#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ANKRD30A	91074	broad.mit.edu	37	10	37430910	37430910	+	Missense_Mutation	SNP	C	C	T	rs200193852	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr10:37430910C>T	ENST00000602533.1	+	7	1016	c.917C>T	c.(916-918)aCg>aTg	p.T306M	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.T306M|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.T306M			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	362					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AGGGAAATTACGAGTCCTGCA	0.433													.|||	2	0.000399361	0.0015	0.0	5008	,	,		19604	0.0		0.0	False		,,,				2504	0.0					ENST00000602533.1	1.000000	0.820000	1.000000	0.920000	0.990000	0.973685	0.990000	1.000000																										0				158						c.(916-918)aCg>aTg		ankyrin repeat domain 30A							92.0	91.0	91.0					10																	37430910		1874	4104	5978	SO:0001583	missense	91074	0	0					g.chr10:37430910C>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.917C>T	chr10.hg19:g.37430910C>T	ENSP00000473551:p.Thr306Met	1					ANKRD30A_ENST00000374660.1_Missense_Mutation_p.T306M|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.T306M	p.T306M			0	2	2	1.780639	Q9BXX3	AN30A_HUMAN		7	1016	+			Q5W025	Missense_Mutation	SNP	ENST00000602533.1	1	0	hg19	c.917C>T		1	.	.	.	.	.	.	.	.	.	.	.	14.40	2.523711	0.44866	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05382	3.45;3.45	0.5	0.5	0.16919	0.5	0.5	0.16919	.	.	.	.	.	T	0.02571	0.0078	N	0.03608	-0.345	0.09310	N	1	B	0.25351	0.124	B	0.10450	0.005	T	0.45366	-0.9266	8	0.33940	T	0.23	.	.	.	.	.	362	Q9BXX3	AN30A_HUMAN	M	306	ENSP00000354432:T306M;ENSP00000363792:T306M	ENSP00000354432:T306M	T	+	2	0	0	ANKRD30A	37470916	37470916	0.012000	0.17670	0.007000	0.13788	0.009000	0.06853	-0.326000	0.07965	0.525000	0.28522	0.134000	0.15878	ACG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.433	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	1	0	1	2	2	2	2	2	2	2	0	105	105	105	104	1	2.800000	-2.144294	0	0.360000	NM_052997		0	67	62	0	291	289	1		1			2	0	105	0	0	1.000000	0	0	0	0	0	0	67	291
C10orf62	414157	broad.mit.edu	37	10	99350210	99350210	+	Silent	SNP	C	C	A	rs145450971	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr10:99350210C>A	ENST00000370640.3	+	1	761	c.556C>A	c.(556-558)Cgg>Agg	p.R186R	HOGA1_ENST00000370646.4_Intron|PI4K2A_ENST00000370649.3_Intron|PI4K2A_ENST00000555577.1_Intron|HOGA1_ENST00000370647.4_Intron	NM_001009997.2	NP_001009997.2	Q5T681	CJ062_HUMAN	chromosome 10 open reading frame 62	186										endometrium(2)|kidney(1)|lung(1)	4		Colorectal(252;0.162)		Epithelial(162;9.58e-11)|all cancers(201;8.62e-09)		CCTCACCCAGCGGGAAAACAC	0.567																																						ENST00000370640.3	1.000000	0.760000	1.000000	0.850000	0.960000	0.938489	0.960000	1.000000																										0				4						c.(556-558)Cgg>Agg		chromosome 10 open reading frame 62							88.0	84.0	85.0					10																	99350210		2203	4300	6503	SO:0001819	synonymous_variant	414157	82	121412	53				g.chr10:99350210C>A		CCDS31261.1	10q24.2	2012-05-31			ENSG00000203942	ENSG00000203942			23294	protein-coding gene	gene with protein product							Standard	NM_001009997		Approved	bA548K23.1	uc001koa.3	Q5T681	OTTHUMG00000018858	ENST00000370640.3:c.556C>A	chr10.hg19:g.99350210C>A		1					HOGA1_ENST00000370647.4_Intron|PI4K2A_ENST00000370649.3_Intron|PI4K2A_ENST00000555577.1_Intron|HOGA1_ENST00000370646.4_Intron	p.R186R	NM_001009997.2	NP_001009997.2	1	3	4	2.127873	Q5T681	CJ062_HUMAN		1	761	+		Colorectal(252;0.162)	Q49A70|Q8N3Y6	Silent	SNP	ENST00000370640.3	1	1	hg19	c.556C>A	CCDS31261.1	1																																																																																								0.468968		TCGA-IB-7890-01A-12D-2201-08	0.567	C10orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049723.1	1	0	1	2	15	2	2	1	1	1	1	148	148	148	147	1	2.800000	-7.194516	1	0.360000	NM_001009997		0	85	84	0	529	520	1		1			1	0	148	0	0	1.000000	0	0	0	0	0	0	85	529
DNMBP	23268	broad.mit.edu	37	10	101716827	101716827	+	Missense_Mutation	SNP	G	G	T	rs374469305		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr10:101716827G>T	ENST00000324109.4	-	4	495	c.404C>A	c.(403-405)tCc>tAc	p.S135Y	DNMBP_ENST00000342239.3_Missense_Mutation_p.S135Y|DNMBP-AS1_ENST00000434409.1_RNA	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	135					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GGCGCTCTGGGAGTGCCACTG	0.617																																						ENST00000324109.4	1.000000	0.490000	1.000000	0.630000	0.820000	0.820667	0.820000	1.000000																										0				61						c.(403-405)tCc>tAc		dynamin binding protein							27.0	29.0	28.0					10																	101716827		2203	4300	6503	SO:0001583	missense	23268	0	0					g.chr10:101716827G>T	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.404C>A	chr10.hg19:g.101716827G>T	ENSP00000315659:p.Ser135Tyr	1					DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Missense_Mutation_p.S135Y	p.S135Y	NM_015221.2	NP_056036.1	1	3	4	2.127873	Q6XZF7	DNMBP_HUMAN		4	495	-		Colorectal(252;0.234)	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	1	1	hg19	c.404C>A	CCDS7485.1	0	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785820	0.70337	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.13778	2.61;2.56	5.47	5.47	0.80525	5.47	5.47	0.80525	Src homology-3 domain (2);	0.160351	0.29791	N	0.011192	T	0.14141	0.0342	N	0.19112	0.55	0.80722	D	1	P	0.49559	0.925	P	0.47206	0.541	T	0.01212	-1.1417	10	0.66056	D	0.02	-8.7178	15.2145	0.73254	0.0:0.1401:0.8598:0.0	.	135	Q6XZF7	DNMBP_HUMAN	Y	135	ENSP00000344914:S135Y;ENSP00000315659:S135Y	ENSP00000315659:S135Y	S	-	2	0	0	DNMBP	101706817	101706817	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	4.044000	0.57361	2.724000	0.93272	0.561000	0.74099	TCC	0.468968		TCGA-IB-7890-01A-12D-2201-08	0.617	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	2.800000	-20.000000	1	0.360000	NM_015221		0	20	18	0	159	155	1		1	1		0	0	54	0	0	0.999995	4.104331e-01	0	4	0	8	0	20	159
SIK3	23387	broad.mit.edu	37	11	116729339	116729339	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr11:116729339G>A	ENST00000292055.4	-	20	2559	c.2524C>T	c.(2524-2526)Cgg>Tgg	p.R842W	SIK3_ENST00000375300.1_Missense_Mutation_p.R900W|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000488337.1_Intron|SIK3_ENST00000446921.2_Intron|SIK3_ENST00000434315.2_Intron|SIK3_ENST00000375288.1_Intron	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	842	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GGGGAACCCCGGGACTGGTCC	0.567																																						ENST00000292055.4	1.000000	0.760000	1.000000	0.840000	0.920000	0.922059	0.920000	1.000000																										0				57						c.(2524-2526)Cgg>Tgg		SIK family kinase 3							73.0	79.0	77.0					11																	116729339		2201	4296	6497	SO:0001583	missense	23387	1	121400	33				g.chr11:116729339G>A	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2524C>T	chr11.hg19:g.116729339G>A	ENSP00000292055:p.Arg842Trp	1					SIK3_ENST00000375288.1_Intron|SIK3_ENST00000375300.1_Missense_Mutation_p.R900W|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000446921.2_Intron|SIK3_ENST00000434315.2_Intron|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000488337.1_Intron	p.R842W	NM_025164.3	NP_079440.3	0	3	3	2.101542	Q9Y2K2	SIK3_HUMAN		20	2559	-			A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	1	1	hg19	c.2524C>T	CCDS8379.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.240336|4.240336	0.79912|0.79912	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000445177|ENST00000375300;ENST00000292055	.|T;T	.|0.73363	.|-0.7;-0.74	5.67|5.67	5.67|5.67	0.87782|0.87782	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.38217	.|U	.|0.001766	T|T	0.71492|0.71492	0.3346|0.3346	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.64830	.|0.994;0.99	.|P;B	.|0.50049	.|0.629;0.306	T|T	0.75379|0.75379	-0.3338|-0.3338	5|10	.|0.87932	.|D	.|0	.|.	14.5942|14.5942	0.68392|0.68392	0.0:0.0:0.8541:0.1459|0.0:0.0:0.8541:0.1459	.|.	.|842;842	.|Q9Y2K2-3;Q9Y2K2	.|.;SIK3_HUMAN	L|W	941|900;842	.|ENSP00000364449:R900W;ENSP00000292055:R842W	.|ENSP00000292055:R842W	P|R	-|-	2|1	0|2	0|2	SIK3|SIK3	116234549|116234549	116234549|116234549	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.705000|6.705000	0.74644|0.74644	2.654000|2.654000	0.90174|0.90174	0.655000|0.655000	0.94253|0.94253	CCG|CGG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.567	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	168	168	168	166	1	2.800000	-2.744776	1	0.360000	NM_025164		0	100	98	0	606	588	1		1	1		0	0	168	0	0	1.000000	7.160760e-01	0	5	0	12	0	100	606
