#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CTSB	1508	broad.mit.edu	37	8	11705590	11705591	+	Frame_Shift_Ins	INS	-	-	A	rs374459060		TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			-	A	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr8:11705590_11705591insA	ENST00000353047.6	-	6	770_771	c.517_518insT	c.(517-519)tatfs	p.Y173fs	CTSB_ENST00000530640.2_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000345125.3_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000533455.1_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000531089.1_Frame_Shift_Ins_p.Y173fs|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000525076.1_5'Flank|CTSB_ENST00000453527.2_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000434271.1_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000415599.2_3'UTR|CTSB_ENST00000534510.1_Frame_Shift_Ins_p.Y173fs	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	173					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		ATGGGATTCATAGAGGCCACCA	0.45																																						ENST00000353047.6	0.860000	0.540000	7.800000e-01	6.100000e-01	0.690000	0.704933	0.690000	0.700000																										0				16						c.(517-519)tatfs		cathepsin B																																				SO:0001589	frameshift_variant	1508	0	0					g.chr8:11705590_11705591insA	M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.518dupT	chr8.hg19:g.11705591_11705591dupA	ENSP00000345672:p.Tyr173fs	1					CTSB_ENST00000534510.1_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000453527.2_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000533455.1_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000530640.2_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000415599.2_3'UTR|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000525076.1_5'Flank|CTSB_ENST00000531089.1_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000345125.3_Frame_Shift_Ins_p.Y173fs|CTSB_ENST00000434271.1_Frame_Shift_Ins_p.Y173fs	p.Y173fs	NM_001908.3	NP_001899.1	0	1	1	1.802685	P07858	CATB_HUMAN	STAD - Stomach adenocarcinoma(15;0.00546)	6	770_771	-	all_epithelial(15;0.205)		B3KQR5|B3KRR5|Q503A6|Q96D87	Frame_Shift_Ins	INS	ENST00000353047.6	0	1	hg19	c.517_518insT	CCDS5986.1	0																																																																																								0.156069		TCGA-IB-7887-01A-11D-2154-08	0.450	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207586.3	1	0	1		2	2		0	0	0	0	111	0	111	111	1	1.780000	-19.974620	1	0.270000	NM_147780		0	62	63	0	503	499	0	0	1	0	0	0	0	111	0	0	1.000000	1	0	1	0	1387	0	62	503
DCHS1	8642	broad.mit.edu	37	11	6662161	6662161	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr11:6662161A>C	ENST00000299441.3	-	2	1095	c.684T>G	c.(682-684)taT>taG	p.Y228*		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	228	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AACCACCATCATAGGCCTCCA	0.602																																						ENST00000299441.3	1.000000	0.840000	9.900000e-01	9.000000e-01	0.950000	0.950780	0.950000	0.990000																										0				103						c.(682-684)taT>taG		dachsous cadherin-related 1							111.0	106.0	108.0					11																	6662161		2201	4296	6497	SO:0001587	stop_gained	8642	0	0					g.chr11:6662161A>C	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.684T>G	chr11.hg19:g.6662161A>C	ENSP00000299441:p.Tyr228*	1						p.Y228*	NM_003737.2	NP_003728.1	0	1	1	1.779903	Q96JQ0	PCD16_HUMAN		2	1095	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	O15098	Nonsense_Mutation	SNP	ENST00000299441.3	0	1	hg19	c.684T>G	CCDS7771.1	1	.	.	.	.	.	.	.	.	.	.	A	37	6.418677	0.97550	.	.	ENSG00000166341	ENST00000299441	.	.	.	4.18	-1.56	0.08532	4.18	-1.56	0.08532	.	0.000000	0.42294	D	0.000731	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.368	0.44035	0.6186:0.0:0.3814:0.0	.	.	.	.	X	228	.	ENSP00000299441:Y228X	Y	-	3	2	2	DCHS1	6618737	6618737	0.966000	0.33281	0.995000	0.50966	0.991000	0.79684	0.258000	0.18387	-0.379000	0.07906	0.445000	0.29226	TAT	0.156069		TCGA-IB-7887-01A-11D-2154-08	0.602	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	1	0	1	2	2	2	2	0	0	0	0	114	114	114	114	1	1.780000	-20.000000	1	0.270000	NM_003737		0	111	109	0	559	552	1		1	0		0	0	114	0	0	1.000000	5.675710e-01	0	0	0	11	0	111	559
FOXJ2	55810	broad.mit.edu	37	12	8205432	8205432	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr12:8205432G>C	ENST00000162391.3	+	11	2856	c.1711G>C	c.(1711-1713)Gac>Cac	p.D571H	FOXJ2_ENST00000539192.1_3'UTR	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	571					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		CTTCGACTGGGACTTGATCAC	0.552																																						ENST00000162391.3	1.000000	0.190000	1	3.100000e-01	0.490000	0.566397	0.490000	0.410000																										0				16						c.(1711-1713)Gac>Cac		forkhead box J2							82.0	60.0	67.0					12																	8205432		2203	4300	6503	SO:0001583	missense	55810	0	0					g.chr12:8205432G>C	AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1711G>C	chr12.hg19:g.8205432G>C	ENSP00000162391:p.Asp571His	1					FOXJ2_ENST00000539192.1_3'UTR	p.D571H	NM_018416.2	NP_060886.1	2	2	4	2.194364	Q9P0K8	FOXJ2_HUMAN		11	2856	+			A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	ENST00000162391.3	0	1	hg19	c.1711G>C	CCDS8587.1	0	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637902	0.87760	.	.	ENSG00000065970	ENST00000162391	D	0.99311	-5.73	5.85	5.85	0.93711	5.85	5.85	0.93711	.	0.244803	0.28724	N	0.014344	D	0.99254	0.9740	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.99819	1.1046	10	0.87932	D	0	.	17.6544	0.88174	0.0:0.0:1.0:0.0	.	571	Q9P0K8	FOXJ2_HUMAN	H	571	ENSP00000162391:D571H	ENSP00000162391:D571H	D	+	1	0	0	FOXJ2	8096699	8096699	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.918000	0.75788	2.772000	0.95346	0.650000	0.86243	GAC	0.316159		TCGA-IB-7887-01A-11D-2154-08	0.552	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.780000	-9.940343	1	0.270000	NM_018416		0	6	6	0	107	99	0		1	1		0	0	20	0	0	0.957759	4.390966e-01	0	7	0	18	0	6	107
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.680000	1	8.600000e-01	0.990000	0.952741	0.990000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	2	2	4	2.192614	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.314425		TCGA-IB-7887-01A-11D-2154-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	627	18	6	2	1	1	1	1	23	23	23	23	1	1.780000	-11.314890	1	0.270000	NM_033360		653	20	20	7363	132	128	0	1	1	1	1	1	0	23	447	9.910251e-01	0.659073	1.691198e-01	1	9	62	18	365	20	132
