#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
MAP4K4	9448	broad.mit.edu	37	2	102314997	102314998	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr2:102314997_102314998insA	ENST00000347699.4	+	2	120_121	c.120_121insA	c.(121-123)aagfs	p.K41fs	MAP4K4_ENST00000324219.4_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000302217.5_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000413150.2_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000425019.1_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000456652.1_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000350198.4_Frame_Shift_Ins_p.K41fs	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	41	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GACAAGTCTATAAGGTCGGTGT	0.515																																						ENST00000347699.4	0.560000	0.340000	0.510000	0.390000	0.440000	0.453055	0.440000	0.450000																										0				41						c.(121-123)aagfs		mitogen-activated protein kinase kinase kinase kinase 4																																				SO:0001589	frameshift_variant	9448	0	0					g.chr2:102314997_102314998insA	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.122dupA	chr2.hg19:g.102314999_102314999dupA	ENSP00000314363:p.Lys41fs	0					MAP4K4_ENST00000456652.1_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000350198.4_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000425019.1_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000324219.4_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000302217.5_Frame_Shift_Ins_p.K41fs|MAP4K4_ENST00000413150.2_Frame_Shift_Ins_p.K41fs	p.K41fs	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	0	0	0	1.985275	O95819	M4K4_HUMAN		2	120_121	+			O75172|Q9NST7	Frame_Shift_Ins	INS	ENST00000347699.4	0	1	hg19	c.120_121insA	CCDS56130.1	0																																																																																								0.202454		TCGA-IB-7889-01A-11D-2154-08	0.515	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	1	0	1		2	2		0	0	0	0	227	0	227	224	1	1.900000	-20.000000	1	0.220000	NM_004834		0	63	64	0	1187	1166	0	0	1	0	0	0	0	227	0	0	1.000000	6.222740e-01	0	0	0	41	0	63	1187
GOLGA2	2801	broad.mit.edu	37	9	131022880	131022881	+	Frame_Shift_Ins	INS	-	-	A	rs566301242		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr9:131022880_131022881insA	ENST00000421699.2	-	17	1552_1553	c.1540_1541insT	c.(1540-1542)tggfs	p.W514fs	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Frame_Shift_Ins_p.W502fs	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	514					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CTGCTCCCCCCAGAGCTCGGCC	0.653																																						ENST00000421699.2	0.730000	0.450000	0.640000	0.500000	0.570000	0.581607	0.570000	0.570000																										0				34						c.(1540-1542)tggfs		golgin A2																																				SO:0001589	frameshift_variant	2801	0	0					g.chr9:131022880_131022881insA	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1541dupT	chr9.hg19:g.131022881_131022881dupA	ENSP00000416097:p.Trp514fs	0					AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Frame_Shift_Ins_p.W502fs	p.W514fs	NM_004486.4	NP_004477.3	1	2	3	2.022956	Q08379	GOGA2_HUMAN		17	1552_1553	-			Q6GRM9|Q9BRB0|Q9NYF9	Frame_Shift_Ins	INS	ENST00000421699.2	0	1	hg19	c.1540_1541insT	CCDS6896.2	0																																																																																								0.221712		TCGA-IB-7889-01A-11D-2154-08	0.653	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	1	0	1		2	2		0	0	0	0	171	0	171	171	1	1.900000	-10.635520	1	0.220000	NM_004486		0	73	77	0	1089	1070	0	0	1	0	0	0	0	171	0	0	1.000000	6.252918e-01	0	0	0	33	0	73	1089
PRKG1	5592	broad.mit.edu	37	10	53564378	53564378	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr10:53564378G>A	ENST00000401604.2	+	4	775	c.581G>A	c.(580-582)cGa>cAa	p.R194Q	PRKG1_ENST00000373985.1_Missense_Mutation_p.R182Q|PRKG1_ENST00000373980.4_Missense_Mutation_p.R209Q			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	194	cGMP-binding, high affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GCCATTGATCGACAATGTTTT	0.338																																						ENST00000401604.2	1.000000	0.690000	1.000000	0.830000	0.990000	0.937497	0.990000	1.000000																										0				53						c.(580-582)cGa>cAa		protein kinase, cGMP-dependent, type I							116.0	108.0	111.0					10																	53564378		2203	4300	6503	SO:0001583	missense	5592	0	0					g.chr10:53564378G>A		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.581G>A	chr10.hg19:g.53564378G>A	ENSP00000384200:p.Arg194Gln	0					PRKG1_ENST00000373980.4_Missense_Mutation_p.R209Q|PRKG1_ENST00000373985.1_Missense_Mutation_p.R182Q	p.R194Q			1	2	3	2.107221	Q13976	KGP1_HUMAN		4	775	+		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	1	1	hg19	c.581G>A	CCDS44399.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.387931	0.95988	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000373976	D;D;D;D	0.97378	-4.36;-4.36;-2.08;-2.08	5.42	5.42	0.78866	5.42	5.42	0.78866	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000003	D	0.98516	0.9505	M	0.85099	2.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.99327	1.0908	10	0.72032	D	0.01	-5.7115	17.0633	0.86553	0.0:0.0:1.0:0.0	.	209;194	Q13976-2;Q13976	.;KGP1_HUMAN	Q	194;182;209;67	ENSP00000384200:R194Q;ENSP00000363097:R182Q;ENSP00000363092:R209Q;ENSP00000363087:R67Q	ENSP00000363087:R67Q	R	+	2	0	0	PRKG1	53234384	53234384	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.386000	0.97228	2.698000	0.92095	0.591000	0.81541	CGA	0.238430		TCGA-IB-7889-01A-11D-2154-08	0.338	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.900000	-11.831130	1	0.220000			0	31	31	0	267	263	1		1			0	0	43	0	0	1.000000	0	0	0	0	0	0	31	267
MYOZ1	58529	broad.mit.edu	37	10	75391860	75391861	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr10:75391860_75391861GG>TT	ENST00000359322.4	-	6	1091_1092	c.727_728CC>AA	c.(727-729)CCc>AAc	p.P243N	RP11-464F9.22_ENST00000609434.1_lincRNA	NM_021245.3	NP_067068.1			myozenin 1											central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					GTCAAACTTGGGCATCTGGAAG	0.49																																						ENST00000359322.4	1.000000	0.210000|0.220000	1.000000	0.290000	0.390000|0.400000	0.486804|0.491344	0.390000|0.400000	0.370000																										0				12						c.(727-729)cCc>cAc|c.(727-729)Ccc>Acc		myozenin 1																																				SO:0001583	missense	58529	0	0					g.chr10:75391860G>T|g.chr10:75391861G>T	AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.727_728delinsTT	chr10.hg19:g.75391860_75391861delinsTT	ENSP00000352272:p.Pro243Asn	0					RP11-464F9.22_ENST00000609434.1_lincRNA	p.P243H|p.P243T	NM_021245.3	NP_067068.1	1	2	3	2.107221				6	1092|1091	-	Prostate(51;0.0112)			Missense_Mutation	SNP	ENST00000359322.4	1	1	hg19	c.728C>A|c.727C>A	CCDS7330.1	0																									5.63	5.63	0.86233																																												0			75061866|75061867														0.238430		TCGA-IB-7889-01A-11D-2154-08	0.490	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048654.1	0	0	1	2	2	2	2	0	0	0	0	48	49|48	49|48	49|48	1	1.900000	-3.125343|-4.170522	1	0.220000			0	14	13	0	342|337	339|334	0		1	0		0	0	49|48	0	0	0.999749	2.513233e-01|2.407919e-01	0	0	0	23|22	0	14	337
OR10Q1	219960	broad.mit.edu	37	11	57995470	57995470	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr11:57995470A>G	ENST00000316770.2	-	1	920	c.878T>C	c.(877-879)tTg>tCg	p.L293S		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GCTGTAAAGCAAAGGGTTGAG	0.547																																						ENST00000316770.2	1.000000	0.470000	0.730000	0.540000	0.630000	0.648913	0.630000	0.620000																										0				35						c.(877-879)tTg>tCg		olfactory receptor, family 10, subfamily Q, member 1							144.0	135.0	138.0					11																	57995470		2201	4295	6496	SO:0001583	missense	219960	0	0					g.chr11:57995470A>G	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.878T>C	chr11.hg19:g.57995470A>G	ENSP00000314324:p.Leu293Ser	0						p.L293S	NM_001004471.2	NP_001004471.1	1	2	3	2.035080	Q8NGQ4	O10Q1_HUMAN		1	920	-		Breast(21;0.0589)	Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	1	1	hg19	c.878T>C	CCDS31547.1	0	.	.	.	.	.	.	.	.	.	.	A	15.25	2.778355	0.49786	.	.	ENSG00000180475	ENST00000316770	T	0.46451	0.87	5.07	5.07	0.68467	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34362	N	0.004034	T	0.62913	0.2467	M	0.79926	2.475	0.32070	N	0.594593	D	0.65815	0.995	P	0.61800	0.894	T	0.74481	-0.3651	10	0.87932	D	0	.	13.8047	0.63223	1.0:0.0:0.0:0.0	.	293	Q8NGQ4	O10Q1_HUMAN	S	293	ENSP00000314324:L293S	ENSP00000314324:L293S	L	-	2	0	0	OR10Q1	57752046	57752046	0.712000	0.27916	0.775000	0.31657	0.195000	0.23768	5.574000	0.67424	2.132000	0.65825	0.528000	0.53228	TTG	0.224267		TCGA-IB-7889-01A-11D-2154-08	0.547	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	1	0	1	2	2	2	2	0	0	0	0	143	143	143	142	1	1.900000	-10.818930	1	0.220000	NM_001004471		0	51	51	0	692	687	0		1			0	0	143	0	0	1.000000	0	0	0	0	0	0	51	692
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.870000	1.000000	0.990000	0.990000	0.992446	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	3	3	2.089326	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.253660		TCGA-IB-7889-01A-11D-2154-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.900000	-9.865792	1	0.220000	NM_033360		1878	13	13	6141	72	72	1	1	1	1	1	0	0	17	403	1	0.999679	1.279220e-01	9.996229e-01	3	8	1	75	13	72
GPR182	11318	broad.mit.edu	37	12	57389416	57389416	+	Silent	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr12:57389416C>T	ENST00000300098.1	+	2	642	c.423C>T	c.(421-423)atC>atT	p.I141I	RP11-474N8.5_ENST00000556850.1_RNA|HBCBP_ENST00000600202.1_5'Flank	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	141					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						ATAGCAGCATCTTCTTCCTGG	0.592																																						ENST00000300098.1	1.000000	0.680000	1.000000	0.820000	0.990000	0.931965	0.990000	1.000000																										0				15						c.(421-423)atC>atT		G protein-coupled receptor 182							170.0	139.0	149.0					12																	57389416		2203	4300	6503	SO:0001819	synonymous_variant	11318	0	0					g.chr12:57389416C>T	Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.423C>T	chr12.hg19:g.57389416C>T		0					HBCBP_ENST00000600202.1_5'Flank|RP11-474N8.5_ENST00000556850.1_RNA	p.I141I	NM_007264.3	NP_009195.1	1	2	3	2.079019	O15218	GP182_HUMAN		2	642	+				Silent	SNP	ENST00000300098.1	1	1	hg19	c.423C>T	CCDS8927.1	1																																																																																								0.253660		TCGA-IB-7889-01A-11D-2154-08	0.592	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411212.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.900000	-20.000000	1	0.220000	NM_007264		0	35	34	0	320	317	0		1			0	0	44	0	0	1.000000	0	0	0	0	0	0	35	320
FOXA1	3169	broad.mit.edu	37	14	38061592	38061592	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr14:38061592C>T	ENST00000250448.2	-	2	458	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.A100T	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	133					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		GGGTTCATGGCGGCCGCGTAG	0.736																																						ENST00000250448.2	1.000000	0.280000	0.990000	0.420000	0.610000	0.653599	0.610000	1.000000																										0				19						c.(397-399)Gcc>Acc		forkhead box A1							13.0	15.0	14.0					14																	38061592		2157	4173	6330	SO:0001583	missense	3169	0	0					g.chr14:38061592C>T	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.397G>A	chr14.hg19:g.38061592C>T	ENSP00000250448:p.Ala133Thr	1					FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.A100T	p.A133T	NM_004496.3	NP_004487.2	0	2	2	1.976087	P55317	FOXA1_HUMAN	Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	2	458	-	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	ENST00000250448.2	0	1	hg19	c.397G>A	CCDS9665.1	0	.	.	.	.	.	.	.	.	.	.	C	4.498	0.092298	0.08632	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	T;T	0.18502	2.21;2.21	3.99	1.91	0.25777	3.99	1.91	0.25777	Fork-head N-terminal (1);	0.667620	0.14434	N	0.319836	T	0.05868	0.0153	N	0.03608	-0.345	0.22954	N	0.998514	B	0.27997	0.197	B	0.23150	0.044	T	0.40308	-0.9570	10	0.10902	T	0.67	.	8.1718	0.31260	0.4693:0.5307:0.0:0.0	.	133	P55317	FOXA1_HUMAN	T	133;100	ENSP00000250448:A133T;ENSP00000440178:A100T	ENSP00000250448:A133T	A	-	1	0	0	FOXA1	37131343	37131343	0.000000	0.05858	0.991000	0.47740	0.985000	0.73830	-0.572000	0.05881	0.869000	0.35703	0.505000	0.49811	GCC	0.220000		TCGA-IB-7889-01A-11D-2154-08	0.736	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276735.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	16	1	1.900000	-12.521950	1	0.220000			0	8	8	0	121	118	0		1			0	0	18	0	0	0.989095	0	0	0	0	0	0	8	121