OR52K2	119774	broad.mit.edu	37	11	4471098	4471098	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr11:4471098G>A	ENST00000325719.4	+	1	574	c.529G>A	c.(529-531)Gct>Act	p.A177T		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCCAGTGATCGCTCACTGCTA	0.547																																						ENST00000325719.4	1.000000	0.860000	1.000000	0.950000	0.990000	0.984129	0.990000	1.000000																										0				25						c.(529-531)Gct>Act		olfactory receptor, family 52, subfamily K, member 2							247.0	195.0	212.0					11																	4471098		2201	4298	6499	SO:0001583	missense	119774	0	0					g.chr11:4471098G>A	AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.529G>A	chr11.hg19:g.4471098G>A	ENSP00000318956:p.Ala177Thr	1						p.A177T	NM_001005172.2	NP_001005172.2	1	2	3	2.073852	Q8NGK3	O52K2_HUMAN		1	574	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	A8MUY8|B2RP35|Q6IFK4	Missense_Mutation	SNP	ENST00000325719.4	1	1	hg19	c.529G>A	CCDS31351.1	1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828372	0.50845	.	.	ENSG00000181963	ENST00000325719	T	0.00107	8.72	4.0	3.05	0.35203	4.0	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	0.154049	0.30085	N	0.010452	T	0.00178	0.0005	L	0.41415	1.275	0.09310	N	1	D	0.53151	0.958	P	0.52343	0.696	T	0.50250	-0.8850	10	0.72032	D	0.01	.	5.1676	0.15094	0.1064:0.0:0.5869:0.3067	.	177	Q8NGK3	O52K2_HUMAN	T	177	ENSP00000318956:A177T	ENSP00000318956:A177T	A	+	1	0	0	OR52K2	4427674	4427674	0.000000	0.05858	0.994000	0.49952	0.921000	0.55340	-0.481000	0.06552	2.054000	0.61138	0.485000	0.47835	GCT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.547	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385844.1	0	0	1	2	15	2	2	1	1	1	1	149	149	149	147	1	2.800000	-20.000000	1	0.360000	NM_001005172		0	101	101	0	528	518	1		1			1	0	149	0	0	1.000000	0	0	0	0	0	0	101	528
RTN3	10313	broad.mit.edu	37	11	63472339	63472339	+	Silent	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr11:63472339C>T	ENST00000377819.5	+	2	313	c.159C>T	c.(157-159)tcC>tcT	p.S53S	RTN3_ENST00000540798.1_Intron|RTN3_ENST00000339997.4_Intron|RTN3_ENST00000538995.1_Intron|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000356000.3_Silent_p.S53S|RTN3_ENST00000341307.2_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	53					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						TTGTTTCTTCCTCTTCCTCTC	0.363																																						ENST00000377819.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				20						c.(157-159)tcC>tcT		reticulon 3							256.0	235.0	242.0					11																	63472339		1830	4089	5919	SO:0001819	synonymous_variant	10313	1	120790	30				g.chr11:63472339C>T	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.159C>T	chr11.hg19:g.63472339C>T		1					RTN3_ENST00000354497.4_Intron|RTN3_ENST00000538995.1_Intron|RTN3_ENST00000540798.1_Intron|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000356000.3_Silent_p.S53S|RTN3_ENST00000339997.4_Intron|RTN3_ENST00000341307.2_Intron	p.S53S	NM_001265589.1	NP_001252518.1	1	2	3	2.073852	O95197	RTN3_HUMAN		2	313	+			B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Silent	SNP	ENST00000377819.5	1	1	hg19	c.159C>T	CCDS58141.1	1																																																																																								0.457627		TCGA-IB-7890-01A-12D-2201-08	0.363	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1	1	0	1	2	2	2	2	0	0	0	0	92	92	92	87	1	2.800000	-20.000000	1	0.360000	NM_006054		0	127	114	0	385	361	1		1	0		0	0	92	0	0	1.000000	6.237770e-02	0	0	0	2	0	127	385
TMEM151A	256472	broad.mit.edu	37	11	66062807	66062807	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr11:66062807G>A	ENST00000327259.4	+	2	1234	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M		NM_153266.3	NP_694998.1	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	364						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(4)|lung(6)	11						CTCGGAGGCCGTGGTCATGGG	0.731																																						ENST00000327259.4	1.000000	0.280000	1.000000	0.490000	0.780000	0.759273	0.780000	1.000000																										0				11						c.(1090-1092)Gtg>Atg		transmembrane protein 151A							8.0	8.0	8.0					11																	66062807		2124	4151	6275	SO:0001583	missense	256472	0	0					g.chr11:66062807G>A	BC033898	CCDS8133.1	11q13.2	2007-10-25	2007-10-25	2007-10-25	ENSG00000179292	ENSG00000179292			28497	protein-coding gene	gene with protein product			"""transmembrane protein 151"""	TMEM151		12477932	Standard	NM_153266		Approved	MGC33486	uc001ohl.3	Q8N4L1	OTTHUMG00000166920	ENST00000327259.4:c.1090G>A	chr11.hg19:g.66062807G>A	ENSP00000326244:p.Val364Met	1						p.V364M	NM_153266.3	NP_694998.1	1	2	3	2.073852	Q8N4L1	T151A_HUMAN		2	1234	+			Q8ND14	Missense_Mutation	SNP	ENST00000327259.4	0	1	hg19	c.1090G>A	CCDS8133.1	0	.	.	.	.	.	.	.	.	.	.	G	7.944	0.743434	0.15642	.	.	ENSG00000179292	ENST00000327259	.	.	.	4.14	2.04	0.26737	4.14	2.04	0.26737	.	0.189097	0.36167	N	0.002755	T	0.14570	0.0352	N	0.10916	0.065	0.29651	N	0.843971	B	0.21905	0.062	B	0.14023	0.01	T	0.12553	-1.0543	9	0.17369	T	0.5	.	4.6644	0.12659	0.1644:0.0:0.6246:0.211	.	364	Q8N4L1	T151A_HUMAN	M	364	.	ENSP00000326244:V364M	V	+	1	0	0	TMEM151A	65819383	65819383	0.997000	0.39634	0.962000	0.40283	0.992000	0.81027	2.403000	0.44530	0.944000	0.37579	0.462000	0.41574	GTG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.731	TMEM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391897.1	0	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	2.800000	-9.808765	1	0.360000	NM_153266		0	4	4	0	32	31	0		1			0	0	10	0	0	0.887472	0	0	0	0	0	0	4	32
EED	8726	broad.mit.edu	37	11	85967469	85967469	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr11:85967469G>C	ENST00000263360.6	+	5	1153	c.467G>C	c.(466-468)aGc>aCc	p.S156T	EED_ENST00000528180.1_Missense_Mutation_p.S156T|EED_ENST00000351625.6_Missense_Mutation_p.S156T|EED_ENST00000327320.4_Missense_Mutation_p.S156T	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	156	Interaction with EZH2. {ECO:0000250}.|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				ACCTATGATAGCAATACGAGC	0.353																																						ENST00000263360.6	1.000000	0.660000	1.000000	0.760000	0.880000	0.882042	0.880000	1.000000																										0				21						c.(466-468)aGc>aCc		embryonic ectoderm development							101.0	100.0	100.0					11																	85967469		2202	4299	6501	SO:0001583	missense	8726	0	0					g.chr11:85967469G>C	AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.467G>C	chr11.hg19:g.85967469G>C	ENSP00000263360:p.Ser156Thr	1					EED_ENST00000528180.1_Missense_Mutation_p.S156T|EED_ENST00000327320.4_Missense_Mutation_p.S156T|EED_ENST00000351625.6_Missense_Mutation_p.S156T	p.S156T	NM_003797.3	NP_003788.2	0	3	3	2.101542	O75530	EED_HUMAN		5	1153	+		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	ENST00000263360.6	1	1	hg19	c.467G>C	CCDS8273.1	1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582457	0.28180	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.59	5.59	0.84812	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.087878	0.85682	D	0.000000	T	0.15825	0.0381	N	0.02802	-0.49	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.15235	-1.0444	9	.	.	.	-11.6578	19.5799	0.95461	0.0:0.0:1.0:0.0	.	156;156;156;156	O75530-3;E9PJK2;O75530-2;O75530	.;.;.;EED_HUMAN	T	156	ENSP00000263360:S156T;ENSP00000431778:S156T;ENSP00000338186:S156T;ENSP00000315587:S156T	.	S	+	2	0	0	EED	85645117	85645117	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.041000	0.70988	2.606000	0.88127	0.585000	0.79938	AGC	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.353	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	2.800000	-19.685700	1	0.360000	NM_003797		0	45	43	0	288	279	1		1	1		0	0	37	0	0	1.000000	9.958223e-01	0	15	0	41	0	45	288
