#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CUBN	8029	broad.mit.edu	37	10	16970247	16970247	+	Silent	SNP	C	C	A	rs534571792		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr10:16970247C>A	ENST00000377833.4	-	41	6245	c.6180G>T	c.(6178-6180)ggG>ggT	p.G2060G		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2060	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCGGATGGGCCCAGGGATCT	0.478																																						ENST00000377833.4	1.000000	0.120000	0.380000	0.180000	0.260000	0.304030	0.260000	0.250000																										0				241						c.(6178-6180)ggG>ggT		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						71.0	67.0	68.0					10																	16970247		2203	4300	6503	SO:0001819	synonymous_variant	8029	0	0					g.chr10:16970247C>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6180G>T	chr10.hg19:g.16970247C>A		0						p.G2060G	NM_001081.3	NP_001072.2	1	2	3	2.033932	O60494	CUBN_HUMAN		41	6245	-			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	1	1	hg19	c.6180G>T	CCDS7113.1	0																																																																																								0.244533		TCGA-IB-7647-01A-11D-2154-08	0.478	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	0	0	1		2	2	2	0		0	0	81		81	79	1	1.920000	-3.318793	1	0.240000	NM_001081			9	9		289	289	0		1	0		0	0	81	0		0.994409	0	0	0	0	1	0	9	289
ST8SIA6	338596	broad.mit.edu	37	10	17363212	17363212	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr10:17363212C>T	ENST00000377602.4	-	8	936	c.862G>A	c.(862-864)Gaa>Aaa	p.E288K		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	288					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						TTAGACTCTTCGAGCGTGTAG	0.443																																						ENST00000377602.4	1.000000	0.130000	0.250000	0.160000	0.200000	0.237006	0.200000	0.200000																										0				37						c.(862-864)Gaa>Aaa		ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6							146.0	153.0	151.0					10																	17363212		2203	4300	6503	SO:0001583	missense	338596	8	121412	45				g.chr10:17363212C>T		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.862G>A	chr10.hg19:g.17363212C>T	ENSP00000366827:p.Glu288Lys	0						p.E288K	NM_001004470.1	NP_001004470.1	1	2	3	2.033932	P61647	SIA8F_HUMAN		8	936	-			B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	1	1	hg19	c.862G>A	CCDS31158.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.010|0.010	-1.793994|-1.793994	0.00617|0.00617	.|.	.|.	ENSG00000148488|ENSG00000148488	ENST00000377610;ENST00000377602|ENST00000440449	T|.	0.28454|.	1.61|.	5.18|5.18	1.42|1.42	0.22433|0.22433	5.18|5.18	1.42|1.42	0.22433|0.22433	.|.	0.613081|.	0.19292|.	N|.	0.117871|.	T|T	0.09423|0.09423	0.0232|0.0232	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	B|.	0.11235|.	0.004|.	B|.	0.04013|.	0.001|.	T|T	0.32025|0.32025	-0.9922|-0.9922	10|5	0.02654|.	T|.	1|.	-14.1943|-14.1943	5.6706|5.6706	0.17721|0.17721	0.0:0.2239:0.2137:0.5624|0.0:0.2239:0.2137:0.5624	.|.	288|.	P61647|.	SIA8F_HUMAN|.	K|Q	118;288|108	ENSP00000366827:E288K|.	ENSP00000366827:E288K|.	E|R	-|-	1|2	0|0	0|0	ST8SIA6|ST8SIA6	17403218|17403218	17403218|17403218	0.060000|0.060000	0.20803|0.20803	0.011000|0.011000	0.14972|0.14972	0.107000|0.107000	0.19398|0.19398	1.102000|1.102000	0.31050|0.31050	0.533000|0.533000	0.28675|0.28675	-0.312000|-0.312000	0.09012|0.09012	GAA|CGA	0.244533		TCGA-IB-7647-01A-11D-2154-08	0.443	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	0	0	1		2	2	2	0		0	0	176		176	175	1	1.920000	-2.564368	1	0.240000	NM_001004470			28	29		1142	1130	0		1	0		0	0	176	0		1.000000	6.317615e-04	0	0	0	2	0	28	1142
ANK3	288	broad.mit.edu	37	10	61847990	61847990	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr10:61847990C>G	ENST00000280772.2	-	29	3646	c.3455G>C	c.(3454-3456)gGa>gCa	p.G1152A	ANK3_ENST00000503366.1_Missense_Mutation_p.G1153A|ANK3_ENST00000373827.2_Missense_Mutation_p.G1146A|ANK3_ENST00000355288.2_Missense_Mutation_p.G286A	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1152	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GCTCAGAATTCCACCTTCAGG	0.468																																						ENST00000280772.2	1.000000	0.790000	1.000000	0.890000	0.990000	0.961262	0.990000	1.000000																										0				196						c.(3454-3456)gGa>gCa		ankyrin 3, node of Ranvier (ankyrin G)							133.0	133.0	133.0					10																	61847990		2203	4300	6503	SO:0001583	missense	288	0	0					g.chr10:61847990C>G	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3455G>C	chr10.hg19:g.61847990C>G	ENSP00000280772:p.Gly1152Ala	0					ANK3_ENST00000355288.2_Missense_Mutation_p.G286A|ANK3_ENST00000373827.2_Missense_Mutation_p.G1146A|ANK3_ENST00000503366.1_Missense_Mutation_p.G1153A	p.G1152A	NM_020987.3	NP_066267.2	1	2	3	2.033932	Q12955	ANK3_HUMAN		29	3646	-			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	1	1	hg19	c.3455G>C	CCDS7258.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.306184	0.95629	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.000000	0.41500	D	0.000864	T	0.62756	0.2454	M	0.90542	3.125	0.80722	D	1	P;D;D;D;D;D;D	0.89917	0.947;1.0;1.0;1.0;0.999;1.0;0.999	P;D;D;D;D;D;D	0.91635	0.878;0.998;0.999;0.999;0.997;0.997;0.996	T	0.67317	-0.5701	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1153;286;685;1146;1152;387;286	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	A	1152;1146;286;286;1153;1132;387;787;787;285;685	ENSP00000280772:G1152A;ENSP00000362933:G1146A;ENSP00000347436:G286A;ENSP00000425236:G1153A	ENSP00000280772:G1152A	G	-	2	0	0	ANK3	61517996	61517996	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.466000	0.80914	2.941000	0.99782	0.655000	0.94253	GGA	0.244533		TCGA-IB-7647-01A-11D-2154-08	0.468	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	1	0	1		2	2	2	0		0	0	136		136	135	1	1.920000	-19.999990	1	0.240000	NM_020987			69	68		507	504	1		1	1		0	0	136	0		1.000000	9.863805e-01	0	20	0	31	0	69	507
SEC31B	25956	broad.mit.edu	37	10	102262171	102262171	+	Missense_Mutation	SNP	C	C	T	rs376511713		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr10:102262171C>T	ENST00000370345.3	-	11	1347	c.1250G>A	c.(1249-1251)cGc>cAc	p.R417H	SEC31B_ENST00000451524.1_Missense_Mutation_p.R417H|SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	417					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GAAGACTAGGCGGGGGCAAGG	0.527																																						ENST00000370345.3	1.000000	0.820000	1.000000	0.950000	0.990000	0.980343	0.990000	1.000000																										0				36						c.(1249-1251)cGc>cAc		SEC31 homolog B (S. cerevisiae)			HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	62.0	63.0	62.0		1250	-1.0	0.2	10		62	0,8600		0,0,4300	no	missense	SEC31B	NM_015490.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	417/1180	102262171	1,13005	2203	4300	6503	SO:0001583	missense	25956	3	121412	36				g.chr10:102262171C>T	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.1250G>A	chr10.hg19:g.102262171C>T	ENSP00000359370:p.Arg417His	0					SEC31B_ENST00000494350.1_5'Flank|SEC31B_ENST00000451524.1_Missense_Mutation_p.R417H	p.R417H	NM_015490.3	NP_056305.1	1	2	3	2.033932	Q9NQW1	SC31B_HUMAN		11	1347	-		Colorectal(252;0.117)	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	1	1	hg19	c.1250G>A	CCDS7495.1	1	.	.	.	.	.	.	.	.	.	.	c	7.417	0.635990	0.14386	2.27E-4	0.0	ENSG00000075826	ENST00000370345;ENST00000451524	T;T	0.59083	0.66;0.29	5.38	-1.01	0.10169	5.38	-1.01	0.10169	.	0.242628	0.49305	N	0.000156	T	0.39627	0.1085	L	0.31926	0.97	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.16778	-1.0391	10	0.14656	T	0.56	-0.3817	11.439	0.50086	0.0:0.5274:0.0:0.4726	.	416;417	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	H	417	ENSP00000359370:R417H;ENSP00000391178:R417H	ENSP00000359370:R417H	R	-	2	0	0	SEC31B	102252161	102252161	0.334000	0.24739	0.219000	0.23793	0.509000	0.34042	-0.023000	0.12456	-0.190000	0.10465	-0.227000	0.12334	CGC	0.244533		TCGA-IB-7647-01A-11D-2154-08	0.527	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	1	0	1		2	2	2	0		0	0	65		65	65	1	1.920000	-2.879556	1	0.240000	NM_015490			49	49		328	327	1		1			0	0	65	0		1.000000	0	0	0	0	0	0	49	328
MUC6	4588	broad.mit.edu	37	11	1031906	1031906	+	Missense_Mutation	SNP	C	C	T	rs547156930		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr11:1031906C>T	ENST00000421673.2	-	3	313	c.263G>A	c.(262-264)cGa>cAa	p.R88Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	88	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTCTGGGCCTCGCCGCAGCTG	0.622																																						ENST00000421673.2	0.910000	0.270000	0.690000	0.380000	0.520000	0.541109	0.520000	0.500000																										0				80						c.(262-264)cGa>cAa		mucin 6, oligomeric mucus/gel-forming							68.0	75.0	73.0					11																	1031906		2140	4227	6367	SO:0001583	missense	4588	3	121076	38				g.chr11:1031906C>T	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.263G>A	chr11.hg19:g.1031906C>T	ENSP00000406861:p.Arg88Gln	1						p.R88Q	NM_005961.2	NP_005952.2	1	2	3	2.282413	Q6W4X9	MUC6_HUMAN		3	313	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	1	1	hg19	c.263G>A	CCDS44513.1	0	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941759	0.73557	.	.	ENSG00000184956	ENST00000421673;ENST00000525923	T;T	0.59638	0.25;0.25	4.03	4.03	0.46877	4.03	4.03	0.46877	von Willebrand factor, type D domain (3);	0.000000	0.28016	U	0.016921	T	0.75443	0.3850	M	0.76002	2.32	0.34055	D	0.656646	D	0.89917	1.0	D	0.91635	0.999	D	0.84681	0.0717	10	0.72032	D	0.01	.	16.1414	0.81528	0.0:1.0:0.0:0.0	.	88	Q6W4X9	MUC6_HUMAN	Q	88;112	ENSP00000406861:R88Q;ENSP00000433790:R112Q	ENSP00000406861:R88Q	R	-	2	0	0	MUC6	1021906	1021906	0.828000	0.29307	0.981000	0.43875	0.586000	0.36452	3.799000	0.55529	1.968000	0.57251	0.462000	0.41574	CGA	0.319971		TCGA-IB-7647-01A-11D-2154-08	0.622	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	1	0	1		2	2	2	0		0	0	68		68	65	1	1.920000	-3.231474	1	0.240000	XM_290540			11	11		193	191	0		1	0		0	0	68	0		0.998386	0	0	0	0	1	0	11	193
LDLRAD3	143458	broad.mit.edu	37	11	36250849	36250849	+	Missense_Mutation	SNP	G	G	A	rs367902001		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr11:36250849G>A	ENST00000315571.5	+	6	961	c.940G>A	c.(940-942)Gtg>Atg	p.V314M	LDLRAD3_ENST00000528989.1_Missense_Mutation_p.V265M|LDLRAD3_ENST00000524419.1_Missense_Mutation_p.V304M	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	314					receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				CCTCCTGAGCGTGGAAGACAC	0.662																																						ENST00000315571.5	0.260000	0.080000	0.210000	0.110000	0.150000	0.172912	0.150000	0.150000																										0				28						c.(940-942)Gtg>Atg		low density lipoprotein receptor class A domain containing 3		G	MET/VAL	0,4404		0,0,2202	57.0	67.0	63.0		940	-1.1	0.0	11		63	1,8589		0,1,4294	no	missense	LDLRAD3	NM_174902.2	21	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	314/346	36250849	1,12993	2202	4295	6497	SO:0001583	missense	143458	9	121390	42				g.chr11:36250849G>A	AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.940G>A	chr11.hg19:g.36250849G>A	ENSP00000318607:p.Val314Met	1					LDLRAD3_ENST00000524419.1_Missense_Mutation_p.V304M|LDLRAD3_ENST00000528989.1_Missense_Mutation_p.V265M	p.V314M	NM_174902.2	NP_777562.1	1	2	3	2.282413	Q86YD5	LRAD3_HUMAN		6	961	+	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)	B7Z1U3|B9EG81|Q8NBJ0	Missense_Mutation	SNP	ENST00000315571.5	0	1	hg19	c.940G>A	CCDS31462.1	0	.	.	.	.	.	.	.	.	.	.	G	9.730	1.161967	0.21538	0.0	1.16E-4	ENSG00000179241	ENST00000528989;ENST00000524419;ENST00000315571	D;D;D	0.94576	-3.46;-3.33;-3.22	5.22	-1.14	0.09741	5.22	-1.14	0.09741	.	1.345450	0.04918	N	0.454465	D	0.86151	0.5864	N	0.14661	0.345	0.09310	N	1	B;B;B	0.15473	0.013;0.003;0.003	B;B;B	0.08055	0.003;0.0;0.0	T	0.73984	-0.3810	10	0.38643	T	0.18	.	2.0251	0.03517	0.5317:0.1415:0.1838:0.1429	.	304;265;314	E9PR86;B7Z1U3;Q86YD5	.;.;LRAD3_HUMAN	M	265;304;314	ENSP00000433954:V265M;ENSP00000434313:V304M;ENSP00000318607:V314M	ENSP00000318607:V314M	V	+	1	0	0	LDLRAD3	36207425	36207425	0.000000	0.05858	0.031000	0.17742	0.580000	0.36256	-0.821000	0.04452	-0.105000	0.12132	0.563000	0.77884	GTG	0.319971		TCGA-IB-7647-01A-11D-2154-08	0.662	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	0	0	1		2	2	2	0		0	0	167		167	159	1	1.920000	-3.078595	1	0.240000	NM_174902			16	16		941	919	0		1	0		0	0	167	0		0.999917	9.819553e-04	0	0	0	3	0	16	941
LRRC4C	57689	broad.mit.edu	37	11	40137319	40137319	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr11:40137319C>T	ENST00000278198.2	-	2	2487	c.524G>A	c.(523-525)cGc>cAc	p.R175H	LRRC4C_ENST00000530763.1_Missense_Mutation_p.R175H|LRRC4C_ENST00000528697.1_Missense_Mutation_p.R175H|LRRC4C_ENST00000527150.1_Missense_Mutation_p.R175H			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	175					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTCTAGTCGGCGCAAAGAAGG	0.428																																						ENST00000278198.2	0.700000	0.330000	0.580000	0.400000	0.480000	0.498374	0.480000	0.480000																										0				86						c.(523-525)cGc>cAc		leucine rich repeat containing 4C							92.0	91.0	91.0					11																	40137319		2203	4300	6503	SO:0001583	missense	57689	3	121412	34				g.chr11:40137319C>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.524G>A	chr11.hg19:g.40137319C>T	ENSP00000278198:p.Arg175His	1					LRRC4C_ENST00000530763.1_Missense_Mutation_p.R175H|LRRC4C_ENST00000527150.1_Missense_Mutation_p.R175H|LRRC4C_ENST00000528697.1_Missense_Mutation_p.R175H	p.R175H			1	2	3	2.282413	Q9HCJ2	LRC4C_HUMAN		2	2487	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	0	1	hg19	c.524G>A	CCDS31464.1	0	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305659	0.60305	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.05081	3.5;3.5;3.5;3.5	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.25344	0.0616	M	0.67517	2.055	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.00029	-1.2295	10	0.49607	T	0.09	.	19.0894	0.93221	0.0:1.0:0.0:0.0	.	175	Q9HCJ2	LRC4C_HUMAN	H	175	ENSP00000278198:R175H;ENSP00000436976:R175H;ENSP00000437132:R175H;ENSP00000434761:R175H	ENSP00000278198:R175H	R	-	2	0	0	LRRC4C	40093895	40093895	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.050000	0.71063	2.754000	0.94517	0.650000	0.86243	CGC	0.319971		TCGA-IB-7647-01A-11D-2154-08	0.428	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	0	0	1		24	3	2	1		1	1	74		74	73	1	1.920000	-5.881021	1	0.240000	NM_020929			30	30		551	550	0		1	0		1	0	74	0		0.830445	1.120463e-01	0	0	0	22	0	30	551
TAS2R31	259290	broad.mit.edu	37	12	11183165	11183165	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:11183165T>C	ENST00000390675.2	-	1	841	c.770A>G	c.(769-771)aAc>aGc	p.N257S	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	257					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						GACAGGTTTGTTTTCCAGACT	0.383																																						ENST00000390675.2	0.180000	0.060000	0.150000	0.090000	0.110000	0.122824	0.110000	0.120000																										0				7						c.(769-771)aAc>aGc		taste receptor, type 2, member 31							203.0	213.0	210.0					12																	11183165		2164	4282	6446	SO:0001583	missense	259290	0	0					g.chr12:11183165T>C	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.770A>G	chr12.hg19:g.11183165T>C	ENSP00000375093:p.Asn257Ser	0					TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	p.N257S	NM_176885.2	NP_795366.2	0	0	0	2.006602	P59538	T2R31_HUMAN		1	841	-			P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	0	1	hg19	c.770A>G	CCDS53747.1	0	.	.	.	.	.	.	.	.	.	.	.	5.489	0.275150	0.10403	.	.	ENSG00000256436	ENST00000390675	T	0.00760	5.73	2.45	-0.013	0.13986	2.45	-0.013	0.13986	.	.	.	.	.	T	0.00906	0.0030	L	0.42487	1.325	0.09310	N	1	B	0.26672	0.156	B	0.33799	0.17	T	0.46148	-0.9212	9	0.26408	T	0.33	.	4.233	0.10613	0.0:0.3766:0.0:0.6234	.	257	P59538	T2R31_HUMAN	S	257	ENSP00000375093:N257S	ENSP00000375093:N257S	N	-	2	0	0	TAS2R31	11074432	11074432	0.000000	0.05858	0.003000	0.11579	0.023000	0.10783	0.106000	0.15354	0.198000	0.20407	0.163000	0.16589	AAC	0.232633		TCGA-IB-7647-01A-11D-2154-08	0.383	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	0	0	1		2	2	2	0		0	0	223		223	227	1	1.920000	-2.774755	1	0.240000	NM_176885			21	18		1452	1399	0		1	0		0	0	223	0		0.999996	0	0	0	0	1	0	21	1452
KCNA5	3741	broad.mit.edu	37	12	5153781	5153781	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:5153781C>A	ENST00000252321.3	+	1	697	c.468C>A	c.(466-468)ttC>ttA	p.F156L		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	156					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	TGCGCTACTTCGACCCCCTGA	0.652																																						ENST00000252321.3	0.400000	0.080000	0.290000	0.130000	0.190000	0.218423	0.190000	0.180000																										0				52						c.(466-468)ttC>ttA		potassium voltage-gated channel, shaker-related subfamily, member 5	Dalfampridine(DB06637)						35.0	38.0	37.0					12																	5153781		2203	4300	6503	SO:0001583	missense	3741	0	0					g.chr12:5153781C>A	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.468C>A	chr12.hg19:g.5153781C>A	ENSP00000252321:p.Phe156Leu	0						p.F156L	NM_002234.3	NP_002225.2	1	2	3	2.022387	P22460	KCNA5_HUMAN		1	697	+			Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	0	1	hg19	c.468C>A	CCDS8536.1	0	.	.	.	.	.	.	.	.	.	.	C	16.79	3.219176	0.58560	.	.	ENSG00000130037	ENST00000252321	T	0.75821	-0.97	4.7	1.64	0.23874	4.7	1.64	0.23874	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	U	0.000000	D	0.82342	0.5016	M	0.71036	2.16	0.50632	D	0.999888	D	0.76494	0.999	D	0.79784	0.993	T	0.82074	-0.0637	10	0.87932	D	0	.	9.7379	0.40399	0.0:0.676:0.0:0.324	.	156	P22460	KCNA5_HUMAN	L	156	ENSP00000252321:F156L	ENSP00000252321:F156L	F	+	3	2	2	KCNA5	5024042	5024042	0.971000	0.33674	1.000000	0.80357	0.994000	0.84299	0.197000	0.17197	0.598000	0.29829	0.511000	0.50034	TTC	0.241820		TCGA-IB-7647-01A-11D-2154-08	0.652	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	0	0	1		2	2	2	0		0	0	84		84	83	1	1.920000	-7.322644	1	0.240000	NM_002234			7	7		305	303	0		1	0		0	0	84	0		0.980472	4.185718e-03	0	0	0	4	0	7	305
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.370000	0.980000	0.530000	0.730000	0.739733	0.730000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	0	0	2.006602	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.232633		TCGA-IB-7647-01A-11D-2154-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	25		25	25	1	1.920000	-6.245686	1	0.240000	NM_033360			9	9		94	93	0		1	1	1	0	0	25	389		0.994669	9.830912e-01	1	25	57	53	534	9	94