HSP90AA1	3320	broad.mit.edu	37	14	102551163	102551163	+	Missense_Mutation	SNP	T	T	A	rs55793809	byFrequency	TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr14:102551163T>A	ENST00000216281.8	-	5	1041	c.836A>T	c.(835-837)aAg>aTg	p.K279M	HSP90AA1_ENST00000334701.7_Missense_Mutation_p.K401M|HSP90AA1_ENST00000441629.2_Missense_Mutation_p.K100M	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	279					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	ttccttaatcttcttcttctt	0.393													T|||	5	0.000998403	0.0015	0.0	5008	,	,		21523	0.0		0.0	False		,,,				2504	0.0031					ENST00000216281.8	1.000000	0.970000	1.000000	0.990000	0.990000	0.997684	0.990000	1.000000																										0				28						c.(835-837)aAg>aTg		heat shock protein 90kDa alpha (cytosolic), class A member 1	Nedocromil(DB00716)|Rifabutin(DB00615)	T	MET/LYS,MET/LYS	9,4397	14.3+/-33.2	0,9,2194	116.0	100.0	106.0		1202,836	4.5	1.0	14	dbSNP_129	106	7,8593	5.7+/-21.5	0,7,4293	no	missense,missense	HSP90AA1	NM_001017963.2,NM_005348.3	95,95	0,16,6487	AA,AT,TT		0.0814,0.2043,0.123	probably-damaging,probably-damaging	401/855,279/733	102551163	16,12990	2203	4300	6503	SO:0001583	missense	3320	164	121306	52				g.chr14:102551163T>A	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.836A>T	chr14.hg19:g.102551163T>A	ENSP00000216281:p.Lys279Met	1					HSP90AA1_ENST00000334701.7_Missense_Mutation_p.K401M|HSP90AA1_ENST00000441629.2_Missense_Mutation_p.K100M	p.K279M	NM_005348.3	NP_005339.3	0	2	2	1.976087	P07900	HS90A_HUMAN		5	1041	-			A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	1	0	hg19	c.836A>T	CCDS9967.1	1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	t	18.27	3.588032	0.66105	0.002043	8.14E-4	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629	T;T;T	0.13538	2.58;2.58;2.58	4.47	4.47	0.54385	4.47	4.47	0.54385	.	0.338820	0.24182	U	0.040783	T	0.55305	0.1912	H	0.98701	4.305	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.996	T	0.74372	-0.3687	10	0.87932	D	0	-21.8453	13.7315	0.62789	0.0:0.0:0.0:1.0	rs55793809	100;401;279	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	M	279;401;100	ENSP00000216281:K279M;ENSP00000335153:K401M;ENSP00000396189:K100M	ENSP00000216281:K279M	K	-	2	0	0	HSP90AA1	101620916	101620916	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.016000	0.70798	1.786000	0.52430	0.533000	0.62120	AAG	0.220000		TCGA-IB-7889-01A-11D-2154-08	0.393	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	1	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.900000	-1.749966	0	0.220000	NM_005348		0	31	29	0	175	174	1		1	1		0	0	43	0	0	1.000000	1	0	661	0	437	0	31	175
PLA2G4E	123745	broad.mit.edu	37	15	42276761	42276761	+	Silent	SNP	G	G	A	rs375560571		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr15:42276761G>A	ENST00000399518.3	-	19	2745	c.2259C>T	c.(2257-2259)taC>taT	p.Y753Y	PLA2G4E_ENST00000413860.2_Silent_p.Y724Y|CTD-2382E5.1_ENST00000499478.2_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	741	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.			C -> Y (in Ref. 1; BAC87034). {ECO:0000305}.	glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		CTGGCAGCTCGTATTTGGGGA	0.522																																						ENST00000399518.3	1.000000	0.220000	0.840000	0.320000	0.440000	0.523035	0.440000	0.400000																										0				16						c.(2257-2259)taC>taT		phospholipase A2, group IVE		G		1,3853		0,1,1926	91.0	88.0	89.0		2259	-6.5	0.0	15		89	0,8308		0,0,4154	no	coding-synonymous	PLA2G4E	NM_001206670.1		0,1,6080	AA,AG,GG		0.0,0.0259,0.0082		753/869	42276761	1,12161	1927	4154	6081	SO:0001819	synonymous_variant	123745	6	120874	38				g.chr15:42276761G>A		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.2259C>T	chr15.hg19:g.42276761G>A		0					CTD-2382E5.1_ENST00000499478.2_RNA|PLA2G4E_ENST00000413860.2_Silent_p.Y724Y	p.Y753Y	NM_001206670.1	NP_001193599.1	1	2	3	2.104604	Q3MJ16	PA24E_HUMAN		19	2745	-		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)	Q6ZSC0	Silent	SNP	ENST00000399518.3	1	1	hg19	c.2259C>T	CCDS55962.1	0																																																																																								0.237611		TCGA-IB-7889-01A-11D-2154-08	0.522	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	0	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.900000	-3.229017	1	0.220000	NM_198442		0	11	11	0	241	238	0		1			0	0	41	0	0	0.998330	0	0	0	0	0	0	11	241
SECISBP2L	9728	broad.mit.edu	37	15	49288724	49288724	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr15:49288724C>A	ENST00000559471.1	-	17	2726	c.2463G>T	c.(2461-2463)atG>atT	p.M821I	Y_RNA_ENST00000384377.1_RNA|SECISBP2L_ENST00000261847.3_Missense_Mutation_p.M776I	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	821							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TTGCTGCAACCATATCTTTAT	0.408																																						ENST00000559471.1	1.000000	0.280000	0.580000	0.330000	0.400000	0.492732	0.400000	0.390000																										0				46						c.(2461-2463)atG>atT		SECIS binding protein 2-like							241.0	226.0	231.0					15																	49288724		2197	4295	6492	SO:0001583	missense	9728	0	0					g.chr15:49288724C>A	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.2463G>T	chr15.hg19:g.49288724C>A	ENSP00000453854:p.Met821Ile	0					SECISBP2L_ENST00000261847.3_Missense_Mutation_p.M776I|Y_RNA_ENST00000384377.1_RNA	p.M821I	NM_001193489.1	NP_001180418.1	1	2	3	2.104604	Q93073	SBP2L_HUMAN		17	2726	-			Q8N767	Missense_Mutation	SNP	ENST00000559471.1	1	1	hg19	c.2463G>T	CCDS53942.1	0	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747448	0.89663	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	D	0.91843	-2.92	4.94	4.94	0.65067	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.90109	0.6910	L	0.29908	0.895	0.58432	D	0.999997	D;P	0.54207	0.965;0.94	B;P	0.47402	0.344;0.546	D	0.91643	0.5328	10	0.72032	D	0.01	.	18.3573	0.90362	0.0:1.0:0.0:0.0	.	821;776	Q93073;Q93073-2	SBP2L_HUMAN;.	I	776;821	ENSP00000261847:M776I	ENSP00000261847:M776I	M	-	3	0	0	SECISBP2L	47076016	47076016	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.300000	0.78841	2.569000	0.86673	0.650000	0.86243	ATG	0.237611		TCGA-IB-7889-01A-11D-2154-08	0.408	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	1	0	1	2	2	2	2	0	0	0	0	165	165	165	164	1	1.900000	-3.858861	1	0.220000	NM_014701		0	42	42	0	958	943	0		1	0		0	0	165	0	0	1.000000	7.920589e-02	0	1	0	10	0	42	958
CEMIP	57214	broad.mit.edu	37	15	81201475	81201475	+	Missense_Mutation	SNP	C	C	T	rs200436734		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr15:81201475C>T	ENST00000394685.3	+	14	2044	c.1625C>T	c.(1624-1626)aCg>aTg	p.T542M	KIAA1199_ENST00000356249.5_Missense_Mutation_p.T542M|RP11-351M8.1_ENST00000560560.1_Intron|KIAA1199_ENST00000220244.3_Missense_Mutation_p.T542M|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		542	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTGGAGGGCACGGAGCTGAAG	0.552													T|||	1	0.000199681	0.0	0.0014	5008	,	,		19589	0.0		0.0	False		,,,				2504	0.0					ENST00000394685.3	1.000000	0.300000	0.830000	0.390000	0.520000	0.583472	0.520000	0.490000																										0				49						c.(1624-1626)aCg>aTg									121.0	89.0	100.0					15																	81201475		2203	4300	6503	SO:0001583	missense	0	3	121412	34				g.chr15:81201475C>T																												ENST00000394685.3:c.1625C>T	chr15.hg19:g.81201475C>T	ENSP00000378177:p.Thr542Met	0					KIAA1199_ENST00000356249.5_Missense_Mutation_p.T542M|RP11-351M8.2_ENST00000560873.1_RNA|RP11-351M8.1_ENST00000560560.1_Intron|KIAA1199_ENST00000220244.3_Missense_Mutation_p.T542M	p.T542M			1	2	3	2.100873	Q8WUJ3	CEMIP_HUMAN		14	2044	+			Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	1	1	hg19	c.1625C>T	CCDS10315.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	T	10.26	1.302383	0.23736	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.80123	-1.34;-1.34;-1.34	5.09	5.09	0.68999	5.09	5.09	0.68999	Pectin lyase fold/virulence factor (1);	0.291065	0.31177	N	0.008117	T	0.60945	0.2308	N	0.03608	-0.345	0.20307	N	0.999913	B	0.02656	0.0	B	0.01281	0.0	T	0.54043	-0.8352	10	0.54805	T	0.06	-9.3098	10.8753	0.46906	0.0:0.0747:0.0:0.9253	.	542	Q8WUJ3	K1199_HUMAN	M	542	ENSP00000220244:T542M;ENSP00000378177:T542M;ENSP00000348583:T542M	ENSP00000220244:T542M	T	+	2	0	0	KIAA1199	78988530	78988530	1.000000	0.71417	0.995000	0.50966	0.215000	0.24574	5.679000	0.68160	0.787000	0.33731	-0.516000	0.04426	ACG	0.236791		TCGA-IB-7889-01A-11D-2154-08	0.552	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.900000	-3.324015	1	0.220000			0	16	16	0	289	286	0		1	0		0	0	47	0	0	0.999934	2.430141e-01	0	1	0	16	0	16	289
SLC28A1	9154	broad.mit.edu	37	15	85461805	85461805	+	Silent	SNP	C	C	T	rs369148182		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr15:85461805C>T	ENST00000286749.3	+	9	936	c.846C>T	c.(844-846)caC>caT	p.H282H	SLC28A1_ENST00000537216.1_Silent_p.H282H|SLC28A1_ENST00000538177.1_Silent_p.H282H|SLC28A1_ENST00000537624.1_Silent_p.H282H|SLC28A1_ENST00000394573.1_Silent_p.H282H|SLC28A1_ENST00000537703.1_Silent_p.H204H			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	282					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	TTCTCTACCACGTGGGCCTCA	0.562																																						ENST00000286749.3	1.000000	0.350000	0.670000	0.410000	0.490000	0.565820	0.490000	0.480000																										0				41						c.(844-846)caC>caT		solute carrier family 28 (concentrative nucleoside transporter), member 1	Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)						252.0	224.0	233.0					15																	85461805		2203	4299	6502	SO:0001819	synonymous_variant	9154	2	121412	39				g.chr15:85461805C>T	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.846C>T	chr15.hg19:g.85461805C>T		0					SLC28A1_ENST00000537703.1_Silent_p.H204H|SLC28A1_ENST00000537216.1_Silent_p.H282H|SLC28A1_ENST00000394573.1_Silent_p.H282H|SLC28A1_ENST00000538177.1_Silent_p.H282H|SLC28A1_ENST00000537624.1_Silent_p.H282H	p.H282H			1	2	3	2.100873	O00337	S28A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)	9	936	+			A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	1	1	hg19	c.846C>T	CCDS10334.1	0																																																																																								0.236791		TCGA-IB-7889-01A-11D-2154-08	0.562	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2	1	0	1	2	2	2	2	0	0	0	0	120	120	120	119	1	1.900000	-6.248170	1	0.220000			0	41	41	0	753	748	0		1			0	0	120	0	0	1.000000	0	0	0	0	0	0	41	753
ST8SIA2	8128	broad.mit.edu	37	15	92981637	92981637	+	Silent	SNP	A	A	G	rs369714591		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr15:92981637A>G	ENST00000268164.3	+	4	582	c.345A>G	c.(343-345)ggA>ggG	p.G115G	ST8SIA2_ENST00000539113.1_Silent_p.G94G	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	115					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TCCTAAAGGGAACCCTGAAGC	0.473																																						ENST00000268164.3	1.000000	0.980000	1.000000	0.990000	0.990000	0.998882	0.990000	1.000000																										0				20						c.(343-345)ggA>ggG		ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2		A		0,4396		0,0,2198	153.0	166.0	162.0		345	4.5	1.0	15		162	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	ST8SIA2	NM_006011.3		0,1,6495	GG,GA,AA		0.0116,0.0,0.0077		115/376	92981637	1,12991	2198	4298	6496	SO:0001819	synonymous_variant	8128	1	121412	26				g.chr15:92981637A>G	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.345A>G	chr15.hg19:g.92981637A>G		0					ST8SIA2_ENST00000539113.1_Silent_p.G94G	p.G115G	NM_006011.3	NP_006002.1	1	2	3	2.100873	Q92186	SIA8B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)	4	582	+	Lung NSC(78;0.0893)|all_lung(78;0.125)		Q4VAZ0|Q92470|Q92746	Silent	SNP	ENST00000268164.3	1	1	hg19	c.345A>G	CCDS10372.1	1																																																																																								0.236791		TCGA-IB-7889-01A-11D-2154-08	0.473	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	1	0	1	2	2	2	2	0	0	0	0	162	162	162	159	1	1.900000	-20.000000	1	0.220000	NM_006011		0	131	130	0	918	911	1		1			0	0	162	0	0	1.000000	0	0	0	0	0	0	131	918
TEPP	374739	broad.mit.edu	37	16	58010414	58010414	+	Silent	SNP	G	G	A	rs367576014		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr16:58010414G>A	ENST00000441824.2	+	1	76	c.39G>A	c.(37-39)ctG>ctA	p.L13L	TEPP_ENST00000290871.5_Silent_p.L13L	NM_199456.2	NP_955535.2	Q6URK8	TEPP_HUMAN	testis, prostate and placenta expressed	13						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	8						TTATTCTGCTGCTGTCCATAA	0.517																																						ENST00000441824.2	0.780000	0.380000	0.680000	0.470000	0.560000	0.578283	0.560000	0.560000																										0				8						c.(37-39)ctG>ctA		testis, prostate and placenta expressed							244.0	182.0	203.0					16																	58010414		2198	4300	6498	SO:0001819	synonymous_variant	374739	0	0					g.chr16:58010414G>A	BC104458	CCDS10790.1, CCDS45496.1	16q13	2009-04-20			ENSG00000159648	ENSG00000159648			33745	protein-coding gene	gene with protein product		610264				14652002	Standard	NM_199456		Approved		uc002emv.4	Q6URK8	OTTHUMG00000133463	ENST00000441824.2:c.39G>A	chr16.hg19:g.58010414G>A		0					TEPP_ENST00000290871.5_Silent_p.L13L	p.L13L	NM_199456.2	NP_955535.2	0	0	0	1.971177	Q6URK8	TEPP_HUMAN		1	76	+			Q6URK7	Silent	SNP	ENST00000441824.2	1	1	hg19	c.39G>A	CCDS45496.1	0																																																																																								0.197035		TCGA-IB-7889-01A-11D-2154-08	0.517	TEPP-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000431966.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.900000	-7.293606	1	0.220000	NM_199456		0	29	29	0	423	415	0		1			0	0	87	0	0	1.000000	0	0	0	0	0	0	29	423
