cGc>cAc		transmembrane protein 38A		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	131.0	95.0	107.0		608	3.8	1.0	19	dbSNP_131	107	0,8600		0,0,4300	no	missense	TMEM38A	NM_024074.1	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	203/300	16797152	1,13005	2203	4300	6503	SO:0001583	missense	79041	2	121412	34				g.chr19:16797152G>A	AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.608G>A	chr19.hg19:g.16797152G>A	ENSP00000187762:p.Arg203His	0						p.R203H	NM_024074.1	NP_076979.1	2	2	4	1.832396	Q9H6F2	TM38A_HUMAN		5	699	+			A8K9P9	Missense_Mutation	SNP	ENST00000187762.2	0	1	hg19	c.608G>A	CCDS12349.1	0	.	.	.	.	.	.	.	.	.	.	g	9.106	1.005306	0.19199	2.27E-4	0.0	ENSG00000072954	ENST00000187762	.	.	.	4.87	3.84	0.44239	4.87	3.84	0.44239	.	0.110837	0.64402	D	0.000011	T	0.15349	0.0370	N	0.00869	-1.13	0.36185	D	0.849713	B	0.11235	0.004	B	0.08055	0.003	T	0.09907	-1.0653	9	0.33940	T	0.23	-42.5728	5.1808	0.15160	0.2785:0.0:0.7215:0.0	.	203	Q9H6F2	TM38A_HUMAN	H	203	.	ENSP00000187762:R203H	R	+	2	0	0	TMEM38A	16658152	16658152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.170000	0.58229	2.257000	0.74773	0.655000	0.94253	CGC	0.357035		TCGA-IB-7646-01A-11D-2154-08	0.562	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462841.1	0	0	1		2	2	2	0		0	0	31		31	31	1	2.940000	-3.148671	1	0.320000	NM_024074			5	5		191	189	0		1	0		0	0	31	0		0.936663	5.367631e-02	0	0	0	12	0	5	191
CKM	1158	broad.mit.edu	37	19	45818781	45818781	+	Silent	SNP	C	C	T	rs376033705		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr19:45818781C>T	ENST00000221476.3	-	4	597	c.423G>A	c.(421-423)acG>acA	p.T141T		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	141	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	GTGGGGGCAACGTGTAGCCCT	0.682																																						ENST00000221476.3	1.000000	0.640000	1	8.100000e-01	0.990000	0.930601	0.990000	1.000000																										0				17						c.(421-423)acG>acA		creatine kinase, muscle	Creatine(DB00148)	C		0,4406		0,0,2203	42.0	41.0	41.0		423	-6.6	0.9	19		41	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CKM	NM_001824.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		141/382	45818781	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1158	20	121344	43				g.chr19:45818781C>T	M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.423G>A	chr19.hg19:g.45818781C>T		1						p.T141T	NM_001824.4	NP_001815.2	2	2	4	1.858363	P06732	KCRM_HUMAN		4	597	-		Ovarian(192;0.0336)|all_neural(266;0.112)	Q96QL9	Silent	SNP	ENST00000221476.3	1	1	hg19	c.423G>A	CCDS12659.1	1																																																																																								0.364723		TCGA-IB-7646-01A-11D-2154-08	0.682	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457569.1	1	0	1		2	2	2	0		0	0	18		18	18	1	2.940000	-20.000000	1	0.320000				21	21		124	123	0		1			0	0	18	0		0.999999	0	0	0	0	0	0	21	124
ADAMTS10	81794	broad.mit.edu	37	19	8666006	8666006	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr19:8666006G>T	ENST00000597188.1	-	6	886	c.616C>A	c.(616-618)Cca>Aca	p.P206T	ADAMTS10_ENST00000596709.1_5'UTR|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.P206T	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	206						extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						AGCCACCATGGCCGCCCTTTC	0.627																																						ENST00000597188.1	1.000000	0.750000	1	9.000000e-01	0.990000	0.966347	0.990000	1.000000																										0				53						c.(616-618)Cca>Aca		ADAM metallopeptidase with thrombospondin type 1 motif, 10							27.0	28.0	28.0					19																	8666006		2202	4298	6500	SO:0001583	missense	81794	0	0					g.chr19:8666006G>T	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.616C>A	chr19.hg19:g.8666006G>T	ENSP00000471851:p.Pro206Thr	1					ADAMTS10_ENST00000270328.4_Missense_Mutation_p.P206T|ADAMTS10_ENST00000596709.1_5'UTR	p.P206T	NM_030957.2	NP_112219.3	2	2	4	1.862622	Q9H324	ATS10_HUMAN		6	886	-			M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	1	1	hg19	c.616C>A	CCDS12206.1	1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.757132	0.31137	.	.	ENSG00000142303	ENST00000270328	T	0.59502	0.26	5.47	5.47	0.80525	5.47	5.47	0.80525	.	0.254626	0.32401	N	0.006146	T	0.47210	0.1433	L	0.34521	1.04	0.28790	N	0.899372	B	0.06786	0.001	B	0.08055	0.003	T	0.24621	-1.0155	10	0.12766	T	0.61	.	18.3275	0.90259	0.0:0.0:1.0:0.0	.	206	Q9H324	ATS10_HUMAN	T	206	ENSP00000270328:P206T	ENSP00000270328:P206T	P	-	1	0	0	ADAMTS10	8572006	8572006	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	3.922000	0.56462	2.575000	0.86900	0.555000	0.69702	CCA	0.366617		TCGA-IB-7646-01A-11D-2154-08	0.627	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	1	0	1		2	2	2	0		0	0	32		32	32	1	2.940000	-20.000000	1	0.320000	NM_030957			33	32		179	175	1		1			0	0	32	0		1.000000	0	0	0	0	0	0	33	179
MYH14	79784	broad.mit.edu	37	19	50812427	50812427	+	Missense_Mutation	SNP	C	C	T	rs369147236		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr19:50812427C>T	ENST00000596571.1	+	39	5830	c.5830C>T	c.(5830-5832)Cgg>Tgg	p.R1944W	MYH14_ENST00000425460.1_Missense_Mutation_p.R1952W|MYH14_ENST00000440075.2_Missense_Mutation_p.R1985W|MYH14_ENST00000262269.8_Missense_Mutation_p.R1985W|MYH14_ENST00000598205.1_Missense_Mutation_p.R1952W|MYH14_ENST00000601313.1_Missense_Mutation_p.R1985W|CTB-191K22.5_ENST00000595563.1_RNA|MYH14_ENST00000376970.2_Missense_Mutation_p.R1977W			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1944					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ACTGAGGAACCGGCTTCGGTA	0.642																																						ENST00000596571.1	1.000000	0.660000	1	7.600000e-01	0.890000	0.888921	0.890000	1.000000																										0				46						c.(5830-5832)Cgg>Tgg		myosin, heavy chain 14, non-muscle		C	TRP/ARG,TRP/ARG,TRP/ARG	0,4210		0,0,2105	97.0	97.0	97.0		5854,5953,5830	1.4	1.0	19		97	1,8473		0,1,4236	no	missense,missense,missense	MYH14	NM_001077186.1,NM_001145809.1,NM_024729.3	101,101,101	0,1,6341	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging,probably-damaging,probably-damaging	1952/2004,1985/2037,1944/1996	50812427	1,12683	2105	4237	6342	SO:0001583	missense	79784	0	0					g.chr19:50812427C>T	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5830C>T	chr19.hg19:g.50812427C>T	ENSP00000472819:p.Arg1944Trp	1					MYH14_ENST00000440075.2_Missense_Mutation_p.R1985W|MYH14_ENST00000425460.1_Missense_Mutation_p.R1952W|MYH14_ENST00000601313.1_Missense_Mutation_p.R1985W|MYH14_ENST00000376970.2_Missense_Mutation_p.R1977W|MYH14_ENST00000262269.8_Missense_Mutation_p.R1985W|CTB-191K22.5_ENST00000595563.1_RNA|MYH14_ENST00000598205.1_Missense_Mutation_p.R1952W	p.R1944W			2	2	4	1.858363	Q7Z406	MYH14_HUMAN		39	5830	+		all_neural(266;0.0571)|Ovarian(192;0.0728)	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	1	1	hg19	c.5830C>T	CCDS59411.1	1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854163	0.51270	0.0	1.18E-4	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	3.69	1.35	0.21983	3.69	1.35	0.21983	Myosin tail (1);	.	.	.	.	D	0.83482	0.5264	L	0.58510	1.815	0.30649	N	0.755608	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.968;0.987;0.978	T	0.78743	-0.2085	9	0.87932	D	0	.	9.3434	0.38093	0.5854:0.4146:0.0:0.0	.	1985;1944;1952	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	W	1985;1977;1952;1728;1985	ENSP00000406273:R1985W;ENSP00000366169:R1977W;ENSP00000407879:R1952W;ENSP00000262269:R1985W	ENSP00000262269:R1985W	R	+	1	2	2	MYH14	55504239	55504239	0.000000	0.05858	1.000000	0.80357	0.770000	0.43624	-0.299000	0.08254	0.293000	0.22520	0.313000	0.20887	CGG	0.364723		TCGA-IB-7646-01A-11D-2154-08	0.642	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	1	0	1		2	2	2	0		0	0	79		79	79	1	2.940000	-2.807013	1	0.320000	NM_024729			48	48		322	318	1		1	1		0	0	79	0		1.000000	7.762845e-01	0	11	0	10	0	48	322
USH2A	7399	broad.mit.edu	37	1	216496975	216496975	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr1:216496975C>T	ENST00000307340.3	-	8	1777	c.1391G>A	c.(1390-1392)cGt>cAt	p.R464H	USH2A_ENST00000366943.2_Missense_Mutation_p.R464H|USH2A_ENST00000366942.3_Missense_Mutation_p.R464H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	464	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.		R -> C (in USH2A; unknown pathological significance). {ECO:0000269|PubMed:15325563}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTATCCAGGACGATAATTTGG	0.373										HNSCC(13;0.011)																												ENST00000307340.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				527						c.(1390-1392)cGt>cAt		Usher syndrome 2A (autosomal recessive, mild)							138.0	140.0	140.0					1																	216496975		2203	4300	6503	SO:0001583	missense	7399	3	121410	41				g.chr1:216496975C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1391G>A	chr1.hg19:g.216496975C>T	ENSP00000305941:p.Arg464His	1	HNSCC(13;0.011)				USH2A_ENST00000366943.2_Missense_Mutation_p.R464H|USH2A_ENST00000366942.3_Missense_Mutation_p.R464H	p.R464H	NM_206933.2	NP_996816	3	3	6	2.355163	O75445	USH2A_HUMAN		8	1777	-			Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	1	1	hg19	c.1391G>A	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.143821	0.94603	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.25579	2.16;2.15;1.79	5.23	5.23	0.72850	5.23	5.23	0.72850	Laminin, N-terminal (3);	0.000000	0.42420	D	0.000719	T	0.61986	0.2391	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	T	0.72093	-0.4394	10	0.87932	D	0	.	18.8157	0.92076	0.0:1.0:0.0:0.0	.	464;464	O75445-2;O75445	.;USH2A_HUMAN	H	464	ENSP00000305941:R464H;ENSP00000355910:R464H;ENSP00000355909:R464H	ENSP00000305941:R464H	R	-	2	0	0	USH2A	214563598	214563598	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	5.485000	0.66850	2.424000	0.82194	0.655000	0.94253	CGT	0.499411		TCGA-IB-7646-01A-11D-2154-08	0.373	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	1	0	1		2	2	2	0		0	0	82		82	82	1	2.940000	-20.000000	1	0.320000	NM_007123			179	179		648	641	1		1			0	0	82	0		1.000000	0	0	0	0	0	0	179	648