ESAM	90952	broad.mit.edu	37	11	124623837	124623837	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr11:124623837C>T	ENST00000278927.5	-	7	1007	c.878G>A	c.(877-879)cGg>cAg	p.R293Q	VSIG2_ENST00000326621.5_5'Flank|VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	293					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		GGGCAGGGTCCGGGGAGCAAT	0.567																																						ENST00000278927.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999995	0.990000	1.000000																										0				16						c.(877-879)cGg>cAg		endothelial cell adhesion molecule							50.0	60.0	57.0					11																	124623837		2201	4299	6500	SO:0001583	missense	90952	3	121408	34				g.chr11:124623837C>T	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.878G>A	chr11.hg19:g.124623837C>T	ENSP00000278927:p.Arg293Gln	1					ESAM_ENST00000442070.2_Intron|VSIG2_ENST00000403470.1_5'Flank|VSIG2_ENST00000326621.5_5'Flank	p.R293Q	NM_138961.2	NP_620411.2	0	3	3	2.101542	Q96AP7	ESAM_HUMAN		7	1007	-	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	B4DVN8|Q96T50	Missense_Mutation	SNP	ENST00000278927.5	1	1	hg19	c.878G>A	CCDS8453.1	1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074636	0.76415	.	.	ENSG00000149564	ENST00000278927	T	0.31510	1.49	5.28	3.37	0.38596	5.28	3.37	0.38596	.	0.354761	0.28730	N	0.014326	T	0.36936	0.0985	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	P	0.59115	0.852	T	0.08330	-1.0727	10	0.21014	T	0.42	.	7.9712	0.30127	0.0:0.6063:0.3104:0.0832	.	293	Q96AP7	ESAM_HUMAN	Q	293	ENSP00000278927:R293Q	ENSP00000278927:R293Q	R	-	2	0	0	ESAM	124129047	124129047	1.000000	0.71417	0.998000	0.56505	0.851000	0.48451	1.757000	0.38400	0.683000	0.31428	-0.176000	0.13171	CGG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.567	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	1	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	2.800000	-4.781374	1	0.360000	NM_138961		0	39	37	0	105	102	1		1	1		0	0	40	0	0	1.000000	1	0	7	0	157	0	39	105
NTF3	4908	broad.mit.edu	37	12	5603687	5603687	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr12:5603687C>T	ENST00000331010.6	+	1	390	c.307C>T	c.(307-309)Cgg>Tgg	p.R103W	NTF3_ENST00000423158.3_Missense_Mutation_p.R116W|NTF3_ENST00000535299.1_Intron	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	103					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						CAACTCACCGCGGGTCCTGCT	0.642																																					GBM(194;1104 2182 8339 9578 18493)	ENST00000331010.6	1.000000	0.730000	1.000000	0.840000	0.970000	0.938563	0.970000	1.000000																										0				22						c.(307-309)Cgg>Tgg		neurotrophin 3							53.0	58.0	56.0					12																	5603687		2203	4300	6503	SO:0001583	missense	4908	0	0					g.chr12:5603687C>T		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.307C>T	chr12.hg19:g.5603687C>T	ENSP00000328738:p.Arg103Trp	1					NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.R116W	p.R103W	NM_002527.4	NP_002518.1	2	6	8	2.212491	P20783	NTF3_HUMAN		1	390	+			B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	1	1	hg19	c.307C>T	CCDS8538.1	1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403819	0.62288	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.48201	0.82;0.82	5.52	3.64	0.41730	5.52	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.72526	0.3471	M	0.89904	3.07	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.77156	-0.2691	10	0.72032	D	0.01	-12.4294	12.7492	0.57298	0.4323:0.5677:0.0:0.0	.	103;116	P20783;B7Z1T5	NTF3_HUMAN;.	W	116;103	ENSP00000397297:R116W;ENSP00000328738:R103W	ENSP00000328738:R103W	R	+	1	2	2	NTF3	5473948	5473948	0.915000	0.31059	1.000000	0.80357	0.992000	0.81027	1.904000	0.39868	0.660000	0.30964	0.591000	0.81541	CGG	0.496063		TCGA-IB-7890-01A-12D-2201-08	0.642	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1	1	0	1	2	2	2	2	0	0	0	0	102	102	102	100	1	2.800000	-20.000000	1	0.360000			0	56	54	0	363	359	1		1	0		0	0	102	0	0	1.000000	3.987962e-01	0	0	0	10	0	56	363
LPCAT3	10162	broad.mit.edu	37	12	7091020	7091020	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr12:7091020C>A	ENST00000261407.4	-	4	497	c.412G>T	c.(412-414)Gat>Tat	p.D138Y	U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'Flank	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	138					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						CACTTGATATCGTAGTTGCCG	0.473																																						ENST00000261407.4	1.000000	0.080000	1.000000	0.130000	0.190000	0.331733	0.190000	0.170000																										0				17						c.(412-414)Gat>Tat		lysophosphatidylcholine acyltransferase 3							173.0	142.0	152.0					12																	7091020		2203	4300	6503	SO:0001583	missense	10162	0	0					g.chr12:7091020C>A	U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.412G>T	chr12.hg19:g.7091020C>A	ENSP00000261407:p.Asp138Tyr	1					U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'Flank	p.D138Y	NM_005768.5	NP_005759.4	2	6	8	2.212491	Q6P1A2	MBOA5_HUMAN		4	497	-			B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	ENST00000261407.4	0	1	hg19	c.412G>T	CCDS8572.1	0	.	.	.	.	.	.	.	.	.	.	C	11.65	1.700633	0.30142	.	.	ENSG00000111684	ENST00000261407	T	0.73897	-0.79	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.86900	0.6044	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87121	0.2191	10	0.56958	D	0.05	-20.8345	19.1925	0.93672	0.0:1.0:0.0:0.0	.	138	Q6P1A2	MBOA5_HUMAN	Y	138	ENSP00000261407:D138Y	ENSP00000261407:D138Y	D	-	1	0	0	LPCAT3	6961281	6961281	1.000000	0.71417	0.998000	0.56505	0.895000	0.52256	7.320000	0.79064	2.767000	0.95098	0.655000	0.94253	GAT	0.496063		TCGA-IB-7890-01A-12D-2201-08	0.473	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1	0	0	1	2	20	7	2	1	1	1	1	68	68	68	66	1	2.800000	-3.304375	1	0.360000	NM_005768		0	10	10	0	405	399	0		0	0		1	0	68	0	0	0.041894	1.882812e-02	0	4	0	86	0	10	405
KRAS	3845	broad.mit.edu	37	12	25380276	25380276	+	Missense_Mutation	SNP	T	T	C	rs121913240		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr12:25380276T>C	ENST00000256078.4	-	3	245	c.182A>G	c.(181-183)cAa>cGa	p.Q61R	KRAS_ENST00000311936.3_Missense_Mutation_p.Q61R|KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61L(73)|p.Q61R(56)|p.Q61P(12)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GTACTCCTCTTGACCTGCTGT	0.418	Q61L(NCIH650_LUNG)|Q61L(SW948_LARGE_INTESTINE)|Q61R(PANC0213_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	Q61L(NCIH650_LUNG)|Q61L(SW948_LARGE_INTESTINE)|Q61R(PANC0213_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	141	Substitution - Missense(141)	p.Q61L(73)|p.Q61R(56)|p.Q61P(12)	large_intestine(63)|lung(27)|thyroid(14)|haematopoietic_and_lymphoid_tissue(9)|pancreas(6)|skin(5)|stomach(3)|cervix(3)|upper_aerodigestive_tract(2)|soft_tissue(1)|central_nervous_system(1)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|gastrointestinal_tract_(site_indeterminate)(1)|breast(1)|prostate(1)|kidney(1)	25349						c.(181-183)cAa>cGa		Kirsten rat sarcoma viral oncogene homolog							109.0	97.0	101.0					12																	25380276		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25380276T>C	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.182A>G	chr12.hg19:g.25380276T>C	ENSP00000256078:p.Gln61Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61R	p.Q61R	NM_033360.2	NP_203524.1	3	4	7	2.408262	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	3	245	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.182A>G	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.022613	0.75275	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.83673	-1.75;-1.75	5.77	5.77	0.91146	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.88358	0.6415	M	0.92367	3.3	0.80722	D	1	B;B	0.26744	0.158;0.026	B;B	0.32805	0.135;0.153	D	0.87885	0.2680	10	0.66056	D	0.02	.	15.5753	0.76373	0.0:0.0:0.0:1.0	.	61;61	P01116-2;P01116	.;RASK_HUMAN	R	61	ENSP00000308495:Q61R;ENSP00000256078:Q61R	ENSP00000256078:Q61R	Q	-	2	0	0	KRAS	25271543	25271543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.983000	0.88140	2.326000	0.78906	0.533000	0.62120	CAA	0.535559		TCGA-IB-7890-01A-12D-2201-08	0.418	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	2.800000	-20.000000	1	0.360000	NM_033360		2290	131	130	5741	305	300	1	1	1	1	1	0	0	53	889	1	1.000000	1	1	13	238	56	705	131	305