ADAMTS18	170692	broad.mit.edu	37	16	77353780	77353780	+	Missense_Mutation	SNP	G	G	A	rs147816593		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr16:77353780G>A	ENST00000282849.5	-	16	2916	c.2498C>T	c.(2497-2499)gCg>gTg	p.A833V		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	833	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GGGCCCTGGCGCGTACAGACG	0.542																																						ENST00000282849.5	0.700000	0.340000	0.610000	0.410000	0.500000	0.517243	0.500000	0.500000																										0				118						c.(2497-2499)gCg>gTg		ADAM metallopeptidase with thrombospondin type 1 motif, 18		G	VAL/ALA	1,4395	2.1+/-5.4	0,1,2197	61.0	60.0	60.0		2498	5.5	0.2	16	dbSNP_134	60	0,8600		0,0,4300	no	missense	ADAMTS18	NM_199355.2	64	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	833/1222	77353780	1,12995	2198	4300	6498	SO:0001583	missense	170692	4	121412	36				g.chr16:77353780G>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2498C>T	chr16.hg19:g.77353780G>A	ENSP00000282849:p.Ala833Val	0						p.A833V	NM_199355.2	NP_955387.1	0	0	0	1.971177	Q8TE60	ATS18_HUMAN		16	2916	-			Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	1	1	hg19	c.2498C>T	CCDS10926.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141924	0.77775	2.27E-4	0.0	ENSG00000140873	ENST00000282849	T	0.56941	0.43	5.54	5.54	0.83059	5.54	5.54	0.83059	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.77336	0.4115	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.81914	0.897;0.995	T	0.81191	-0.1045	10	0.87932	D	0	.	18.4764	0.90793	0.0:0.0:1.0:0.0	.	833;833	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	V	833	ENSP00000282849:A833V	ENSP00000282849:A833V	A	-	2	0	0	ADAMTS18	75911281	75911281	1.000000	0.71417	0.242000	0.24170	0.254000	0.26022	9.378000	0.97191	2.618000	0.88619	0.563000	0.77884	GCG	0.197035		TCGA-IB-7889-01A-11D-2154-08	0.542	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.900000	-20.000000	1	0.220000			0	28	28	0	461	457	0		1			0	0	74	0	0	1.000000	0	0	0	0	0	0	28	461
DRG2	1819	broad.mit.edu	37	17	18003681	18003681	+	Silent	SNP	C	C	T	rs200673460		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr17:18003681C>T	ENST00000225729.3	+	6	610	c.472C>T	c.(472-474)Ctg>Ttg	p.L158L	DRG2_ENST00000583355.1_Intron|DRG2_ENST00000395726.4_Silent_p.L158L	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	158	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					TCCTAGGTCTCTGCTGGAGAA	0.577																																						ENST00000225729.3	1.000000	0.850000	1.000000	0.970000	0.990000	0.986362	0.990000	1.000000																										0				14						c.(472-474)Ctg>Ttg		developmentally regulated GTP binding protein 2		C		0,4406		0,0,2203	152.0	140.0	144.0		472	5.4	1.0	17		144	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DRG2	NM_001388.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		158/365	18003681	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1819	14	121412	44				g.chr17:18003681C>T	X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.472C>T	chr17.hg19:g.18003681C>T		1					DRG2_ENST00000583355.1_Intron|DRG2_ENST00000395726.4_Silent_p.L158L	p.L158L	NM_001388.4	NP_001379.1	1	5	6	2.880456	P55039	DRG2_HUMAN		6	610	+	all_neural(463;0.228)		B2R8G5|Q53Y50|Q9BWB2	Silent	SNP	ENST00000225729.3	1	1	hg19	c.472C>T	CCDS11191.1	1																																																																																								0.443016		TCGA-IB-7889-01A-11D-2154-08	0.577	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	1	0	1	2	2	2	2	0	0	0	0	111	111	111	110	1	1.900000	-3.318794	1	0.220000	NM_001388		0	66	66	0	703	698	0		1	1		0	0	111	0	0	1.000000	9.998704e-01	0	27	0	110	0	66	703
NF1	4763	broad.mit.edu	37	17	29576089	29576089	+	Silent	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr17:29576089C>T	ENST00000358273.4	+	30	4445	c.4062C>T	c.(4060-4062)tcC>tcT	p.S1354S	NF1_ENST00000356175.3_Silent_p.S1354S	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1354	Poly-Ser.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCAGTTCCTCCTCAGAATTCC	0.398			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												ENST00000358273.4	1.000000	0.170000	0.370000	0.220000	0.280000	0.334518	0.280000	0.270000			yes	Rec	yes	Neurofibromatosis type 1	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	17q12	4763	D, Mis, N, F, S, O	neurofibromatosis type 1 gene				O	O		neurofibroma, glioma	neurofibroma, glioma	NF1/ACCN1(2)	12	Whole gene deletion(8)|Unknown(4)	p.0?(8)|p.?(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	599						c.(4060-4062)tcC>tcT		neurofibromin 1							167.0	151.0	157.0					17																	29576089		2203	4300	6503	SO:0001819	synonymous_variant	4763	0	0		Neurofibromatosis, type 1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	g.chr17:29576089C>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4062C>T	chr17.hg19:g.29576089C>T		0	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_ENST00000356175.3_Silent_p.S1354S	p.S1354S	NM_001042492.2	NP_001035957.1	1	2	3	2.048456	P21359	NF1_HUMAN		30	4445	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	1	1	hg19	c.4062C>T	CCDS42292.1	0																																																																																								0.226804		TCGA-IB-7889-01A-11D-2154-08	0.398	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	1.900000	-2.616949	1	0.220000	NM_000267		0	18	18	0	580	571	0		1	0		0	0	88	0	0	0.999980	1.439571e-02	0	0	0	6	0	18	580
TP53	7157	broad.mit.edu	37	17	7577046	7577046	+	Nonsense_Mutation	SNP	C	C	A	rs201744589		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr17:7577046C>A	ENST00000269305.4	-	8	1081	c.892G>T	c.(892-894)Gag>Tag	p.E298*	TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E298*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E298*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.E298*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E298*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	298	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E298*(49)|p.0?(8)|p.?(2)|p.E298K(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.E298fs*53(1)|p.G293fs*1(1)|p.E298Q(1)|p.E298_P301delELPP(1)|p.H296_S303delHHELPPGS(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGGCAGCTCGTGGTGAGGC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.560000	0.920000	0.670000	0.780000	0.797851	0.780000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		67	Substitution - Nonsense(49)|Whole gene deletion(8)|Deletion - In frame(3)|Unknown(2)|Deletion - Frameshift(2)|Substitution - Missense(2)|Insertion - Frameshift(1)	p.E298*(49)|p.0?(8)|p.?(2)|p.E298K(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.E298fs*53(1)|p.G293fs*1(1)|p.E298Q(1)|p.E298_P301delELPP(1)|p.H296_S303delHHELPPGS(1)	lung(21)|upper_aerodigestive_tract(13)|breast(6)|bone(5)|haematopoietic_and_lymphoid_tissue(4)|urinary_tract(4)|central_nervous_system(2)|oesophagus(2)|ovary(2)|pancreas(2)|liver(2)|large_intestine(1)|stomach(1)|salivary_gland(1)|skin(1)	24185	GRCh37	CM031387	TP53	M		c.(892-894)Gag>Tag	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						110.0	96.0	101.0					17																	7577046		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577046C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.892G>T	chr17.hg19:g.7577046C>A	ENSP00000269305:p.Glu298*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.E298*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.E298*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E298*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E298*|TP53_ENST00000413465.2_Intron	p.E298*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.882628	P04637	P53_HUMAN		8	1081	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.892G>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603544	0.66445	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	-4.03	0.04021	5.26	-4.03	0.04021	.	0.553557	0.18174	N	0.149346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-12.8318	5.9489	0.19234	0.0:0.2155:0.4162:0.3682	.	.	.	.	X	298;298;298;298;298;287;166	.	ENSP00000269305:E298X	E	-	1	0	0	TP53	7517771	7517771	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.837000	0.04377	-0.441000	0.07201	-0.218000	0.12543	GAG	0.147820		TCGA-IB-7889-01A-11D-2154-08	0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	3	0	0	0	0	64	64	64	63	1	1.900000	-3.221884	1	0.220000	NM_000546		0	36	34	0	340	338	0		1	1	1	0	2	64	1162	0	1.000000	9.965345e-01	9.998332e-01	2	26	82	126	36	340
BPTF	2186	broad.mit.edu	37	17	65850550	65850550	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr17:65850550C>T	ENST00000321892.4	+	2	1169	c.1108C>T	c.(1108-1110)Cag>Tag	p.Q370*	BPTF_ENST00000424123.3_Nonsense_Mutation_p.Q231*|BPTF_ENST00000306378.6_Nonsense_Mutation_p.Q370*|BPTF_ENST00000335221.5_Nonsense_Mutation_p.Q370*			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	370					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCTAGTCGATCAGTTTCTTAC	0.418																																						ENST00000321892.4	1.000000	0.850000	1.000000	0.950000	0.990000	0.982510	0.990000	1.000000																										0				78						c.(1108-1110)Cag>Tag		bromodomain PHD finger transcription factor							187.0	184.0	185.0					17																	65850550		2203	4300	6503	SO:0001587	stop_gained	2186	0	0					g.chr17:65850550C>T	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.1108C>T	chr17.hg19:g.65850550C>T	ENSP00000315454:p.Gln370*	0					BPTF_ENST00000335221.5_Nonsense_Mutation_p.Q370*|BPTF_ENST00000424123.3_Nonsense_Mutation_p.Q231*|BPTF_ENST00000306378.6_Nonsense_Mutation_p.Q370*	p.Q370*			1	2	3	2.041252	Q12830	BPTF_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)	2	1169	+	all_cancers(12;6e-11)		Q6NX67|Q7Z7D6|Q9UIG2	Nonsense_Mutation	SNP	ENST00000321892.4	0	1	hg19	c.1108C>T		1	.	.	.	.	.	.	.	.	.	.	C	32	5.169246	0.94768	.	.	ENSG00000171634	ENST00000544491;ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	.	.	.	5.62	5.62	0.85841	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6584	0.95853	0.0:1.0:0.0:0.0	.	.	.	.	X	275;370;370;370;231	.	ENSP00000307208:Q370X	Q	+	1	0	0	BPTF	63281012	63281012	1.000000	0.71417	0.999000	0.59377	0.406000	0.30931	7.818000	0.86416	2.646000	0.89796	0.655000	0.94253	CAG	0.225960		TCGA-IB-7889-01A-11D-2154-08	0.418	BPTF-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	129	129	129	128	1	1.900000	-20.000000	1	0.220000	NM_182641, NM_004459		0	90	90	0	693	686	1		1	1		0	0	129	0	0	1.000000	3.749916e-02	0	2	0	1	0	90	693
SMAD4	4089	broad.mit.edu	37	18	48591918	48591918	+	Missense_Mutation	SNP	C	C	T	rs80338963		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr18:48591918C>T	ENST00000342988.3	+	9	1619	c.1081C>T	c.(1081-1083)Cgc>Tgc	p.R361C	SMAD4_ENST00000398417.2_Missense_Mutation_p.R361C|SMAD4_ENST00000588745.1_Missense_Mutation_p.R265C	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361C(3)|p.R361S(2)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGGAGGAGATCGCTTTTGTTT	0.413																																						ENST00000342988.3	1.000000	0.650000	0.990000	0.760000	0.880000	0.879974	0.880000	1.000000																										43	Whole gene deletion(36)|Substitution - Missense(5)|Unknown(2)	p.0?(36)|p.R361C(3)|p.R361S(2)|p.?(2)	pancreas(26)|large_intestine(4)|lung(3)|breast(3)|stomach(2)|small_intestine(2)|upper_aerodigestive_tract(1)|biliary_tract(1)|oesophagus(1)	454	GRCh37	CM040450|CM041789|CM981228	SMAD4	M	rs80338963	c.(1081-1083)Cgc>Tgc		SMAD family member 4							179.0	149.0	159.0					18																	48591918		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48591918C>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1081C>T	chr18.hg19:g.48591918C>T	ENSP00000341551:p.Arg361Cys	1					SMAD4_ENST00000588745.1_Missense_Mutation_p.R265C|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361C	p.R361C	NM_005359.5	NP_005350.1	0	1	1	1.793076	Q13485	SMAD4_HUMAN		9	1619	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1081C>T	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820743	0.90873	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98164	-4.76;-4.76	5.86	5.86	0.93980	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99275	0.9747	M	0.94021	3.485	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99157	1.0860	9	0.87932	D	0	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	361	Q13485	SMAD4_HUMAN	C	361	ENSP00000341551:R361C;ENSP00000381452:R361C	ENSP00000341551:R361C	R	+	1	0	0	SMAD4	46845916	46845916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.718000	0.61930	2.771000	0.95319	0.563000	0.77884	CGC	0.128978		TCGA-IB-7889-01A-11D-2154-08	0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.900000	-3.221909	1	0.220000	NM_005359		0	35	34	0	268	267	1		1	1	1	0	1	50	867	0	1.000000	8.172738e-01	9.995530e-01	6	12	20	80	35	268
CDH20	28316	broad.mit.edu	37	18	59195270	59195270	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr18:59195270G>A	ENST00000262717.4	+	7	1486	c.1088G>A	c.(1087-1089)cGt>cAt	p.R363H	CDH20_ENST00000536675.2_Missense_Mutation_p.R363H|CDH20_ENST00000538374.1_Missense_Mutation_p.R363H			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	363	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				CTAGAGATGCGTTTTCTGAAC	0.473																																						ENST00000262717.4	0.990000	0.540000	0.890000	0.650000	0.760000	0.775037	0.760000	0.770000																										0				61						c.(1087-1089)cGt>cAt		cadherin 20, type 2							117.0	108.0	111.0					18																	59195270		2203	4300	6503	SO:0001583	missense	28316	4	121412	36				g.chr18:59195270G>A	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1088G>A	chr18.hg19:g.59195270G>A	ENSP00000262717:p.Arg363His	1					CDH20_ENST00000538374.1_Missense_Mutation_p.R363H|CDH20_ENST00000536675.2_Missense_Mutation_p.R363H	p.R363H			0	1	1	1.793076	Q9HBT6	CAD20_HUMAN		7	1486	+		Colorectal(73;0.186)	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	1	1	hg19	c.1088G>A	CCDS11977.1	0	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800571	0.50315	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.38401	1.14;1.14;1.14	5.88	5.01	0.66863	5.88	5.01	0.66863	Cadherin (4);Cadherin-like (1);	0.352394	0.34110	N	0.004250	T	0.44307	0.1287	M	0.79805	2.47	0.39023	D	0.959782	B	0.21905	0.062	B	0.22601	0.04	T	0.48127	-0.9062	10	0.54805	T	0.06	.	14.9937	0.71412	0.0683:0.0:0.9317:0.0	.	363	Q9HBT6	CAD20_HUMAN	H	363	ENSP00000444767:R363H;ENSP00000442226:R363H;ENSP00000262717:R363H	ENSP00000262717:R363H	R	+	2	0	0	CDH20	57346250	57346250	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	1.798000	0.38814	1.492000	0.48499	0.650000	0.86243	CGT	0.128978		TCGA-IB-7889-01A-11D-2154-08	0.473	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	1.900000	-20.000000	1	0.220000	NM_031891		0	34	34	0	321	318	0		1			0	0	66	0	0	1.000000	0	0	0	0	0	0	34	321
