#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CFAP58	159686	broad.mit.edu	37	10	106207500	106207500	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr10:106207500C>T	ENST00000369704.3	+	16	2435	c.2301C>T	c.(2299-2301)cgC>cgT	p.R767R		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		767						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TCTTGGCCCGCCAGCCTGGAC	0.537																																						ENST00000369704.3	1.000000	0.700000	1	8.500000e-01	0.990000	0.945769	0.990000	1.000000																										0				52						c.(2299-2301)cgC>cgT									56.0	54.0	55.0					10																	106207500		2203	4300	6503	SO:0001819	synonymous_variant	0	0	0					g.chr10:106207500C>T																												ENST00000369704.3:c.2301C>T	chr10.hg19:g.106207500C>T		1						p.R767R	NM_001008723.1	NP_001008723.1	0	1	1	1.870313	Q5T655	CC147_HUMAN		16	2435	+		Colorectal(252;0.103)|Breast(234;0.122)	D3DRA6|Q8NA27	Silent	SNP	ENST00000369704.3	0	1	hg19	c.2301C>T	CCDS31282.1	1																																																																																								0.111675		TCGA-IB-7888-01A-11D-2154-08	0.537	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1	1	0	1		2	2	2	0		0	0	25		25	24	1	1.960000	-20.000000	1	0.160000				29	29		300	284	0		1			0	0	25	0		1.000000	0	0	0	0	0	0	29	300
RET	5979	broad.mit.edu	37	10	43596003	43596003	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr10:43596003G>A	ENST00000355710.3	+	2	402	c.170G>A	c.(169-171)cGg>cAg	p.R57Q	RET_ENST00000340058.5_Missense_Mutation_p.R57Q	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	57					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CATGCCCTGCGGGACGCCCCT	0.622		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	ENST00000355710.3	0.970000	0.340000	8.000000e-01	4.600000e-01	0.610000	0.636909	0.610000	1.000000		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	10q11.2	5979	T, Mis, N, F	ret proto-oncogene	yes	yes	Hirschsprung disease	"""E, O"""	E, O	H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6	medullary thyroid,  papillary thyroid, pheochromocytoma	medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC	CCDC6/RET(4)|KIF5B/RET(79)	0				607						c.(169-171)cGg>cAg		ret proto-oncogene	Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)						74.0	64.0	67.0					10																	43596003		2203	4300	6503	SO:0001583	missense	5979	1	121406	33	Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	g.chr10:43596003G>A	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.170G>A	chr10.hg19:g.43596003G>A	ENSP00000347942:p.Arg57Gln	0					RET_ENST00000340058.5_Missense_Mutation_p.R57Q	p.R57Q	NM_020975.4	NP_066124.1	0	0	0	1.993230	P07949	RET_HUMAN		2	402	+		Ovarian(717;0.0423)	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	1	1	hg19	c.170G>A	CCDS7200.1	0	.	.	.	.	.	.	.	.	.	.	G	7.893	0.732679	0.15507	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.80566	-1.27;-1.39	5.51	-2.98	0.05513	5.51	-2.98	0.05513	.	0.511992	0.21682	N	0.070717	T	0.62159	0.2405	N	0.17474	0.49	0.20703	N	0.999866	B;B	0.27656	0.068;0.184	B;B	0.12156	0.003;0.007	T	0.51395	-0.8711	10	0.59425	D	0.04	.	13.0759	0.59087	0.6294:0.0:0.3706:0.0	.	57;57	P07949;P07949-2	RET_HUMAN;.	Q	57	ENSP00000347942:R57Q;ENSP00000344798:R57Q	ENSP00000344798:R57Q	R	+	2	0	0	RET	42916009	42916009	0.007000	0.16637	0.001000	0.08648	0.001000	0.01503	-0.012000	0.12699	-0.533000	0.06323	-1.553000	0.00894	CGG	0.150485		TCGA-IB-7888-01A-11D-2154-08	0.622	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	1	0	1		2	2	2	0		0	0	51		51	51	1	1.960000	-3.318794	1	0.160000	NM_020975			13	13		250	247	0		1	0		0	0	51	0		0.999537	2.979146e-03	0	0	0	2	0	13	250
MKI67	4288	broad.mit.edu	37	10	129906577	129906577	+	Missense_Mutation	SNP	G	G	A	rs117795868		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr10:129906577G>A	ENST00000368654.3	-	13	3902	c.3527C>T	c.(3526-3528)aCg>aTg	p.T1176M	MKI67_ENST00000368653.3_Missense_Mutation_p.T816M	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1176	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGGTTTGGGCGTAAGCATGGC	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		21842	0.001		0.0	False		,,,				2504	0.0					ENST00000368654.3	0.120000	0.020000	9.000000e-02	4.000000e-02	0.060000	0.072004	0.060000	0.070000																										0				159						c.(3526-3528)aCg>aTg		marker of proliferation Ki-67							292.0	278.0	283.0					10																	129906577		2203	4300	6503	SO:0001583	missense	4288	29	121412	52				g.chr10:129906577G>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3527C>T	chr10.hg19:g.129906577G>A	ENSP00000357643:p.Thr1176Met	1					MKI67_ENST00000368653.3_Missense_Mutation_p.T816M	p.T1176M	NM_002417.4	NP_002408.3	0	1	1	1.885195	P46013	KI67_HUMAN		13	3902	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	0	1	hg19	c.3527C>T	CCDS7659.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.05	1.822665	0.32237	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03301	3.98;3.98	2.74	1.83	0.25207	2.74	1.83	0.25207	.	1.848640	0.03443	N	0.209516	T	0.15998	0.0385	M	0.72118	2.19	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.96;0.991;0.989	T	0.06058	-1.0848	10	0.52906	T	0.07	.	5.4955	0.16799	0.1565:0.0:0.8435:0.0	.	1175;816;1176	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	M	1176;816;1175	ENSP00000357643:T1176M;ENSP00000357642:T816M	ENSP00000357642:T816M	T	-	2	0	0	MKI67	129796567	129796567	0.005000	0.15991	0.002000	0.10522	0.005000	0.04900	0.110000	0.15437	0.740000	0.32651	0.462000	0.41574	ACG	0.102564		TCGA-IB-7888-01A-11D-2154-08	0.463	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	0	0	1		2	2	2	0		0	0	242		242	241	1	1.960000	-2.030090	0	0.160000	NM_002417			9	10		1605	1587	0		1	0		0	0	242	0		0.993885	4.132300e-04	0	0	0	5	0	9	1605
DDX10	1662	broad.mit.edu	37	11	108546412	108546412	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:108546412G>A	ENST00000322536.3	+	3	466	c.337G>A	c.(337-339)Gcc>Acc	p.A113T	DDX10_ENST00000526794.1_Missense_Mutation_p.A113T	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	113	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.A113T(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		ACTTGGAGCGGCCAAAACTGG	0.438			T	NUP98	AML*																																	ENST00000322536.3	0.260000	0.040000	1.900000e-01	7.000000e-02	0.120000	0.138238	0.120000	0.120000				Dom	yes			Dom	yes		11	11q22-q23	11q22-q23	1662	T	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10				L	L	NUP98		AML*		1	Substitution - Missense(1)	p.A113T(1)	kidney(1)	27						c.(337-339)Gcc>Acc		DEAD (Asp-Glu-Ala-Asp) box polypeptide 10							157.0	147.0	150.0					11																	108546412		2201	4298	6499	SO:0001583	missense	1662	0	0					g.chr11:108546412G>A	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.337G>A	chr11.hg19:g.108546412G>A	ENSP00000314348:p.Ala113Thr	0					DDX10_ENST00000526794.1_Missense_Mutation_p.A113T	p.A113T	NM_004398.2	NP_004389.2	0	1	1	2.000262	Q13206	DDX10_HUMAN		3	466	+		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)	B2RCQ3|Q5BJD8	Missense_Mutation	SNP	ENST00000322536.3	0	1	hg19	c.337G>A	CCDS8342.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.649371	0.96714	.	.	ENSG00000178105	ENST00000322536;ENST00000456020;ENST00000526794	T;T	0.22539	1.95;1.95	5.82	5.82	0.92795	5.82	5.82	0.92795	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.046541	0.85682	N	0.000000	T	0.53302	0.1788	H	0.95679	3.705	0.80722	D	1	P;P	0.48764	0.858;0.915	P;P	0.51055	0.657;0.657	T	0.67921	-0.5545	10	0.87932	D	0	-4.8073	20.1566	0.98115	0.0:0.0:1.0:0.0	.	113;113	Q13206;E9PIF2	DDX10_HUMAN;.	T	113	ENSP00000314348:A113T;ENSP00000432032:A113T	ENSP00000314348:A113T	A	+	1	0	0	DDX10	108051622	108051622	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.413000	0.97351	2.779000	0.95612	0.603000	0.83216	GCC	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.438	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	0	0	1		2	2	2	0		0	0	49		49	49	1	1.960000	-1.724912	0	0.160000	NM_004398			5	6		527	522	0		1	0		0	0	49	0		0.936255	7.344143e-03	0	1	0	10	0	5	527
TSPAN18	90139	broad.mit.edu	37	11	44931325	44931325	+	Missense_Mutation	SNP	G	G	A	rs138512957		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:44931325G>A	ENST00000520358.2	+	5	548	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	TSPAN18_ENST00000340160.3_Missense_Mutation_p.V45M			Q96SJ8	TSN18_HUMAN	tetraspanin 18	45						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						CCGGGAGATCGTGGCTGCCAA	0.697																																						ENST00000520358.2	1.000000	0.070000	2.500000e-01	1.100000e-01	0.160000	0.208268	0.160000	0.160000																										0				10						c.(133-135)Gtg>Atg		tetraspanin 18		G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	46.0	50.0	49.0		133	3.1	1.0	11	dbSNP_134	49	1,8595	1.2+/-3.3	0,1,4297	no	missense	TSPAN18	NM_130783.4	21	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	45/249	44931325	2,13000	2203	4298	6501	SO:0001583	missense	90139	3	121408	40				g.chr11:44931325G>A	AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.133G>A	chr11.hg19:g.44931325G>A	ENSP00000429993:p.Val45Met	0					TSPAN18_ENST00000340160.3_Missense_Mutation_p.V45M	p.V45M			1	2	3	2.007403	Q96SJ8	TSN18_HUMAN		5	548	+			Q6UY44|Q8NBI9	Missense_Mutation	SNP	ENST00000520358.2	0	1	hg19	c.133G>A	CCDS7910.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.311265|4.311265	0.81358|0.81358	2.27E-4|2.27E-4	1.16E-4|1.16E-4	ENSG00000157570|ENSG00000157570	ENST00000518429|ENST00000533786;ENST00000533202;ENST00000520358;ENST00000520999;ENST00000340160;ENST00000520837	.|T;T;T;T;T;T	.|0.80214	.|-1.35;-1.35;-1.35;-1.35;-1.35;-1.35	5.0|5.0	3.1|3.1	0.35709|0.35709	5.0|5.0	3.1|3.1	0.35709|0.35709	.|.	.|0.239380	.|0.41823	.|D	.|0.000806	D|D	0.86049|0.86049	0.5840|0.5840	M|M	0.71036|0.71036	2.16|2.16	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.996;0.997	.|D;D	.|0.67548	.|0.952;0.922	D|D	0.85562|0.85562	0.1228|0.1228	5|10	.|0.59425	.|D	.|0.04	.|.	8.9069|8.9069	0.35530|0.35530	0.232:0.0:0.768:0.0|0.232:0.0:0.768:0.0	.|.	.|45;45	.|Q8WUV1;Q96SJ8	.|.;TSN18_HUMAN	H|M	48|45;45;45;55;45;55	.|ENSP00000433592:V45M;ENSP00000434625:V45M;ENSP00000429993:V45M;ENSP00000427942:V55M;ENSP00000339820:V45M;ENSP00000430343:V55M	.|ENSP00000339820:V45M	R|V	+|+	2|1	0|0	0|0	TSPAN18|TSPAN18	44887901|44887901	44887901|44887901	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	4.890000|4.890000	0.63178|0.63178	1.105000|1.105000	0.41606|0.41606	0.561000|0.561000	0.74099|0.74099	CGT|GTG	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.697	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376197.3	0	0	1		2	2	2	0		0	0	57		57	56	1	1.960000	-5.739786	1	0.160000	NM_130783			7	7		553	538	0		1	0		0	0	57	0		0.978751	2.318911e-02	0	0	0	16	0	7	553
CHST1	8534	broad.mit.edu	37	11	45671352	45671352	+	Silent	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:45671352G>A	ENST00000308064.2	-	4	1792	c.1122C>T	c.(1120-1122)aaC>aaT	p.N374N	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	374					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GCTGGCAGGCGTTCTGGGCAA	0.662																																						ENST00000308064.2	1.000000	0.290000	6.200000e-01	3.800000e-01	0.480000	0.511742	0.480000	0.470000																										0				42						c.(1120-1122)aaC>aaT		carbohydrate (keratan sulfate Gal-6) sulfotransferase 1							49.0	52.0	51.0					11																	45671352		2203	4299	6502	SO:0001819	synonymous_variant	8534	0	0					g.chr11:45671352G>A	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.1122C>T	chr11.hg19:g.45671352G>A		0					CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	p.N374N	NM_003654.5	NP_003645.1	1	2	3	2.007403	O43916	CHST1_HUMAN		4	1792	-			D3DQP2	Silent	SNP	ENST00000308064.2	1	1	hg19	c.1122C>T	CCDS7913.1	0																																																																																								0.163347		TCGA-IB-7888-01A-11D-2154-08	0.662	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	0	0	1		2	2	2	0		0	0	79		79	79	1	1.960000	-17.057420	1	0.160000	NM_003654			18	18		459	455	0		1	0		0	0	79	0		0.999981	1.652749e-03	0	0	0	2	0	18	459
OR8K5	219453	broad.mit.edu	37	11	55927158	55927158	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:55927158C>T	ENST00000313447.1	-	1	635	c.636G>A	c.(634-636)ctG>ctA	p.L212L		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CTAAGACTATCAGAAAGGAGG	0.378																																						ENST00000313447.1	1.000000	0.490000	9.800000e-01	6.200000e-01	0.780000	0.788623	0.780000	1.000000																										0				34						c.(634-636)ctG>ctA		olfactory receptor, family 8, subfamily K, member 5							67.0	68.0	67.0					11																	55927158		2201	4296	6497	SO:0001819	synonymous_variant	219453	1	121412	32				g.chr11:55927158C>T	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.636G>A	chr11.hg19:g.55927158C>T		0						p.L212L	NM_001004058.2	NP_001004058.2	1	2	3	2.007403	Q8NH50	OR8K5_HUMAN		1	635	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	Q6IFB5	Silent	SNP	ENST00000313447.1	1	1	hg19	c.636G>A	CCDS31521.1	0																																																																																								0.163347		TCGA-IB-7888-01A-11D-2154-08	0.378	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	1	0	1		2	2	2	0		0	0	42		42	42	1	1.960000	-3.075367	1	0.160000	NM_001004058			20	20		306	302	0		1			0	0	42	0		0.999995	0	0	0	0	0	0	20	306
OR1S1	219959	broad.mit.edu	37	11	57982249	57982249	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:57982249C>T	ENST00000309433.6	+	1	33	c.33C>T	c.(31-33)ggC>ggT	p.G11G		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				TTCAGATCGGCAGAAATATGC	0.393																																						ENST00000309433.6	1.000000	0.120000	3.400000e-01	1.800000e-01	0.240000	0.284717	0.240000	0.240000																										0				48						c.(31-33)ggC>ggT		olfactory receptor, family 1, subfamily S, member 1							150.0	136.0	141.0					11																	57982249		2201	4296	6497	SO:0001819	synonymous_variant	219959	0	0					g.chr11:57982249C>T	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.33C>T	chr11.hg19:g.57982249C>T		0						p.G11G	NM_001004458.1	NP_001004458.1	1	2	3	2.007403	Q8NH92	OR1S1_HUMAN		1	33	+		Breast(21;0.0589)	Q6IFG3	Silent	SNP	ENST00000309433.6	0	1	hg19	c.33C>T	CCDS31546.1	0																																																																																								0.163347		TCGA-IB-7888-01A-11D-2154-08	0.393	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	0	0	1		2	2	2	0		0	0	51		51	51	1	1.960000	-3.349171	1	0.160000	NM_001004458			11	11		569	563	0		1			0	0	51	0		0.998258	0	0	0	0	0	0	11	569
INCENP	3619	broad.mit.edu	37	11	61897787	61897787	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:61897787C>T	ENST00000394818.3	+	4	990	c.788C>T	c.(787-789)tCc>tTc	p.S263F	INCENP_ENST00000278849.4_Missense_Mutation_p.S263F	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	263					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GCGCAGGTCTCCCCTGGCCCA	0.652																																						ENST00000394818.3	1.000000	0.630000	1	7.500000e-01	0.870000	0.872899	0.870000	1.000000																										0				19						c.(787-789)tCc>tTc		inner centromere protein antigens 135/155kDa							62.0	62.0	62.0					11																	61897787		2202	4299	6501	SO:0001583	missense	3619	0	0					g.chr11:61897787C>T	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.788C>T	chr11.hg19:g.61897787C>T	ENSP00000378295:p.Ser263Phe	0					INCENP_ENST00000278849.4_Missense_Mutation_p.S263F	p.S263F	NM_001040694.1	NP_001035784.1	0	1	1	2.000262	Q9NQS7	INCE_HUMAN		4	990	+			A8MQD2|Q5Y192	Missense_Mutation	SNP	ENST00000394818.3	1	1	hg19	c.788C>T	CCDS44624.1	1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338769	0.41398	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.16597	2.33;2.33	5.3	5.3	0.74995	5.3	5.3	0.74995	.	0.412804	0.20464	N	0.091830	T	0.34193	0.0889	L	0.54323	1.7	0.43317	D	0.995338	D;D;P	0.62365	0.991;0.971;0.952	P;P;P	0.60473	0.687;0.875;0.753	T	0.02512	-1.1148	10	0.87932	D	0	.	14.4724	0.67526	0.0:1.0:0.0:0.0	.	263;263;263	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	F	263	ENSP00000378295:S263F;ENSP00000278849:S263F	ENSP00000278849:S263F	S	+	2	0	0	INCENP	61654363	61654363	0.092000	0.21681	0.980000	0.43619	0.238000	0.25445	2.050000	0.41297	2.492000	0.84095	0.462000	0.41574	TCC	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.652	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	1	0	1		2	2	2	0		0	0	66		66	65	1	1.960000	-3.142702	1	0.160000	NM_020238			39	37		512	498	0		1	1		0	0	66	0		1.000000	4.520780e-01	0	5	0	16	0	39	512
ZBTB3	79842	broad.mit.edu	37	11	62519604	62519604	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:62519604C>T	ENST00000394807.3	-	2	1808	c.1683G>A	c.(1681-1683)ggG>ggA	p.G561G		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	561					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						CTTTAGGTGGCCCTCCACCAC	0.537																																						ENST00000394807.3	1.000000	0.440000	8.600000e-01	5.500000e-01	0.690000	0.711106	0.690000	1.000000																										0				24						c.(1681-1683)ggG>ggA		zinc finger and BTB domain containing 3							89.0	82.0	84.0					11																	62519604		2202	4299	6501	SO:0001819	synonymous_variant	79842	0	0					g.chr11:62519604C>T	AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1683G>A	chr11.hg19:g.62519604C>T		0						p.G561G	NM_024784.3	NP_079060.1	0	1	1	2.000262	Q9H5J0	ZBTB3_HUMAN		2	1808	-				Silent	SNP	ENST00000394807.3	1	1	hg19	c.1683G>A	CCDS8034.1	0																																																																																								0.155270		TCGA-IB-7888-01A-11D-2154-08	0.537	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395342.1	1	0	1		2	2	2	0		0	0	49		49	49	1	1.960000	-5.638260	1	0.160000	NM_024784			20	20		338	333	0		1	0		0	0	49	0		0.999995	3.535299e-03	0	0	0	2	0	20	338
NOX4	50507	broad.mit.edu	37	11	89106611	89106611	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:89106611C>T	ENST00000263317.4	-	12	1362	c.1124G>A	c.(1123-1125)gGa>gAa	p.G375E	NOX4_ENST00000527626.1_Missense_Mutation_p.G209E|NOX4_ENST00000528341.1_Missense_Mutation_p.G350E|NOX4_ENST00000375979.3_Missense_Mutation_p.G68E|NOX4_ENST00000424319.1_Missense_Mutation_p.G351E|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000343727.5_Missense_Mutation_p.G351E|NOX4_ENST00000532825.1_Missense_Mutation_p.G351E|NOX4_ENST00000531342.1_Missense_Mutation_p.G68E|NOX4_ENST00000534731.1_Missense_Mutation_p.G375E|NOX4_ENST00000527956.1_Missense_Mutation_p.G351E|NOX4_ENST00000542487.1_Missense_Mutation_p.G351E|NOX4_ENST00000413594.2_Missense_Mutation_p.G396E|NOX4_ENST00000535633.1_Missense_Mutation_p.G351E			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	375	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.G375E(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TGTCCAGTCTCCTACTATTTT	0.279																																						ENST00000263317.4	0.270000	0.070000	2.100000e-01	1.100000e-01	0.150000	0.166443	0.150000	0.150000																										1	Substitution - Missense(1)	p.G375E(1)	large_intestine(1)	44						c.(1123-1125)gGa>gAa		NADPH oxidase 4							100.0	110.0	107.0					11																	89106611		2201	4283	6484	SO:0001583	missense	50507	0	0					g.chr11:89106611C>T	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1124G>A	chr11.hg19:g.89106611C>T	ENSP00000263317:p.Gly375Glu	0					NOX4_ENST00000535633.1_Missense_Mutation_p.G351E|NOX4_ENST00000528341.1_Missense_Mutation_p.G350E|NOX4_ENST00000542487.1_Missense_Mutation_p.G351E|NOX4_ENST00000534731.1_Missense_Mutation_p.G375E|NOX4_ENST00000531342.1_Missense_Mutation_p.G68E|NOX4_ENST00000532825.1_Missense_Mutation_p.G351E|NOX4_ENST00000527626.1_Missense_Mutation_p.G209E|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000527956.1_Missense_Mutation_p.G351E|NOX4_ENST00000424319.1_Missense_Mutation_p.G351E|NOX4_ENST00000413594.2_Missense_Mutation_p.G396E|NOX4_ENST00000343727.5_Missense_Mutation_p.G351E|NOX4_ENST00000375979.3_Missense_Mutation_p.G68E	p.G375E			0	1	1	2.000262	Q9NPH5	NOX4_HUMAN		12	1362	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	0	1	hg19	c.1124G>A	CCDS8285.1	0	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057366	0.55325	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	T;T;T;T;T;T;T;T;T;T;T;D;D	0.98012	1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;-4.05;-4.66	5.12	5.12	0.69794	5.12	5.12	0.69794	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98757	0.9582	M	0.87971	2.92	0.52501	D	0.999951	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.992;0.998;1.0;0.999;1.0	D	0.99505	1.0954	9	.	.	.	-12.7557	15.4797	0.75514	0.0:1.0:0.0:0.0	.	351;209;350;68;68;375;375	E9PMY6;E9PR43;E9PPP2;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;NOX4_HUMAN	E	351;351;351;375;375;351;351;351;209;350;396;68;68	ENSP00000412446:G351E;ENSP00000440172:G351E;ENSP00000344747:G351E;ENSP00000436892:G375E;ENSP00000263317:G375E;ENSP00000434924:G351E;ENSP00000433797:G351E;ENSP00000439373:G351E;ENSP00000436093:G209E;ENSP00000436970:G350E;ENSP00000405705:G396E;ENSP00000435039:G68E;ENSP00000365146:G68E	.	G	-	2	0	0	NOX4	88746259	88746259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.868000	0.63021	2.382000	0.81193	0.563000	0.77884	GGA	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.279	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	0	0	1		2	2	2	0		0	0	65		65	64	1	1.960000	-1.640117	0	0.160000	NM_016931			10	10		804	779	0		1	0		0	0	65	0		0.996366	1.088310e-01	0	0	0	41	0	10	804