PUS7L	83448	broad.mit.edu	37	12	44142334	44142334	+	Missense_Mutation	SNP	G	G	A	rs143739935	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr12:44142334G>A	ENST00000416848.2	-	3	1477	c.989C>T	c.(988-990)tCg>tTg	p.S330L	PUS7L_ENST00000553166.1_Missense_Mutation_p.S330L|PUS7L_ENST00000344862.5_Missense_Mutation_p.S330L|PUS7L_ENST00000431332.3_Missense_Mutation_p.S17L|PUS7L_ENST00000551923.1_Missense_Mutation_p.S330L	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	330					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		ACTAAAATCCGAAGGAATAAC	0.348													G|||	3	0.000599042	0.0	0.0	5008	,	,		16227	0.0		0.003	False		,,,				2504	0.0					ENST00000416848.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				32						c.(988-990)tCg>tTg		pseudouridylate synthase 7 homolog (S. cerevisiae)-like		G	LEU/SER,LEU/SER,LEU/SER	0,4404		0,0,2202	117.0	117.0	117.0		989,989,989	4.9	1.0	12	dbSNP_134	117	20,8580	14.6+/-50.1	0,20,4280	yes	missense,missense,missense	PUS7L	NM_001098614.1,NM_001098615.1,NM_031292.3	145,145,145	0,20,6482	AA,AG,GG		0.2326,0.0,0.1538	probably-damaging,probably-damaging,probably-damaging	330/702,330/702,330/702	44142334	20,12984	2202	4300	6502	SO:0001583	missense	83448	215	121406	56				g.chr12:44142334G>A	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.989C>T	chr12.hg19:g.44142334G>A	ENSP00000415899:p.Ser330Leu	1					PUS7L_ENST00000553166.1_Missense_Mutation_p.S330L|PUS7L_ENST00000551923.1_Missense_Mutation_p.S330L|PUS7L_ENST00000431332.3_Missense_Mutation_p.S17L|PUS7L_ENST00000344862.5_Missense_Mutation_p.S330L	p.S330L	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	0	3	3	1.882622	Q9H0K6	PUS7L_HUMAN		3	1477	-	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	1	0	hg19	c.989C>T	CCDS8743.1	1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	25.6	4.658329	0.88154	0.0	0.002326	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000431332;ENST00000550784;ENST00000547156;ENST00000553166	T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93	4.86	4.86	0.63082	4.86	4.86	0.63082	Pseudouridine synthase, catalytic domain (1);	0.135257	0.52532	D	0.000074	T	0.66858	0.2832	M	0.79693	2.465	0.58432	D	0.999999	D	0.89917	1.0	D	0.69142	0.962	T	0.70051	-0.4978	10	0.52906	T	0.07	-1.7808	18.8708	0.92313	0.0:0.0:1.0:0.0	.	330	Q9H0K6	PUS7L_HUMAN	L	330;330;330;17;17;17;330	ENSP00000415899:S330L;ENSP00000343081:S330L;ENSP00000447706:S330L;ENSP00000398497:S17L;ENSP00000449222:S17L;ENSP00000450341:S17L;ENSP00000446865:S330L	ENSP00000343081:S330L	S	-	2	0	0	PUS7L	42428601	42428601	1.000000	0.71417	0.980000	0.43619	0.983000	0.72400	7.429000	0.80309	2.612000	0.88384	0.563000	0.77884	TCG	0.434329		TCGA-IB-7890-01A-12D-2201-08	0.348	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	0	0	1	2	2	2	2	0	0	0	0	101	101	101	101	1	2.800000	-2.578431	1	0.360000	NM_031292		0	163	162	0	281	278	1		1	0		0	0	101	0	0	1.000000	7.930302e-01	0	1	0	6	0	163	281
GIT2	9815	broad.mit.edu	37	12	110390957	110390957	+	Silent	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr12:110390957G>A	ENST00000355312.3	-	13	1181	c.1182C>T	c.(1180-1182)agC>agT	p.S394S	GIT2_ENST00000457474.2_Silent_p.S396S|GIT2_ENST00000354574.4_Silent_p.S396S|GIT2_ENST00000547815.1_Silent_p.S394S|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000338373.5_Silent_p.S394S|GIT2_ENST00000343646.5_Intron|GIT2_ENST00000361006.5_Silent_p.S394S|GIT2_ENST00000551209.1_Silent_p.S393S|GIT2_ENST00000360185.4_Silent_p.S394S|GIT2_ENST00000356259.4_Silent_p.S394S|GIT2_ENST00000320063.9_Silent_p.S394S|GIT2_ENST00000553118.1_Silent_p.S394S	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	394					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						CTGATGCCACGCTGTCATAGT	0.488																																						ENST00000355312.3	1.000000	0.060000	1.000000	0.090000	0.150000	0.307514	0.150000	0.130000																										0				27						c.(1180-1182)agC>agT		G protein-coupled receptor kinase interacting ArfGAP 2							259.0	205.0	223.0					12																	110390957		2203	4300	6503	SO:0001819	synonymous_variant	9815	5	121412	38				g.chr12:110390957G>A	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1182C>T	chr12.hg19:g.110390957G>A		1					GIT2_ENST00000551209.1_Silent_p.S393S|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000356259.4_Silent_p.S394S|GIT2_ENST00000338373.5_Silent_p.S394S|GIT2_ENST00000360185.4_Silent_p.S394S|GIT2_ENST00000343646.5_Intron|GIT2_ENST00000354574.4_Silent_p.S396S|GIT2_ENST00000553118.1_Silent_p.S394S|GIT2_ENST00000547815.1_Silent_p.S394S|GIT2_ENST00000320063.9_Silent_p.S394S|GIT2_ENST00000361006.5_Silent_p.S394S|GIT2_ENST00000457474.2_Silent_p.S396S	p.S394S	NM_057169.3	NP_476510.1	0	3	3	1.882622	Q14161	GIT2_HUMAN		13	1181	-			Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Silent	SNP	ENST00000355312.3	0	1	hg19	c.1182C>T	CCDS9138.1	0																																																																																								0.434329		TCGA-IB-7890-01A-12D-2201-08	0.488	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	0	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	2.800000	-3.105365	1	0.360000	NM_057169		0	8	8	0	376	374	0		1	0		0	0	74	0	0	0.989317	3.460154e-01	0	0	0	53	0	8	376
LCP1	3936	broad.mit.edu	37	13	46701838	46701838	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr13:46701838C>T	ENST00000398576.2	-	19	2160	c.1772G>A	c.(1771-1773)cGa>cAa	p.R591Q	LCP1_ENST00000323076.2_Missense_Mutation_p.R591Q|LCP1_ENST00000435666.2_Missense_Mutation_p.R160Q			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	591	Actin-binding 2.|CH 4. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TCCAATTTTTCGGGCCATAGA	0.488			T	BCL6	NHL																																	ENST00000398576.2	1.000000	0.700000	0.950000	0.780000	0.860000	0.869744	0.860000	1.000000				Dom	yes			Dom	yes		13	13q14.1-q14.3	13q14.1-q14.3	3936	T	lymphocyte cytosolic protein 1 (L-plastin)				L	L	BCL6		NHL		0				34						c.(1771-1773)cGa>cAa		lymphocyte cytosolic protein 1 (L-plastin)							153.0	148.0	150.0					13																	46701838		2203	4300	6503	SO:0001583	missense	3936	0	0					g.chr13:46701838C>T	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1772G>A	chr13.hg19:g.46701838C>T	ENSP00000381581:p.Arg591Gln	1					LCP1_ENST00000435666.2_Missense_Mutation_p.R160Q|LCP1_ENST00000323076.2_Missense_Mutation_p.R591Q	p.R591Q			1	2	3	2.045309	P13796	PLSL_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	19	2160	-		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	1	1	hg19	c.1772G>A	CCDS9403.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.769574	0.96914	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000435666	D;D;D	0.94650	-3.48;-3.48;-3.48	5.54	5.54	0.83059	5.54	5.54	0.83059	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97823	0.9285	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.986;0.996	D	0.98204	1.0469	10	0.66056	D	0.02	-8.2981	18.8301	0.92135	0.0:1.0:0.0:0.0	.	160;591	B4DUA0;P13796	.;PLSL_HUMAN	Q	591;591;160	ENSP00000315757:R591Q;ENSP00000381581:R591Q;ENSP00000405134:R160Q	ENSP00000315757:R591Q	R	-	2	0	0	LCP1	45599839	45599839	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.776000	0.85560	2.764000	0.94973	0.655000	0.94253	CGA	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.488	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	1	0	1	2	2	2	2	0	0	0	0	147	147	147	147	1	2.800000	-3.142703	1	0.360000	NM_002298		0	93	93	0	610	588	1		1	0		0	0	147	0	0	1.000000	9.999994e-01	0	0	0	132	0	93	610
TMTC4	84899	broad.mit.edu	37	13	101289837	101289837	+	Silent	SNP	G	G	A	rs529835816		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr13:101289837G>A	ENST00000376234.3	-	8	1086	c.897C>T	c.(895-897)acC>acT	p.T299T	TMTC4_ENST00000342624.5_Silent_p.T318T|TMTC4_ENST00000328767.5_Silent_p.T188T|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	299						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTCCACCTCGGTGAAGGCCG	0.642																																						ENST00000376234.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				34						c.(895-897)acC>acT		transmembrane and tetratricopeptide repeat containing 4							62.0	68.0	66.0					13																	101289837		2203	4300	6503	SO:0001819	synonymous_variant	84899	5	121410	39				g.chr13:101289837G>A		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.897C>T	chr13.hg19:g.101289837G>A		1					TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Silent_p.T188T|TMTC4_ENST00000342624.5_Silent_p.T318T	p.T299T	NM_001079669.1	NP_001073137.1	1	2	3	2.045309	Q5T4D3	TMTC4_HUMAN		8	1086	-	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	ENST00000376234.3	1	1	hg19	c.897C>T	CCDS41904.1	1																																																																																								0.457627		TCGA-IB-7890-01A-12D-2201-08	0.642	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	1	0	1	2	2	2	2	0	0	0	0	137	137	137	135	1	2.800000	-12.041230	1	0.360000	NM_032813		0	167	164	0	371	364	1		1	1		0	0	137	0	0	1.000000	9.584764e-01	0	2	0	12	0	167	371