CYP4F22	126410	broad.mit.edu	37	19	15662205	15662205	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr19:15662205C>T	ENST00000269703.3	+	14	1718	c.1519C>T	c.(1519-1521)Cgg>Tgg	p.R507W	CYP4F22_ENST00000601005.2_Missense_Mutation_p.R507W	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	507						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						GCGCAAGGTGCGGCGGAAGCC	0.672																																						ENST00000269703.3	1.000000	0.230000	0.860000	0.380000	0.590000	0.615780	0.590000	1.000000																										0				37						c.(1519-1521)Cgg>Tgg		cytochrome P450, family 4, subfamily F, polypeptide 22							38.0	29.0	32.0					19																	15662205		2203	4300	6503	SO:0001583	missense	126410	0	0					g.chr19:15662205C>T		CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.1519C>T	chr19.hg19:g.15662205C>T	ENSP00000269703:p.Arg507Trp	0					CYP4F22_ENST00000601005.2_Missense_Mutation_p.R507W	p.R507W	NM_173483.3	NP_775754.2	0	0	0	2.005031	Q6NT55	CP4FN_HUMAN		14	1718	+			Q8N8H4	Missense_Mutation	SNP	ENST00000269703.3	0	1	hg19	c.1519C>T	CCDS12331.1	0	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566553	0.86439	.	.	ENSG00000171954	ENST00000269703	T	0.69040	-0.37	4.6	4.6	0.57074	4.6	4.6	0.57074	.	0.125575	0.53938	D	0.000052	T	0.82006	0.4943	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82500	-0.0426	10	0.37606	T	0.19	.	15.245	0.73499	0.0:1.0:0.0:0.0	.	507	Q6NT55	CP4FN_HUMAN	W	507	ENSP00000269703:R507W	ENSP00000269703:R507W	R	+	1	2	2	CYP4F22	15523205	15523205	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.527000	0.73803	2.247000	0.74100	0.455000	0.32223	CGG	0.211325		TCGA-IB-7889-01A-11D-2154-08	0.672	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461338.2	1	0	0	2	2	2	2	0	0	0	0	14	14	14	14	1	1.900000	-9.210014	1	0.220000	NM_173483		0	5	5	0	75	75	0		1	0		0	0	14	0	0	0.939603	0	0	0	0	1	0	5	75
GRIN2D	2906	broad.mit.edu	37	19	48919318	48919318	+	Silent	SNP	C	C	T	rs148340456	byFrequency	TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr19:48919318C>T	ENST00000263269.3	+	7	1729	c.1641C>T	c.(1639-1641)tcC>tcT	p.S547S		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	547					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGGAGCGCTCCGAGATCGTGG	0.662																																						ENST00000263269.3	0.720000	0.340000	0.620000	0.420000	0.510000	0.529886	0.510000	0.510000																										0				37						c.(1639-1641)tcC>tcT		glutamate receptor, ionotropic, N-methyl D-aspartate 2D	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	C		0,4406		0,0,2203	109.0	93.0	98.0		1641	-7.8	0.6	19	dbSNP_134	98	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	GRIN2D	NM_000836.2		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		547/1337	48919318	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	2906	16	121412	50				g.chr19:48919318C>T	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1641C>T	chr19.hg19:g.48919318C>T		0						p.S547S	NM_000836.2	NP_000827.2	0	1	1	2.013467	O15399	NMDE4_HUMAN		7	1729	+		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		Silent	SNP	ENST00000263269.3	1	1	hg19	c.1641C>T	CCDS12719.1	0																																																																																								0.215686		TCGA-IB-7889-01A-11D-2154-08	0.662	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1	1	0	1	2	2	2	2	0	0	0	0	86	86	86	85	1	1.900000	-2.690484	1	0.220000			0	26	25	0	429	424	0		1	0		0	0	86	0	0	1.000000	9.648041e-02	0	0	0	9	0	26	429
MUC16	94025	broad.mit.edu	37	19	9071237	9071237	+	Silent	SNP	C	C	T	rs373387179		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr19:9071237C>T	ENST00000397910.4	-	3	16412	c.16209G>A	c.(16207-16209)ccG>ccA	p.P5403P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5405	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P5403P(2)|p.P1036P(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTAAGTGGCCGGTCTCTCAT	0.502																																						ENST00000397910.4	0.560000	0.360000	0.520000	0.410000	0.460000	0.467558	0.460000	0.460000																										3	Substitution - coding silent(3)	p.P5403P(2)|p.P1036P(1)	lung(3)	590						c.(16207-16209)ccG>ccA		mucin 16, cell surface associated		C		1,4181		0,1,2090	407.0	384.0	392.0		16209	-4.4	0.0	19		392	1,8459		0,1,4229	no	coding-synonymous	MUC16	NM_024690.2		0,2,6319	TT,TC,CC		0.0118,0.0239,0.0158		5403/14508	9071237	2,12640	2091	4230	6321	SO:0001819	synonymous_variant	94025	6	121062	44				g.chr19:9071237C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16209G>A	chr19.hg19:g.9071237C>T		0						p.P5403P	NM_024690.2	NP_078966.2	0	0	0	2.005031	Q8WXI7	MUC16_HUMAN		3	16412	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	1	1	hg19	c.16209G>A	CCDS54212.1	0																																																																																								0.211325		TCGA-IB-7889-01A-11D-2154-08	0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	298	298	298	295	1	1.900000	-7.962869	1	0.220000	NM_024690		0	85	84	0	1563	1535	0		1	0		0	0	298	0	0	1.000000	7.947024e-03	0	0	0	3	0	85	1563
TPM3P9	147804	broad.mit.edu	37	19	53950474	53950474	+	RNA	SNP	C	C	T	rs367954566		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr19:53950474C>T	ENST00000424846.3	+	0	2920				ZNF761_ENST00000454407.1_RNA	NR_003148.3				tropomyosin 3 pseudogene 9																		ACTCTTGGTACGTGAGGAAGA	0.433													c|||	1	0.000199681	0.0	0.0	5008	,	,		21832	0.0		0.0	False		,,,				2504	0.001					ENST00000424846.3	0.760000	0.330000	0.650000	0.420000	0.520000	0.540943	0.520000	0.510000																										0												tropomyosin 3 pseudogene 9		C		0,1752		0,0,876	95.0	91.0	92.0			-1.0	0.0	19		92	1,3981		0,1,1990	no	utr-5	ZNF761	NM_001008401.3		0,1,2866	TT,TC,CC		0.0251,0.0,0.0174			53950474	1,5733	876	1991	2867			147804	7	121408	33				g.chr19:53950474C>T			19q13.42	2012-07-04			ENSG00000241015	ENSG00000241015			44142	pseudogene	pseudogene							Standard	NR_003148		Approved				OTTHUMG00000157312		chr19.hg19:g.53950474C>T		0					ZNF761_ENST00000454407.1_RNA		NR_003148.3		0	1	1	2.013467				0	2920	+				RNA	SNP	ENST00000424846.3	0	1	hg19			0																																																																																								0.215686		TCGA-IB-7889-01A-11D-2154-08	0.433	TPM3P9-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347070.1	0	0	1	2	2	2	2	0	0	0	0	71	71	71	69	1	1.900000	-5.232620	1	0.220000	NR_003148		0	21	19	0	341	330	0		1	0		0	0	71	0	0	0.999997	1.210399e-01	0	0	0	10	0	21	341
AMPD1	270	broad.mit.edu	37	1	115216697	115216697	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:115216697C>T	ENST00000520113.2	-	14	1921	c.1906G>A	c.(1906-1908)Gtg>Atg	p.V636M	AMPD1_ENST00000353928.6_Missense_Mutation_p.V603M|AMPD1_ENST00000369538.3_Missense_Mutation_p.V632M			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	636					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TACTGTAGCACGGGACTCTGA	0.353																																						ENST00000520113.2	0.760000	0.220000	0.610000	0.320000	0.440000	0.469668	0.440000	0.430000																										0				45						c.(1906-1908)Gtg>Atg		adenosine monophosphate deaminase 1	Adenosine monophosphate(DB00131)						60.0	63.0	62.0					1																	115216697		2203	4300	6503	SO:0001583	missense	270	2	121378	34				g.chr1:115216697C>T	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1906G>A	chr1.hg19:g.115216697C>T	ENSP00000430075:p.Val636Met	1					AMPD1_ENST00000353928.6_Missense_Mutation_p.V603M|AMPD1_ENST00000369538.3_Missense_Mutation_p.V632M	p.V636M			0	0	0	1.888448	P23109	AMPD1_HUMAN		14	1921	-	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	1	1	hg19	c.1906G>A	CCDS876.2	0	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647876	0.87958	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.95554	-3.74;-3.74;-3.74	5.96	5.96	0.96718	5.96	5.96	0.96718	Adenosine/AMP deaminase (1);	0.052104	0.85682	D	0.000000	D	0.97923	0.9317	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.988;0.996	D	0.98016	1.0368	10	0.87932	D	0	-21.0775	20.4008	0.98991	0.0:1.0:0.0:0.0	.	632;603	Q5TF02;P23109	.;AMPD1_HUMAN	M	636;632;603	ENSP00000430075:V636M;ENSP00000358551:V632M;ENSP00000316520:V603M	ENSP00000316520:V603M	V	-	1	0	0	AMPD1	115018220	115018220	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GTG	0.162910		TCGA-IB-7889-01A-11D-2154-08	0.353	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4	1	0	1	2	2	2	2	0	0	0	0	37	37	37	36	1	1.900000	-3.318794	1	0.220000			0	9	9	0	164	162	0		1	0		0	0	37	0	0	0.994302	3.113139e-02	0	0	0	5	0	9	164
ADAMTSL4	54507	broad.mit.edu	37	1	150529196	150529196	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:150529196G>A	ENST00000369038.2	+	8	1877	c.1676G>A	c.(1675-1677)cGt>cAt	p.R559H	ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R559H|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R582H|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R559H			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	559					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CGATATAACCGTCCTCCCAGG	0.647																																						ENST00000369038.2	1.000000	0.340000	1.000000	0.400000	0.470000	0.566720	0.470000	0.460000																										0				32						c.(1675-1677)cGt>cAt		ADAMTS-like 4							95.0	111.0	106.0					1																	150529196		2203	4300	6503	SO:0001583	missense	54507	1	121412	37				g.chr1:150529196G>A	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1676G>A	chr1.hg19:g.150529196G>A	ENSP00000358034:p.Arg559His	1					ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R582H|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R559H|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R559H	p.R559H			0	3	3	2.120537	Q6UY14	ATL4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)	8	1877	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	1	1	hg19	c.1676G>A	CCDS955.1	0	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235869	0.58886	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	4.54	4.54	0.55810	4.54	4.54	0.55810	ADAM-TS Spacer 1 (1);	.	.	.	.	T	0.65852	0.2731	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.995;0.993;0.988	T	0.70992	-0.4721	9	0.72032	D	0.01	.	8.4206	0.32698	0.1047:0.0:0.8953:0.0	.	582;582;559;559	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	H	559;559;97;582;559	ENSP00000358037:R559H;ENSP00000271643:R559H;ENSP00000358035:R582H;ENSP00000358034:R559H	ENSP00000271643:R559H	R	+	2	0	0	ADAMTSL4	148795820	148795820	0.988000	0.35896	0.629000	0.29254	0.140000	0.21249	5.061000	0.64319	2.346000	0.79739	0.462000	0.41574	CGT	0.277242		TCGA-IB-7889-01A-11D-2154-08	0.647	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	1	0	1	2	22	2	2	0	0	0	1	163	163	163	162	1	1.900000	-5.477019	1	0.220000	NM_019032		0	51	48	0	1047	1032	0		1	0		0	0	163	0	0	0.999803	2.991740e-02	0	0	0	6	0	51	1047
RIT1	6016	broad.mit.edu	37	1	155880296	155880296	+	Splice_Site	SNP	G	G	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:155880296G>T	ENST00000368323.3	-	3	312	c.108C>A	c.(106-108)gcC>gcA	p.A36A	RIT1_ENST00000368322.3_Splice_Site_p.A53A|RIT1_ENST00000539040.1_5'UTR	NM_006912.5	NP_008843.1	Q92963	RIT1_HUMAN	Ras-like without CAAX 1	36					GTP catabolic process (GO:0006184)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|skin(1)|urinary_tract(1)	19	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			GCATGGTCATGGCTTCAAAAG	0.393																																						ENST00000368323.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999941	0.990000	1.000000																										0				19						c.(106-108)gcC>gcA		Ras-like without CAAX 1							127.0	121.0	123.0					1																	155880296		2203	4300	6503	SO:0001630	splice_region_variant	6016	0	0					g.chr1:155880296G>T	AF084462	CCDS1123.1, CCDS58037.1, CCDS58036.1	1q21.2	2014-05-09	2002-09-11	2002-09-13	ENSG00000143622	ENSG00000143622			10023	protein-coding gene	gene with protein product	"""Ric-like, expressed in many tissues"", ""GTP-binding protein Roc1"""	609591	"""Ric (Drosophila)-like, expressed in many tissues"""	RIT		8824319, 8918462	Standard	NM_006912		Approved	RIBB, ROC1, MGC125864, MGC125865	uc031pqc.1	Q92963	OTTHUMG00000014104	ENST00000368323.3:c.107-1C>A	chr1.hg19:g.155880296G>T		1					RIT1_ENST00000368322.3_Splice_Site_p.A53A|RIT1_ENST00000539040.1_5'UTR	p.A36A	NM_006912.5	NP_008843.1	0	3	3	2.120537	Q92963	RIT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)	3	312	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		B4DQE8|O00646|O00720|Q5VY89|Q5VY90	Splice_Site	SNP	ENST00000368323.3	1	0	hg19	c.108C>A	CCDS1123.1	1																																																																																								0.277242		TCGA-IB-7889-01A-11D-2154-08	0.393	RIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039593.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.900000	-3.150828	1	0.220000	NM_006912	Silent	0	50	49	0	275	274	1		1	1		0	0	47	0	0	1.000000	9.965648e-01	0	16	0	34	0	50	275