HMBS	3145	broad.mit.edu	37	11	118955763	118955763	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr11:118955763C>T	ENST00000278715.3	+	1	171	c.20C>T	c.(19-21)gCg>gTg	p.A7V	HMBS_ENST00000537841.1_5'UTR|HMBS_ENST00000442944.2_5'UTR|HMBS_ENST00000392841.1_5'Flank|HMBS_ENST00000543090.1_Missense_Mutation_p.A7V|HMBS_ENST00000544387.1_Missense_Mutation_p.A7V|HMBS_ENST00000542729.1_5'UTR	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	7					heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		AACGGCAATGCGGCTGCAACG	0.667																																						ENST00000278715.3	0.410000	0.070000	3.000000e-01	1.200000e-01	0.200000	0.221602	0.200000	0.190000																										0				15						c.(19-21)gCg>gTg		hydroxymethylbilane synthase							46.0	41.0	43.0					11																	118955763		2200	4295	6495	SO:0001583	missense	3145	0	0					g.chr11:118955763C>T	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.20C>T	chr11.hg19:g.118955763C>T	ENSP00000278715:p.Ala7Val	0					HMBS_ENST00000542729.1_5'UTR|HMBS_ENST00000442944.2_5'UTR|HMBS_ENST00000537841.1_5'UTR|HMBS_ENST00000543090.1_Missense_Mutation_p.A7V|HMBS_ENST00000392841.1_5'Flank|HMBS_ENST00000544387.1_Missense_Mutation_p.A7V	p.A7V	NM_000190.3	NP_000181.2	0	1	1	2.000262	P08397	HEM3_HUMAN		1	171	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Missense_Mutation	SNP	ENST00000278715.3	0	1	hg19	c.20C>T	CCDS8409.1	0	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004515	0.54254	.	.	ENSG00000256269	ENST00000278715;ENST00000536813;ENST00000546302;ENST00000544387;ENST00000543090	D;D;D;D;D	0.99832	-7.02;-5.71;-6.09;-6.71;-6.91	5.55	-0.207	0.13189	5.55	-0.207	0.13189	.	0.410282	0.21922	N	0.067144	D	0.97955	0.9327	N	0.22421	0.69	0.18873	N	0.999989	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	D	0.99023	1.0818	10	0.18276	T	0.48	-1.7114	1.6993	0.02869	0.1664:0.3811:0.2802:0.1723	.	7;7;7	F5H345;G5EA58;P08397	.;.;HEM3_HUMAN	V	7	ENSP00000278715:A7V;ENSP00000438726:A7V;ENSP00000445599:A7V;ENSP00000438424:A7V;ENSP00000445429:A7V	ENSP00000278715:A7V	A	+	2	0	0	HMBS	118460973	118460973	0.037000	0.19845	0.044000	0.18714	0.485000	0.33311	0.342000	0.19926	0.062000	0.16340	0.650000	0.86243	GCG	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.667	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399188.1	0	0	1		2	2	2	0		0	0	31		31	31	1	1.960000	-3.134256	1	0.160000	NM_000190			5	5		324	307	0		1	0		0	0	31	0		0.928867	2.878254e-02	0	0	0	14	0	5	324
DUSP16	80824	broad.mit.edu	37	12	12629995	12629995	+	Silent	SNP	G	G	A	rs145763524		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr12:12629995G>A	ENST00000228862.2	-	7	2401	c.1770C>T	c.(1768-1770)tgC>tgT	p.C590C	DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'Flank	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	590					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		CTTGGTCTCCGCAAGTGGGCA	0.562																																					Ovarian(158;443 1896 15437 36069 46477)	ENST00000228862.2	0.250000	0.060000	1.900000e-01	9.000000e-02	0.130000	0.145571	0.130000	0.130000																										0				26						c.(1768-1770)tgC>tgT		dual specificity phosphatase 16		G		0,4406		0,0,2203	78.0	83.0	81.0		1770	2.9	0.0	12	dbSNP_134	81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DUSP16	NM_030640.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		590/666	12629995	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80824	1	121412	39				g.chr12:12629995G>A	AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1770C>T	chr12.hg19:g.12629995G>A		0					DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'Flank	p.C590C	NM_030640.2	NP_085143.1	0	1	1	2.001092	Q9BY84	DUS16_HUMAN		7	2401	-		Prostate(47;0.0687)	Q547C7|Q96QS2|Q9C0G3	Silent	SNP	ENST00000228862.2	0	1	hg19	c.1770C>T	CCDS8650.1	0																																																																																								0.155270		TCGA-IB-7888-01A-11D-2154-08	0.562	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	0	0	1		2	2	2	0		0	0	85		85	83	1	1.960000	-2.488069	0	0.160000	NM_030640			8	9		753	744	0		1	0		0	0	85	0		0.988935	1.940647e-01	0	0	0	68	0	8	753
TPTE2	93492	broad.mit.edu	37	13	20048175	20048175	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr13:20048175G>C	ENST00000400230.2	-	6	315	c.271C>G	c.(271-273)Ctc>Gtc	p.L91V	TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000255310.6_Missense_Mutation_p.L54V|TPTE2_ENST00000382977.4_Missense_Mutation_p.L91V|TPTE2_ENST00000390680.2_Missense_Mutation_p.L54V|TPTE2_ENST00000382978.1_Missense_Mutation_p.L91V|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000382975.4_Missense_Mutation_p.L91V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	91					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TCGGCAAGGAGGAGAGTGACA	0.294																																						ENST00000400230.2	0.330000	0.060000	2.500000e-01	1.100000e-01	0.160000	0.182912	0.160000	0.160000																										0				65						c.(271-273)Ctc>Gtc		transmembrane phosphoinositide 3-phosphatase and tensin homolog 2							65.0	73.0	70.0					13																	20048175		2203	4300	6503	SO:0001583	missense	93492	0	0					g.chr13:20048175G>C	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.271C>G	chr13.hg19:g.20048175G>C	ENSP00000383089:p.Leu91Val	0					TPTE2_ENST00000382977.4_Missense_Mutation_p.L91V|TPTE2_ENST00000382975.4_Missense_Mutation_p.L91V|TPTE2_ENST00000255310.6_Missense_Mutation_p.L54V|TPTE2_ENST00000382978.1_Missense_Mutation_p.L91V|TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000390680.2_Missense_Mutation_p.L54V	p.L91V			0	1	1	2.005752	Q6XPS3	TPTE2_HUMAN		6	315	-		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	0	1	hg19	c.271C>G	CCDS45014.1	0	.	.	.	.	.	.	.	.	.	.	g	0	-2.671852	0.00104	.	.	ENSG00000132958	ENST00000382978;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000343548	D;D;D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43;-4.43;-4.43	2.33	-2.98	0.05513	2.33	-2.98	0.05513	.	0.341290	0.24920	N	0.034543	D	0.87853	0.6282	N	0.11064	0.09	0.09310	N	1	B;B	0.12013	0.005;0.002	B;B	0.06405	0.002;0.002	T	0.79778	-0.1660	9	.	.	.	-2.0597	4.2976	0.10910	0.0:0.4631:0.2199:0.317	.	54;91	Q6XPS3-3;Q6XPS3	.;TPTE2_HUMAN	V	91;91;54;54;91;91;91	ENSP00000372438:L91V;ENSP00000383089:L91V;ENSP00000255310:L54V;ENSP00000375098:L54V;ENSP00000372437:L91V;ENSP00000372435:L91V	.	L	-	1	0	0	TPTE2	18946175	18946175	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.850000	0.04317	-0.793000	0.04475	-0.718000	0.03613	CTC	0.156627		TCGA-IB-7888-01A-11D-2154-08	0.294	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	42		42	41	1	1.960000	-2.146826	0	0.160000	NM_199254			6	6		463	449	0		1			0	0	42	0		0.961525	0	0	0	0	0	0	6	463
RCBTB2	1102	broad.mit.edu	37	13	49070346	49070346	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr13:49070346G>A	ENST00000344532.3	-	14	1919	c.1496C>T	c.(1495-1497)gCg>gTg	p.A499V	RCBTB2_ENST00000430805.2_Missense_Mutation_p.A504V|RCBTB2_ENST00000544492.1_Missense_Mutation_p.A225V	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	499	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		ATACTTCACCGCAGCCGAGAG	0.478																																						ENST00000344532.3	0.880000	0.380000	7.500000e-01	4.800000e-01	0.600000	0.624406	0.600000	0.600000																										0				31						c.(1495-1497)gCg>gTg		regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2							86.0	81.0	83.0					13																	49070346		2203	4300	6503	SO:0001583	missense	1102	1	121386	30				g.chr13:49070346G>A	AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.1496C>T	chr13.hg19:g.49070346G>A	ENSP00000345144:p.Ala499Val	0					RCBTB2_ENST00000430805.2_Missense_Mutation_p.A504V|RCBTB2_ENST00000544492.1_Missense_Mutation_p.A225V	p.A499V	NM_001268.2	NP_001259.1	0	1	1	2.005752	O95199	RCBT2_HUMAN		14	1919	-		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	0	1	hg19	c.1496C>T	CCDS9411.1	0	.	.	.	.	.	.	.	.	.	.	g	14.03	2.412381	0.42817	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544492	T;T;D	0.84800	-1.03;-1.04;-1.9	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.86669	0.5988	M	0.82323	2.585	0.80722	D	1	P;P;P;P	0.40144	0.514;0.699;0.704;0.699	B;B;B;B	0.36244	0.086;0.22;0.137;0.22	D	0.89133	0.3511	10	0.66056	D	0.02	.	18.7477	0.91800	0.0:0.0:1.0:0.0	.	225;504;451;499	B4E372;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	V	499;451;504;504;225	ENSP00000345144:A499V;ENSP00000389910:A504V;ENSP00000443862:A225V	ENSP00000345144:A499V	A	-	2	0	0	RCBTB2	47968347	47968347	1.000000	0.71417	0.192000	0.23308	0.093000	0.18481	9.372000	0.97165	2.499000	0.84300	0.558000	0.71614	GCG	0.156627		TCGA-IB-7888-01A-11D-2154-08	0.478	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	0	0	1		27	4	2	1		1	1	44		44	43	1	1.960000	-2.885646	1	0.160000	NM_001268			20	20		391	388	0		0	1		1	0	44	0		0.174725	5.152384e-02	0	5	0	22	0	20	391
TBC1D4	9882	broad.mit.edu	37	13	75886933	75886933	+	Missense_Mutation	SNP	C	C	T	rs375938256		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr13:75886933C>T	ENST00000377636.3	-	13	2670	c.2324G>A	c.(2323-2325)cGc>cAc	p.R775H	TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Missense_Mutation_p.R712H|TBC1D4_ENST00000431480.2_Missense_Mutation_p.R767H	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	775					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GAGGAAAATGCGCTGCCGCCA	0.522																																						ENST00000377636.3	0.370000	0.070000	2.800000e-01	1.200000e-01	0.190000	0.210776	0.190000	0.180000																										0				50						c.(2323-2325)cGc>cAc		TBC1 domain family, member 4		C	HIS/ARG	0,3932		0,0,1966	79.0	82.0	81.0		2324	5.5	1.0	13		81	1,8305		0,1,4152	no	missense	TBC1D4	NM_014832.2	29	0,1,6118	TT,TC,CC		0.012,0.0,0.0082	probably-damaging	775/1299	75886933	1,12237	1966	4153	6119	SO:0001583	missense	9882	2	120902	36				g.chr13:75886933C>T	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.2324G>A	chr13.hg19:g.75886933C>T	ENSP00000366863:p.Arg775His	0					TBC1D4_ENST00000377625.2_Missense_Mutation_p.R712H|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000431480.2_Missense_Mutation_p.R767H	p.R775H	NM_014832.2	NP_055647.2	0	1	1	2.005752	O60343	TBCD4_HUMAN		13	2670	-		Prostate(6;0.014)|Breast(118;0.0982)	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	0	1	hg19	c.2324G>A	CCDS41901.1	0	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876178	0.91664	0.0	1.2E-4	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000413735	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.085211	0.48767	D	0.000171	T	0.64349	0.2590	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	P;D;D	0.65443	0.862;0.91;0.935	T	0.63804	-0.6554	10	0.59425	D	0.04	-12.7168	19.8372	0.96661	0.0:1.0:0.0:0.0	.	712;767;775	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	H	775;767;712;224	ENSP00000366863:R775H;ENSP00000395986:R767H;ENSP00000366852:R712H;ENSP00000396932:R224H	ENSP00000366852:R712H	R	-	2	0	0	TBC1D4	74784934	74784934	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.095000	0.64529	2.770000	0.95276	0.655000	0.94253	CGC	0.156627		TCGA-IB-7888-01A-11D-2154-08	0.522	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	0	0	1		2	2	2	0		0	0	42		42	42	1	1.960000	-2.560475	1	0.160000	NM_014832			6	6		400	396	0		1	0		0	0	42	0		0.964437	6.299263e-02	0	0	0	23	0	6	400
STRN3	29966	broad.mit.edu	37	14	31376184	31376184	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr14:31376184C>T	ENST00000357479.5	-	14	1983	c.1787G>A	c.(1786-1788)gGc>gAc	p.G596D	STRN3_ENST00000355683.5_Missense_Mutation_p.G512D	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	596					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		ATTTTTTATGCCACTATAAGC	0.368																																						ENST00000357479.5	0.280000	0.040000	2.100000e-01	8.000000e-02	0.130000	0.149249	0.130000	0.120000																										0				20						c.(1786-1788)gGc>gAc		striatin, calmodulin binding protein 3							115.0	110.0	112.0					14																	31376184		2203	4300	6503	SO:0001583	missense	29966	0	0					g.chr14:31376184C>T		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1787G>A	chr14.hg19:g.31376184C>T	ENSP00000350071:p.Gly596Asp	1					STRN3_ENST00000355683.5_Missense_Mutation_p.G512D	p.G596D	NM_001083893.1	NP_001077362.1	0	1	1	1.874017	Q13033	STRN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	14	1983	-	Hepatocellular(127;0.0877)|Breast(36;0.148)		A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	0	1	hg19	c.1787G>A	CCDS41938.1	0	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743342	0.89663	.	.	ENSG00000196792	ENST00000355683;ENST00000357479	T;T	0.59502	0.26;0.26	5.73	5.73	0.89815	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58495	0.2126	N	0.10733	0.035	0.80722	D	1	P;D	0.64830	0.762;0.994	B;D	0.66351	0.343;0.943	T	0.61322	-0.7086	10	0.30854	T	0.27	-5.1717	19.9019	0.96988	0.0:1.0:0.0:0.0	.	512;596	Q13033-2;Q13033	.;STRN3_HUMAN	D	512;596	ENSP00000347909:G512D;ENSP00000350071:G596D	ENSP00000347909:G512D	G	-	2	0	0	STRN3	30445935	30445935	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.498000	0.60373	2.706000	0.92434	0.563000	0.77884	GGC	0.113176		TCGA-IB-7888-01A-11D-2154-08	0.368	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	0	0	1		2	2	2	0		0	0	32		32	31	1	1.960000	-2.050533	0	0.160000	NM_014574			5	5		461	456	0		1	0		0	0	32	0		0.936073	3.527353e-02	0	0	0	22	0	5	461
TGM7	116179	broad.mit.edu	37	15	43579655	43579655	+	Splice_Site	SNP	T	T	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr15:43579655T>C	ENST00000452443.2	-	6	692	c.688A>G	c.(688-690)Atc>Gtc	p.I230V		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	230					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TTGCTGTTGATCTGCAGAGGA	0.597																																						ENST00000452443.2	1.000000	0.780000	1	9.200000e-01	0.990000	0.972449	0.990000	1.000000																										0				39						c.(688-690)Atc>Gtc		transglutaminase 7	L-Glutamine(DB00130)						104.0	92.0	96.0					15																	43579655		2202	4299	6501	SO:0001630	splice_region_variant	116179	0	0					g.chr15:43579655T>C	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.688-1A>G	chr15.hg19:g.43579655T>C		0						p.I230V	NM_052955.2	NP_443187.1	0	1	1	2.000515	Q96PF1	TGM7_HUMAN		6	692	-		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		Splice_Site	SNP	ENST00000452443.2	1	0	hg19	c.688A>G	CCDS32213.1	1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.647826	0.47258	.	.	ENSG00000159495	ENST00000452443	D	0.84589	-1.87	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.051682	0.85682	D	0.000000	D	0.85133	0.5627	L	0.28608	0.87	0.39793	D	0.972465	D	0.64830	0.994	D	0.72625	0.978	T	0.80848	-0.1199	10	0.02654	T	1	-28.5987	13.9677	0.64218	0.0:0.0:0.0:1.0	.	230	Q96PF1	TGM7_HUMAN	V	230	ENSP00000389466:I230V	ENSP00000389466:I230V	I	-	1	0	0	TGM7	41366947	41366947	0.998000	0.40836	1.000000	0.80357	0.843000	0.47879	0.496000	0.22499	2.189000	0.69895	0.533000	0.62120	ATC	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.597	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	1	0	1		2	2	2	0		0	0	52		52	52	1	1.960000	-20.000000	1	0.160000	NM_052955	Missense_Mutation		37	36		385	378	0		1			0	0	52	0		1.000000	0	0	0	0	0	0	37	385
PYGO1	26108	broad.mit.edu	37	15	55838323	55838323	+	Silent	SNP	T	T	C	rs559608416	byFrequency	TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr15:55838323T>C	ENST00000302000.6	-	3	1252	c.1158A>G	c.(1156-1158)gcA>gcG	p.A386A	PYGO1_ENST00000563719.1_Silent_p.A386A	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	386	Interaction with BCL9.|Interaction with H3K4me2.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		ATACTGCAGATGCTTCTGCAG	0.458													T|||	3	0.000599042	0.0	0.0	5008	,	,		20151	0.0		0.0	False		,,,				2504	0.0031					ENST00000302000.6	1.000000	0.670000	1	7.900000e-01	0.920000	0.907506	0.920000	1.000000																										0				27						c.(1156-1158)gcA>gcG		pygopus family PHD finger 1							120.0	101.0	108.0					15																	55838323		2193	4292	6485	SO:0001819	synonymous_variant	26108	10	121412	40				g.chr15:55838323T>C	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.1158A>G	chr15.hg19:g.55838323T>C		0					PYGO1_ENST00000563719.1_Silent_p.A386A	p.A386A	NM_015617.1	NP_056432.1	0	1	1	2.000515	Q9Y3Y4	PYGO1_HUMAN		3	1252	-			A7Y2D6	Silent	SNP	ENST00000302000.6	1	1	hg19	c.1158A>G	CCDS10155.1	1																																																																																								0.155270		TCGA-IB-7888-01A-11D-2154-08	0.458	PYGO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254977.2	1	0	1		2	2	2	0		0	0	39		39	38	1	1.960000	-20.000000	1	0.160000	NM_015617			40	40		495	489	0		1	0		0	0	39	0		1.000000	7.181526e-02	0	0	0	6	0	40	495
ALDH1A3	220	broad.mit.edu	37	15	101438319	101438319	+	Missense_Mutation	SNP	G	G	A	rs147665432		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr15:101438319G>A	ENST00000329841.5	+	8	1344	c.812G>A	c.(811-813)cGg>cAg	p.R271Q	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.R164Q|RP11-66B24.4_ENST00000560351.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	271					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	GCTGCGTCCCGGAGCAATCTG	0.557																																						ENST00000329841.5	1.000000	0.700000	1	8.400000e-01	0.990000	0.944883	0.990000	1.000000																										0				27						c.(811-813)cGg>cAg		aldehyde dehydrogenase 1 family, member A3	Vitamin A(DB00162)	G	GLN/ARG	0,4406		0,0,2203	78.0	74.0	75.0		812	1.0	0.0	15	dbSNP_134	75	3,8597	3.0+/-9.4	0,3,4297	no	missense	ALDH1A3	NM_000693.2	43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	271/513	101438319	3,13003	2203	4300	6503	SO:0001583	missense	220	9	121412	40				g.chr15:101438319G>A	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.812G>A	chr15.hg19:g.101438319G>A	ENSP00000332256:p.Arg271Gln	0					RP11-66B24.4_ENST00000560351.1_RNA|ALDH1A3_ENST00000346623.6_Missense_Mutation_p.R164Q	p.R271Q	NM_000693.2	NP_000684.2	0	1	1	1.999187	P47895	AL1A3_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)	8	1344	+	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		Q6NT64	Missense_Mutation	SNP	ENST00000329841.5	1	1	hg19	c.812G>A	CCDS10389.1	1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886741	0.51908	0.0	3.49E-4	ENSG00000184254	ENST00000329841;ENST00000346623	T	0.15603	2.41	5.76	1.03	0.20045	5.76	1.03	0.20045	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.354015	0.32935	N	0.005464	T	0.07818	0.0196	N	0.14661	0.345	0.09310	N	1	B;B	0.25521	0.128;0.001	B;B	0.22753	0.041;0.001	T	0.22208	-1.0223	10	0.48119	T	0.1	.	3.9817	0.09498	0.387:0.0:0.4484:0.1646	.	175;271	Q7Z3A2;P47895	.;AL1A3_HUMAN	Q	271;175	ENSP00000332256:R271Q	ENSP00000332256:R271Q	R	+	2	0	0	ALDH1A3	99255842	99255842	0.817000	0.29147	0.003000	0.11579	0.960000	0.62799	2.008000	0.40893	0.296000	0.22592	0.555000	0.69702	CGG	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.557	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2	1	0	1		2	2	2	0		0	0	29		29	29	1	1.960000	-2.920853	1	0.160000				29	29		324	321	0		1	0		0	0	29	0		1.000000	9.996826e-01	0	0	0	140	0	29	324