SACS	26278	broad.mit.edu	37	13	23906194	23906194	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr13:23906194G>A	ENST00000382292.3	-	9	12094	c.11821C>T	c.(11821-11823)Caa>Taa	p.Q3941*	SACS_ENST00000402364.1_Nonsense_Mutation_p.Q3191*|SACS_ENST00000382298.3_Nonsense_Mutation_p.Q3941*			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3941					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACTAACATTTGCACACCAATA	0.403																																						ENST00000382292.3	1.000000	0.660000	9.100000e-01	7.300000e-01	0.810000	0.824706	0.810000	0.820000																										0				189						c.(11821-11823)Caa>Taa		sacsin molecular chaperone							127.0	117.0	120.0					13																	23906194		2203	4300	6503	SO:0001587	stop_gained	26278	0	0					g.chr13:23906194G>A	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11821C>T	chr13.hg19:g.23906194G>A	ENSP00000371729:p.Gln3941*	0					SACS_ENST00000402364.1_Nonsense_Mutation_p.Q3191*|SACS_ENST00000382298.3_Nonsense_Mutation_p.Q3941*	p.Q3941*			1	2	3	2.062589	Q9NZJ4	SACS_HUMAN		9	12094	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Nonsense_Mutation	SNP	ENST00000382292.3	0	1	hg19	c.11821C>T	CCDS9300.2	0	.	.	.	.	.	.	.	.	.	.	G	58	33.524865	0.99981	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	.	.	.	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.053109	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	20.1013	0.97878	0.0:0.0:1.0:0.0	.	.	.	.	X	3941;3191;3941	.	ENSP00000371729:Q3941X	Q	-	1	0	0	SACS	22804194	22804194	1.000000	0.71417	0.990000	0.47175	0.948000	0.59901	9.865000	0.99609	2.748000	0.94277	0.655000	0.94253	CAA	0.270984		TCGA-IB-7887-01A-11D-2154-08	0.403	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	1	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	1.780000	-20.000000	1	0.270000	NM_014363		0	85	85	0	683	669	0		1	1		0	0	102	0	0	1.000000	5.443034e-01	0	2	0	14	0	85	683
POTEG	404785	broad.mit.edu	37	14	19553582	19553582	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr14:19553582A>T	ENST00000409832.3	+	1	218	c.166A>T	c.(166-168)Aca>Tca	p.T56S		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	56										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TGCTATGAAGACACTCAGGAG	0.617																																						ENST00000409832.3			0	0																														0				47						c.(166-168)Aca>Tca		POTE ankyrin domain family, member G							109.0	151.0	137.0					14																	19553582		2198	4286	6484	SO:0001583	missense	404785	0	0					g.chr14:19553582A>T		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.166A>T	chr14.hg19:g.19553582A>T	ENSP00000386971:p.Thr56Ser							p.T56S	NM_001005356.2	NP_001005356.1					Q6S5H5	POTEG_HUMAN		1	218	+			A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	1	1	hg19	c.166A>T	CCDS32018.1		.	.	.	.	.	.	.	.	.	.	a	10.49	1.364135	0.24684	.	.	ENSG00000222036	ENST00000409832	T	0.29397	1.57	.	.	.	.	.	.	.	.	.	.	.	T	0.23727	0.0574	L	0.43152	1.355	0.09310	N	1	P	0.35745	0.518	B	0.36418	0.224	T	0.17745	-1.0359	7	0.56958	D	0.05	.	.	.	.	.	56	Q6S5H5	POTEG_HUMAN	S	56	ENSP00000386971:T56S	ENSP00000386971:T56S	T	+	1	0	0	POTEG	18623582	18623582	0.003000	0.15002	0.006000	0.13384	0.006000	0.05464	0.468000	0.22051	0.141000	0.18875	0.139000	0.15985	ACA			TCGA-IB-7887-01A-11D-2154-08	0.617	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	0	0	1	2	2	2	2	0	0	0	0	550	550	550	808	1	1.780000	-3.191071	1	0.270000	NM_001005356		0	97	53	0	3062	1800	0		1			0	0	550	0	0	1.000000	0	0	0	0	0	0	97	3062
FAM179B	23116	broad.mit.edu	37	14	45473306	45473306	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr14:45473306T>C	ENST00000361577.3	+	4	2595	c.2381T>C	c.(2380-2382)tTt>tCt	p.F794S	FAM179B_ENST00000382233.2_Missense_Mutation_p.F794S|KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Missense_Mutation_p.F794S	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	794										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CAGCAAACATTTGGTAGTCAA	0.363																																						ENST00000361577.3	1.000000	0.920000	1	9.900000e-01	0.990000	0.995573	0.990000	1.000000																										0				45						c.(2380-2382)tTt>tCt		family with sequence similarity 179, member B							89.0	77.0	81.0					14																	45473306		2203	4300	6503	SO:0001583	missense	23116	0	0					g.chr14:45473306T>C	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2381T>C	chr14.hg19:g.45473306T>C	ENSP00000355045:p.Phe794Ser	0					FAM179B_ENST00000382233.2_Missense_Mutation_p.F794S|KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Missense_Mutation_p.F794S	p.F794S	NM_015091.2	NP_055906.2	0	1	1	2.054966	Q9Y4F4	F179B_HUMAN		4	2595	+			Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	1	1	hg19	c.2381T>C	CCDS9681.1	1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.798217	0.70567	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233;ENST00000555874	T;T;T;T	0.13538	2.58;2.58;4.05;4.05	5.56	4.4	0.53042	5.56	4.4	0.53042	Armadillo-type fold (1);	0.352636	0.27253	N	0.020216	T	0.17916	0.0430	N	0.24115	0.695	0.27467	N	0.952969	P;D;D	0.62365	0.567;0.974;0.991	B;P;P	0.56563	0.175;0.57;0.801	T	0.02901	-1.1096	10	0.87932	D	0	-10.7199	11.2492	0.49015	0.0:0.0:0.1532:0.8468	.	794;794;794	G3XAE9;Q9Y4F4;Q9Y4F4-2	.;F179B_HUMAN;.	S	794;794;794;794;113	ENSP00000355045:F794S;ENSP00000354917:F794S;ENSP00000371668:F794S;ENSP00000451141:F113S	ENSP00000354917:F794S	F	+	2	0	0	FAM179B	44543056	44543056	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.528000	0.53524	0.916000	0.36871	0.460000	0.39030	TTT	0.268024		TCGA-IB-7887-01A-11D-2154-08	0.363	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	1	0	1	2	2	2	2	0	0	0	0	27	27	27	26	1	1.780000	-20.000000	1	0.270000	XM_113781		0	51	51	0	260	254	1		1	1		0	0	27	0	0	1.000000	8.931436e-01	0	8	0	14	0	51	260
VAC14	55697	broad.mit.edu	37	16	70726807	70726807	+	Silent	SNP	G	G	A	rs371620220		TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr16:70726807G>A	ENST00000261776.5	-	18	2363	c.2103C>T	c.(2101-2103)ctC>ctT	p.L701L	VAC14_ENST00000571759.1_5'Flank|VAC14_ENST00000536184.2_Silent_p.L133L	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	701					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GCAGGAGCATGAGCAGGCCGT	0.662																																						ENST00000261776.5	1.000000	0.640000	1	8.200000e-01	0.990000	0.937106	0.990000	1.000000																										0				33						c.(2101-2103)ctC>ctT		Vac14 homolog (S. cerevisiae)		G		0,4394		0,0,2197	50.0	50.0	50.0		2103	4.3	1.0	16		50	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	VAC14	NM_018052.3		0,1,6495	AA,AG,GG		0.0116,0.0,0.0077		701/783	70726807	1,12991	2197	4299	6496	SO:0001819	synonymous_variant	55697	3	120788	30				g.chr16:70726807G>A	AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.2103C>T	chr16.hg19:g.70726807G>A		0					VAC14_ENST00000571759.1_5'Flank|VAC14_ENST00000536184.2_Silent_p.L133L	p.L701L	NM_018052.3	NP_060522.3	0	1	1	2.059000	Q08AM6	VAC14_HUMAN		18	2363	-		Ovarian(137;0.0699)	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Silent	SNP	ENST00000261776.5	0	1	hg19	c.2103C>T	CCDS10896.1	1																																																																																								0.269013		TCGA-IB-7887-01A-11D-2154-08	0.662	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268973.3	1	0	1	2	2	2	2	0	0	0	0	10	10	10	9	1	1.780000	-20.000000	1	0.270000	NM_018052		0	16	16	0	97	93	1		1	1		0	0	10	0	0	0.999941	9.999064e-01	0	46	0	56	0	16	97