CADM3	57863	broad.mit.edu	37	1	159163257	159163257	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:159163257C>T	ENST00000368125.4	+	4	584	c.427C>T	c.(427-429)Cgg>Tgg	p.R143W	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.R177W	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	143	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					ATCTTCATTACGGGAAAAAGA	0.532																																						ENST00000368125.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				55						c.(427-429)Cgg>Tgg		cell adhesion molecule 3							105.0	108.0	107.0					1																	159163257		2203	4300	6503	SO:0001583	missense	57863	0	0					g.chr1:159163257C>T	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.427C>T	chr1.hg19:g.159163257C>T	ENSP00000357107:p.Arg143Trp	1					CADM3_ENST00000368124.4_Missense_Mutation_p.R177W|CTA-134P22.2_ENST00000415675.2_RNA	p.R143W	NM_001127173.1	NP_001120645.1	0	3	3	2.161655	Q8N126	CADM3_HUMAN		4	584	+	all_hematologic(112;0.0429)		Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	1	1	hg19	c.427C>T	CCDS44251.1	1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559293	0.65538	.	.	ENSG00000162706	ENST00000368124;ENST00000368125;ENST00000416746	T;T;T	0.76060	-0.99;-0.99;-0.99	5.13	5.13	0.70059	5.13	5.13	0.70059	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.372580	0.26514	N	0.023944	T	0.73418	0.3584	L	0.39245	1.2	0.36569	D	0.872888	P;D;D	0.76494	0.863;0.999;0.998	D;D;P	0.66979	0.913;0.948;0.787	T	0.77275	-0.2648	10	0.66056	D	0.02	.	11.0641	0.47966	0.1847:0.8152:0.0:0.0	.	143;143;177	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	W	177;143;143	ENSP00000357106:R177W;ENSP00000357107:R143W;ENSP00000387802:R143W	ENSP00000357106:R177W	R	+	1	2	2	CADM3	157429881	157429881	0.004000	0.15560	1.000000	0.80357	0.953000	0.61014	-0.061000	0.11693	2.655000	0.90218	0.655000	0.94253	CGG	0.281636		TCGA-IB-7889-01A-11D-2154-08	0.532	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	1.900000	-3.322064	1	0.220000	NM_021189		0	84	85	0	345	341	1		1	0		0	0	73	0	0	1.000000	2.575212e-01	0	0	0	5	0	84	345
IGSF9	57549	broad.mit.edu	37	1	159900160	159900160	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:159900160C>T	ENST00000368094.1	-	15	2080	c.1883G>A	c.(1882-1884)cGg>cAg	p.R628Q	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R612Q	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	628	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R612L(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CACCAGACCCCGCGGAGGGGA	0.652																																						ENST00000368094.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.R612L(1)	lung(1)	56						c.(1882-1884)cGg>cAg		immunoglobulin superfamily, member 9							55.0	63.0	60.0					1																	159900160		2202	4298	6500	SO:0001583	missense	57549	0	0					g.chr1:159900160C>T	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1883G>A	chr1.hg19:g.159900160C>T	ENSP00000357073:p.Arg628Gln	1					IGSF9_ENST00000361509.3_Missense_Mutation_p.R612Q|IGSF9_ENST00000493195.1_5'UTR	p.R628Q	NM_001135050.1	NP_001128522.1	0	3	3	2.161655	Q9P2J2	TUTLA_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)	15	2080	-	all_hematologic(112;0.0597)	Breast(1374;0.000126)		Missense_Mutation	SNP	ENST00000368094.1	1	1	hg19	c.1883G>A	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988769	0.53934	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.53640	0.61;0.61	5.17	5.17	0.71159	5.17	5.17	0.71159	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.37012	N	0.002287	T	0.27489	0.0675	L	0.50333	1.59	0.42485	D	0.992879	P	0.41232	0.743	B	0.33750	0.169	T	0.10941	-1.0608	9	.	.	.	-8.1725	16.1513	0.81624	0.0:1.0:0.0:0.0	.	628	Q9P2J2	TUTLA_HUMAN	Q	612;628	ENSP00000355049:R612Q;ENSP00000357073:R628Q	.	R	-	2	0	0	IGSF9	158166784	158166784	0.010000	0.17322	0.694000	0.30210	0.512000	0.34134	1.424000	0.34848	2.396000	0.81511	0.455000	0.32223	CGG	0.281636		TCGA-IB-7889-01A-11D-2154-08	0.652	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	1.900000	-2.963670	1	0.220000	NM_020789		0	137	133	0	528	520	1		1	1		0	0	103	0	0	1.000000	9.975707e-01	0	26	0	11	0	137	528
H6PD	9563	broad.mit.edu	37	1	9324398	9324398	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:9324398C>A	ENST00000377403.2	+	5	2148	c.1846C>A	c.(1846-1848)Ctg>Atg	p.L616M	H6PD_ENST00000602477.1_Missense_Mutation_p.L627M	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	616	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CCACACGCACCTGTGGCTGGT	0.682																																						ENST00000377403.2	0.670000	0.160000	0.520000	0.250000	0.370000	0.394234	0.370000	0.350000																										0				23						c.(1846-1848)Ctg>Atg		hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)							18.0	20.0	19.0					1																	9324398		2187	4269	6456	SO:0001583	missense	9563	0	0					g.chr1:9324398C>A	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1846C>A	chr1.hg19:g.9324398C>A	ENSP00000366620:p.Leu616Met	0					H6PD_ENST00000602477.1_Missense_Mutation_p.L627M	p.L616M	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	0	0	0	1.905531	O95479	G6PE_HUMAN		5	2148	+	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	ENST00000377403.2	1	1	hg19	c.1846C>A	CCDS101.1	0	.	.	.	.	.	.	.	.	.	.	C	16.77	3.213707	0.58452	.	.	ENSG00000049239	ENST00000377403	T	0.49139	0.79	5.4	5.4	0.78164	5.4	5.4	0.78164	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.230625	0.37715	N	0.001970	T	0.66703	0.2816	M	0.88570	2.965	0.39055	D	0.960407	D	0.54397	0.966	P	0.58331	0.837	T	0.74262	-0.3722	10	0.72032	D	0.01	-23.0015	8.9799	0.35959	0.0:0.7713:0.1498:0.0789	.	616	O95479	G6PE_HUMAN	M	616	ENSP00000366620:L616M	ENSP00000366620:L616M	L	+	1	2	2	H6PD	9246985	9246985	0.995000	0.38212	1.000000	0.80357	0.975000	0.68041	0.536000	0.23129	2.536000	0.85505	0.561000	0.74099	CTG	0.168798		TCGA-IB-7889-01A-11D-2154-08	0.682	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	1	0	1	2	2	2	2	0	0	0	0	30	30	30	28	1	1.900000	-10.008620	1	0.220000	NM_004285		0	7	7	0	159	156	0		1	0		0	0	30	0	0	0.980043	1.463060e-01	0	1	0	13	0	7	159
PAPPA2	60676	broad.mit.edu	37	1	176709307	176709307	+	Missense_Mutation	SNP	G	G	A	rs376402363		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr1:176709307G>A	ENST00000367662.3	+	14	5290	c.4126G>A	c.(4126-4128)Gag>Aag	p.E1376K		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1376					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTCAGAGGACGAGGGGCAGAA	0.483																																						ENST00000367662.3	1.000000	0.650000	1.000000	0.790000	0.970000	0.919572	0.970000	1.000000																										0				226						c.(4126-4128)Gag>Aag		pappalysin 2							83.0	80.0	81.0					1																	176709307		1979	4162	6141	SO:0001583	missense	60676	3	120896	40				g.chr1:176709307G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4126G>A	chr1.hg19:g.176709307G>A	ENSP00000356634:p.Glu1376Lys	1						p.E1376K	NM_020318.2	NP_064714.2	0	3	3	2.161655	Q9BXP8	PAPP2_HUMAN		14	5290	+			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	1	1	hg19	c.4126G>A	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	G	9.393	1.075892	0.20227	.	.	ENSG00000116183	ENST00000367662	T	0.01745	4.66	5.3	-2.21	0.06973	5.3	-2.21	0.06973	.	0.849038	0.10709	N	0.643103	T	0.01976	0.0062	L	0.49256	1.55	0.24431	N	0.994576	B	0.18461	0.028	B	0.13407	0.009	T	0.39941	-0.9589	10	0.54805	T	0.06	-0.3589	4.9535	0.14027	0.3507:0.2614:0.3879:0.0	.	1376	Q9BXP8	PAPP2_HUMAN	K	1376	ENSP00000356634:E1376K	ENSP00000356634:E1376K	E	+	1	0	0	PAPPA2	174975930	174975930	0.973000	0.33851	0.000000	0.03702	0.021000	0.10359	1.361000	0.34136	-0.798000	0.04444	-0.345000	0.07892	GAG	0.281636		TCGA-IB-7889-01A-11D-2154-08	0.483	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1	1	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	1.900000	-2.920854	1	0.220000			0	29	28	0	279	275	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	29	279
TMX4	56255	broad.mit.edu	37	20	7963022	7963022	+	Missense_Mutation	SNP	C	C	T	rs534982642		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr20:7963022C>T	ENST00000246024.2	-	8	1141	c.926G>A	c.(925-927)cGg>cAg	p.R309Q		NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	309	Glu-rich.				cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						TACTTCCTCCCGGGTCACACC	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		16082	0.0		0.0	False		,,,				2504	0.001					ENST00000246024.2	0.590000	0.260000	0.500000	0.330000	0.410000	0.421529	0.410000	0.410000																										0				17						c.(925-927)cGg>cAg		thioredoxin-related transmembrane protein 4							128.0	117.0	121.0					20																	7963022		2203	4300	6503	SO:0001583	missense	56255	0	0					g.chr20:7963022C>T		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.926G>A	chr20.hg19:g.7963022C>T	ENSP00000246024:p.Arg309Gln	0						p.R309Q	NM_021156.2	NP_066979.2	0	0	0	1.980412	Q9H1E5	TMX4_HUMAN		8	1141	-			Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	ENST00000246024.2	1	1	hg19	c.926G>A	CCDS13101.1	0	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350863	0.24512	.	.	ENSG00000125827	ENST00000246024	T	0.09350	2.99	5.54	-7.71	0.01254	5.54	-7.71	0.01254	.	2.465280	0.01182	N	0.007100	T	0.02888	0.0086	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35276	-0.9795	10	0.23891	T	0.37	2.3619	0.5542	0.00668	0.2156:0.2763:0.232:0.276	.	309	Q9H1E5	TMX4_HUMAN	Q	309	ENSP00000246024:R309Q	ENSP00000246024:R309Q	R	-	2	0	0	TMX4	7911022	7911022	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.154000	0.03166	-1.638000	0.01529	-0.455000	0.05494	CGG	0.200656		TCGA-IB-7889-01A-11D-2154-08	0.582	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	73	1	1.900000	-2.247832	0	0.220000	NM_021156		0	22	21	0	456	451	0		1	1		0	0	76	0	0	0.999999	9.696323e-01	0	6	0	114	0	22	456
TSHZ2	128553	broad.mit.edu	37	20	51872260	51872260	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr20:51872260C>T	ENST00000371497.5	+	2	3150	c.2263C>T	c.(2263-2265)Cgc>Tgc	p.R755C	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.R752C|TSHZ2_ENST00000329613.6_Missense_Mutation_p.R752C	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	755					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CGTGTCCAGGCGCTACCTGTT	0.512																																						ENST00000371497.5	0.790000	0.410000	0.700000	0.490000	0.590000	0.601979	0.590000	0.590000																										0				84						c.(2263-2265)Cgc>Tgc		teashirt zinc finger homeobox 2							93.0	90.0	91.0					20																	51872260		2203	4300	6503	SO:0001583	missense	128553	1	121410	41				g.chr20:51872260C>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2263C>T	chr20.hg19:g.51872260C>T	ENSP00000360552:p.Arg755Cys	0					TSHZ2_ENST00000603338.2_Missense_Mutation_p.R752C|TSHZ2_ENST00000329613.6_Missense_Mutation_p.R752C|RP4-678D15.1_ENST00000606932.1_RNA	p.R755C	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	0	0	0	1.980412	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)	2	3150	+			B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	1	1	hg19	c.2263C>T	CCDS33490.1	0	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992826	0.35131	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.50277	0.75;0.75	5.23	5.23	0.72850	5.23	5.23	0.72850	.	0.475787	0.23196	N	0.050846	T	0.43144	0.1234	M	0.68317	2.08	0.34997	D	0.755567	P	0.49358	0.923	B	0.34452	0.183	T	0.65709	-0.6102	10	0.87932	D	0	-5.9641	13.7395	0.62838	0.1538:0.8461:0.0:0.0	.	755	Q9NRE2	TSH2_HUMAN	C	755;752;281	ENSP00000360552:R755C;ENSP00000333114:R752C	ENSP00000333114:R752C	R	+	1	0	0	TSHZ2	51305667	51305667	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.499000	0.53310	2.438000	0.82558	0.579000	0.79373	CGC	0.200656		TCGA-IB-7889-01A-11D-2154-08	0.512	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	1	0	1	2	2	2	2	0	0	0	0	80	80	80	78	1	1.900000	-8.215395	1	0.220000	NM_173485		0	33	33	0	462	446	0		1	1		0	0	80	0	0	1.000000	1.721122e-01	0	2	0	9	0	33	462
NCAM2	4685	broad.mit.edu	37	21	22656721	22656721	+	Splice_Site	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr21:22656721G>A	ENST00000400546.1	+	3	586		c.e3+1		NCAM2_ENST00000535285.1_Splice_Site|NCAM2_ENST00000486367.1_Splice_Site|NCAM2_ENST00000284894.7_Intron	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2						axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GAAATTTACCGTAAGTAATGT	0.294																																						ENST00000400546.1	0.820000	0.180000	0.630000	0.290000	0.440000	0.468309	0.440000	0.410000																										1	Unknown(1)	p.?(1)	ovary(1)	108						c.e3+1		neural cell adhesion molecule 2							41.0	39.0	40.0					21																	22656721		1821	4076	5897	SO:0001630	splice_region_variant	4685	0	0					g.chr21:22656721G>A		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.337+1G>A	chr21.hg19:g.22656721G>A		0					NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000535285.1_Splice_Site|NCAM2_ENST00000486367.1_Splice_Site		NM_004540.3	NP_004531.2	0	0	0	1.988257	O15394	NCAM2_HUMAN		3	586	+		Lung NSC(9;0.195)	A8MQ06|B7Z841|Q7Z7F2	Splice_Site	SNP	ENST00000400546.1	0	1	hg19		CCDS42910.1	0	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876114	0.72180	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	.	.	.	5.58	5.58	0.84498	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.134	0.89612	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	NCAM2	21578592	21578592	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.804000	0.91921	2.632000	0.89209	0.591000	0.81541	.	0.204244		TCGA-IB-7889-01A-11D-2154-08	0.294	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.900000	-3.360477	1	0.220000	NM_004540	Intron	0	6	6	0	121	121	0		1			0	0	19	0	0	0.966148	0	0	0	0	0	0	6	121