SLC8A3	6547	broad.mit.edu	37	14	70634760	70634760	+	Missense_Mutation	SNP	C	C	T	rs201527251		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr14:70634760C>T	ENST00000381269.2	-	2	1133	c.380G>A	c.(379-381)cGg>cAg	p.R127Q	SLC8A3_ENST00000357887.3_Missense_Mutation_p.R127Q|SLC8A3_ENST00000356921.2_Missense_Mutation_p.R127Q|SLC8A3_ENST00000528359.1_Missense_Mutation_p.R127Q|SLC8A3_ENST00000534137.1_Missense_Mutation_p.R127Q	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	127					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATTCCAGACCCGAATAGTGGT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		22443	0.001		0.0	False		,,,				2504	0.0					ENST00000381269.2	1.000000	0.690000	1.000000	0.790000	0.910000	0.902066	0.910000	1.000000																										0				54						c.(379-381)cGg>cAg		solute carrier family 8 (sodium/calcium exchanger), member 3							109.0	97.0	101.0					14																	70634760		2203	4300	6503	SO:0001583	missense	6547	1	121412	38				g.chr14:70634760C>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.380G>A	chr14.hg19:g.70634760C>T	ENSP00000370669:p.Arg127Gln	1					SLC8A3_ENST00000356921.2_Missense_Mutation_p.R127Q|SLC8A3_ENST00000528359.1_Missense_Mutation_p.R127Q|SLC8A3_ENST00000357887.3_Missense_Mutation_p.R127Q|SLC8A3_ENST00000534137.1_Missense_Mutation_p.R127Q	p.R127Q	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	1	2	3	2.059402	P57103	NAC3_HUMAN		2	1133	-			Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	1	1	hg19	c.380G>A	CCDS35498.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	20.9	4.070178	0.76301	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	5.48	5.48	0.80851	5.48	5.48	0.80851	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.84243	0.5429	M	0.91663	3.23	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.997;0.998;0.993;0.993	D	0.87094	0.2174	10	0.62326	D	0.03	.	19.3613	0.94440	0.0:1.0:0.0:0.0	.	127;127;127;127	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	Q	127	ENSP00000349392:R127Q;ENSP00000370669:R127Q;ENSP00000350560:R127Q;ENSP00000436688:R127Q;ENSP00000433531:R127Q	ENSP00000349392:R127Q	R	-	2	0	0	SLC8A3	69704513	69704513	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	7.811000	0.86092	2.573000	0.86826	0.650000	0.86243	CGG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.483	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1	1	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	2.800000	-2.599474	1	0.360000			0	48	46	0	297	292	1		1	0		0	0	85	0	0	1.000000	9.933579e-02	0	0	0	4	0	48	297
SERPINA3	12	broad.mit.edu	37	14	95080911	95080911	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr14:95080911G>A	ENST00000467132.1	+	2	1281	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393078.3_Missense_Mutation_p.V45M|SERPINA3_ENST00000393080.4_Missense_Mutation_p.V45M			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	45					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V45M(1)		NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		AGGGACACACGTGGACCTCGG	0.572																																						ENST00000467132.1	1.000000	0.860000	1.000000	0.940000	0.990000	0.980263	0.990000	1.000000																										1	Substitution - Missense(1)	p.V45M(1)	central_nervous_system(1)	40						c.(133-135)Gtg>Atg		serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3							121.0	118.0	119.0					14																	95080911		2203	4300	6503	SO:0001583	missense	12	5	121412	39				g.chr14:95080911G>A	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.133G>A	chr14.hg19:g.95080911G>A	ENSP00000450540:p.Val45Met	1					RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393078.3_Missense_Mutation_p.V45M|SERPINA3_ENST00000393080.4_Missense_Mutation_p.V45M	p.V45M			1	2	3	2.059402	P01011	AACT_HUMAN		2	1281	+		all_cancers(154;0.0525)|all_epithelial(191;0.179)	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	1	1	hg19	c.133G>A	CCDS32150.1	1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404725	0.42613	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132;ENST00000380354	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	4.68	-0.036	0.13890	4.68	-0.036	0.13890	Serpin domain (1);	1.940150	0.03623	U	0.236685	T	0.81418	0.4818	N	0.19112	0.55	0.09310	N	1	D;P	0.53885	0.963;0.661	B;B	0.43809	0.432;0.154	T	0.72527	-0.4266	10	0.72032	D	0.01	.	10.9606	0.47383	0.0825:0.5309:0.3866:0.0	.	45;70	P01011;G3V5I3	AACT_HUMAN;.	M	70;45;45;45;45;45	ENSP00000452367:V70M;ENSP00000376793:V45M;ENSP00000376795:V45M;ENSP00000450540:V45M	ENSP00000369712:V45M	V	+	1	0	0	SERPINA3	94150664	94150664	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.456000	0.06754	0.073000	0.16731	0.561000	0.74099	GTG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.572	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	1	0	1	2	2	2	2	0	0	0	0	193	193	193	192	1	2.800000	-20.000000	1	0.360000	NM_001085		0	118	115	0	632	617	1		1	1		0	0	193	0	0	1.000000	9.998222e-01	0	19	0	49	0	118	632
EPB42	2038	broad.mit.edu	37	15	43499591	43499591	+	Missense_Mutation	SNP	G	G	A	rs115972761	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr15:43499591G>A	ENST00000441366.2	-	9	1349	c.1124C>T	c.(1123-1125)aCg>aTg	p.T375M	EPB42_ENST00000540029.1_Missense_Mutation_p.T297M|EPB42_ENST00000563128.1_5'Flank|EPB42_ENST00000300215.3_Missense_Mutation_p.T405M	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	375					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		CAGCCCCAGCGTCCCCTCCTT	0.582													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15600	0.0		0.0	False		,,,				2504	0.0					ENST00000441366.2	1.000000	0.930000	1.000000	0.990000	0.990000	0.996392	0.990000	1.000000																										0				20						c.(1123-1125)aCg>aTg		erythrocyte membrane protein band 4.2							66.0	53.0	58.0					15																	43499591		2203	4299	6502	SO:0001583	missense	2038	18	121412	43				g.chr15:43499591G>A	M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.1124C>T	chr15.hg19:g.43499591G>A	ENSP00000396616:p.Thr375Met	1					EPB42_ENST00000540029.1_Missense_Mutation_p.T297M|EPB42_ENST00000563128.1_5'Flank|EPB42_ENST00000300215.3_Missense_Mutation_p.T405M	p.T375M	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	0	2	2	1.793594	P16452	EPB42_HUMAN		9	1349	-		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	1	1	hg19	c.1124C>T	CCDS45249.1	1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	7.005	0.555666	0.13436	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366	T;T;T	0.51071	0.72;0.72;0.72	6.02	-12.0	0.00017	6.02	-12.0	0.00017	.	1.311570	0.04307	N	0.348294	T	0.28333	0.0700	L	0.51422	1.61	0.09310	N	1	B;B;B;B	0.27823	0.029;0.068;0.19;0.068	B;B;B;B	0.16289	0.005;0.006;0.015;0.006	T	0.08330	-1.0727	10	0.38643	T	0.18	4.7421	1.2729	0.02025	0.4301:0.1641:0.1298:0.276	.	297;375;405;375	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	M	405;297;375	ENSP00000300215:T405M;ENSP00000444699:T297M;ENSP00000396616:T375M	ENSP00000300215:T405M	T	-	2	0	0	EPB42	41286883	41286883	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-1.186000	0.03070	-2.622000	0.00439	-0.769000	0.03391	ACG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.582	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	62	1	2.800000	-20.000000	1	0.360000	NM_000119		0	47	46	0	165	159	1		1			0	0	63	0	0	1.000000	0	0	0	0	0	0	47	165