OR1C1	26188	broad.mit.edu	37	1	247920822	247920822	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr1:247920822T>C	ENST00000408896.2	-	1	1160	c.887A>G	c.(886-888)gAt>gGt	p.D296G		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	296					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CCTCTTCATATCCCTGTTCCT	0.428																																						ENST00000408896.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				46						c.(886-888)gAt>gGt		olfactory receptor, family 1, subfamily C, member 1							146.0	135.0	138.0					1																	247920822		1917	4142	6059	SO:0001583	missense	26188	0	0					g.chr1:247920822T>C	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.887A>G	chr1.hg19:g.247920822T>C	ENSP00000386138:p.Asp296Gly	1						p.D296G	NM_012353.2	NP_036485.2	2	2	4	2.321657	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)	1	1160	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	1	1	hg19	c.887A>G	CCDS41481.1	1	.	.	.	.	.	.	.	.	.	.	T	9.331	1.060439	0.19987	.	.	ENSG00000221888	ENST00000408896	T	0.39592	1.07	3.22	0.691	0.18045	3.22	0.691	0.18045	.	.	.	.	.	T	0.59500	0.2198	M	0.70903	2.155	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.49854	-0.8895	9	0.87932	D	0	.	9.657	0.39932	0.0:0.0:0.3383:0.6617	.	296	Q15619	OR1C1_HUMAN	G	296	ENSP00000386138:D296G	ENSP00000386138:D296G	D	-	2	0	0	OR1C1	245987445	245987445	0.376000	0.25098	0.048000	0.18961	0.024000	0.10985	2.018000	0.40991	0.017000	0.15025	-1.419000	0.01111	GAT	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.428	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1	1	0	1		2	2	2	0		0	0	82		82	82	1	2.940000	-20.000000	1	0.320000				143	143		560	554	1		1			0	0	82	0		1.000000	0	0	0	0	0	0	143	560
MATN4	8785	broad.mit.edu	37	20	43933094	43933094	+	Silent	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr20:43933094C>T	ENST00000372754.1	-	2	425	c.417G>A	c.(415-417)ccG>ccA	p.P139P	MATN4_ENST00000360607.6_Silent_p.P139P|MATN4_ENST00000537548.1_Silent_p.P139P|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000342716.4_Silent_p.P139P|RBPJL_ENST00000343694.3_5'Flank|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000353917.5_Silent_p.P139P|MATN4_ENST00000372756.1_Silent_p.P139P|MATN4_ENST00000372751.4_Intron			O95460	MATN4_HUMAN	matrilin 4	139	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				CAGCGACACGCGGCACGCGCT	0.701																																						ENST00000372754.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				27						c.(415-417)ccG>ccA		matrilin 4							8.0	8.0	8.0					20																	43933094		2125	4135	6260	SO:0001819	synonymous_variant	8785	1	119296	25				g.chr20:43933094C>T	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.417G>A	chr20.hg19:g.43933094C>T		1					RBPJL_ENST00000343694.3_5'Flank|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000537548.1_Silent_p.P139P|MATN4_ENST00000353917.5_Silent_p.P139P|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000372756.1_Silent_p.P139P|MATN4_ENST00000342716.4_Silent_p.P139P|MATN4_ENST00000360607.6_Silent_p.P139P|RBPJL_ENST00000372741.3_5'Flank	p.P139P			2	2	4	2.292060	O95460	MATN4_HUMAN		2	425	-		Myeloproliferative disorder(115;0.0122)	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	ENST00000372754.1	1	1	hg19	c.417G>A		1																																																																																								0.484848		TCGA-IB-7646-01A-11D-2154-08	0.701	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1	1	0	1		2	2	2	0		0	0	12		12	12	1	2.940000	-20.000000	1	0.320000				32	31		65	65	1		1			0	0	12	0		1.000000	0	0	0	0	0	0	32	65
TSHZ2	128553	broad.mit.edu	37	20	51870106	51870106	+	Missense_Mutation	SNP	G	G	A	rs201799053		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr20:51870106G>A	ENST00000371497.5	+	2	996	c.109G>A	c.(109-111)Ggt>Agt	p.G37S	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.G34S|TSHZ2_ENST00000329613.6_Missense_Mutation_p.G34S	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	37					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			ggaggaCAGCGGTTCAGTAGC	0.532																																						ENST00000371497.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				84						c.(109-111)Ggt>Agt		teashirt zinc finger homeobox 2		G	SER/GLY,SER/GLY	0,4406		0,0,2203	67.0	63.0	65.0		100,109	4.7	0.9	20		65	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	TSHZ2	NM_001193421.1,NM_173485.5	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	34/1032,37/1035	51870106	1,13005	2203	4300	6503	SO:0001583	missense	128553	5	121412	38				g.chr20:51870106G>A	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.109G>A	chr20.hg19:g.51870106G>A	ENSP00000360552:p.Gly37Ser	1					TSHZ2_ENST00000603338.2_Missense_Mutation_p.G34S|TSHZ2_ENST00000329613.6_Missense_Mutation_p.G34S|RP4-678D15.1_ENST00000606932.1_RNA	p.G37S	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	2	2	4	2.292060	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)	2	996	+			B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	1	1	hg19	c.109G>A	CCDS33490.1	1	.	.	.	.	.	.	.	.	.	.	G	5.295	0.239845	0.10023	0.0	1.16E-4	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.14022	2.55;2.54	5.7	4.66	0.58398	5.7	4.66	0.58398	.	0.302267	0.35615	N	0.003083	T	0.08670	0.0215	L	0.29908	0.895	0.30185	N	0.800061	B	0.19200	0.034	B	0.08055	0.003	T	0.04900	-1.0919	10	0.48119	T	0.1	-17.7222	3.7522	0.08570	0.3374:0.0:0.6626:0.0	.	37	Q9NRE2	TSH2_HUMAN	S	37;34	ENSP00000360552:G37S;ENSP00000333114:G34S	ENSP00000333114:G34S	G	+	1	0	0	TSHZ2	51303513	51303513	0.992000	0.36948	0.935000	0.37517	0.345000	0.29048	2.759000	0.47573	2.685000	0.91497	0.643000	0.83706	GGT	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.532	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	1	0	1		2	2	2	0		0	0	23		23	23	1	2.940000	-20.000000	1	0.320000	NM_173485			46	46		162	161	1		1	0		0	0	23	0		1.000000	5.607157e-01	0	1	0	7	0	46	162
PHACTR3	116154	broad.mit.edu	37	20	58342409	58342409	+	Missense_Mutation	SNP	C	C	T	rs139799389	byFrequency	TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr20:58342409C>T	ENST00000371015.1	+	5	1177	c.710C>T	c.(709-711)cCg>cTg	p.P237L	PHACTR3_ENST00000359926.3_Missense_Mutation_p.P234L|PHACTR3_ENST00000395636.2_Missense_Mutation_p.P196L|PHACTR3_ENST00000355648.4_Missense_Mutation_p.P196L|PHACTR3_ENST00000361300.4_Intron|PHACTR3_ENST00000541461.1_Missense_Mutation_p.P196L|PHACTR3_ENST00000395639.4_Intron	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	237	Pro-rich.					nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CTGCCCACTCCGCCACCCAAG	0.587													C|||	4	0.000798722	0.0015	0.0014	5008	,	,		18475	0.0		0.0	False		,,,				2504	0.001					ENST00000371015.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				59						c.(709-711)cCg>cTg		phosphatase and actin regulator 3		C	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,	1,4403		0,1,2201	31.0	29.0	30.0		701,587,710,587,	4.7	0.8	20	dbSNP_134	30	16,8584		0,16,4284	yes	missense,missense,missense,missense,intron	PHACTR3	NM_001199505.1,NM_001199506.1,NM_080672.3,NM_183244.1,NM_183246.1	98,98,98,98,	0,17,6485	TT,TC,CC		0.186,0.0227,0.1307	probably-damaging,probably-damaging,probably-damaging,probably-damaging,	234/557,196/519,237/560,196/519,	58342409	17,12987	2202	4300	6502	SO:0001583	missense	116154	74	121406	48				g.chr20:58342409C>T	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.710C>T	chr20.hg19:g.58342409C>T	ENSP00000360054:p.Pro237Leu	1					PHACTR3_ENST00000395639.4_Intron|PHACTR3_ENST00000355648.4_Missense_Mutation_p.P196L|PHACTR3_ENST00000361300.4_Intron|PHACTR3_ENST00000359926.3_Missense_Mutation_p.P234L|PHACTR3_ENST00000541461.1_Missense_Mutation_p.P196L|PHACTR3_ENST00000395636.2_Missense_Mutation_p.P196L	p.P237L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	2	2	4	2.292060	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)	5	1177	+	all_lung(29;0.00344)		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	1	0	hg19	c.710C>T	CCDS13480.1	1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	14.73	2.621533	0.46736	2.27E-4	0.00186	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000541461;ENST00000355648;ENST00000395636	T;T;T;T;T	0.23147	1.92;1.93;1.93;1.93;1.93	4.7	4.7	0.59300	4.7	4.7	0.59300	.	0.109577	0.64402	D	0.000006	T	0.24774	0.0601	M	0.63428	1.95	0.80722	D	1	P;B	0.38300	0.626;0.42	B;B	0.25506	0.059;0.061	T	0.11792	-1.0573	10	0.42905	T	0.14	-17.6812	16.6343	0.85042	0.0:1.0:0.0:0.0	.	237;234	Q96KR7;B1AKX0	PHAR3_HUMAN;.	L	234;237;196;196;196	ENSP00000353002:P234L;ENSP00000360054:P237L;ENSP00000442483:P196L;ENSP00000347866:P196L;ENSP00000378998:P196L	ENSP00000347866:P196L	P	+	2	0	0	PHACTR3	57775804	57775804	0.986000	0.35501	0.836000	0.33094	0.972000	0.66771	3.474000	0.53129	2.166000	0.68216	0.460000	0.39030	CCG	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.587	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	0	0	1		2	2	2	0		0	0	28		28	28	1	2.940000	-2.761986	1	0.320000	NM_080672			55	55		201	200	1		1			0	0	28	0		1.000000	0	0	0	0	0	0	55	201