TP53	7157	broad.mit.edu	37	17	7578206	7578206	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr17:7578206T>C	ENST00000269305.4	-	6	832	c.643A>G	c.(643-645)Agt>Ggt	p.S215G	TP53_ENST00000420246.2_Missense_Mutation_p.S215G|TP53_ENST00000413465.2_Missense_Mutation_p.S215G|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.S215G|TP53_ENST00000455263.2_Missense_Mutation_p.S215G|TP53_ENST00000445888.2_Missense_Mutation_p.S215G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S215G(6)|p.?(5)|p.S215C(5)|p.H214fs*5(2)|p.S215R(2)|p.D208fs*1(1)|p.R213_S215>X(1)|p.S215fs*32(1)|p.R209fs*6(1)|p.T211fs*28(1)|p.S215fs*31(1)|p.D207_V216del10(1)|p.S215fs*27(1)|p.H214fs*7(1)|p.R213fs*32(1)|p.T211_S215delTFRHS(1)|p.H214_S215insX(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACCACCACACTATGTCGAAAA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.990000	0.630000	9.500000e-01	7.400000e-01	0.850000	0.851546	0.850000	0.890000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		43	Substitution - Missense(13)|Deletion - Frameshift(11)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(4)|Insertion - In frame(1)|Complex - deletion inframe(1)	p.0?(8)|p.S215G(6)|p.?(5)|p.S215C(5)|p.H214fs*5(2)|p.S215R(2)|p.D208fs*1(1)|p.R213_S215>X(1)|p.S215fs*32(1)|p.R209fs*6(1)|p.T211fs*28(1)|p.S215fs*31(1)|p.D207_V216del10(1)|p.S215fs*27(1)|p.H214fs*7(1)|p.R213fs*32(1)|p.T211_S215delTFRHS(1)|p.H214_S215insX(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)	ovary(6)|biliary_tract(5)|bone(5)|stomach(4)|oesophagus(4)|breast(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|urinary_tract(1)|liver(1)|skin(1)	24185						c.(643-645)Agt>Ggt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						125.0	112.0	116.0					17																	7578206		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578206T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.643A>G	chr17.hg19:g.7578206T>C	ENSP00000269305:p.Ser215Gly	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.S215G|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.S215G|TP53_ENST00000420246.2_Missense_Mutation_p.S215G|TP53_ENST00000359597.4_Missense_Mutation_p.S215G|TP53_ENST00000413465.2_Missense_Mutation_p.S215G	p.S215G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.788086	P04637	P53_HUMAN		6	832	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.643A>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274381	0.80580	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99851	-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17	5.28	4.18	0.49190	5.28	4.18	0.49190	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90705	3.14	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.995;1.0;0.98;0.996;1.0;1.0;0.999	D	0.97163	0.9839	10	0.87932	D	0	-18.3023	10.6958	0.45899	0.0:0.0:0.1605:0.8394	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215G;ENSP00000352610:S215G;ENSP00000269305:S215G;ENSP00000398846:S215G;ENSP00000391127:S215G;ENSP00000391478:S215G;ENSP00000425104:S83G;ENSP00000423862:S122G	ENSP00000269305:S215G	S	-	1	0	0	TP53	7518931	7518931	1.000000	0.71417	0.471000	0.27229	0.962000	0.63368	6.146000	0.71777	0.919000	0.36945	0.460000	0.39030	AGT	0.156069		TCGA-IB-7887-01A-11D-2154-08	0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.780000	-20.000000	1	0.270000	NM_000546		0	36	35	0	217	208	1		1	1	1	0	0	42	1530	0	1.000000	9.999603e-01	1	64	134	32	654	36	217
KRT31	3881	broad.mit.edu	37	17	39551782	39551782	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr17:39551782T>C	ENST00000251645.2	-	4	734	c.682A>G	c.(682-684)Acc>Gcc	p.T228A		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	228	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				TGACTCCTGGTCTCGTTCAGC	0.597																																						ENST00000251645.2	1.000000	0.800000	1	8.900000e-01	0.990000	0.959288	0.990000	1.000000																										0				31						c.(682-684)Acc>Gcc		keratin 31							103.0	91.0	95.0					17																	39551782		2203	4300	6503	SO:0001583	missense	3881	0	0					g.chr17:39551782T>C	X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.682A>G	chr17.hg19:g.39551782T>C	ENSP00000251645:p.Thr228Ala	0						p.T228A	NM_002277.2	NP_002268.2	0	0	0	2.045882	Q15323	K1H1_HUMAN		4	734	-		Breast(137;0.000496)	Q9UE12	Missense_Mutation	SNP	ENST00000251645.2	1	1	hg19	c.682A>G	CCDS11391.1	1	.	.	.	.	.	.	.	.	.	.	t	13.06	2.125541	0.37533	.	.	ENSG00000094796	ENST00000251645	D	0.88586	-2.4	5.4	4.33	0.51752	5.4	4.33	0.51752	Filament (1);	0.180058	0.39759	N	0.001269	D	0.86764	0.6011	L	0.50333	1.59	0.31092	N	0.710708	B	0.22604	0.072	B	0.32980	0.156	D	0.84831	0.0802	10	0.87932	D	0	.	10.2699	0.43477	0.0:0.0774:0.0:0.9226	.	228	Q15323	K1H1_HUMAN	A	228	ENSP00000251645:T228A	ENSP00000251645:T228A	T	-	1	0	0	KRT31	36805308	36805308	0.978000	0.34361	0.998000	0.56505	0.529000	0.34654	1.848000	0.39309	0.888000	0.36160	0.460000	0.39030	ACC	0.262030		TCGA-IB-7887-01A-11D-2154-08	0.597	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	1.780000	-20.000000	1	0.270000	NM_002277		0	83	82	0	528	514	1		1			0	0	88	0	0	1.000000	0	0	0	0	0	0	83	528
UNC13A	23025	broad.mit.edu	37	19	17760372	17760372	+	Silent	SNP	G	G	A	rs551065041		TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr19:17760372G>A	ENST00000519716.2	-	13	1463	c.1464C>T	c.(1462-1464)atC>atT	p.I488I	UNC13A_ENST00000551649.1_Silent_p.I488I|UNC13A_ENST00000252773.7_Silent_p.I488I|UNC13A_ENST00000550896.1_Silent_p.I488I|UNC13A_ENST00000428389.2_Silent_p.I576I|UNC13A_ENST00000552293.1_Silent_p.I488I	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	488					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.I488I(1)|p.I576I(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GCATGCTGTCGATGATGATGA	0.567																																						ENST00000519716.2	1.000000	0.720000	9.900000e-01	8.000000e-01	0.890000	0.894076	0.890000	1.000000																										2	Substitution - coding silent(2)	p.I488I(1)|p.I576I(1)	kidney(2)	61						c.(1462-1464)atC>atT		unc-13 homolog A (C. elegans)							147.0	152.0	150.0					19																	17760372		2107	4228	6335	SO:0001819	synonymous_variant	23025	0	0					g.chr19:17760372G>A	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1464C>T	chr19.hg19:g.17760372G>A		0					UNC13A_ENST00000551649.1_Silent_p.I488I|UNC13A_ENST00000252773.7_Silent_p.I488I|UNC13A_ENST00000552293.1_Silent_p.I488I|UNC13A_ENST00000550896.1_Silent_p.I488I|UNC13A_ENST00000428389.2_Silent_p.I576I	p.I488I	NM_001080421.2	NP_001073890.2	0	0	0	2.033670	Q9UPW8	UN13A_HUMAN		13	1463	-			E5RHY9	Silent	SNP	ENST00000519716.2	1	1	hg19	c.1464C>T	CCDS46013.2	1																																																																																								0.257979		TCGA-IB-7887-01A-11D-2154-08	0.567	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	1	0	1	2	19	2	2	1	1	1	1	119	119	119	118	1	1.780000	-20.000000	1	0.270000	XM_038604		0	82	81	0	584	575	1		1			1	0	119	0	0	1.000000	0	0	0	0	0	0	82	584