GGT1	2678	broad.mit.edu	37	22	25023843	25023843	+	Silent	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr22:25023843G>A	ENST00000400382.1	+	13	1988	c.1233G>A	c.(1231-1233)ccG>ccA	p.P411P	GGT1_ENST00000400380.1_Silent_p.P411P|GGT1_ENST00000406383.2_Silent_p.P411P|GGT1_ENST00000403838.1_Silent_p.P67P|GGT1_ENST00000404532.1_Silent_p.P67P|GGT1_ENST00000404920.1_Silent_p.P67P|GGT1_ENST00000248923.4_Silent_p.P411P|GGT1_ENST00000400383.1_Silent_p.P411P|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000401885.1_Silent_p.P67P|GGT1_ENST00000404223.1_Silent_p.P67P			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	411					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	TCCGCTCCCCGGTCAGCGGGA	0.597																																						ENST00000400382.1	0.640000	0.240000	0.530000	0.320000	0.410000	0.429460	0.410000	0.400000																										0				40						c.(1231-1233)ccG>ccA		gamma-glutamyltransferase 1	Glutathione(DB00143)						42.0	48.0	46.0					22																	25023843		2203	4299	6502	SO:0001819	synonymous_variant	2678	8	121410	41				g.chr22:25023843G>A	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1233G>A	chr22.hg19:g.25023843G>A		0					GGT1_ENST00000403838.1_Silent_p.P67P|GGT1_ENST00000400380.1_Silent_p.P411P|GGT1_ENST00000248923.4_Silent_p.P411P|GGT1_ENST00000401885.1_Silent_p.P67P|GGT1_ENST00000400383.1_Silent_p.P411P|GGT1_ENST00000406383.2_Silent_p.P411P|GGT1_ENST00000404532.1_Silent_p.P67P|GGT1_ENST00000404920.1_Silent_p.P67P|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000404223.1_Silent_p.P67P	p.P411P			0	1	1	2.000519	P19440	GGT1_HUMAN		13	1988	+			Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	ENST00000400382.1	1	1	hg19	c.1233G>A	CCDS42992.1	0																																																																																								0.208684		TCGA-IB-7889-01A-11D-2154-08	0.597	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	62	1	1.900000	-2.647879	1	0.220000	NM_013430		0	15	15	0	313	300	0		1	1		0	0	56	0	0	0.999838	9.119113e-01	0	9	0	81	0	15	313
CSNK1E	1454	broad.mit.edu	37	22	38690455	38690455	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr22:38690455G>A	ENST00000396832.1	-	8	1231	c.971C>T	c.(970-972)gCg>gTg	p.A324V	CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000403904.1_Missense_Mutation_p.A324V|CSNK1E_ENST00000359867.3_Missense_Mutation_p.A324V|CSNK1E_ENST00000400206.2_Missense_Mutation_p.A324V	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	324					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GGCTCGGGTCGCGGACCCCCG	0.726																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	ENST00000396832.1	1.000000	0.280000	1.000000	0.530000	0.900000	0.810961	0.900000	1.000000																										0				22						c.(970-972)gCg>gTg		casein kinase 1, epsilon																																				SO:0001583	missense	1454	7	119040	33				g.chr22:38690455G>A		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.971C>T	chr22.hg19:g.38690455G>A	ENSP00000380044:p.Ala324Val	0					CSNK1E_ENST00000403904.1_Missense_Mutation_p.A324V|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000400206.2_Missense_Mutation_p.A324V|CSNK1E_ENST00000359867.3_Missense_Mutation_p.A324V	p.A324V	NM_152221.2	NP_689407.1	0	1	1	2.000519	P49674	KC1E_HUMAN		8	1231	-	Melanoma(58;0.045)			Missense_Mutation	SNP	ENST00000396832.1	0	1	hg19	c.971C>T	CCDS13970.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.49|16.49	3.138626|3.138626	0.56936|0.56936	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904|ENST00000366216	T;T;T;T|.	0.57107|.	0.42;0.42;0.42;0.42|.	5.56|5.56	4.54|4.54	0.55810|0.55810	5.56|5.56	4.54|4.54	0.55810|0.55810	.|.	0.436410|.	0.26156|.	N|.	0.026018|.	T|.	0.61553|.	0.2356|.	L|L	0.48642|0.48642	1.525|1.525	0.42079|0.42079	D|D	0.991242|0.991242	B|.	0.13594|.	0.008|.	B|.	0.08055|.	0.003|.	T|.	0.59836|.	-0.7379|.	10|.	0.31617|.	T|.	0.26|.	.|.	14.7935|14.7935	0.69860|0.69860	0.0699:0.0:0.9301:0.0|0.0699:0.0:0.9301:0.0	.|.	324|.	P49674|.	KC1E_HUMAN|.	V|X	324|27	ENSP00000352929:A324V;ENSP00000380044:A324V;ENSP00000383067:A324V;ENSP00000384074:A324V|.	ENSP00000352929:A324V|.	A|R	-|-	2|1	0|2	0|2	CSNK1E|CSNK1E	37020401|37020401	37020401|37020401	1.000000|1.000000	0.71417|0.71417	0.040000|0.040000	0.18447|0.18447	0.110000|0.110000	0.19582|0.19582	5.714000|5.714000	0.68422|0.68422	1.327000|1.327000	0.45338|0.45338	0.650000|0.650000	0.86243|0.86243	GCG|CGA	0.208684		TCGA-IB-7889-01A-11D-2154-08	0.726	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	0	0	1	2	2	2	2	0	0	0	0	10	10	10	9	1	1.900000	-9.593557	1	0.220000	NM_001894		0	3	3	0	27	27	0		1	1		0	0	10	0	0	0.812770	6.597741e-01	0	3	0	17	0	3	27
LCT	3938	broad.mit.edu	37	2	136564940	136564940	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr2:136564940G>A	ENST00000264162.2	-	9	3941	c.3931C>T	c.(3931-3933)Cga>Tga	p.R1311*	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1311	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	ACATACCCTCGAAGGTCTATA	0.522																																						ENST00000264162.2	0.870000	0.470000	0.770000	0.550000	0.650000	0.668554	0.650000	0.660000																										0				124						c.(3931-3933)Cga>Tga		lactase	Vitamin C(DB00126)						103.0	97.0	99.0					2																	136564940		2203	4300	6503	SO:0001587	stop_gained	3938	0	0					g.chr2:136564940G>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3931C>T	chr2.hg19:g.136564940G>A	ENSP00000264162:p.Arg1311*	0					Y_RNA_ENST00000363794.1_RNA	p.R1311*	NM_002299.2	NP_002290.2	0	0	0	1.985275	P09848	LPH_HUMAN		9	3941	-			Q4ZG58	Nonsense_Mutation	SNP	ENST00000264162.2	0	1	hg19	c.3931C>T	CCDS2178.1	0	.	.	.	.	.	.	.	.	.	.	G	38	6.963892	0.97967	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	.	.	.	5.87	4.98	0.66077	5.87	4.98	0.66077	.	0.165435	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.877	13.1749	0.59621	0.0:0.0:0.5643:0.4357	.	.	.	.	X	1311;743	.	ENSP00000264162:R1311X	R	-	1	2	2	LCT	136281410	136281410	0.998000	0.40836	1.000000	0.80357	0.748000	0.42578	2.030000	0.41108	1.446000	0.47643	0.655000	0.94253	CGA	0.202454		TCGA-IB-7889-01A-11D-2154-08	0.522	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.900000	-9.381009	1	0.220000	NM_002299		0	36	36	0	450	443	0		1			0	0	96	0	0	1.000000	0	0	0	0	0	0	36	450
RNF144A	9781	broad.mit.edu	37	2	7160800	7160800	+	Silent	SNP	C	C	G			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr2:7160800C>G	ENST00000320892.6	+	6	940	c.498C>G	c.(496-498)ccC>ccG	p.P166P	RNF144A_ENST00000467276.1_3'UTR	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	166					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		CCTTCCTCCCCGGGGAGACCA	0.587																																						ENST00000320892.6	1.000000	0.730000	1.000000	0.830000	0.940000	0.929858	0.940000	1.000000																										0				25						c.(496-498)ccC>ccG		ring finger protein 144A							66.0	70.0	68.0					2																	7160800		2203	4300	6503	SO:0001819	synonymous_variant	9781	0	0					g.chr2:7160800C>G	D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.498C>G	chr2.hg19:g.7160800C>G		0					RNF144A_ENST00000467276.1_3'UTR	p.P166P	NM_014746.3	NP_055561.2	0	0	0	1.983751	P50876	R144A_HUMAN		6	940	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)	D6W4Y6|Q585H5	Silent	SNP	ENST00000320892.6	1	1	hg19	c.498C>G	CCDS1657.1	1	.	.	.	.	.	.	.	.	.	.	C	7.556	0.663657	0.14710	.	.	ENSG00000151692	ENST00000432850	T	0.30182	1.54	5.42	-5.68	0.02436	5.42	-5.68	0.02436	.	0.000000	0.85682	D	0.000000	T	0.16938	0.0407	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.17868	-1.0355	7	0.20046	T	0.44	.	2.4736	0.04570	0.3811:0.1371:0.0718:0.41	.	.	.	.	R	162	ENSP00000411616:P162R	ENSP00000411616:P162R	P	+	2	0	0	RNF144A	7078251	7078251	0.025000	0.19082	0.602000	0.28890	0.849000	0.48306	-0.908000	0.04063	-1.362000	0.02166	-0.254000	0.11334	CCG	0.202454		TCGA-IB-7889-01A-11D-2154-08	0.587	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206725.2	1	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	1.900000	-2.429492	0	0.220000	NM_014746		0	59	59	0	491	485	1		1	0		0	0	92	0	0	1.000000	6.145692e-02	0	0	0	3	0	59	491
CXCR4	7852	broad.mit.edu	37	2	136872710	136872710	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr2:136872710G>A	ENST00000241393.3	-	2	892	c.788C>T	c.(787-789)tCc>tTc	p.S263F	CXCR4_ENST00000409817.1_Missense_Mutation_p.S267F|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	263					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	GAGGATGAAGGAGTCGATGCT	0.517																																						ENST00000241393.3	0.470000	0.160000	0.390000	0.220000	0.290000	0.310414	0.290000	0.290000																										0				25						c.(787-789)tCc>tTc		chemokine (C-X-C motif) receptor 4	Framycetin(DB00452)|Plerixafor(DB06809)						228.0	215.0	219.0					2																	136872710		2203	4300	6503	SO:0001583	missense	7852	0	0					g.chr2:136872710G>A	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.788C>T	chr2.hg19:g.136872710G>A	ENSP00000241393:p.Ser263Phe	0					CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Missense_Mutation_p.S267F	p.S263F	NM_003467.2	NP_003458.1	0	0	0	1.985275	P61073	CXCR4_HUMAN		2	892	-			B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	1	1	hg19	c.788C>T	CCDS46420.1	0	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722563	0.48728	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	T;T	0.36699	1.24;1.24	6.17	5.29	0.74685	6.17	5.29	0.74685	GPCR, rhodopsin-like superfamily (1);	0.137085	0.64402	D	0.000003	T	0.30634	0.0771	L	0.33189	0.99	0.49483	D	0.99979	P;D	0.57257	0.718;0.979	B;B	0.39503	0.237;0.301	T	0.16719	-1.0393	10	0.87932	D	0	.	17.6818	0.88246	0.0:0.1228:0.8772:0.0	.	263;267	P61073;P61073-2	CXCR4_HUMAN;.	F	267;263;133	ENSP00000386884:S267F;ENSP00000241393:S263F	ENSP00000241393:S263F	S	-	2	0	0	CXCR4	136589180	136589180	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.050000	0.57404	1.615000	0.50252	0.655000	0.94253	TCC	0.202454		TCGA-IB-7889-01A-11D-2154-08	0.517	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	1.900000	-3.592798	1	0.220000			0	13	13	0	382	376	0		1	0		0	0	76	0	0	0.999504	9.999547e-01	0	1	0	540	0	13	382
QTRTD1	79691	broad.mit.edu	37	3	113804663	113804663	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr3:113804663A>G	ENST00000493014.1	+	6	910	c.842A>G	c.(841-843)tAc>tGc	p.Y281C	QTRTD1_ENST00000479882.1_Missense_Mutation_p.Y264C|QTRTD1_ENST00000485050.1_Missense_Mutation_p.Y399C|QTRTD1_ENST00000281273.4_Missense_Mutation_p.Y387C	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						TTTGAACACTACTTTGGGTTT	0.463																																						ENST00000493014.1	0.620000	0.300000	0.540000	0.370000	0.440000	0.459686	0.440000	0.450000																										0				10						c.(841-843)tAc>tGc		queuine tRNA-ribosyltransferase domain containing 1							185.0	155.0	165.0					3																	113804663		2203	4300	6503	SO:0001583	missense	79691	1	121412	21				g.chr3:113804663A>G	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.842A>G	chr3.hg19:g.113804663A>G	ENSP00000419169:p.Tyr281Cys	0					QTRTD1_ENST00000281273.4_Missense_Mutation_p.Y387C|QTRTD1_ENST00000485050.1_Missense_Mutation_p.Y399C|QTRTD1_ENST00000479882.1_Missense_Mutation_p.Y264C	p.Y281C	NM_001256836.1	NP_001243765.1	0	0	0	1.985992				6	910	+				Missense_Mutation	SNP	ENST00000493014.1	1	1	hg19	c.842A>G	CCDS58845.1	0	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524255	0.85600	.	.	ENSG00000151576	ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014	.	.	.	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.85004	0.5598	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.87953	0.2725	9	0.87932	D	0	-16.4311	15.2149	0.73258	1.0:0.0:0.0:0.0	.	281;387	B7Z472;Q9H974	.;QTRD1_HUMAN	C	399;387;264;281	.	ENSP00000281273:Y387C	Y	+	2	0	0	QTRTD1	115287353	115287353	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.273000	0.89887	2.333000	0.79357	0.533000	0.62120	TAC	0.204244		TCGA-IB-7889-01A-11D-2154-08	0.463	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000354711.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	1.900000	-5.601550	1	0.220000	NM_024638		0	30	30	0	565	561	1		1	1		0	0	97	0	0	1.000000	2.395284e-01	0	8	0	10	0	30	565