KIAA0430	9665	broad.mit.edu	37	16	15728761	15728761	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr16:15728761C>T	ENST00000396368.3	-	4	1065	c.859G>A	c.(859-861)Gct>Act	p.A287T	KIAA0430_ENST00000540441.2_Missense_Mutation_p.A287T|KIAA0430_ENST00000602337.1_Missense_Mutation_p.A287T|KIAA0430_ENST00000548025.1_Missense_Mutation_p.A287T|KIAA0430_ENST00000344181.3_Missense_Mutation_p.A109T|KIAA0430_ENST00000551742.1_Missense_Mutation_p.A287T	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	287					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CAGACTTTAGCCGCATCGATT	0.418																																						ENST00000396368.3	0.280000	0.070000	2.200000e-01	1.000000e-01	0.150000	0.168639	0.150000	0.150000																										0				40						c.(859-861)Gct>Act		KIAA0430							273.0	239.0	250.0					16																	15728761		1902	4119	6021	SO:0001583	missense	9665	0	0					g.chr16:15728761C>T	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.859G>A	chr16.hg19:g.15728761C>T	ENSP00000379654:p.Ala287Thr	0					KIAA0430_ENST00000602337.1_Missense_Mutation_p.A287T|KIAA0430_ENST00000344181.3_Missense_Mutation_p.A109T|KIAA0430_ENST00000540441.2_Missense_Mutation_p.A287T|KIAA0430_ENST00000548025.1_Missense_Mutation_p.A287T|KIAA0430_ENST00000551742.1_Missense_Mutation_p.A287T	p.A287T	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	0	1	1	2.005683	Q9Y4F3	MARF1_HUMAN		4	1065	-			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	0	1	hg19	c.859G>A	CCDS10562.2	0	.	.	.	.	.	.	.	.	.	.	C	19.81	3.895972	0.72639	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.42	5.42	0.78866	5.42	5.42	0.78866	.	0.211356	0.49916	D	0.000125	T	0.48223	0.1488	L	0.54323	1.7	0.25621	N	0.9864	P;P;P;P	0.48089	0.905;0.817;0.817;0.847	P;B;B;B	0.48654	0.585;0.295;0.295;0.381	T	0.48927	-0.8991	9	0.59425	D	0.04	.	15.1059	0.72322	0.0:0.8589:0.1411:0.0	.	286;287;286;286	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	T	287;287;286;109;287;287;287	.	ENSP00000315718:A286T	A	-	1	0	0	KIAA0430	15636262	15636262	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.818000	0.48041	2.695000	0.91970	0.655000	0.94253	GCT	0.156627		TCGA-IB-7888-01A-11D-2154-08	0.418	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	0	0	1		2	2	2	0		0	0	73		73	72	1	1.960000	-2.666207	1	0.160000	NM_014647			8	8		649	642	0		1	0		0	0	73	0		0.988951	9.480072e-02	0	0	0	37	0	8	649
SLC12A3	6559	broad.mit.edu	37	16	56920970	56920970	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr16:56920970G>A	ENST00000563236.1	+	17	2168	c.2143G>A	c.(2143-2145)Gag>Aag	p.E715K	SLC12A3_ENST00000262502.5_Missense_Mutation_p.E714K|SLC12A3_ENST00000438926.2_Missense_Mutation_p.E715K|SLC12A3_ENST00000566786.1_Missense_Mutation_p.E714K			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	715					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TGTCATTGCCGAGGACCTCCG	0.587																																						ENST00000563236.1	0.820000	0.360000	7.000000e-01	4.600000e-01	0.570000	0.586407	0.570000	0.560000																										0				50						c.(2143-2145)Gag>Aag		solute carrier family 12 (sodium/chloride transporter), member 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)						94.0	82.0	86.0					16																	56920970		2198	4300	6498	SO:0001583	missense	6559	2	121412	31				g.chr16:56920970G>A		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2143G>A	chr16.hg19:g.56920970G>A	ENSP00000456149:p.Glu715Lys	0					SLC12A3_ENST00000262502.5_Missense_Mutation_p.E714K|SLC12A3_ENST00000438926.2_Missense_Mutation_p.E715K|SLC12A3_ENST00000566786.1_Missense_Mutation_p.E714K	p.E715K			0	0	0	1.991807	P55017	S12A3_HUMAN		17	2168	+			A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	1	1	hg19	c.2143G>A	CCDS58464.1	0	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068187	0.55539	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.281585	0.38058	N	0.001840	T	0.51873	0.1700	N	0.21545	0.675	0.53688	D	0.999976	B;B;B	0.26258	0.145;0.051;0.085	B;B;B	0.21546	0.035;0.007;0.035	T	0.45175	-0.9279	9	0.39692	T	0.17	.	19.7573	0.96299	0.0:0.0:1.0:0.0	.	714;715;715	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	K	714;715	.	ENSP00000262502:E715K	E	+	1	0	0	SLC12A3	55478471	55478471	1.000000	0.71417	0.986000	0.45419	0.557000	0.35523	4.779000	0.62375	2.668000	0.90789	0.551000	0.68910	GAG	0.150485		TCGA-IB-7888-01A-11D-2154-08	0.587	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1	0	0	1		2	2	2	0		0	0	54		54	54	1	1.960000	-2.747607	1	0.160000				22	22		455	448	0		1	0		0	0	54	0		0.999999	6.952938e-03	0	0	0	3	0	22	455
DNAH9	1770	broad.mit.edu	37	17	11650990	11650990	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr17:11650990C>T	ENST00000262442.4	+	32	6585	c.6517C>T	c.(6517-6519)Cgg>Tgg	p.R2173W	DNAH9_ENST00000454412.2_Missense_Mutation_p.R2173W	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2173	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R2173W(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GATCATGAAACGGCGCCCCGT	0.542																																						ENST00000262442.4	0.900000	0.430000	7.800000e-01	5.200000e-01	0.640000	0.658160	0.640000	0.640000																										1	Substitution - Missense(1)	p.R2173W(1)	kidney(1)	290						c.(6517-6519)Cgg>Tgg		dynein, axonemal, heavy chain 9							91.0	84.0	86.0					17																	11650990		2203	4300	6503	SO:0001583	missense	1770	2	121412	34				g.chr17:11650990C>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6517C>T	chr17.hg19:g.11650990C>T	ENSP00000262442:p.Arg2173Trp	1					DNAH9_ENST00000454412.2_Missense_Mutation_p.R2173W	p.R2173W	NM_001372.3	NP_001363.2	0	1	1	1.871319	Q9NYC9	DYH9_HUMAN		32	6585	+		Breast(5;0.0122)|all_epithelial(5;0.131)	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	1	1	hg19	c.6517C>T	CCDS11160.1	0	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987431	0.74589	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.56103	0.48;0.48	4.5	3.52	0.40303	4.5	3.52	0.40303	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.385584	0.26638	N	0.023273	T	0.72447	0.3461	M	0.90542	3.125	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.75221	-0.3394	10	0.87932	D	0	.	8.0598	0.30627	0.1561:0.7625:0.0:0.0814	.	2173	Q9NYC9	DYH9_HUMAN	W	2173;2173;755	ENSP00000262442:R2173W;ENSP00000414874:R2173W	ENSP00000262442:R2173W	R	+	1	2	2	DNAH9	11591715	11591715	1.000000	0.71417	0.881000	0.34555	0.987000	0.75469	2.893000	0.48633	1.096000	0.41439	0.557000	0.71058	CGG	0.101027		TCGA-IB-7888-01A-11D-2154-08	0.542	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	1	0	1		2	2	2	0		0	0	55		55	55	1	1.960000	-20.000000	1	0.160000	NM_001372			25	25		425	417	0		1			0	0	55	0		1.000000	0	0	0	0	0	0	25	425
PIGS	94005	broad.mit.edu	37	17	26881272	26881272	+	Missense_Mutation	SNP	C	C	T	rs202057961	byFrequency	TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr17:26881272C>T	ENST00000308360.7	-	12	2009	c.1634G>A	c.(1633-1635)cGc>cAc	p.R545H	UNC119_ENST00000335765.4_5'Flank|UNC119_ENST00000484980.1_5'Flank|PIGS_ENST00000395346.2_Missense_Mutation_p.R537H|UNC119_ENST00000301032.4_5'Flank|PIGS_ENST00000543734.1_Missense_Mutation_p.R484H	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	545					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CCAGGACTTGCGGGTCTCCAG	0.547													c|||	14	0.00279553	0.0	0.0	5008	,	,		20239	0.0		0.0	False		,,,				2504	0.0143					ENST00000308360.7	1.000000	0.040000	2.000000e-01	7.000000e-02	0.120000	0.166374	0.120000	0.110000																										0				16						c.(1633-1635)cGc>cAc		phosphatidylinositol glycan anchor biosynthesis, class S							110.0	113.0	112.0					17																	26881272		2203	4300	6503	SO:0001583	missense	94005	156	121412	52				g.chr17:26881272C>T		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1634G>A	chr17.hg19:g.26881272C>T	ENSP00000309430:p.Arg545His	0					PIGS_ENST00000543734.1_Missense_Mutation_p.R484H|UNC119_ENST00000335765.4_5'Flank|PIGS_ENST00000395346.2_Missense_Mutation_p.R537H|UNC119_ENST00000301032.4_5'Flank|UNC119_ENST00000484980.1_5'Flank	p.R545H	NM_033198.3	NP_149975.1	1	2	3	2.007269	Q96S52	PIGS_HUMAN		12	2009	-	Lung NSC(42;0.00431)		Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	0	1	hg19	c.1634G>A	CCDS11235.1	0	.	.	.	.	.	.	.	.	.	.	c	10.96	1.499138	0.26861	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.46819	0.86;0.86;0.86	5.25	-1.09	0.09904	5.25	-1.09	0.09904	.	0.331862	0.33199	N	0.005180	T	0.43567	0.1253	M	0.79123	2.44	0.09310	N	1	B;B	0.14805	0.011;0.009	B;B	0.14578	0.011;0.01	T	0.42766	-0.9432	10	0.48119	T	0.1	-1.8876	8.6723	0.34159	0.0964:0.5151:0.0:0.3886	.	545;537	Q96S52;Q96S52-2	PIGS_HUMAN;.	H	537;545;484	ENSP00000378755:R537H;ENSP00000309430:R545H;ENSP00000438447:R484H	ENSP00000309430:R545H	R	-	2	0	0	PIGS	23905399	23905399	0.394000	0.25246	0.947000	0.38551	0.790000	0.44656	-0.430000	0.06973	-0.251000	0.09542	-1.733000	0.00692	CGC	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.547	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	0	0	1		2	2	2	0		0	0	81		81	81	1	1.960000	-1.828400	0	0.160000	NM_033198			5	5		552	543	0		1	0		0	0	81	0		0.935091	3.483103e-01	0	0	0	117	0	5	552
TP53	7157	broad.mit.edu	37	17	7578275	7578275	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr17:7578275G>A	ENST00000269305.4	-	6	763	c.574C>T	c.(574-576)Cag>Tag	p.Q192*	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q192*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q192*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	192	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q192*(83)|p.0?(8)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191del(4)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATAAGATGCTGAGGAGGGGCC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.850000	0.300000	7.000000e-01	4.100000e-01	0.540000	0.562971	0.540000	0.520000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		144	Substitution - Nonsense(95)|Deletion - In frame(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(6)|Unknown(6)|Insertion - Frameshift(1)|Complex - frameshift(1)|Substitution - Missense(1)	p.Q192*(83)|p.0?(8)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191del(4)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)	breast(26)|ovary(20)|urinary_tract(15)|lung(12)|upper_aerodigestive_tract(10)|skin(8)|biliary_tract(7)|oesophagus(7)|large_intestine(6)|kidney(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|liver(5)|bone(4)|central_nervous_system(3)|pancreas(2)|cervix(1)|endometrium(1)|eye(1)	24185						c.(574-576)Cag>Tag	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						89.0	80.0	83.0					17																	7578275		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578275G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.574C>T	chr17.hg19:g.7578275G>A	ENSP00000269305:p.Gln192*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q192*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q192*	p.Q192*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.871319	P04637	P53_HUMAN		6	763	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.574C>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269040	0.40095	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	3.36	0.38483	5.41	3.36	0.38483	.	0.242461	0.43260	D	0.000594	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.6404	8.6971	0.34303	0.0:0.1484:0.545:0.3066	.	.	.	.	X	192;192;192;192;192;192;181;99;60;99;60	.	ENSP00000269305:Q192X	Q	-	1	0	0	TP53	7519000	7519000	1.000000	0.71417	0.987000	0.45799	0.035000	0.12851	2.163000	0.42377	0.732000	0.32470	0.655000	0.94253	CAG	0.101027		TCGA-IB-7888-01A-11D-2154-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	6	0		0	0	46		46	46	1	1.960000	-4.489831	1	0.160000	NM_000546			13	13		266	265	0		1	1	1	0	1	46	1227		0.999557	5.685033e-01	9.999999e-01	2	89	37	1229	13	266
DNAH2	146754	broad.mit.edu	37	17	7680922	7680922	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr17:7680922G>A	ENST00000572933.1	+	33	6677	c.5217G>A	c.(5215-5217)tgG>tgA	p.W1739*	DNAH2_ENST00000389173.2_Nonsense_Mutation_p.W1739*			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1739	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTTTGACTGGCTCAGCCAAC	0.478																																						ENST00000572933.1	0.120000	0.020000	9.000000e-02	4.000000e-02	0.060000	0.071104	0.060000	0.070000																										0				189						c.(5215-5217)tgG>tgA		dynein, axonemal, heavy chain 2							250.0	239.0	243.0					17																	7680922		2203	4300	6503	SO:0001587	stop_gained	146754	0	0					g.chr17:7680922G>A	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.5217G>A	chr17.hg19:g.7680922G>A	ENSP00000458355:p.Trp1739*	1					DNAH2_ENST00000389173.2_Nonsense_Mutation_p.W1739*	p.W1739*			0	1	1	1.871319	Q9P225	DYH2_HUMAN		33	6677	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Nonsense_Mutation	SNP	ENST00000572933.1	0	1	hg19	c.5217G>A	CCDS32551.1	0	.	.	.	.	.	.	.	.	.	.	G	46	12.308359	0.99656	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	.	.	.	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1309	0.89600	0.0:0.0:1.0:0.0	.	.	.	.	X	1739	.	ENSP00000353818:W1739X	W	+	3	0	0	DNAH2	7621647	7621647	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.405000	0.97313	2.569000	0.86673	0.585000	0.79938	TGG	0.101027		TCGA-IB-7888-01A-11D-2154-08	0.478	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	0	0	1		2	2	2	0		0	0	215		215	212	1	1.960000	-2.444690	0	0.160000	NM_020877			10	10		1786	1772	0		1	0		0	0	215	0		0.996730	4.076339e-05	0	0	0	2	0	10	1786
HAP1	9001	broad.mit.edu	37	17	39883349	39883349	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr17:39883349C>T	ENST00000310778.5	-	10	1488	c.1479G>A	c.(1477-1479)acG>acA	p.T493T	HAP1_ENST00000393939.2_Silent_p.T416T|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Silent_p.T424T|HAP1_ENST00000347901.4_Silent_p.T441T			P54257	HAP1_HUMAN	huntingtin-associated protein 1	493	Glu-rich.		T -> M (may influence the age-at-onset of Huntington disease; increases binding to mutated HTT; influences HTT degradation; dbSNP:rs4523977). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:18192679}.		anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TCCTTAGAGACGTTCTGAGCT	0.577																																						ENST00000310778.5	1.000000	0.290000	1	5.200000e-01	0.850000	0.792522	0.850000	1.000000																										0				21						c.(1477-1479)acG>acA		huntingtin-associated protein 1							37.0	38.0	38.0					17																	39883349		2203	4300	6503	SO:0001819	synonymous_variant	9001	5	121276	34				g.chr17:39883349C>T	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1479G>A	chr17.hg19:g.39883349C>T		0					JUP_ENST00000540235.1_Intron|HAP1_ENST00000393939.2_Silent_p.T416T|HAP1_ENST00000347901.4_Silent_p.T441T|HAP1_ENST00000341193.5_Silent_p.T424T	p.T493T			1	2	3	2.007269	P54257	HAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)	10	1488	-		Breast(137;0.000162)	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Silent	SNP	ENST00000310778.5	0	1	hg19	c.1479G>A		1																																																																																								0.163347		TCGA-IB-7888-01A-11D-2154-08	0.577	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	0	0	1		2	2	2	0		0	0	10		10	10	1	1.960000	-8.658599	1	0.160000	NM_003949			4	4		59	58	0		1	0		0	0	10	0		0.888797	3.637100e-02	0	0	0	4	0	4	59
CILP2	148113	broad.mit.edu	37	19	19655205	19655205	+	Silent	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:19655205G>A	ENST00000291495.5	+	8	1936	c.1851G>A	c.(1849-1851)tcG>tcA	p.S617S	CILP2_ENST00000586018.1_Silent_p.S623S	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	617						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						ACCTCACCTCGGCGGCGTCTG	0.697																																						ENST00000291495.5	1.000000	0.570000	9.000000e-01	6.600000e-01	0.770000	0.788764	0.770000	1.000000																										0				32						c.(1849-1851)tcG>tcA		cartilage intermediate layer protein 2							45.0	54.0	51.0					19																	19655205		2198	4295	6493	SO:0001819	synonymous_variant	148113	0	0					g.chr19:19655205G>A	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1851G>A	chr19.hg19:g.19655205G>A		0					CILP2_ENST00000586018.1_Silent_p.S623S	p.S617S	NM_153221.2	NP_694953.2	0	1	1	2.000492	Q8IUL8	CILP2_HUMAN		8	1936	+			Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	1	1	hg19	c.1851G>A	CCDS12405.1	0																																																																																								0.155270		TCGA-IB-7888-01A-11D-2154-08	0.697	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	1	0	1		2	2	2	0		0	0	95		95	94	1	1.960000	-3.017761	1	0.160000	NM_153221			42	42		626	613	0		1	0		0	0	95	0		1.000000	0	0	0	0	1	0	42	626
NPHS1	4868	broad.mit.edu	37	19	36322199	36322199	+	Splice_Site	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:36322199G>A	ENST00000378910.5	-	26	3385	c.3386C>T	c.(3385-3387)aCg>aTg	p.T1129M	NPHS1_ENST00000353632.6_Splice_Site_p.T1089M	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1129					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCACTTACCGTGGAGCTCTG	0.607																																						ENST00000378910.5	1.000000	0.530000	9.200000e-01	6.400000e-01	0.770000	0.783806	0.770000	1.000000																										0				74						c.(3385-3387)aCg>aTg		nephrosis 1, congenital, Finnish type (nephrin)							81.0	73.0	76.0					19																	36322199		2203	4300	6503	SO:0001630	splice_region_variant	4868	2	121412	39				g.chr19:36322199G>A		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3387+1C>T	chr19.hg19:g.36322199G>A		0					NPHS1_ENST00000353632.6_Splice_Site_p.T1089M	p.T1129M	NM_004646.3	NP_004637.1	0	1	1	2.000492	O60500	NPHN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)	26	3385	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		A6NDH2|C3RX61	Splice_Site	SNP	ENST00000378910.5	1	0	hg19	c.3386C>T	CCDS32996.1	0	.	.	.	.	.	.	.	.	.	.	G	6.172	0.399943	0.11696	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.75154	-0.79;-0.91	5.07	1.79	0.24919	5.07	1.79	0.24919	.	0.218040	0.40144	N	0.001180	T	0.57227	0.2039	L	0.29908	0.895	0.23969	N	0.996316	B	0.13145	0.007	B	0.11329	0.006	T	0.41324	-0.9515	10	0.29301	T	0.29	-2.7895	7.28	0.26306	0.2727:0.0:0.7273:0.0	.	1129	O60500	NPHN_HUMAN	M	1129;1089	ENSP00000368190:T1129M;ENSP00000343634:T1089M	ENSP00000343634:T1089M	T	-	2	0	0	NPHS1	41014039	41014039	0.000000	0.05858	0.392000	0.26245	0.023000	0.10783	-0.642000	0.05427	0.336000	0.23639	0.442000	0.29010	ACG	0.155270		TCGA-IB-7888-01A-11D-2154-08	0.607	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1	1	0	1		2	2	2	0		0	0	63		63	60	1	1.960000	-7.324553	1	0.160000		Missense_Mutation		30	30		451	449	0		1	0		0	0	63	0		1.000000	0	0	0	0	1	0	30	451
TYROBP	7305	broad.mit.edu	37	19	36398352	36398352	+	Silent	SNP	C	C	T	rs368476838		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:36398352C>T	ENST00000262629.4	-	3	291	c.225G>A	c.(223-225)gcG>gcA	p.A75A	TYROBP_ENST00000585901.2_Silent_p.A75A|TYROBP_ENST00000424586.3_Silent_p.A64A|TYROBP_ENST00000589517.1_Silent_p.A75A|TYROBP_ENST00000544690.2_Silent_p.A64A	NM_003332.3|NM_198125.2	NP_003323.1|NP_937758.1	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein	75					axon guidance (GO:0007411)|cellular defense response (GO:0006968)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|regulation of immune response (GO:0050776)|regulation of osteoclast development (GO:2001204)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|large_intestine(1)|lung(4)|skin(1)	8	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACTCACCCTCCGCAGCCCCTC	0.632																																						ENST00000262629.4	0.850000	0.410000	7.400000e-01	5.000000e-01	0.610000	0.627357	0.610000	0.610000																										0				8						c.(223-225)gcG>gcA		TYRO protein tyrosine kinase binding protein		C	,,,	0,4404		0,0,2202	35.0	42.0	40.0		192,192,225,225	-7.4	0.0	19		40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TYROBP	NM_001173514.1,NM_001173515.1,NM_003332.3,NM_198125.2	,,,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,,	64/103,64/102,75/114,75/113	36398352	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	7305	6	121408	39				g.chr19:36398352C>T	AF019563	CCDS12482.1, CCDS46058.1, CCDS54255.1, CCDS59378.1	19q13.1	2014-09-17				ENSG00000011600			12449	protein-coding gene	gene with protein product	"""killer activating receptor associated protein"", ""DNAX-activation protein 12"""	604142		PLOSL		9490415, 10888890	Standard	NM_003332		Approved	DAP12, PLO-SL, KARAP	uc002ocm.3	O43914		ENST00000262629.4:c.225G>A	chr19.hg19:g.36398352C>T		0					TYROBP_ENST00000589517.1_Silent_p.A75A|TYROBP_ENST00000424586.3_Silent_p.A64A|TYROBP_ENST00000585901.2_Silent_p.A75A|TYROBP_ENST00000544690.2_Silent_p.A64A	p.A75A	NM_003332.3|NM_198125.2	NP_003323.1|NP_937758.1	0	1	1	2.000492	O43914	TYOBP_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)	3	291	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		A8K2X0|F5H389|Q6FGA5|Q9UMT3	Silent	SNP	ENST00000262629.4	1	1	hg19	c.225G>A	CCDS12482.1	0																																																																																								0.155270		TCGA-IB-7888-01A-11D-2154-08	0.632	TYROBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457397.1	1	0	1		2	2	2	0		0	0	50		50	48	1	1.960000	-3.144665	1	0.160000				28	27		539	531	0		1	0		0	0	50	0		1.000000	9.999998e-01	0	1	0	475	0	28	539