FBN3	84467	broad.mit.edu	37	19	8130859	8130859	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr19:8130859G>A	ENST00000600128.1	-	64	8788	c.8374C>T	c.(8374-8376)Cag>Tag	p.Q2792*	FBN3_ENST00000270509.2_Nonsense_Mutation_p.Q2792*|FBN3_ENST00000601739.1_Nonsense_Mutation_p.Q2792*			Q75N90	FBN3_HUMAN	fibrillin 3	2792						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGCCCTGGCTGCCCCTCTGGC	0.687																																						ENST00000600128.1	1.000000	0.670000	1	7.700000e-01	0.890000	0.892067	0.890000	1.000000																										0				132						c.(8374-8376)Cag>Tag		fibrillin 3							29.0	31.0	31.0					19																	8130859		2200	4296	6496	SO:0001587	stop_gained	84467	0	0					g.chr19:8130859G>A		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.8374C>T	chr19.hg19:g.8130859G>A	ENSP00000470498:p.Gln2792*	0					FBN3_ENST00000601739.1_Nonsense_Mutation_p.Q2792*|FBN3_ENST00000270509.2_Nonsense_Mutation_p.Q2792*	p.Q2792*			0	0	0	2.045320	Q75N90	FBN3_HUMAN		64	8788	-			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Nonsense_Mutation	SNP	ENST00000600128.1	0	1	hg19	c.8374C>T	CCDS12196.1	1	.	.	.	.	.	.	.	.	.	.	G	48	14.127981	0.99781	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	.	.	.	3.83	-4.06	0.03986	3.83	-4.06	0.03986	.	0.602780	0.16277	U	0.221518	.	.	.	.	.	.	0.37599	D	0.920499	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	9.7216	0.40306	0.5538:0.0:0.4462:0.0	.	.	.	.	X	2792;855	.	ENSP00000270509:Q2792X	Q	-	1	0	0	FBN3	8036859	8036859	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.106000	0.15354	-0.844000	0.04184	-0.768000	0.03414	CAG	0.262030		TCGA-IB-7887-01A-11D-2154-08	0.687	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	1.780000	-20.000000	1	0.270000	NM_032447		0	44	43	0	313	303	1		1			0	0	61	0	0	1.000000	0	0	0	0	0	0	44	313
MBOAT7	79143	broad.mit.edu	37	19	54691118	54691118	+	Silent	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr19:54691118G>A	ENST00000245615.1	-	4	738	c.258C>T	c.(256-258)ttC>ttT	p.F86F	MBOAT7_ENST00000431666.2_Intron|MBOAT7_ENST00000391754.1_Silent_p.F86F|MBOAT7_ENST00000474910.1_5'UTR|MBOAT7_ENST00000338624.6_Intron	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	86					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGAGGGCTCGGAAGAACAGGA	0.642																																					NSCLC(97;826 2151 10470 22540)	ENST00000245615.1	1.000000	0.610000	1	8.200000e-01	0.990000	0.936127	0.990000	1.000000																										0				10						c.(256-258)ttC>ttT		membrane bound O-acyltransferase domain containing 7							57.0	60.0	59.0					19																	54691118		2195	4298	6493	SO:0001819	synonymous_variant	79143	0	0					g.chr19:54691118G>A	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.258C>T	chr19.hg19:g.54691118G>A		0					MBOAT7_ENST00000338624.6_Intron|MBOAT7_ENST00000391754.1_Silent_p.F86F|MBOAT7_ENST00000431666.2_Intron|MBOAT7_ENST00000474910.1_5'UTR	p.F86F	NM_024298.3	NP_077274.3	0	1	1	2.058955	Q96N66	MBOA7_HUMAN		4	738	-	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Silent	SNP	ENST00000245615.1	0	1	hg19	c.258C>T	CCDS12883.1	1																																																																																								0.269013		TCGA-IB-7887-01A-11D-2154-08	0.642	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	1	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	1.780000	-19.995520	1	0.270000	NM_024298		0	13	12	0	77	69	0		1	1		0	0	11	0	0	0.999339	9.999996e-01	0	66	0	137	0	13	77
FLG	2312	broad.mit.edu	37	1	152277769	152277769	+	Missense_Mutation	SNP	A	A	C	rs143183339		TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr1:152277769A>C	ENST00000368799.1	-	3	9628	c.9593T>G	c.(9592-9594)gTc>gGc	p.V3198G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3198	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCCCTGGACTGCCTGTGA	0.552									Ichthyosis																													ENST00000368799.1	1.000000	0.840000	1	9.000000e-01	0.960000	0.956658	0.960000	1.000000																										0				424						c.(9592-9594)gTc>gGc		filaggrin		C	GLY/VAL	2,4404	823.4+/-416.5	0,2,2201	124.0	147.0	139.0		9593	-1.8	0.0	1	dbSNP_134	139	0,8592		0,0,4296	no	missense	FLG	NM_002016.1	109	0,2,6497	CC,CA,AA		0.0,0.0454,0.0154	benign	3198/4062	152277769	2,12996	2203	4296	6499	SO:0001583	missense	2312	17	121402	46	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152277769A>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9593T>G	chr1.hg19:g.152277769A>C	ENSP00000357789:p.Val3198Gly	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.V3198G	NM_002016.1	NP_002007.1	0	0	0	2.052197	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	9628	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	1	1	hg19	c.9593T>G	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	1.935	-0.444964	0.04604	4.54E-4	0.0	ENSG00000143631	ENST00000368799	T	0.01963	4.53	1.93	-1.78	0.07957	1.93	-1.78	0.07957	.	.	.	.	.	T	0.00144	0.0004	N	0.00347	-1.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32402	-0.9908	9	0.10636	T	0.68	.	0.4443	0.00491	0.198:0.336:0.196:0.27	.	3198	P20930	FILA_HUMAN	G	3198	ENSP00000357789:V3198G	ENSP00000357789:V3198G	V	-	2	0	0	FLG	150544393	150544393	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.291000	0.08343	-0.950000	0.03659	-0.383000	0.06682	GTC	0.266037		TCGA-IB-7887-01A-11D-2154-08	0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	1	0	1	2	2	2	2	0	0	0	0	242	242	242	333	1	1.780000	-20.000000	1	0.270000	NM_002016		0	209	194	0	1382	1276	0		1			0	0	242	0	0	1.000000	0	0	0	0	0	0	209	1382
OR10K2	391107	broad.mit.edu	37	1	158390039	158390039	+	Silent	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr1:158390039G>A	ENST00000314902.2	-	1	617	c.618C>T	c.(616-618)gtC>gtT	p.V206V		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GGATAGCCAGGACCAATGTAC	0.443																																						ENST00000314902.2	0.970000	0.560000	8.700000e-01	6.500000e-01	0.750000	0.767868	0.750000	0.760000																										0				36						c.(616-618)gtC>gtT		olfactory receptor, family 10, subfamily K, member 2							145.0	131.0	135.0					1																	158390039		2203	4300	6503	SO:0001819	synonymous_variant	391107	0	0					g.chr1:158390039G>A	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.618C>T	chr1.hg19:g.158390039G>A		0						p.V206V	NM_001004476.1	NP_001004476.1	0	0	0	2.052197	Q6IF99	O10K2_HUMAN		1	617	-	all_hematologic(112;0.0378)			Silent	SNP	ENST00000314902.2	1	1	hg19	c.618C>T	CCDS30896.1	0																																																																																								0.266037		TCGA-IB-7887-01A-11D-2154-08	0.443	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	1.780000	-20.000000	1	0.270000	NM_001004476		0	45	45	0	391	376	1		1			0	0	75	0	0	1.000000	0	0	0	0	0	0	45	391