SYNPO2	171024	broad.mit.edu	37	4	119948009	119948009	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr4:119948009C>T	ENST00000429713.2	+	3	667	c.485C>T	c.(484-486)cCg>cTg	p.P162L	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Missense_Mutation_p.P162L|SYNPO2_ENST00000307142.4_Missense_Mutation_p.P162L	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	162						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GAAACAGGCCCGAGCTACCAA	0.547																																						ENST00000429713.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999493	0.990000	1.000000																										0				64						c.(484-486)cCg>cTg		synaptopodin 2							35.0	38.0	37.0					4																	119948009		2203	4300	6503	SO:0001583	missense	171024	0	0					g.chr4:119948009C>T	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.485C>T	chr4.hg19:g.119948009C>T	ENSP00000395143:p.Pro162Leu	0					SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Missense_Mutation_p.P162L|SYNPO2_ENST00000434046.2_Missense_Mutation_p.P162L	p.P162L	NM_001128933.1	NP_001122405.1	0	0	0	2.008776	Q9UMS6	SYNP2_HUMAN		3	667	+			B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	1	1	hg19	c.485C>T	CCDS47129.1	1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.429248	0.00184	.	.	ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046	T;T;T	0.06768	3.26;3.26;3.26	4.56	-5.91	0.02269	4.56	-5.91	0.02269	.	0.414976	0.17348	N	0.177482	T	0.01489	0.0048	N	0.00237	-1.79	0.09310	N	0.999996	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.47774	-0.9091	10	0.31617	T	0.26	0.9506	8.3027	0.32023	0.1979:0.5711:0.0:0.231	.	162;162;162;162	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.;.;.;SYNP2_HUMAN	L	162	ENSP00000306015:P162L;ENSP00000395143:P162L;ENSP00000390965:P162L	ENSP00000306015:P162L	P	+	2	0	0	SYNPO2	120167457	120167457	0.001000	0.12720	0.000000	0.03702	0.014000	0.08584	0.077000	0.14738	-0.619000	0.05648	-1.181000	0.01715	CCG	0.213075		TCGA-IB-7889-01A-11D-2154-08	0.547	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	41	1	1.900000	-2.957194	1	0.220000			0	38	38	0	196	196	1		1	0		0	0	42	0	0	1.000000	0	0	0	0	1	0	38	196
CCRN4L	25819	broad.mit.edu	37	4	139966043	139966043	+	Silent	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr4:139966043C>T	ENST00000280614.2	+	3	904	c.711C>T	c.(709-711)gcC>gcT	p.A237A	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	237					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					ATGGTTGTGCCTTATTTTTTC	0.463																																					Ovarian(144;566 1842 19130 21379 22209)	ENST00000280614.2	0.880000	0.440000	0.770000	0.540000	0.640000	0.660609	0.640000	0.640000																										0				9						c.(709-711)gcC>gcT		CCR4 carbon catabolite repression 4-like (S. cerevisiae)							100.0	90.0	93.0					4																	139966043		2203	4300	6503	SO:0001819	synonymous_variant	25819	0	0					g.chr4:139966043C>T	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.711C>T	chr4.hg19:g.139966043C>T		0					ELF2_ENST00000515489.1_Intron	p.A237A	NM_012118.2	NP_036250.2	0	0	0	2.008776	Q9UK39	NOCT_HUMAN		3	904	+	all_hematologic(180;0.162)		D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Silent	SNP	ENST00000280614.2	1	1	hg19	c.711C>T	CCDS3743.1	0																																																																																								0.213075		TCGA-IB-7889-01A-11D-2154-08	0.463	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	0	0	1	2	2	2	2	0	0	0	0	74	74	74	72	1	1.900000	-2.920856	1	0.220000	NM_012118		0	30	27	0	387	384	0		1	1		0	0	74	0	0	1.000000	2.500807e-01	0	4	0	9	0	30	387
PCDHB13	56123	broad.mit.edu	37	5	140595561	140595561	+	Silent	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr5:140595561C>T	ENST00000341948.4	+	1	2053	c.1866C>T	c.(1864-1866)ggC>ggT	p.G622G		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	622	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCACAATGGCGAGGTGCGCA	0.701																																						ENST00000341948.4	0.900000	0.390000	0.770000	0.500000	0.620000	0.639125	0.620000	0.610000																										0				66						c.(1864-1866)ggC>ggT		protocadherin beta 13							17.0	19.0	18.0					5																	140595561		1710	3586	5296	SO:0001819	synonymous_variant	56123	0	0					g.chr5:140595561C>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1866C>T	chr5.hg19:g.140595561C>T		0						p.G622G	NM_018933.2	NP_061756.1	0	0	0	1.998860	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	2053	+			A8K9V6	Silent	SNP	ENST00000341948.4	1	0	hg19	c.1866C>T	CCDS4255.1	0																																																																																								0.207800		TCGA-IB-7889-01A-11D-2154-08	0.701	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	121	1	1.900000	-19.999950	1	0.220000	NM_018933		0	20	13	0	268	201	0		1			0	0	61	0	0	0.999934	0	0	0	0	0	0	20	268
FOXQ1	94234	broad.mit.edu	37	6	1313384	1313384	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr6:1313384C>T	ENST00000296839.2	+	1	710	c.445C>T	c.(445-447)Ctc>Ttc	p.L149F		NM_033260.3	NP_150285.3	Q9C009	FOXQ1_HUMAN	forkhead box Q1	149					hair follicle morphogenesis (GO:0031069)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|urinary_tract(1)	2	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		CAACGAGTACCTCATGGGCAA	0.657																																						ENST00000296839.2	0.660000	0.240000	0.550000	0.320000	0.420000	0.440724	0.420000	0.420000																										0				2						c.(445-447)Ctc>Ttc		forkhead box Q1							35.0	36.0	36.0					6																	1313384		2196	4290	6486	SO:0001583	missense	94234	0	0					g.chr6:1313384C>T	AF153341	CCDS4471.1	6p25	2008-02-05			ENSG00000164379	ENSG00000164379		"""Forkhead boxes"""	20951	protein-coding gene	gene with protein product		612788				11747606, 12011061	Standard	NM_033260		Approved	HFH1	uc003mtl.4	Q9C009	OTTHUMG00000016160	ENST00000296839.2:c.445C>T	chr6.hg19:g.1313384C>T	ENSP00000296839:p.Leu149Phe	1						p.L149F	NM_033260.3	NP_150285.3	0	0	0	1.871651	Q9C009	FOXQ1_HUMAN		1	710	+	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)	Q9NS06	Missense_Mutation	SNP	ENST00000296839.2	1	1	hg19	c.445C>T	CCDS4471.1	0	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821825	0.50633	.	.	ENSG00000164379	ENST00000296839	D	0.96011	-3.88	3.87	1.9	0.25705	3.87	1.9	0.25705	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.093430	0.44483	N	0.000458	D	0.91415	0.7291	N	0.25426	0.745	0.45822	D	0.998695	D	0.57571	0.98	P	0.59761	0.863	D	0.90412	0.4410	10	0.66056	D	0.02	.	6.7197	0.23323	0.1739:0.7262:0.0:0.1	.	149	Q9C009	FOXQ1_HUMAN	F	149	ENSP00000296839:L149F	ENSP00000296839:L149F	L	+	1	0	0	FOXQ1	1258384	1258384	0.969000	0.33509	0.955000	0.39395	0.340000	0.28889	0.219000	0.17641	0.643000	0.30638	-1.206000	0.01644	CTC	0.154930		TCGA-IB-7889-01A-11D-2154-08	0.657	FOXQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043410.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.900000	-16.454680	1	0.220000	NM_033260		0	14	14	0	264	263	0		1	1		0	0	61	0	0	0.999769	4.565631e-01	0	2	0	27	0	14	264
ZAN	7455	broad.mit.edu	37	7	100377265	100377265	+	RNA	SNP	A	A	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr7:100377265A>T	ENST00000348028.3	+	0	6679				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCTCTGTGAGTTCGGAGGT	0.652																																						ENST00000348028.3	1.000000	0.620000	1.000000	0.940000	0.990000	0.962772	0.990000	1.000000																										0				139								zonadhesin (gene/pseudogene)							33.0	35.0	34.0					7																	100377265		1913	4121	6034			7455	0	0					g.chr7:100377265A>T	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		chr7.hg19:g.100377265A>T		0					ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA				1	2	3	2.094265	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)	0	6679	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	0	1	hg19			1	.	.	.	.	.	.	.	.	.	.	A	8.808	0.934469	0.18206	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.77877	-1.13;-1.13;-1.13	4.17	1.81	0.25067	4.17	1.81	0.25067	Uncharacterised domain, cysteine-rich (2);	1.310930	0.05416	N	0.543352	D	0.83667	0.5304	.	.	.	0.34357	D	0.690562	D;D	0.63046	0.99;0.992	P;D	0.63283	0.858;0.913	T	0.73940	-0.3824	9	0.46703	T	0.11	.	5.6012	0.17355	0.7788:0.0:0.2212:0.0	.	2171;2172	F5H0T8;Q9Y493	.;ZAN_HUMAN	V	2171	ENSP00000445943:E2171V;ENSP00000445091:E2171V;ENSP00000444427:E2171V	ENSP00000445091:E2171V	E	+	2	0	0	ZAN	100215201	100215201	0.412000	0.25392	0.247000	0.24249	0.095000	0.18619	0.900000	0.28431	0.419000	0.25927	0.456000	0.33151	GAG	0.235968		TCGA-IB-7889-01A-11D-2154-08	0.652	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	0	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	1.900000	-14.445940	1	0.220000	NM_003386		0	7	7	0	43	43	0		1			0	0	12	0	0	0.983297	0	0	0	0	0	0	7	43
PRKAR1B	5575	broad.mit.edu	37	7	720280	720280	+	Silent	SNP	C	C	T	rs545804273		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr7:720280C>T	ENST00000406797.1	-	3	435	c.261G>A	c.(259-261)ccG>ccA	p.P87P	PRKAR1B_ENST00000360274.4_Silent_p.P87P|PRKAR1B_ENST00000544935.1_Silent_p.P87P|PRKAR1B_ENST00000537384.1_Silent_p.P87P|PRKAR1B_ENST00000403562.1_Silent_p.P87P	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	87	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		CCACAGGGTTCGGGGGGGTGG	0.622													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16030	0.0		0.0	False		,,,				2504	0.0					ENST00000406797.1	1.000000	0.850000	1.000000	0.990000	0.990000	0.987826	0.990000	1.000000																										0				17						c.(259-261)ccG>ccA		protein kinase, cAMP-dependent, regulatory, type I, beta							54.0	53.0	54.0					7																	720280		2203	4300	6503	SO:0001819	synonymous_variant	5575	0	0					g.chr7:720280C>T	M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.261G>A	chr7.hg19:g.720280C>T		1					PRKAR1B_ENST00000403562.1_Silent_p.P87P|PRKAR1B_ENST00000360274.4_Silent_p.P87P|PRKAR1B_ENST00000537384.1_Silent_p.P87P|PRKAR1B_ENST00000544935.1_Silent_p.P87P	p.P87P	NM_001164761.1	NP_001158233.1	1	3	4	2.330104	P31321	KAP1_HUMAN		3	435	-		Ovarian(82;0.0779)	Q8N422	Silent	SNP	ENST00000406797.1	1	0	hg19	c.261G>A	CCDS34579.1	1																																																																																								0.309612		TCGA-IB-7889-01A-11D-2154-08	0.622	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322525.1	1	0	1	2	2	2	2	0	0	0	0	45	45	45	42	1	1.900000	-1.639820	0	0.220000			0	52	52	0	431	423	1		1	0		0	0	45	0	0	1.000000	3.824771e-01	0	1	0	11	0	52	431
BBS9	27241	broad.mit.edu	37	7	33407475	33407475	+	Splice_Site	SNP	G	G	A	rs201938124		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr7:33407475G>A	ENST00000242067.6	+	17	2310		c.e17+1		BBS9_ENST00000355070.2_Splice_Site|BBS9_ENST00000350941.3_Splice_Site|BBS9_ENST00000354265.4_Splice_Site|BBS9_ENST00000396127.2_Splice_Site	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9						cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			AAAACTTCTCGTAAGTAAAAC	0.373									Bardet-Biedl syndrome																													ENST00000242067.6	1.000000	0.310000	1.000000	0.420000	0.580000	0.649202	0.580000	0.510000																									BBS9/PKD1L1(2)	0				50	GRCh37	CS055613	BBS9	S		c.e17+1		Bardet-Biedl syndrome 9							149.0	135.0	139.0					7																	33407475		2203	4300	6503	SO:0001630	splice_region_variant	27241	0	0		Bardet-Biedl syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	g.chr7:33407475G>A		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1789+1G>A	chr7.hg19:g.33407475G>A		1					BBS9_ENST00000355070.2_Splice_Site|BBS9_ENST00000350941.3_Splice_Site|BBS9_ENST00000354265.4_Splice_Site|BBS9_ENST00000396127.2_Splice_Site		NM_198428.2	NP_940820.1	1	3	4	2.330104	Q3SYG4	PTHB1_HUMAN	GBM - Glioblastoma multiforme(11;0.0894)	17	2310	+			E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Splice_Site	SNP	ENST00000242067.6	1	1	hg19		CCDS43566.1	0	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496770	0.85069	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000434373	.	.	.	5.48	5.48	0.80851	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9484	0.92630	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	BBS9	33374000	33374000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.787000	0.75099	2.572000	0.86782	0.655000	0.94253	.	0.309612		TCGA-IB-7889-01A-11D-2154-08	0.373	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.900000	-4.463742	1	0.220000		Intron	0	14	14	0	266	265	0		1			0	0	49	0	0	0.999769	0	0	0	0	0	0	14	266
SPAM1	6677	broad.mit.edu	37	7	123599604	123599604	+	Silent	SNP	C	C	T	rs146075363		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr7:123599604C>T	ENST00000439500.1	+	6	1724	c.1111C>T	c.(1111-1113)Cta>Tta	p.L371L	SPAM1_ENST00000223028.7_Silent_p.L371L|SPAM1_ENST00000340011.5_Silent_p.L371L|SPAM1_ENST00000460182.1_Silent_p.L371L|SPAM1_ENST00000402183.2_Silent_p.L371L	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	371					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAACGTCACACTAGCAGCCAA	0.378																																						ENST00000439500.1	1.000000	0.730000	1.000000	0.870000	0.990000	0.953776	0.990000	1.000000																										0				46						c.(1111-1113)Cta>Tta		sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)		C	,,,,	1,4405	2.1+/-5.4	0,1,2202	106.0	97.0	100.0		1111,1111,1111,1111,1111	2.3	1.0	7	dbSNP_134	100	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SPAM1	NM_001174044.1,NM_001174045.1,NM_001174046.1,NM_003117.4,NM_153189.2	,,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,	371/510,371/510,371/510,371/512,371/510	123599604	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6677	1	121354	25				g.chr7:123599604C>T	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1111C>T	chr7.hg19:g.123599604C>T		0					SPAM1_ENST00000223028.7_Silent_p.L371L|SPAM1_ENST00000460182.1_Silent_p.L371L|SPAM1_ENST00000340011.5_Silent_p.L371L|SPAM1_ENST00000402183.2_Silent_p.L371L	p.L371L	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	1	2	3	2.094265	P38567	HYALP_HUMAN		6	1724	+			Q8TC30	Silent	SNP	ENST00000439500.1	1	1	hg19	c.1111C>T	CCDS5791.1	1																																																																																								0.235968		TCGA-IB-7889-01A-11D-2154-08	0.378	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.900000	-14.405540	1	0.220000			0	37	37	0	305	302	1		1			0	0	56	0	0	1.000000	0	0	0	0	0	0	37	305