SLC5A3	6526	broad.mit.edu	37	21	35469256	35469256	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr21:35469256C>T	ENST00000381151.3	+	2	2271	c.1759C>T	c.(1759-1761)Ccc>Tcc	p.P587S	AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.P587S|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	587					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						CCACATCATTCCCAACGGGAA	0.473																																						ENST00000381151.3	0.940000	0.570000	8.500000e-01	6.600000e-01	0.750000	0.760343	0.750000	0.750000																										0				20						c.(1759-1761)Ccc>Tcc		solute carrier family 5 (sodium/myo-inositol cotransporter), member 3							131.0	116.0	121.0					21																	35469256		2203	4300	6503	SO:0001583	missense	6526	0	0					g.chr21:35469256C>T		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1759C>T	chr21.hg19:g.35469256C>T	ENSP00000370543:p.Pro587Ser	1					MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.P587S	p.P587S			0	1	1	1.551330	P53794	SC5A3_HUMAN		2	2271	+			O43489	Missense_Mutation	SNP	ENST00000381151.3	1	0	hg19	c.1759C>T	CCDS33549.1	0	.	.	.	.	.	.	.	.	.	.	C	14.06	2.422391	0.43020	.	.	ENSG00000198743	ENST00000381151	D	0.85556	-2.0	6.06	6.06	0.98353	6.06	6.06	0.98353	.	0.578471	0.16748	N	0.201173	T	0.76499	0.3996	L	0.34521	1.04	0.41674	D	0.989258	B	0.30326	0.276	B	0.21917	0.037	T	0.71199	-0.4663	10	0.14656	T	0.56	.	14.4021	0.67053	0.0:0.9291:0.0:0.0709	.	587	P53794	SC5A3_HUMAN	S	587	ENSP00000370543:P587S	ENSP00000370543:P587S	P	+	1	0	0	SLC5A3	34391126	34391126	0.999000	0.42202	0.985000	0.45067	0.966000	0.64601	1.925000	0.40074	2.885000	0.99019	0.643000	0.83706	CCC	0.196597		TCGA-IB-7646-01A-11D-2154-08	0.473	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1	1	0	0		2	2	2	0		0	0	93		93	92	1	2.940000	-19.999420	1	0.320000				52	57		310	308	1		1	1		0	0	93	0		1.000000	2.140893e-01	0	3	0	3	0	52	310
FN1	2335	broad.mit.edu	37	2	216288871	216288871	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr2:216288871G>A	ENST00000359671.1	-	8	1479	c.1214C>T	c.(1213-1215)aCt>aTt	p.T405I	FN1_ENST00000356005.4_Missense_Mutation_p.T405I|FN1_ENST00000345488.5_Missense_Mutation_p.T405I|FN1_ENST00000357867.4_Missense_Mutation_p.T405I|FN1_ENST00000336916.4_Missense_Mutation_p.T405I|FN1_ENST00000354785.4_Missense_Mutation_p.T405I|FN1_ENST00000446046.1_Missense_Mutation_p.T405I|FN1_ENST00000426059.1_Missense_Mutation_p.T405I|FN1_ENST00000346544.3_Missense_Mutation_p.T405I|FN1_ENST00000357009.2_Missense_Mutation_p.T405I|FN1_ENST00000432072.2_Missense_Mutation_p.T405I|FN1_ENST00000421182.1_Missense_Mutation_p.T405I|FN1_ENST00000323926.6_Missense_Mutation_p.T405I|FN1_ENST00000443816.1_Missense_Mutation_p.T405I			P02751	FINC_HUMAN	fibronectin 1	405	Collagen-binding.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ACACTCACCAGTGTGGTCTGT	0.488																																						ENST00000359671.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																									FN1/ALK(2)	0				109						c.(1213-1215)aCt>aTt		fibronectin 1	Ocriplasmin(DB08888)						125.0	106.0	113.0					2																	216288871		2203	4300	6503	SO:0001583	missense	2335	0	0					g.chr2:216288871G>A		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1214C>T	chr2.hg19:g.216288871G>A	ENSP00000352696:p.Thr405Ile	1					FN1_ENST00000357867.4_Missense_Mutation_p.T405I|FN1_ENST00000345488.5_Missense_Mutation_p.T405I|FN1_ENST00000336916.4_Missense_Mutation_p.T405I|FN1_ENST00000432072.2_Missense_Mutation_p.T405I|FN1_ENST00000446046.1_Missense_Mutation_p.T405I|FN1_ENST00000357009.2_Missense_Mutation_p.T405I|FN1_ENST00000346544.3_Missense_Mutation_p.T405I|FN1_ENST00000356005.4_Missense_Mutation_p.T405I|FN1_ENST00000323926.6_Missense_Mutation_p.T405I|FN1_ENST00000426059.1_Missense_Mutation_p.T405I|FN1_ENST00000421182.1_Missense_Mutation_p.T405I|FN1_ENST00000443816.1_Missense_Mutation_p.T405I|FN1_ENST00000354785.4_Missense_Mutation_p.T405I	p.T405I			2	2	4	2.161681	P02751	FINC_HUMAN		8	1479	-		Renal(323;0.127)	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	1	1	hg19	c.1214C>T		1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068483	0.76301	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.49432	0.78;2.14;2.32;0.86;2.38;2.02;2.36;2.02;2.31;2.06;1.55;0.85;1.45;1.47	5.97	5.97	0.96955	5.97	5.97	0.96955	.	0.537042	0.19271	N	0.118405	T	0.51822	0.1697	L	0.29908	0.895	0.36489	D	0.868311	B;P;B;D;B;B;P;P;B;B;P	0.60575	0.073;0.839;0.198;0.988;0.265;0.173;0.511;0.843;0.265;0.265;0.715	B;P;B;P;B;B;B;B;B;B;B	0.60609	0.083;0.452;0.135;0.877;0.13;0.061;0.239;0.128;0.13;0.13;0.39	T	0.59156	-0.7507	10	0.66056	D	0.02	.	10.327	0.43798	0.0:0.1207:0.6964:0.1828	.	405;405;405;405;405;405;405;405;405;405;405	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	I	405	ENSP00000394423:T405I;ENSP00000323534:T405I;ENSP00000338200:T405I;ENSP00000350534:T405I;ENSP00000346839:T405I;ENSP00000352696:T405I;ENSP00000265312:T405I;ENSP00000273049:T405I;ENSP00000349509:T405I;ENSP00000410422:T405I;ENSP00000415018:T405I;ENSP00000399538:T405I;ENSP00000348285:T405I;ENSP00000398907:T405I	ENSP00000265313:T405I	T	-	2	0	0	FN1	215997116	215997116	0.995000	0.38212	0.985000	0.45067	0.985000	0.73830	2.437000	0.44828	2.836000	0.97738	0.655000	0.94253	ACT	0.454429		TCGA-IB-7646-01A-11D-2154-08	0.488	FN1-204	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	75		75	75	1	2.940000	-20.000000	1	0.320000	NM_212476			134	133		545	536	1		1	0		0	0	75	0		1.000000	1	0	0	0	6381	0	134	545
ARHGAP31	57514	broad.mit.edu	37	3	119121128	119121128	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr3:119121128G>C	ENST00000264245.4	+	10	2061	c.1529G>C	c.(1528-1530)aGa>aCa	p.R510T		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	510					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						ACGCCGTGCAGAACACCCCCG	0.592																																					Pancreas(7;176 297 5394 51128 51241)	ENST00000264245.4	0.390000	0.120000	3.200000e-01	1.700000e-01	0.240000	0.253511	0.240000	0.240000																										0				67						c.(1528-1530)aGa>aCa		Rho GTPase activating protein 31							47.0	53.0	51.0					3																	119121128		2047	4198	6245	SO:0001583	missense	57514	0	0					g.chr3:119121128G>C		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1529G>C	chr3.hg19:g.119121128G>C	ENSP00000264245:p.Arg510Thr	1						p.R510T	NM_020754.2	NP_065805.2	2	2	4	2.335509	Q2M1Z3	RHG31_HUMAN		10	2061	+			Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	1	1	hg19	c.1529G>C	CCDS43135.1	0	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904142	0.92035	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.18657	2.2	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000002	T	0.45538	0.1347	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.16512	-1.0400	10	0.42905	T	0.14	.	18.1871	0.89796	0.0:0.0:1.0:0.0	.	510	Q2M1Z3	RHG31_HUMAN	T	510	ENSP00000264245:R510T	ENSP00000264245:R510T	R	+	2	0	0	ARHGAP31	120603818	120603818	1.000000	0.71417	0.874000	0.34290	0.996000	0.88848	9.263000	0.95617	2.774000	0.95407	0.655000	0.94253	AGA	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.592	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2	0	0	1		2	2	2	0		0	0	86		86	86	1	2.940000	-11.358160	1	0.320000				12	12		408	406	0		1	0		0	0	86	0		0.999117	7.855959e-02	0	1	0	14	0	12	408
PTPN23	25930	broad.mit.edu	37	3	47453870	47453870	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr3:47453870C>T	ENST00000265562.4	+	23	4353	c.4276C>T	c.(4276-4278)Cgg>Tgg	p.R1426W	PTPN23_ENST00000431726.1_Missense_Mutation_p.R1300W	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1426	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.R1426W(1)		breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCAGCTGGTGCGGCGCATGCG	0.647																																						ENST00000265562.4	0.330000	0.060000	2.500000e-01	1.000000e-01	0.160000	0.181005	0.160000	0.160000																										1	Substitution - Missense(1)	p.R1426W(1)	prostate(1)	23						c.(4276-4278)Cgg>Tgg		protein tyrosine phosphatase, non-receptor type 23							37.0	37.0	37.0					3																	47453870		2203	4300	6503	SO:0001583	missense	25930	1	121390	27				g.chr3:47453870C>T	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.4276C>T	chr3.hg19:g.47453870C>T	ENSP00000265562:p.Arg1426Trp	1					PTPN23_ENST00000431726.1_Missense_Mutation_p.R1300W	p.R1426W	NM_015466.2	NP_056281.1	0	2	2	1.781462	Q9H3S7	PTN23_HUMAN		23	4353	+			A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	0	1	hg19	c.4276C>T	CCDS2754.1	0	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559102	0.45590	.	.	ENSG00000076201	ENST00000265562	D	0.84146	-1.81	3.99	3.08	0.35506	3.99	3.08	0.35506	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.315773	0.26304	N	0.025156	D	0.86377	0.5918	L	0.49571	1.57	0.32817	D	0.502271	D	0.76494	0.999	P	0.57846	0.828	D	0.87764	0.2600	10	0.56958	D	0.05	-21.5748	9.5586	0.39355	0.5458:0.4541:0.0:0.0	.	1426	Q9H3S7	PTN23_HUMAN	W	1426	ENSP00000265562:R1426W	ENSP00000265562:R1426W	R	+	1	2	2	PTPN23	47428874	47428874	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	1.491000	0.35583	0.813000	0.34350	0.563000	0.77884	CGG	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.647	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	0	0	1		2	2	2	0		0	0	46		46	46	1	2.940000	-3.447885	1	0.320000	NM_015466			5	5		198	196	0		1	0		0	0	46	0		0.936688	6.713330e-01	0	0	0	86	0	5	198
APPL1	26060	broad.mit.edu	37	3	57282266	57282266	+	Silent	SNP	A	A	C	rs184540761	byFrequency	TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr3:57282266A>C	ENST00000288266.3	+	10	897	c.750A>C	c.(748-750)acA>acC	p.T250T		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	250	Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		TGCAACAGACAATAGAGGATT	0.428																																						ENST00000288266.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				27						c.(748-750)acA>acC		adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1							120.0	112.0	115.0					3																	57282266		2203	4300	6503	SO:0001819	synonymous_variant	26060	0	0					g.chr3:57282266A>C	AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.750A>C	chr3.hg19:g.57282266A>C		1						p.T250T	NM_012096.2	NP_036228.1	2	2	4	2.335423	Q9UKG1	DP13A_HUMAN		10	897	+			Q9P2B9	Silent	SNP	ENST00000288266.3	1	1	hg19	c.750A>C	CCDS2882.1	1																																																																																								0.484848		TCGA-IB-7646-01A-11D-2154-08	0.428	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	1	0	1		2	2	2	0		0	0	55		55	54	1	2.940000	-20.000000	1	0.320000	NM_012096			154	154		463	459	1		1	1		0	0	55	0		1.000000	9.999991e-01	0	20	0	42	0	154	463