AXL	558	broad.mit.edu	37	19	41745081	41745081	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:41745081A>G	ENST00000301178.4	+	9	1337	c.1147A>G	c.(1147-1149)Ata>Gta	p.I383V	AXL_ENST00000359092.3_Missense_Mutation_p.I383V|AXL_ENST00000593513.1_Missense_Mutation_p.I115V	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	383	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GCTAATGGACATAGGGCTAAG	0.572																																						ENST00000301178.4	1.000000	0.550000	1	6.900000e-01	0.870000	0.858844	0.870000	1.000000																										0				48						c.(1147-1149)Ata>Gta		AXL receptor tyrosine kinase							139.0	102.0	114.0					19																	41745081		2203	4300	6503	SO:0001583	missense	558	0	0					g.chr19:41745081A>G	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1147A>G	chr19.hg19:g.41745081A>G	ENSP00000301178:p.Ile383Val	0					AXL_ENST00000359092.3_Missense_Mutation_p.I383V|AXL_ENST00000593513.1_Missense_Mutation_p.I115V	p.I383V	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	1	2	3	2.007548	P30530	UFO_HUMAN		9	1337	+			Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	1	1	hg19	c.1147A>G	CCDS12575.1	1	.	.	.	.	.	.	.	.	.	.	a	1.232	-0.623935	0.03636	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.57107	0.42;0.42	4.31	-2.42	0.06542	4.31	-2.42	0.06542	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.576798	0.16485	N	0.212370	T	0.27489	0.0675	N	0.17312	0.475	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31888	-0.9927	10	0.05959	T	0.93	-1.1005	11.2374	0.48949	0.2549:0.0:0.7451:0.0	.	383;383	P30530-2;P30530	.;UFO_HUMAN	V	383	ENSP00000301178:I383V;ENSP00000351995:I383V	ENSP00000301178:I383V	I	+	1	0	0	AXL	46436921	46436921	0.002000	0.14202	0.135000	0.22099	0.952000	0.60782	-0.610000	0.05629	-0.465000	0.06953	0.317000	0.21355	ATA	0.166005		TCGA-IB-7888-01A-11D-2154-08	0.572	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2	1	0	1		2	2	2	0		0	0	32		32	32	1	1.960000	-19.999980	1	0.160000				20	20		274	270	0		1	0		0	0	32	0		0.999995	9.415436e-01	0	0	0	68	0	20	274
MEGF8	1954	broad.mit.edu	37	19	42873053	42873053	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:42873053C>T	ENST00000251268.6	+	37	6540	c.6540C>T	c.(6538-6540)gaC>gaT	p.D2180D	MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Silent_p.D2113D	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2180	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCCCTGAGGACGAGTGTGCAA	0.612																																						ENST00000251268.6	1.000000	0.550000	9.900000e-01	6.700000e-01	0.800000	0.813853	0.800000	1.000000																										0				50						c.(6538-6540)gaC>gaT		multiple EGF-like-domains 8							85.0	91.0	89.0					19																	42873053		2203	4300	6503	SO:0001819	synonymous_variant	1954	12	121408	41				g.chr19:42873053C>T	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6540C>T	chr19.hg19:g.42873053C>T		0					MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Silent_p.D2113D	p.D2180D	NM_001271938.1	NP_001258867.1	1	2	3	2.007548	Q7Z7M0	MEGF8_HUMAN		37	6540	+		Prostate(69;0.00682)	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	1	1	hg19	c.6540C>T		0																																																																																								0.166005		TCGA-IB-7888-01A-11D-2154-08	0.612	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	1	0	1		2	2	2	0		0	0	58		58	58	1	1.960000	-3.221907	1	0.160000	NM_001410			31	31		462	457	0		1	0		0	0	58	0		1.000000	1.125161e-01	0	0	0	9	0	31	462
ZNF155	7711	broad.mit.edu	37	19	44495748	44495748	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:44495748C>G	ENST00000270014.2	+	3	192	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V	ZNF155_ENST00000590615.1_Missense_Mutation_p.L22V|ZNF155_ENST00000407951.2_Missense_Mutation_p.L33V	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	22	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				TGAGGAGGAGCTGGGGCTGCT	0.532																																					NSCLC(61;554 1277 20909 42067 42312)	ENST00000270014.2	0.540000	0.300000	4.800000e-01	3.500000e-01	0.410000	0.423340	0.410000	0.410000																										0				15						c.(64-66)Ctg>Gtg		zinc finger protein 155							239.0	221.0	227.0					19																	44495748		2203	4297	6500	SO:0001583	missense	7711	2	121412	31				g.chr19:44495748C>G	U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.64C>G	chr19.hg19:g.44495748C>G	ENSP00000270014:p.Leu22Val	0					ZNF155_ENST00000590615.1_Missense_Mutation_p.L22V|ZNF155_ENST00000407951.2_Missense_Mutation_p.L33V	p.L22V	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	0	1	1	2.005789	Q12901	ZN155_HUMAN		3	192	+		Prostate(69;0.0352)	A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Missense_Mutation	SNP	ENST00000270014.2	1	1	hg19	c.64C>G	CCDS12634.1	0	.	.	.	.	.	.	.	.	.	.	c	13.84	2.356298	0.41700	.	.	ENSG00000204920	ENST00000407951;ENST00000270014	T;T	0.01787	4.64;4.64	1.64	1.64	0.23874	1.64	1.64	0.23874	Krueppel-associated box (4);	.	.	.	.	T	0.06508	0.0167	M	0.68317	2.08	0.23546	N	0.997442	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.996	T	0.30475	-0.9977	9	0.87932	D	0	.	3.5586	0.07873	0.0:0.6202:0.0:0.3798	.	33;22	B4DM95;Q12901	.;ZN155_HUMAN	V	33;22	ENSP00000385163:L33V;ENSP00000270014:L22V	ENSP00000270014:L22V	L	+	1	2	2	ZNF155	49187588	49187588	0.980000	0.34600	1.000000	0.80357	0.940000	0.58332	-0.002000	0.12924	1.202000	0.43218	0.462000	0.41574	CTG	0.156627		TCGA-IB-7888-01A-11D-2154-08	0.532	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	0	0	1		2	2	2	0		0	0	167		167	165	1	1.960000	-2.880287	1	0.160000	NM_003445			44	42		1272	1249	0		1	0		0	0	167	0		1.000000	1.620949e-02	0	1	0	5	0	44	1272
CD33	945	broad.mit.edu	37	19	51728620	51728620	+	Missense_Mutation	SNP	C	C	T	rs138300409	byFrequency	TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:51728620C>T	ENST00000262262.4	+	2	205	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	CD33_ENST00000391796.3_Missense_Mutation_p.R62W|CD33_ENST00000421133.2_Intron|CD33_ENST00000436584.2_Intron	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	62	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TTACTGGTTCCGGGAAGGAGC	0.537													c|||	2	0.000399361	0.0015	0.0	5008	,	,		19244	0.0		0.0	False		,,,				2504	0.0					ENST00000262262.4	1.000000	0.770000	1	8.800000e-01	0.990000	0.959666	0.990000	1.000000																										0				24						c.(184-186)Cgg>Tgg		CD33 molecule	Gemtuzumab ozogamicin(DB00056)	C	,TRP/ARG,TRP/ARG	12,4394		0,12,2191	84.0	84.0	84.0		,184,184	2.4	0.3	19	dbSNP_134	84	0,8600		0,0,4300	yes	intron,missense,missense	CD33	NM_001082618.1,NM_001177608.1,NM_001772.3	,101,101	0,12,6491	TT,TC,CC		0.0,0.2724,0.0923	,possibly-damaging,possibly-damaging	,62/311,62/365	51728620	12,12994	2203	4300	6503	SO:0001583	missense	945	34	121412	48				g.chr19:51728620C>T	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.184C>T	chr19.hg19:g.51728620C>T	ENSP00000262262:p.Arg62Trp	0					CD33_ENST00000421133.2_Intron|CD33_ENST00000436584.2_Intron|CD33_ENST00000391796.3_Missense_Mutation_p.R62W	p.R62W	NM_001772.3	NP_001763.3	0	1	1	2.005789	P20138	CD33_HUMAN		2	205	+		all_neural(266;0.0199)	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	ENST00000262262.4	1	1	hg19	c.184C>T	CCDS33084.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	.	13.98	2.398956	0.42512	0.002724	0.0	ENSG00000105383	ENST00000262262;ENST00000391796	T;T	0.70986	-0.53;-0.53	3.49	2.41	0.29592	3.49	2.41	0.29592	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.872790	0.03872	N	0.275685	T	0.78641	0.4315	M	0.84433	2.695	0.34210	D	0.674215	P;P	0.52061	0.95;0.908	B;P	0.47162	0.32;0.54	T	0.71424	-0.4597	10	0.59425	D	0.04	.	8.0281	0.30448	0.2431:0.7569:0.0:0.0	.	62;62	F8WAL2;P20138	.;CD33_HUMAN	W	62	ENSP00000262262:R62W;ENSP00000375673:R62W	ENSP00000262262:R62W	R	+	1	2	2	CD33	56420432	56420432	0.000000	0.05858	0.293000	0.24932	0.544000	0.35116	-0.589000	0.05767	0.778000	0.33520	0.655000	0.94253	CGG	0.156627		TCGA-IB-7888-01A-11D-2154-08	0.537	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	1	0	1		2	2	2	0		0	0	60		60	60	1	1.960000	-2.774725	1	0.160000	NM_001772			53	52		594	585	0		1	0		0	0	60	0		1.000000	2.000260e-01	0	0	0	10	0	53	594
ZNF480	147657	broad.mit.edu	37	19	52825191	52825191	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:52825191C>T	ENST00000595962.1	+	5	754	c.688C>T	c.(688-690)Cct>Tct	p.P230S	ZNF480_ENST00000334564.7_Missense_Mutation_p.P187S|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000490272.1_3'UTR|ZNF480_ENST00000335090.6_Missense_Mutation_p.P153S	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		TGTAGAGAAACCTTACAAATG	0.358																																						ENST00000595962.1	1.000000	0.540000	1	6.800000e-01	0.840000	0.840870	0.840000	1.000000																										0				12						c.(688-690)Cct>Tct		zinc finger protein 480							55.0	56.0	56.0					19																	52825191		2203	4300	6503	SO:0001583	missense	147657	0	0					g.chr19:52825191C>T	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.688C>T	chr19.hg19:g.52825191C>T	ENSP00000471754:p.Pro230Ser	0					ZNF480_ENST00000334564.7_Missense_Mutation_p.P187S|ZNF480_ENST00000490272.1_3'UTR|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000335090.6_Missense_Mutation_p.P153S	p.P230S	NM_144684.2	NP_653285.2	1	2	3	2.034393	Q8WV37	ZN480_HUMAN		5	754	+			Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	1	1	hg19	c.688C>T	CCDS12850.2	0	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385181	0.25031	.	.	ENSG00000198464	ENST00000468240;ENST00000334564;ENST00000335090	T;T;T	0.28454	1.61;1.61;1.61	1.99	1.99	0.26369	1.99	1.99	0.26369	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25791	0.0628	L	0.49640	1.575	0.24874	N	0.992269	B;B	0.28552	0.215;0.097	B;B	0.23852	0.049;0.026	T	0.22138	-1.0225	9	0.66056	D	0.02	.	7.3747	0.26821	0.0:1.0:0.0:0.0	.	187;230	F8WEZ9;Q8WV37	.;ZN480_HUMAN	S	230;187;153	ENSP00000417424:P230S;ENSP00000334164:P187S;ENSP00000335670:P153S	ENSP00000334164:P187S	P	+	1	0	0	ZNF480	57517003	57517003	0.000000	0.05858	0.041000	0.18516	0.050000	0.14768	0.441000	0.21611	1.080000	0.41073	0.467000	0.42956	CCT	0.169304		TCGA-IB-7888-01A-11D-2154-08	0.358	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3	1	0	1		2	2	2	0		0	0	51		51	51	1	1.960000	-20.000000	1	0.160000	NM_144684			24	24		347	342	0		1	0	0	0	0	51	0		1.000000	4.659431e-03	0	0	0	2	1	24	347
ZNF578	147660	broad.mit.edu	37	19	53015104	53015104	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:53015104G>C	ENST00000421239.2	+	6	1714	c.1470G>C	c.(1468-1470)aaG>aaC	p.K490N	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AGTGTCACAAGACCTTCAGTC	0.393																																						ENST00000421239.2	1.000000	0.110000	3.800000e-01	1.600000e-01	0.240000	0.330088	0.240000	0.220000																										0										c.(1468-1470)aaG>aaC		zinc finger protein 578							81.0	83.0	82.0					19																	53015104		2203	4300	6503	SO:0001583	missense	147660	0	0					g.chr19:53015104G>C	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1470G>C	chr19.hg19:g.53015104G>C	ENSP00000459216:p.Lys490Asn	0					CTD-3099C6.5_ENST00000599143.1_RNA	p.K490N	NM_001099694.1	NP_001093164.1	1	2	3	2.034393	Q96N58	ZN578_HUMAN		6	1714	+			B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	0	1	hg19	c.1470G>C	CCDS54310.1	0	.	.	.	.	.	.	.	.	.	.	-	11.14	1.552309	0.27739	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.54	0.276	0.15663	1.54	0.276	0.15663	.	.	.	.	.	T	0.64438	0.2598	M	0.85373	2.75	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.52208	-0.8606	7	.	.	.	.	3.0654	0.06213	0.1691:0.0:0.5654:0.2655	.	490	G3V4F6	.	N	490	.	.	K	+	3	2	2	ZNF578	57706916	57706916	0.001000	0.12720	0.000000	0.03702	0.074000	0.17049	-0.210000	0.09345	-0.031000	0.13781	0.306000	0.20318	AAG	0.169304		TCGA-IB-7888-01A-11D-2154-08	0.393	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	0	0	1		2	2	2	0		0	0	60		60	60	1	1.960000	-7.785121	1	0.160000	NM_152472			9	9		498	494	0		1	0		0	0	60	0		0.994088	0	0	0	0	1	0	9	498
OR7D4	125958	broad.mit.edu	37	19	9325369	9325369	+	Missense_Mutation	SNP	C	C	T	rs112089905		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:9325369C>T	ENST00000308682.2	-	1	173	c.145G>A	c.(145-147)Gtc>Atc	p.V49I		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						TCAGAGCTGACGGCCAGAATG	0.552																																						ENST00000308682.2	1.000000	0.060000	2.300000e-01	1.000000e-01	0.150000	0.198449	0.150000	0.140000																										0				26						c.(145-147)Gtc>Atc		olfactory receptor, family 7, subfamily D, member 4							81.0	76.0	78.0					19																	9325369		2203	4300	6503	SO:0001583	missense	125958	4	121412	40				g.chr19:9325369C>T		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.145G>A	chr19.hg19:g.9325369C>T	ENSP00000310488:p.Val49Ile	0						p.V49I	NM_001005191.2	NP_001005191.1	1	2	3	2.008981	Q8NG98	OR7D4_HUMAN		1	173	-			A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	0	1	hg19	c.145G>A	CCDS32901.1	0	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.485647	0.01018	.	.	ENSG00000174667	ENST00000308682	T	0.01422	4.91	4.0	-3.92	0.04155	4.0	-3.92	0.04155	GPCR, rhodopsin-like superfamily (1);	0.997135	0.08123	N	0.994431	T	0.00637	0.0021	N	0.02802	-0.49	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.46884	-0.9159	10	0.06625	T	0.88	.	7.4819	0.27411	0.0:0.4152:0.1191:0.4657	.	49	Q8NG98	OR7D4_HUMAN	I	49	ENSP00000310488:V49I	ENSP00000310488:V49I	V	-	1	0	0	OR7D4	9186369	9186369	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	-3.502000	0.00449	-1.075000	0.03129	-0.441000	0.05720	GTC	0.164013		TCGA-IB-7888-01A-11D-2154-08	0.552	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1	0	0	1		2	2	2	0		0	0	80		80	80	1	1.960000	-2.597637	1	0.160000				7	7		618	614	0		1			0	0	80	0		0.980242	0	0	0	0	0	0	7	618
VN1R4	317703	broad.mit.edu	37	19	53770125	53770125	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr19:53770125A>G	ENST00000311170.4	-	1	847	c.794T>C	c.(793-795)tTa>tCa	p.L265S	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	265					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		GTTCACCAGTAAACTATTGGG	0.453										HNSCC(26;0.072)																												ENST00000311170.4	1.000000	0.240000	7.000000e-01	3.400000e-01	0.470000	0.531349	0.470000	0.440000																										0				22						c.(793-795)tTa>tCa		vomeronasal 1 receptor 4							62.0	58.0	59.0					19																	53770125		2203	4300	6503	SO:0001583	missense	317703	12	121412	18				g.chr19:53770125A>G	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.794T>C	chr19.hg19:g.53770125A>G	ENSP00000310856:p.Leu265Ser	0	HNSCC(26;0.072)				CTD-2245F17.9_ENST00000599803.1_lincRNA	p.L265S	NM_173857.2	NP_776256.2	1	2	3	2.034393	Q7Z5H5	VN1R4_HUMAN		1	847	-			Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	ENST00000311170.4	1	1	hg19	c.794T>C	CCDS33099.1	0	.	.	.	.	.	.	.	.	.	.	A	7.798	0.713095	0.15306	.	.	ENSG00000228567	ENST00000311170	T	0.09723	2.95	2.28	-2.0	0.07433	2.28	-2.0	0.07433	GPCR, rhodopsin-like superfamily (1);	1.998760	0.03487	N	0.216036	T	0.14787	0.0357	M	0.66939	2.045	0.09310	N	1	P	0.34724	0.465	B	0.38458	0.274	T	0.31971	-0.9924	10	0.62326	D	0.03	.	4.3774	0.11277	0.4545:0.3629:0.0:0.1826	.	265	Q7Z5H5	VN1R4_HUMAN	S	265	ENSP00000310856:L265S	ENSP00000310856:L265S	L	-	2	0	0	VN1R4	58461937	58461937	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.932000	0.01554	-0.543000	0.06240	0.445000	0.29226	TTA	0.169304		TCGA-IB-7888-01A-11D-2154-08	0.453	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	0	0	1		2	2	2	0		0	0	35		35	35	1	1.960000	-3.073324	1	0.160000	NM_173857			11	10		303	299	0		1			0	0	35	0		0.998261	0	0	0	0	0	0	11	303
SCNN1D	6339	broad.mit.edu	37	1	1225872	1225872	+	Missense_Mutation	SNP	G	G	A	rs372237576		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr1:1225872G>A	ENST00000338555.2	+	11	2448	c.1304G>A	c.(1303-1305)cGc>cAc	p.R435H	SCNN1D_ENST00000325425.8_Missense_Mutation_p.R501H|SCNN1D_ENST00000400928.3_Missense_Mutation_p.R435H|SCNN1D_ENST00000379116.5_Missense_Mutation_p.R599H			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	435					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	TGCTTCTACCGCCTCTACCAG	0.667																																						ENST00000338555.2	1.000000	0.060000	2.400000e-01	9.000000e-02	0.150000	0.230713	0.150000	0.140000																										0				7						c.(1303-1305)cGc>cAc		sodium channel, non-voltage-gated 1, delta subunit	Amiloride(DB00594)|Triamterene(DB00384)	G	HIS/ARG	0,4388		0,0,2194	67.0	75.0	72.0		1796	-0.8	0.7	1		72	1,8589	1.2+/-3.3	0,1,4294	no	missense	SCNN1D	NM_001130413.3	29	0,1,6488	AA,AG,GG		0.0116,0.0,0.0077	benign	599/803	1225872	1,12977	2194	4295	6489	SO:0001583	missense	6339	29	120860	46				g.chr1:1225872G>A	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.1304G>A	chr1.hg19:g.1225872G>A	ENSP00000339504:p.Arg435His	0					SCNN1D_ENST00000379116.5_Missense_Mutation_p.R599H|SCNN1D_ENST00000325425.8_Missense_Mutation_p.R501H|SCNN1D_ENST00000400928.3_Missense_Mutation_p.R435H	p.R435H			1	2	3	2.027057	P51172	SCNND_HUMAN		11	2448	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Missense_Mutation	SNP	ENST00000338555.2	0	1	hg19	c.1304G>A		0	.	.	.	.	.	.	.	.	.	.	G	11.04	1.522663	0.27211	0.0	1.16E-4	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	4.05	-0.816	0.10839	4.05	-0.816	0.10839	.	1.672600	0.03725	N	0.252521	T	0.50820	0.1638	L	0.34521	1.04	0.19300	N	0.999974	P;P;P	0.47350	0.894;0.869;0.456	B;B;B	0.40565	0.273;0.333;0.018	T	0.49995	-0.8879	10	0.52906	T	0.07	.	7.7318	0.28791	0.5569:0.0:0.4431:0.0	.	257;435;599	B1AMF2;P51172;A6NNF7	.;SCNND_HUMAN;.	H	466;599;435;501;435	ENSP00000368411:R599H;ENSP00000339504:R435H;ENSP00000321594:R501H;ENSP00000383717:R435H	ENSP00000321594:R501H	R	+	2	0	0	SCNN1D	1215735	1215735	0.000000	0.05858	0.745000	0.31077	0.243000	0.25628	-0.215000	0.09279	-0.054000	0.13266	-0.350000	0.07774	CGC	0.167328		TCGA-IB-7888-01A-11D-2154-08	0.667	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000005802.2	0	0	1		2	2	2	0		0	0	95		95	92	1	1.960000	-2.715278	1	0.160000	NM_002978			7	7		634	545	0		1	0		0	0	95	0		0.967663	0	0	0	0	1	0	7	634