NELL2	4753	broad.mit.edu	37	12	44917143	44917143	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:44917143A>T	ENST00000429094.2	-	17	2433	c.1929T>A	c.(1927-1929)gaT>gaA	p.D643E	NELL2_ENST00000333837.4_Missense_Mutation_p.D666E|NELL2_ENST00000437801.2_Missense_Mutation_p.D693E|NELL2_ENST00000395487.2_Missense_Mutation_p.D642E|NELL2_ENST00000551601.1_Missense_Mutation_p.D595E|NELL2_ENST00000549027.1_Missense_Mutation_p.D642E|NELL2_ENST00000452445.2_Missense_Mutation_p.D643E	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	643	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TAACTTTTCCATCATGGATGC	0.413																																						ENST00000429094.2	1.000000	0.700000	0.970000	0.780000	0.870000	0.879691	0.870000	1.000000																										0				65						c.(1927-1929)gaT>gaA		NEL-like 2 (chicken)							166.0	159.0	161.0					12																	44917143		2203	4300	6503	SO:0001583	missense	4753	0	0					g.chr12:44917143A>T	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1929T>A	chr12.hg19:g.44917143A>T	ENSP00000390680:p.Asp643Glu	0					NELL2_ENST00000437801.2_Missense_Mutation_p.D693E|NELL2_ENST00000549027.1_Missense_Mutation_p.D642E|NELL2_ENST00000452445.2_Missense_Mutation_p.D643E|NELL2_ENST00000395487.2_Missense_Mutation_p.D642E|NELL2_ENST00000333837.4_Missense_Mutation_p.D666E|NELL2_ENST00000551601.1_Missense_Mutation_p.D595E	p.D643E	NM_001145108.1	NP_001138580.1	0	1	1	2.015391	Q99435	NELL2_HUMAN		17	2433	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	1	1	hg19	c.1929T>A	CCDS8746.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.402|6.402	0.442294|0.442294	0.12164|0.12164	.|.	.|.	ENSG00000184613|ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801|ENST00000550139	T;T;T;T;T;T;D|.	0.81739|.	-1.47;-1.46;-1.13;-1.46;-1.47;-1.4;-1.53|.	5.82|5.82	-1.94|-1.94	0.07571|0.07571	5.82|5.82	-1.94|-1.94	0.07571|0.07571	von Willebrand factor, type C (2);|.	0.336601|.	0.33753|.	N|.	0.004596|.	T|T	0.12902|0.12902	0.0313|0.0313	N|N	0.10629|0.10629	0.01|0.01	0.29822|0.29822	N|N	0.830744|0.830744	B;B;B;B;B|.	0.06786|.	0.0;0.0;0.001;0.0;0.0|.	B;B;B;B;B|.	0.08055|.	0.001;0.001;0.003;0.001;0.001|.	T|T	0.26780|0.26780	-1.0093|-1.0093	10|5	0.02654|.	T|.	1|.	-8.98|-8.98	0.8838|0.8838	0.01240|0.01240	0.3152:0.0985:0.2528:0.3335|0.3152:0.0985:0.2528:0.3335	.|.	666;693;595;643;642|.	B7Z2U7;B7Z9U3;F8VVB6;Q99435;Q96JS2|.	.;.;.;NELL2_HUMAN;.|.	E|R	642;643;595;643;642;666;693|56	ENSP00000378866:D642E;ENSP00000390680:D643E;ENSP00000449332:D595E;ENSP00000394612:D643E;ENSP00000447927:D642E;ENSP00000327988:D666E;ENSP00000416341:D693E|.	ENSP00000327988:D666E|.	D|W	-|-	3|1	2|0	2|0	NELL2|NELL2	43203410|43203410	43203410|43203410	0.983000|0.983000	0.35010|0.35010	0.406000|0.406000	0.26421|0.26421	0.961000|0.961000	0.63080|0.63080	0.473000|0.473000	0.22132|0.22132	-0.594000|-0.594000	0.05836|0.05836	0.523000|0.523000	0.50628|0.50628	GAT|TGG	0.238172		TCGA-IB-7647-01A-11D-2154-08	0.413	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	1	0	1		2	2	2	0		0	0	114		114	112	1	1.920000	-20.000000	1	0.240000	NM_006159			83	83		701	696	1		1	0		0	0	114	0		1.000000	8.391413e-01	0	0	0	30	0	83	701
TUBA1A	7846	broad.mit.edu	37	12	49580155	49580155	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:49580155G>A	ENST00000295766.5	-	3	792	c.313C>T	c.(313-315)Cga>Tga	p.R105*	TUBA1A_ENST00000546918.1_Silent_p.P155P|TUBA1A_ENST00000301071.7_Nonsense_Mutation_p.R105*|TUBA1A_ENST00000550767.1_Nonsense_Mutation_p.R70*	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	105					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	TAGTGCCCTCGGGCATAGTTA	0.468																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	ENST00000295766.5	0.390000	0.190000	0.340000	0.230000	0.280000	0.292366	0.280000	0.280000																										0				2						c.(313-315)Cga>Tga		tubulin, alpha 1a	Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)						135.0	139.0	138.0					12																	49580155		2203	4300	6503	SO:0001587	stop_gained	7846	0	0					g.chr12:49580155G>A	AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.313C>T	chr12.hg19:g.49580155G>A	ENSP00000439020:p.Arg105*	0					TUBA1A_ENST00000550767.1_Nonsense_Mutation_p.R70*|TUBA1A_ENST00000546918.1_Silent_p.P155P|TUBA1A_ENST00000301071.7_Nonsense_Mutation_p.R105*	p.R105*	NM_001270399.1	NP_001257328.1	0	1	1	2.015391	Q71U36	TBA1A_HUMAN		3	792	-			A8K0B8|G3V1U9|P04687|P05209	Nonsense_Mutation	SNP	ENST00000295766.5	0	1	hg19	c.313C>T	CCDS58227.1	0	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716103	0.89205	.	.	ENSG00000167552	ENST00000301071;ENST00000295766;ENST00000550767;ENST00000547939;ENST00000552924	.	.	.	5.22	5.22	0.72569	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5677	0.61828	0.0:0.0:0.8438:0.1562	.	.	.	.	X	105;105;70;70;70	.	ENSP00000439020:R105X	R	-	1	2	2	TUBA1A	47866422	47866422	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.541000	0.82084	2.605000	0.88082	0.561000	0.74099	CGA	0.238172		TCGA-IB-7647-01A-11D-2154-08	0.468	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404547.2	0	0	1		2	2	2	0		0	0	180		180	183	1	1.920000	-2.222362	0	0.240000	NM_006009			34	34		956	946	0		1	0		0	0	180	0		1.000000	1	0	1	0	1406	0	34	956
CAPS2	84698	broad.mit.edu	37	12	75687069	75687069	+	Nonsense_Mutation	SNP	G	G	A	rs201447508		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:75687069G>A	ENST00000409445.3	-	13	1376	c.1180C>T	c.(1180-1182)Cga>Tga	p.R394*	CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000442339.2_5'UTR|RP11-560G2.1_ENST00000534648.2_RNA|CAPS2_ENST00000393284.3_Nonsense_Mutation_p.R162*|RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000409799.1_Nonsense_Mutation_p.R312*	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	394							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TTTGTGATTCGGAGTTTAAGT	0.318																																						ENST00000409445.3	0.590000	0.190000	0.470000	0.260000	0.350000	0.374684	0.350000	0.340000																										0				10						c.(1180-1182)Cga>Tga		calcyphosine 2							125.0	114.0	118.0					12																	75687069		2203	4300	6503	SO:0001587	stop_gained	84698	9	121410	41				g.chr12:75687069G>A	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1180C>T	chr12.hg19:g.75687069G>A	ENSP00000386959:p.Arg394*	0					CAPS2_ENST00000393284.3_Nonsense_Mutation_p.R162*|RP11-560G2.1_ENST00000534648.2_RNA|CAPS2_ENST00000409799.1_Nonsense_Mutation_p.R312*|CAPS2_ENST00000409004.1_5'UTR|RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000442339.2_5'UTR	p.R394*	NM_032606.3	NP_115995.2	0	1	1	2.015391	Q9BXY5	CAYP2_HUMAN		13	1376	-			Q6PH84|Q8N242|Q8NAY5	Nonsense_Mutation	SNP	ENST00000409445.3	0	1	hg19	c.1180C>T	CCDS9008.2	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	21.2	4.110650	0.77210	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284	.	.	.	4.6	4.6	0.57074	4.6	4.6	0.57074	.	0.130292	0.34245	N	0.004139	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0574	8.339	0.32232	0.0819:0.0:0.7645:0.1536	.	.	.	.	X	312;394;130;162	.	ENSP00000367975:R130X	R	-	1	2	2	CAPS2	73973336	73973336	1.000000	0.71417	0.988000	0.46212	0.091000	0.18340	3.286000	0.51724	2.282000	0.76494	0.446000	0.29264	CGA	0.238172		TCGA-IB-7647-01A-11D-2154-08	0.318	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2	1	0	1		2	2	2	0		0	0	45		45	45	1	1.920000	-2.557264	1	0.240000				11	11		250	247	0		1	0		0	0	45	0		0.998329	2.246803e-03	0	1	0	1	0	11	250
TBX5	6910	broad.mit.edu	37	12	114836449	114836449	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr12:114836449G>T	ENST00000310346.4	-	5	1105	c.439C>A	c.(439-441)Cat>Aat	p.H147N	TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000526441.1_Missense_Mutation_p.H147N|TBX5_ENST00000349716.5_Missense_Mutation_p.H97N|TBX5_ENST00000405440.2_Missense_Mutation_p.H147N	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	147					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CTCATCCAATGCGCCCCGGTG	0.612																																					NSCLC(152;1358 1980 4050 23898 40356)	ENST00000310346.4	1.000000	0.740000	1.000000	0.970000	0.990000	0.976400	0.990000	1.000000																										0				56						c.(439-441)Cat>Aat		T-box 5							76.0	60.0	65.0					12																	114836449		2203	4300	6503	SO:0001583	missense	6910	0	0					g.chr12:114836449G>T	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.439C>A	chr12.hg19:g.114836449G>T	ENSP00000309913:p.His147Asn	0					TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000405440.2_Missense_Mutation_p.H147N|TBX5_ENST00000349716.5_Missense_Mutation_p.H97N|TBX5_ENST00000526441.1_Missense_Mutation_p.H147N	p.H147N	NM_000192.3	NP_000183.2	0	1	1	2.015391	Q99593	TBX5_HUMAN		5	1105	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	0	1	hg19	c.439C>A	CCDS9173.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143320	0.77888	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	4.35	4.35	0.52113	4.35	4.35	0.52113	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92971	0.7763	M	0.77103	2.36	0.80722	D	1	D;D	0.65815	0.995;0.988	D;D	0.66979	0.948;0.947	D	0.93955	0.7235	10	0.72032	D	0.01	.	17.429	0.87534	0.0:0.0:1.0:0.0	.	147;147	Q99593-2;Q99593	.;TBX5_HUMAN	N	97;147;44;147;147	ENSP00000337723:H97N;ENSP00000309913:H147N;ENSP00000384152:H147N;ENSP00000433292:H147N	ENSP00000309913:H147N	H	-	1	0	0	TBX5	113320832	113320832	1.000000	0.71417	0.733000	0.30861	0.486000	0.33341	9.581000	0.98210	2.392000	0.81423	0.655000	0.94253	CAT	0.238172		TCGA-IB-7647-01A-11D-2154-08	0.612	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	1	0	1		2	2	2	0		0	0	22		22	22	1	1.920000	-19.999990	1	0.240000	NM_080717			15	13		85	85	1		1			0	0	22	0		0.999893	0	0	0	0	0	0	15	85
EXOSC8	11340	broad.mit.edu	37	13	37576427	37576427	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr13:37576427A>G	ENST00000389704.3	+	2	300	c.35A>G	c.(34-36)gAg>gGg	p.E12G	ALG5_ENST00000443765.1_5'Flank|EXOSC8_ENST00000489088.1_3'UTR|ALG5_ENST00000496689.1_5'Flank|ALG5_ENST00000239891.3_5'Flank|ALG5_ENST00000413537.2_5'Flank	NM_181503.2	NP_852480.1	Q96B26	EXOS8_HUMAN	exosome component 8	12					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)			biliary_tract(1)|breast(1)|kidney(2)|pancreas(1)|prostate(1)|skin(1)	7		Lung NSC(96;6.57e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.67e-07)|Epithelial(112;1.31e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00699)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0411)		GAACCTCTGGAGTATTACAGG	0.323																																						ENST00000389704.3	1.000000	0.140000	1.000000	0.200000	0.280000	0.428207	0.280000	0.250000																										0				7						c.(34-36)gAg>gGg		exosome component 8							116.0	112.0	113.0					13																	37576427		2203	4300	6503	SO:0001583	missense	11340	0	0					g.chr13:37576427A>G	AF025438	CCDS31958.1	13q13.1	2010-05-07			ENSG00000120699	ENSG00000120699	3.1.13.-		17035	protein-coding gene	gene with protein product	"""CBP-interacting protein 3"", ""Opa interacting protein 2"""	606019				9466265, 11929972	Standard	NM_181503		Approved	OIP2, RRP43, bA421P11.3, Rrp43p, EAP2, p9, CIP3	uc001uwa.3	Q96B26	OTTHUMG00000016742	ENST00000389704.3:c.35A>G	chr13.hg19:g.37576427A>G	ENSP00000374354:p.Glu12Gly	1					ALG5_ENST00000443765.1_5'Flank|EXOSC8_ENST00000489088.1_3'UTR|ALG5_ENST00000413537.2_5'Flank|ALG5_ENST00000496689.1_5'Flank|ALG5_ENST00000239891.3_5'Flank	p.E12G	NM_181503.2	NP_852480.1	1	2	3	2.183870	Q96B26	EXOS8_HUMAN		2	300	+		Lung NSC(96;6.57e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	O43480|Q5TBA5	Missense_Mutation	SNP	ENST00000389704.3	1	1	hg19	c.35A>G	CCDS31958.1	0	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943943	0.73672	.	.	ENSG00000120699	ENST00000389704;ENST00000379809	T	0.45276	0.9	5.47	5.47	0.80525	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.43743	0.1261	M	0.75615	2.305	0.80722	D	1	B;P	0.35139	0.219;0.486	B;B	0.28465	0.072;0.09	T	0.48468	-0.9033	10	0.52906	T	0.07	-14.8925	15.5547	0.76184	1.0:0.0:0.0:0.0	.	12;12	Q5JXM0;Q96B26	.;EXOS8_HUMAN	G	12	ENSP00000374354:E12G	ENSP00000369137:E12G	E	+	2	0	0	EXOSC8	36474427	36474427	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.767000	0.74975	2.088000	0.63022	0.528000	0.53228	GAG	0.294991		TCGA-IB-7647-01A-11D-2154-08	0.323	EXOSC8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044535.2	0	0	1		2	2	2	0		0	0	73		73	71	1	1.920000	-3.490276	1	0.240000	NM_181503			14	14		486	481	0		1	0		0	0	73	0		0.999742	9.285532e-01	0	1	0	158	0	14	486
AKAP11	11215	broad.mit.edu	37	13	42873717	42873717	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr13:42873717A>T	ENST00000025301.2	+	8	1010	c.835A>T	c.(835-837)Agg>Tgg	p.R279W		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	279	Ser-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TTGGACCCAAAGGAGTTTCTA	0.393																																						ENST00000025301.2	1.000000	0.120000	1.000000	0.170000	0.230000	0.391861	0.230000	0.210000																										0				56						c.(835-837)Agg>Tgg		A kinase (PRKA) anchor protein 11							84.0	82.0	82.0					13																	42873717		2203	4299	6502	SO:0001583	missense	11215	0	0					g.chr13:42873717A>T	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.835A>T	chr13.hg19:g.42873717A>T	ENSP00000025301:p.Arg279Trp	1						p.R279W	NM_016248.3	NP_057332.1	1	2	3	2.183870	Q9UKA4	AKA11_HUMAN		8	1010	+		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	1	1	hg19	c.835A>T	CCDS9383.1	0	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399892	0.62177	.	.	ENSG00000023516	ENST00000025301	T	0.54675	0.56	5.43	5.43	0.79202	5.43	5.43	0.79202	.	0.257696	0.42548	D	0.000687	T	0.49575	0.1565	L	0.51422	1.61	0.29627	N	0.845705	B	0.24426	0.103	B	0.21917	0.037	T	0.53229	-0.8468	10	0.54805	T	0.06	.	15.787	0.78315	1.0:0.0:0.0:0.0	.	279	Q9UKA4	AKA11_HUMAN	W	279	ENSP00000025301:R279W	ENSP00000025301:R279W	R	+	1	2	2	AKAP11	41771717	41771717	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	4.323000	0.59221	2.197000	0.70478	0.533000	0.62120	AGG	0.294991		TCGA-IB-7647-01A-11D-2154-08	0.393	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	0	0	1		2	2	2	0		0	0	101		101	100	1	1.920000	-12.642810	1	0.240000	NM_016248			16	16		672	670	0		1	1		0	0	101	0		0.999931	6.627483e-01	0	4	0	91	0	16	672
KLHL1	57626	broad.mit.edu	37	13	70281775	70281775	+	Silent	SNP	T	T	C			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr13:70281775T>C	ENST00000377844.4	-	10	2928	c.2169A>G	c.(2167-2169)caA>caG	p.Q723Q	KLHL1_ENST00000545028.1_Silent_p.Q530Q	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	723					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ACTCATTAGTTTGTGGGTCAT	0.413																																						ENST00000377844.4	1.000000	0.080000	0.300000	0.130000	0.190000	0.263195	0.190000	0.190000																										0				84						c.(2167-2169)caA>caG		kelch-like family member 1							163.0	131.0	142.0					13																	70281775		2203	4300	6503	SO:0001819	synonymous_variant	57626	0	0					g.chr13:70281775T>C	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2169A>G	chr13.hg19:g.70281775T>C		0					KLHL1_ENST00000545028.1_Silent_p.Q530Q	p.Q723Q	NM_020866.2	NP_065917.1	1	2	3	2.050432	Q9NR64	KLHL1_HUMAN		10	2928	-		Breast(118;0.000162)	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	0	1	hg19	c.2169A>G	CCDS9445.1	0																																																																																								0.248120		TCGA-IB-7647-01A-11D-2154-08	0.413	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	0	0	1		2	2	2	0		0	0	69		69	69	1	1.920000	-8.438654	1	0.240000	NM_020866			8	8		356	353	0		1			0	0	69	0		0.989198	0	0	0	0	0	0	8	356
LRFN5	145581	broad.mit.edu	37	14	42356419	42356419	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr14:42356419G>A	ENST00000298119.4	+	3	1780	c.591G>A	c.(589-591)atG>atA	p.M197I	LRFN5_ENST00000554120.1_Missense_Mutation_p.M197I|LRFN5_ENST00000554171.1_Missense_Mutation_p.M197I	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	197						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGCACAAGATGACTCGGTTAG	0.443										HNSCC(30;0.082)																												ENST00000298119.4	1.000000	0.790000	1.000000	0.930000	0.990000	0.974723	0.990000	1.000000																										0				120						c.(589-591)atG>atA		leucine rich repeat and fibronectin type III domain containing 5							72.0	64.0	67.0					14																	42356419		2203	4300	6503	SO:0001583	missense	145581	0	0					g.chr14:42356419G>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.591G>A	chr14.hg19:g.42356419G>A	ENSP00000298119:p.Met197Ile	0	HNSCC(30;0.082)				LRFN5_ENST00000554171.1_Missense_Mutation_p.M197I|LRFN5_ENST00000554120.1_Missense_Mutation_p.M197I	p.M197I	NM_152447.3	NP_689660.2	0	0	0	1.926440	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	3	1780	+			B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	1	1	hg19	c.591G>A	CCDS9678.1	1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809997	0.31961	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.49139	0.79;0.79;0.79	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000002	T	0.23289	0.0563	N	0.01771	-0.73	0.42698	D	0.993608	B;B	0.16396	0.001;0.017	B;B	0.19666	0.009;0.026	T	0.11916	-1.0568	10	0.66056	D	0.02	.	10.4503	0.44518	0.0879:0.0:0.9121:0.0	.	197;197	G3V364;Q96NI6	.;LRFN5_HUMAN	I	197	ENSP00000298119:M197I;ENSP00000451897:M197I;ENSP00000451067:M197I	ENSP00000298119:M197I	M	+	3	0	0	LRFN5	41426169	41426169	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.040000	0.41203	2.595000	0.87683	0.650000	0.86243	ATG	0.201681		TCGA-IB-7647-01A-11D-2154-08	0.443	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	1	0	1		2	2	2	0		0	0	57		57	55	1	1.920000	-20.000000	1	0.240000	NM_152447			41	40		258	254	1		1	0		0	0	57	0		1.000000	0	0	0	0	1	0	41	258
MAGEL2	54551	broad.mit.edu	37	15	23890566	23890566	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr15:23890566T>C	ENST00000532292.1	-	1	609	c.515A>G	c.(514-516)aAc>aGc	p.N172S		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	55					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GGCAGGCAGGTTTTTCCAGGC	0.587																																						ENST00000532292.1	0.480000	0.110000	0.370000	0.180000	0.260000	0.282175	0.260000	0.250000																										0				7						c.(514-516)aAc>aGc		MAGE-like 2							47.0	54.0	52.0					15																	23890566		2017	4186	6203	SO:0001583	missense	54551	0	0					g.chr15:23890566T>C	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.515A>G	chr15.hg19:g.23890566T>C	ENSP00000433433:p.Asn172Ser	0						p.N172S	NM_019066.4	NP_061939.3	0	0	0	1.976255	Q9UJ55	MAGL2_HUMAN		1	609	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		Missense_Mutation	SNP	ENST00000532292.1	0	1	hg19	c.515A>G		0	.	.	.	.	.	.	.	.	.	.	T	1.611	-0.523921	0.04141	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.08	-6.12	0.02124	4.08	-6.12	0.02124	.	.	.	.	.	T	0.23649	0.0572	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	T	0.28776	-1.0033	5	.	.	.	.	6.4455	0.21873	0.0:0.3177:0.3652:0.317	.	.	.	.	A	204	.	.	T	-	1	0	0	MAGEL2	21441659	21441659	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.962000	0.03841	-1.381000	0.02112	-1.151000	0.01829	ACC	0.221311		TCGA-IB-7647-01A-11D-2154-08	0.587	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	0	0	1		2	2	2	0		0	0	60		60	54	1	1.920000	-1.629323	0	0.240000	NM_019066			7	6		218	214	0		1	0		0	0	60	0		0.979509	1.252798e-02	0	0	0	5	0	7	218
GDE1	51573	broad.mit.edu	37	16	19528371	19528372	+	Missense_Mutation	DNP	AA	AA	TT			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr16:19528371_19528372AA>TT	ENST00000353258.3	-	2	581_582	c.401_402TT>AA	c.(400-402)aTT>aAA	p.I134K		NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	134	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						TCAGCTTCCTAATTTGTTCAAA	0.411																																						ENST00000353258.3	1.000000	0.710000|0.720000	1.000000	0.800000|0.820000	0.900000|0.920000	0.903514|0.914132	0.900000|0.920000	1.000000																										0				13						c.(400-402)atT>atA|c.(400-402)aTt>aAt		glycerophosphodiester phosphodiesterase 1																																				SO:0001583	missense	51573	0	0					g.chr16:19528371A>T|g.chr16:19528372A>T		CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.401_402delinsTT	chr16.hg19:g.19528371_19528372delinsTT	ENSP00000261386:p.Ile134Lys	0						p.I134I|p.I134N	NM_016641.3	NP_057725.1	1	2	3	2.033166	Q9NZC3	GDE1_HUMAN		2	582|581	-			O43334|Q6PKF7|Q7KYR4	Silent|Missense_Mutation	SNP	ENST00000353258.3	1	1	hg19	c.402T>A|c.401T>A	CCDS10578.1	1																									|5.56	|5.56	|0.83823																																												|0			|19435873														0.244533		TCGA-IB-7647-01A-11D-2154-08	0.411	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	1	0	1		2	2	2	0		0	0	99		99|100	96|97	1	1.920000	-19.999400|-20.000000	1	0.240000	NM_016641			70|71	70|71		578|576	575|573	1		1	1		0	0	99|100	0		1.000000	1	0	82	0	228|226	0	70	576