TRIM42	287015	broad.mit.edu	37	3	140397360	140397360	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr3:140397360C>T	ENST00000286349.3	+	1	480	c.289C>T	c.(289-291)Cgc>Tgc	p.R97C		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	97						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCGCTGCTGCCGCAATACCAT	0.542																																						ENST00000286349.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				69						c.(289-291)Cgc>Tgc		tripartite motif containing 42							45.0	41.0	42.0					3																	140397360		2194	4272	6466	SO:0001583	missense	287015	5	121342	35				g.chr3:140397360C>T	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.289C>T	chr3.hg19:g.140397360C>T	ENSP00000286349:p.Arg97Cys	1						p.R97C	NM_152616.4	NP_689829.3	2	2	4	2.335509	Q8IWZ5	TRI42_HUMAN		1	480	+			A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	1	1	hg19	c.289C>T	CCDS3113.1	1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768237	0.49680	.	.	ENSG00000155890	ENST00000286349	T	0.18810	2.19	5.15	2.12	0.27331	5.15	2.12	0.27331	.	0.000000	0.48767	D	0.000162	T	0.16981	0.0408	N	0.14661	0.345	0.42892	D	0.994201	D	0.76494	0.999	P	0.54924	0.764	T	0.04053	-1.0981	10	0.66056	D	0.02	-23.7362	5.0235	0.14372	0.3777:0.5241:0.0:0.0982	.	97	Q8IWZ5	TRI42_HUMAN	C	97	ENSP00000286349:R97C	ENSP00000286349:R97C	R	+	1	0	0	TRIM42	141880050	141880050	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	1.466000	0.35310	1.262000	0.44165	0.655000	0.94253	CGC	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.542	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	1	0	1		2	2	7	0		0	0	31		31	30	1	2.940000	-3.439551	1	0.320000	NM_152616			63	63		248	244	1		1		1	0	1	31	1288		1.000000	0	1	0	425	0	1413	63	248
RAPGEF2	9693	broad.mit.edu	37	4	160260455	160260455	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr4:160260455G>T	ENST00000264431.4	+	13	2419	c.2000G>T	c.(1999-2001)aGa>aTa	p.R667I		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	667	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AAACAAAGAAGACTTCCAGAT	0.438																																						ENST00000264431.4	1.000000	0.350000	1	4.100000e-01	0.490000	0.566109	0.490000	0.470000																										0				70						c.(1999-2001)aGa>aTa		Rap guanine nucleotide exchange factor (GEF) 2							134.0	125.0	128.0					4																	160260455		1878	4099	5977	SO:0001583	missense	9693	0	0					g.chr4:160260455G>T	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2000G>T	chr4.hg19:g.160260455G>T	ENSP00000264431:p.Arg667Ile	0						p.R667I	NM_014247.2	NP_055062.1	1	2	3	1.979019	Q9Y4G8	RPGF2_HUMAN		13	2419	+	all_hematologic(180;0.24)		D3DP27	Missense_Mutation	SNP	ENST00000264431.4	1	1	hg19	c.2000G>T	CCDS43277.1	0	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766898	0.90020	.	.	ENSG00000109756	ENST00000264431	T	0.30182	1.54	5.18	5.18	0.71444	5.18	5.18	0.71444	Ras-association (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.60573	0.2279	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65705	-0.6103	10	0.87932	D	0	.	19.0561	0.93066	0.0:0.0:1.0:0.0	.	667	Q9Y4G8	RPGF2_HUMAN	I	667	ENSP00000264431:R667I	ENSP00000264431:R667I	R	+	2	0	0	RAPGEF2	160479905	160479905	1.000000	0.71417	0.020000	0.16555	0.929000	0.56500	9.726000	0.98782	2.571000	0.86741	0.591000	0.81541	AGA	0.395448		TCGA-IB-7646-01A-11D-2154-08	0.438	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	1	0	1		2	2	2	0		0	0	114		114	113	1	2.940000	-10.116810	1	0.320000	NM_014247			48	48		664	660	1		1	1		0	0	114	0		1.000000	4.256963e-01	0	8	0	13	0	48	664
CCKAR	886	broad.mit.edu	37	4	26491074	26491074	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr4:26491074A>C	ENST00000295589.3	-	2	339	c.145T>G	c.(145-147)Tcc>Gcc	p.S49A		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	49					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	AATATCAAGGAGTACAAGAGA	0.547																																						ENST00000295589.3	1.000000	0.520000	9.600000e-01	6.100000e-01	0.720000	0.751564	0.720000	0.700000																										0				29						c.(145-147)Tcc>Gcc		cholecystokinin A receptor	Ceruletide(DB00403)						89.0	90.0	90.0					4																	26491074		2203	4300	6503	SO:0001583	missense	886	0	0					g.chr4:26491074A>C	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.145T>G	chr4.hg19:g.26491074A>C	ENSP00000295589:p.Ser49Ala	0						p.S49A	NM_000730.2	NP_000721.1	1	2	3	1.977537	P32238	CCKAR_HUMAN		2	339	-		Breast(46;0.0503)	B2R9Z5	Missense_Mutation	SNP	ENST00000295589.3	1	1	hg19	c.145T>G	CCDS3438.1	0	.	.	.	.	.	.	.	.	.	.	A	9.049	0.991544	0.18966	.	.	ENSG00000163394	ENST00000295589	T	0.37752	1.18	5.24	4.03	0.46877	5.24	4.03	0.46877	.	0.310205	0.34986	N	0.003532	T	0.17831	0.0428	N	0.12502	0.225	0.32321	N	0.562438	B	0.16166	0.016	B	0.20184	0.028	T	0.25813	-1.0121	10	0.02654	T	1	.	11.3334	0.49490	0.8638:0.0:0.0:0.1362	.	49	P32238	CCKAR_HUMAN	A	49	ENSP00000295589:S49A	ENSP00000295589:S49A	S	-	1	0	0	CCKAR	26100172	26100172	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	3.999000	0.57031	0.796000	0.33947	0.459000	0.35465	TCC	0.397163		TCGA-IB-7646-01A-11D-2154-08	0.547	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2	1	0	1		2	2	2	0		0	0	53		53	53	1	2.940000	-20.000000	1	0.320000				44	43		401	398	0		1			0	0	53	0		1.000000	0	0	0	0	0	0	44	401
GABRB1	2560	broad.mit.edu	37	4	47322169	47322169	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr4:47322169A>T	ENST00000295454.3	+	5	779	c.487A>T	c.(487-489)Atg>Ttg	p.M163L	GABRB1_ENST00000538619.1_Missense_Mutation_p.M93L	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	163					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGCATGTATGATGGATCTTCG	0.423																																						ENST00000295454.3	1.000000	0.270000	7.200000e-01	3.500000e-01	0.460000	0.534842	0.460000	0.430000																										0				44						c.(487-489)Atg>Ttg		gamma-aminobutyric acid (GABA) A receptor, beta 1	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)						121.0	107.0	112.0					4																	47322169		2203	4300	6503	SO:0001583	missense	2560	0	0					g.chr4:47322169A>T		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.487A>T	chr4.hg19:g.47322169A>T	ENSP00000295454:p.Met163Leu	0					GABRB1_ENST00000538619.1_Missense_Mutation_p.M93L	p.M163L	NM_000812.3	NP_000803.2	1	2	3	1.977537	P18505	GBRB1_HUMAN		5	779	+			B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	1	1	hg19	c.487A>T	CCDS3474.1	0	.	.	.	.	.	.	.	.	.	.	A	31	5.067721	0.93950	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	T;T	0.78707	-1.2;-1.2	5.19	5.19	0.71726	5.19	5.19	0.71726	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.196139	0.44285	D	0.000466	T	0.81394	0.4813	L	0.43554	1.36	0.58432	D	0.999998	D;P	0.57257	0.979;0.699	P;P	0.60345	0.873;0.833	T	0.82839	-0.0259	10	0.62326	D	0.03	-26.9689	13.0442	0.58916	1.0:0.0:0.0:0.0	.	93;163	F5GXV5;P18505	.;GBRB1_HUMAN	L	163;93	ENSP00000295454:M163L;ENSP00000440330:M93L	ENSP00000295454:M163L	M	+	1	0	0	GABRB1	47016926	47016926	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.665000	0.91144	2.178000	0.69098	0.477000	0.44152	ATG	0.397163		TCGA-IB-7646-01A-11D-2154-08	0.423	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1	1	0	1		2	2	2	0		0	0	58		58	58	1	2.940000	-5.929462	1	0.320000				18	18		275	274	0		1			0	0	58	0		0.999984	0	0	0	0	0	0	18	275
IGJ	3512	broad.mit.edu	37	4	71522118	71522118	+	Silent	SNP	G	G	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr4:71522118G>T	ENST00000254801.4	-	4	577	c.408C>A	c.(406-408)gtC>gtA	p.V136V	IGJ_ENST00000543780.1_Silent_p.V152V|ENAM_ENST00000472903.1_Intron	NM_144646.3	NP_653247.1	P01591	IGJ_HUMAN	immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides	136					adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|dimeric IgA immunoglobulin complex (GO:0071750)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|pentameric IgM immunoglobulin complex (GO:0071756)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7			Lung(101;0.235)			ATACGAGTGGGACCACAGCTG	0.453																																						ENST00000254801.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				7						c.(406-408)gtC>gtA		immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides							184.0	148.0	160.0					4																	71522118		2203	4300	6503	SO:0001819	synonymous_variant	3512	0	0					g.chr4:71522118G>T	M12759	CCDS3545.1	4q21	2012-10-02			ENSG00000132465	ENSG00000132465		"""Immunoglobulins / IGJ linker"""	5713	protein-coding gene	gene with protein product	"""immunoglobulin J chain"", ""IgJ chain"""	147790				3016707, 2984306	Standard	NM_144646		Approved	IGCJ, JCH	uc003hfn.4	P01591	OTTHUMG00000129909	ENST00000254801.4:c.408C>A	chr4.hg19:g.71522118G>T		0					IGJ_ENST00000543780.1_Silent_p.V152V|ENAM_ENST00000472903.1_Intron	p.V136V	NM_144646.3	NP_653247.1	1	2	3	1.979019	P01591	IGJ_HUMAN	Lung(101;0.235)	4	577	-				Silent	SNP	ENST00000254801.4	1	1	hg19	c.408C>A	CCDS3545.1	1																																																																																								0.395448		TCGA-IB-7646-01A-11D-2154-08	0.453	IGJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252160.1	1	0	1		2	2	2	0		0	0	51		51	51	1	2.940000	-20.000000	1	0.320000	NM_144646			74	73		224	224	1		1	0		0	0	51	0		1.000000	9.999450e-01	0	0	0	47	0	74	224