TAF5L	27097	broad.mit.edu	37	1	229730411	229730411	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr1:229730411C>T	ENST00000366676.1	-	4	1402	c.1403G>A	c.(1402-1404)cGt>cAt	p.R468H	TAF5L_ENST00000258281.2_Missense_Mutation_p.R468H			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	468					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R468P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				CACGGGGCCACGGTGGCCTGT	0.607																																						ENST00000366676.1	0.600000	0.350000	5.400000e-01	4.100000e-01	0.470000	0.479382	0.470000	0.470000																										1	Substitution - Missense(1)	p.R468P(1)	lung(1)	11						c.(1402-1404)cGt>cAt		TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa							76.0	81.0	79.0					1																	229730411		2203	4300	6503	SO:0001583	missense	27097	0	0					g.chr1:229730411C>T	AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.1403G>A	chr1.hg19:g.229730411C>T	ENSP00000355636:p.Arg468His	0					TAF5L_ENST00000258281.2_Missense_Mutation_p.R468H	p.R468H			0	1	1	2.057782	O75529	TAF5L_HUMAN		4	1402	-	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	ENST00000366676.1	1	1	hg19	c.1403G>A	CCDS1581.1	0	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987862	0.35036	.	.	ENSG00000135801	ENST00000366676;ENST00000258281	T;T	0.60548	0.18;0.18	5.97	5.06	0.68205	5.97	5.06	0.68205	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047962	0.85682	D	0.000000	T	0.45935	0.1367	N	0.21097	0.63	0.80722	D	1	B	0.15473	0.013	B	0.10450	0.005	T	0.37407	-0.9707	10	0.54805	T	0.06	-7.1912	15.1546	0.72730	0.0:0.9326:0.0:0.0674	.	468	O75529	TAF5L_HUMAN	H	468	ENSP00000355636:R468H;ENSP00000258281:R468H	ENSP00000258281:R468H	R	-	2	0	0	TAF5L	227797034	227797034	1.000000	0.71417	0.921000	0.36526	0.013000	0.08279	7.785000	0.85724	1.537000	0.49254	0.655000	0.94253	CGT	0.268024		TCGA-IB-7887-01A-11D-2154-08	0.607	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095229.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.780000	-9.415912	1	0.270000	NM_014409		0	52	52	0	760	752	1		1	1		0	0	107	0	0	1.000000	8.652265e-01	0	10	0	44	0	52	760
RRAGC	64121	broad.mit.edu	37	1	39305328	39305328	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr1:39305328A>C	ENST00000373001.3	-	7	1273	c.1097T>G	c.(1096-1098)gTt>gGt	p.V366G	RRAGC_ENST00000474456.1_5'UTR	NM_022157.2	NP_071440.1			Ras-related GTP binding C											endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)	10	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				CACCTCAAAAACCTCATGAAT	0.458																																						ENST00000373001.3	0.450000	0.150000	3.500000e-01	2.000000e-01	0.270000	0.286871	0.270000	0.260000																										0				10						c.(1096-1098)gTt>gGt		Ras-related GTP binding C							125.0	113.0	117.0					1																	39305328		2203	4300	6503	SO:0001583	missense	64121	0	0					g.chr1:39305328A>C	AF323609	CCDS430.1	1p34	2008-02-05			ENSG00000116954	ENSG00000116954			19902	protein-coding gene	gene with protein product		608267				11073942	Standard	NM_022157		Approved	GTR2, FLJ13311	uc001ccq.3	Q9HB90	OTTHUMG00000000490	ENST00000373001.3:c.1097T>G	chr1.hg19:g.39305328A>C	ENSP00000362092:p.Val366Gly	0					RRAGC_ENST00000474456.1_5'UTR	p.V366G	NM_022157.2	NP_071440.1	1	2	3	2.067602				7	1273	-	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)		Missense_Mutation	SNP	ENST00000373001.3	0	1	hg19	c.1097T>G	CCDS430.1	0	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082251	0.76528	.	.	ENSG00000116954	ENST00000373001	.	.	.	5.85	5.85	0.93711	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.85013	0.5600	M	0.90309	3.105	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.76071	0.987;0.944;0.979	D	0.87774	0.2607	9	0.62326	D	0.03	-33.3787	16.2355	0.82371	1.0:0.0:0.0:0.0	.	332;300;366	E7ENI3;D3DPT8;Q9HB90	.;.;RRAGC_HUMAN	G	366	.	ENSP00000362092:V366G	V	-	2	0	0	RRAGC	39077915	39077915	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.238000	0.73509	0.533000	0.62120	GTT	0.271966		TCGA-IB-7887-01A-11D-2154-08	0.458	RRAGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001222.2	0	0	1	2	25	10	2	1	1	1	1	49	49	49	49	1	1.780000	-15.126710	1	0.270000	NM_022157		0	15	15	0	405	398	0		0	0		1	0	49	0	0	0.063780	3.517657e-02	0	0	0	123	0	15	405
ZYG11B	79699	broad.mit.edu	37	1	53287249	53287249	+	Missense_Mutation	SNP	G	G	A	rs151077871		TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr1:53287249G>A	ENST00000294353.6	+	14	2328	c.2183G>A	c.(2182-2184)cGc>cAc	p.R728H	ZYG11B_ENST00000443756.2_Missense_Mutation_p.R658H	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	728										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						CACATTGTGCGCCATGGGAGG	0.418																																						ENST00000294353.6	1.000000	0.690000	1	8.000000e-01	0.920000	0.911345	0.920000	1.000000																										0				30						c.(2182-2184)cGc>cAc		zyg-11 family member B, cell cycle regulator		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	86.0	80.0	82.0		2183	5.5	1.0	1	dbSNP_134	82	0,8600		0,0,4300	no	missense	ZYG11B	NM_024646.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	728/745	53287249	1,13005	2203	4300	6503	SO:0001583	missense	79699	2	121412	33				g.chr1:53287249G>A	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.2183G>A	chr1.hg19:g.53287249G>A	ENSP00000294353:p.Arg728His	0					ZYG11B_ENST00000443756.2_Missense_Mutation_p.R658H	p.R728H	NM_024646.2	NP_078922.1	1	2	3	2.067602	Q9C0D3	ZY11B_HUMAN		14	2328	+			Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	1	1	hg19	c.2183G>A	CCDS30717.1	1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579177	0.65878	2.27E-4	0.0	ENSG00000162378	ENST00000443756;ENST00000294353	T	0.47177	0.85	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.37046	0.0989	L	0.51422	1.61	0.80722	D	1	P;B	0.39601	0.68;0.07	B;B	0.26094	0.066;0.019	T	0.35525	-0.9785	10	0.48119	T	0.1	.	12.6624	0.56822	0.0756:0.0:0.9244:0.0	.	658;728	B4DK95;Q9C0D3	.;ZY11B_HUMAN	H	658;728	ENSP00000294353:R728H	ENSP00000294353:R728H	R	+	2	0	0	ZYG11B	53059837	53059837	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.446000	0.66600	2.567000	0.86603	0.591000	0.81541	CGC	0.271966		TCGA-IB-7887-01A-11D-2154-08	0.418	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	1	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.780000	-3.318834	1	0.270000	NM_024646		0	46	45	0	322	318	1		1	1		0	0	70	0	0	1.000000	5.009208e-01	0	4	0	9	0	46	322