UQCRC2	7385	broad.mit.edu	37	16	21974207	21974207	+	Splice_Site	SNP	G	G	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr16:21974207G>T	ENST00000268379.4	+	6	1278		c.e6+1		UQCRC2_ENST00000561553.1_Splice_Site	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		CCGCAGACTCGTAAGTACATT	0.363																																					Colon(123;450 1645 12841 25393 45623)	ENST00000268379.4	1.000000	0.600000	1.000000	0.720000	0.850000	0.855447	0.850000	1.000000																										0				15						c.e6+1		ubiquinol-cytochrome c reductase core protein II							60.0	55.0	57.0					16																	21974207		2198	4300	6498	SO:0001630	splice_region_variant	7385	0	0					g.chr16:21974207G>T	J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.514+1G>T	chr16.hg19:g.21974207G>T		0					UQCRC2_ENST00000561553.1_Splice_Site		NM_003366.2	NP_003357.2	1	2	3	2.033166	P22695	QCR2_HUMAN		6	1278	+			B3KSN4|Q9BQ05	Splice_Site	SNP	ENST00000268379.4	1	1	hg19		CCDS10601.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208992	0.79240	.	.	ENSG00000140740	ENST00000268379	.	.	.	4.88	4.88	0.63580	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9872	0.86342	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	UQCRC2	21881708	21881708	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.328000	0.96403	2.411000	0.81874	0.563000	0.77884	.	0.244533		TCGA-IB-7647-01A-11D-2154-08	0.363	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254466.1	1	0	1		2	2	2	0		0	0	56		56	56	1	1.920000	-20.000000	1	0.240000	NM_003366	Intron		32	32		283	281	0		1	1		0	0	56	0		1.000000	3.076204e-02	0	3	0	0	0	32	283
ABCC11	85320	broad.mit.edu	37	16	48209224	48209224	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr16:48209224G>A	ENST00000394747.1	-	25	3992	c.3643C>T	c.(3643-3645)Cgg>Tgg	p.R1215W	ABCC11_ENST00000356608.2_Missense_Mutation_p.R1215W|ABCC11_ENST00000394748.1_Missense_Mutation_p.R1215W|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000353782.5_Missense_Mutation_p.R1215W	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1215	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AGCTTGGACCGCAAGTCCTCC	0.622																																						ENST00000394747.1	1.000000	0.080000	0.370000	0.150000	0.230000	0.280950	0.230000	0.210000																										0				83						c.(3643-3645)Cgg>Tgg		ATP-binding cassette, sub-family C (CFTR/MRP), member 11	Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)						87.0	68.0	75.0					16																	48209224		2201	4300	6501	SO:0001583	missense	85320	0	0					g.chr16:48209224G>A	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3643C>T	chr16.hg19:g.48209224G>A	ENSP00000378230:p.Arg1215Trp	0					ABCC11_ENST00000353782.5_Missense_Mutation_p.R1215W|ABCC11_ENST00000394748.1_Missense_Mutation_p.R1215W|ABCC11_ENST00000356608.2_Missense_Mutation_p.R1215W|ABCC11_ENST00000565329.1_5'UTR	p.R1215W	NM_033151.3	NP_149163.2	1	2	3	2.033166	Q96J66	ABCCB_HUMAN		25	3992	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	0	1	hg19	c.3643C>T	CCDS10732.1	0	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998707	0.74818	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57	4.99	2.72	0.32119	4.99	2.72	0.32119	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96904	0.8989	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.977;1.0	D	0.94753	0.7929	10	0.87932	D	0	-11.4901	4.5859	0.12282	0.1267:0.0:0.5176:0.3557	.	1215;1215	Q96J66-2;Q96J66	.;ABCCB_HUMAN	W	1215	ENSP00000311326:R1215W;ENSP00000349017:R1215W;ENSP00000378231:R1215W;ENSP00000378230:R1215W	ENSP00000311326:R1215W	R	-	1	2	2	ABCC11	46766725	46766725	1.000000	0.71417	0.310000	0.25168	0.990000	0.78478	2.368000	0.44222	0.342000	0.23796	0.591000	0.81541	CGG	0.244533		TCGA-IB-7647-01A-11D-2154-08	0.622	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	0	0	1		2	2	2	0		0	0	56		56	56	1	1.920000	-2.791385	1	0.240000	NM_032583			5	5		189	188	0		1	0		0	0	56	0		0.937509	0	0	0	0	1	0	5	189
NLRC5	84166	broad.mit.edu	37	16	57060803	57060803	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr16:57060803G>A	ENST00000262510.6	+	6	2173	c.1948G>A	c.(1948-1950)Gac>Aac	p.D650N	NLRC5_ENST00000308149.7_Missense_Mutation_p.D650N|NLRC5_ENST00000436936.1_Missense_Mutation_p.D650N|NLRC5_ENST00000539144.1_Missense_Mutation_p.D650N	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	650					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GACCTGCACCGACCTGGCCAC	0.602																																						ENST00000262510.6	1.000000	0.240000	0.500000	0.310000	0.390000	0.421919	0.390000	0.380000																										0				75						c.(1948-1950)Gac>Aac		NLR family, CARD domain containing 5							116.0	92.0	101.0					16																	57060803		2198	4300	6498	SO:0001583	missense	84166	0	0					g.chr16:57060803G>A	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1948G>A	chr16.hg19:g.57060803G>A	ENSP00000262510:p.Asp650Asn	0					NLRC5_ENST00000539144.1_Missense_Mutation_p.D650N|NLRC5_ENST00000308149.7_Missense_Mutation_p.D650N|NLRC5_ENST00000436936.1_Missense_Mutation_p.D650N	p.D650N	NM_032206.4	NP_115582.4	1	2	3	2.033166	Q86WI3	NLRC5_HUMAN		6	2173	+		all_neural(199;0.225)	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	1	1	hg19	c.1948G>A	CCDS10773.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.20|16.20	3.055616|3.055616	0.55325|0.55325	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.54675|.	0.56;0.56;0.56;0.56;0.56;0.56|.	5.52|5.52	4.57|4.57	0.56435|0.56435	5.52|5.52	4.57|4.57	0.56435|0.56435	.|.	0.000000|.	0.36591|.	N|.	0.002501|.	T|T	0.70011|0.70011	0.3175|0.3175	M|M	0.79475|0.79475	2.455|2.455	0.33435|0.33435	D|D	0.581619|0.581619	D;D;D;D|.	0.89917|.	1.0;1.0;0.993;0.992|.	D;D;P;D|.	0.97110|.	1.0;1.0;0.88;0.915|.	T|T	0.79398|0.79398	-0.1820|-0.1820	10|5	0.41790|.	T|.	0.15|.	.|.	13.374|13.374	0.60728|0.60728	0.0759:0.0:0.9241:0.0|0.0759:0.0:0.9241:0.0	.|.	650;650;650;650|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	N|Q	650;650;650;124;650;157;5|402	ENSP00000262510:D650N;ENSP00000308886:D650N;ENSP00000389739:D650N;ENSP00000441727:D650N;ENSP00000441597:D157N;ENSP00000440153:D5N|.	ENSP00000262510:D650N|.	D|R	+|+	1|2	0|0	0|0	NLRC5|NLRC5	55618304|55618304	55618304|55618304	1.000000|1.000000	0.71417|0.71417	0.861000|0.861000	0.33841|0.33841	0.050000|0.050000	0.14768|0.14768	6.066000|6.066000	0.71185|0.71185	1.338000|1.338000	0.45544|0.45544	0.561000|0.561000	0.74099|0.74099	GAC|CGA	0.244533		TCGA-IB-7647-01A-11D-2154-08	0.602	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	1	0	1		2	2	2	0		0	0	129		129	126	1	1.920000	-4.442301	1	0.240000	NM_032206			20	19		416	412	0		1	1		0	0	129	0		0.999995	8.538147e-01	0	6	0	68	0	20	416
RTN4RL1	146760	broad.mit.edu	37	17	1840990	1840990	+	Silent	SNP	C	C	T	rs200721283		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:1840990C>T	ENST00000331238.6	-	2	605	c.126G>A	c.(124-126)gcG>gcA	p.A42A		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						CAAAGTTGTGCGCCTGGCAGC	0.672													C|||	0	0.0	0.0	0.0	5008	,	,		16733	0.0		0.0	False		,,,				2504	0.0				GBM(68;949 1139 14865 32798 38342)	ENST00000331238.6	1.000000	0.670000	1.000000	0.820000	0.950000	0.924934	0.950000	1.000000																										0				11						c.(124-126)gcG>gcA		reticulon 4 receptor-like 1							38.0	47.0	44.0					17																	1840990		2149	4248	6397	SO:0001819	synonymous_variant	146760	15	121148	39				g.chr17:1840990C>T	AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.126G>A	chr17.hg19:g.1840990C>T		1						p.A42A	NM_178568.2	NP_848663.1	0	1	1	1.815224				2	605	-				Silent	SNP	ENST00000331238.6	1	1	hg19	c.126G>A	CCDS45569.1	1																																																																																								0.144529		TCGA-IB-7647-01A-11D-2154-08	0.672	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450155.2	1	0	1		2	2	2	0		0	0	32		32	31	1	1.920000	-20.000000	1	0.240000	NM_178568			18	18		88	88	1		1	0		0	0	32	0		0.999990	3.227999e-02	0	1	0	1	0	18	88
CDK12	51755	broad.mit.edu	37	17	37687333	37687333	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:37687333C>G	ENST00000447079.4	+	14	4270	c.4237C>G	c.(4237-4239)Cac>Gac	p.H1413D	CDK12_ENST00000430627.2_Missense_Mutation_p.H1404D	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1413					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CTTAGCGTTACACCCGGTGGT	0.582			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																												ENST00000447079.4	1.000000	0.090000	0.300000	0.130000	0.200000	0.258934	0.200000	0.190000				Rec	yes			Rec	yes		17	17q12	17q12	51755	Mis, N, F	cyclin-dependent kinase 12				E	E			serous ovarian		0				70						c.(4237-4239)Cac>Gac		cyclin-dependent kinase 12							70.0	74.0	73.0					17																	37687333		2203	4300	6503	SO:0001583	missense	51755	0	0					g.chr17:37687333C>G	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.4237C>G	chr17.hg19:g.37687333C>G	ENSP00000398880:p.His1413Asp	0	TCGA Ovarian(9;0.13)				CDK12_ENST00000430627.2_Missense_Mutation_p.H1404D	p.H1413D	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	1	2	3	2.046166	Q9NYV4	CDK12_HUMAN		14	4270	+			A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	0	1	hg19	c.4237C>G	CCDS11337.1	0	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136315	0.37728	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.69435	-0.37;-0.4	5.34	5.34	0.76211	5.34	5.34	0.76211	.	0.124406	0.36665	N	0.002461	T	0.50922	0.1644	N	0.08118	0	0.42641	D	0.99341	P;P	0.40476	0.596;0.718	B;B	0.38803	0.146;0.282	T	0.61143	-0.7122	10	0.62326	D	0.03	-4.3884	18.8418	0.92188	0.0:1.0:0.0:0.0	.	1413;1404	Q9NYV4;Q9NYV4-2	CDK12_HUMAN;.	D	1404;1413	ENSP00000407720:H1404D;ENSP00000398880:H1413D	ENSP00000407720:H1404D	H	+	1	0	0	CDK12	34940859	34940859	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.938000	0.48987	2.775000	0.95449	0.650000	0.86243	CAC	0.247227		TCGA-IB-7647-01A-11D-2154-08	0.582	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	0	0	1		2	2	2	0		0	0	78		78	77	1	1.920000	-8.065260	1	0.240000	NM_016507			8	8		351	348	0		1	1		0	0	78	0		0.989198	6.865565e-01	0	4	0	98	0	8	351
KIF18B	146909	broad.mit.edu	37	17	43011628	43011628	+	Silent	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:43011628G>A	ENST00000593135.1	-	6	955	c.858C>T	c.(856-858)aaC>aaT	p.N286N	KIF18B_ENST00000590129.1_Silent_p.N295N|KIF18B_ENST00000587309.1_Silent_p.N286N|KIF18B_ENST00000339151.4_Silent_p.N286N|KIF18B_ENST00000438933.2_Silent_p.N286N	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	295	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				CATTGAGGACGTTGATGAGCG	0.617																																						ENST00000593135.1	1.000000	0.120000	0.600000	0.220000	0.360000	0.421424	0.360000	0.310000																										0				21						c.(856-858)aaC>aaT		kinesin family member 18B							26.0	29.0	28.0					17																	43011628		2083	4245	6328	SO:0001819	synonymous_variant	146909	2	121048	29				g.chr17:43011628G>A		CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.858C>T	chr17.hg19:g.43011628G>A		0					KIF18B_ENST00000590129.1_Silent_p.N295N|KIF18B_ENST00000438933.2_Silent_p.N286N|KIF18B_ENST00000587309.1_Silent_p.N286N|KIF18B_ENST00000339151.4_Silent_p.N286N	p.N286N	NM_001265577.1	NP_001252506.1	1	2	3	2.046166	Q86Y91	KI18B_HUMAN		6	955	-		Prostate(33;0.155)	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Silent	SNP	ENST00000593135.1	1	1	hg19	c.858C>T	CCDS45709.2	0																																																																																								0.247227		TCGA-IB-7647-01A-11D-2154-08	0.617	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1	0	0	1		2	2	2	0		0	0	29		29	29	1	1.920000	-7.196137	1	0.240000	NM_001080443			4	4		101	101	0		1	0		0	0	29	0		0.891773	2.903272e-01	0	1	0	22	0	4	101
CACNA1G	8913	broad.mit.edu	37	17	48650006	48650006	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:48650006C>T	ENST00000359106.5	+	6	838	c.838C>T	c.(838-840)Cgg>Tgg	p.R280W	CACNA1G_ENST00000505165.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000442258.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000502264.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000416767.4_Missense_Mutation_p.R280W|CACNA1G_ENST00000358244.5_Missense_Mutation_p.R280W|CACNA1G_ENST00000514181.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000514079.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000507336.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000515411.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000512389.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000510366.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000354983.4_Missense_Mutation_p.R280W|CACNA1G_ENST00000507510.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000513964.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000514717.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000503485.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000515165.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000513689.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000510115.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000429973.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000515765.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000360761.4_Missense_Mutation_p.R280W|CACNA1G_ENST00000507609.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000507896.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000352832.5_Missense_Mutation_p.R280W	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	280					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GAACGGCATGCGGTCCTGCAG	0.647																																						ENST00000359106.5	1.000000	0.150000	1.000000	0.300000	0.550000	0.594085	0.550000	1.000000																										0				47						c.(838-840)Cgg>Tgg		calcium channel, voltage-dependent, T type, alpha 1G subunit	Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						20.0	23.0	22.0					17																	48650006		2082	4204	6286	SO:0001583	missense	8913	0	0					g.chr17:48650006C>T	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.838C>T	chr17.hg19:g.48650006C>T	ENSP00000352011:p.Arg280Trp	0					CACNA1G_ENST00000515411.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000354983.4_Missense_Mutation_p.R280W|CACNA1G_ENST00000507896.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000513689.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000352832.5_Missense_Mutation_p.R280W|CACNA1G_ENST00000515765.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000514717.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000429973.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000507336.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000505165.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000510115.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000514079.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000512389.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000514181.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000507609.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000360761.4_Missense_Mutation_p.R280W|CACNA1G_ENST00000515165.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000416767.4_Missense_Mutation_p.R280W|CACNA1G_ENST00000510366.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000502264.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000507510.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000358244.5_Missense_Mutation_p.R280W|CACNA1G_ENST00000503485.1_Missense_Mutation_p.R280W|CACNA1G_ENST00000442258.2_Missense_Mutation_p.R280W|CACNA1G_ENST00000513964.1_Missense_Mutation_p.R280W	p.R280W	NM_018896.4	NP_061496.2	1	2	3	2.076965	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)	6	838	+	Breast(11;6.7e-17)		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	0	1	hg19	c.838C>T	CCDS45730.1	0	.	.	.	.	.	.	.	.	.	.	c	21.5	4.154466	0.78114	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97066	-4.09;-4.09;-4.23;-4.04;-4.09;-4.08;-4.11;-4.18;-4.15;-4.16;-4.17;-4.04;-4.06;-4.12;-4.07;-4.03;-4.11;-4.07;-4.05;-4.11;-4.09;-4.06;-4.1;-4.05;-4.11;-4.11	5.36	4.38	0.52667	5.36	4.38	0.52667	Ion transport (1);	0.332930	0.22063	N	0.065148	D	0.98021	0.9348	M	0.65498	2.005	0.54753	D	0.99998	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.993;0.997;0.997;0.999;0.986;0.999;1.0;0.999;0.981;1.0;0.975;0.993;0.998;0.999;0.993;0.991;0.984;1.0;0.987;0.993;0.993;0.999;0.99;0.981;0.985	D	0.98545	1.0634	10	0.66056	D	0.02	.	15.6493	0.77078	0.138:0.862:0.0:0.0	.	280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280;280	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	W	280	ENSP00000353990:R280W;ENSP00000339302:R280W;ENSP00000392390:R280W;ENSP00000347078:R280W;ENSP00000409759:R280W;ENSP00000425522:R280W;ENSP00000426261:R280W;ENSP00000425451:R280W;ENSP00000422407:R280W;ENSP00000426814:R280W;ENSP00000427238:R280W;ENSP00000423112:R280W;ENSP00000420918:R280W;ENSP00000426172:R280W;ENSP00000423045:R280W;ENSP00000427173:R280W;ENSP00000426098:R280W;ENSP00000425698:R280W;ENSP00000426232:R280W;ENSP00000423317:R280W;ENSP00000350979:R280W;ENSP00000352011:R280W;ENSP00000414388:R280W;ENSP00000423155:R280W;ENSP00000422268:R280W;ENSP00000421518:R280W	ENSP00000339302:R280W	R	+	1	2	2	CACNA1G	46005005	46005005	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.314000	0.43743	1.259000	0.44117	0.505000	0.49811	CGG	0.252557		TCGA-IB-7647-01A-11D-2154-08	0.647	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	0	0	0		2	2	2	0		0	0	23		23	21	1	1.920000	-6.777303	1	0.240000	NM_018896			3	3		53	51	0		1			0	0	23	0		0.801111	0	0	0	0	0	0	3	53
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.710000	0.980000	0.820000	0.910000	0.904389	0.910000	0.990000	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	24185	GRCh37	CM010465|CM900211	TP53	M	rs121912651	c.(742-744)Cgg>Tgg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	7157	1	121412	37	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577539G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	chr17.hg19:g.7577539G>A	ENSP00000269305:p.Arg248Trp	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W	p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.820921	P04637	P53_HUMAN		7	931	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.742C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	2	TP53	7518264	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	0.136364		TCGA-IB-7647-01A-11D-2154-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	71		71	71	1	1.920000	-2.605585	1	0.240000	NM_000546			37	36		216	214	1		1	1	1	0	0	71	942		1.000000	1	1	95	107	99	905	37	216