CPE	1363	broad.mit.edu	37	4	166418730	166418730	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			T	C	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr4:166418730T>C	ENST00000402744.4	+	9	1679	c.1399T>C	c.(1399-1401)Tgg>Cgg	p.W467R		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	467					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GATGGAATGGTGGAAAATGAT	0.289																																						ENST00000402744.4	1.000000	0.170000	1	2.300000e-01	0.330000	0.474326	0.330000	0.290000																										0				26						c.(1399-1401)Tgg>Cgg		carboxypeptidase E	"""Insulin(DB00071)|Insulin Regular(DB00030)"						85.0	87.0	86.0					4																	166418730		2201	4296	6497	SO:0001583	missense	1363	0	0					g.chr4:166418730T>C	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.1399T>C	chr4.hg19:g.166418730T>C	ENSP00000386104:p.Trp467Arg	0						p.W467R	NM_001873.2	NP_001864.1	1	2	3	1.911743	P16870	CBPE_HUMAN		9	1679	+	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	1	1	hg19	c.1399T>C	CCDS3810.1	0	.	.	.	.	.	.	.	.	.	.	T	17.01	3.280597	0.59758	.	.	ENSG00000109472	ENST00000402744	T	0.12774	2.65	6.08	6.08	0.98989	6.08	6.08	0.98989	Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.33876	0.0878	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.01829	-1.1265	10	0.87932	D	0	-11.282	16.643	0.85134	0.0:0.0:0.0:1.0	.	467	P16870	CBPE_HUMAN	R	467	ENSP00000386104:W467R	ENSP00000386104:W467R	W	+	1	0	0	CPE	166638180	166638180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.085000	0.76875	2.330000	0.79161	0.533000	0.62120	TGG	0.364723		TCGA-IB-7646-01A-11D-2154-08	0.289	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	1	0	1		2	2	2	0		0	0	51		51	51	1	2.940000	-4.371902	1	0.320000	NM_001873			13	13		286	285	0		1	0		0	0	51	0		0.999553	9.989164e-01	0	0	0	260	0	13	286
GABRA6	2559	broad.mit.edu	37	5	161115979	161115979	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr5:161115979C>T	ENST00000274545.5	+	4	683	c.250C>T	c.(250-252)Cgc>Tgc	p.R84C	GABRA6_ENST00000522269.1_3'UTR|RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Intron			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	84					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGTTTTTTTCCGCCAGACCTG	0.408										TCGA Ovarian(5;0.080)																												ENST00000274545.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				57						c.(250-252)Cgc>Tgc		gamma-aminobutyric acid (GABA) A receptor, alpha 6	Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)						81.0	83.0	82.0					5																	161115979		2203	4299	6502	SO:0001583	missense	2559	4	121412	39				g.chr5:161115979C>T		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.250C>T	chr5.hg19:g.161115979C>T	ENSP00000274545:p.Arg84Cys	1	TCGA Ovarian(5;0.080)				RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000522269.1_3'UTR|GABRA6_ENST00000523217.1_Intron	p.R84C			1	2	3	2.067916	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	4	683	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	1	1	hg19	c.250C>T	CCDS4356.1	1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915608	0.92178	.	.	ENSG00000145863	ENST00000274545;ENST00000517823	T;T	0.80566	-1.39;-1.39	5.65	5.65	0.86999	5.65	5.65	0.86999	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.93103	0.7804	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94213	0.7460	10	0.87932	D	0	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	84	Q16445	GBRA6_HUMAN	C	84;31	ENSP00000274545:R84C;ENSP00000430212:R31C	ENSP00000274545:R84C	R	+	1	0	0	GABRA6	161048557	161048557	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.843000	0.69424	2.824000	0.97209	0.655000	0.94253	CGC	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.408	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2	0	0	1		2	2	2	0		0	0	66		66	66	1	2.940000	-3.685264	1	0.320000				128	127		444	441	1		1			0	0	66	0		1.000000	0	0	0	0	0	0	128	444
BVES	11149	broad.mit.edu	37	6	105563588	105563588	+	Missense_Mutation	SNP	G	G	A	rs371189369		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr6:105563588G>A	ENST00000314641.5	-	7	1147	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	BVES_ENST00000336775.5_Missense_Mutation_p.R311W|BVES_ENST00000446408.2_Missense_Mutation_p.R311W	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	311					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)	p.R311W(1)		NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				GAGGTACCCCGAAGAAACTGG	0.478																																						ENST00000314641.5	1.000000	0.760000	1	8.600000e-01	0.970000	0.945027	0.970000	1.000000																										1	Substitution - Missense(1)	p.R311W(1)	skin(1)	21						c.(931-933)Cgg>Tgg		blood vessel epicardial substance		G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	180.0	155.0	163.0		931,931,931	5.9	1.0	6		163	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	BVES	NM_001199563.1,NM_007073.4,NM_147147.3	101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	311/361,311/361,311/361	105563588	1,13005	2203	4300	6503	SO:0001583	missense	11149	2	121412	42				g.chr6:105563588G>A	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.931C>T	chr6.hg19:g.105563588G>A	ENSP00000313172:p.Arg311Trp	0					BVES_ENST00000446408.2_Missense_Mutation_p.R311W|BVES_ENST00000336775.5_Missense_Mutation_p.R311W	p.R311W	NM_001199563.1	NP_001186492.1	1	2	3	1.781456	Q8NE79	POPD1_HUMAN		7	1147	-		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)	A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	ENST00000314641.5	1	1	hg19	c.931C>T	CCDS5051.1	1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.884860	0.72410	0.0	1.16E-4	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.29397	1.57;1.57;1.57	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.43853	0.1266	L	0.55990	1.75	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.29822	-0.9999	10	0.72032	D	0.01	-21.4302	15.137	0.72576	0.0:0.0:0.8587:0.1413	.	311	Q8NE79	POPD1_HUMAN	W	311	ENSP00000313172:R311W;ENSP00000337259:R311W;ENSP00000397310:R311W	ENSP00000313172:R311W	R	-	1	2	2	BVES	105670281	105670281	1.000000	0.71417	0.997000	0.53966	0.708000	0.40852	3.314000	0.51943	2.822000	0.97130	0.563000	0.77884	CGG	0.329653		TCGA-IB-7646-01A-11D-2154-08	0.478	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	1	0	1		2	2	2	0		0	0	83		83	82	1	2.940000	-3.077796	1	0.320000	NM_147147			70	69		390	386	1		1	0		0	0	83	0		1.000000	1.723761e-01	0	0	0	5	0	70	390
PXT1	222659	broad.mit.edu	37	6	36368236	36368236	+	Nonsense_Mutation	SNP	G	G	A	rs183075818		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr6:36368236G>A	ENST00000454782.2	-	4	778	c.295C>T	c.(295-297)Cga>Tga	p.R99*		NM_152990.3	NP_694535.2	Q8NFP0	PXT1_HUMAN	peroxisomal, testis specific 1	99					positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|peroxisome (GO:0005777)											CTCACCTCTCGAACCATCCTA	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19453	0.0		0.0	False		,,,				2504	0.0					ENST00000454782.2	1.000000	0.890000	1	9.900000e-01	0.990000	0.991920	0.990000	1.000000																										0										c.(295-297)Cga>Tga		peroxisomal, testis specific 1							237.0	191.0	207.0					6																	36368236		2203	4300	6503	SO:0001587	stop_gained	222659	11	121412	44				g.chr6:36368236G>A	AF486827	CCDS4820.2	6p21.31	2004-04-30			ENSG00000179165	ENSG00000179165			18312	protein-coding gene	gene with protein product							Standard	NM_152990		Approved	STEPP	uc003omd.2	Q8NFP0	OTTHUMG00000159815	ENST00000454782.2:c.295C>T	chr6.hg19:g.36368236G>A	ENSP00000419944:p.Arg99*	0						p.R99*	NM_152990.3	NP_694535.2	1	2	3	1.787259	Q8NFP0	PXT1_HUMAN		4	778	-			J3KR74	Nonsense_Mutation	SNP	ENST00000454782.2	0	1	hg19	c.295C>T	CCDS4820.2	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	39	7.886637	0.98542	.	.	ENSG00000179165	ENST00000454782;ENST00000538109	.	.	.	4.9	4.01	0.46588	4.9	4.01	0.46588	.	0.919982	0.08824	N	0.888375	.	.	.	.	.	.	0.49915	D	0.999834	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0883	10.898	0.47034	0.0:0.1901:0.8099:0.0	.	.	.	.	X	99;16	.	ENSP00000419944:R99X	R	-	1	2	2	PXT1	36476214	36476214	0.069000	0.21087	0.259000	0.24435	0.603000	0.37013	1.193000	0.32162	1.250000	0.43966	0.555000	0.69702	CGA	0.330709		TCGA-IB-7646-01A-11D-2154-08	0.493	PXT1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357516.2	1	0	1		2	2	2	0		0	0	70		70	69	1	2.940000	-3.367243	1	0.320000	NM_152990			75	74		353	348	1		1			0	0	70	0		1.000000	0	0	0	0	0	0	75	353
TMEM30A	55754	broad.mit.edu	37	6	75965841	75965841	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr6:75965841T>C	ENST00000230461.6	-	7	1392	c.1063A>G	c.(1063-1065)Aat>Gat	p.N355D	TMEM30A_ENST00000475111.2_Missense_Mutation_p.N319D|TMEM30A_ENST00000370050.5_Missense_Mutation_p.N236D	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	355					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCAGCTGTATTACTACTGTTT	0.358																																						ENST00000230461.6	1.000000	0.680000	1	8.200000e-01	0.990000	0.933726	0.990000	1.000000																										0				21						c.(1063-1065)Aat>Gat		transmembrane protein 30A							68.0	69.0	69.0					6																	75965841		2203	4299	6502	SO:0001583	missense	55754	0	0					g.chr6:75965841T>C	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.1063A>G	chr6.hg19:g.75965841T>C	ENSP00000230461:p.Asn355Asp	0					TMEM30A_ENST00000475111.2_Missense_Mutation_p.N319D|TMEM30A_ENST00000370050.5_Missense_Mutation_p.N236D	p.N355D	NM_018247.3	NP_060717.1	1	2	3	1.781456	Q9NV96	CC50A_HUMAN		7	1392	-			A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	ENST00000230461.6	1	1	hg19	c.1063A>G	CCDS4983.1	1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.523412	0.64747	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111	.	.	.	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.082960	0.85682	D	0.000000	T	0.34135	0.0887	L	0.45228	1.405	0.50171	D	0.999851	B;B	0.09022	0.002;0.002	B;B	0.17433	0.006;0.018	T	0.36578	-0.9742	9	0.05525	T	0.97	.	16.0847	0.81038	0.0:0.0:0.0:1.0	.	319;355	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	D	355;339;236;319	.	ENSP00000230461:N355D	N	-	1	0	0	TMEM30A	76022561	76022561	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.202000	0.70862	0.528000	0.53228	AAT	0.329653		TCGA-IB-7646-01A-11D-2154-08	0.358	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	1	0	1		2	2	2	0		0	0	24		24	24	1	2.940000	-20.000000	1	0.320000	NM_018247			30	30		165	164	1		1	1		0	0	24	0		1.000000	1	0	104	0	231	0	30	165