CSMD2	114784	broad.mit.edu	37	1	33999485	33999485	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr1:33999485C>T	ENST00000373381.4	-	63	10078	c.9902G>A	c.(9901-9903)cGt>cAt	p.R3301H		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTTTTGACAACGGAAGAGGAC	0.562																																						ENST00000373381.4	1.000000	0.550000	1	7.100000e-01	0.900000	0.871378	0.900000	1.000000																										0				246						c.(9901-9903)cGt>cAt		CUB and Sushi multiple domains 2							139.0	117.0	125.0					1																	33999485		2203	4300	6503	SO:0001583	missense	114784	8	121412	36				g.chr1:33999485C>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9902G>A	chr1.hg19:g.33999485C>T	ENSP00000362479:p.Arg3301His	0						p.R3301H	NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	0	1	1	2.003071	Q7Z408	CSMD2_HUMAN		63	10078	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	1	1	hg19	c.9902G>A		1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753862	0.49362	.	.	ENSG00000121904	ENST00000373381	T	0.64991	-0.13	5.33	3.45	0.39498	5.33	3.45	0.39498	Complement control module (2);Sushi/SCR/CCP (3);	0.324034	0.31010	N	0.008421	T	0.57140	0.2033	N	0.12961	0.28	0.80722	D	1	B;D	0.59357	0.014;0.985	B;D	0.65323	0.015;0.934	T	0.51411	-0.8709	10	0.20046	T	0.44	.	9.63	0.39774	0.0:0.7703:0.0:0.2297	.	3157;3301	Q7Z408;E7EUA6	CSMD2_HUMAN;.	H	3301	ENSP00000362479:R3301H	ENSP00000241312:R3157H	R	-	2	0	0	CSMD2	33772072	33772072	0.958000	0.32768	0.903000	0.35520	0.527000	0.34593	1.098000	0.31000	1.248000	0.43934	0.591000	0.81541	CGT	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.562	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	30		30	29	1	1.960000	-19.981070	1	0.160000	NM_052896			17	17		218	214	0		1			0	0	30	0		0.999965	0	0	0	0	0	0	17	218
GRIK3	2899	broad.mit.edu	37	1	37282815	37282815	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr1:37282815G>A	ENST00000373091.3	-	13	1953	c.1937C>T	c.(1936-1938)aCg>aTg	p.T646M	GRIK3_ENST00000373093.4_Missense_Mutation_p.T646M	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	646					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GATGATGAGCGTGAAGAACCA	0.547																																						ENST00000373091.3	1.000000	0.540000	9.200000e-01	6.500000e-01	0.780000	0.788689	0.780000	1.000000																										0				89						c.(1936-1938)aCg>aTg		glutamate receptor, ionotropic, kainate 3							175.0	151.0	159.0					1																	37282815		2203	4300	6503	SO:0001583	missense	2899	0	0					g.chr1:37282815G>A	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1937C>T	chr1.hg19:g.37282815G>A	ENSP00000362183:p.Thr646Met	0					GRIK3_ENST00000373093.4_Missense_Mutation_p.T646M	p.T646M	NM_000831.3	NP_000822.2	0	1	1	2.003071	Q13003	GRIK3_HUMAN		13	1953	-		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	1	1	hg19	c.1937C>T	CCDS416.1	0	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021642	0.93462	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	D;D	0.97455	-4.39;-4.39	5.74	5.74	0.90152	5.74	5.74	0.90152	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.98642	0.9545	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99402	1.0928	10	0.87932	D	0	.	19.9326	0.97124	0.0:0.0:1.0:0.0	.	646;646	A9Z1Z8;Q13003	.;GRIK3_HUMAN	M	646	ENSP00000362183:T646M;ENSP00000362185:T646M	ENSP00000362183:T646M	T	-	2	0	0	GRIK3	37055402	37055402	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.720000	0.93068	0.650000	0.86243	ACG	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.547	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	1	0	1		2	2	2	0		0	0	61		61	61	1	1.960000	-7.096011	1	0.160000	NM_000831			31	30		463	460	0		1	0		0	0	61	0		1.000000	4.232465e-03	0	0	0	2	0	31	463
PTBP2	58155	broad.mit.edu	37	1	97250690	97250690	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr1:97250690G>C	ENST00000426398.2	+	8	827	c.784G>C	c.(784-786)Gta>Cta	p.V262L	PTBP2_ENST00000609116.1_Missense_Mutation_p.V262L|PTBP2_ENST00000370198.1_Missense_Mutation_p.V262L|PTBP2_ENST00000370197.1_Missense_Mutation_p.V262L|PTBP2_ENST00000541987.1_Missense_Mutation_p.V231L|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000394184.3_Missense_Mutation_p.V273L	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	262					mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GAATTTGAATGTAAAATACAA	0.388																																						ENST00000426398.2	0.920000	0.430000	7.900000e-01	5.300000e-01	0.650000	0.666091	0.650000	0.640000																										0				26						c.(784-786)Gta>Cta		polypyrimidine tract binding protein 2							123.0	122.0	122.0					1																	97250690		2203	4300	6503	SO:0001583	missense	58155	0	0					g.chr1:97250690G>C	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.784G>C	chr1.hg19:g.97250690G>C	ENSP00000412788:p.Val262Leu	0					PTBP2_ENST00000370198.1_Missense_Mutation_p.V262L|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000541987.1_Missense_Mutation_p.V231L|PTBP2_ENST00000609116.1_Missense_Mutation_p.V262L|PTBP2_ENST00000370197.1_Missense_Mutation_p.V262L|PTBP2_ENST00000394184.3_Missense_Mutation_p.V273L	p.V262L	NM_021190.2	NP_067013.1	0	1	1	2.003071	Q9UKA9	PTBP2_HUMAN		8	827	+		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	1	1	hg19	c.784G>C	CCDS754.1	0	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652675	0.67472	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184;ENST00000541987;ENST00000394176	T;T;T;T;T;D	0.83837	0.25;0.29;0.3;0.25;0.29;-1.77	5.57	5.57	0.84162	5.57	5.57	0.84162	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.91164	0.7217	M	0.81341	2.54	0.80722	D	1	B;B;P;B;B;B	0.34800	0.06;0.339;0.469;0.006;0.004;0.046	B;P;P;B;B;B	0.59115	0.18;0.716;0.852;0.118;0.227;0.235	D	0.90767	0.4669	10	0.87932	D	0	.	19.5464	0.95299	0.0:0.0:1.0:0.0	.	270;273;262;262;262;262	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;PTBP2_HUMAN;.;.	L	262;262;262;262;273;231;252	ENSP00000236228:V262L;ENSP00000359217:V262L;ENSP00000359216:V262L;ENSP00000412788:V262L;ENSP00000377738:V273L;ENSP00000442475:V231L	ENSP00000236228:V262L	V	+	1	0	0	PTBP2	97023278	97023278	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.629000	0.89072	0.591000	0.81541	GTA	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.388	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1	1	0	1		2	2	2	0		0	0	55		55	55	1	1.960000	-5.277491	1	0.160000				24	24		435	431	0		1	0		0	0	55	0		1.000000	6.763151e-02	0	1	0	7	0	24	435
ZCCHC3	85364	broad.mit.edu	37	20	279077	279077	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr20:279077C>T	ENST00000382352.3	+	1	1341	c.850C>T	c.(850-852)Ccg>Tcg	p.P284S		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	284							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCTGGCCGTGCCGGTGAAAGT	0.627																																						ENST00000382352.3	1.000000	0.050000	2.200000e-01	9.000000e-02	0.140000	0.182398	0.140000	0.130000																										0				8						c.(850-852)Ccg>Tcg		zinc finger, CCHC domain containing 3							67.0	73.0	71.0					20																	279077		2125	4235	6360	SO:0001583	missense	85364	0	0					g.chr20:279077C>T	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.850C>T	chr20.hg19:g.279077C>T	ENSP00000371789:p.Pro284Ser	0						p.P284S	NM_033089.6	NP_149080	1	2	3	2.007114	Q9NUD5	ZCHC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(29;0.149)	1	1341	+		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	Q3B7J3|Q6NT79	Missense_Mutation	SNP	ENST00000382352.3	0	1	hg19	c.850C>T	CCDS42844.1	0	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003893	0.54254	.	.	ENSG00000177764	ENST00000382352	.	.	.	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.169587	0.37304	N	0.002143	T	0.49575	0.1565	N	0.11560	0.145	0.36834	D	0.887039	D	0.76494	0.999	D	0.66716	0.946	T	0.58346	-0.7652	9	0.52906	T	0.07	-21.2771	9.6167	0.39696	0.0:0.9079:0.0:0.0921	.	284	Q9NUD5	ZCHC3_HUMAN	S	284	.	ENSP00000371789:P284S	P	+	1	0	0	ZCCHC3	227077	227077	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.058000	0.41374	2.707000	0.92482	0.555000	0.69702	CCG	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.627	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1	0	0	1		2	2	2	0		0	0	59		59	59	1	1.960000	-2.079961	0	0.160000				6	6		572	562	0		1	0		0	0	59	0		0.963188	5.782568e-02	0	0	0	31	0	6	572
RALGAPA2	57186	broad.mit.edu	37	20	20493321	20493321	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr20:20493321A>C	ENST00000202677.7	-	32	4699	c.4692T>G	c.(4690-4692)atT>atG	p.I1564M		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1564					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						TTTGGCGCAAAATGACCTCAA	0.473																																						ENST00000202677.7	1.000000	0.460000	9.200000e-01	5.800000e-01	0.730000	0.745524	0.730000	1.000000																										0				54						c.(4690-4692)atT>atG		Ral GTPase activating protein, alpha subunit 2 (catalytic)							138.0	129.0	132.0					20																	20493321		1926	4143	6069	SO:0001583	missense	57186	0	0					g.chr20:20493321A>C	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.4692T>G	chr20.hg19:g.20493321A>C	ENSP00000202677:p.Ile1564Met	0						p.I1564M	NM_020343.3	NP_065076.2	1	2	3	2.007114	Q2PPJ7	RGPA2_HUMAN		32	4699	-			Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	1	1	hg19	c.4692T>G	CCDS46584.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.96|12.96	2.094340|2.094340	0.36952|0.36952	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000430436|ENST00000202677	.|D	.|0.93953	.|-3.32	5.97|5.97	-2.19|-2.19	0.07015|0.07015	5.97|5.97	-2.19|-2.19	0.07015|0.07015	.|.	.|0.185757	.|0.47093	.|D	.|0.000246	D|D	0.92967|0.92967	0.7762|0.7762	M|M	0.84326|0.84326	2.69|2.69	0.23150|0.23150	N|N	0.998215|0.998215	.|P;P;P	.|0.52463	.|0.745;0.953;0.852	.|B;P;P	.|0.54924	.|0.41;0.737;0.764	D|D	0.85470|0.85470	0.1172|0.1172	5|9	.|.	.|.	.|.	.|.	0.7294|0.7294	0.00955|0.00955	0.3729:0.2028:0.2455:0.1788|0.3729:0.2028:0.2455:0.1788	.|.	.|1402;1564;1564	.|A8MSM5;Q2PPJ7-2;Q2PPJ7	.|.;.;RGPA2_HUMAN	C|M	1381|1564	.|ENSP00000202677:I1564M	.|.	F|I	-|-	2|3	0|3	0|3	RALGAPA2|RALGAPA2	20441321|20441321	20441321|20441321	0.025000|0.025000	0.19082|0.19082	0.786000|0.786000	0.31890|0.31890	0.938000|0.938000	0.57974|0.57974	-0.042000|-0.042000	0.12063|0.12063	-0.312000|-0.312000	0.08741|0.08741	0.459000|0.459000	0.35465|0.35465	TTT|ATT	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.473	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	1	0	1		2	2	2	0		0	0	29		29	29	1	1.960000	-19.999920	1	0.160000	NM_020343			21	22		345	342	1		1	1		0	0	29	0		0.999998	5.994290e-01	0	8	0	26	0	21	345
KCNB1	3745	broad.mit.edu	37	20	47990860	47990860	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr20:47990860C>T	ENST00000371741.4	-	2	1403	c.1237G>A	c.(1237-1239)Gtc>Atc	p.V413I		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	413					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	AAGTTATTGACGATGATGGGG	0.507																																						ENST00000371741.4	1.000000	0.270000	5.800000e-01	3.500000e-01	0.450000	0.480415	0.450000	0.440000																										0				53						c.(1237-1239)Gtc>Atc		potassium voltage-gated channel, Shab-related subfamily, member 1	Dalfampridine(DB06637)						78.0	78.0	78.0					20																	47990860		2203	4300	6503	SO:0001583	missense	3745	0	0					g.chr20:47990860C>T	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1237G>A	chr20.hg19:g.47990860C>T	ENSP00000360806:p.Val413Ile	0						p.V413I	NM_004975.2	NP_004966.1	1	2	3	2.007114	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)	2	1403	-			Q14193	Missense_Mutation	SNP	ENST00000371741.4	1	1	hg19	c.1237G>A	CCDS13418.1	0	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910860	0.72983	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	D	0.97620	-4.46	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.132027	0.49305	D	0.000146	D	0.98388	0.9464	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.98623	1.0668	10	0.62326	D	0.03	.	20.2543	0.98414	0.0:1.0:0.0:0.0	.	413	Q14721	KCNB1_HUMAN	I	413;368	ENSP00000360806:V413I	ENSP00000360806:V413I	V	-	1	0	0	KCNB1	47424267	47424267	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	GTC	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.507	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	0	0	1		2	2	2	0		0	0	63		63	63	1	1.960000	-3.817906	1	0.160000	NM_004975			17	17		467	465	0		1			0	0	63	0		0.999965	0	0	0	0	0	0	17	467
ZNF70	7621	broad.mit.edu	37	22	24086567	24086567	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr22:24086567C>G	ENST00000341976.3	-	2	1221	c.761G>C	c.(760-762)tGt>tCt	p.C254S		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						ACATTCCTTACACTGATAAGG	0.512																																						ENST00000341976.3			0	0																														0				21						c.(760-762)tGt>tCt		zinc finger protein 70							69.0	67.0	67.0					22																	24086567		2203	4300	6503	SO:0001583	missense	7621	0	0					g.chr22:24086567C>G	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.761G>C	chr22.hg19:g.24086567C>G	ENSP00000339314:p.Cys254Ser							p.C254S	NM_021916.2	NP_068735.1					Q9UC06	ZNF70_HUMAN		2	1221	-				Missense_Mutation	SNP	ENST00000341976.3	1	1	hg19	c.761G>C	CCDS13812.1		.	.	.	.	.	.	.	.	.	.	C	19.48	3.836062	0.71373	.	.	ENSG00000187792	ENST00000341976	D	0.85171	-1.95	3.34	3.34	0.38264	3.34	3.34	0.38264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94248	0.8153	H	0.95884	3.735	0.42002	D	0.990899	D	0.89917	1.0	D	0.97110	1.0	D	0.95533	0.8605	9	0.87932	D	0	-14.9537	13.0199	0.58779	0.0:1.0:0.0:0.0	.	254	Q9UC06	ZNF70_HUMAN	S	254	ENSP00000339314:C254S	ENSP00000339314:C254S	C	-	2	0	0	ZNF70	22416567	22416567	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.099000	0.76981	2.175000	0.68902	0.456000	0.33151	TGT			TCGA-IB-7888-01A-11D-2154-08	0.512	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	1	0	1		2	2	2	0		0	0	26		26	26	1	1.960000	-19.985140	1	0.160000	NM_021916			20	21		360	358	0		1	0		0	0	26	0		0.999996	3.141319e-03	0	0	0	2	0	20	360
ZAP70	7535	broad.mit.edu	37	2	98354224	98354224	+	Missense_Mutation	SNP	G	G	A	rs150631046		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr2:98354224G>A	ENST00000264972.5	+	12	1702	c.1487G>A	c.(1486-1488)cGc>cAc	p.R496H	ZAP70_ENST00000442208.1_Missense_Mutation_p.R370H|ZAP70_ENST00000451498.2_Missense_Mutation_p.R189H|ZAP70_ENST00000463643.1_3'UTR	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	496	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CCCCAGGCCCGCTCAGCAGGG	0.627																																						ENST00000264972.5	0.190000	0.030000	1.400000e-01	6.000000e-02	0.090000	0.104071	0.090000	0.090000																										0				29						c.(1486-1488)cGc>cAc		zeta-chain (TCR) associated protein kinase 70kDa		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	78.0	88.0	85.0		1487,566	5.2	1.0	2	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZAP70	NM_001079.3,NM_207519.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	496/620,189/313	98354224	1,13005	2203	4300	6503	SO:0001583	missense	7535	1	121412	28				g.chr2:98354224G>A	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1487G>A	chr2.hg19:g.98354224G>A	ENSP00000264972:p.Arg496His	1					ZAP70_ENST00000451498.2_Missense_Mutation_p.R189H|ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.R370H	p.R496H	NM_001079.3	NP_001070.2	0	1	1	1.892716	P43403	ZAP70_HUMAN		12	1702	+			A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	0	1	hg19	c.1487G>A	CCDS33254.1	0	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206886	0.79127	0.0	1.16E-4	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	D;D;D	0.83250	-1.7;-1.7;-1.7	5.2	5.2	0.72013	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44902	D	0.000406	T	0.80839	0.4700	N	0.24115	0.695	0.51233	D	0.99991	D;D	0.76494	0.999;0.999	P;D	0.62955	0.864;0.909	T	0.75371	-0.3341	10	0.15952	T	0.53	.	10.1268	0.42654	0.0915:0.0:0.9085:0.0	.	370;496	P43403-3;P43403	.;ZAP70_HUMAN	H	496;370;189	ENSP00000264972:R496H;ENSP00000411141:R370H;ENSP00000400475:R189H	ENSP00000264972:R496H	R	+	2	0	0	ZAP70	97720656	97720656	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.334000	0.72944	2.610000	0.88304	0.655000	0.94253	CGC	0.119866		TCGA-IB-7888-01A-11D-2154-08	0.627	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1	0	0	1		2	2	2	0		0	0	94		94	91	1	1.960000	-2.317295	0	0.160000				6	6		787	770	0		1	0		0	0	94	0		0.962626	1.762158e-02	0	0	0	22	0	6	787
HOXD1	3231	broad.mit.edu	37	2	177054575	177054575	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr2:177054575C>T	ENST00000331462.4	+	2	915	c.692C>T	c.(691-693)gCg>gTg	p.A231V	HOXD-AS1_ENST00000425005.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000436126.1_RNA|HOXD-AS1_ENST00000413969.1_RNA|HOXD-AS1_ENST00000417086.1_RNA	NM_024501.2	NP_078777.1	Q9GZZ0	HXD1_HUMAN	homeobox D1	231					embryonic skeletal system development (GO:0048706)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		CCCTCCAGCGCGATCCGCACG	0.557																																						ENST00000331462.4	1.000000	0.100000	2.600000e-01	1.400000e-01	0.190000	0.238081	0.190000	0.190000																										0				10						c.(691-693)gCg>gTg		homeobox D1							90.0	102.0	98.0					2																	177054575		2203	4300	6503	SO:0001583	missense	3231	1	121412	33				g.chr2:177054575C>T		CCDS2271.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128645	ENSG00000128645		"""Homeoboxes / ANTP class : HOXL subclass"""	5132	protein-coding gene	gene with protein product		142987	"""homeo box D1"""	HOX4, HOX4G		1973146, 1358459	Standard	NM_024501		Approved		uc002ukv.5	Q9GZZ0	OTTHUMG00000132512	ENST00000331462.4:c.692C>T	chr2.hg19:g.177054575C>T	ENSP00000328598:p.Ala231Val	0					HOXD-AS1_ENST00000413969.1_RNA|HOXD-AS1_ENST00000417086.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000425005.1_RNA|HOXD-AS1_ENST00000436126.1_RNA	p.A231V	NM_024501.2	NP_078777.1	1	2	3	2.011184	Q9GZZ0	HXD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	2	915	+			B2RAB4	Missense_Mutation	SNP	ENST00000331462.4	0	1	hg19	c.692C>T	CCDS2271.1	0	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934471	0.73442	.	.	ENSG00000128645	ENST00000331462	D	0.95656	-3.77	5.45	4.56	0.56223	5.45	4.56	0.56223	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.288296	0.25122	N	0.032971	D	0.91676	0.7369	L	0.46157	1.445	0.43342	D	0.99539	P;B	0.44006	0.824;0.209	B;B	0.32465	0.146;0.073	D	0.90160	0.4227	10	0.33940	T	0.23	.	15.8297	0.78741	0.0:0.8637:0.1363:0.0	.	231;231	Q96CA4;Q9GZZ0	.;HXD1_HUMAN	V	231	ENSP00000328598:A231V	ENSP00000328598:A231V	A	+	2	0	0	HOXD1	176762821	176762821	1.000000	0.71417	0.982000	0.44146	0.976000	0.68499	6.063000	0.71162	1.273000	0.44346	0.655000	0.94253	GCG	0.164013		TCGA-IB-7888-01A-11D-2154-08	0.557	HOXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255693.2	0	0	1		2	2	2	0		0	0	106		106	105	1	1.960000	-2.967410	1	0.160000				15	15		980	961	0		1	0		0	0	106	0		0.999847	8.054221e-04	0	0	0	3	0	15	980
CACNA2D3	55799	broad.mit.edu	37	3	54798357	54798357	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr3:54798357C>T	ENST00000474759.1	+	13	1407	c.1359C>T	c.(1357-1359)acC>acT	p.T453T	CACNA2D3_ENST00000490478.1_Silent_p.T359T|CACNA2D3_ENST00000415676.2_Silent_p.T453T|CACNA2D3_ENST00000288197.5_Silent_p.T453T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	453	Cache.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TGGTGTGGACCGAAGCTTACA	0.507																																						ENST00000474759.1	1.000000	0.550000	9.600000e-01	6.700000e-01	0.800000	0.811147	0.800000	1.000000																										0				59						c.(1357-1359)acC>acT		calcium channel, voltage-dependent, alpha 2/delta subunit 3	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)						105.0	102.0	103.0					3																	54798357		2055	4199	6254	SO:0001819	synonymous_variant	55799	1	120972	35				g.chr3:54798357C>T	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1359C>T	chr3.hg19:g.54798357C>T		0					CACNA2D3_ENST00000490478.1_Silent_p.T359T|CACNA2D3_ENST00000415676.2_Silent_p.T453T|CACNA2D3_ENST00000288197.5_Silent_p.T453T	p.T453T	NM_018398.2	NP_060868.2	0	1	1	2.003901	Q8IZS8	CA2D3_HUMAN		13	1407	+			B2RPL6|Q9NY16|Q9NY18	Silent	SNP	ENST00000474759.1	1	1	hg19	c.1359C>T	CCDS54598.1	0																																																																																								0.155949		TCGA-IB-7888-01A-11D-2154-08	0.507	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1	1	0	1		2	2	2	0		0	0	56		56	56	1	1.960000	-2.429504	0	0.160000				30	30		433	430	0		1	0		0	0	56	0		1.000000	1.308691e-02	0	0	0	3	0	30	433