CORO2B	10391	broad.mit.edu	37	15	68937512	68937512	+	Missense_Mutation	SNP	C	C	T	rs371239183		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr15:68937512C>T	ENST00000566799.1	+	2	58	c.29C>T	c.(28-30)cCg>cTg	p.P10L	CORO2B_ENST00000540068.1_Missense_Mutation_p.P5L|CORO2B_ENST00000261861.5_Missense_Mutation_p.P5L|CORO2B_ENST00000543950.1_Missense_Mutation_p.P5L			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	10					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						TCCTGGCGTCCGCAATACCGT	0.622																																						ENST00000566799.1	1.000000	0.550000	1.000000	0.690000	0.860000	0.853216	0.860000	1.000000																										0				36						c.(28-30)cCg>cTg		coronin, actin binding protein, 2B		C	LEU/PRO,LEU/PRO,LEU/PRO	0,4400		0,0,2200	67.0	59.0	61.0		14,14,29	4.4	1.0	15		61	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense	CORO2B	NM_001190456.1,NM_001190457.1,NM_006091.4	98,98,98	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	5/476,5/476,10/481	68937512	1,12995	2200	4298	6498	SO:0001583	missense	10391	5	121412	36				g.chr15:68937512C>T	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.29C>T	chr15.hg19:g.68937512C>T	ENSP00000454783:p.Pro10Leu	1					CORO2B_ENST00000543950.1_Missense_Mutation_p.P5L|CORO2B_ENST00000261861.5_Missense_Mutation_p.P5L|CORO2B_ENST00000540068.1_Missense_Mutation_p.P5L	p.P10L			0	2	2	1.793594	Q9UQ03	COR2B_HUMAN		2	58	+			A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	1	1	hg19	c.29C>T	CCDS10229.2	1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518852	0.85495	0.0	1.16E-4	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.56941	0.43;0.43	4.38	4.38	0.52667	4.38	4.38	0.52667	.	0.053861	0.85682	D	0.000000	T	0.66147	0.2760	M	0.66939	2.045	0.80722	D	1	P	0.52170	0.951	P	0.57371	0.819	T	0.69394	-0.5157	10	0.51188	T	0.08	-21.1529	15.8812	0.79207	0.0:1.0:0.0:0.0	.	10	Q9UQ03	COR2B_HUMAN	L	10;5;5	ENSP00000446250:P5L;ENSP00000443819:P5L	ENSP00000261861:P10L	P	+	2	0	0	CORO2B	66724566	66724566	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	7.565000	0.82337	2.142000	0.66516	0.563000	0.77884	CCG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.622	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	2.800000	-20.000000	1	0.360000	NM_006091		0	19	19	0	103	98	1		1	0		0	0	60	0	0	0.999992	0	0	0	0	1	0	19	103
CELF6	60677	broad.mit.edu	37	15	72579635	72579635	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr15:72579635G>A	ENST00000569547.1	-	12	1488	c.1417C>T	c.(1417-1419)Cgg>Tgg	p.R473W	CELF6_ENST00000569311.1_5'Flank|CELF6_ENST00000567083.1_Missense_Mutation_p.R446W|CELF6_ENST00000395258.2_Missense_Mutation_p.R360W|CELF6_ENST00000539635.1_Missense_Mutation_p.R334W|CELF6_ENST00000543764.2_Missense_Mutation_p.R336W|RP11-106M3.2_ENST00000379915.4_RNA|CELF6_ENST00000287202.5_Missense_Mutation_p.R473W|RP11-106M3.3_ENST00000570175.1_RNA			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	473	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						TCCTTGGGCCGCTTTAGCTGG	0.517																																						ENST00000569547.1	1.000000	0.880000	1.000000	0.980000	0.990000	0.989997	0.990000	1.000000																										0				13						c.(1417-1419)Cgg>Tgg		CUGBP, Elav-like family member 6							137.0	127.0	130.0					15																	72579635		2199	4297	6496	SO:0001583	missense	60677	0	0					g.chr15:72579635G>A	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.1417C>T	chr15.hg19:g.72579635G>A	ENSP00000454749:p.Arg473Trp	1					CELF6_ENST00000569311.1_5'Flank|RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000395258.2_Missense_Mutation_p.R360W|CELF6_ENST00000567083.1_Missense_Mutation_p.R446W|CELF6_ENST00000539635.1_Missense_Mutation_p.R334W|CELF6_ENST00000287202.5_Missense_Mutation_p.R473W|CELF6_ENST00000543764.2_Missense_Mutation_p.R336W	p.R473W			0	2	2	1.793594	Q96J87	CELF6_HUMAN		12	1488	-			B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	ENST00000569547.1	1	1	hg19	c.1417C>T	CCDS10242.1	1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234720	0.58886	.	.	ENSG00000140488	ENST00000287202;ENST00000437872;ENST00000543764;ENST00000379915;ENST00000395258;ENST00000539635	T;T;T;T	0.06449	3.3;3.3;3.3;3.3	5.79	-1.42	0.08913	5.79	-1.42	0.08913	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.64402	U	0.000006	T	0.23492	0.0568	M	0.77103	2.36	0.53005	D	0.999967	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;D;D	0.91635	0.998;0.993;0.985;0.967;0.999	T	0.27226	-1.0080	10	0.87932	D	0	-14.4833	16.9829	0.86333	0.0:0.0:0.6119:0.3881	.	446;336;360;334;473	B4DJB6;B4DG28;Q96J87-2;B3KWE6;Q96J87	.;.;.;.;CELF6_HUMAN	W	473;446;336;297;360;334	ENSP00000287202:R473W;ENSP00000439956:R336W;ENSP00000378677:R360W;ENSP00000443162:R334W	ENSP00000287202:R473W	R	-	1	2	2	CELF6	70366689	70366689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.311000	0.33562	0.107000	0.17824	0.561000	0.74099	CGG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.517	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	1	0	1	2	2	2	2	0	0	0	0	112	112	112	110	1	2.800000	-3.611022	1	0.360000	NM_052840		0	75	75	0	303	295	1		1	0		0	0	112	0	0	1.000000	1.816005e-01	0	0	0	4	0	75	303
TMC3	342125	broad.mit.edu	37	15	81654605	81654605	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr15:81654605A>G	ENST00000359440.5	-	4	485	c.350T>C	c.(349-351)gTg>gCg	p.V117A	RP11-761I4.3_ENST00000560851.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.V117A|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						GAAGATGACCACAAAGTTACA	0.478																																						ENST00000359440.5	0.530000	0.110000	0.410000	0.180000	0.280000	0.304238	0.280000	0.260000																										0				34						c.(349-351)gTg>gCg		transmembrane channel-like 3							87.0	83.0	85.0					15																	81654605		1973	4155	6128	SO:0001583	missense	342125	0	0					g.chr15:81654605A>G	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.350T>C	chr15.hg19:g.81654605A>G	ENSP00000352413:p.Val117Ala	1					RP11-761I4.3_ENST00000559781.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.V117A|RP11-761I4.3_ENST00000560851.1_RNA	p.V117A	NM_001080532.1	NP_001074001.1	0	2	2	1.793594				4	485	-				Missense_Mutation	SNP	ENST00000359440.5	0	1	hg19	c.350T>C	CCDS45324.1	0	.	.	.	.	.	.	.	.	.	.	A	10.65	1.409904	0.25465	.	.	ENSG00000188869	ENST00000359440	T	0.63580	-0.05	5.26	4.15	0.48705	5.26	4.15	0.48705	.	0.183784	0.34268	N	0.004111	T	0.40448	0.1117	N	0.16743	0.435	0.30774	N	0.742708	B;B	0.14012	0.0;0.009	B;B	0.12156	0.002;0.007	T	0.33445	-0.9868	10	0.15066	T	0.55	-11.5679	7.9842	0.30202	0.8433:0.0:0.1567:0.0	.	117;117	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	A	117	ENSP00000352413:V117A	ENSP00000352413:V117A	V	-	2	0	0	TMC3	79441660	79441660	0.967000	0.33354	0.990000	0.47175	0.990000	0.78478	3.776000	0.55356	0.856000	0.35383	0.455000	0.32223	GTG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.478	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	2.800000	-9.698396	1	0.360000	NM_181841		0	6	6	0	118	112	0		1			0	0	22	0	0	0.960559	0	0	0	0	0	0	6	118
FURIN	5045	broad.mit.edu	37	15	91419516	91419516	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr15:91419516G>A	ENST00000268171.3	+	3	488	c.209G>A	c.(208-210)cGa>cAa	p.R70Q		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	70					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TTCTGGCATCGAGGAGTGACG	0.657																																						ENST00000268171.3	1.000000	0.720000	0.960000	0.790000	0.870000	0.876650	0.870000	1.000000																										0				36						c.(208-210)cGa>cAa		furin (paired basic amino acid cleaving enzyme)							77.0	84.0	82.0					15																	91419516		2198	4298	6496	SO:0001583	missense	5045	0	0					g.chr15:91419516G>A	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.209G>A	chr15.hg19:g.91419516G>A	ENSP00000268171:p.Arg70Gln	1						p.R70Q	NM_002569.2	NP_002560.1	0	2	2	1.793594	P09958	FURIN_HUMAN	Lung(145;0.189)	3	488	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		Q14336|Q6LBS3|Q9UCZ5	Missense_Mutation	SNP	ENST00000268171.3	1	1	hg19	c.209G>A	CCDS10364.1	1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441351	0.63067	.	.	ENSG00000140564	ENST00000268171	T	0.31510	1.49	4.58	4.58	0.56647	4.58	4.58	0.56647	Proteinase inhibitor, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	M	0.69248	2.105	0.58432	D	0.999998	D	0.59767	0.986	P	0.48738	0.588	T	0.45629	-0.9248	10	0.59425	D	0.04	-2.4622	15.8038	0.78477	0.0:0.0:1.0:0.0	.	70	P09958	FURIN_HUMAN	Q	70	ENSP00000268171:R70Q	ENSP00000268171:R70Q	R	+	2	0	0	FURIN	89220520	89220520	0.978000	0.34361	0.999000	0.59377	0.083000	0.17756	2.778000	0.47726	2.396000	0.81511	0.555000	0.69702	CGA	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.657	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	1	0	1	2	2	2	2	0	0	0	0	235	235	235	234	1	2.800000	-3.144086	1	0.360000	NM_002569		0	102	100	0	545	532	1		1	1		0	0	235	0	0	1.000000	1	0	43	0	159	0	102	545