IL20RA	53832	broad.mit.edu	37	6	137323435	137323435	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr6:137323435C>T	ENST00000316649.5	-	7	1157	c.922G>A	c.(922-924)Gtg>Atg	p.V308M	IL20RA_ENST00000541547.1_Missense_Mutation_p.V259M|IL20RA_ENST00000468393.1_5'Flank|IL20RA_ENST00000367748.1_Missense_Mutation_p.V197M|RP11-204P2.3_ENST00000458017.1_RNA	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	308					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		AAGTTAATCACGATTTTTTCA	0.318																																						ENST00000316649.5	1.000000	0.750000	1	8.700000e-01	0.990000	0.956409	0.990000	1.000000																										0				27						c.(922-924)Gtg>Atg		interleukin 20 receptor, alpha							39.0	44.0	42.0					6																	137323435		2203	4296	6499	SO:0001583	missense	53832	0	0					g.chr6:137323435C>T	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.922G>A	chr6.hg19:g.137323435C>T	ENSP00000314976:p.Val308Met	0					RP11-204P2.3_ENST00000458017.1_RNA|IL20RA_ENST00000541547.1_Missense_Mutation_p.V259M|IL20RA_ENST00000468393.1_5'Flank|IL20RA_ENST00000367748.1_Missense_Mutation_p.V197M	p.V308M	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	1	2	3	1.778247	Q9UHF4	I20RA_HUMAN		7	1157	-	Colorectal(23;0.24)		B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Missense_Mutation	SNP	ENST00000316649.5	1	1	hg19	c.922G>A	CCDS5181.1	1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473496	0.26423	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	T;T;T	0.62364	0.29;1.74;0.03	5.79	-1.79	0.07932	5.79	-1.79	0.07932	.	0.528864	0.18758	N	0.131980	T	0.26122	0.0637	L	0.56769	1.78	0.09310	N	1	P;P	0.40230	0.708;0.669	B;B	0.28305	0.088;0.046	T	0.15292	-1.0442	10	0.46703	T	0.11	-2.8981	6.3867	0.21563	0.0:0.478:0.1229:0.3991	.	197;308	Q9UHF4-2;Q9UHF4	.;I20RA_HUMAN	M	308;197;259	ENSP00000314976:V308M;ENSP00000356722:V197M;ENSP00000437843:V259M	ENSP00000314976:V308M	V	-	1	0	0	IL20RA	137365128	137365128	0.845000	0.29573	0.013000	0.15412	0.940000	0.58332	0.935000	0.28924	-0.331000	0.08501	-0.777000	0.03380	GTG	0.329653		TCGA-IB-7646-01A-11D-2154-08	0.318	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	1	0	1		2	2	2	0		0	0	40		40	40	1	2.940000	-20.000000	1	0.320000	NM_014432			40	40		210	209	1		1	1		0	0	40	0		1.000000	3.191575e-01	0	3	0	4	0	40	210
USP42	84132	broad.mit.edu	37	7	6189801	6189801	+	Silent	SNP	C	C	T	rs546255931		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr7:6189801C>T	ENST00000306177.5	+	13	2132	c.1974C>T	c.(1972-1974)aaC>aaT	p.N658N		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	658					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TGACCCTAAACGGTGCTAATA	0.567																																						ENST00000306177.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999930	0.990000	1.000000																										0				35						c.(1972-1974)aaC>aaT		ubiquitin specific peptidase 42							37.0	42.0	40.0					7																	6189801		2043	4194	6237	SO:0001819	synonymous_variant	84132	0	0					g.chr7:6189801C>T	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1974C>T	chr7.hg19:g.6189801C>T		1						p.N658N	NM_032172.2	NP_115548.1	2	2	4	2.309781	Q9H9J4	UBP42_HUMAN		13	2132	+		Ovarian(82;0.0423)	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	1	1	hg19	c.1974C>T	CCDS47535.1	1																																																																																								0.484848		TCGA-IB-7646-01A-11D-2154-08	0.567	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	1	0	1		2	2	2	0		0	0	24		24	23	1	2.940000	-20.000000	1	0.320000	XM_166526			34	34		135	134	1		1	1		0	0	24	0		1.000000	8.317724e-01	0	9	0	6	0	34	135
INHBA	3624	broad.mit.edu	37	7	41729807	41729807	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr7:41729807C>T	ENST00000242208.4	-	3	968	c.722G>A	c.(721-723)cGg>cAg	p.R241Q	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.R241Q	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	241					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						ACAGGCAATCCGAACGTCCAG	0.572										TSP Lung(11;0.080)																												ENST00000242208.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999811	0.990000	1.000000																										0				55						c.(721-723)cGg>cAg		inhibin, beta A							47.0	46.0	47.0					7																	41729807		2203	4300	6503	SO:0001583	missense	3624	1	121412	31				g.chr7:41729807C>T		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.722G>A	chr7.hg19:g.41729807C>T	ENSP00000242208:p.Arg241Gln	1	TSP Lung(11;0.080)				INHBA_ENST00000442711.1_Missense_Mutation_p.R241Q|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	p.R241Q	NM_002192.2	NP_002183.1	2	2	4	2.290144	P08476	INHBA_HUMAN		3	968	-			Q14599	Missense_Mutation	SNP	ENST00000242208.4	1	1	hg19	c.722G>A	CCDS5464.1	1	.	.	.	.	.	.	.	.	.	.	.	36	5.853696	0.97030	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.62788	0.0;0.0	6.06	6.06	0.98353	6.06	6.06	0.98353	Transforming growth factor-beta, N-terminal (1);	0.431115	0.26859	N	0.022126	T	0.73118	0.3546	L	0.40543	1.245	0.80722	D	1	D	0.71674	0.998	D	0.68353	0.957	T	0.67352	-0.5692	10	0.33141	T	0.24	-20.8404	20.6208	0.99490	0.0:1.0:0.0:0.0	.	241	P08476	INHBA_HUMAN	Q	241	ENSP00000242208:R241Q;ENSP00000397197:R241Q	ENSP00000242208:R241Q	R	-	2	0	0	INHBA	41696332	41696332	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.915000	0.63355	2.882000	0.98803	0.655000	0.94253	CGG	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.572	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1	1	0	1		2	2	2	0		0	0	37		37	37	1	2.940000	-3.083655	1	0.320000				43	43		196	192	1		1	0		0	0	37	0		1.000000	1	0	0	0	441	0	43	196
GLI3	2737	broad.mit.edu	37	7	42079807	42079807	+	Silent	SNP	G	G	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr7:42079807G>T	ENST00000395925.3	-	7	942	c.858C>A	c.(856-858)gcC>gcA	p.A286A	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	286					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGCTCGGCCTGGCTGACAGCC	0.468									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	0.640000	9.800000e-01	7.400000e-01	0.850000	0.857625	0.850000	1.000000																										0				112						c.(856-858)gcC>gcA		GLI family zinc finger 3							144.0	132.0	136.0					7																	42079807		2203	4300	6503	SO:0001819	synonymous_variant	2737	0	0		Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42079807G>T		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.858C>A	chr7.hg19:g.42079807G>T		1					GLI3_ENST00000479210.1_5'UTR	p.A286A	NM_000168.5	NP_000159.3	2	2	4	2.290144	P10071	GLI3_HUMAN		7	942	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	1	1	hg19	c.858C>A	CCDS5465.1	1																																																																																								0.484848		TCGA-IB-7646-01A-11D-2154-08	0.468	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	1	0	1		2	2	2	0		0	0	63		63	63	1	2.940000	-16.432610	1	0.320000	NM_000168			50	50		433	430	1		1	0		0	0	63	0		1.000000	1.255287e-01	0	0	0	6	0	50	433
POM121L12	285877	broad.mit.edu	37	7	53104077	53104077	+	Missense_Mutation	SNP	C	C	T	rs373781225		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr7:53104077C>T	ENST00000408890.4	+	1	729	c.713C>T	c.(712-714)cCg>cTg	p.P238L		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	238										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCTCTGAAGCCGAGCCTCGGC	0.652																																						ENST00000408890.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				61						c.(712-714)cCg>cTg		POM121 transmembrane nucleoporin-like 12		C	LEU/PRO	1,3927		0,1,1963	44.0	52.0	49.0		713	-3.7	0.0	7		49	0,8270		0,0,4135	no	missense	POM121L12	NM_182595.3	98	0,1,6098	TT,TC,CC		0.0,0.0255,0.0082	possibly-damaging	238/297	53104077	1,12197	1964	4135	6099	SO:0001583	missense	285877	0	0					g.chr7:53104077C>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.713C>T	chr7.hg19:g.53104077C>T	ENSP00000386133:p.Pro238Leu	1						p.P238L	NM_182595.3	NP_872401.3	2	2	4	2.290144	Q8N7R1	P1L12_HUMAN		1	729	+			Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	1	1	hg19	c.713C>T	CCDS43584.1	1	.	.	.	.	.	.	.	.	.	.	C	3.553	-0.091246	0.07053	2.55E-4	0.0	ENSG00000221900	ENST00000408890	T	0.10860	2.83	1.84	-3.67	0.04476	1.84	-3.67	0.04476	.	.	.	.	.	T	0.05502	0.0145	N	0.08118	0	0.09310	N	1	P	0.49635	0.926	P	0.45037	0.467	T	0.19353	-1.0308	9	0.51188	T	0.08	.	5.1209	0.14860	0.4429:0.2886:0.2685:0.0	.	238	Q8N7R1	P1L12_HUMAN	L	238	ENSP00000386133:P238L	ENSP00000386133:P238L	P	+	2	0	0	POM121L12	53071571	53071571	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.714000	0.01881	-2.499000	0.00511	-1.083000	0.02208	CCG	0.484848		TCGA-IB-7646-01A-11D-2154-08	0.652	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	1	0	1		2	2	2	0		0	0	45		45	43	1	2.940000	-20.000000	1	0.320000	NM_182595			93	93		301	299	0		1			0	0	45	0		1.000000	0	0	0	0	0	0	93	301