MUC4	4585	broad.mit.edu	37	3	195515980	195515980	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr3:195515980G>T	ENST00000463781.3	-	2	2930	c.2471C>A	c.(2470-2472)tCa>tAa	p.S824*	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Nonsense_Mutation_p.S824*	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	829	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGTCTCTCCTGAGGTGGATAT	0.577																																						ENST00000463781.3	1.000000	0.720000	1	8.400000e-01	0.980000	0.942069	0.980000	1.000000																										0				51						c.(2470-2472)tCa>tAa		mucin 4, cell surface associated							85.0	94.0	91.0					3																	195515980		2155	4250	6405	SO:0001587	stop_gained	4585	0	0					g.chr3:195515980G>T	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2471C>A	chr3.hg19:g.195515980G>T	ENSP00000417498:p.Ser824*	0					MUC4_ENST00000475231.1_Nonsense_Mutation_p.S824*|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	p.S824*	NM_018406.6	NP_060876.5	0	1	1	2.003901	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	2	2930	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Nonsense_Mutation	SNP	ENST00000463781.3	0	1	hg19	c.2471C>A	CCDS54700.1	1	.	.	.	.	.	.	.	.	.	.	-	37	6.249658	0.97412	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	.	.	.	3.5	1.63	0.23807	3.5	1.63	0.23807	.	2.354170	0.02108	N	0.054574	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.5202	5.4797	0.16717	0.1201:0.2045:0.6753:0.0	.	.	.	.	X	824;824;798	.	ENSP00000376209:S798X	S	-	2	0	0	MUC4	197000375	197000375	0.027000	0.19231	0.000000	0.03702	0.004000	0.04260	3.437000	0.52863	0.260000	0.21731	0.627000	0.83407	TCA	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	1	0	1		2	2	2	0		0	0	48		48	48	1	1.960000	-3.142702	1	0.160000	NM_018406			41	41		473	466	0		1	0		0	0	48	0		1.000000	5.692764e-02	0	1	0	4	0	41	473
ZGRF1	55345	broad.mit.edu	37	4	113460845	113460845	+	Splice_Site	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr4:113460845C>T	ENST00000505019.1	-	28	6298	c.6173G>A	c.(6172-6174)gGa>gAa	p.G2058E	RP11-402J6.1_ENST00000504009.1_RNA	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		2058						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		ATCTTCCCTTCCTTAAAAAAA	0.373																																						ENST00000505019.1	1.000000	0.620000	1	8.600000e-01	0.990000	0.950493	0.990000	1.000000																										0				45						c.(6172-6174)gGa>gAa									75.0	70.0	72.0					4																	113460845		2203	4300	6503	SO:0001630	splice_region_variant	0	0	0					g.chr4:113460845C>T																												ENST00000505019.1:c.6173-1G>A	chr4.hg19:g.113460845C>T		0					RP11-402J6.1_ENST00000504009.1_RNA	p.G2058E	NM_018392.4	NP_060862.3	1	2	3	2.007896	Q86YA3	ZGRF1_HUMAN		28	6298	-		Ovarian(17;0.156)	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Splice_Site	SNP	ENST00000505019.1	0	1	hg19	c.6173G>A		1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504359	0.44558	.	.	ENSG00000138658	ENST00000505019	D	0.81659	-1.52	5.37	5.37	0.77165	5.37	5.37	0.77165	.	0.229935	0.38436	N	0.001681	T	0.70850	0.3271	L	0.34521	1.04	0.80722	D	1	B;B	0.33637	0.42;0.016	B;B	0.35240	0.198;0.008	T	0.66763	-0.5841	10	0.21540	T	0.41	-21.145	12.0989	0.53772	0.0:0.9203:0.0:0.0797	.	2058;516	G5EA02;B3KQX2	.;.	E	2058	ENSP00000424737:G2058E	ENSP00000424737:G2058E	G	-	2	0	0	C4orf21	113680294	113680294	0.955000	0.32602	0.986000	0.45419	0.904000	0.53231	0.837000	0.27558	2.678000	0.91216	0.555000	0.69702	GGA	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.373	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1	0	0	1		2	2	2	0		0	0	16		16	16	1	1.960000	-6.664263	1	0.160000		Missense_Mutation		11	11		109	108	0		1	0		0	0	16	0		0.998525	2.222264e-01	0	0	0	9	0	11	109
KDR	3791	broad.mit.edu	37	4	55956204	55956204	+	Silent	SNP	C	C	T	rs147630437		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr4:55956204C>T	ENST00000263923.4	-	23	3406	c.3111G>A	c.(3109-3111)tcG>tcA	p.S1037S	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1037	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CGTTCTTCTCCGATAAGAGGA	0.428			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												ENST00000263923.4	1.000000	0.670000	1	7.900000e-01	0.940000	0.911841	0.940000	1.000000				Dom	yes			Dom	yes		4	4q11-q12	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2				E	E			NSCLC, angiosarcoma		0				135						c.(3109-3111)tcG>tcA		kinase insert domain receptor (a type III receptor tyrosine kinase)	Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	C		0,4406		0,0,2203	98.0	95.0	96.0		3111	-2.3	1.0	4	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KDR	NM_002253.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1037/1357	55956204	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3791	9	121412	40				g.chr4:55956204C>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3111G>A	chr4.hg19:g.55956204C>T		0	TSP Lung(20;0.16)				RP11-530I17.1_ENST00000511222.1_RNA	p.S1037S	NM_002253.2	NP_002244.1	1	2	3	2.007896	P35968	VGFR2_HUMAN	Epithelial(7;0.189)	23	3406	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	1	1	hg19	c.3111G>A	CCDS3497.1	1																																																																																								0.163347		TCGA-IB-7888-01A-11D-2154-08	0.428	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1	1	0	1		2	2	2	0		0	0	58		58	58	1	1.960000	-2.578431	1	0.160000				36	36		448	443	0		1	0		0	0	58	0		1.000000	8.836514e-01	0	0	0	49	0	36	448
TLL1	7092	broad.mit.edu	37	4	166978413	166978413	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr4:166978413G>A	ENST00000061240.2	+	14	2445	c.1798G>A	c.(1798-1800)Gcc>Acc	p.A600T	TLL1_ENST00000507499.1_Missense_Mutation_p.A623T	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	600	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTACCAGTGTGCCTGTGAGCC	0.512																																						ENST00000061240.2	1.000000	0.060000	2.700000e-01	1.100000e-01	0.170000	0.215827	0.170000	0.160000																										0				77						c.(1798-1800)Gcc>Acc		tolloid-like 1							146.0	137.0	140.0					4																	166978413		2203	4300	6503	SO:0001583	missense	7092	0	0					g.chr4:166978413G>A	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1798G>A	chr4.hg19:g.166978413G>A	ENSP00000061240:p.Ala600Thr	0					TLL1_ENST00000507499.1_Missense_Mutation_p.A623T	p.A600T	NM_012464.4	NP_036596.3	1	2	3	2.007896	O43897	TLL1_HUMAN		14	2445	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	0	1	hg19	c.1798G>A	CCDS3811.1	0	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296332	0.40594	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	D;D	0.97016	-4.21;-4.21	5.96	1.33	0.21861	5.96	1.33	0.21861	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.201206	0.42172	N	0.000746	D	0.90683	0.7077	N	0.04669	-0.19	0.50813	D	0.99989	B;P	0.42584	0.088;0.784	B;P	0.51657	0.054;0.676	D	0.83697	0.0180	10	0.20519	T	0.43	.	6.019	0.19618	0.1836:0.0:0.5477:0.2687	.	623;600	E9PD25;O43897	.;TLL1_HUMAN	T	600;623	ENSP00000061240:A600T;ENSP00000426082:A623T	ENSP00000061240:A600T	A	+	1	0	0	TLL1	167197863	167197863	0.980000	0.34600	0.005000	0.12908	0.779000	0.44077	2.781000	0.47750	-0.066000	0.12998	-0.143000	0.13931	GCC	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.512	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1	0	0	1		2	2	2	0		0	0	42		42	42	1	1.960000	-5.501510	1	0.160000				6	6		462	459	0		1	0		0	0	42	0		0.964492	2.424630e-03	0	0	0	5	0	6	462
SLC6A19	340024	broad.mit.edu	37	5	1208876	1208876	+	Missense_Mutation	SNP	C	C	T	rs200783817		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr5:1208876C>T	ENST00000304460.10	+	2	274	c.218C>T	c.(217-219)cCg>cTg	p.P73L		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	73					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TTCATGATCCCGTTCCTCATC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16941	0.001		0.0	False		,,,				2504	0.0					ENST00000304460.10	1.000000	0.710000	1	8.200000e-01	0.930000	0.921879	0.930000	1.000000																										0				44						c.(217-219)cCg>cTg		solute carrier family 6 (neutral amino acid transporter), member 19		C	LEU/PRO	0,4406		0,0,2203	104.0	99.0	101.0		218	4.6	0.9	5		101	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SLC6A19	NM_001003841.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	73/635	1208876	1,13005	2203	4300	6503	SO:0001583	missense	340024	12	121408	44				g.chr5:1208876C>T	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.218C>T	chr5.hg19:g.1208876C>T	ENSP00000305302:p.Pro73Leu	0						p.P73L	NM_001003841.2	NP_001003841.1	0	1	1	2.003436	Q695T7	S6A19_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)	2	274	+	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		A8K446	Missense_Mutation	SNP	ENST00000304460.10	1	1	hg19	c.218C>T	CCDS34130.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.6	4.754281	0.89843	0.0	1.16E-4	ENSG00000174358	ENST00000304460	D	0.86865	-2.18	4.55	4.55	0.56014	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.94968	0.8372	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96314	0.9231	10	0.72032	D	0.01	.	17.3733	0.87384	0.0:1.0:0.0:0.0	.	73	Q695T7	S6A19_HUMAN	L	73	ENSP00000305302:P73L	ENSP00000305302:P73L	P	+	2	0	0	SLC6A19	1261876	1261876	1.000000	0.71417	0.919000	0.36401	0.935000	0.57460	5.849000	0.69465	2.091000	0.63221	0.485000	0.47835	CCG	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.657	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	1	0	1		2	2	2	0		0	0	71		71	70	1	1.960000	-2.287385	0	0.160000	XM_291120			54	54		658	652	0		1			0	0	71	0		1.000000	0	0	0	0	0	0	54	658
PCDHGA8	9708	broad.mit.edu	37	5	140774356	140774356	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr5:140774356C>T	ENST00000398604.2	+	1	1976	c.1976C>T	c.(1975-1977)aCg>aTg	p.T659M	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	659	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCACTGTCACGCTCACCGTA	0.642																																						ENST00000398604.2	1.000000	0.440000	8.600000e-01	5.600000e-01	0.690000	0.712766	0.690000	1.000000																										0				51						c.(1975-1977)aCg>aTg		protocadherin gamma subfamily A, 8							36.0	42.0	40.0					5																	140774356		2202	4298	6500	SO:0001583	missense	9708	0	0					g.chr5:140774356C>T	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1976C>T	chr5.hg19:g.140774356C>T	ENSP00000381605:p.Thr659Met	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	p.T659M	NM_032088.1	NP_114477.1	0	1	1	2.003436	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1976	+			A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	1	1	hg19	c.1976C>T	CCDS47291.1	0	.	.	.	.	.	.	.	.	.	.	.	10.15	1.270078	0.23221	.	.	ENSG00000253767	ENST00000398604	T	0.55588	0.51	4.99	0.815	0.18763	4.99	0.815	0.18763	Cadherin (4);Cadherin-like (1);	0.284430	0.17574	U	0.169343	T	0.64260	0.2582	M	0.77103	2.36	0.09310	N	0.999997	D;D	0.71674	0.974;0.998	P;P	0.58820	0.656;0.846	T	0.56123	-0.8031	10	0.72032	D	0.01	.	8.7668	0.34708	0.0:0.6668:0.1188:0.2144	.	659;659	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	M	659	ENSP00000381605:T659M	ENSP00000381605:T659M	T	+	2	0	0	PCDHGA8	140754540	140754540	0.000000	0.05858	0.009000	0.14445	0.315000	0.28087	0.251000	0.18257	0.182000	0.20032	-0.156000	0.13503	ACG	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.642	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	1	0	1		2	2	2	0		0	0	37		37	37	1	1.960000	-19.999590	1	0.160000	NM_032088			21	18		354	315	0		1			0	0	37	0		0.999992	0	0	0	0	0	0	21	354
SLC1A3	6507	broad.mit.edu	37	5	36684084	36684084	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr5:36684084G>A	ENST00000265113.4	+	9	1884	c.1408G>A	c.(1408-1410)Gcg>Acg	p.A470T	CTD-2353F22.1_ENST00000510740.1_RNA|SLC1A3_ENST00000381918.3_Intron	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	470					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCTCATCATCGCGGTGGACTG	0.587																																						ENST00000265113.4	1.000000	0.760000	1	8.700000e-01	0.990000	0.951944	0.990000	1.000000																										0				41						c.(1408-1410)Gcg>Acg		solute carrier family 1 (glial high affinity glutamate transporter), member 3							162.0	136.0	145.0					5																	36684084		2203	4300	6503	SO:0001583	missense	6507	1	121412	33				g.chr5:36684084G>A		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1408G>A	chr5.hg19:g.36684084G>A	ENSP00000265113:p.Ala470Thr	0					SLC1A3_ENST00000381918.3_Intron|CTD-2353F22.1_ENST00000510740.1_RNA	p.A470T	NM_004172.4	NP_004163.3	0	1	1	2.003436	P43003	EAA1_HUMAN	Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	9	1884	+	all_lung(31;0.000245)		B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	1	1	hg19	c.1408G>A	CCDS3919.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.635976	0.96693	.	.	ENSG00000079215	ENST00000265113;ENST00000427100	T	0.64260	-0.09	5.74	5.74	0.90152	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.79592	0.4472	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.63793	0.918	T	0.79938	-0.1592	10	0.54805	T	0.06	-18.3873	19.9326	0.97124	0.0:0.0:1.0:0.0	.	470	P43003	EAA1_HUMAN	T	470;418	ENSP00000265113:A470T	ENSP00000265113:A470T	A	+	1	0	0	SLC1A3	36719841	36719841	1.000000	0.71417	0.972000	0.41901	0.977000	0.68977	9.768000	0.98965	2.720000	0.93068	0.650000	0.86243	GCG	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.587	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	1	0	1		2	2	2	0		0	0	71		71	70	1	1.960000	-14.296970	1	0.160000	NM_004172			60	59		690	685	0		1	0	0	0	0	71	0		1.000000	7.535664e-01	0	0	0	33	1	60	690
BDP1	55814	broad.mit.edu	37	5	70840231	70840231	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr5:70840231C>A	ENST00000358731.4	+	31	6723	c.6460C>A	c.(6460-6462)Ctc>Atc	p.L2154I	BDP1_ENST00000380675.2_Missense_Mutation_p.L290I	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2154					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAATAAAAACCTCGGACCAGT	0.358																																						ENST00000358731.4	1.000000	0.680000	1	7.900000e-01	0.920000	0.908874	0.920000	1.000000																										0				72						c.(6460-6462)Ctc>Atc		B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB							102.0	96.0	97.0					5																	70840231		1835	4090	5925	SO:0001583	missense	55814	0	0					g.chr5:70840231C>A	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.6460C>A	chr5.hg19:g.70840231C>A	ENSP00000351575:p.Leu2154Ile	0					BDP1_ENST00000380675.2_Missense_Mutation_p.L290I	p.L2154I	NM_018429.2	NP_060899.2	0	1	1	2.003436	A6H8Y1	BDP1_HUMAN		31	6723	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	1	1	hg19	c.6460C>A	CCDS43328.1	1	.	.	.	.	.	.	.	.	.	.	C	9.258	1.042474	0.19748	.	.	ENSG00000145734	ENST00000358731;ENST00000451951;ENST00000380675;ENST00000545546	T;T	0.49139	3.67;0.79	5.24	0.299	0.15771	5.24	0.299	0.15771	.	0.742384	0.12025	N	0.506463	T	0.40196	0.1107	M	0.64997	1.995	0.09310	N	1	B;B	0.21147	0.052;0.005	B;B	0.22601	0.04;0.004	T	0.35773	-0.9775	10	0.42905	T	0.14	.	4.7548	0.13078	0.0:0.5134:0.1484:0.3382	.	2154;2154	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	I	2154;1702;290;290	ENSP00000351575:L2154I;ENSP00000370050:L290I	ENSP00000351575:L2154I	L	+	1	0	0	BDP1	70875987	70875987	0.000000	0.05858	0.001000	0.08648	0.669000	0.39330	-0.816000	0.04477	0.037000	0.15575	-0.122000	0.15005	CTC	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.358	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	1	0	1		2	2	2	0		0	0	53		53	53	1	1.960000	-2.879461	1	0.160000	NM_018429			41	41		507	500	0		1	0		0	0	53	0		1.000000	9.569440e-02	0	0	0	7	0	41	507
POLK	51426	broad.mit.edu	37	5	74893770	74893770	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr5:74893770T>C	ENST00000241436.4	+	15	2712	c.2540T>C	c.(2539-2541)aTg>aCg	p.M847T	POLK_ENST00000504026.1_3'UTR|POLK_ENST00000508526.1_Missense_Mutation_p.M649T|CTC-366B18.2_ENST00000511329.1_RNA|POLK_ENST00000352007.5_Missense_Mutation_p.M649T|POLK_ENST00000506928.1_3'UTR|POLK_ENST00000380481.3_Missense_Mutation_p.M757T	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	847				M -> V (in Ref. 4; AAF23270). {ECO:0000305}.	DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		CCAGGATTGATGACAAAGTAC	0.244								DNA polymerases (catalytic subunits)																														ENST00000241436.4	1.000000	0.650000	1	8.300000e-01	0.990000	0.939041	0.990000	1.000000																										0				27						c.(2539-2541)aTg>aCg	DNA polymerases (catalytic subunits)	polymerase (DNA directed) kappa							48.0	50.0	49.0					5																	74893770		2201	4285	6486	SO:0001583	missense	51426	0	0					g.chr5:74893770T>C	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.2540T>C	chr5.hg19:g.74893770T>C	ENSP00000241436:p.Met847Thr	0					POLK_ENST00000506928.1_3'UTR|POLK_ENST00000508526.1_Missense_Mutation_p.M649T|POLK_ENST00000380481.3_Missense_Mutation_p.M757T|CTC-366B18.2_ENST00000511329.1_RNA|POLK_ENST00000504026.1_3'UTR|POLK_ENST00000352007.5_Missense_Mutation_p.M649T	p.M847T	NM_016218.2	NP_057302.1	0	1	1	2.003436	Q9UBT6	POLK_HUMAN		15	2712	+		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	0	1	hg19	c.2540T>C	CCDS4030.1	1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.252983	0.22965	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000508526;ENST00000380481	T;T;T;T	0.52754	1.38;0.65;0.65;1.38	5.22	-2.08	0.07254	5.22	-2.08	0.07254	.	0.820001	0.11842	N	0.524186	T	0.24431	0.0592	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.32295	-0.9912	10	0.02654	T	1	-0.5908	3.4503	0.07495	0.4082:0.2354:0.0:0.3564	.	649;847	Q9UBT6-3;Q9UBT6	.;POLK_HUMAN	T	847;649;649;757	ENSP00000241436:M847T;ENSP00000342256:M649T;ENSP00000426853:M649T;ENSP00000369848:M757T	ENSP00000241436:M847T	M	+	2	0	0	POLK	74929526	74929526	0.000000	0.05858	0.004000	0.12327	0.939000	0.58152	-0.694000	0.05115	-0.514000	0.06488	-0.333000	0.08304	ATG	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.244	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	1	0	1		2	2	2	0		0	0	8		8	8	1	1.960000	-19.999990	1	0.160000	NM_016218			19	19		208	204	0		1	1		0	0	8	0		0.999991	7.891585e-01	0	4	0	30	0	19	208
PCDHGB7	56099	broad.mit.edu	37	5	140797472	140797472	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr5:140797472G>A	ENST00000398594.2	+	1	46	c.46G>A	c.(46-48)Gta>Ata	p.V16I	PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	16					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cccgcggcAGGTACTATTTCC	0.642											OREG0016863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000398594.2	1.000000	0.240000	1	4.200000e-01	0.690000	0.696963	0.690000	1.000000																										0				56						c.(46-48)Gta>Ata		protocadherin gamma subfamily B, 7							25.0	28.0	27.0					5																	140797472		1887	4101	5988	SO:0001583	missense	56099	0	0					g.chr5:140797472G>A	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.46G>A	chr5.hg19:g.140797472G>A	ENSP00000381594:p.Val16Ile	0		OREG0016863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1659	PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron	p.V16I	NM_018927.3	NP_061750.1	0	1	1	2.003436	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	46	+			Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	0	1	hg19	c.46G>A	CCDS47293.1	0	.	.	.	.	.	.	.	.	.	.	g	16.24	3.066765	0.55539	.	.	ENSG00000254122	ENST00000398594	T	0.49432	0.78	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.310523	0.16999	U	0.190963	T	0.44644	0.1303	N	0.08118	0	0.22199	N	0.999295	P;P	0.50617	0.63;0.937	B;P	0.52554	0.407;0.702	T	0.47129	-0.9141	10	0.39692	T	0.17	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	16;16	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	I	16	ENSP00000381594:V16I	ENSP00000381594:V16I	V	+	1	0	0	PCDHGB7	140777656	140777656	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	7.377000	0.79668	2.822000	0.97130	0.650000	0.86243	GTA	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.642	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	0	0	1		2	2	2	0		0	0	9		9	9	1	1.960000	-8.332241	1	0.160000	NM_018927			4	4		72	70	0		1			0	0	9	0		0.885874	0	0	0	0	0	0	4	72