LUC7L3	51747	broad.mit.edu	37	17	48821167	48821167	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:48821167C>T	ENST00000505658.1	+	6	716	c.527C>T	c.(526-528)aCg>aTg	p.T176M	LUC7L3_ENST00000544170.1_Missense_Mutation_p.T100M|LUC7L3_ENST00000393227.2_Missense_Mutation_p.T176M|LUC7L3_ENST00000240304.1_Missense_Mutation_p.T176M			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	176					mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						AGGTCCACAACGTCGGTGAGT	0.368																																						ENST00000505658.1	1.000000	0.790000	1.000000	0.930000	0.990000	0.975263	0.990000	1.000000																										0				12						c.(526-528)aCg>aTg		LUC7-like 3 (S. cerevisiae)							86.0	87.0	87.0					17																	48821167		2203	4300	6503	SO:0001583	missense	51747	0	0					g.chr17:48821167C>T		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.527C>T	chr17.hg19:g.48821167C>T	ENSP00000425092:p.Thr176Met	0					LUC7L3_ENST00000393227.2_Missense_Mutation_p.T176M|LUC7L3_ENST00000240304.1_Missense_Mutation_p.T176M|LUC7L3_ENST00000544170.1_Missense_Mutation_p.T100M	p.T176M			1	2	3	2.088520	O95232	LC7L3_HUMAN		6	716	+			B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	ENST00000505658.1	1	1	hg19	c.527C>T	CCDS11573.1	1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970220	0.34754	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000542316;ENST00000544170	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.097706	0.64402	D	0.000001	T	0.37489	0.1005	N	0.16478	0.41	0.53005	D	0.99996	P;D;D	0.67145	0.629;0.988;0.996	B;P;P	0.58928	0.091;0.761;0.848	T	0.13282	-1.0515	10	0.38643	T	0.18	-7.8056	19.7073	0.96079	0.0:1.0:0.0:0.0	.	100;176;176	B4DJ96;O95232;A8K3C5	.;LC7L3_HUMAN;.	M	176;176;176;176;100	ENSP00000425092:T176M;ENSP00000376919:T176M;ENSP00000240304:T176M;ENSP00000444253:T100M	ENSP00000240304:T176M	T	+	2	0	0	LUC7L3	46176166	46176166	1.000000	0.71417	0.963000	0.40424	0.042000	0.13812	5.910000	0.69931	2.722000	0.93159	0.557000	0.71058	ACG	0.254317		TCGA-IB-7647-01A-11D-2154-08	0.368	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368205.2	1	0	1		2	2	2	0		0	0	64		64	63	1	1.920000	-16.138760	1	0.240000	NM_016424			36	36		246	245	1		1	1		0	0	64	0		1.000000	1	0	85	0	188	0	36	246
RAB40B	10966	broad.mit.edu	37	17	80615798	80615798	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr17:80615798C>T	ENST00000571995.1	-	6	909	c.778G>A	c.(778-780)Gtc>Atc	p.V260I	RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_Missense_Mutation_p.V81I|RAB40B_ENST00000538809.2_3'UTR	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	260					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GGGGGGCGGACGAGCTTCACT	0.572																																						ENST00000571995.1	0.230000	0.080000	0.190000	0.110000	0.140000	0.157809	0.140000	0.150000																										0				10						c.(778-780)Gtc>Atc		RAB40B, member RAS oncogene family							81.0	94.0	90.0					17																	80615798		2203	4300	6503	SO:0001583	missense	10966	0	0					g.chr17:80615798C>T	U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.778G>A	chr17.hg19:g.80615798C>T	ENSP00000461785:p.Val260Ile	0					RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_Missense_Mutation_p.V81I|RAB40B_ENST00000538809.2_3'UTR	p.V260I	NM_006822.2	NP_006813.1	0	1	1	1.963353	Q12829	RB40B_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)	6	909	-	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	Q8WVG3	Missense_Mutation	SNP	ENST00000571995.1	0	1	hg19	c.778G>A	CCDS11816.1	0	.	.	.	.	.	.	.	.	.	.	C	2.276	-0.365935	0.05069	.	.	ENSG00000141542	ENST00000269347;ENST00000538809	.	.	.	4.79	-9.58	0.00559	4.79	-9.58	0.00559	.	2.176640	0.02755	N	0.117936	T	0.05868	0.0153	N	0.00308	-1.67	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13683	-1.0500	9	0.02654	T	1	.	7.8491	0.29444	0.0702:0.0823:0.1585:0.6889	.	260	Q12829	RB40B_HUMAN	I	260;294	.	ENSP00000269347:V260I	V	-	1	0	0	RAB40B	78209087	78209087	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.991000	0.03728	-3.220000	0.00212	-0.244000	0.11960	GTC	0.214551		TCGA-IB-7647-01A-11D-2154-08	0.572	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1	0	0	0		17	5	2	1		1	1	184		184	153	1	1.920000	-2.386141	0	0.240000				16	14		847	712	0		0	1		1	0	184	0		0.309789	1.813240e-01	0	12	0	135	0	16	847
TECR	9524	broad.mit.edu	37	19	14674472	14674472	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:14674472C>T	ENST00000215567.5	+	4	258	c.121C>T	c.(121-123)Ccg>Tcg	p.P41S	TECR_ENST00000436007.2_Missense_Mutation_p.P56S|TECR_ENST00000596164.1_3'UTR|TECR_ENST00000600083.1_5'UTR|TECR_ENST00000596073.1_5'UTR	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	41					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						CCCCGCAGATCCGCAGTGGTA	0.697																																						ENST00000215567.5	0.720000	0.240000	0.590000	0.330000	0.450000	0.468466	0.450000	0.440000																										0				3						c.(121-123)Ccg>Tcg		trans-2,3-enoyl-CoA reductase							25.0	28.0	27.0					19																	14674472		2203	4298	6501	SO:0001583	missense	9524	3	121354	34				g.chr19:14674472C>T	AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.121C>T	chr19.hg19:g.14674472C>T	ENSP00000215567:p.Pro41Ser	0					TECR_ENST00000600083.1_5'UTR|TECR_ENST00000596164.1_3'UTR|TECR_ENST00000436007.2_Missense_Mutation_p.P56S|TECR_ENST00000596073.1_5'UTR	p.P41S	NM_138501.5	NP_612510.1	0	1	1	1.952177	Q9NZ01	TECR_HUMAN		4	258	+			B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Missense_Mutation	SNP	ENST00000215567.5	1	1	hg19	c.121C>T	CCDS12313.1	0	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409144	0.62399	.	.	ENSG00000099797	ENST00000215567;ENST00000436007	T;T	0.46451	0.87;0.87	5.25	5.25	0.73442	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.58206	0.2106	L	0.48218	1.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.56335	-0.7996	10	0.45353	T	0.12	-10.426	16.3276	0.82990	0.0:1.0:0.0:0.0	.	41;56;41	B3KM97;B3KSQ1;Q9NZ01	.;.;TECR_HUMAN	S	41;56	ENSP00000215567:P41S;ENSP00000397206:P56S	ENSP00000215567:P41S	P	+	1	0	0	TECR	14535472	14535472	1.000000	0.71417	0.989000	0.46669	0.027000	0.11550	4.298000	0.59067	2.462000	0.83206	0.561000	0.74099	CCG	0.204688		TCGA-IB-7647-01A-11D-2154-08	0.697	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466000.1	1	0	0		2	2	2	0		0	0	48		48	47	1	1.920000	-15.968060	1	0.240000	NM_138501			12	12		203	197	0		1	1		0	0	48	0		0.999045	9.999992e-01	0	90	0	442	0	12	203
NOTCH3	4854	broad.mit.edu	37	19	15271507	15271507	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:15271507G>A	ENST00000263388.2	-	33	7007	c.6932C>T	c.(6931-6933)cCg>cTg	p.P2311L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2311					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGTAACTTCCGGCTGGGGCCC	0.627																																						ENST00000263388.2	1.000000	0.680000	1.000000	0.790000	0.900000	0.898655	0.900000	1.000000																										0				93						c.(6931-6933)cCg>cTg		notch 3							50.0	59.0	56.0					19																	15271507		2202	4300	6502	SO:0001583	missense	4854	1	121400	26				g.chr19:15271507G>A	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6932C>T	chr19.hg19:g.15271507G>A	ENSP00000263388:p.Pro2311Leu	0						p.P2311L	NM_000435.2	NP_000426.2	0	1	1	1.952177	Q9UM47	NOTC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)	33	7007	-			Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	1	1	hg19	c.6932C>T	CCDS12326.1	1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390466	0.25118	.	.	ENSG00000074181	ENST00000263388	T	0.81247	-1.47	3.99	3.99	0.46301	3.99	3.99	0.46301	.	.	.	.	.	T	0.59390	0.2190	N	0.08118	0	0.21105	N	0.999789	P	0.34587	0.458	B	0.19391	0.025	T	0.55685	-0.8102	9	0.87932	D	0	.	9.199	0.37246	0.1056:0.0:0.8944:0.0	.	2311	Q9UM47	NOTC3_HUMAN	L	2311	ENSP00000263388:P2311L	ENSP00000263388:P2311L	P	-	2	0	0	NOTCH3	15132507	15132507	0.858000	0.29795	0.387000	0.26183	0.565000	0.35776	2.105000	0.41825	1.948000	0.56530	0.591000	0.81541	CCG	0.204688		TCGA-IB-7647-01A-11D-2154-08	0.627	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	1	0	1		2	2	2	0		0	0	89		89	88	1	1.920000	-3.075756	1	0.240000	NM_000435			48	47		371	366	1		1	1		0	0	89	0		1.000000	1	0	56	0	481	0	48	371
RYR1	6261	broad.mit.edu	37	19	38976522	38976522	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:38976522G>A	ENST00000359596.3	+	34	5227	c.5227G>A	c.(5227-5229)Gcc>Acc	p.A1743T	RYR1_ENST00000355481.4_Missense_Mutation_p.A1743T|RYR1_ENST00000360985.3_Missense_Mutation_p.A1743T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1743	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGAGACCCGCGCCATCACGCT	0.622																																						ENST00000359596.3	1.000000	0.770000	1.000000	0.890000	0.990000	0.961260	0.990000	1.000000																										0				285						c.(5227-5229)Gcc>Acc		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						64.0	62.0	63.0					19																	38976522		2203	4300	6503	SO:0001583	missense	6261	0	0					g.chr19:38976522G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5227G>A	chr19.hg19:g.38976522G>A	ENSP00000352608:p.Ala1743Thr	0					RYR1_ENST00000360985.3_Missense_Mutation_p.A1743T|RYR1_ENST00000355481.4_Missense_Mutation_p.A1743T	p.A1743T			1	2	3	2.062989	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	34	5227	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	1	1	hg19	c.5227G>A	CCDS33011.1	1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297479	0.40694	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.72615	-0.67;-0.67;-0.67	3.77	1.49	0.22878	3.77	1.49	0.22878	.	0.137822	0.45126	U	0.000388	T	0.41581	0.1165	N	0.14661	0.345	0.29121	N	0.880273	B;B	0.33940	0.433;0.274	B;B	0.26614	0.071;0.056	T	0.23368	-1.0190	10	0.19590	T	0.45	.	4.2144	0.10528	0.5402:0.0:0.4598:0.0	.	1743;1743	P21817-2;P21817	.;RYR1_HUMAN	T	1743	ENSP00000352608:A1743T;ENSP00000347667:A1743T;ENSP00000354254:A1743T	ENSP00000347667:A1743T	A	+	1	0	0	RYR1	43668362	43668362	0.108000	0.22018	1.000000	0.80357	0.613000	0.37349	0.876000	0.28092	0.796000	0.33947	-0.225000	0.12378	GCC	0.249901		TCGA-IB-7647-01A-11D-2154-08	0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	1	0	1		2	2	2	0		0	0	120		120	117	1	1.920000	-19.044860	1	0.240000				50	50		366	360	1		1			0	0	120	0		1.000000	0	0	0	0	0	0	50	366
BCKDHA	593	broad.mit.edu	37	19	41928085	41928085	+	Silent	SNP	C	C	T	rs151227241	byFrequency	TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:41928085C>T	ENST00000269980.2	+	6	1031	c.663C>T	c.(661-663)taC>taT	p.Y221Y	BCKDHA_ENST00000595085.1_Silent_p.Y255Y|CTC-435M10.3_ENST00000540732.1_Silent_p.Y255Y|BCKDHA_ENST00000535632.1_3'UTR|BCKDHA_ENST00000457836.2_Silent_p.Y199Y	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide	221					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						GGGCGGCGTACGCAGCCAAGC	0.637																																						ENST00000269980.2	1.000000	0.170000	1.000000	0.270000	0.430000	0.541928	0.430000	0.360000																										0				10						c.(661-663)taC>taT		branched chain keto acid dehydrogenase E1, alpha polypeptide		C	,	0,4406		0,0,2203	36.0	33.0	34.0		663,663	-8.9	0.3	19	dbSNP_134	34	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	BCKDHA	NM_000709.3,NM_001164783.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	221/446,221/445	41928085	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	593	9	121412	40				g.chr19:41928085C>T	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128	ENST00000269980.2:c.663C>T	chr19.hg19:g.41928085C>T		1					BCKDHA_ENST00000457836.2_Silent_p.Y199Y|CTC-435M10.3_ENST00000540732.1_Silent_p.Y255Y|BCKDHA_ENST00000595085.1_Silent_p.Y255Y|BCKDHA_ENST00000535632.1_3'UTR	p.Y221Y	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	2	3	5	2.327642	P12694	ODBA_HUMAN		6	1031	+			B4DP47|E7EW46|Q16034|Q16472	Silent	SNP	ENST00000269980.2	1	1	hg19	c.663C>T	CCDS12581.1	0	.	.	.	.	.	.	.	.	.	.	C	1.529	-0.544937	0.04024	0.0	1.16E-4	ENSG00000248098	ENST00000541315	.	.	.	4.85	-8.87	0.00792	4.85	-8.87	0.00792	.	.	.	.	.	T	0.64461	0.2600	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72304	-0.4333	4	.	.	.	-19.325	17.7578	0.88455	0.0:0.1167:0.0:0.8833	.	.	.	.	M	188	.	.	T	+	2	0	0	BCKDHA	46619925	46619925	0.000000	0.05858	0.295000	0.24960	0.242000	0.25591	-2.269000	0.01168	-1.955000	0.01023	-1.202000	0.01658	ACG	0.343923		TCGA-IB-7647-01A-11D-2154-08	0.637	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	0	0	1		2	2	2	0		0	0	38		38	37	1	1.920000	-9.434995	1	0.240000	NM_000709			7	7		183	180	0		1	1		0	0	38	0		0.980097	9.727769e-01	0	11	0	160	0	7	183
KLC3	147700	broad.mit.edu	37	19	45853603	45853603	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:45853603C>G	ENST00000391946.2	+	9	1250	c.1148C>G	c.(1147-1149)tCa>tGa	p.S383*	KLC3_ENST00000585434.1_Nonsense_Mutation_p.S382*|ERCC2_ENST00000391945.4_3'UTR|KLC3_ENST00000470402.1_Nonsense_Mutation_p.S397*	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	383					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCGCAGGCCTCAGCCTACCTG	0.532																																						ENST00000391946.2	0.970000	0.430000	0.830000	0.540000	0.670000	0.689497	0.670000	0.660000																										0				8						c.(1147-1149)tCa>tGa		kinesin light chain 3							48.0	52.0	50.0					19																	45853603		1886	4121	6007	SO:0001587	stop_gained	147700	0	0					g.chr19:45853603C>G	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.1148C>G	chr19.hg19:g.45853603C>G	ENSP00000375810:p.Ser383*	1					ERCC2_ENST00000391945.4_3'UTR|KLC3_ENST00000585434.1_Nonsense_Mutation_p.S382*|KLC3_ENST00000470402.1_Nonsense_Mutation_p.S397*	p.S383*	NM_177417.2	NP_803136.2	1	2	3	2.335259	Q6P597	KLC3_HUMAN		9	1250	+		Ovarian(192;0.0728)|all_neural(266;0.112)	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Nonsense_Mutation	SNP	ENST00000391946.2	0	1	hg19	c.1148C>G	CCDS12660.2	0	.	.	.	.	.	.	.	.	.	.	C	33	5.269984	0.95429	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	.	.	.	3.74	3.74	0.42951	3.74	3.74	0.42951	.	0.094375	0.44285	D	0.000478	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	1.0098	13.0785	0.59100	0.0:1.0:0.0:0.0	.	.	.	.	X	383;397	.	ENSP00000375810:S383X	S	+	2	0	0	KLC3	50545443	50545443	1.000000	0.71417	0.980000	0.43619	0.644000	0.38419	7.541000	0.82084	1.913000	0.55393	0.462000	0.41574	TCA	0.321429		TCGA-IB-7647-01A-11D-2154-08	0.532	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	1	0	0		2	2	2	0		0	0	65		65	65	1	1.920000	-20.000000	1	0.240000	NM_145275			21	21		272	270	1		1	1		0	0	65	0		0.999998	5.967317e-01	0	5	0	22	0	21	272
KLC3	147700	broad.mit.edu	37	19	45853629	45853629	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:45853629C>T	ENST00000391946.2	+	9	1276	c.1174C>T	c.(1174-1176)Caa>Taa	p.Q392*	KLC3_ENST00000585434.1_Nonsense_Mutation_p.Q391*|ERCC2_ENST00000391945.4_3'UTR|KLC3_ENST00000470402.1_Nonsense_Mutation_p.Q406*	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	392					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GAACAAGTATCAACAAGCGGA	0.567																																						ENST00000391946.2	1.000000	0.630000	1.000000	0.750000	0.890000	0.883752	0.890000	1.000000																										0				8						c.(1174-1176)Caa>Taa		kinesin light chain 3							57.0	61.0	59.0					19																	45853629		1909	4123	6032	SO:0001587	stop_gained	147700	0	0					g.chr19:45853629C>T	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.1174C>T	chr19.hg19:g.45853629C>T	ENSP00000375810:p.Gln392*	1					ERCC2_ENST00000391945.4_3'UTR|KLC3_ENST00000585434.1_Nonsense_Mutation_p.Q391*|KLC3_ENST00000470402.1_Nonsense_Mutation_p.Q406*	p.Q392*	NM_177417.2	NP_803136.2	1	2	3	2.335259	Q6P597	KLC3_HUMAN		9	1276	+		Ovarian(192;0.0728)|all_neural(266;0.112)	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Nonsense_Mutation	SNP	ENST00000391946.2	0	1	hg19	c.1174C>T	CCDS12660.2	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816862	0.90790	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	.	.	.	3.93	-1.34	0.09143	3.93	-1.34	0.09143	.	0.172476	0.38436	N	0.001693	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	12.5559	7.0831	0.25241	0.2875:0.2665:0.446:0.0	.	.	.	.	X	392;406	.	ENSP00000375810:Q392X	Q	+	1	0	0	KLC3	50545469	50545469	0.571000	0.26659	0.999000	0.59377	0.813000	0.45954	0.192000	0.17096	0.256000	0.21614	0.462000	0.41574	CAA	0.321429		TCGA-IB-7647-01A-11D-2154-08	0.567	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	1	0	0		2	2	2	0		0	0	79		79	79	1	1.920000	-20.000000	1	0.240000	NM_145275			32	32		302	301	0		1	1		0	0	79	0		1.000000	5.890675e-01	0	4	0	16	0	32	302
ERCC2	2068	broad.mit.edu	37	19	45854888	45854888	+	Nonstop_Mutation	SNP	C	C	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:45854888C>G	ENST00000391945.4	-	23	2359	c.2282G>C	c.(2281-2283)tGa>tCa	p.*761S	ERCC2_ENST00000391944.3_Nonstop_Mutation_p.*683S	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	0					7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCGCCCCACTCAGAGCTGCTG	0.592			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													ENST00000391945.4	0.920000	0.620000	0.850000	0.690000	0.760000	0.775677	0.760000	0.780000			yes	Rec		Xeroderma pigmentosum (D)	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	19q13.2-q13.3	2068	Mis, N, F, S	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""				E	E		skin basal cell, skin squamous cell, melanoma			0				9						c.(2281-2283)tGa>tCa	Nucleotide excision repair (NER)	excision repair cross-complementation group 2							133.0	142.0	139.0					19																	45854888		2203	4300	6503	SO:0001578	stop_lost	2068	0	0		Xeroderma Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	g.chr19:45854888C>G		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.2282G>C	chr19.hg19:g.45854888C>G		1					ERCC2_ENST00000391944.3_Nonstop_Mutation_p.*683S	p.*761S	NM_000400.3	NP_000391.1	1	2	3	2.335259	P18074	ERCC2_HUMAN		23	2359	-		Ovarian(192;0.0728)|all_neural(266;0.112)	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Nonstop_Mutation	SNP	ENST00000391945.4	0	1	hg19	c.2282G>C	CCDS33049.1	0	.	.	.	.	.	.	.	.	.	.	C	9.890	1.203909	0.22121	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	.	.	.	4.29	3.26	0.37387	4.29	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3154	0.21188	0.0:0.8316:0.0:0.1684	.	.	.	.	S	711;737;761;683	.	.	X	-	2	2	2	ERCC2	50546728	50546728	1.000000	0.71417	0.948000	0.38648	0.024000	0.10985	3.262000	0.51538	0.932000	0.37266	0.561000	0.74099	TGA	0.321429		TCGA-IB-7647-01A-11D-2154-08	0.592	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	0	0	0		2	2	2	0		0	0	291		291	286	1	1.920000	-19.928260	1	0.240000	NM_000400			98	97		1089	1070	0		1	1		0	0	291	0		1.000000	8.424976e-01	0	7	0	32	0	98	1089
ERCC2	2068	broad.mit.edu	37	19	45854979	45854979	+	Splice_Site	SNP	C	C	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:45854979C>G	ENST00000391945.4	-	23	2268	c.2191G>C	c.(2191-2193)Gag>Cag	p.E731Q	ERCC2_ENST00000391944.3_Splice_Site_p.E653Q	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	731					7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCTGATCCTCCTGCAGAGAA	0.627			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													ENST00000391945.4	1.000000	0.640000	0.980000	0.740000	0.850000	0.859816	0.850000	1.000000			yes	Rec		Xeroderma pigmentosum (D)	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	19q13.2-q13.3	2068	Mis, N, F, S	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""				E	E		skin basal cell, skin squamous cell, melanoma			0				9						c.(2191-2193)Gag>Cag	Nucleotide excision repair (NER)	excision repair cross-complementation group 2							62.0	63.0	62.0					19																	45854979		2203	4300	6503	SO:0001630	splice_region_variant	2068	0	0		Xeroderma Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	g.chr19:45854979C>G		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.2191-1G>C	chr19.hg19:g.45854979C>G		1					ERCC2_ENST00000391944.3_Splice_Site_p.E653Q	p.E731Q	NM_000400.3	NP_000391.1	1	2	3	2.335259	P18074	ERCC2_HUMAN		23	2268	-		Ovarian(192;0.0728)|all_neural(266;0.112)	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Splice_Site	SNP	ENST00000391945.4	1	0	hg19	c.2191G>C	CCDS33049.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056286	0.76074	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	T;D	0.82893	-1.44;-1.66	4.13	4.13	0.48395	4.13	4.13	0.48395	.	0.058002	0.64402	D	0.000002	D	0.90205	0.6938	M	0.79805	2.47	0.80722	D	1	B;B;D	0.63880	0.066;0.114;0.993	B;B;D	0.72982	0.109;0.04;0.979	D	0.90111	0.4192	10	0.41790	T	0.15	-29.0483	13.9463	0.64086	0.0:1.0:0.0:0.0	.	653;731;424	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	Q	681;707;731;653	ENSP00000375809:E731Q;ENSP00000375808:E653Q	ENSP00000375805:E681Q	E	-	1	0	0	ERCC2	50546819	50546819	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.925000	0.75829	2.153000	0.67306	0.561000	0.74099	GAG	0.321429		TCGA-IB-7647-01A-11D-2154-08	0.627	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	1	0	0		2	2	2	0		0	0	131		131	131	1	1.920000	-3.017764	1	0.240000	NM_000400	Missense_Mutation		51	50		504	501	0		1	1		0	0	131	0		1.000000	9.181251e-01	0	3	0	41	0	51	504