DPP6	1804	broad.mit.edu	37	7	154596629	154596629	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr7:154596629A>G	ENST00000377770.3	+	15	1643	c.1502A>G	c.(1501-1503)tAc>tGc	p.Y501C	DPP6_ENST00000404039.1_Missense_Mutation_p.Y437C|DPP6_ENST00000332007.3_Missense_Mutation_p.Y439C|DPP6_ENST00000427557.1_Missense_Mutation_p.Y394C			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	501					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTTTGCAGCTACTTCCTGAGC	0.577																																					NSCLC(125;1384 1783 2490 7422 34254)	ENST00000377770.3	1.000000	0.830000	1	9.900000e-01	0.990000	0.990012	0.990000	1.000000																										0				71						c.(1501-1503)tAc>tGc		dipeptidyl-peptidase 6							84.0	92.0	89.0					7																	154596629		2073	4211	6284	SO:0001583	missense	1804	0	0					g.chr7:154596629A>G	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1502A>G	chr7.hg19:g.154596629A>G	ENSP00000367001:p.Tyr501Cys	1					DPP6_ENST00000427557.1_Missense_Mutation_p.Y394C|DPP6_ENST00000332007.3_Missense_Mutation_p.Y439C|DPP6_ENST00000404039.1_Missense_Mutation_p.Y437C	p.Y501C			0	2	2	1.768284	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)	15	1643	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)		Missense_Mutation	SNP	ENST00000377770.3	1	1	hg19	c.1502A>G		1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.092541	0.76756	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.04	5.04	0.67666	5.04	5.04	0.67666	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.056551	0.64402	D	0.000001	T	0.73560	0.3602	H	0.95780	3.72	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.81904	-0.0719	10	0.87932	D	0	-22.1949	13.0759	0.59087	1.0:0.0:0.0:0.0	.	394;439;501;437	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	C	437;501;439;394	ENSP00000385578:Y437C;ENSP00000367001:Y501C;ENSP00000328226:Y439C;ENSP00000397303:Y394C	ENSP00000328226:Y439C	Y	+	2	0	0	DPP6	154227562	154227562	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.947000	0.75959	2.018000	0.59344	0.529000	0.55759	TAC	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.577	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	1	0	1		2	2	2	0		0	0	12		12	12	1	2.940000	-19.998920	1	0.320000	NM_130797			11	11		34	34	1		1	0		0	0	12	0		0.999034	1.679331e-01	0	0	0	3	0	11	34
ARHGEF10	9639	broad.mit.edu	37	8	1882002	1882002	+	Missense_Mutation	SNP	A	A	G	rs573337230		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr8:1882002A>G	ENST00000398564.1	+	26	3191	c.3191A>G	c.(3190-3192)aAg>aGg	p.K1064R	ARHGEF10_ENST00000520359.1_Missense_Mutation_p.K1001R|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.K1063R|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.K1035R|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.K1039R			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	1064					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		AAAGTGATCAAGTTAGGCGTC	0.433																																						ENST00000398564.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				35						c.(3190-3192)aAg>aGg		Rho guanine nucleotide exchange factor (GEF) 10							158.0	151.0	153.0					8																	1882002		2203	4300	6503	SO:0001583	missense	9639	2	121412	36				g.chr8:1882002A>G	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.3191A>G	chr8.hg19:g.1882002A>G	ENSP00000381571:p.Lys1064Arg	1					ARHGEF10_ENST00000520359.1_Missense_Mutation_p.K1001R|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.K1063R|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.K1039R|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.K1035R	p.K1064R			1	2	3	2.097200	O15013	ARHGA_HUMAN		26	3191	+		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	1	1	hg19	c.3191A>G		1	.	.	.	.	.	.	.	.	.	.	A	5.753	0.323425	0.10900	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38	5.11	2.74	0.32292	5.11	2.74	0.32292	.	0.095581	0.64402	N	0.000001	T	0.27241	0.0668	L	0.41079	1.255	0.38419	D	0.946126	B;B	0.21520	0.057;0.004	B;B	0.25405	0.06;0.013	T	0.08371	-1.0725	10	0.23891	T	0.37	-32.4453	9.2439	0.37513	0.8544:0.0:0.1456:0.0	.	1001;1039	O15013-7;O15013-5	.;.	R	1039;1001;1063;1064;1035;683	ENSP00000340297:K1039R;ENSP00000427909:K1001R;ENSP00000431012:K1063R;ENSP00000381571:K1064R;ENSP00000262112:K1035R;ENSP00000427768:K683R	ENSP00000262112:K1035R	K	+	2	0	0	ARHGEF10	1869409	1869409	0.983000	0.35010	0.000000	0.03702	0.003000	0.03518	4.878000	0.63093	0.369000	0.24510	0.533000	0.62120	AAG	0.413793		TCGA-IB-7646-01A-11D-2154-08	0.433	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	69		69	69	1	2.940000	-20.000000	1	0.320000				177	176		502	498	1		1	1		0	0	69	0		1.000000	9.666073e-01	0	6	0	12	0	177	502
ESCO2	157570	broad.mit.edu	37	8	27634027	27634027	+	Silent	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr8:27634027C>T	ENST00000305188.8	+	3	440	c.202C>T	c.(202-204)Ctg>Ttg	p.L68L	ESCO2_ENST00000397418.2_5'UTR|ESCO2_ENST00000523910.1_3'UTR|RNU6-1276P_ENST00000365372.1_RNA	NM_001017420.2	NP_001017420.1	Q56NI9	ESCO2_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 2	68					chromosome segregation (GO:0007059)|double-strand break repair (GO:0006302)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|protein localization to chromatin (GO:0071168)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromocenter (GO:0010369)|Golgi apparatus (GO:0005794)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		AATAAATAGACTGCCATCAGC	0.368									SC Phocomelia syndrome																													ENST00000305188.8	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				18						c.(202-204)Ctg>Ttg		establishment of sister chromatid cohesion N-acetyltransferase 2							60.0	59.0	59.0					8																	27634027		2203	4300	6503	SO:0001819	synonymous_variant	157570	0	0		SC Phocomelia syndrome	Familial Cancer Database	SC-Pseudothalidomide s., incl.: Roberts s.	g.chr8:27634027C>T	AF306679	CCDS34872.1	8p21.1	2013-05-02	2013-05-02		ENSG00000171320	ENSG00000171320			27230	protein-coding gene	gene with protein product		609353	"""Roberts syndrome"", ""establishment of cohesion 1 homolog 2 (S. cerevisiae)"""	RBS		15958495, 16775838, 15821733, 16380922	Standard	XR_247122		Approved	EFO2	uc003xgg.3	Q56NI9	OTTHUMG00000163901	ENST00000305188.8:c.202C>T	chr8.hg19:g.27634027C>T		1					ESCO2_ENST00000523910.1_3'UTR|ESCO2_ENST00000397418.2_5'UTR|RNU6-1276P_ENST00000365372.1_RNA	p.L68L	NM_001017420.2	NP_001017420.1	2	2	4	2.180446	Q56NI9	ESCO2_HUMAN		3	440	+		Ovarian(32;0.000953)	B3KW59|Q49AP4	Silent	SNP	ENST00000305188.8	1	1	hg19	c.202C>T	CCDS34872.1	1																																																																																								0.459975		TCGA-IB-7646-01A-11D-2154-08	0.368	ESCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376276.1	1	0	1		2	2	2	0		0	0	40		40	40	1	2.940000	-20.000000	1	0.320000	NM_001017420			69	68		182	179	1		1	1		0	0	40	0		1.000000	6.917410e-01	0	5	0	3	0	69	182
UNC5D	137970	broad.mit.edu	37	8	35647893	35647893	+	Missense_Mutation	SNP	G	G	A	rs374094705		TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr8:35647893G>A	ENST00000404895.2	+	17	3002	c.2674G>A	c.(2674-2676)Gct>Act	p.A892T	UNC5D_ENST00000453357.2_Missense_Mutation_p.A887T|UNC5D_ENST00000449677.1_Missense_Mutation_p.A468T|UNC5D_ENST00000287272.2_Missense_Mutation_p.A823T|UNC5D_ENST00000420357.1_Missense_Mutation_p.A825T|AC012215.1_ENST00000437887.1_5'Flank|UNC5D_ENST00000416672.1_Missense_Mutation_p.A897T	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	892	Death.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ATCTTATTTCGCTACACAAAG	0.393																																						ENST00000404895.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				112						c.(2674-2676)Gct>Act		unc-5 homolog D (C. elegans)		G	THR/ALA	0,4406		0,0,2203	114.0	101.0	106.0		2674	5.7	1.0	8		106	1,8599	1.2+/-3.3	0,1,4299	no	missense	UNC5D	NM_080872.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	892/954	35647893	1,13005	2203	4300	6503	SO:0001583	missense	137970	4	121408	40				g.chr8:35647893G>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2674G>A	chr8.hg19:g.35647893G>A	ENSP00000385143:p.Ala892Thr	1					UNC5D_ENST00000287272.2_Missense_Mutation_p.A823T|UNC5D_ENST00000449677.1_Missense_Mutation_p.A468T|UNC5D_ENST00000453357.2_Missense_Mutation_p.A887T|UNC5D_ENST00000416672.1_Missense_Mutation_p.A897T|AC012215.1_ENST00000437887.1_5'Flank|UNC5D_ENST00000420357.1_Missense_Mutation_p.A825T	p.A892T	NM_080872.2	NP_543148.2	2	4	6	2.211130	Q6UXZ4	UNC5D_HUMAN		17	3002	+			Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	1	1	hg19	c.2674G>A	CCDS6093.2	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470526	0.84533	0.0	1.16E-4	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	5.72	5.72	0.89469	5.72	5.72	0.89469	Death (2);DEATH-like (2);	0.049286	0.85682	D	0.000000	D	0.86694	0.5994	L	0.52011	1.625	0.58432	D	0.999999	P;P;P	0.52692	0.955;0.944;0.955	P;B;B	0.48598	0.583;0.177;0.271	D	0.87244	0.2268	10	0.59425	D	0.04	-14.2436	19.873	0.96856	0.0:0.0:1.0:0.0	.	468;887;892	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	T	892;825;823;897;887;468	ENSP00000385143:A892T;ENSP00000392739:A825T;ENSP00000287272:A823T;ENSP00000412652:A897T;ENSP00000394303:A887T;ENSP00000397211:A468T	ENSP00000287272:A823T	A	+	1	0	0	UNC5D	35767435	35767435	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.497000	0.81536	2.705000	0.92388	0.557000	0.71058	GCT	0.466750		TCGA-IB-7646-01A-11D-2154-08	0.393	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2	1	0	1		2	2	2	0		0	0	48		48	47	1	2.940000	-4.349722	1	0.320000				114	114		392	390	1		1			0	0	48	0		1.000000	0	0	0	0	0	0	114	392