DDO	8528	broad.mit.edu	37	6	110714483	110714483	+	Missense_Mutation	SNP	G	G	A	rs370285627		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr6:110714483G>A	ENST00000368924.3	-	5	620	c.605C>T	c.(604-606)cCg>cTg	p.P202L	DDO_ENST00000368923.3_Missense_Mutation_p.P143L	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	174					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		GTCAAAGGACGGATGAAGTTC	0.502																																						ENST00000368924.3	0.890000	0.540000	8.000000e-01	6.100000e-01	0.700000	0.714213	0.700000	0.710000																										0				24						c.(604-606)cCg>cTg		D-aspartate oxidase		G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	125.0	124.0	124.0		428,605	1.9	0.0	6		124	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DDO	NM_004032.2,NM_003649.2	98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	143/311,202/370	110714483	1,13005	2203	4300	6503	SO:0001583	missense	8528	13	121412	44				g.chr6:110714483G>A	D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.605C>T	chr6.hg19:g.110714483G>A	ENSP00000357920:p.Pro202Leu	0					DDO_ENST00000368923.3_Missense_Mutation_p.P143L	p.P202L	NM_003649.2	NP_003640.2	0	1	1	1.995738	Q99489	OXDD_HUMAN		5	620	-		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	ENST00000368924.3	1	1	hg19	c.605C>T	CCDS5082.1	0	.	.	.	.	.	.	.	.	.	.	G	3.961	-0.010388	0.07727	0.0	1.16E-4	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	T;T;T	0.35421	1.31;1.31;1.31	5.95	1.93	0.25924	5.95	1.93	0.25924	.	0.501675	0.22971	N	0.053429	T	0.09686	0.0238	L	0.46157	1.445	0.09310	N	1	P;B	0.34662	0.462;0.121	B;B	0.17722	0.01;0.019	T	0.11470	-1.0586	10	0.31617	T	0.26	-13.5945	7.5782	0.27948	0.0:0.3124:0.3619:0.3257	.	143;202	Q99489-4;Q99489-3	.;.	L	202;143;174	ENSP00000357920:P202L;ENSP00000357919:P143L;ENSP00000357921:P174L	ENSP00000357919:P143L	P	-	2	0	0	DDO	110821176	110821176	0.000000	0.05858	0.018000	0.16275	0.049000	0.14656	0.680000	0.25306	0.804000	0.34136	0.563000	0.77884	CCG	0.154589		TCGA-IB-7888-01A-11D-2154-08	0.502	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1	1	0	1		2	2	2	0		0	0	86		86	86	1	1.960000	-2.578427	1	0.160000				57	57		944	935	0		1			0	0	86	0		1.000000	0	0	0	0	0	0	57	944
TCP10	6953	broad.mit.edu	37	6	167789540	167789540	+	Missense_Mutation	SNP	G	G	A	rs28637384	byFrequency	TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr6:167789540G>A	ENST00000397829.4	-	6	769	c.602C>T	c.(601-603)cCg>cTg	p.P201L	TCP10_ENST00000366827.2_Missense_Mutation_p.P201L	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	228						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GGAGTTTTGCGGACTTCGGGA	0.612													g|||	19	0.00379393	0.0106	0.0	5008	,	,		20040	0.001		0.001	False		,,,				2504	0.0031					ENST00000397829.4	1.000000	0.160000	6.100000e-01	2.500000e-01	0.390000	0.443821	0.390000	0.360000																										0				18						c.(601-603)cCg>cTg		t-complex 10		G	LEU/PRO	26,3906		0,26,1940	41.0	43.0	42.0		602	-1.0	0.0	6	dbSNP_125	42	3,8347		0,3,4172	no	missense	TCP10	NM_004610.3	98	0,29,6112	AA,AG,GG		0.0359,0.6612,0.2361	benign	201/327	167789540	29,12253	1966	4175	6141	SO:0001583	missense	6953	189	120932	47				g.chr6:167789540G>A	U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.602C>T	chr6.hg19:g.167789540G>A	ENSP00000380929:p.Pro201Leu	0					TCP10_ENST00000366827.2_Missense_Mutation_p.P201L	p.P201L	NM_004610.3	NP_004601.3	1	2	3	2.019436	Q12799	TCP10_HUMAN		6	769	-		Breast(66;1.53e-05)|Ovarian(120;0.024)	Q5JR60|Q6P4F4	Missense_Mutation	SNP	ENST00000397829.4	0	1	hg19	c.602C>T	CCDS43527.1	0	10	0.004578754578754579	4	0.008130081300813009	1	0.0027624309392265192	3	0.005244755244755245	2	0.002638522427440633	G	0.115	-1.133580	0.01756	0.006612	3.59E-4	ENSG00000203690	ENST00000366827;ENST00000397829	T;T	0.14266	2.52;2.52	1.65	-1.01	0.10169	1.65	-1.01	0.10169	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47522	-0.9111	9	0.02654	T	1	.	5.1124	0.14815	0.7913:0.0:0.2087:0.0	rs28637384	228;228	Q12799;Q12799-2	TCP10_HUMAN;.	L	201	ENSP00000355792:P201L;ENSP00000380929:P201L	ENSP00000355792:P201L	P	-	2	0	0	TCP10	167709530	167709530	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.285000	0.18883	-0.248000	0.09583	-0.699000	0.03677	CCG	0.166005		TCGA-IB-7888-01A-11D-2154-08	0.612	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	1	0	1		2	2	2	0		0	0	25		25	25	1	1.960000	-2.847517	1	0.160000	NM_004610			6	6		207	203	0		1			0	0	25	0		0.963528	0	0	0	0	0	0	6	207
RREB1	6239	broad.mit.edu	37	6	7229365	7229365	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr6:7229365C>T	ENST00000349384.6	+	10	1347	c.1033C>T	c.(1033-1035)Caa>Taa	p.Q345*	RREB1_ENST00000334984.6_Nonsense_Mutation_p.Q345*|RREB1_ENST00000379938.2_Nonsense_Mutation_p.Q345*|RREB1_ENST00000379933.3_Nonsense_Mutation_p.Q345*	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	345					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AGACCAGGGTCAAGAAAAGCC	0.627																																						ENST00000349384.6	1.000000	0.390000	9.600000e-01	5.400000e-01	0.730000	0.740569	0.730000	1.000000																										0				58						c.(1033-1035)Caa>Taa		ras responsive element binding protein 1							32.0	32.0	32.0					6																	7229365		2203	4300	6503	SO:0001587	stop_gained	6239	0	0					g.chr6:7229365C>T	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1033C>T	chr6.hg19:g.7229365C>T	ENSP00000305560:p.Gln345*	0					RREB1_ENST00000379938.2_Nonsense_Mutation_p.Q345*|RREB1_ENST00000334984.6_Nonsense_Mutation_p.Q345*|RREB1_ENST00000379933.3_Nonsense_Mutation_p.Q345*	p.Q345*	NM_001003698.3	NP_001003698.1	0	0	0	1.991081	Q92766	RREB1_HUMAN		10	1347	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Nonsense_Mutation	SNP	ENST00000349384.6	0	1	hg19	c.1033C>T	CCDS34336.1	0	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191693	0.58017	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984;ENST00000483150	.	.	.	5.7	2.61	0.31194	5.7	2.61	0.31194	.	0.654137	0.12867	N	0.432616	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-5.9613	4.9171	0.13851	0.329:0.4924:0.0998:0.0788	.	.	.	.	X	345	.	ENSP00000335574:Q345X	Q	+	1	0	0	RREB1	7174364	7174364	0.000000	0.05858	0.001000	0.08648	0.054000	0.15201	0.831000	0.27476	0.754000	0.32968	0.455000	0.32223	CAA	0.150485		TCGA-IB-7888-01A-11D-2154-08	0.627	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	1	0	0		2	2	2	0		0	0	26		26	25	1	1.960000	-15.022750	1	0.160000				11	11		177	174	1		1	1		0	0	26	0		0.998344	3.810143e-01	0	6	0	15	0	11	177
RREB1	6239	broad.mit.edu	37	6	7229368	7229368	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr6:7229368G>T	ENST00000349384.6	+	10	1350	c.1036G>T	c.(1036-1038)Gaa>Taa	p.E346*	RREB1_ENST00000334984.6_Nonsense_Mutation_p.E346*|RREB1_ENST00000379938.2_Nonsense_Mutation_p.E346*|RREB1_ENST00000379933.3_Nonsense_Mutation_p.E346*	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	346					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CCAGGGTCAAGAAAAGCCGCA	0.632																																						ENST00000349384.6	1.000000	0.340000	8.700000e-01	4.700000e-01	0.650000	0.672841	0.650000	1.000000																										0				58						c.(1036-1038)Gaa>Taa		ras responsive element binding protein 1							32.0	32.0	32.0					6																	7229368		2203	4300	6503	SO:0001587	stop_gained	6239	0	0					g.chr6:7229368G>T	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1036G>T	chr6.hg19:g.7229368G>T	ENSP00000305560:p.Glu346*	0					RREB1_ENST00000379938.2_Nonsense_Mutation_p.E346*|RREB1_ENST00000334984.6_Nonsense_Mutation_p.E346*|RREB1_ENST00000379933.3_Nonsense_Mutation_p.E346*	p.E346*	NM_001003698.3	NP_001003698.1	0	0	0	1.991081	Q92766	RREB1_HUMAN		10	1350	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Nonsense_Mutation	SNP	ENST00000349384.6	0	1	hg19	c.1036G>T	CCDS34336.1	0	.	.	.	.	.	.	.	.	.	.	G	18.90	3.720585	0.68959	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984;ENST00000483150	.	.	.	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.520225	0.17251	N	0.181180	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-9.0175	12.5884	0.56430	0.0761:0.0:0.9239:0.0	.	.	.	.	X	346	.	ENSP00000335574:E346X	E	+	1	0	0	RREB1	7174367	7174367	1.000000	0.71417	0.030000	0.17652	0.053000	0.15095	4.178000	0.58284	2.547000	0.85894	0.455000	0.32223	GAA	0.150485		TCGA-IB-7888-01A-11D-2154-08	0.632	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	1	0	0		2	2	2	0		0	0	25		25	24	1	1.960000	-13.174810	1	0.160000				10	10		182	179	0		1	1		0	0	25	0		0.996872	3.530145e-01	0	8	0	14	0	10	182
PHF10	55274	broad.mit.edu	37	6	170118958	170118958	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr6:170118958G>A	ENST00000339209.4	-	3	374	c.251C>T	c.(250-252)aCa>aTa	p.T84I	PHF10_ENST00000366780.4_Missense_Mutation_p.T84I|PHF10_ENST00000464779.1_5'UTR	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	84					nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		GTATTCTCCTGTTTCATCAGG	0.313																																						ENST00000339209.4	1.000000	0.100000	3.500000e-01	1.600000e-01	0.230000	0.298149	0.230000	0.210000																										0				14						c.(250-252)aCa>aTa		PHD finger protein 10							71.0	76.0	75.0					6																	170118958		2203	4293	6496	SO:0001583	missense	55274	0	0					g.chr6:170118958G>A	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.251C>T	chr6.hg19:g.170118958G>A	ENSP00000341805:p.Thr84Ile	0					PHF10_ENST00000366780.4_Missense_Mutation_p.T84I|PHF10_ENST00000464779.1_5'UTR	p.T84I	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	1	2	3	2.019436	Q8WUB8	PHF10_HUMAN		3	374	-		Breast(66;5.08e-05)|Ovarian(120;0.208)	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	ENST00000339209.4	0	1	hg19	c.251C>T	CCDS5308.2	0	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629915	0.67015	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	T;T	0.29397	1.57;1.57	5.49	5.49	0.81192	5.49	5.49	0.81192	.	.	.	.	.	T	0.19927	0.0479	L	0.44542	1.39	0.53005	D	0.999969	B;B	0.34329	0.449;0.321	B;B	0.35413	0.202;0.1	T	0.03483	-1.1032	9	0.59425	D	0.04	.	16.8851	0.86074	0.0:0.0:1.0:0.0	.	84;84	Q8WUB8-2;Q8WUB8	.;PHF10_HUMAN	I	84	ENSP00000355743:T84I;ENSP00000341805:T84I	ENSP00000341805:T84I	T	-	2	0	0	PHF10	169860883	169860883	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.257000	0.78362	2.724000	0.93272	0.557000	0.71058	ACA	0.166005		TCGA-IB-7888-01A-11D-2154-08	0.313	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	0	0	1		2	2	2	0		0	0	29		29	29	1	1.960000	-3.105146	1	0.160000	NM_018288			8	8		451	447	0		1	0		0	0	29	0		0.989113	2.212888e-01	0	0	0	45	0	8	451
CFTR	1080	broad.mit.edu	37	7	117171027	117171027	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr7:117171027A>C	ENST00000003084.6	+	4	480	c.348A>C	c.(346-348)gaA>gaC	p.E116D	CFTR_ENST00000454343.1_Missense_Mutation_p.E116D	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	116	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	ACAAGGAGGAACGCTCTATCG	0.448									Cystic Fibrosis																													ENST00000003084.6	0.570000	0.090000	4.100000e-01	1.600000e-01	0.260000	0.293962	0.260000	0.240000																										0				69						c.(346-348)gaA>gaC		cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)						108.0	94.0	99.0					7																	117171027		2203	4300	6503	SO:0001583	missense	1080	0	0		Cystic Fibrosis	Familial Cancer Database	CF	g.chr7:117171027A>C	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.348A>C	chr7.hg19:g.117171027A>C	ENSP00000003084:p.Glu116Asp	0					CFTR_ENST00000454343.1_Missense_Mutation_p.E116D	p.E116D	NM_000492.3	NP_000483.3	0	1	1	2.001689	P13569	CFTR_HUMAN	STAD - Stomach adenocarcinoma(10;0.000534)	4	480	+	Lung NSC(10;0.00148)|all_lung(10;0.00171)		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	0	1	hg19	c.348A>C	CCDS5773.1	0	.	.	.	.	.	.	.	.	.	.	A	16.08	3.022693	0.54683	.	.	ENSG00000001626	ENST00000446805;ENST00000003084;ENST00000454343;ENST00000426809	D;D;D;D	0.99748	-6.62;-2.63;-2.63;-2.63	5.73	-1.17	0.09648	5.73	-1.17	0.09648	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98713	0.9568	N	0.17872	0.535	0.42468	D	0.992811	D	0.76494	0.999	D	0.83275	0.996	D	0.96486	0.9360	10	0.22109	T	0.4	-17.2878	5.6679	0.17704	0.6179:0.0:0.2697:0.1124	.	116	P13569	CFTR_HUMAN	D	35;116;116;116	ENSP00000417012:E35D;ENSP00000003084:E116D;ENSP00000403677:E116D;ENSP00000389119:E116D	ENSP00000003084:E116D	E	+	3	2	2	CFTR	116958263	116958263	1.000000	0.71417	0.935000	0.37517	0.096000	0.18686	0.836000	0.27545	-0.336000	0.08438	-0.388000	0.06559	GAA	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.448	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	0	0	1		2	2	2	0		0	0	21		21	21	1	1.960000	-3.449250	1	0.160000	NM_000492			4	4		200	198	0		1	0		0	0	21	0		0.888885	5.561244e-02	0	1	0	14	0	4	200
NXPH1	30010	broad.mit.edu	37	7	8790918	8790918	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr7:8790918C>T	ENST00000405863.1	+	3	1246	c.335C>T	c.(334-336)aCg>aTg	p.T112M	NXPH1_ENST00000602349.1_5'UTR|NXPH1_ENST00000497400.1_3'UTR	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	112	III.					extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		ATTGTTAAAACGGGCAAGTTT	0.473																																						ENST00000405863.1	1.000000	0.600000	1	7.300000e-01	0.880000	0.869109	0.880000	1.000000																										0				17						c.(334-336)aCg>aTg		neurexophilin 1							79.0	76.0	77.0					7																	8790918		1838	4082	5920	SO:0001583	missense	30010	5	120786	38				g.chr7:8790918C>T	AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.335C>T	chr7.hg19:g.8790918C>T	ENSP00000384551:p.Thr112Met	0					NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_5'UTR	p.T112M	NM_152745.2	NP_689958.1	1	2	3	2.008079	P58417	NXPH1_HUMAN		3	1246	+		Ovarian(82;0.0628)	Q8NB31	Missense_Mutation	SNP	ENST00000405863.1	1	1	hg19	c.335C>T	CCDS47540.1	1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220768	0.58560	.	.	ENSG00000122584	ENST00000405863;ENST00000438764;ENST00000429542	.	.	.	6.07	5.19	0.71726	6.07	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.79458	0.4449	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82293	-0.0529	9	0.72032	D	0.01	-8.2624	16.7467	0.85474	0.1304:0.8696:0.0:0.0	.	112	P58417	NXPH1_HUMAN	M	112	.	ENSP00000384551:T112M	T	+	2	0	0	NXPH1	8757443	8757443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.792000	0.85828	1.553000	0.49476	0.655000	0.94253	ACG	0.163347		TCGA-IB-7888-01A-11D-2154-08	0.473	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324591.1	1	0	1		2	2	2	0		0	0	52		52	52	1	1.960000	-8.202104	1	0.160000	NM_152745			30	29		402	397	0		1			0	0	52	0		1.000000	0	0	0	0	0	0	30	402
ASB15	142685	broad.mit.edu	37	7	123270139	123270139	+	Silent	SNP	A	A	G			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr7:123270139A>G	ENST00000451558.1	+	13	2081	c.1560A>G	c.(1558-1560)gtA>gtG	p.V520V	ASB15_ENST00000434204.1_Silent_p.V520V|ASB15_ENST00000451215.1_Silent_p.V520V|ASB15_ENST00000275699.3_Silent_p.V520V|ASB15_ENST00000540573.1_Silent_p.V520V			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	520					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						CACTAGAAGTACAGAGAGAAT	0.368																																						ENST00000451558.1	1.000000	0.560000	1	6.900000e-01	0.840000	0.843403	0.840000	1.000000																										0				12						c.(1558-1560)gtA>gtG		ankyrin repeat and SOCS box containing 15							103.0	98.0	100.0					7																	123270139		2203	4300	6503	SO:0001819	synonymous_variant	142685	0	0					g.chr7:123270139A>G	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1560A>G	chr7.hg19:g.123270139A>G		0					ASB15_ENST00000275699.3_Silent_p.V520V|ASB15_ENST00000451215.1_Silent_p.V520V|ASB15_ENST00000434204.1_Silent_p.V520V|ASB15_ENST00000540573.1_Silent_p.V520V	p.V520V			0	1	1	2.001689	Q8WXK1	ASB15_HUMAN		13	2081	+			Q3ZCP3|Q3ZCP5|Q68D37	Silent	SNP	ENST00000451558.1	1	1	hg19	c.1560A>G	CCDS34742.1	0																																																																																								0.155949		TCGA-IB-7888-01A-11D-2154-08	0.368	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1	1	0	1		2	2	2	0		0	0	42		42	42	1	1.960000	-20.000000	1	0.160000				24	24		328	324	0		1			0	0	42	0		1.000000	0	0	0	0	0	0	24	328
SLC7A2	6542	broad.mit.edu	37	8	17415826	17415826	+	Missense_Mutation	SNP	C	C	G	rs148874201	byFrequency	TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr8:17415826C>G	ENST00000494857.1	+	9	1436	c.1218C>G	c.(1216-1218)gaC>gaG	p.D406E	SLC7A2_ENST00000470360.1_Missense_Mutation_p.D445E|SLC7A2_ENST00000398090.3_Missense_Mutation_p.D445E|SLC7A2_ENST00000522656.1_Missense_Mutation_p.D406E|SLC7A2_ENST00000004531.10_Missense_Mutation_p.D446E	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	406					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	TTCTGTTTGACCTGAAGGCGC	0.507																																						ENST00000494857.1	1.000000	0.490000	9.600000e-01	6.100000e-01	0.760000	0.777142	0.760000	1.000000																										0				25						c.(1216-1218)gaC>gaG		solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	L-Lysine(DB00123)|L-Ornithine(DB00129)						208.0	174.0	185.0					8																	17415826		2203	4300	6503	SO:0001583	missense	6542	0	0					g.chr8:17415826C>G	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1218C>G	chr8.hg19:g.17415826C>G	ENSP00000419140:p.Asp406Glu	0					SLC7A2_ENST00000470360.1_Missense_Mutation_p.D445E|SLC7A2_ENST00000522656.1_Missense_Mutation_p.D406E|SLC7A2_ENST00000398090.3_Missense_Mutation_p.D445E|SLC7A2_ENST00000004531.10_Missense_Mutation_p.D446E	p.D406E	NM_001008539.3	NP_001008539.3	1	2	3	2.011730	P52569	CTR2_HUMAN		9	1436	+			B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	ENST00000494857.1	1	0	hg19	c.1218C>G	CCDS34852.1	0	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157068	0.38119	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62	5.38	5.38	0.77491	5.38	5.38	0.77491	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.91181	0.7222	L	0.57130	1.785	0.58432	D	0.999999	B;P;D	0.55172	0.141;0.859;0.97	B;B;P	0.55455	0.132;0.367;0.776	D	0.87579	0.2483	10	0.12430	T	0.62	.	12.823	0.57704	0.0:0.9251:0.0:0.0748	.	446;445;406	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	E	406;406;445;446;445	ENSP00000419140:D406E;ENSP00000430464:D406E;ENSP00000419873:D445E;ENSP00000004531:D446E;ENSP00000381164:D445E	ENSP00000004531:D446E	D	+	3	2	2	SLC7A2	17460118	17460118	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.982000	0.63825	2.691000	0.91804	0.561000	0.74099	GAC	0.164678		TCGA-IB-7888-01A-11D-2154-08	0.507	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	1	0	1		2	2	2	0		0	0	46		46	46	1	1.960000	-16.208110	1	0.160000	NM_003046			22	22		346	342	0		1	0		0	0	46	0		0.999999	7.163784e-01	0	0	0	41	0	22	346
CSMD1	64478	broad.mit.edu	37	8	3165343	3165343	+	Splice_Site	SNP	G	G	A	rs200672229		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr8:3165343G>A	ENST00000520002.1	-	26	4382	c.3827C>T	c.(3826-3828)gCg>gTg	p.A1276V	CSMD1_ENST00000602557.1_Splice_Site_p.A1276V|CSMD1_ENST00000602723.1_Splice_Site_p.A1276V|CSMD1_ENST00000400186.3_Splice_Site_p.A1276V|CSMD1_ENST00000542608.1_Splice_Site_p.A1275V|CSMD1_ENST00000539096.1_Splice_Site_p.A1275V|CSMD1_ENST00000537824.1_Splice_Site_p.A1275V			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1276	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACCACATTCCGCTGTAGAAGA	0.448																																						ENST00000520002.1	1.000000	0.660000	1	8.000000e-01	0.970000	0.922793	0.970000	1.000000																										0				25						c.(3826-3828)gCg>gTg		CUB and Sushi multiple domains 1		G	VAL/ALA	0,4050		0,0,2025	89.0	88.0	88.0		3824	4.9	1.0	8		88	1,8405		0,1,4202	yes	missense-near-splice	CSMD1	NM_033225.5	64	0,1,6227	AA,AG,GG		0.0119,0.0,0.0080	benign	1275/3565	3165343	1,12455	2025	4203	6228	SO:0001630	splice_region_variant	64478	18	120976	44				g.chr8:3165343G>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3827-1C>T	chr8.hg19:g.3165343G>A		0					CSMD1_ENST00000542608.1_Splice_Site_p.A1275V|CSMD1_ENST00000602557.1_Splice_Site_p.A1276V|CSMD1_ENST00000537824.1_Splice_Site_p.A1275V|CSMD1_ENST00000400186.3_Splice_Site_p.A1276V|CSMD1_ENST00000602723.1_Splice_Site_p.A1276V|CSMD1_ENST00000539096.1_Splice_Site_p.A1275V	p.A1276V			1	2	3	2.028523	Q96PZ7	CSMD1_HUMAN		26	4382	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	Q0H0J5|Q96QU9|Q96RM4	Splice_Site	SNP	ENST00000520002.1	1	0	hg19	c.3827C>T		1	.	.	.	.	.	.	.	.	.	.	G	34	5.328932	0.95733	0.0	1.19E-4	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	4.86	4.86	0.63082	4.86	4.86	0.63082	Complement control module (2);Sushi/SCR/CCP (1);	0.069339	0.56097	D	0.000026	T	0.55178	0.1904	M	0.84156	2.68	0.80722	D	1	P;D;D	0.89917	0.847;1.0;0.981	B;D;P	0.73380	0.129;0.98;0.832	T	0.60767	-0.7198	10	0.49607	T	0.09	.	18.0036	0.89203	0.0:0.0:1.0:0.0	.	1276;1276;1276	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	V	1276;1276;1138;1275;1275;1275	ENSP00000383047:A1276V;ENSP00000430733:A1276V;ENSP00000441462:A1275V;ENSP00000446243:A1275V;ENSP00000441675:A1275V	ENSP00000320445:A1138V	A	-	2	0	0	CSMD1	3152750	3152750	1.000000	0.71417	0.996000	0.52242	0.866000	0.49608	9.606000	0.98325	2.241000	0.73720	0.655000	0.94253	GCG	0.167987		TCGA-IB-7888-01A-11D-2154-08	0.448	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	1	0	1		2	2	2	0		0	0	48		48	47	1	1.960000	-3.318793	1	0.160000	NM_033225	Missense_Mutation		31	30		381	380	0		1			0	0	48	0		1.000000	0	0	0	0	0	0	31	381