MUC16	94025	broad.mit.edu	37	19	9074001	9074001	+	Missense_Mutation	SNP	G	G	A	rs377647571		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:9074001G>A	ENST00000397910.4	-	3	13648	c.13445C>T	c.(13444-13446)gCg>gTg	p.A4482V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4484	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACTGAAGTCGCAGAAACAGG	0.463																																						ENST00000397910.4	0.730000	0.380000	0.640000	0.450000	0.540000	0.551997	0.540000	0.540000																										0				590						c.(13444-13446)gCg>gTg		mucin 16, cell surface associated		G	VAL/ALA	2,4038		0,2,2018	137.0	129.0	132.0		13445	-4.4	0.0	19		132	1,8347		0,1,4173	no	missense	MUC16	NM_024690.2	64	0,3,6191	AA,AG,GG		0.012,0.0495,0.0242	benign	4482/14508	9074001	3,12385	2020	4174	6194	SO:0001583	missense	94025	3	120972	41				g.chr19:9074001G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13445C>T	chr19.hg19:g.9074001G>A	ENSP00000381008:p.Ala4482Val	0						p.A4482V	NM_024690.2	NP_078966.2	0	1	1	1.952177	Q8WXI7	MUC16_HUMAN		3	13648	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.13445C>T	CCDS54212.1	0	.	.	.	.	.	.	.	.	.	.	a	1.841	-0.467526	0.04476	4.95E-4	1.2E-4	ENSG00000181143	ENST00000397910	T	0.15603	2.41	2.22	-4.44	0.03557	2.22	-4.44	0.03557	.	.	.	.	.	T	0.03564	0.0102	N	0.00368	-1.59	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.44667	-0.9313	8	0.87932	D	0	.	5.0828	0.14666	0.4495:0.0:0.4123:0.1382	.	4482	B5ME49	.	V	4482	ENSP00000381008:A4482V	ENSP00000381008:A4482V	A	-	2	0	0	MUC16	8935001	8935001	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.514000	0.00956	-2.395000	0.00582	-2.024000	0.00429	GCG	0.204688		TCGA-IB-7647-01A-11D-2154-08	0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1		2	2	2	0		0	0	110		110	109	1	1.920000	-7.773385	1	0.240000	NM_024690			34	34		465	458	0		1	0	0	0	0	110	0		1.000000	5.009901e-03	0	0	0	2	1	34	465
ZNF671	79891	broad.mit.edu	37	19	58232832	58232832	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr19:58232832C>T	ENST00000317398.6	-	4	717	c.622G>A	c.(622-624)Gac>Aac	p.D208N	ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Missense_Mutation_p.D110N|AC003006.7_ENST00000599221.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGGTGCTGGTCAAAGTCTGTA	0.502																																						ENST00000317398.6	1.000000	0.340000	1.000000	0.420000	0.520000	0.595968	0.520000	0.490000																										0				22						c.(622-624)Gac>Aac		zinc finger protein 671							139.0	132.0	135.0					19																	58232832		2203	4300	6503	SO:0001583	missense	79891	0	0					g.chr19:58232832C>T		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.622G>A	chr19.hg19:g.58232832C>T	ENSP00000321848:p.Asp208Asn	1					ZNF671_ENST00000594803.1_5'Flank|ZNF671_ENST00000335820.3_Missense_Mutation_p.D110N|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron	p.D208N	NM_024833.2	NP_079109.2	0	3	3	2.098921	Q8TAW3	ZN671_HUMAN		4	717	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	A6NF07|Q9H5E9	Missense_Mutation	SNP	ENST00000317398.6	1	1	hg19	c.622G>A	CCDS12961.1	0	.	.	.	.	.	.	.	.	.	.	C	13.37	2.218275	0.39201	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.27402	1.67;1.67	2.45	-2.07	0.07276	2.45	-2.07	0.07276	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10895	0.0266	N	0.04297	-0.235	0.09310	N	1	B	0.17038	0.02	B	0.19391	0.025	T	0.37314	-0.9711	9	0.13108	T	0.6	.	4.9308	0.13916	0.0:0.5176:0.2982:0.1842	.	208	Q8TAW3	ZN671_HUMAN	N	208;110	ENSP00000321848:D208N;ENSP00000338670:D110N	ENSP00000321848:D208N	D	-	1	0	0	ZNF671	62924644	62924644	0.000000	0.05858	0.006000	0.13384	0.365000	0.29674	-2.416000	0.01035	-0.084000	0.12595	0.467000	0.42956	GAC	0.301984		TCGA-IB-7647-01A-11D-2154-08	0.502	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466817.1	1	0	1		2	2	2	0		0	0	131		131	130	1	1.920000	-6.069153	1	0.240000	NM_024833			31	31		540	536	0		1	0		0	0	131	0		1.000000	4.824536e-01	0	0	0	29	0	31	540
EPHA2	1969	broad.mit.edu	37	1	16455955	16455955	+	Silent	SNP	G	G	A	rs374544665		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:16455955G>A	ENST00000358432.5	-	16	2953	c.2799C>T	c.(2797-2799)atC>atT	p.I933I		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	933	Negatively regulates interaction with ARHGEF16.|SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	CCACCTTCTCGATGGCAGTGT	0.652																																						ENST00000358432.5	1.000000	0.160000	0.390000	0.220000	0.290000	0.321218	0.290000	0.280000																										0				42						c.(2797-2799)atC>atT		EPH receptor A2	Dasatinib(DB01254)|Regorafenib(DB08896)						91.0	80.0	84.0					1																	16455955		2203	4300	6503	SO:0001819	synonymous_variant	1969	9	121412	44				g.chr1:16455955G>A	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2799C>T	chr1.hg19:g.16455955G>A		0						p.I933I	NM_004431.3	NP_004422.2	1	2	3	2.028492	P29317	EPHA2_HUMAN		16	2953	-		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	B5A968|Q8N3Z2	Silent	SNP	ENST00000358432.5	1	1	hg19	c.2799C>T	CCDS169.1	0																																																																																								0.243631		TCGA-IB-7647-01A-11D-2154-08	0.652	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	0	0	1		2	2	2	0		0	0	107		107	106	1	1.920000	-13.482850	1	0.240000	NM_004431			14	13		398	390	0		1	1		0	0	107	0		0.999725	9.973017e-01	0	17	0	262	0	14	398
CACNA1E	777	broad.mit.edu	37	1	181732595	181732595	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:181732595C>T	ENST00000367573.2	+	34	4743	c.4743C>T	c.(4741-4743)gcC>gcT	p.A1581A	CACNA1E_ENST00000367567.4_Silent_p.A1188A|CACNA1E_ENST00000367570.1_Silent_p.A1581A|CACNA1E_ENST00000357570.5_Silent_p.A1532A|CACNA1E_ENST00000526775.1_Silent_p.A1562A|CACNA1E_ENST00000358338.5_Silent_p.A1513A|CACNA1E_ENST00000360108.3_Silent_p.A1562A	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1581					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCCGAGCTGCCCGCCTCATAA	0.463																																						ENST00000367573.2	0.420000	0.110000	0.330000	0.160000	0.230000	0.253315	0.230000	0.230000																										0				204						c.(4741-4743)gcC>gcT		calcium channel, voltage-dependent, R type, alpha 1E subunit							84.0	82.0	83.0					1																	181732595		1861	4100	5961	SO:0001819	synonymous_variant	777	0	0					g.chr1:181732595C>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4743C>T	chr1.hg19:g.181732595C>T		0					CACNA1E_ENST00000367567.4_Silent_p.A1188A|CACNA1E_ENST00000526775.1_Silent_p.A1562A|CACNA1E_ENST00000360108.3_Silent_p.A1562A|CACNA1E_ENST00000358338.5_Silent_p.A1513A|CACNA1E_ENST00000357570.5_Silent_p.A1532A|CACNA1E_ENST00000367570.1_Silent_p.A1581A	p.A1581A	NM_001205293.1	NP_001192222.1	0	1	1	2.016410	Q15878	CAC1E_HUMAN		34	4743	+			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	1	1	hg19	c.4743C>T	CCDS55664.1	0																																																																																								0.235412		TCGA-IB-7647-01A-11D-2154-08	0.463	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	0	0	1		2	2	2	0		0	0	38		38	37	1	1.920000	-3.614931	1	0.240000	NM_000721			8	8		281	278	0		1	0		0	0	38	0		0.989183	1.962366e-02	0	0	0	7	0	8	281
TMCC2	9911	broad.mit.edu	37	1	205241064	205241064	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:205241064A>G	ENST00000358024.3	+	5	2331	c.1942A>G	c.(1942-1944)Aac>Gac	p.N648D	TMCC2_ENST00000330675.7_Missense_Mutation_p.N423D|TMCC2_ENST00000495538.1_3'UTR|TMCC2_ENST00000329800.7_Missense_Mutation_p.N408D|TMCC2_ENST00000545499.1_Missense_Mutation_p.N570D	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	648						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CAAGTTCATCAACGTGATCCT	0.627																																						ENST00000358024.3	1.000000	0.790000	1.000000	0.900000	0.990000	0.963737	0.990000	1.000000																										0				20						c.(1942-1944)Aac>Gac		transmembrane and coiled-coil domain family 2							209.0	168.0	182.0					1																	205241064		2203	4300	6503	SO:0001583	missense	9911	0	0					g.chr1:205241064A>G	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.1942A>G	chr1.hg19:g.205241064A>G	ENSP00000350718:p.Asn648Asp	0					TMCC2_ENST00000329800.7_Missense_Mutation_p.N408D|TMCC2_ENST00000330675.7_Missense_Mutation_p.N423D|TMCC2_ENST00000495538.1_3'UTR|TMCC2_ENST00000545499.1_Missense_Mutation_p.N570D	p.N648D	NM_014858.3	NP_055673.2	1	2	3	2.024286	O75069	TMCC2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.117)	5	2331	+	Breast(84;0.0871)		A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	1	1	hg19	c.1942A>G	CCDS30984.1	1	.	.	.	.	.	.	.	.	.	.	A	32	5.136024	0.94517	.	.	ENSG00000133069	ENST00000358024;ENST00000545499;ENST00000330675;ENST00000329800	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.75831	0.3903	M	0.88181	2.935	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.69479	0.94;0.964;0.964	T	0.81191	-0.1045	10	0.72032	D	0.01	.	15.1067	0.72326	1.0:0.0:0.0:0.0	.	408;423;648	G5E963;B2RAX5;O75069	.;.;TMCC2_HUMAN	D	648;570;423;408	ENSP00000350718:N648D;ENSP00000437943:N570D;ENSP00000331842:N423D;ENSP00000329436:N408D	ENSP00000329436:N408D	N	+	1	0	0	TMCC2	203507687	203507687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.233000	0.73108	0.533000	0.62120	AAC	0.248120		TCGA-IB-7647-01A-11D-2154-08	0.627	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	1	0	1		2	2	2	0		0	0	162		162	160	1	1.920000	-20.000000	1	0.240000	NM_014858			70	70		516	509	1		1	0		0	0	162	0		1.000000	2.971353e-01	0	1	0	8	0	70	516
OBSCN	84033	broad.mit.edu	37	1	228494661	228494661	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:228494661G>A	ENST00000422127.1	+	45	12030	c.11986G>A	c.(11986-11988)Gca>Aca	p.A3996T	OBSCN_ENST00000570156.2_Missense_Mutation_p.A4953T|OBSCN_ENST00000366709.4_Missense_Mutation_p.A1115T|OBSCN_ENST00000366707.4_Missense_Mutation_p.A1630T|OBSCN_ENST00000284548.11_Missense_Mutation_p.A3996T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3996	Ig-like 41.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGGAGGCACCGCACACTTATG	0.662																																						ENST00000422127.1	1.000000	0.180000	1.000000	0.350000	0.620000	0.645483	0.620000	1.000000																										0				223						c.(11986-11988)Gca>Aca		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							24.0	29.0	27.0					1																	228494661		2142	4229	6371	SO:0001583	missense	84033	0	0					g.chr1:228494661G>A	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11986G>A	chr1.hg19:g.228494661G>A	ENSP00000409493:p.Ala3996Thr	0					OBSCN_ENST00000284548.11_Missense_Mutation_p.A3996T|OBSCN_ENST00000366707.4_Missense_Mutation_p.A1630T|OBSCN_ENST00000570156.2_Missense_Mutation_p.A4953T|OBSCN_ENST00000366709.4_Missense_Mutation_p.A1115T	p.A3996T	NM_001098623.2	NP_001092093.2	1	2	3	2.024286	Q5VST9	OBSCN_HUMAN		45	12030	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	0	1	hg19	c.11986G>A	CCDS58065.1	0	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234904	0.58886	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	5.75	4.83	0.62350	5.75	4.83	0.62350	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.080615	0.51477	D	0.000084	T	0.23806	0.0576	M	0.76433	2.335	0.09310	N	1	D;P	0.89917	1.0;0.945	D;P	0.91635	0.999;0.465	T	0.02450	-1.1157	10	0.35671	T	0.21	.	15.1731	0.72891	0.069:0.0:0.931:0.0	.	3996;3996	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	T	3996;3996;1630;1115	ENSP00000284548:A3996T;ENSP00000409493:A3996T;ENSP00000355668:A1630T;ENSP00000355670:A1115T	ENSP00000284548:A3996T	A	+	1	0	0	OBSCN	226561284	226561284	0.393000	0.25237	0.150000	0.22450	0.002000	0.02628	3.437000	0.52863	2.722000	0.93159	0.462000	0.41574	GCA	0.248120		TCGA-IB-7647-01A-11D-2154-08	0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	13		13	13	1	1.920000	-7.313587	1	0.240000	NM_052843			3	3		44	44	0		1			0	0	13	0		0.812608	0	0	0	0	0	0	3	44
ACTA1	58	broad.mit.edu	37	1	229568336	229568336	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:229568336C>T	ENST00000366684.3	-	3	523	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	ACTA1_ENST00000366683.2_Intron	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	141					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				AGGGACAGCACGGCCTGGATG	0.706																																						ENST00000366684.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999975	0.990000	1.000000																										0				28						c.(421-423)Gtg>Atg		actin, alpha 1, skeletal muscle							52.0	53.0	53.0					1																	229568336		2203	4298	6501	SO:0001583	missense	58	0	0					g.chr1:229568336C>T	J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.421G>A	chr1.hg19:g.229568336C>T	ENSP00000355645:p.Val141Met	0					ACTA1_ENST00000366683.2_Intron	p.V141M	NM_001100.3	NP_001091.1	1	2	3	2.024286	P68133	ACTS_HUMAN		3	523	-	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	ENST00000366684.3	1	1	hg19	c.421G>A	CCDS1578.1	1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444060	0.43429	.	.	ENSG00000143632	ENST00000366684;ENST00000366682;ENST00000342787	D	0.96136	-3.92	4.54	4.54	0.55810	4.54	4.54	0.55810	.	0.000000	0.64402	D	0.000001	D	0.97838	0.9290	H	0.96111	3.77	0.80722	D	1	P	0.41475	0.751	P	0.49332	0.607	D	0.99867	1.1091	10	0.87932	D	0	.	17.4768	0.87661	0.0:1.0:0.0:0.0	.	141	P68133	ACTS_HUMAN	M	141;106;141	ENSP00000355645:V141M	ENSP00000344142:V141M	V	-	1	0	0	ACTA1	227634959	227634959	1.000000	0.71417	0.998000	0.56505	0.419000	0.31324	7.620000	0.83070	2.360000	0.80028	0.655000	0.94253	GTG	0.248120		TCGA-IB-7647-01A-11D-2154-08	0.706	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092781.1	1	0	1		2	2	2	0		0	0	103		103	100	1	1.920000	-20.000000	1	0.240000	NM_001100			75	74		367	360	0		1			0	0	103	0		1.000000	0	0	0	0	0	0	75	367
OR2W5	441932	broad.mit.edu	37	1	247655201	247655201	+	RNA	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:247655201C>T	ENST00000522351.1	+	0	832							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCATCATCTACGTGTACCTGA	0.532																																						ENST00000522351.1	1.000000	0.220000	0.440000	0.270000	0.340000	0.393516	0.340000	0.330000																										0				39								olfactory receptor, family 2, subfamily W, member 5							133.0	116.0	122.0					1																	247655201		2203	4300	6503			441932	0	0					g.chr1:247655201C>T			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		chr1.hg19:g.247655201C>T		0									1	2	3	2.024286	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)	0	832	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	B9EH85	RNA	SNP	ENST00000522351.1	1	1	hg19			0																																																																																								0.248120		TCGA-IB-7647-01A-11D-2154-08	0.532	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	0	0	1		2	2	2	0		0	0	123		123	121	1	1.920000	-4.257193	1	0.240000	NM_001004698			25	24		603	601	0		1			0	0	123	0		1.000000	0	0	0	0	0	0	25	603
ACOT11	26027	broad.mit.edu	37	1	55062956	55062956	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:55062956G>A	ENST00000371316.3	+	7	714	c.632G>A	c.(631-633)cGc>cAc	p.R211H	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Missense_Mutation_p.R211H	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	211	Acyl coenzyme A hydrolase 2.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)	p.R211H(2)		NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						GACTGTAGCCGCATGGTGCCG	0.627																																					Ovarian(148;1440 1861 22015 32453 51933)	ENST00000371316.3	0.550000	0.120000	0.420000	0.190000	0.290000	0.313339	0.290000	0.270000																										2	Substitution - Missense(2)	p.R211H(2)	lung(2)	17						c.(631-633)cGc>cAc		acyl-CoA thioesterase 11							66.0	54.0	58.0					1																	55062956		2203	4300	6503	SO:0001583	missense	26027	0	0					g.chr1:55062956G>A	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.632G>A	chr1.hg19:g.55062956G>A	ENSP00000360366:p.Arg211His	0					ACOT11_ENST00000343744.2_Missense_Mutation_p.R211H|ACOT11_ENST00000481208.1_3'UTR	p.R211H	NM_015547.3	NP_056362.1	0	0	0	2.004852	Q8WXI4	ACO11_HUMAN		7	714	+			B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Missense_Mutation	SNP	ENST00000371316.3	1	1	hg19	c.632G>A	CCDS592.1	0	.	.	.	.	.	.	.	.	.	.	G	10.16	1.273318	0.23221	.	.	ENSG00000162390	ENST00000343744;ENST00000371316	T;T	0.10573	2.88;2.86	4.93	-7.81	0.01210	4.93	-7.81	0.01210	.	1.969230	0.02401	N	0.080685	T	0.06872	0.0175	L	0.34521	1.04	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.003	T	0.27606	-1.0069	10	0.44086	T	0.13	-24.5333	2.1472	0.03790	0.4433:0.0829:0.2566:0.2172	.	211;211	Q8WXI4;Q8WXI4-2	ACO11_HUMAN;.	H	211	ENSP00000340260:R211H;ENSP00000360366:R211H	ENSP00000340260:R211H	R	+	2	0	0	ACOT11	54835544	54835544	0.000000	0.05858	0.016000	0.15963	0.557000	0.35523	-2.496000	0.00970	-1.568000	0.01670	-1.808000	0.00615	CGC	0.232633		TCGA-IB-7647-01A-11D-2154-08	0.627	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	0	0	1		2	2	2	0		0	0	53		53	52	1	1.920000	-3.471743	1	0.240000	NM_015547			6	6		173	173	0		1	0		0	0	53	0		0.965767	2.935509e-01	0	0	0	28	0	6	173
HOOK1	51361	broad.mit.edu	37	1	60330911	60330911	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:60330911C>A	ENST00000371208.3	+	18	1995	c.1738C>A	c.(1738-1740)Caa>Aaa	p.Q580K	HOOK1_ENST00000465876.1_Intron|HOOK1_ENST00000395561.2_Missense_Mutation_p.Q538K	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	580					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					AGATATAAATCAAAATGGTAG	0.363																																						ENST00000371208.3	0.530000	0.150000	0.420000	0.220000	0.310000	0.328351	0.310000	0.300000																										0				29						c.(1738-1740)Caa>Aaa		hook microtubule-tethering protein 1							55.0	57.0	56.0					1																	60330911		2203	4300	6503	SO:0001583	missense	51361	0	0					g.chr1:60330911C>A	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1738C>A	chr1.hg19:g.60330911C>A	ENSP00000360252:p.Gln580Lys	0					HOOK1_ENST00000395561.2_Missense_Mutation_p.Q538K|HOOK1_ENST00000465876.1_Intron	p.Q580K	NM_015888.4	NP_056972.1	0	0	0	2.004852	Q9UJC3	HOOK1_HUMAN		18	1995	+	all_cancers(7;0.000129)		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	0	1	hg19	c.1738C>A	CCDS612.1	0	.	.	.	.	.	.	.	.	.	.	C	12.53	1.965749	0.34659	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.17213	2.29;2.29	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.156942	0.56097	D	0.000022	T	0.19005	0.0456	L	0.45581	1.43	0.58432	D	0.999999	B	0.11235	0.004	B	0.16722	0.016	T	0.13202	-1.0518	10	0.10377	T	0.69	.	20.6398	0.99548	0.0:1.0:0.0:0.0	.	580	Q9UJC3	HOOK1_HUMAN	K	580;538	ENSP00000360252:Q580K;ENSP00000378928:Q538K	ENSP00000360252:Q580K	Q	+	1	0	0	HOOK1	60103499	60103499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.497000	0.73674	2.881000	0.98747	0.650000	0.86243	CAA	0.232633		TCGA-IB-7647-01A-11D-2154-08	0.363	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	0	0	1		2	2	2	0		0	0	47		47	47	1	1.920000	-3.995250	1	0.240000	NM_015888			9	9		237	236	0		1	1		0	0	47	0		0.994360	6.083853e-01	0	9	0	44	0	9	237