TFB2M	64216	broad.mit.edu	37	1	246704361	246704361	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr1:246704361A>T	ENST00000366514.4	-	8	1348	c.1163T>A	c.(1162-1164)cTg>cAg	p.L388Q		NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	388					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			TTCATCATACAGCCATTTATA	0.373																																						ENST00000366514.4	1.000000	0.650000	9.800000e-01	7.400000e-01	0.850000	0.858840	0.850000	1.000000																										0				28						c.(1162-1164)cTg>cAg		transcription factor B2, mitochondrial							133.0	119.0	124.0					1																	246704361		2203	4300	6503	SO:0001583	missense	64216	0	0					g.chr1:246704361A>T	AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.1163T>A	chr1.hg19:g.246704361A>T	ENSP00000355471:p.Leu388Gln	0						p.L388Q	NM_022366.2	NP_071761.1	0	1	1	2.056446	Q9H5Q4	TFB2M_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00358)	8	1348	-	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		Q9H626	Missense_Mutation	SNP	ENST00000366514.4	1	1	hg19	c.1163T>A	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.567021	0.45694	.	.	ENSG00000162851	ENST00000366514	T	0.40476	1.03	5.23	5.23	0.72850	5.23	5.23	0.72850	.	0.173798	0.38837	N	0.001547	T	0.56411	0.1983	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.63597	0.916	T	0.59883	-0.7370	10	0.87932	D	0	-0.8824	12.7768	0.57453	1.0:0.0:0.0:0.0	.	388	Q9H5Q4	TFB2M_HUMAN	Q	388	ENSP00000355471:L388Q	ENSP00000355471:L388Q	L	-	2	0	0	TFB2M	244770984	244770984	0.993000	0.37304	0.292000	0.24919	0.018000	0.09664	4.722000	0.61958	2.108000	0.64289	0.528000	0.53228	CTG	0.268024		TCGA-IB-7887-01A-11D-2154-08	0.373	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096673.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.780000	-18.936130	1	0.270000	NM_022366		0	50	50	0	380	375	1		1	1		0	0	62	0	0	1.000000	9.999654e-01	0	40	0	76	0	50	380
DLGAP4	22839	broad.mit.edu	37	20	35060133	35060133	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr20:35060133G>A	ENST00000373907.2	+	2	212	c.13G>A	c.(13-15)Ggt>Agt	p.G5S	DLGAP4_ENST00000339266.5_Missense_Mutation_p.G5S|DLGAP4_ENST00000373913.3_Missense_Mutation_p.G5S|DLGAP4_ENST00000401952.2_Missense_Mutation_p.G5S			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	5					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GAAAGGCCTCGGTGACAGCCG	0.692																																						ENST00000373907.2	1.000000	0.690000	1	8.000000e-01	0.930000	0.914925	0.930000	1.000000																										0				37						c.(13-15)Ggt>Agt		discs, large (Drosophila) homolog-associated protein 4							16.0	18.0	17.0					20																	35060133		2145	4230	6375	SO:0001583	missense	22839	5	120658	36				g.chr20:35060133G>A	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.13G>A	chr20.hg19:g.35060133G>A	ENSP00000363014:p.Gly5Ser	0					DLGAP4_ENST00000373913.3_Missense_Mutation_p.G5S|DLGAP4_ENST00000401952.2_Missense_Mutation_p.G5S|DLGAP4_ENST00000339266.5_Missense_Mutation_p.G5S	p.G5S			0	0	0	2.051649	Q9Y2H0	DLGP4_HUMAN		2	212	+	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	1	1	hg19	c.13G>A		1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651735	0.29336	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.67	3.36	0.38483	5.67	3.36	0.38483	.	0.151756	0.64402	D	0.000016	T	0.45438	0.1342	N	0.19112	0.55	0.44852	D	0.997862	D	0.89917	1.0	D	0.91635	0.999	T	0.39165	-0.9627	10	0.02654	T	1	.	11.4918	0.50385	0.0787:0.1303:0.7911:0.0	.	5	Q9Y2H0-1	.	S	5	ENSP00000363023:G5S;ENSP00000384954:G5S;ENSP00000363014:G5S;ENSP00000341633:G5S	ENSP00000341633:G5S	G	+	1	0	0	DLGAP4	34493547	34493547	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	5.453000	0.66645	1.377000	0.46286	0.561000	0.74099	GGT	0.266037		TCGA-IB-7887-01A-11D-2154-08	0.692	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	39	1	1.780000	-3.221981	1	0.270000	NM_014902		0	44	41	0	302	288	0		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	44	302
SEMG2	6407	broad.mit.edu	37	20	43851593	43851593	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr20:43851593G>C	ENST00000372769.3	+	2	1410	c.1320G>C	c.(1318-1320)gaG>gaC	p.E440D		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	440	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				AAACTGAAGAGAAAATACATG	0.383																																						ENST00000372769.3	1.000000	0.850000	1	9.400000e-01	0.990000	0.979746	0.990000	1.000000																										0				36						c.(1318-1320)gaG>gaC		semenogelin II							77.0	75.0	76.0					20																	43851593		2203	4300	6503	SO:0001583	missense	6407	0	0					g.chr20:43851593G>C		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1320G>C	chr20.hg19:g.43851593G>C	ENSP00000361855:p.Glu440Asp	0						p.E440D	NM_003008.2	NP_002999.1	0	0	0	2.051649	Q02383	SEMG2_HUMAN		2	1410	+		Myeloproliferative disorder(115;0.0122)	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	1	1	hg19	c.1320G>C	CCDS13346.1	1	.	.	.	.	.	.	.	.	.	.	G	5.930	0.355577	0.11239	.	.	ENSG00000124157	ENST00000372769	T	0.10005	2.92	1.03	-1.67	0.08238	1.03	-1.67	0.08238	.	.	.	.	.	T	0.14141	0.0342	L	0.27053	0.805	0.09310	N	1	P;B	0.51057	0.941;0.004	D;B	0.71414	0.973;0.012	T	0.18209	-1.0344	9	0.41790	T	0.15	.	3.074	0.06240	0.0:0.2992:0.3985:0.3023	.	440;440	A8K6Z6;Q02383	.;SEMG2_HUMAN	D	440	ENSP00000361855:E440D	ENSP00000361855:E440D	E	+	3	2	2	SEMG2	43285007	43285007	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.388000	0.07352	-0.534000	0.06315	-1.468000	0.01013	GAG	0.266037		TCGA-IB-7887-01A-11D-2154-08	0.383	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.780000	-20.000000	1	0.270000	NM_003008		0	87	86	0	525	510	1		1			0	0	87	0	0	1.000000	0	0	0	0	0	0	87	525
TTC3	7267	broad.mit.edu	37	21	38572533	38572533	+	Splice_Site	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr21:38572533G>A	ENST00000399017.2	+	45	8598	c.5851G>A	c.(5851-5853)Gca>Aca	p.A1951T	TTC3_ENST00000354749.2_Splice_Site_p.A1951T|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Splice_Site_p.A1951T	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1951					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GTTTCCACAGGCACTGGGTGC	0.428																																					Ovarian(38;194 1649 35661)	ENST00000399017.2	0.880000	0.420000	7.700000e-01	5.200000e-01	0.630000	0.649148	0.630000	0.630000																										0				75						c.(5851-5853)Gca>Aca		tetratricopeptide repeat domain 3							68.0	62.0	64.0					21																	38572533		2203	4300	6503	SO:0001630	splice_region_variant	7267	0	0					g.chr21:38572533G>A	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5851-1G>A	chr21.hg19:g.38572533G>A		1					TTC3_ENST00000355666.1_Splice_Site_p.A1951T|TTC3_ENST00000354749.2_Splice_Site_p.A1951T|TTC3_ENST00000479930.1_3'UTR	p.A1951T	NM_003316.3	NP_003307.3	0	1	1	1.781476	P53804	TTC3_HUMAN		45	8598	+		Myeloproliferative disorder(46;0.0412)	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Splice_Site	SNP	ENST00000399017.2	1	0	hg19	c.5851G>A	CCDS13651.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.961|3.961	-0.010251|-0.010251	0.07727|0.07727	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749|ENST00000428693	T;T;T|.	0.08807|.	3.05;3.05;3.05|.	5.58|5.58	1.74|1.74	0.24563|0.24563	5.58|5.58	1.74|1.74	0.24563|0.24563	.|.	0.905217|.	0.09312|.	N|.	0.819490|.	T|T	0.45776|0.45776	0.1359|0.1359	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999999|0.999999	B|.	0.18461|.	0.028|.	B|.	0.12837|.	0.008|.	T|T	0.25398|0.25398	-1.0133|-1.0133	9|5	.|.	.|.	.|.	-0.7948|-0.7948	3.6024|3.6024	0.08030|0.08030	0.2713:0.0:0.553:0.1756|0.2713:0.0:0.553:0.1756	.|.	1951|.	P53804|.	TTC3_HUMAN|.	T|Y	1951|242	ENSP00000347889:A1951T;ENSP00000381981:A1951T;ENSP00000346791:A1951T|.	.|.	A|C	+|+	1|2	0|0	0|0	TTC3|TTC3	37494403|37494403	37494403|37494403	0.258000|0.258000	0.24033|0.24033	0.448000|0.448000	0.26945|0.26945	0.031000|0.031000	0.12232|0.12232	0.312000|0.312000	0.19397|0.19397	0.303000|0.303000	0.22785|0.22785	-0.182000|-0.182000	0.12963|0.12963	GCA|TGC	0.157384		TCGA-IB-7887-01A-11D-2154-08	0.428	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.780000	-20.000000	1	0.270000		Missense_Mutation	0	24	23	0	215	210	1		1	1		0	0	29	0	0	1.000000	9.999399e-01	0	39	0	103	0	24	215