PTK2B	2185	broad.mit.edu	37	8	27288476	27288476	+	Silent	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr8:27288476C>T	ENST00000397501.1	+	13	1561	c.753C>T	c.(751-753)ttC>ttT	p.F251F	PTK2B_ENST00000338238.4_Silent_p.F251F|PTK2B_ENST00000397497.4_5'UTR|PTK2B_ENST00000420218.2_Silent_p.F251F|PTK2B_ENST00000517339.1_Silent_p.F251F|PTK2B_ENST00000544172.1_Silent_p.F251F|PTK2B_ENST00000346049.5_Silent_p.F251F	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	251	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	TGAAGTTCTTCAACACTCTCG	0.577																																						ENST00000397501.1	1.000000	0.470000	8.600000e-01	5.700000e-01	0.690000	0.715459	0.690000	0.680000																										0				47						c.(751-753)ttC>ttT		protein tyrosine kinase 2 beta	Leflunomide(DB01097)						153.0	133.0	139.0					8																	27288476		2203	4300	6503	SO:0001819	synonymous_variant	2185	0	0					g.chr8:27288476C>T	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.753C>T	chr8.hg19:g.27288476C>T		0					PTK2B_ENST00000544172.1_Silent_p.F251F|PTK2B_ENST00000338238.4_Silent_p.F251F|PTK2B_ENST00000346049.5_Silent_p.F251F|PTK2B_ENST00000397497.4_5'UTR|PTK2B_ENST00000517339.1_Silent_p.F251F|PTK2B_ENST00000420218.2_Silent_p.F251F	p.F251F	NM_173174.2	NP_775266.1	1	2	3	2.011730	Q14289	FAK2_HUMAN		13	1561	+		Ovarian(32;2.72e-05)	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Silent	SNP	ENST00000397501.1	1	1	hg19	c.753C>T	CCDS6057.1	0	.	.	.	.	.	.	.	.	.	.	C	11.33	1.608253	0.28623	.	.	ENSG00000120899	ENST00000519512	.	.	.	5.8	5.8	0.92144	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1808	0.59653	0.0:0.8401:0.1599:0.0	.	.	.	.	X	25	.	.	Q	+	1	0	0	PTK2B	27344393	27344393	0.998000	0.40836	1.000000	0.80357	0.968000	0.65278	0.490000	0.22403	2.735000	0.93741	0.655000	0.94253	CAA	0.164678		TCGA-IB-7888-01A-11D-2154-08	0.577	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	1	0	1		2	2	2	0		0	0	75		75	74	1	1.960000	-5.730829	1	0.160000	NM_004103			28	28		486	481	1		1	1		0	0	75	0		1.000000	8.909084e-01	0	12	0	57	0	28	486
ASTN2	23245	broad.mit.edu	37	9	119188282	119188282	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr9:119188282C>T	ENST00000313400.4	-	23	3968	c.3868G>A	c.(3868-3870)Gtg>Atg	p.V1290M	ASTN2_ENST00000341734.4_Missense_Mutation_p.V342M|ASTN2_ENST00000361209.2_Missense_Mutation_p.V1239M|ASTN2_ENST00000361477.3_Missense_Mutation_p.V342M|ASTN2_ENST00000373996.3_Missense_Mutation_p.V1286M|ASTN2_ENST00000288520.5_Missense_Mutation_p.V391M			O75129	ASTN2_HUMAN	astrotactin 2	1290					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACTGTTTCCACGCGGCTCTGG	0.582																																						ENST00000313400.4	1.000000	0.370000	8.700000e-01	5.000000e-01	0.670000	0.688759	0.670000	1.000000																										0				102						c.(3868-3870)Gtg>Atg		astrotactin 2							81.0	69.0	73.0					9																	119188282		2203	4300	6503	SO:0001583	missense	23245	4	121412	33				g.chr9:119188282C>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3868G>A	chr9.hg19:g.119188282C>T	ENSP00000314038:p.Val1290Met	0					ASTN2_ENST00000373996.3_Missense_Mutation_p.V1286M|ASTN2_ENST00000361209.2_Missense_Mutation_p.V1239M|ASTN2_ENST00000341734.4_Missense_Mutation_p.V342M|ASTN2_ENST00000288520.5_Missense_Mutation_p.V391M|ASTN2_ENST00000361477.3_Missense_Mutation_p.V342M	p.V1290M			0	1	1	2.003816	O75129	ASTN2_HUMAN		23	3968	-			A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	1	1	hg19	c.3868G>A		0	.	.	.	.	.	.	.	.	.	.	C	15.58	2.877017	0.51801	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.14766	2.9;2.9;2.48;2.49;2.72;2.91;2.49	5.86	5.86	0.93980	5.86	5.86	0.93980	.	0.187931	0.46442	D	0.000285	T	0.10551	0.0258	N	0.08118	0	0.39656	D	0.970535	P;P;D;D;D;P;P	0.63046	0.567;0.567;0.992;0.987;0.989;0.567;0.882	B;B;P;B;P;B;B	0.51193	0.141;0.141;0.607;0.403;0.662;0.216;0.388	T	0.07520	-1.0768	10	0.51188	T	0.08	-23.4177	7.6948	0.28587	0.0:0.808:0.0:0.192	.	342;342;1239;1290;1286;342;391	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	M	1290;1286;391;342;1013;1239;342	ENSP00000314038:V1290M;ENSP00000363108:V1286M;ENSP00000288520:V391M;ENSP00000339925:V342M;ENSP00000363098:V1013M;ENSP00000354504:V1239M;ENSP00000355116:V342M	ENSP00000288520:V391M	V	-	1	0	0	ASTN2	118228103	118228103	1.000000	0.71417	0.966000	0.40874	0.836000	0.47400	4.208000	0.58486	2.761000	0.94854	0.655000	0.94253	GTG	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.582	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	28		28	27	1	1.960000	-15.089070	1	0.160000	NM_014010			12	12		213	211	0		1	0		0	0	28	0		0.999146	1.119584e-01	0	0	0	10	0	12	213
DOCK8	81704	broad.mit.edu	37	9	328114	328114	+	Silent	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr9:328114G>A	ENST00000453981.1	+	9	1099	c.987G>A	c.(985-987)gcG>gcA	p.A329A	DOCK8_ENST00000432829.2_Silent_p.A261A|DOCK8_ENST00000469391.1_Silent_p.A261A			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	329					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAAGTCAGGCGAGATCTGCAG	0.458																																						ENST00000453981.1	1.000000	0.740000	1	9.100000e-01	0.990000	0.967088	0.990000	1.000000																										0				65						c.(985-987)gcG>gcA		dedicator of cytokinesis 8							116.0	98.0	104.0					9																	328114		2203	4300	6503	SO:0001819	synonymous_variant	81704	0	0					g.chr9:328114G>A	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.987G>A	chr9.hg19:g.328114G>A		0					DOCK8_ENST00000432829.2_Silent_p.A261A|DOCK8_ENST00000469391.1_Silent_p.A261A	p.A329A			0	1	1	2.003816	Q8NF50	DOCK8_HUMAN		9	1099	+		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	ENST00000453981.1	1	1	hg19	c.987G>A	CCDS6440.2	1																																																																																								0.155949		TCGA-IB-7888-01A-11D-2154-08	0.458	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	1	0	1		2	2	2	0		0	0	30		30	29	1	1.960000	-2.966611	1	0.160000	XM_036307			25	25		255	255	0		1	0		0	0	30	0		1.000000	7.295541e-01	0	0	0	28	0	25	255
MELK	9833	broad.mit.edu	37	9	36670999	36670999	+	Missense_Mutation	SNP	C	C	T	rs200746617		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr9:36670999C>T	ENST00000298048.2	+	16	1694	c.1510C>T	c.(1510-1512)Cgc>Tgc	p.R504C	MELK_ENST00000545008.1_Missense_Mutation_p.R433C|MELK_ENST00000538311.1_Missense_Mutation_p.R310C|MELK_ENST00000543751.1_Missense_Mutation_p.R472C|MELK_ENST00000541717.1_Missense_Mutation_p.R463C|MELK_ENST00000536329.1_Missense_Mutation_p.R433C|MELK_ENST00000536860.1_Missense_Mutation_p.R456C|MELK_ENST00000536987.1_Missense_Mutation_p.R373C	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	504	Autoinhibitory region.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)	p.R504C(2)		breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TTTCAGGTGCCGCTCAGTGGA	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16669	0.0		0.0	False		,,,				2504	0.0				Ovarian(82;980 1317 7225 14391 18624)	ENST00000298048.2	0.960000	0.480000	8.300000e-01	5.800000e-01	0.690000	0.711876	0.690000	0.690000																										2	Substitution - Missense(2)	p.R504C(2)	ovary(1)|large_intestine(1)	29						c.(1510-1512)Cgc>Tgc		maternal embryonic leucine zipper kinase		C	CYS/ARG	0,4406		0,0,2203	103.0	100.0	101.0		1510	5.9	1.0	9		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	MELK	NM_014791.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	504/652	36670999	1,13005	2203	4300	6503	SO:0001583	missense	9833	4	121412	39				g.chr9:36670999C>T	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1510C>T	chr9.hg19:g.36670999C>T	ENSP00000298048:p.Arg504Cys	0					MELK_ENST00000541717.1_Missense_Mutation_p.R463C|MELK_ENST00000543751.1_Missense_Mutation_p.R472C|MELK_ENST00000536329.1_Missense_Mutation_p.R433C|MELK_ENST00000545008.1_Missense_Mutation_p.R433C|MELK_ENST00000538311.1_Missense_Mutation_p.R310C|MELK_ENST00000536987.1_Missense_Mutation_p.R373C|MELK_ENST00000536860.1_Missense_Mutation_p.R456C	p.R504C	NM_014791.3	NP_055606.1	0	1	1	2.003816	Q14680	MELK_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	16	1694	+		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	1	1	hg19	c.1510C>T	CCDS6606.1	0	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455826	0.84209	0.0	1.16E-4	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.73789	-0.58;0.39;0.17;0.71;0.08;-0.78;-0.56;-0.59	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.099925	0.64402	D	0.000001	D	0.85279	0.5660	M	0.63843	1.955	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;P;P	0.70716	0.97;0.97;0.921;0.921;0.911;0.886;0.886	D	0.84401	0.0560	10	0.54805	T	0.06	-9.996	20.3932	0.98965	0.0:1.0:0.0:0.0	.	424;433;456;463;433;472;504	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	C	504;310;373;433;456;433;463;472	ENSP00000298048:R504C;ENSP00000438226:R310C;ENSP00000439184:R373C;ENSP00000445452:R433C;ENSP00000439792:R456C;ENSP00000443550:R433C;ENSP00000437804:R463C;ENSP00000441596:R472C	ENSP00000298048:R504C	R	+	1	0	0	MELK	36660999	36660999	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.420000	0.52735	2.824000	0.97209	0.655000	0.94253	CGC	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.488	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	1	0	1		2	2	2	0		0	0	41		41	41	1	1.960000	-2.642034	1	0.160000	NM_014791			29	28		487	484	0		1	1		0	0	41	0		1.000000	9.344850e-02	0	2	0	7	0	29	487
COL5A1	1289	broad.mit.edu	37	9	137658318	137658318	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08			G	C	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chr9:137658318G>C	ENST00000371817.3	+	22	2521	c.2107G>C	c.(2107-2109)Ggc>Cgc	p.G703R		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	703	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGGTATGGACGGCCAGCCGGG	0.542																																						ENST00000371817.3	0.900000	0.280000	7.200000e-01	3.900000e-01	0.540000	0.565456	0.540000	0.520000																										0				115						c.(2107-2109)Ggc>Cgc		collagen, type V, alpha 1							85.0	80.0	82.0					9																	137658318		2203	4300	6503	SO:0001583	missense	1289	0	0					g.chr9:137658318G>C	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2107G>C	chr9.hg19:g.137658318G>C	ENSP00000360882:p.Gly703Arg	0						p.G703R	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	0	1	1	2.003816	P20908	CO5A1_HUMAN		22	2521	+		Myeloproliferative disorder(178;0.0341)	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	0	1	hg19	c.2107G>C	CCDS6982.1	0	.	.	.	.	.	.	.	.	.	.	G	11.38	1.620563	0.28801	.	.	ENSG00000130635	ENST00000371817	D	0.99186	-5.53	4.71	3.79	0.43588	4.71	3.79	0.43588	.	0.000000	0.64402	U	0.000001	D	0.99318	0.9761	H	0.98314	4.2	0.47819	D	0.999522	D	0.63046	0.992	P	0.53722	0.733	D	0.98691	1.0696	10	0.87932	D	0	.	10.0654	0.42299	0.0:0.0:0.7989:0.2011	.	703	P20908	CO5A1_HUMAN	R	703	ENSP00000360882:G703R	ENSP00000360882:G703R	G	+	1	0	0	COL5A1	136798139	136798139	1.000000	0.71417	0.559000	0.28332	0.315000	0.28087	6.660000	0.74417	0.933000	0.37291	0.655000	0.94253	GGC	0.155949		TCGA-IB-7888-01A-11D-2154-08	0.542	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	0	0	1		2	2	2	0		0	0	30		30	30	1	1.960000	-3.884504	1	0.160000	NM_000093			10	10		224	222	0		1	0		0	0	30	0		0.996863	9.943699e-01	0	0	0	206	0	10	224
CSF2RA	1438	broad.mit.edu	37	X	1428355	1428355	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chrX:1428355G>A	ENST00000381524.3	+	13	1372	c.1186G>A	c.(1186-1188)Gtg>Atg	p.V396M	CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_3'UTR|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000417535.2_Missense_Mutation_p.V430M|CSF2RA_ENST00000432318.2_Missense_Mutation_p.V396M|CSF2RA_ENST00000361536.3_3'UTR|CSF2RA_ENST00000355432.3_Missense_Mutation_p.R336H|CSF2RA_ENST00000381529.3_Missense_Mutation_p.V396M|CSF2RA_ENST00000501036.2_Missense_Mutation_p.V263M|CSF2RA_ENST00000355805.2_3'UTR			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	396					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GGTCTTGACCGTGAAGGAAAT	0.527																																					Esophageal Squamous(131;723 1707 25334 40494 41806)	ENST00000381524.3	0.180000	0.030000	1.300000e-01	5.000000e-02	0.080000	0.098159	0.080000	0.080000																										0				45						c.(1186-1188)Gtg>Atg		colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	Sargramostim(DB00020)	G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,HIS/ARG,,	0,4406		0,0,2203	232.0	216.0	221.0		1186,1288,787,1186,1186,1007,,	0.7	0.0	X	dbSNP_134	221	3,8589		0,3,4293	yes	missense,missense,missense,missense,missense,missense,utr-3,utr-3	CSF2RA	NM_001161529.1,NM_001161530.1,NM_001161532.1,NM_006140.4,NM_172245.2,NM_172246.2,NM_172247.2,NM_172249.2	21,21,21,21,21,29,,	0,3,6496	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,,	396/401,430/435,263/268,396/401,396/401,336/378,,	1428355	3,12995	2203	4296	6499	SO:0001583	missense	1438	18	121412	48				g.chrX:1428355G>A	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.1186G>A	chrX.hg19:g.1428355G>A	ENSP00000370935:p.Val396Met						CSF2RA_ENST00000381500.1_3'UTR|CSF2RA_ENST00000381529.3_Missense_Mutation_p.V396M|CSF2RA_ENST00000417535.2_Missense_Mutation_p.V430M|CSF2RA_ENST00000361536.3_3'UTR|CSF2RA_ENST00000355432.3_Missense_Mutation_p.R336H|CSF2RA_ENST00000501036.2_Missense_Mutation_p.V263M|CSF2RA_ENST00000432318.2_Missense_Mutation_p.V396M|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000355805.2_3'UTR|CSF2RA_ENST00000498153.1_3'UTR	p.V396M			0	1	1		P15509	CSF2R_HUMAN		13	1372	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	ENST00000381524.3	0	1	hg19	c.1186G>A	CCDS35191.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.17|11.17	1.559304|1.559304	0.27827|0.27827	0.0|0.0	3.49E-4|3.49E-4	ENSG00000198223|ENSG00000198223	ENST00000355432|ENST00000381529;ENST00000432318;ENST00000501036;ENST00000381524;ENST00000417535	T|D;D;D;D;D	0.46451|0.95272	0.87|-3.53;-3.53;-3.66;-3.53;-3.32	0.69|0.69	0.69|0.69	0.18039|0.18039	0.69|0.69	0.69|0.69	0.18039|0.18039	.|.	.|.	.|.	.|.	.|.	D|D	0.95522|0.95522	0.8545|0.8545	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|D;D	0.54207|0.76494	0.965|0.999;0.997	B|P;P	0.32864|0.61201	0.154|0.885;0.838	D|D	0.88243|0.88243	0.2911|0.2911	7|7	0.87932|0.66056	D|D	0|0.02	.|.	.|.	.|.	.|.	.|.	337|430;396	P15509-5|A7J003;P15509	.|.;CSF2R_HUMAN	H|M	336|396;396;263;396;430	ENSP00000347606:R336H|ENSP00000370940:V396M;ENSP00000416437:V396M;ENSP00000440491:V263M;ENSP00000370935:V396M;ENSP00000394227:V430M	ENSP00000347606:R336H|ENSP00000370935:V396M	R|V	+|+	2|1	0|0	0|0	CSF2RA|CSF2RA	1388355|1388355	1388355|1388355	0.007000|0.007000	0.16637|0.16637	0.020000|0.020000	0.16555|0.16555	0.092000|0.092000	0.18411|0.18411	1.192000|1.192000	0.32150|0.32150	0.658000|0.658000	0.30925|0.30925	0.110000|0.110000	0.15639|0.15639	CGT|GTG	0.160000		TCGA-IB-7888-01A-11D-2154-08	0.527	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2	0	0	1		2	2	2	0		0	0	91		91	91	1	1.960000	-2.034825	0	0.160000				6	6		878	872	0		1	0		0	0	91	0		0.964281	4.139506e-02	0	0	0	39	0	6	878
STS	412	broad.mit.edu	37	X	7267976	7267976	+	Missense_Mutation	SNP	G	G	A	rs183370963		TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chrX:7267976G>A	ENST00000217961.4	+	10	1646	c.1426G>A	c.(1426-1428)Gtg>Atg	p.V476M		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	476					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CTTCAACCCCGTGGGTTCCAA	0.473									Ichthyosis				G|||	4	0.0010596	0.0	0.0	3775	,	,		14289	0.004		0.0	False		,,,				2504	0.0					ENST00000217961.4	0.180000	0.030000	1.300000e-01	5.000000e-02	0.080000	0.098936	0.080000	0.080000																										0				27						c.(1426-1428)Gtg>Atg		steroid sulfatase (microsomal), isozyme S	Norelgestromin(DB06713)						117.0	107.0	111.0					X																	7267976		2203	4299	6502	SO:0001583	missense	412	32	121388	49	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chrX:7267976G>A	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1426G>A	chrX.hg19:g.7267976G>A	ENSP00000217961:p.Val476Met							p.V476M	NM_000351.4	NP_000342.2	0	1	1		P08842	STS_HUMAN		10	1646	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	0	1	hg19	c.1426G>A	CCDS14127.1	0	3	0.0018083182640144665	0	0.0	0	0.0	1	0.0017605633802816902	0	0.0	G	8.477	0.858878	0.17178	.	.	ENSG00000101846	ENST00000217961	D	0.89415	-2.51	4.22	3.35	0.38373	4.22	3.35	0.38373	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.537990	0.20281	N	0.095442	T	0.70413	0.3221	N	0.03608	-0.345	0.09310	N	0.999996	P	0.41498	0.752	B	0.33339	0.162	T	0.65146	-0.6239	10	0.56958	D	0.05	.	7.1491	0.25599	0.2151:0.0:0.7849:0.0	.	476	P08842	STS_HUMAN	M	476	ENSP00000217961:V476M	ENSP00000217961:V476M	V	+	1	0	0	STS	7277976	7277976	0.042000	0.20092	0.064000	0.19789	0.004000	0.04260	1.805000	0.38883	0.627000	0.30340	0.594000	0.82650	GTG	0.160000		TCGA-IB-7888-01A-11D-2154-08	0.473	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	0	0	1		2	2	2	0		0	0	92		92	91	1	1.960000	-2.891929	1	0.160000	NM_000351			6	6		871	858	0		1	0	0	0	0	92	0		0.963373	1.467889e-01	0	0	0	83	1	6	871
LAMP2	3920	broad.mit.edu	37	X	119576496	119576496	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7888-01A-11D-2154-08	TCGA-IB-7888-10A-01D-2154-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	848ffe2a-2771-4f43-8b27-d59425f52af4	8f106862-2abd-4d1f-b9af-8d584a18d612	g.chrX:119576496G>T	ENST00000200639.4	-	7	1022	c.886C>A	c.(886-888)Ctg>Atg	p.L296M	LAMP2_ENST00000371335.4_Missense_Mutation_p.L296M|LAMP2_ENST00000538785.1_Missense_Mutation_p.L185M|LAMP2_ENST00000540603.1_Missense_Mutation_p.L249M|LAMP2_ENST00000434600.2_Missense_Mutation_p.L296M			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	296	Second lumenal domain.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						ACTTCCTTCAGATAAAATCGG	0.383																																						ENST00000200639.4	0.950000	0.630000	8.700000e-01	7.000000e-01	0.780000	0.795474	0.780000	0.790000																										0				15						c.(886-888)Ctg>Atg		lysosomal-associated membrane protein 2							202.0	192.0	195.0					X																	119576496		2203	4300	6503	SO:0001583	missense	3920	0	0					g.chrX:119576496G>T	X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.886C>A	chrX.hg19:g.119576496G>T	ENSP00000200639:p.Leu296Met						LAMP2_ENST00000434600.2_Missense_Mutation_p.L296M|LAMP2_ENST00000538785.1_Missense_Mutation_p.L185M|LAMP2_ENST00000371335.4_Missense_Mutation_p.L296M|LAMP2_ENST00000540603.1_Missense_Mutation_p.L249M	p.L296M			0	1	1		P13473	LAMP2_HUMAN		7	1022	-			A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Missense_Mutation	SNP	ENST00000200639.4	1	1	hg19	c.886C>A	CCDS14599.1	0	.	.	.	.	.	.	.	.	.	.	G	17.93	3.510196	0.64522	.	.	ENSG00000005893	ENST00000434600;ENST00000538785;ENST00000200639;ENST00000371335;ENST00000540603	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	5.34	4.48	0.54585	5.34	4.48	0.54585	.	0.000000	0.64402	D	0.000002	T	0.76557	0.4004	M	0.91038	3.17	0.48288	D	0.999626	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.80625	-0.1299	10	0.72032	D	0.01	-9.4133	11.8331	0.52307	0.0878:0.0:0.9122:0.0	.	249;185;296;296;296	B4E2S7;B7Z2R9;P13473-2;P13473;Q6Q3G8	.;.;.;LAMP2_HUMAN;.	M	296;185;296;296;249	ENSP00000408411:L296M;ENSP00000440506:L185M;ENSP00000200639:L296M;ENSP00000360386:L296M;ENSP00000440479:L249M	ENSP00000200639:L296M	L	-	1	2	2	LAMP2	119460524	119460524	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.599000	0.67592	1.011000	0.39340	0.594000	0.82650	CTG	0.160000		TCGA-IB-7888-01A-11D-2154-08	0.383	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058099.1	1	0	1		2	2	2	0		0	0	158		158	158	1	1.960000	-12.721170	1	0.160000				87	87		1288	1276	1		1	1		0	0	158	0		1.000000	1	0	101	0	299	0	87	1288