OR2L13	284521	broad.mit.edu	37	1	248262826	248262826	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr1:248262826T>G	ENST00000358120.2	+	2	294	c.149T>G	c.(148-150)gTg>gGg	p.V50G	OR2L13_ENST00000366478.2_Missense_Mutation_p.V50G			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CTCATCCACGTGGATCCTCGT	0.502																																						ENST00000358120.2	1.000000	0.210000	0.410000	0.260000	0.320000	0.377809	0.320000	0.320000																										0				59						c.(148-150)gTg>gGg		olfactory receptor, family 2, subfamily L, member 13							229.0	214.0	219.0					1																	248262826		2203	4300	6503	SO:0001583	missense	284521	0	0					g.chr1:248262826T>G	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.149T>G	chr1.hg19:g.248262826T>G	ENSP00000350836:p.Val50Gly	0					OR2L13_ENST00000366478.2_Missense_Mutation_p.V50G	p.V50G			1	2	3	2.024286	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)	2	294	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	1	1	hg19	c.149T>G	CCDS1637.1	0	.	.	.	.	.	.	.	.	.	.	T	8.900	0.956010	0.18507	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.03004	4.08;4.08	4.07	2.92	0.33932	4.07	2.92	0.33932	GPCR, rhodopsin-like superfamily (1);	0.615698	0.13314	N	0.397234	T	0.02807	0.0084	L	0.28014	0.82	0.09310	N	1	B	0.24258	0.1	B	0.21708	0.036	T	0.44697	-0.9311	10	0.54805	T	0.06	.	2.5302	0.04701	0.2215:0.1561:0.0:0.6224	.	50	Q8N349	OR2LD_HUMAN	G	50	ENSP00000355434:V50G;ENSP00000350836:V50G	ENSP00000350836:V50G	V	+	2	0	0	OR2L13	246329449	246329449	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	-3.499000	0.00450	0.580000	0.29522	0.528000	0.53228	GTG	0.248120		TCGA-IB-7647-01A-11D-2154-08	0.502	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	0	0	1		2	2	2	0		0	0	169		169	167	1	1.920000	-20.000000	1	0.240000	NM_175911			29	29		734	723	0		1			0	0	169	0		1.000000	0	0	0	0	0	0	29	734
NKX2-2	4821	broad.mit.edu	37	20	21492879	21492879	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr20:21492879C>T	ENST00000377142.4	-	2	860	c.504G>A	c.(502-504)acG>acA	p.T168T	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	168					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						CCTGCGTGGGCGTGAGGCGGA	0.677																																						ENST00000377142.4	1.000000	0.620000	1.000000	0.770000	0.940000	0.905623	0.940000	1.000000																										0				21						c.(502-504)acG>acA		NK2 homeobox 2							42.0	43.0	42.0					20																	21492879		2202	4300	6502	SO:0001819	synonymous_variant	4821	0	0					g.chr20:21492879C>T	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.504G>A	chr20.hg19:g.21492879C>T		0					NKX2-2-AS1_ENST00000549659.1_RNA	p.T168T	NM_002509.3	NP_002500.1	0	1	1	1.927046	O95096	NKX22_HUMAN		2	860	-				Silent	SNP	ENST00000377142.4	1	1	hg19	c.504G>A	CCDS13145.1	1																																																																																								0.194574		TCGA-IB-7647-01A-11D-2154-08	0.677	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078278.9	1	0	1		2	2	2	0		0	0	50		50	49	1	1.920000	-20.000000	1	0.240000				23	22		167	165	1		1	0		0	0	50	0		1.000000	1.685971e-01	0	0	0	6	0	23	167
NFATC2	4773	broad.mit.edu	37	20	50140613	50140613	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr20:50140613G>A	ENST00000396009.3	-	2	386	c.167C>T	c.(166-168)tCc>tTc	p.S56F	NFATC2_ENST00000414705.1_Missense_Mutation_p.S36F|NFATC2_ENST00000610033.1_Intron|NFATC2_ENST00000609507.1_Intron|NFATC2_ENST00000609943.1_Missense_Mutation_p.S36F|NFATC2_ENST00000371564.3_Missense_Mutation_p.S56F	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	56					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					TGCGGGTCCGGAGGGTGGGCT	0.597																																						ENST00000396009.3	1.000000	0.260000	0.540000	0.330000	0.410000	0.459752	0.410000	0.410000																									EWSR1/NFATC2(9)	0				53						c.(166-168)tCc>tTc		nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2							49.0	57.0	54.0					20																	50140613		2202	4300	6502	SO:0001583	missense	4773	0	0					g.chr20:50140613G>A	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.167C>T	chr20.hg19:g.50140613G>A	ENSP00000379330:p.Ser56Phe	0					NFATC2_ENST00000414705.1_Missense_Mutation_p.S36F|NFATC2_ENST00000609943.1_Missense_Mutation_p.S36F|NFATC2_ENST00000610033.1_Intron|NFATC2_ENST00000609507.1_Intron|NFATC2_ENST00000371564.3_Missense_Mutation_p.S56F	p.S56F	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	1	2	3	2.049961	Q13469	NFAC2_HUMAN		2	386	-	Hepatocellular(150;0.248)		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	1	1	hg19	c.167C>T	CCDS13437.1	0	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577607	0.65878	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.18016	2.26;2.26;2.24	5.13	5.13	0.70059	5.13	5.13	0.70059	.	0.428509	0.25903	N	0.027548	T	0.30479	0.0766	N	0.22421	0.69	0.50039	D	0.999842	D;D;D;D	0.71674	0.997;0.998;0.998;0.998	P;D;D;D	0.78314	0.897;0.991;0.943;0.987	T	0.07501	-1.0769	10	0.54805	T	0.06	-28.7684	18.9234	0.92536	0.0:0.0:1.0:0.0	.	36;36;56;56	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	F	56;56;36	ENSP00000360619:S56F;ENSP00000379330:S56F;ENSP00000396471:S36F	ENSP00000360619:S56F	S	-	2	0	0	NFATC2	49574020	49574020	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.705000	0.91357	2.550000	0.86006	0.313000	0.20887	TCC	0.247227		TCGA-IB-7647-01A-11D-2154-08	0.597	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	1	0	1		2	2	2	0		0	0	93		93	91	1	1.920000	-5.147189	1	0.240000	NM_012340			20	20		393	385	0		1	0		0	0	93	0		0.999995	3.061662e-01	0	0	0	22	0	20	393
MYT1	4661	broad.mit.edu	37	20	62851191	62851191	+	Silent	SNP	C	C	T	rs117853857		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr20:62851191C>T	ENST00000328439.1	+	13	2461	c.2097C>T	c.(2095-2097)gaC>gaT	p.D699D	MYT1_ENST00000360149.4_Silent_p.D401D|MYT1_ENST00000536311.1_Silent_p.D726D	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AGTCTCCCGACGCCTCCCAGC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16055	0.001		0.0	False		,,,				2504	0.0				GBM(59;481 1041 20555 21139 33705)	ENST00000328439.1	0.950000	0.300000	0.810000	0.440000	0.620000	0.632616	0.620000	0.610000																										0				55						c.(2095-2097)gaC>gaT		myelin transcription factor 1							38.0	39.0	39.0					20																	62851191		2203	4299	6502	SO:0001819	synonymous_variant	4661	33	121286	41				g.chr20:62851191C>T	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2097C>T	chr20.hg19:g.62851191C>T		1					MYT1_ENST00000536311.1_Silent_p.D726D|MYT1_ENST00000360149.4_Silent_p.D401D	p.D699D	NM_004535.2	NP_004526.1	0	1	1	1.770176	Q99640	PMYT1_HUMAN		13	2461	+	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	ENST00000328439.1	1	1	hg19	c.2097C>T	CCDS13558.1	0																																																																																								0.136364		TCGA-IB-7647-01A-11D-2154-08	0.657	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	1	0	1		2	2	2	0		0	0	32		32	32	1	1.920000	-5.894015	1	0.240000	NM_004535			8	8		83	81	0		1	0		0	0	32	0		0.989531	0	0	0	0	1	0	8	83
SLC37A1	54020	broad.mit.edu	37	21	43999848	43999848	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr21:43999848C>T	ENST00000352133.2	+	19	2506	c.1524C>T	c.(1522-1524)ttC>ttT	p.F508F	SLC37A1_ENST00000398341.3_Silent_p.F508F			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	508					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						TGGTGCAGTTCCTGATCCGCC	0.647																																						ENST00000352133.2	1.000000	0.520000	1.000000	0.670000	0.850000	0.840128	0.850000	1.000000																										0				15						c.(1522-1524)ttC>ttT		solute carrier family 37 (glucose-6-phosphate transporter), member 1							78.0	61.0	67.0					21																	43999848		2203	4300	6503	SO:0001819	synonymous_variant	54020	0	0					g.chr21:43999848C>T	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.1524C>T	chr21.hg19:g.43999848C>T		0					SLC37A1_ENST00000398341.3_Silent_p.F508F	p.F508F			0	0	0	1.959383	P57057	GLPT_HUMAN		19	2506	+			D3DSJ7|Q9HAQ1	Silent	SNP	ENST00000352133.2	1	1	hg19	c.1524C>T	CCDS13689.1	1																																																																																								0.215524		TCGA-IB-7647-01A-11D-2154-08	0.647	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1	1	0	1		2	2	2	0		0	0	35		35	35	1	1.920000	-19.999980	1	0.240000				17	17		144	143	0		1	1		0	0	35	0		0.999973	9.998573e-01	0	44	0	86	0	17	144
OR11H1	81061	broad.mit.edu	37	22	16449649	16449649	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr22:16449649C>T	ENST00000252835.4	-	1	156	c.156G>A	c.(154-156)ctG>ctA	p.L52L		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		CTGTTATAGTCAGTGCATATG	0.418																																						ENST00000252835.4	1.000000	0.240000	0.400000	0.280000	0.330000	0.361786	0.330000	0.340000																										0				11						c.(154-156)ctG>ctA		olfactory receptor, family 11, subfamily H, member 1							103.0	103.0	103.0					22																	16449649		1501	3161	4662	SO:0001819	synonymous_variant	81061	0	0					g.chr22:16449649C>T	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.156G>A	chr22.hg19:g.16449649C>T		0						p.L52L	NM_001005239.1	NP_001005239.1	1	2	3	2.027205	Q8NG94	O11H1_HUMAN		1	156	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)	Q6IEX0|Q96R32	Silent	SNP	ENST00000252835.4	1	1	hg19	c.156G>A	CCDS33594.1	0																																																																																								0.243631		TCGA-IB-7647-01A-11D-2154-08	0.418	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	0	0	1		2	2	2	0		0	0	189		189	333	1	1.920000	-4.182016	1	0.240000	NM_001005239			42	23		1003	570	0		1			0	0	189	0		1.000000	0	0	0	0	0	0	42	1003
GPR45	11250	broad.mit.edu	37	2	105858390	105858390	+	Silent	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr2:105858390G>A	ENST00000258456.1	+	1	191	c.75G>A	c.(73-75)ggG>ggA	p.G25G		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						CAGACTCGGGGTCCACCCAGT	0.602																																						ENST00000258456.1	1.000000	0.340000	0.660000	0.420000	0.520000	0.558657	0.520000	0.500000																										0				28						c.(73-75)ggG>ggA		G protein-coupled receptor 45							106.0	99.0	101.0					2																	105858390		2203	4300	6503	SO:0001819	synonymous_variant	11250	0	0					g.chr2:105858390G>A	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.75G>A	chr2.hg19:g.105858390G>A		0						p.G25G	NM_007227.3	NP_009158.3	1	2	3	2.055490	Q9Y5Y3	GPR45_HUMAN		1	191	+			Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	1	1	hg19	c.75G>A	CCDS2066.1	0																																																																																								0.249012		TCGA-IB-7647-01A-11D-2154-08	0.602	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	1	0	1		2	2	2	0		0	0	111		111	109	1	1.920000	-6.753744	1	0.240000	NM_007227			26	26		407	404	0		1			0	0	111	0		1.000000	0	0	0	0	0	0	26	407
TTN	7273	broad.mit.edu	37	2	179464316	179464316	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr2:179464316C>A	ENST00000591111.1	-	239	51613	c.51389G>T	c.(51388-51390)gGa>gTa	p.G17130V	TTN_ENST00000589042.1_Missense_Mutation_p.G18771V|TTN_ENST00000342992.6_Missense_Mutation_p.G16203V|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G9831V|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G9706V|TTN_ENST00000342175.6_Missense_Mutation_p.G9898V			Q8WZ42	TITIN_HUMAN	titin	17130	Ig-like 102.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGATGCTGTTCCCAGATTATT	0.388																																						ENST00000591111.1	1.000000	0.330000	0.490000	0.380000	0.420000	0.459265	0.420000	0.430000																										0				1448						c.(51388-51390)gGa>gTa		titin							260.0	256.0	257.0					2																	179464316		1918	4130	6048	SO:0001583	missense	7273	0	0					g.chr2:179464316C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51389G>T	chr2.hg19:g.179464316C>A	ENSP00000465570:p.Gly17130Val	0					TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G16203V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G9706V|TTN_ENST00000589042.1_Missense_Mutation_p.G18771V|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G9898V|TTN_ENST00000359218.5_Missense_Mutation_p.G9831V|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA	p.G17130V			1	2	3	2.037028	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	239	51613	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.51389G>T		0	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657649	0.47467	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.55	5.55	0.83447	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91219	0.7233	H	0.96175	3.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93592	0.6922	9	0.87932	D	0	.	19.5067	0.95121	0.0:1.0:0.0:0.0	.	9706;9831;9898;17130	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	16203;9706;9898;9831;9704	ENSP00000343764:G16203V;ENSP00000434586:G9706V;ENSP00000340554:G9898V;ENSP00000352154:G9831V	ENSP00000340554:G9898V	G	-	2	0	0	TTN	179172561	179172561	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.760000	0.85248	2.609000	0.88269	0.650000	0.86243	GGA	0.245433		TCGA-IB-7647-01A-11D-2154-08	0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0		0	0	254		254	254	1	1.920000	-7.614373	1	0.240000	NM_133378			74	73		1376	1365	0		1			0	0	254	0		1.000000	0	0	0	0	0	0	74	1376
OTOF	9381	broad.mit.edu	37	2	26702178	26702178	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr2:26702178C>T	ENST00000272371.2	-	18	2294	c.2168G>A	c.(2167-2169)cGc>cAc	p.R723H	OTOF_ENST00000339598.3_5'Flank|OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000403946.3_Missense_Mutation_p.R723H	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	723					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTAGAGGCGGCGGCGCTGGTC	0.652																																					GBM(102;732 1451 20652 24062 31372)	ENST00000272371.2	1.000000	0.650000	1.000000	0.870000	0.990000	0.952634	0.990000	1.000000																										0				106						c.(2167-2169)cGc>cAc		otoferlin							27.0	29.0	29.0					2																	26702178		2200	4298	6498	SO:0001583	missense	9381	12	120760	37				g.chr2:26702178C>T	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2168G>A	chr2.hg19:g.26702178C>T	ENSP00000272371:p.Arg723His	0					OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000339598.3_5'Flank|OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000403946.3_Missense_Mutation_p.R723H	p.R723H	NM_194248.2	NP_919224.1	1	2	3	2.055490	Q9HC10	OTOF_HUMAN		18	2294	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	0	1	hg19	c.2168G>A	CCDS1725.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888835	0.91814	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.80123	-1.34;-1.34	4.54	4.54	0.55810	4.54	4.54	0.55810	.	0.051541	0.64402	D	0.000001	D	0.84215	0.5423	M	0.82056	2.57	0.54753	D	0.999985	D	0.54397	0.966	P	0.50231	0.635	T	0.82952	-0.0202	10	0.15066	T	0.55	-18.8365	15.9074	0.79442	0.0:1.0:0.0:0.0	.	723	Q9HC10	OTOF_HUMAN	H	723	ENSP00000272371:R723H;ENSP00000385255:R723H	ENSP00000272371:R723H	R	-	2	0	0	OTOF	26555682	26555682	0.983000	0.35010	0.997000	0.53966	0.970000	0.65996	5.961000	0.70356	2.074000	0.62210	0.555000	0.69702	CGC	0.249012		TCGA-IB-7647-01A-11D-2154-08	0.652	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3	1	0	1		2	2	2	0		0	0	20		20	19	1	1.920000	-2.659288	1	0.240000				14	14		93	91	1		1			0	0	20	0		0.999799	0	0	0	0	0	0	14	93
TCF7L1	83439	broad.mit.edu	37	2	85533483	85533483	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr2:85533483A>T	ENST00000282111.3	+	9	1419	c.1144A>T	c.(1144-1146)Aga>Tga	p.R382*		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	382					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						GATCCTTGGAAGAAAGGTAAG	0.567																																						ENST00000282111.3	1.000000	0.170000	0.490000	0.250000	0.340000	0.402678	0.340000	0.320000																										0				18						c.(1144-1146)Aga>Tga		transcription factor 7-like 1 (T-cell specific, HMG-box)							124.0	111.0	115.0					2																	85533483		2203	4300	6503	SO:0001587	stop_gained	83439	0	0					g.chr2:85533483A>T	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.1144A>T	chr2.hg19:g.85533483A>T	ENSP00000282111:p.Arg382*	0						p.R382*	NM_031283.2	NP_112573.1	1	2	3	2.055490	Q9HCS4	TF7L1_HUMAN		9	1419	+			Q53R97|Q6PD70|Q9NP00	Nonsense_Mutation	SNP	ENST00000282111.3	0	1	hg19	c.1144A>T	CCDS1971.1	0	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644390	0.87859	.	.	ENSG00000152284	ENST00000282111	.	.	.	5.17	2.67	0.31697	5.17	2.67	0.31697	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.7191	0.46030	0.5148:0.4852:0.0:0.0	.	.	.	.	X	382	.	ENSP00000282111:R382X	R	+	1	2	2	TCF7L1	85386994	85386994	0.082000	0.21442	0.979000	0.43373	0.034000	0.12701	0.726000	0.25984	0.257000	0.21650	-0.435000	0.05868	AGA	0.249012		TCGA-IB-7647-01A-11D-2154-08	0.567	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	0	0	1		2	2	2	0		0	0	64		64	65	1	1.920000	-3.959755	1	0.240000	NM_031283			11	11		273	270	0		1	0		0	0	64	0		0.998326	2.809593e-01	0	0	0	25	0	11	273
TTN	7273	broad.mit.edu	37	2	179641506	179641506	+	Silent	SNP	A	A	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr2:179641506A>G	ENST00000591111.1	-	28	5309	c.5085T>C	c.(5083-5085)taT>taC	p.Y1695Y	TTN_ENST00000589042.1_Silent_p.Y1695Y|TTN_ENST00000342992.6_Silent_p.Y1695Y|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000359218.5_Silent_p.Y1649Y|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000460472.2_Silent_p.Y1649Y|TTN_ENST00000342175.6_Silent_p.Y1649Y|TTN_ENST00000360870.5_Silent_p.Y1695Y			Q8WZ42	TITIN_HUMAN	titin	12526					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCTTTGTCATAGAGATCAC	0.473																																						ENST00000591111.1	1.000000	0.900000	1.000000	0.990000	0.990000	0.993917	0.990000	1.000000																										0				1448						c.(5083-5085)taT>taC		titin							90.0	84.0	86.0					2																	179641506		2203	4300	6503	SO:0001819	synonymous_variant	7273	0	0					g.chr2:179641506A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5085T>C	chr2.hg19:g.179641506A>G		0					TTN_ENST00000360870.5_Silent_p.Y1695Y|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Silent_p.Y1695Y|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Silent_p.Y1649Y|TTN_ENST00000589042.1_Silent_p.Y1695Y|TTN_ENST00000342175.6_Silent_p.Y1649Y|TTN_ENST00000359218.5_Silent_p.Y1649Y|TTN-AS1_ENST00000584485.1_RNA	p.Y1695Y			1	2	3	2.037028	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	28	5309	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	1	1	hg19	c.5085T>C		1																																																																																								0.245433		TCGA-IB-7647-01A-11D-2154-08	0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0		0	0	53		53	52	1	1.920000	-19.999890	1	0.240000	NM_133378			54	54		331	330	1		1			0	0	53	0		1.000000	0	0	0	0	0	0	54	331
PARP14	54625	broad.mit.edu	37	3	122422822	122422822	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr3:122422822C>T	ENST00000474629.2	+	7	3581	c.3315C>T	c.(3313-3315)ctC>ctT	p.L1105L		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1105	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CATCTTCACTCAAGGTTGGGC	0.483																																						ENST00000474629.2	1.000000	0.070000	1.000000	0.120000	0.180000	0.357987	0.180000	0.160000																										0				50						c.(3313-3315)ctC>ctT		poly (ADP-ribose) polymerase family, member 14							111.0	112.0	111.0					3																	122422822		1971	4147	6118	SO:0001819	synonymous_variant	54625	0	0					g.chr3:122422822C>T	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3315C>T	chr3.hg19:g.122422822C>T		1						p.L1105L	NM_017554.2	NP_060024.2	1	2	3	2.200593	Q460N5	PAR14_HUMAN		7	3581	+			B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	0	1	hg19	c.3315C>T	CCDS46894.1	0																																																																																								0.294991		TCGA-IB-7647-01A-11D-2154-08	0.483	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	0	0	1		2	2	2	0		0	0	73		73	73	1	1.920000	-2.854990	1	0.240000	NM_017554			8	8		444	438	0		1	1		0	0	73	0		0.988910	8.402633e-01	0	3	0	184	0	8	444