PES1	23481	broad.mit.edu	37	22	30983324	30983324	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr22:30983324C>T	ENST00000354694.7	-	4	423	c.317G>A	c.(316-318)cGt>cAt	p.R106H	PES1_ENST00000402284.3_Missense_Mutation_p.R106H|PES1_ENST00000402281.1_5'UTR|PES1_ENST00000405677.1_5'UTR|PES1_ENST00000335214.6_Missense_Mutation_p.R106H	NM_001243225.1|NM_014303.3	NP_001230154.1|NP_055118.1			pescadillo ribosomal biogenesis factor 1											breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						GTCCTTTAAACGCTCTACAGT	0.498																																						ENST00000354694.7	1.000000	0.800000	1	9.000000e-01	0.990000	0.967455	0.990000	1.000000																										0				29						c.(316-318)cGt>cAt		pescadillo ribosomal biogenesis factor 1							306.0	246.0	266.0					22																	30983324		2203	4300	6503	SO:0001583	missense	23481	2	121412	35				g.chr22:30983324C>T	U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000354694.7:c.317G>A	chr22.hg19:g.30983324C>T	ENSP00000346725:p.Arg106His	0					PES1_ENST00000405677.1_5'UTR|PES1_ENST00000335214.6_Missense_Mutation_p.R106H|PES1_ENST00000402284.3_Missense_Mutation_p.R106H|PES1_ENST00000402281.1_5'UTR	p.R106H	NM_001243225.1|NM_014303.3	NP_001230154.1|NP_055118.1	1	2	3	2.066540				4	423	-				Missense_Mutation	SNP	ENST00000354694.7	1	1	hg19	c.317G>A	CCDS13880.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272796	0.80580	.	.	ENSG00000100029	ENST00000354694;ENST00000402284;ENST00000335214;ENST00000433575	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.6	5.6	0.85130	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.51736	0.1692	M	0.75085	2.285	0.80722	D	1	B;B;B;B	0.32245	0.361;0.25;0.14;0.361	B;B;B;B	0.28232	0.041;0.087;0.024;0.041	T	0.55147	-0.8186	10	0.54805	T	0.06	-9.5911	19.2042	0.93723	0.0:1.0:0.0:0.0	.	106;106;106;106	B2RDF2;B5MCF9;O00541-2;O00541	.;.;.;PESC_HUMAN	H	106	ENSP00000346725:R106H;ENSP00000384252:R106H;ENSP00000334612:R106H;ENSP00000388071:R106H	ENSP00000334612:R106H	R	-	2	0	0	PES1	29313324	29313324	1.000000	0.71417	0.990000	0.47175	0.937000	0.57800	7.192000	0.77771	2.650000	0.89964	0.655000	0.94253	CGT	0.271966		TCGA-IB-7887-01A-11D-2154-08	0.498	PES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321188.3	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.780000	-20.000000	1	0.270000	NM_014303		0	65	65	0	406	393	1		1	1		0	0	62	0	0	1.000000	1	0	56	0	115	0	65	406
LRCH3	84859	broad.mit.edu	37	3	197553808	197553808	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr3:197553808C>T	ENST00000425562.2	+	5	700	c.700C>T	c.(700-702)Cct>Tct	p.P234S	LRCH3_ENST00000438796.2_Missense_Mutation_p.P234S|LRCH3_ENST00000536618.1_5'Flank|LRCH3_ENST00000334859.4_Missense_Mutation_p.P234S|LRCH3_ENST00000414675.2_Missense_Mutation_p.P234S|LRCH3_ENST00000441090.2_Missense_Mutation_p.P108S			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	234						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TACCACAATCCCTGTTTGTTA	0.423																																						ENST00000425562.2	0.650000	0.310000	5.600000e-01	3.800000e-01	0.470000	0.481075	0.470000	0.460000																										0				29						c.(700-702)Cct>Tct		leucine-rich repeats and calponin homology (CH) domain containing 3							156.0	140.0	145.0					3																	197553808		2203	4300	6503	SO:0001583	missense	84859	0	0					g.chr3:197553808C>T	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.700C>T	chr3.hg19:g.197553808C>T	ENSP00000393579:p.Pro234Ser	1					LRCH3_ENST00000536618.1_5'Flank|LRCH3_ENST00000334859.4_Missense_Mutation_p.P234S|LRCH3_ENST00000438796.2_Missense_Mutation_p.P234S|LRCH3_ENST00000414675.2_Missense_Mutation_p.P234S|LRCH3_ENST00000441090.2_Missense_Mutation_p.P108S	p.P234S			1	2	3	2.341094	Q96II8	LRCH3_HUMAN	Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	5	700	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	0	1	hg19	c.700C>T		0	.	.	.	.	.	.	.	.	.	.	C	33	5.261561	0.95368	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.59502	1.85;0.26;1.85;1.85;1.85	5.31	5.31	0.75309	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.78773	0.4336	M	0.81614	2.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.97110	1.0;1.0;1.0;0.966	T	0.81291	-0.0999	10	0.87932	D	0	-15.0214	19.3993	0.94621	0.0:1.0:0.0:0.0	.	108;234;234;234	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	S	234;108;234;234;234	ENSP00000399751:P234S;ENSP00000394609:P108S;ENSP00000394965:P234S;ENSP00000334375:P234S;ENSP00000393579:P234S	ENSP00000334375:P234S	P	+	1	0	0	LRCH3	199038205	199038205	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.421000	0.80204	2.654000	0.90174	0.650000	0.86243	CCT	0.356828		TCGA-IB-7887-01A-11D-2154-08	0.423	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	0	0	1	2	22	5	2	1	1	1	1	70	70	70	69	1	1.780000	-2.619927	1	0.270000	NM_032773		0	28	28	0	475	462	1		1	1		1	0	70	0	0	0.817563	2.043922e-01	0	9	0	45	0	28	475
DGKB	1607	broad.mit.edu	37	7	14724956	14724956	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr7:14724956C>T	ENST00000403951.2	-	10	1162	c.743G>A	c.(742-744)cGa>cAa	p.R248Q	DGKB_ENST00000258767.5_Missense_Mutation_p.R248Q|DGKB_ENST00000399322.3_Missense_Mutation_p.R248Q|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000406247.3_Missense_Mutation_p.R248Q|DGKB_ENST00000444700.2_Missense_Mutation_p.R241Q|DGKB_ENST00000407950.1_Missense_Mutation_p.R241Q|DGKB_ENST00000402815.1_Missense_Mutation_p.R248Q			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	248					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						GTGCTTCAGTCGCCACACGTG	0.463																																						ENST00000403951.2	1.000000	0.960000	1	9.900000e-01	0.990000	0.998013	0.990000	1.000000																										0				72						c.