RGMA	56963	broad.mit.edu	37	15	93588562	93588562	+	Missense_Mutation	SNP	C	C	T	rs200113920		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr15:93588562C>T	ENST00000329082.7	-	4	1290	c.1019G>A	c.(1018-1020)cGc>cAc	p.R340H	RGMA_ENST00000542321.2_Missense_Mutation_p.R324H|RGMA_ENST00000556658.1_Missense_Mutation_p.R231H|RGMA_ENST00000538818.1_Missense_Mutation_p.R231H|RGMA_ENST00000543599.1_Missense_Mutation_p.R324H|RGMA_ENST00000557420.1_3'UTR|RGMA_ENST00000557301.1_Missense_Mutation_p.R348H|RGMA_ENST00000425933.2_Missense_Mutation_p.R324H	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	340					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			TGCCAGCCTGCGGGCACCGGT	0.672																																						ENST00000329082.7	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				9						c.(1018-1020)cGc>cAc		repulsive guidance molecule family member a		C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,3970		0,0,1985	16.0	21.0	19.0		1043,971,971,971,971,1019	-1.0	0.0	15		19	5,8321		0,5,4158	no	missense,missense,missense,missense,missense,missense	RGMA	NM_001166283.1,NM_001166286.1,NM_001166287.1,NM_001166288.1,NM_001166289.1,NM_020211.2	29,29,29,29,29,29	0,5,6143	TT,TC,CC		0.0601,0.0,0.0407	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	348/459,324/435,324/435,324/435,324/435,340/451	93588562	5,12291	1985	4163	6148	SO:0001583	missense	56963	43	120770	45				g.chr15:93588562C>T	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.1019G>A	chr15.hg19:g.93588562C>T	ENSP00000330005:p.Arg340His	1					RGMA_ENST00000425933.2_Missense_Mutation_p.R324H|RGMA_ENST00000542321.2_Missense_Mutation_p.R324H|RGMA_ENST00000557301.1_Missense_Mutation_p.R348H|RGMA_ENST00000556658.1_Missense_Mutation_p.R231H|RGMA_ENST00000538818.1_Missense_Mutation_p.R231H|RGMA_ENST00000543599.1_Missense_Mutation_p.R324H|RGMA_ENST00000557420.1_3'UTR	p.R340H	NM_020211.2	NP_064596	0	2	2	1.793594	Q96B86	RGMA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)	4	1290	-	Lung NSC(78;0.0542)|all_lung(78;0.0786)		B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	1	1	hg19	c.1019G>A	CCDS45357.1	1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464028	0.26335	0.0	6.01E-4	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000538818;ENST00000557301	D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.82;-2.83;-2.44;-2.83	4.4	-0.978	0.10279	4.4	-0.978	0.10279	Repulsive guidance molecule, C-terminal (1);	0.646923	0.14204	N	0.334497	T	0.81138	0.4760	N	0.14661	0.345	0.09310	N	1	D;P	0.53151	0.958;0.952	P;P	0.49597	0.616;0.564	T	0.74038	-0.3793	10	0.11794	T	0.64	-24.0079	5.3558	0.16059	0.0:0.4763:0.1344:0.3894	.	348;340	G3V518;Q96B86	.;RGMA_HUMAN	H	324;324;340;324;231;348	ENSP00000442498:R324H;ENSP00000404442:R324H;ENSP00000330005:R340H;ENSP00000440025:R324H;ENSP00000442546:R231H;ENSP00000452126:R348H	ENSP00000330005:R340H	R	-	2	0	0	RGMA	91389566	91389566	0.004000	0.15560	0.003000	0.11579	0.011000	0.07611	0.075000	0.14686	-0.582000	0.05929	-0.658000	0.03865	CGC	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.672	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	2.800000	-3.221883	1	0.360000	NM_020211		0	36	33	0	44	44	1		1	0		0	0	39	0	0	1.000000	9.286910e-01	0	0	0	8	0	36	44
AXIN1	8312	broad.mit.edu	37	16	347159	347159	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr16:347159C>T	ENST00000262320.3	-	7	2223	c.1852G>A	c.(1852-1854)Gag>Aag	p.E618K	AXIN1_ENST00000481769.1_5'Flank|AXIN1_ENST00000354866.3_Missense_Mutation_p.E618K	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	618	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCTGGCACCTCGGTGCTGGCG	0.612																																						ENST00000262320.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				221						c.(1852-1854)Gag>Aag		axin 1							219.0	210.0	213.0					16																	347159		2203	4300	6503	SO:0001583	missense	8312	1	121412	36				g.chr16:347159C>T	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1852G>A	chr16.hg19:g.347159C>T	ENSP00000262320:p.Glu618Lys	1					AXIN1_ENST00000354866.3_Missense_Mutation_p.E618K|AXIN1_ENST00000481769.1_5'Flank	p.E618K	NM_003502.3	NP_003493.1	2	2	4	2.345296	O15169	AXIN1_HUMAN		7	2223	-		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	1	1	hg19	c.1852G>A	CCDS10405.1	1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676683	0.47886	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.60672	0.17;0.18	4.98	4.02	0.46733	4.98	4.02	0.46733	.	0.156231	0.56097	D	0.000026	T	0.45935	0.1367	M	0.61703	1.905	0.41038	D	0.985201	P;P	0.45715	0.865;0.494	B;B	0.28305	0.088;0.029	T	0.47873	-0.9083	10	0.25106	T	0.35	-1.1885	13.1589	0.59533	0.0:0.9217:0.0:0.0782	.	618;618	O15169-2;O15169	.;AXIN1_HUMAN	K	618	ENSP00000262320:E618K;ENSP00000346935:E618K	ENSP00000262320:E618K	E	-	1	0	0	AXIN1	287160	287160	0.510000	0.26171	0.287000	0.24848	0.008000	0.06430	1.583000	0.36579	1.088000	0.41272	0.478000	0.44815	GAG	0.523100		TCGA-IB-7890-01A-12D-2201-08	0.612	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3	1	0	1	2	2	2	2	0	0	0	0	400	400	400	398	1	2.800000	-20.000000	1	0.360000			0	350	337	0	1167	1147	1		1	1		0	0	400	0	0	1.000000	1	0	31	0	72	0	350	1167
BFAR	51283	broad.mit.edu	37	16	14749057	14749057	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr16:14749057G>C	ENST00000261658.2	+	5	1050	c.773G>C	c.(772-774)tGg>tCg	p.W258S	BFAR_ENST00000563971.1_Missense_Mutation_p.W133S|BFAR_ENST00000426842.2_Missense_Mutation_p.W130S	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	258					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CAGAATCTCTGGGAATATAAG	0.333																																						ENST00000261658.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				11						c.(772-774)tGg>tCg		bifunctional apoptosis regulator							48.0	52.0	51.0					16																	14749057		2197	4300	6497	SO:0001583	missense	51283	0	0					g.chr16:14749057G>C	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.773G>C	chr16.hg19:g.14749057G>C	ENSP00000261658:p.Trp258Ser	1					BFAR_ENST00000563971.1_Missense_Mutation_p.W133S|BFAR_ENST00000426842.2_Missense_Mutation_p.W130S	p.W258S	NM_016561.2	NP_057645.1	2	2	4	2.345296	Q9NZS9	BFAR_HUMAN		5	1050	+			A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	ENST00000261658.2	1	1	hg19	c.773G>C	CCDS10554.1	1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412066	0.62511	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.56776	2.77;0.44	4.86	4.86	0.63082	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.61937	0.2387	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.85130	0.99;0.997;0.997	T	0.67409	-0.5678	10	0.87932	D	0	.	16.9649	0.86283	0.0:0.0:1.0:0.0	.	130;258;258	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	S	258;130	ENSP00000261658:W258S;ENSP00000400634:W130S	ENSP00000261658:W258S	W	+	2	0	0	BFAR	14656558	14656558	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	9.561000	0.98142	2.239000	0.73571	0.313000	0.20887	TGG	0.523100		TCGA-IB-7890-01A-12D-2201-08	0.333	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	1	0	1	2	2	2	2	0	0	0	0	111	111	111	108	1	2.800000	-7.039860	1	0.360000	NM_016561		0	127	124	0	337	326	0		1	1		0	0	111	0	0	1.000000	1	0	131	0	99	0	127	337