IGSF10	285313	broad.mit.edu	37	3	151155325	151155325	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr3:151155325G>C	ENST00000282466.3	-	6	7023	c.7024C>G	c.(7024-7026)Cca>Gca	p.P2342A	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2342	Ig-like C2-type 10.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCATTAAATGGATTTCTAAAT	0.423																																						ENST00000282466.3	1.000000	0.200000	1.000000	0.250000	0.310000	0.456618	0.310000	0.290000																										0				116						c.(7024-7026)Cca>Gca		immunoglobulin superfamily, member 10							118.0	120.0	119.0					3																	151155325		2203	4300	6503	SO:0001583	missense	285313	0	0					g.chr3:151155325G>C	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7024C>G	chr3.hg19:g.151155325G>C	ENSP00000282466:p.Pro2342Ala	1					IGSF10_ENST00000495443.1_5'UTR	p.P2342A	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	1	2	3	2.200593	Q6WRI0	IGS10_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)	6	7023	-			Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	1	1	hg19	c.7024C>G	CCDS3160.1	0	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173936	0.78452	.	.	ENSG00000152580	ENST00000282466	T	0.66815	-0.23	5.77	5.77	0.91146	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.46442	D	0.000299	T	0.82254	0.4997	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.82118	-0.0615	10	0.56958	D	0.05	.	19.9792	0.97320	0.0:0.0:1.0:0.0	.	2342;369	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	A	2342	ENSP00000282466:P2342A	ENSP00000282466:P2342A	P	-	1	0	0	IGSF10	152638015	152638015	1.000000	0.71417	0.549000	0.28204	0.904000	0.53231	9.414000	0.97362	2.727000	0.93392	0.591000	0.81541	CCA	0.294991		TCGA-IB-7647-01A-11D-2154-08	0.423	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	0	0	1		2	2	2	0		0	0	108		108	107	1	1.920000	-3.588511	1	0.240000	NM_178822			30	30		883	879	0		1	0		0	0	108	0		1.000000	1.178419e-03	0	0	0	2	0	30	883
PIK3CA	5290	broad.mit.edu	37	3	178948163	178948163	+	Splice_Site	SNP	A	A	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr3:178948163A>G	ENST00000263967.3	+	20	3092	c.2935A>G	c.(2935-2937)Agg>Ggg	p.R979G		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	979	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGAATTTGAGAGGTGAGCTCG	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	ENST00000263967.3	1.000000	0.910000	1.000000	0.990000	0.990000	0.994887	0.990000	1.000000		57		Dom	yes			Dom	yes		3	3q26.3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""				"""E, O"""	E, O			colorectal, gastric, gliobastoma, breast		0				5269						c.(2935-2937)Agg>Ggg		phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	Caffeine(DB00201)						65.0	63.0	64.0					3																	178948163		1803	4073	5876	SO:0001630	splice_region_variant	5290	0	0					g.chr3:178948163A>G		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2936+1A>G	chr3.hg19:g.178948163A>G		1	HNSCC(19;0.045)|TSP Lung(28;0.18)					p.R979G	NM_006218.2	NP_006209.2	1	2	3	2.200593	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)	20	3092	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		Q14CW1|Q99762	Splice_Site	SNP	ENST00000263967.3	1	0	hg19	c.2935A>G	CCDS43171.1	1	.	.	.	.	.	.	.	.	.	.	A	18.36	3.606615	0.66558	.	.	ENSG00000121879	ENST00000263967	T	0.75938	-0.98	4.99	4.99	0.66335	4.99	4.99	0.66335	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	T	0.73590	0.3606	L	0.55213	1.73	0.80722	D	1	P	0.45827	0.867	P	0.45071	0.468	T	0.75297	-0.3367	10	0.44086	T	0.13	-11.9936	14.9656	0.71188	1.0:0.0:0.0:0.0	.	979	P42336	PK3CA_HUMAN	G	979	ENSP00000263967:R979G	ENSP00000263967:R979G	R	+	1	2	2	PIK3CA	180430857	180430857	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.842000	0.75379	1.990000	0.58119	0.477000	0.44152	AGG	0.294991		TCGA-IB-7647-01A-11D-2154-08	0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2	1	0	1		2	2	2	0		0	0	68		68	66	1	1.920000	-19.999990	1	0.240000		Missense_Mutation		63	62		427	423	1		1	1		0	0	68	0		1.000000	9.999911e-01	0	4	0	111	0	63	427
CELSR3	1951	broad.mit.edu	37	3	48677669	48677669	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr3:48677669G>A	ENST00000164024.4	-	34	9629	c.9349C>T	c.(9349-9351)Cgg>Tgg	p.R3117W	CELSR3_ENST00000544264.1_Missense_Mutation_p.R3122W	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	3117					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGCTGCCCCGATCTTTGGGC	0.682																																						ENST00000164024.4	1.000000	0.690000	0.970000	0.800000	0.900000	0.892557	0.900000	0.990000																										0				83						c.(9349-9351)Cgg>Tgg		cadherin, EGF LAG seven-pass G-type receptor 3							35.0	39.0	37.0					3																	48677669		2202	4294	6496	SO:0001583	missense	1951	0	0					g.chr3:48677669G>A	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.9349C>T	chr3.hg19:g.48677669G>A	ENSP00000164024:p.Arg3117Trp	1					CELSR3_ENST00000544264.1_Missense_Mutation_p.R3122W	p.R3117W	NM_001407.2	NP_001398.2	0	1	1	1.793368	Q9NYQ7	CELR3_HUMAN		34	9629	-			O75092	Missense_Mutation	SNP	ENST00000164024.4	1	1	hg19	c.9349C>T	CCDS2775.1	1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207667	0.58343	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.72167	-0.63;-0.62	4.72	2.78	0.32641	4.72	2.78	0.32641	.	.	.	.	.	T	0.71065	0.3296	N	0.19112	0.55	0.29159	N	0.877919	D;D;D	0.89917	0.999;0.999;1.0	P;P;P	0.62885	0.9;0.798;0.908	T	0.67534	-0.5646	9	0.72032	D	0.01	.	12.7798	0.57471	0.0:0.0:0.6916:0.3084	.	3122;3117;3215	Q9NYQ7-2;Q9NYQ7;Q5Y190	.;CELR3_HUMAN;.	W	3117;3122	ENSP00000164024:R3117W;ENSP00000445694:R3122W	ENSP00000164024:R3117W	R	-	1	2	2	CELSR3	48652673	48652673	0.936000	0.31750	0.981000	0.43875	0.483000	0.33249	1.494000	0.35616	0.333000	0.23563	0.484000	0.47621	CGG	0.136364		TCGA-IB-7647-01A-11D-2154-08	0.682	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	1	0	1		2	2	2	0		0	0	81		81	80	1	1.920000	-17.797470	1	0.240000	NM_001407			37	36		228	226	1		1	1	1	0	0	81	865		1.000000	5.218463e-01	1	6	137	6	795	37	228
LMLN	89782	broad.mit.edu	37	3	197707289	197707289	+	Silent	SNP	C	C	T	rs146220433		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr3:197707289C>T	ENST00000330198.4	+	6	664	c.642C>T	c.(640-642)taC>taT	p.Y214Y	LMLN_ENST00000482695.1_Silent_p.Y162Y|LMLN_ENST00000332636.5_Silent_p.Y162Y|LMLN_ENST00000420910.2_Silent_p.Y214Y	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	214					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		TTGTTCTTTACGTTGGTGCTC	0.527																																						ENST00000330198.4	0.440000	0.180000	0.360000	0.230000	0.280000	0.304312	0.280000	0.290000																										0				25						c.(640-642)taC>taT		leishmanolysin-like (metallopeptidase M8 family)		C	,	1,4405	2.1+/-5.4	0,1,2202	164.0	152.0	156.0		642,642	2.4	1.0	3	dbSNP_134	156	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LMLN	NM_001136049.2,NM_033029.3	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	214/693,214/656	197707289	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	89782	4	121412	41				g.chr3:197707289C>T	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.642C>T	chr3.hg19:g.197707289C>T		1					LMLN_ENST00000420910.2_Silent_p.Y214Y|LMLN_ENST00000482695.1_Silent_p.Y162Y|LMLN_ENST00000332636.5_Silent_p.Y162Y	p.Y214Y	NM_033029.3	NP_149018.2	1	2	3	2.316141	Q96KR4	LMLN_HUMAN	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	6	664	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Silent	SNP	ENST00000330198.4	1	1	hg19	c.642C>T	CCDS3332.1	0																																																																																								0.319971		TCGA-IB-7647-01A-11D-2154-08	0.527	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	0	0	1		22	2	2	1		1	1	120		120	120	1	1.920000	-3.247122	1	0.240000	NM_033029			25	24		785	776	0		1	0		1	0	120	0		0.706700	6.458159e-02	0	1	0	12	0	25	785
COX7B2	170712	broad.mit.edu	37	4	46736995	46736995	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr4:46736995C>T	ENST00000396533.1	-	4	465	c.215G>A	c.(214-216)aGa>aAa	p.R72K	COX7B2_ENST00000355591.3_Missense_Mutation_p.R72K|COX7B2_ENST00000302930.5_Missense_Mutation_p.R72K|COX7B2_ENST00000543208.1_Missense_Mutation_p.R71K			Q8TF08	CX7B2_HUMAN	cytochrome c oxidase subunit VIIb2	72						integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)	p.R71I(1)		large_intestine(1)|lung(4)	5						TGGGGTAACTCTGCCAACAGG	0.428																																						ENST00000396533.1	1.000000	0.090000	0.290000	0.130000	0.190000	0.249716	0.190000	0.190000																										1	Substitution - Missense(1)	p.R71I(1)	lung(1)	5						c.(214-216)aGa>aAa		cytochrome c oxidase subunit VIIb2							112.0	100.0	104.0					4																	46736995		2203	4300	6503	SO:0001583	missense	170712	0	0					g.chr4:46736995C>T	AF125109	CCDS3472.2	4p12	2011-07-04			ENSG00000170516	ENSG00000170516		"""Mitochondrial respiratory chain complex / Complex IV"""	24381	protein-coding gene	gene with protein product		609811				15623157	Standard	NM_130902		Approved		uc003gxf.3	Q8TF08	OTTHUMG00000099423	ENST00000396533.1:c.215G>A	chr4.hg19:g.46736995C>T	ENSP00000379784:p.Arg72Lys	0					COX7B2_ENST00000355591.3_Missense_Mutation_p.R72K|COX7B2_ENST00000543208.1_Missense_Mutation_p.R71K|COX7B2_ENST00000302930.5_Missense_Mutation_p.R72K	p.R72K			1	2	3	2.040586	Q8TF08	CX7B2_HUMAN		4	465	-			Q32Q40	Missense_Mutation	SNP	ENST00000396533.1	0	1	hg19	c.215G>A	CCDS3472.2	0	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574133	0.65765	.	.	ENSG00000170516	ENST00000355591;ENST00000396533;ENST00000302930;ENST00000543208	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.57	4.57	0.56435	4.57	4.57	0.56435	Cytochrome C oxidase, subunit VIIB, domain (2);	0.057494	0.64402	D	0.000001	T	0.56031	0.1958	.	.	.	0.28946	N	0.890717	D	0.76494	0.999	D	0.85130	0.997	T	0.46555	-0.9183	9	0.24483	T	0.36	-8.9049	13.1628	0.59554	0.0:1.0:0.0:0.0	.	72	Q8TF08	CX7B2_HUMAN	K	72;72;72;71	ENSP00000347799:R72K;ENSP00000379784:R72K;ENSP00000305964:R72K;ENSP00000437439:R71K	ENSP00000305964:R72K	R	-	2	0	0	COX7B2	46431752	46431752	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.933000	0.28897	2.830000	0.97506	0.585000	0.79938	AGA	0.246331		TCGA-IB-7647-01A-11D-2154-08	0.428	COX7B2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313899.1	0	0	1		2	2	2	0		0	0	76		76	75	1	1.920000	-3.868727	1	0.240000	NM_130902			9	9		395	393	0		1			0	0	76	0		0.994208	0	0	0	0	0	0	9	395
ADH1A	124	broad.mit.edu	37	4	100205883	100205883	+	Silent	SNP	A	A	G			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr4:100205883A>G	ENST00000209668.2	-	4	450	c.337T>C	c.(337-339)Ttg>Ctg	p.L113L	ADH1A_ENST00000511656.1_5'Flank|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	113					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TCGTTTTTCAAGCAGTAGTTG	0.433																																						ENST00000209668.2	1.000000	0.970000	1.000000	0.990000	0.990000	0.998027	0.990000	1.000000																										0				25						c.(337-339)Ttg>Ctg		alcohol dehydrogenase 1A (class I), alpha polypeptide	Ethanol(DB00898)|Fomepizole(DB01213)						120.0	117.0	118.0					4																	100205883		2203	4300	6503	SO:0001819	synonymous_variant	124	0	0					g.chr4:100205883A>G	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.337T>C	chr4.hg19:g.100205883A>G		0					RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'Flank	p.L113L	NM_000667.3	NP_000658.1	1	2	3	2.040586	P07327	ADH1A_HUMAN		4	450	-			A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	1	1	hg19	c.337T>C	CCDS3648.1	1																																																																																								0.246331		TCGA-IB-7647-01A-11D-2154-08	0.433	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	1	0	1		2	2	2	0		0	0	49		49	49	1	1.920000	-20.000000	1	0.240000	NM_000667			52	52		293	289	1		1			0	0	49	0		1.000000	0	0	0	0	0	0	52	293
PCDHA2	56146	broad.mit.edu	37	5	140176361	140176361	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr5:140176361C>T	ENST00000526136.1	+	1	1812	c.1812C>T	c.(1810-1812)aaC>aaT	p.N604N	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Silent_p.N604N|PCDHA2_ENST00000520672.2_Silent_p.N604N|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	604	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N604N(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCTACAACGCGTGGCTTT	0.657																																						ENST00000526136.1	0.750000	0.360000	0.650000	0.440000	0.540000	0.552279	0.540000	0.530000																										2	Substitution - coding silent(2)	p.N604N(2)	large_intestine(2)	71						c.(1810-1812)aaC>aaT		protocadherin alpha 2							154.0	139.0	144.0					5																	140176361		2203	4300	6503	SO:0001819	synonymous_variant	56146	0	0					g.chr5:140176361C>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1812C>T	chr5.hg19:g.140176361C>T		0					PCDHA2_ENST00000520672.2_Silent_p.N604N|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Silent_p.N604N|PCDHA1_ENST00000394633.3_Intron	p.N604N	NM_018905.2	NP_061728.1	0	0	0	1.994106	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1812	+			O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	1	1	hg19	c.1812C>T	CCDS54914.1	0																																																																																								0.228896		TCGA-IB-7647-01A-11D-2154-08	0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	1	0	1		2	2	2	0		0	0	130		130	129	1	1.920000	-7.190530	1	0.240000	NM_018905			27	27		384	382	0		1	0		0	0	130	0		1.000000	2.582454e-02	0	0	0	4	0	27	384
LMBRD1	55788	broad.mit.edu	37	6	70428941	70428941	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr6:70428941C>T	ENST00000370577.3	-	8	898	c.669G>A	c.(667-669)ctG>ctA	p.L223L	LMBRD1_ENST00000370570.1_Silent_p.L150L	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	223					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TGCCTTTTATCAGATTTAAAG	0.313																																						ENST00000370577.3	0.530000	0.140000	0.420000	0.210000	0.300000	0.322612	0.300000	0.290000																										0				31						c.(667-669)ctG>ctA		LMBR1 domain containing 1							115.0	99.0	104.0					6																	70428941		2203	4300	6503	SO:0001819	synonymous_variant	55788	0	0					g.chr6:70428941C>T	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.669G>A	chr6.hg19:g.70428941C>T		1					LMBRD1_ENST00000370570.1_Silent_p.L150L	p.L223L	NM_018368.3	NP_060838.3	0	1	1	1.794209	Q9NUN5	LMBD1_HUMAN		8	898	-			A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Silent	SNP	ENST00000370577.3	0	1	hg19	c.669G>A	CCDS4969.1	0																																																																																								0.136364		TCGA-IB-7647-01A-11D-2154-08	0.313	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	1	0	0		2	2	2	0		0	0	27		27	26	1	1.920000	-4.171414	1	0.240000	NM_018368			8	4		188	186	0		1	0		0	0	27	0		0.988433	9.989937e-01	0	0	0	320	0	8	188
PPP1R9A	55607	broad.mit.edu	37	7	94740662	94740662	+	Missense_Mutation	SNP	G	G	A	rs201822608		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr7:94740662G>A	ENST00000433881.1	+	3	2019	c.1487G>A	c.(1486-1488)cGt>cAt	p.R496H	PPP1R9A_ENST00000424654.1_Missense_Mutation_p.R496H|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.R496H|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.R496H|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.R496H|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.R496H			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	496	Interacts with protein phosphatase 1. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			CTTGAAAAACGTGTAGAAAAG	0.383										HNSCC(28;0.073)			G|||	1	0.000199681	0.0	0.0	5008	,	,		15037	0.0		0.001	False		,,,				2504	0.0					ENST00000433881.1	0.710000	0.260000	0.560000	0.340000	0.430000	0.455942	0.430000	0.420000																										0				71						c.(1486-1488)cGt>cAt		protein phosphatase 1, regulatory subunit 9A							69.0	71.0	70.0					7																	94740662		2203	4300	6503	SO:0001583	missense	55607	1	121402	31				g.chr7:94740662G>A	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1487G>A	chr7.hg19:g.94740662G>A	ENSP00000398870:p.Arg496His	0	HNSCC(28;0.073)				PPP1R9A_ENST00000456331.2_Missense_Mutation_p.R496H|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.R496H|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.R496H|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.R496H|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.R496H	p.R496H			1	2	3	2.022996	Q9ULJ8	NEB1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)	3	2019	+	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	1	1	hg19	c.1487G>A	CCDS34683.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	19.83	3.899587	0.72754	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09	4.98	4.98	0.66077	4.98	4.98	0.66077	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.67951	0.2948	M	0.80616	2.505	0.80722	D	1	D;D;D;D;D	0.89917	0.981;0.987;0.989;1.0;1.0	P;P;P;D;D	0.79784	0.59;0.767;0.819;0.988;0.993	T	0.72268	-0.4343	10	0.87932	D	0	.	18.8349	0.92157	0.0:0.0:1.0:0.0	.	496;496;496;496;496	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	H	496	ENSP00000405514:R496H;ENSP00000344524:R496H;ENSP00000411342:R496H;ENSP00000398870:R496H;ENSP00000289495:R496H;ENSP00000402893:R496H	ENSP00000289495:R496H	R	+	2	0	0	PPP1R9A	94578598	94578598	1.000000	0.71417	1.000000	0.80357	0.083000	0.17756	9.587000	0.98229	2.755000	0.94549	0.650000	0.86243	CGT	0.241820		TCGA-IB-7647-01A-11D-2154-08	0.383	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	1	0	1		2	2	2	0		0	0	45		45	45	1	1.920000	-17.873090	1	0.240000	NM_001166160			16	16		294	292	0		1	0		0	0	45	0		0.999936	2.771978e-02	0	0	0	5	0	16	294
ZNF777	27153	broad.mit.edu	37	7	149129516	149129516	+	Missense_Mutation	SNP	G	G	A	rs552895043		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr7:149129516G>A	ENST00000247930.4	-	6	2170	c.1847C>T	c.(1846-1848)gCg>gTg	p.A616V		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CGGCTTGAGCGCGTGCTTGGG	0.672																																						ENST00000247930.4	1.000000	0.900000	1.000000	0.990000	0.990000	0.992020	0.990000	1.000000																										0				26						c.(1846-1848)gCg>gTg		zinc finger protein 777							66.0	78.0	74.0					7																	149129516		2161	4259	6420	SO:0001583	missense	27153	2	121190	36				g.chr7:149129516G>A	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1847C>T	chr7.hg19:g.149129516G>A	ENSP00000247930:p.Ala616Val	0						p.A616V	NM_015694.2	NP_056509.2	1	2	3	2.022996	Q9ULD5	ZN777_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00358)	6	2170	-	Melanoma(164;0.165)		Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	1	1	hg19	c.1847C>T	CCDS43675.1	1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216935	0.39201	.	.	ENSG00000196453	ENST00000247930;ENST00000314683	T	0.05319	3.46	5.02	5.02	0.67125	5.02	5.02	0.67125	.	1.524830	0.03983	N	0.293589	T	0.07458	0.0188	N	0.25144	0.715	0.30708	N	0.749545	B	0.28971	0.229	B	0.24269	0.052	T	0.30621	-0.9972	10	0.24483	T	0.36	-3.7701	15.8456	0.78887	0.0:0.0:1.0:0.0	.	616	Q9ULD5-2	.	V	616;359	ENSP00000247930:A616V	ENSP00000247930:A616V	A	-	2	0	0	ZNF777	148760449	148760449	0.825000	0.29262	0.934000	0.37439	0.724000	0.41520	3.866000	0.56040	2.328000	0.79073	0.460000	0.39030	GCG	0.241820		TCGA-IB-7647-01A-11D-2154-08	0.672	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	1	0	1		2	2	2	0		0	0	141		141	138	1	1.920000	-20.000000	1	0.240000	NM_015694			92	93		604	590	1		1	1		0	0	141	0		1.000000	8.882131e-02	0	2	0	2	0	92	604