(742-744)cGa>cAa		diacylglycerol kinase, beta 90kDa							105.0	106.0	106.0					7																	14724956		2199	4292	6491	SO:0001583	missense	1607	0	0					g.chr7:14724956C>T	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.743G>A	chr7.hg19:g.14724956C>T	ENSP00000385780:p.Arg248Gln	0					DGKB_ENST00000258767.5_Missense_Mutation_p.R248Q|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000402815.1_Missense_Mutation_p.R248Q|DGKB_ENST00000406247.3_Missense_Mutation_p.R248Q|DGKB_ENST00000407950.1_Missense_Mutation_p.R241Q|DGKB_ENST00000444700.2_Missense_Mutation_p.R241Q|DGKB_ENST00000399322.3_Missense_Mutation_p.R248Q	p.R248Q			0	1	1	2.055534	Q9Y6T7	DGKB_HUMAN		10	1162	-			A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	1	1	hg19	c.743G>A	CCDS47547.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.902986	0.97087	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	D;D;D;D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08;-3.08;-3.08;-3.08	6.16	6.16	0.99307	6.16	6.16	0.99307	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.052374	0.64402	D	0.000001	D	0.94683	0.8285	L	0.43701	1.375	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;0.995;0.995;1.0	D;P;P;D	0.70227	0.943;0.876;0.876;0.968	D	0.93847	0.7142	10	0.52906	T	0.07	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	248;241;248;248	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	Q	248;248;248;248;241;241;248	ENSP00000385780:R248Q;ENSP00000382260:R248Q;ENSP00000258767:R248Q;ENSP00000384909:R248Q;ENSP00000385031:R241Q;ENSP00000388451:R241Q;ENSP00000386066:R248Q	ENSP00000258767:R248Q	R	-	2	0	0	DGKB	14691481	14691481	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	CGA	0.268024		TCGA-IB-7887-01A-11D-2154-08	0.463	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.780000	-3.039706	1	0.270000	NM_004080		0	65	64	0	326	322	1		1			0	0	48	0	0	1.000000	0	0	0	0	0	0	65	326
GLI3	2737	broad.mit.edu	37	7	42004926	42004927	+	Missense_Mutation	DNP	AG	AG	CA			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr7:42004926_42004927AG>CA	ENST00000395925.3	-	15	3828_3829	c.3744_3745CT>TG	c.(3742-3747)ccCTgt>ccTGgt	p.C1249G	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1249					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGGGCCTTACAGGGCTGTTCAT	0.614									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	0.650000|0.640000	9.300000e-01|9.200000e-01	7.300000e-01|7.200000e-01	0.820000	0.834291|0.827592	0.820000	1.000000																										0				112						c.(3745-3747)Tgt>Ggt|c.(3742-3744)ccC>ccT		GLI family zinc finger 3																																				SO:0001583	missense	2737	0|1	0|121412	|31	Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42004926A>C|g.chr7:42004927G>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3744_3745delinsCA	chr7.hg19:g.42004926_42004927delinsCA	ENSP00000379258:p.Cys1249Gly	0					GLI3_ENST00000479210.1_5'UTR	p.C1249G|p.P1248P	NM_000168.5	NP_000159.3	0	1	1	2.055534	P10071	GLI3_HUMAN		15	3829|3828	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation|Silent	SNP	ENST00000395925.3	1	1	hg19	c.3745T>G|c.3744C>T	CCDS5465.1	0																									5.8|	3.26|	0.37387|																																												0|			41971451|														0.268024		TCGA-IB-7887-01A-11D-2154-08	0.614	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	1|0	0	1	2	2	2	2	0	0	0	0	98	99|98	99|98	99|98	1	1.780000	-20.000000|-2.598634	1	0.270000	NM_000168		0	65	64|65	0	513|518	504|508	1		1	0		0	0	99|98	0	0	1.000000	6.186468e-01|6.718914e-01	0	0	0	18|20	0	65	513
CLVS1	157807	broad.mit.edu	37	8	62212794	62212794	+	Silent	SNP	C	C	T			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chr8:62212794C>T	ENST00000519846.1	+	3	880	c.408C>T	c.(406-408)taC>taT	p.Y136Y	RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000518592.1_Intron|CLVS1_ENST00000325897.4_Silent_p.Y136Y|RP11-787D18.1_ENST00000518064.1_RNA			Q8IUQ0	CLVS1_HUMAN	clavesin 1	136	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.Y136*(1)		endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						GAGACCATTACGGCAGGAAGA	0.443																																						ENST00000519846.1	1.000000	0.710000	1	8.300000e-01	0.950000	0.931040	0.950000	1.000000																										1	Substitution - Nonsense(1)	p.Y136*(1)	lung(1)	41						c.(406-408)taC>taT		clavesin 1																																				SO:0001819	synonymous_variant	157807	4	121400	35				g.chr8:62212794C>T	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.408C>T	chr8.hg19:g.62212794C>T		0					CLVS1_ENST00000518592.1_Intron|RP11-787D18.1_ENST00000518064.1_RNA|CLVS1_ENST00000325897.4_Silent_p.Y136Y|RP11-787D18.1_ENST00000521801.1_RNA	p.Y136Y			0	1	1	2.056610	Q8IUQ0	CLVS1_HUMAN		3	880	+			B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	1	1	hg19	c.408C>T	CCDS6176.1	1																																																																																								0.268024		TCGA-IB-7887-01A-11D-2154-08	0.443	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	49	1	1.780000	-20.000000	1	0.270000	NM_173519		0	45	44	0	300	290	1		1	0		0	0	50	0	0	1.000000	0	0	0	0	1	0	45	300
IGSF1	3547	broad.mit.edu	37	X	130408064	130408064	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7887-01A-11D-2154-08	TCGA-IB-7887-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	35c4c115-e867-4ae4-987f-9ff02003be62	73139364-4a90-4b65-82fb-efa77a95b3fa	g.chrX:130408064G>A	ENST00000361420.3	-	19	3947	c.3868C>T	c.(3868-3870)Cga>Tga	p.R1290*	IGSF1_ENST00000370903.3_Nonsense_Mutation_p.R1295*|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.R1281*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.R1281*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1290					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TACCTGGTTCGCAGTCGAGGC	0.502																																						ENST00000361420.3	1.000000	0.980000	1	9.900000e-01	0.990000	0.999062	0.990000	1.000000																										0				78						c.(3868-3870)Cga>Tga		immunoglobulin superfamily, member 1							239.0	218.0	225.0					X																	130408064		2203	4300	6503	SO:0001587	stop_gained	3547	2	121410	29				g.chrX:130408064G>A	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3868C>T	chrX.hg19:g.130408064G>A	ENSP00000355010:p.Arg1290*						IGSF1_ENST00000370903.3_Nonsense_Mutation_p.R1295*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.R1281*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.R1281*	p.R1290*			0	1	1		Q8N6C5	IGSF1_HUMAN		19	3947	-			B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	ENST00000361420.3	0	1	hg19	c.3868C>T	CCDS14629.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.400588	0.99159	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	4.48	4.48	0.54585	4.48	4.48	0.54585	.	0.350736	0.21139	N	0.079510	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4099	0.49919	0.0:0.0:1.0:0.0	.	.	.	.	X	1281;1290;1281;1295	.	ENSP00000355010:R1290X	R	-	1	2	2	IGSF1	130235745	130235745	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.588000	0.36633	2.465000	0.83290	0.544000	0.68410	CGA	0.270000		TCGA-IB-7887-01A-11D-2154-08	0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1	1	0	1	2	2	2	2	0	0	0	0	242	242	242	241	1	1.780000	-20.000000	1	0.270000			0	263	250	0	1495	1450	1		1	1		0	0	242	0	0	1.000000	7.144762e-01	0	15	0	1	0	263	1495