RGS22	26166	broad.mit.edu	37	8	101076206	101076206	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr8:101076206A>T	ENST00000360863.6	-	8	984	c.790T>A	c.(790-792)Ttg>Atg	p.L264M	RGS22_ENST00000523437.1_Missense_Mutation_p.L252M|RGS22_ENST00000523287.1_Missense_Mutation_p.L83M	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	264					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TCAGAAATCAATTTGTTGGTT	0.343																																						ENST00000360863.6	1.000000	0.440000	1.000000	0.510000	0.600000	0.672623	0.600000	0.580000																									RGS22/SYCP1(2)	0				68						c.(790-792)Ttg>Atg		regulator of G-protein signaling 22							123.0	128.0	126.0					8																	101076206		1809	4071	5880	SO:0001583	missense	26166	0	0					g.chr8:101076206A>T	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.790T>A	chr8.hg19:g.101076206A>T	ENSP00000354109:p.Leu264Met	1					RGS22_ENST00000523287.1_Missense_Mutation_p.L83M|RGS22_ENST00000523437.1_Missense_Mutation_p.L252M	p.L264M	NM_015668.3	NP_056483.3	1	3	4	2.338081	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)	8	984	-			A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	1	1	hg19	c.790T>A	CCDS43758.1	0	.	.	.	.	.	.	.	.	.	.	A	14.54	2.564891	0.45694	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.32988	1.45;1.44;1.43	5.45	0.102	0.14522	5.45	0.102	0.14522	.	2.260420	0.01579	N	0.020975	T	0.30386	0.0763	L	0.60455	1.87	0.09310	N	1	P;P;B	0.37864	0.61;0.61;0.065	B;B;B	0.39185	0.293;0.293;0.037	T	0.09509	-1.0671	10	0.39692	T	0.17	.	1.6829	0.02835	0.4861:0.1481:0.0809:0.2849	.	252;264;83	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	M	264;252;83;252	ENSP00000354109:L264M;ENSP00000429382:L83M;ENSP00000428212:L252M	ENSP00000354109:L264M	L	-	1	2	2	RGS22	101145382	101145382	0.000000	0.05858	0.000000	0.03702	0.337000	0.28794	-0.768000	0.04715	-0.138000	0.11434	0.528000	0.53228	TTG	0.324090		TCGA-IB-7889-01A-11D-2154-08	0.343	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	109	1	1.900000	-20.000000	1	0.220000	NM_015668		0	51	50	0	870	858	0		1	0		0	0	109	0	0	1.000000	0	0	0	0	1	0	51	870
ASH2L	9070	broad.mit.edu	37	8	37964684	37964684	+	Splice_Site	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr8:37964684C>T	ENST00000343823.6	+	3	710	c.401C>T	c.(400-402)tCa>tTa	p.S134L	ASH2L_ENST00000545394.1_Intron|ASH2L_ENST00000521652.1_Splice_Site_p.S40L|ASH2L_ENST00000250635.7_Splice_Site_p.S40L|ASH2L_ENST00000428278.2_Splice_Site_p.S40L	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	134	DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				ATAGATACCTCGTGAGTACTT	0.408																																						ENST00000343823.6	1.000000	0.470000	1.000000	0.570000	0.690000	0.736590	0.690000	0.650000																										0				19						c.(400-402)tCa>tTa		ash2 (absent, small, or homeotic)-like (Drosophila)							193.0	175.0	181.0					8																	37964684		2203	4300	6503	SO:0001630	splice_region_variant	9070	0	0					g.chr8:37964684C>T	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.401+1C>T	chr8.hg19:g.37964684C>T		1					ASH2L_ENST00000428278.2_Splice_Site_p.S40L|ASH2L_ENST00000545394.1_Intron|ASH2L_ENST00000250635.7_Splice_Site_p.S40L|ASH2L_ENST00000521652.1_Splice_Site_p.S40L	p.S134L	NM_004674.4	NP_004665.2	2	2	4	2.146007	Q9UBL3	ASH2L_HUMAN		3	710	+	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Splice_Site	SNP	ENST00000343823.6	1	0	hg19	c.401C>T	CCDS6101.1	0	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705343	0.68615	.	.	ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000517719;ENST00000428278;ENST00000521652	T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12	4.82	4.82	0.62117	4.82	4.82	0.62117	.	0.114028	0.64402	D	0.000014	T	0.16214	0.0390	N	0.19112	0.55	0.80722	D	1	B;B	0.27732	0.187;0.061	B;B	0.21151	0.033;0.005	T	0.05468	-1.0883	10	0.62326	D	0.03	.	17.9105	0.88932	0.0:1.0:0.0:0.0	.	40;134	Q9UBL3-2;Q9UBL3	.;ASH2L_HUMAN	L	134;40;148;40;40	ENSP00000340896:S134L;ENSP00000250635:S40L;ENSP00000428877:S148L;ENSP00000395310:S40L;ENSP00000430259:S40L	ENSP00000250635:S40L	S	+	2	0	0	ASH2L	38083841	38083841	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.090000	0.41682	2.223000	0.72356	0.557000	0.71058	TCA	0.268293		TCGA-IB-7889-01A-11D-2154-08	0.408	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.900000	-2.744761	1	0.220000	NM_004674	Missense_Mutation	0	33	33	0	454	450	0		1	1		0	0	60	0	0	1.000000	8.169225e-01	0	2	0	43	0	33	454
WHSC1L1	54904	broad.mit.edu	37	8	38187221	38187221	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr8:38187221G>T	ENST00000317025.8	-	6	1773	c.1256C>A	c.(1255-1257)aCc>aAc	p.T419N	WHSC1L1_ENST00000316985.3_Missense_Mutation_p.T419N|WHSC1L1_ENST00000433384.2_Missense_Mutation_p.T419N|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.T419N	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	419					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TGGTCGTCGGGTTTTTTTAAC	0.433			T	NUP98	AML																																	ENST00000317025.8	1.000000	0.260000	1.000000	0.340000	0.440000	0.543674	0.440000	0.420000				Dom	yes			Dom	yes		8	8p12	8p12	54904	T	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)				L	L	NUP98		AML		0				24						c.(1255-1257)aCc>aAc		Wolf-Hirschhorn syndrome candidate 1-like 1							111.0	107.0	108.0					8																	38187221		2203	4300	6503	SO:0001583	missense	54904	0	0					g.chr8:38187221G>T	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.1256C>A	chr8.hg19:g.38187221G>T	ENSP00000313983:p.Thr419Asn	1					WHSC1L1_ENST00000316985.3_Missense_Mutation_p.T419N|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.T419N|WHSC1L1_ENST00000433384.2_Missense_Mutation_p.T419N	p.T419N	NM_023034.1	NP_075447.1	2	2	4	2.146007	Q9BZ95	NSD3_HUMAN	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)	6	1773	-	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	ENST00000317025.8	1	1	hg19	c.1256C>A	CCDS43729.1	0	.	.	.	.	.	.	.	.	.	.	G	8.652	0.898580	0.17686	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502;ENST00000316985	D;D;D;T	0.95137	-3.62;-3.62;-3.62;-0.48	5.6	4.65	0.58169	5.6	4.65	0.58169	.	0.608282	0.13904	U	0.354722	D	0.82870	0.5131	N	0.02011	-0.69	0.25889	N	0.983491	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.68580	-0.5371	10	0.12103	T	0.63	.	11.164	0.48533	0.0:0.0:0.5948:0.4052	.	419;419;419;419	B7ZL11;Q9BZ95-2;Q9BZ95-3;Q9BZ95	.;.;.;NSD3_HUMAN	N	419;419;356;419;419	ENSP00000393284:T419N;ENSP00000313983:T419N;ENSP00000434730:T419N;ENSP00000313410:T419N	ENSP00000313410:T419N	T	-	2	0	0	WHSC1L1	38306378	38306378	0.785000	0.28726	0.870000	0.34147	0.989000	0.77384	1.199000	0.32235	2.634000	0.89283	0.650000	0.86243	ACC	0.268293		TCGA-IB-7889-01A-11D-2154-08	0.433	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	1	0	1	2	2	2	2	0	0	0	0	65	65	65	63	1	1.900000	-3.210257	1	0.220000	NM_023034		0	19	19	0	429	421	0		1	1		0	0	65	0	0	0.999989	8.856142e-01	0	7	0	81	0	19	429
TRPS1	7227	broad.mit.edu	37	8	116616325	116616325	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr8:116616325C>T	ENST00000220888.5	-	3	1991	c.1832G>A	c.(1831-1833)cGa>cAa	p.R611Q	TRPS1_ENST00000520276.1_Missense_Mutation_p.R615Q|TRPS1_ENST00000519674.1_Missense_Mutation_p.R611Q|TRPS1_ENST00000395715.3_Missense_Mutation_p.R624Q|TRPS1_ENST00000519076.1_Intron			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	611					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATGTTTGACTCGCGAGCTTCC	0.478									Langer-Giedion syndrome																													ENST00000220888.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999979	0.990000	1.000000																										0				111						c.(1831-1833)cGa>cAa		trichorhinophalangeal syndrome I							69.0	70.0	69.0					8																	116616325		2034	4189	6223	SO:0001583	missense	7227	1	120940	30	Langer-Giedion syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	g.chr8:116616325C>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1832G>A	chr8.hg19:g.116616325C>T	ENSP00000220888:p.Arg611Gln	1					TRPS1_ENST00000520276.1_Missense_Mutation_p.R615Q|TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000519674.1_Missense_Mutation_p.R611Q|TRPS1_ENST00000395715.3_Missense_Mutation_p.R624Q	p.R611Q			2	2	4	2.208572	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)	3	1991	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	1	1	hg19	c.1832G>A		1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729920	0.48833	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.183848	0.49305	D	0.000160	T	0.23886	0.0578	L	0.27053	0.805	0.40856	D	0.983791	D;D;D	0.69078	0.991;0.994;0.997	P;D;D	0.69479	0.563;0.921;0.964	T	0.00717	-1.1596	10	0.72032	D	0.01	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	615;611;624	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	Q	624;611;615;611	ENSP00000379065:R624Q;ENSP00000220888:R611Q;ENSP00000428680:R615Q;ENSP00000429174:R611Q	ENSP00000220888:R611Q	R	-	2	0	0	TRPS1	116685500	116685500	1.000000	0.71417	0.587000	0.28692	0.015000	0.08874	5.682000	0.68182	2.941000	0.99782	0.655000	0.94253	CGA	0.287411		TCGA-IB-7889-01A-11D-2154-08	0.478	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	1	0	1	2	2	2	2	0	0	0	0	46	46	46	45	1	1.900000	-2.926725	1	0.220000	NM_014112		0	56	55	0	308	305	1		1	0		0	0	46	0	0	1.000000	0	0	0	0	1	0	56	308
CDKN2A	1029	broad.mit.edu	37	9	21971120	21971120	+	Nonsense_Mutation	SNP	G	G	A	rs121913388		TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr9:21971120G>A	ENST00000304494.5	-	2	508	c.238C>T	c.(238-240)Cga>Tga	p.R80*	CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	80			R -> L (in a head and neck tumor).|R -> P (in CMM2; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGCACGGGTCGGGTGAGAGTG	0.726	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	0.560000	1.000000	0.720000	0.880000	0.866427	0.880000	1.000000	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17																								1474	Whole gene deletion(1316)|Substitution - Nonsense(100)|Unknown(44)|Substitution - Missense(7)|Deletion - Frameshift(6)|Deletion - In frame(1)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)	haematopoietic_and_lymphoid_tissue(298)|skin(206)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(76)|oesophagus(72)|upper_aerodigestive_tract(63)|soft_tissue(60)|pleura(51)|pancreas(37)|ovary(36)|kidney(32)|breast(32)|biliary_tract(16)|thyroid(15)|NS(14)|stomach(14)|large_intestine(7)|autonomic_ganglia(7)|meninges(7)|liver(6)|salivary_gland(4)|thymus(4)|vulva(3)|endometrium(3)|prostate(2)	4199	GRCh37	CM014695	CDKN2A	M	rs121913388	c.(238-240)Cga>Tga		cyclin-dependent kinase inhibitor 2A							11.0	14.0	13.0					9																	21971120		2172	4246	6418	SO:0001587	stop_gained	1029	0	0					g.chr9:21971120G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.238C>T	chr9.hg19:g.21971120G>A	ENSP00000307101:p.Arg80*	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*	p.R80*	NM_000077.4	NP_000068.1	0	1	1	1.860055	P42771	CD2A1_HUMAN		2	508	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.238C>T	CCDS6510.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.328457|7.328457	0.98214|0.98214	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	D;D|.	0.86497|.	-2.13;-2.02|.	5.93|5.93	5.01|5.01	0.66863|0.66863	5.93|5.93	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.37136|.	N|.	0.002233|.	T|.	0.44561|.	0.1299|.	L|L	0.36672|0.36672	1.1|1.1	0.47511|0.47511	D|D	0.999443|0.999443	D|.	0.59357|.	0.985|.	B|.	0.40602|.	0.334|.	T|.	0.34825|.	-0.9813|.	10|.	0.13108|0.02654	T|T	0.6|1	-2.989|-2.989	8.7197|8.7197	0.34434|0.34434	0.0759:0.0:0.7715:0.1526|0.0759:0.0:0.7715:0.1526	.|.	135|.	Q8N726|.	CD2A2_HUMAN|.	L|X	135;94|80	ENSP00000355153:P135L;ENSP00000432664:P94L|.	ENSP00000355153:P135L|ENSP00000307101:R80X	P|R	-|-	2|1	0|2	0|2	CDKN2A|CDKN2A	21961120|21961120	21961120|21961120	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	2.363000|2.363000	0.44178|0.44178	1.464000|1.464000	0.47987|0.47987	0.650000|0.650000	0.86243|0.86243	CCG|CGA	0.134295		TCGA-IB-7889-01A-11D-2154-08	0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	21	1	1.900000	-2.749063	1	0.220000	NM_000077		0	16	14	0	117	88	0		1		1	0	0	24	141	0	0.999630	0	7.398962e-01	0	5	0	16	16	117
PKN3	29941	broad.mit.edu	37	9	131477728	131477728	+	Silent	SNP	C	C	T			TCGA-IB-7889-01A-11D-2154-08	TCGA-IB-7889-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01ca4fa5-629f-433d-ab6a-e0a8b2417ddc	273e3c23-c89d-4142-a9c3-59c5ec1224dc	g.chr9:131477728C>T	ENST00000291906.4	+	15	2190	c.1797C>T	c.(1795-1797)gaC>gaT	p.D599D	PKN3_ENST00000485301.1_Intron	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	599	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)	p.D599D(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCAGCCGGGACGAGATAGAGA	0.612																																						ENST00000291906.4	0.760000	0.250000	0.590000	0.340000	0.450000	0.471469	0.450000	0.440000																										1	Substitution - coding silent(1)	p.D599D(1)	large_intestine(1)	24						c.(1795-1797)gaC>gaT		protein kinase N3							45.0	45.0	45.0					9																	131477728		2203	4300	6503	SO:0001819	synonymous_variant	29941	0	0					g.chr9:131477728C>T	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.1797C>T	chr9.hg19:g.131477728C>T		0					PKN3_ENST00000485301.1_Intron	p.D599D	NM_013355.3	NP_037487.2	1	2	3	2.022956	Q6P5Z2	PKN3_HUMAN		15	2190	+			Q9UM03	Silent	SNP	ENST00000291906.4	1	1	hg19	c.1797C>T	CCDS6908.1	0																																																																																								0.221712		TCGA-IB-7889-01A-11D-2154-08	0.612	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.900000	-15.209500	1	0.220000	NM_013355		0	13	12	0	255	254	0		1	1		0	0	56	0	0	0.999547	8.674753e-01	0	7	0	66	0	13	255