ADCY8	114	broad.mit.edu	37	8	132051844	132051844	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr8:132051844C>T	ENST00000286355.5	-	1	2828	c.736G>A	c.(736-738)Ggc>Agc	p.G246S	ADCY8_ENST00000377928.3_Missense_Mutation_p.G246S	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	246					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GTGACCACGCCGCTGTACTGC	0.637										HNSCC(32;0.087)																												ENST00000286355.5	1.000000	0.350000	1.000000	0.480000	0.660000	0.699734	0.660000	1.000000																										0				134						c.(736-738)Ggc>Agc		adenylate cyclase 8 (brain)							53.0	46.0	49.0					8																	132051844		2203	4300	6503	SO:0001583	missense	114	0	0					g.chr8:132051844C>T	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.736G>A	chr8.hg19:g.132051844C>T	ENSP00000286355:p.Gly246Ser	1	HNSCC(32;0.087)				ADCY8_ENST00000377928.3_Missense_Mutation_p.G246S	p.G246S	NM_001115.2	NP_001106.1	1	4	5	2.610665	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)	1	2828	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)			Missense_Mutation	SNP	ENST00000286355.5	1	1	hg19	c.736G>A	CCDS6363.1	0	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052698	0.55218	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.39406	1.08;1.08	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.131197	0.52532	D	0.000067	T	0.29652	0.0740	N	0.21545	0.675	0.41736	D	0.989582	B;B	0.19817	0.011;0.039	B;B	0.12156	0.004;0.007	T	0.12451	-1.0547	10	0.08179	T	0.78	.	18.2863	0.90115	0.0:1.0:0.0:0.0	.	246;246	E7EVL1;P40145	.;ADCY8_HUMAN	S	246	ENSP00000286355:G246S;ENSP00000367161:G246S	ENSP00000286355:G246S	G	-	1	0	0	ADCY8	132121026	132121026	1.000000	0.71417	0.889000	0.34880	0.907000	0.53573	5.747000	0.68689	2.580000	0.87095	0.455000	0.32223	GGC	0.404948		TCGA-IB-7647-01A-11D-2154-08	0.637	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1	1	0	1		2	2	2	0		0	0	36		36	35	1	1.920000	-16.078160	1	0.240000				13	13		216	214	0		1			0	0	36	0		0.999553	0	0	0	0	0	0	13	216
LRRCC1	85444	broad.mit.edu	37	8	86027446	86027446	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr8:86027446G>A	ENST00000360375.3	+	5	805	c.656G>A	c.(655-657)tGc>tAc	p.C219Y	LRRCC1_ENST00000414626.2_Missense_Mutation_p.C199Y	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	219					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						CAGCTGCAGTGCCTAGAAGGT	0.323																																						ENST00000360375.3	1.000000	0.920000	1.000000	0.990000	0.990000	0.995710	0.990000	1.000000																										0				43						c.(655-657)tGc>tAc		leucine rich repeat and coiled-coil centrosomal protein 1							92.0	94.0	93.0					8																	86027446		1825	4080	5905	SO:0001583	missense	85444	0	0					g.chr8:86027446G>A	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.656G>A	chr8.hg19:g.86027446G>A	ENSP00000353538:p.Cys219Tyr	1					LRRCC1_ENST00000414626.2_Missense_Mutation_p.C199Y	p.C219Y	NM_033402.4	NP_208325.3	1	2	3	2.244964	Q9C099	LRCC1_HUMAN		5	805	+			B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	1	1	hg19	c.656G>A	CCDS43750.1	1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747158	0.30955	.	.	ENSG00000133739	ENST00000426019;ENST00000360375;ENST00000414626	T;T	0.32272	1.46;1.47	5.52	4.63	0.57726	5.52	4.63	0.57726	.	0.000000	0.42420	D	0.000701	T	0.31575	0.0801	L	0.59436	1.845	0.38194	D	0.940008	B;B;B	0.18610	0.016;0.029;0.005	B;B;B	0.25614	0.062;0.037;0.014	T	0.18023	-1.0350	10	0.42905	T	0.14	-1.709	12.0541	0.53524	0.0795:0.0:0.9205:0.0	.	199;126;219	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	Y	126;219;199	ENSP00000353538:C219Y;ENSP00000394695:C199Y	ENSP00000353538:C219Y	C	+	2	0	0	LRRCC1	86214698	86214698	1.000000	0.71417	0.998000	0.56505	0.666000	0.39218	6.269000	0.72558	2.585000	0.87301	0.460000	0.39030	TGC	0.316301		TCGA-IB-7647-01A-11D-2154-08	0.323	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	1	0	1		2	2	2	0		0	0	75		75	74	1	1.920000	-20.000000	1	0.240000	NM_033402			82	82		579	577	1		1	1		0	0	75	0		1.000000	9.846473e-01	0	11	0	37	0	82	579
TSTA3	7264	broad.mit.edu	37	8	144698284	144698284	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr8:144698284C>T	ENST00000425753.2	-	3	356	c.253G>A	c.(253-255)Gac>Aac	p.D85N	TSTA3_ENST00000529064.1_Missense_Mutation_p.D85N	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	85					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			ACCCAGAAGTCCAAATTGTAT	0.562																																						ENST00000425753.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				9						c.(253-255)Gac>Aac		tissue specific transplantation antigen P35B							111.0	110.0	110.0					8																	144698284		2203	4300	6503	SO:0001583	missense	7264	0	0					g.chr8:144698284C>T	U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.253G>A	chr8.hg19:g.144698284C>T	ENSP00000398803:p.Asp85Asn	1					TSTA3_ENST00000529064.1_Missense_Mutation_p.D85N	p.D85N	NM_003313.3	NP_003304.1	1	4	5	2.610665	Q13630	FCL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)	3	356	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Missense_Mutation	SNP	ENST00000425753.2	1	1	hg19	c.253G>A	CCDS6408.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.477638|5.477638	0.96291|0.96291	.|.	.|.	ENSG00000104522|ENSG00000104522	ENST00000529064;ENST00000425753;ENST00000529048;ENST00000533817;ENST00000526290|ENST00000527006	D;D;D;D;D|.	0.94138|.	-3.36;-3.36;-3.36;-3.36;-3.36|.	4.75|4.75	4.75|4.75	0.60458|0.60458	4.75|4.75	4.75|4.75	0.60458|0.60458	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);|.	0.266244|.	0.39759|.	N|.	0.001266|.	D|.	0.85173|.	0.5636|.	M|M	0.93283|0.93283	3.4|3.4	0.80722|0.80722	D|D	1|1	D;D|.	0.56035|.	0.974;0.958|.	P;P|.	0.62382|.	0.901;0.77|.	D|.	0.89272|.	0.3605|.	10|.	0.87932|.	D|.	0|.	-33.5833|-33.5833	14.467|14.467	0.67490|0.67490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	85;85|.	B4DZW9;Q13630|.	.;FCL_HUMAN|.	N|X	85|117	ENSP00000435386:D85N;ENSP00000398803:D85N;ENSP00000431587:D85N;ENSP00000437012:D85N;ENSP00000433331:D85N|.	ENSP00000398803:D85N|.	D|W	-|-	1|3	0|0	0|0	TSTA3|TSTA3	144769427|144769427	144769427|144769427	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	5.485000|5.485000	0.66850|0.66850	2.158000|2.158000	0.67659|0.67659	0.655000|0.655000	0.94253|0.94253	GAC|TGG	0.404948		TCGA-IB-7647-01A-11D-2154-08	0.562	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	1	0	1		2	2	2	0		0	0	90		90	90	1	1.920000	-20.000000	1	0.240000	NM_003313			90	88		494	488	1		1	1		0	0	90	0		1.000000	1	0	467	0	909	0	90	494
FPGS	2356	broad.mit.edu	37	9	130575756	130575756	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr9:130575756C>T	ENST00000373247.2	+	15	1687	c.1637C>T	c.(1636-1638)aCc>aTc	p.T546I	FPGS_ENST00000373225.3_Missense_Mutation_p.T496I|RP11-228B15.4_ENST00000439298.1_RNA|FPGS_ENST00000393706.2_Missense_Mutation_p.T520I|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	546					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	GGCCTCCTCACCCACCCTGTG	0.607																																						ENST00000373247.2	1.000000	0.660000	1.000000	0.750000	0.860000	0.866966	0.860000	1.000000																										0				7						c.(1636-1638)aCc>aTc		folylpolyglutamate synthase	Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)						81.0	80.0	80.0					9																	130575756		2203	4300	6503	SO:0001583	missense	2356	0	0					g.chr9:130575756C>T		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.1637C>T	chr9.hg19:g.130575756C>T	ENSP00000362344:p.Thr546Ile	0					FPGS_ENST00000373245.1_3'UTR|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000393706.2_Missense_Mutation_p.T520I|RP11-228B15.4_ENST00000439298.1_RNA|FPGS_ENST00000373225.3_Missense_Mutation_p.T496I	p.T546I	NM_004957.4	NP_004948.4	1	2	3	2.053842	Q05932	FOLC_HUMAN		15	1687	+			B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	1	1	hg19	c.1637C>T	CCDS35148.1	1	.	.	.	.	.	.	.	.	.	.	C	5.750	0.322762	0.10900	.	.	ENSG00000136877	ENST00000373247;ENST00000393706;ENST00000373225	T;T;T	0.14144	2.94;2.94;2.53	5.16	3.12	0.35913	5.16	3.12	0.35913	.	0.920751	0.09423	N	0.804181	T	0.09598	0.0236	N	0.14661	0.345	0.80722	D	1	B;B	0.22003	0.063;0.063	B;B	0.20577	0.03;0.03	T	0.13764	-1.0497	10	0.33940	T	0.23	-4.02	11.7357	0.51763	0.4523:0.5477:0.0:0.0	.	520;546	Q05932-4;Q05932	.;FOLC_HUMAN	I	546;520;496	ENSP00000362344:T546I;ENSP00000377309:T520I;ENSP00000362322:T496I	ENSP00000362322:T496I	T	+	2	0	0	FPGS	129615577	129615577	0.211000	0.23529	0.692000	0.30179	0.023000	0.10783	0.343000	0.19944	1.103000	0.41568	0.650000	0.86243	ACC	0.248120		TCGA-IB-7647-01A-11D-2154-08	0.607	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1	1	0	1		2	2	2	0		0	0	181		181	178	1	1.920000	-20.000000	1	0.240000				61	61		540	533	1		1	1		0	0	181	0		1.000000	1	0	71	0	161	0	61	540
ADAMTSL1	92949	broad.mit.edu	37	9	18777015	18777015	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr9:18777015G>A	ENST00000380548.4	+	19	3127	c.2788G>A	c.(2788-2790)Ggc>Agc	p.G930S		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	930	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GGCCCCCTTCGGCTATCTCAA	0.667																																						ENST00000380548.4	1.000000	0.700000	0.970000	0.800000	0.890000	0.889925	0.890000	0.970000																										0				42						c.(2788-2790)Ggc>Agc		ADAMTS-like 1							42.0	50.0	48.0					9																	18777015		2049	4205	6254	SO:0001583	missense	92949	6	120966	37				g.chr9:18777015G>A	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2788G>A	chr9.hg19:g.18777015G>A	ENSP00000369921:p.Gly930Ser	1						p.G930S	NM_001040272.5	NP_001035362.3	0	1	1	1.797798	Q8N6G6	ATL1_HUMAN		19	3127	+			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	1	1	hg19	c.2788G>A	CCDS47954.1	1	.	.	.	.	.	.	.	.	.	.	g	17.01	3.279858	0.59758	.	.	ENSG00000178031	ENST00000380548	T	0.73469	-0.75	5.53	4.64	0.57946	5.53	4.64	0.57946	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.719030	0.08080	U	1.000000	D	0.85630	0.5741	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.64877	0.93	T	0.79303	-0.1859	10	0.62326	D	0.03	.	14.6057	0.68478	0.0701:0.0:0.9299:0.0	.	930	Q8N6G6	ATL1_HUMAN	S	930	ENSP00000369921:G930S	ENSP00000369921:G930S	G	+	1	0	0	ADAMTSL1	18767015	18767015	1.000000	0.71417	0.881000	0.34555	0.031000	0.12232	9.551000	0.98112	1.350000	0.45770	-0.355000	0.07637	GGC	0.136364		TCGA-IB-7647-01A-11D-2154-08	0.667	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1	1	0	1		2	2	2	0		0	0	89		89	89	1	1.920000	-2.775340	1	0.240000				43	42		276	271	1		1	0		0	0	89	0		1.000000	9.429832e-02	0	0	0	4	0	43	276
DDX31	64794	broad.mit.edu	37	9	135537950	135537950	+	Missense_Mutation	SNP	C	C	T	rs367667543		TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chr9:135537950C>T	ENST00000372159.3	-	2	674	c.523G>A	c.(523-525)Gca>Aca	p.A175T	DDX31_ENST00000310532.2_Missense_Mutation_p.A175T|DDX31_ENST00000544003.1_Missense_Mutation_p.A79T|DDX31_ENST00000372153.1_Missense_Mutation_p.A175T|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000438527.3_Missense_Mutation_p.A46T	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	175						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		ATTTTTTGTGCGTTCCCCTTA	0.428																																						ENST00000372159.3	1.000000	0.770000	1.000000	0.860000	0.960000	0.944172	0.960000	1.000000																										0				27						c.(523-525)Gca>Aca		DEAD (Asp-Glu-Ala-Asp) box polypeptide 31		C	THR/ALA,THR/ALA	0,4406		0,0,2203	174.0	171.0	172.0		523,523	-7.7	0.0	9		172	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DDX31	NM_138620.1,NM_022779.7	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	175/586,175/852	135537950	1,13005	2203	4300	6503	SO:0001583	missense	64794	3	121412	39				g.chr9:135537950C>T	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.523G>A	chr9.hg19:g.135537950C>T	ENSP00000361232:p.Ala175Thr	0					DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000438527.3_Missense_Mutation_p.A46T|DDX31_ENST00000544003.1_Missense_Mutation_p.A79T|DDX31_ENST00000372153.1_Missense_Mutation_p.A175T|DDX31_ENST00000310532.2_Missense_Mutation_p.A175T	p.A175T	NM_022779.7	NP_073616.6	1	2	3	2.049767	Q9H8H2	DDX31_HUMAN		2	674	-			Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	1	1	hg19	c.523G>A	CCDS6951.1	1	.	.	.	.	.	.	.	.	.	.	c	3.149	-0.174630	0.06421	0.0	1.16E-4	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000438527;ENST00000310532;ENST00000544003	T;T;T;T;T	0.47869	4.37;3.92;4.34;3.5;0.83	5.6	-7.73	0.01245	5.6	-7.73	0.01245	.	1.174590	0.05861	N	0.622977	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B;B;B	0.23891	0.093;0.003;0.002	B;B;B	0.14578	0.011;0.003;0.0	T	0.18871	-1.0323	10	0.09843	T	0.71	0.329	0.3822	0.00396	0.2246:0.2316:0.2547:0.2891	.	175;175;175	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	T	175;175;175;46;175;79	ENSP00000361232:A175T;ENSP00000361226:A175T;ENSP00000387730:A46T;ENSP00000310539:A175T;ENSP00000442425:A79T	ENSP00000310539:A175T	A	-	1	0	0	DDX31	134527771	134527771	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.965000	0.03829	-0.997000	0.03450	-0.285000	0.09966	GCA	0.247227		TCGA-IB-7647-01A-11D-2154-08	0.428	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	1	0	1		2	2	2	0		0	0	95		95	94	1	1.920000	-20.000000	1	0.240000	NM_138620			85	85		660	650	1		1	1		0	0	95	0		1.000000	9.686397e-01	0	8	0	37	0	85	660
MAGEB16	139604	broad.mit.edu	37	X	35820358	35820358	+	Silent	SNP	C	C	T			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chrX:35820358C>T	ENST00000399989.1	+	2	324	c.45C>T	c.(43-45)caC>caT	p.H15H	MAGEB16_ENST00000399987.1_Silent_p.H15H|MAGEB16_ENST00000399992.1_Silent_p.H47H|MAGEB16_ENST00000399985.1_Silent_p.H15H|MAGEB16_ENST00000399988.1_Silent_p.H15H	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	15										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						ATGATCAGCACCTTCAGACCT	0.572																																						ENST00000399989.1	0.920000	0.450000	0.810000	0.550000	0.670000	0.688523	0.670000	0.670000																										0				31						c.(43-45)caC>caT		melanoma antigen family B, 16							50.0	52.0	51.0					X																	35820358		2113	4208	6321	SO:0001819	synonymous_variant	139604	0	0					g.chrX:35820358C>T		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.45C>T	chrX.hg19:g.35820358C>T							MAGEB16_ENST00000399988.1_Silent_p.H15H|MAGEB16_ENST00000399985.1_Silent_p.H15H|MAGEB16_ENST00000399987.1_Silent_p.H15H|MAGEB16_ENST00000399992.1_Silent_p.H47H	p.H15H	NM_001099921.1	NP_001093391.1	0	1	1		A2A368	MAGBG_HUMAN		2	324	+			A8MU30	Silent	SNP	ENST00000399989.1	1	1	hg19	c.45C>T	CCDS43927.1	0																																																																																								0.240000		TCGA-IB-7647-01A-11D-2154-08	0.572	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1	1	0	1		2	2	2	0		0	0	24		24	23	1	1.920000	-20.000000	1	0.240000				23	22		116	116	1		1			0	0	24	0		1.000000	0	0	0	0	0	0	23	116
CXorf22	170063	broad.mit.edu	37	X	35974224	35974224	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chrX:35974224G>A	ENST00000297866.5	+	8	1387	c.1321G>A	c.(1321-1323)Gaa>Aaa	p.E441K		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	441								p.E441K(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AAATCAATGCGAATTACTTCC	0.358																																						ENST00000297866.5	0.510000	0.220000	0.430000	0.280000	0.350000	0.362001	0.350000	0.350000																										2	Substitution - Missense(2)	p.E441K(2)	large_intestine(2)	44						c.(1321-1323)Gaa>Aaa		chromosome X open reading frame 22							69.0	63.0	65.0					X																	35974224		2202	4300	6502	SO:0001583	missense	170063	4	121408	33				g.chrX:35974224G>A	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1321G>A	chrX.hg19:g.35974224G>A	ENSP00000297866:p.Glu441Lys							p.E441K	NM_152632.3	NP_689845.2	0	1	1		Q6ZTR5	CX022_HUMAN		8	1387	+			Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	1	1	hg19	c.1321G>A	CCDS14237.2	0	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.057199	0.00390	.	.	ENSG00000165164	ENST00000297866	T	0.53640	0.61	5.2	-5.28	0.02755	5.2	-5.28	0.02755	.	1.251890	0.05007	N	0.470268	T	0.16257	0.0391	N	0.03324	-0.35	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.21999	-1.0229	10	0.05959	T	0.93	-31.1423	3.3027	0.06989	0.2448:0.3051:0.3491:0.101	.	441	Q6ZTR5	CX022_HUMAN	K	441	ENSP00000297866:E441K	ENSP00000297866:E441K	E	+	1	0	0	CXorf22	35884145	35884145	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.269000	0.08596	-0.677000	0.05231	-1.184000	0.01707	GAA	0.240000		TCGA-IB-7647-01A-11D-2154-08	0.358	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	1	0	1		2	2	2	0		0	0	47		47	47	1	1.920000	-8.067526	1	0.240000	NM_152632			21	21		227	226	0		1			0	0	47	0		0.999998	0	0	0	0	0	0	21	227
GPR112	139378	broad.mit.edu	37	X	135432097	135432097	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7647-01A-11D-2154-08	TCGA-IB-7647-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2579415-7e40-48ba-a59c-e5543b8097dc	fae3bedd-75e3-4f2a-86fa-c7e2c4dd4880	g.chrX:135432097G>C	ENST00000394143.1	+	6	6523	c.6232G>C	c.(6232-6234)Ggt>Cgt	p.G2078R	GPR112_ENST00000287534.4_Missense_Mutation_p.G2015R|GPR112_ENST00000394141.1_Missense_Mutation_p.G1873R|GPR112_ENST00000412101.1_Missense_Mutation_p.G1873R|GPR112_ENST00000370652.1_Missense_Mutation_p.G2078R	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2078					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACCTACACTGGGTGGTATCAC	0.468																																						ENST00000394143.1	0.360000	0.170000	0.310000	0.200000	0.250000	0.263339	0.250000	0.250000																										0				199						c.(6232-6234)Ggt>Cgt		G protein-coupled receptor 112							257.0	190.0	212.0					X																	135432097		2203	4300	6503	SO:0001583	missense	139378	0	0					g.chrX:135432097G>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6232G>C	chrX.hg19:g.135432097G>C	ENSP00000377699:p.Gly2078Arg						GPR112_ENST00000412101.1_Missense_Mutation_p.G1873R|GPR112_ENST00000370652.1_Missense_Mutation_p.G2078R|GPR112_ENST00000394141.1_Missense_Mutation_p.G1873R|GPR112_ENST00000287534.4_Missense_Mutation_p.G2015R	p.G2078R	NM_153834.3	NP_722576.3	0	1	1		Q8IZF6	GP112_HUMAN		6	6523	+	Acute lymphoblastic leukemia(192;0.000127)		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	1	1	hg19	c.6232G>C	CCDS35409.1	0	.	.	.	.	.	.	.	.	.	.	g	13.55	2.270870	0.40194	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.30981	1.55;1.55;1.51;1.54;1.51	4.04	2.04	0.26737	4.04	2.04	0.26737	.	.	.	.	.	T	0.32346	0.0826	L	0.29908	0.895	0.09310	N	1	D;P;D	0.64830	0.982;0.926;0.994	P;P;P	0.59221	0.763;0.45;0.854	T	0.09907	-1.0653	9	0.59425	D	0.04	.	3.828	0.08863	0.1358:0.0:0.6268:0.2374	.	2015;1873;2078	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	R	2078;2078;1873;2015;1873	ENSP00000377699:G2078R;ENSP00000359686:G2078R;ENSP00000416526:G1873R;ENSP00000287534:G2015R;ENSP00000377697:G1873R	ENSP00000287534:G2015R	G	+	1	0	0	GPR112	135259763	135259763	0.000000	0.05858	0.001000	0.08648	0.135000	0.20990	-0.243000	0.08915	0.646000	0.30693	0.509000	0.49947	GGT	0.240000		TCGA-IB-7647-01A-11D-2154-08	0.468	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1	1	0	1		2	2	2	0		0	0	60		60	59	1	1.920000	-2.598543	1	0.240000				26	26		396	388	0		1			0	0	60	0		1.000000	0	0	0	0	0	0	26	396