SLC30A8	169026	broad.mit.edu	37	8	118165302	118165302	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chr8:118165302C>T	ENST00000456015.2	+	3	391	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W	SLC30A8_ENST00000427715.2_Missense_Mutation_p.R82W|SLC30A8_ENST00000521243.1_Missense_Mutation_p.R82W|SLC30A8_ENST00000519688.1_Missense_Mutation_p.R82W	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	131					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TCCCTCTAAGCGGCTGACATT	0.507																																					Ovarian(162;1202 1922 6011 16223 52092)	ENST00000456015.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999932	0.990000	1.000000																										0				41						c.(391-393)Cgg>Tgg		solute carrier family 30 (zinc transporter), member 8							120.0	88.0	98.0					8																	118165302		2203	4300	6503	SO:0001583	missense	169026	1	121410	28				g.chr8:118165302C>T		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.391C>T	chr8.hg19:g.118165302C>T	ENSP00000415011:p.Arg131Trp	1					SLC30A8_ENST00000427715.2_Missense_Mutation_p.R82W|SLC30A8_ENST00000519688.1_Missense_Mutation_p.R82W|SLC30A8_ENST00000521243.1_Missense_Mutation_p.R82W	p.R131W	NM_173851.2	NP_776250.2	2	2	4	2.139731	Q8IWU4	ZNT8_HUMAN	STAD - Stomach adenocarcinoma(47;0.203)	3	391	+	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	1	1	hg19	c.391C>T	CCDS6322.1	1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024966	0.54683	.	.	ENSG00000164756	ENST00000521243;ENST00000524274;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.37	0.822	0.18806	5.37	0.822	0.18806	.	0.812377	0.11451	N	0.562795	T	0.78104	0.4231	M	0.82923	2.615	0.09310	N	0.999999	D	0.65815	0.995	P	0.61722	0.893	T	0.70912	-0.4743	10	0.72032	D	0.01	-1.0271	15.0224	0.71640	0.69:0.31:0.0:0.0	.	131	Q8IWU4	ZNT8_HUMAN	W	82;82;82;82;131	ENSP00000428545:R82W;ENSP00000427760:R82W;ENSP00000407505:R82W;ENSP00000431069:R82W;ENSP00000415011:R131W	ENSP00000407505:R82W	R	+	1	2	2	SLC30A8	118234483	118234483	0.046000	0.20272	0.094000	0.20943	0.336000	0.28762	0.600000	0.24104	0.243000	0.21327	0.655000	0.94253	CGG	0.448768		TCGA-IB-7646-01A-11D-2154-08	0.507	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	1	0	1		2	2	2	0		0	0	27		27	26	1	2.940000	-19.999780	1	0.320000	NM_173851			37	37		141	139	1		1			0	0	27	0		1.000000	0	0	0	0	0	0	37	141
POLA1	5422	broad.mit.edu	37	X	24839663	24839663	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chrX:24839663T>C	ENST00000379059.3	+	31	3521	c.3506T>C	c.(3505-3507)gTg>gCg	p.V1169A	POLA1_ENST00000379068.3_Missense_Mutation_p.V1175A	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1169					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GGCAGAAAGGTGAAAGCTGGA	0.393																																						ENST00000379059.3	1.000000	0.920000	1	9.500000e-01	0.980000	0.982590	0.980000	0.990000																										0				11						c.(3505-3507)gTg>gCg		polymerase (DNA directed), alpha 1, catalytic subunit	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)						92.0	77.0	82.0					X																	24839663		2203	4300	6503	SO:0001583	missense	5422	0	0					g.chrX:24839663T>C		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3506T>C	chrX.hg19:g.24839663T>C	ENSP00000368349:p.Val1169Ala						POLA1_ENST00000379068.3_Missense_Mutation_p.V1175A	p.V1169A	NM_016937.3	NP_058633.2	0	1	1		P09884	DPOLA_HUMAN		31	3521	+			Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	1	1	hg19	c.3506T>C	CCDS14214.1	1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.184335	0.57800	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.17528	2.27;2.27	4.9	4.9	0.64082	4.9	4.9	0.64082	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.246861	0.40302	N	0.001126	T	0.26268	0.0641	M	0.69823	2.125	0.58432	D	0.999998	P	0.37207	0.587	B	0.43754	0.43	T	0.03240	-1.1057	10	0.21540	T	0.41	-0.1434	13.7335	0.62804	0.0:0.0:0.0:1.0	.	1169	P09884	DPOLA_HUMAN	A	1175;1169	ENSP00000368358:V1175A;ENSP00000368349:V1169A	ENSP00000368349:V1169A	V	+	2	0	0	POLA1	24749584	24749584	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	7.463000	0.80869	1.816000	0.52996	0.441000	0.28932	GTG	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.393	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	0	0	1		2	2	2	0		0	0	19		19	19	1	2.940000	-20.000000	1	0.320000	NM_016937			81	81		80	79	1		1	1		0	0	19	0		1.000000	1	0	24	0	9	0	81	80
PAGE1	8712	broad.mit.edu	37	X	49459355	49459355	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chrX:49459355A>C	ENST00000376150.3	-	2	151	c.19T>G	c.(19-21)Tta>Gta	p.L7V		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	7					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					CGATAGATTAATCTTCTTAGA	0.373																																						ENST00000376150.3	1.000000	0.840000	9.900000e-01	9.100000e-01	0.960000	0.956454	0.960000	0.990000																										0				7						c.(19-21)Tta>Gta		P antigen family, member 1 (prostate associated)							73.0	61.0	65.0					X																	49459355		2203	4300	6503	SO:0001583	missense	8712	0	0					g.chrX:49459355A>C	AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.19T>G	chrX.hg19:g.49459355A>C	ENSP00000365320:p.Leu7Val							p.L7V	NM_003785.3	NP_003776.2	0	1	1		O75459	PAGE1_HUMAN		2	151	-	Ovarian(276;0.236)		Q6FGM3|Q9BSS7	Missense_Mutation	SNP	ENST00000376150.3	0	1	hg19	c.19T>G	CCDS14327.1	1	.	.	.	.	.	.	.	.	.	.	A	6.763	0.509661	0.12883	.	.	ENSG00000068985	ENST00000376150	T	0.10005	2.92	1.57	1.57	0.23409	1.57	1.57	0.23409	.	.	.	.	.	T	0.11067	0.0270	L	0.50333	1.59	0.09310	N	1	D	0.56521	0.976	P	0.46389	0.515	T	0.21211	-1.0252	9	0.24483	T	0.36	.	4.6903	0.12778	1.0:0.0:0.0:0.0	.	7	O75459	GAGB1_HUMAN	V	7	ENSP00000365320:L7V	ENSP00000365320:L7V	L	-	1	2	2	PAGE1	49346066	49346066	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.800000	0.27042	0.857000	0.35407	0.314000	0.21332	TTA	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.373	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081210.1	1	0	1		2	2	2	0		0	0	13		13	13	1	2.940000	-20.000000	1	0.320000				45	45		61	60	1		1			0	0	13	0		1.000000	0	0	0	0	0	0	45	61
ALAS2	212	broad.mit.edu	37	X	55047614	55047614	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chrX:55047614C>T	ENST00000330807.5	-	5	646	c.509G>A	c.(508-510)cGc>cAc	p.R170H	ALAS2_ENST00000396198.3_Missense_Mutation_p.R157H|ALAS2_ENST00000335854.4_Missense_Mutation_p.R133H|ALAS2_ENST00000498636.1_5'Flank	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	170			R -> H (in XLSA; significantly increased thermosensitivity). {ECO:0000269|PubMed:21309041}.		cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	ATCAGCCCAGCGGTTCACAGT	0.483																																						ENST00000330807.5	1.000000	0.930000	1	9.600000e-01	0.980000	0.986981	0.980000	0.990000																										0				17	GRCh37	CM983851|CM983852	ALAS2	M		c.(508-510)cGc>cAc		aminolevulinate, delta-, synthase 2	Glycine(DB00145)						170.0	121.0	137.0					X																	55047614		2203	4300	6503	SO:0001583	missense	212	0	0					g.chrX:55047614C>T		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.509G>A	chrX.hg19:g.55047614C>T	ENSP00000332369:p.Arg170His						ALAS2_ENST00000396198.3_Missense_Mutation_p.R157H|ALAS2_ENST00000335854.4_Missense_Mutation_p.R133H|ALAS2_ENST00000498636.1_5'Flank	p.R170H	NM_000032.4	NP_000023.2	0	1	1		P22557	HEM0_HUMAN		5	646	-			A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	1	1	hg19	c.509G>A	CCDS14366.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.145686|5.145686	0.94603|0.94603	.|.	.|.	ENSG00000158578|ENSG00000158578	ENST00000455688|ENST00000330807;ENST00000396198;ENST00000335854	.|D;D;D	.|0.95554	.|-3.74;-3.74;-3.74	4.92|4.92	4.92|4.92	0.64577|0.64577	4.92|4.92	4.92|4.92	0.64577|0.64577	.|Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97971|0.97971	0.9332|0.9332	M|M	0.88310|0.88310	2.945|2.945	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.998;0.996;0.998	D|D	0.99123|0.99123	1.0850|1.0850	5|10	.|0.87932	.|D	.|0	-17.4214|-17.4214	16.2829|16.2829	0.82707|0.82707	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|133;157;170	.|A8K6C4;Q5JZF5;P22557	.|.;.;HEM0_HUMAN	T|H	122|170;157;133	.|ENSP00000332369:R170H;ENSP00000379501:R157H;ENSP00000337131:R133H	.|ENSP00000332369:R170H	A|R	-|-	1|2	0|0	0|0	ALAS2|ALAS2	55064339|55064339	55064339|55064339	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.818000|7.818000	0.86416|0.86416	2.185000|2.185000	0.69588|0.69588	0.529000|0.529000	0.55759|0.55759	GCT|CGC	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.483	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	1	0	1		2	2	2	0		0	0	34		34	33	1	2.940000	-20.000000	1	0.320000	NM_000032			109	109		113	113	1		1			0	0	34	0		1.000000	0	0	0	0	0	0	109	113
IRS4	8471	broad.mit.edu	37	X	107977753	107977753	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IB-7646-01A-11D-2154-08	TCGA-IB-7646-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e26b2473-9399-4eb8-9574-5b934b560740	5218f2a6-5b5d-4e1a-aaf1-a0cd5e536571	g.chrX:107977753T>A	ENST00000372129.2	-	1	1898	c.1822A>T	c.(1822-1824)Aaa>Taa	p.K608*	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	608					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TTCAGAGATTTTCCACGTTCA	0.542																																						ENST00000372129.2	1.000000	0.970000	1	9.800000e-01	0.990000	0.997513	0.990000	1.000000																										0				78						c.(1822-1824)Aaa>Taa		insulin receptor substrate 4							206.0	204.0	205.0					X																	107977753		2203	4300	6503	SO:0001587	stop_gained	8471	0	0					g.chrX:107977753T>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1822A>T	chrX.hg19:g.107977753T>A	ENSP00000361202:p.Lys608*						RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	p.K608*	NM_003604.2	NP_003595.1	0	1	1		O14654	IRS4_HUMAN		1	1898	-				Nonsense_Mutation	SNP	ENST00000372129.2	0	1	hg19	c.1822A>T	CCDS14544.1	1	.	.	.	.	.	.	.	.	.	.	T	38	6.696633	0.97772	.	.	ENSG00000133124	ENST00000372129	.	.	.	4.77	4.77	0.60923	4.77	4.77	0.60923	.	0.116050	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1376	13.1593	0.59535	0.0:0.0:0.0:1.0	.	.	.	.	X	608	.	ENSP00000361202:K608X	K	-	1	0	0	IRS4	107864409	107864409	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	3.745000	0.55119	1.757000	0.51966	0.417000	0.27973	AAA	0.320000		TCGA-IB-7646-01A-11D-2154-08	0.542	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	1	0	1		2	2	2	0		0	0	126		126	125	1	2.940000	-20.000000	1	0.320000	NM_003604			439	435		491	482	1		1			0	0	126	0		1.000000	0	0	0	0	0	0	439	491