ZFHX3	463	broad.mit.edu	37	16	72830417	72830417	+	Missense_Mutation	SNP	G	G	A	rs144401383		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr16:72830417G>A	ENST00000268489.5	-	9	6836	c.6164C>T	c.(6163-6165)cCg>cTg	p.P2055L	ZFHX3_ENST00000397992.5_Missense_Mutation_p.P1141L	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2055					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CGGCTGAGGCGGCGCTGCCGG	0.662																																						ENST00000268489.5	1.000000	0.710000	1.000000	0.820000	0.930000	0.921320	0.930000	1.000000																										0				153						c.(6163-6165)cCg>cTg		zinc finger homeobox 3		G	LEU/PRO,LEU/PRO	1,4389		0,1,2194	29.0	32.0	31.0		3422,6164	5.4	0.1	16	dbSNP_134	31	0,8582		0,0,4291	no	missense,missense	ZFHX3	NM_001164766.1,NM_006885.3	98,98	0,1,6485	AA,AG,GG		0.0,0.0228,0.0077	possibly-damaging,possibly-damaging	1141/2790,2055/3704	72830417	1,12971	2195	4291	6486	SO:0001583	missense	463	1	120878	24				g.chr16:72830417G>A	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6164C>T	chr16.hg19:g.72830417G>A	ENSP00000268489:p.Pro2055Leu	1					ZFHX3_ENST00000397992.5_Missense_Mutation_p.P1141L	p.P2055L	NM_006885.3	NP_008816.3	2	2	4	2.360506	Q15911	ZFHX3_HUMAN		9	6836	-		Ovarian(137;0.13)	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	1	1	hg19	c.6164C>T	CCDS10908.1	1	.	.	.	.	.	.	.	.	.	.	G	5.395	0.258120	0.10239	2.28E-4	0.0	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.74947	-0.89;-0.89	5.4	5.4	0.78164	5.4	5.4	0.78164	.	0.000000	0.46442	D	0.000284	T	0.73830	0.3637	L	0.46157	1.445	0.80722	D	1	D	0.57899	0.981	P	0.46685	0.524	T	0.73626	-0.3923	10	0.36615	T	0.2	.	18.7943	0.91988	0.0:0.0:1.0:0.0	.	2055	Q15911	ZFHX3_HUMAN	L	2055;1141	ENSP00000268489:P2055L;ENSP00000438926:P1141L	ENSP00000268489:P2055L	P	-	2	0	0	ZFHX3	71387918	71387918	1.000000	0.71417	0.099000	0.21106	0.103000	0.19146	7.142000	0.77339	2.523000	0.85059	0.655000	0.94253	CCG	0.528163		TCGA-IB-7890-01A-12D-2201-08	0.662	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	1	0	1	2	2	2	2	0	0	0	0	86	86	86	84	1	2.800000	-3.221892	1	0.360000	NM_006885		0	54	48	0	380	343	0		1	0		0	0	86	0	0	1.000000	1.616526e-02	0	1	0	1	0	54	380
SLC6A4	6532	broad.mit.edu	37	17	28537580	28537580	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:28537580C>A	ENST00000401766.2	-	10	1914	c.1402G>T	c.(1402-1404)Gcc>Tcc	p.A468S	SLC6A4_ENST00000261707.3_Missense_Mutation_p.A468S			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	468					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	ATGACCACGGCGAGCACGAAC	0.597																																						ENST00000401766.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				25						c.(1402-1404)Gcc>Tcc		solute carrier family 6 (neurotransmitter transporter), member 4	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)						112.0	98.0	103.0					17																	28537580		2203	4300	6503	SO:0001583	missense	6532	0	0					g.chr17:28537580C>A	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1402G>T	chr17.hg19:g.28537580C>A	ENSP00000385822:p.Ala468Ser	1					SLC6A4_ENST00000261707.3_Missense_Mutation_p.A468S	p.A468S			1	2	3	2.115199	P31645	SC6A4_HUMAN		10	1914	-			Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	1	1	hg19	c.1402G>T	CCDS11256.1	1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.248984	0.22880	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T	0.74632	-0.86;-0.86	6.04	-0.373	0.12516	6.04	-0.373	0.12516	.	0.664706	0.17075	N	0.188038	T	0.50786	0.1636	N	0.21324	0.655	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.22521	-1.0214	10	0.17369	T	0.5	.	3.284	0.06925	0.1179:0.3322:0.3805:0.1694	.	468	P31645	SC6A4_HUMAN	S	510;468;468	ENSP00000385822:A468S;ENSP00000261707:A468S	ENSP00000261707:A468S	A	-	1	0	0	SLC6A4	25561706	25561706	0.000000	0.05858	0.000000	0.03702	0.274000	0.26718	0.560000	0.23500	-0.236000	0.09753	0.561000	0.74099	GCC	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.597	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	1	0	1	2	2	2	2	0	0	0	0	114	114	114	112	1	2.800000	-15.033990	1	0.360000	NM_001045		0	166	165	0	332	327	1		1	0		0	0	114	0	0	1.000000	0	0	0	0	1	0	166	332
ATAD5	79915	broad.mit.edu	37	17	29167753	29167753	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:29167753C>G	ENST00000321990.4	+	4	2573	c.2195C>G	c.(2194-2196)tCt>tGt	p.S732C	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	732					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGGCGCTCCTCTAGACATCAG	0.348																																						ENST00000321990.4	1.000000	0.770000	1.000000	0.860000	0.960000	0.943385	0.960000	1.000000																										0				51						c.(2194-2196)tCt>tGt		ATPase family, AAA domain containing 5							87.0	92.0	90.0					17																	29167753		2203	4300	6503	SO:0001583	missense	79915	1	121410	40				g.chr17:29167753C>G		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.2195C>G	chr17.hg19:g.29167753C>G	ENSP00000313171:p.Ser732Cys	1					CTD-2349P21.11_ENST00000580873.1_RNA	p.S732C	NM_024857.3	NP_079133.3	1	2	3	2.115199	Q96QE3	ATAD5_HUMAN		4	2573	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	1	1	hg19	c.2195C>G	CCDS11260.1	1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413979	0.42817	.	.	ENSG00000176208	ENST00000321990	T	0.13089	2.62	6.05	6.05	0.98169	6.05	6.05	0.98169	.	0.809409	0.11693	N	0.538668	T	0.41373	0.1156	M	0.63843	1.955	0.40418	D	0.979817	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	T	0.06006	-1.0851	10	0.72032	D	0.01	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	732;732	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	C	732	ENSP00000313171:S732C	ENSP00000313171:S732C	S	+	2	0	0	ATAD5	26191879	26191879	0.984000	0.35163	1.000000	0.80357	0.882000	0.50991	3.568000	0.53820	2.878000	0.98634	0.650000	0.86243	TCT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.348	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	1	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	2.800000	-2.967187	1	0.360000	NM_024857		0	74	74	0	428	424	1		1	0		0	0	78	0	0	1.000000	0	0	0	0	1	0	74	428
NMT1	4836	broad.mit.edu	37	17	43174523	43174523	+	Silent	SNP	C	C	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:43174523C>A	ENST00000592782.1	+	7	755	c.624C>A	c.(622-624)ccC>ccA	p.P208P	NMT1_ENST00000590114.1_Intron|NMT1_ENST00000258960.2_Silent_p.P208P			P30419	NMT1_HUMAN	N-myristoyltransferase 1	208					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				GCTGGCTCCCCCAGTGGCACT	0.597											OREG0024469	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000592782.1	1.000000	0.740000	1.000000	0.820000	0.900000	0.905311	0.900000	1.000000																										0				8						c.(622-624)ccC>ccA		N-myristoyltransferase 1							98.0	96.0	96.0					17																	43174523		2203	4300	6503	SO:0001819	synonymous_variant	4836	0	0					g.chr17:43174523C>A		CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.624C>A	chr17.hg19:g.43174523C>A		1		OREG0024469	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	914	NMT1_ENST00000258960.2_Silent_p.P208P|NMT1_ENST00000590114.1_Intron	p.P208P			1	2	3	2.115199	P30419	NMT1_HUMAN		7	755	+		Prostate(33;0.155)	A8K7C1|Q9UE09	Silent	SNP	ENST00000592782.1	1	1	hg19	c.624C>A	CCDS11494.1	1																																																																																								0.457627		TCGA-IB-7890-01A-12D-2201-08	0.597	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449239.1	1	0	1	2	2	2	2	0	0	0	0	233	233	233	228	1	2.800000	-2.841679	1	0.360000	NM_021079		0	95	90	0	591	565	1		1	1		0	0	233	0	0	1.000000	9.999984e-01	0	22	0	95	0	95	591
HEXIM1	10614	broad.mit.edu	37	17	43226570	43226570	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:43226570T>C	ENST00000332499.2	+	1	1887	c.13T>C	c.(13-15)Ttc>Ctc	p.F5L	AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	5					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGCCGAGCCATTCTTGTCAGA	0.458											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000332499.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				11						c.(13-15)Ttc>Ctc		hexamethylene bis-acetamide inducible 1							86.0	100.0	95.0					17																	43226570		2203	4296	6499	SO:0001583	missense	10614	1	121404	35				g.chr17:43226570T>C	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.13T>C	chr17.hg19:g.43226570T>C	ENSP00000328773:p.Phe5Leu	1		OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	914	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	p.F5L	NM_006460.2	NP_006451.1	1	2	3	2.115199	O94992	HEXI1_HUMAN		1	1887	+			B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	1	1	hg19	c.13T>C	CCDS11495.1	1	.	.	.	.	.	.	.	.	.	.	T	0.625	-0.819580	0.02776	.	.	ENSG00000186834	ENST00000332499	.	.	.	3.94	1.93	0.25924	3.94	1.93	0.25924	.	.	.	.	.	T	0.08758	0.0217	N	0.02011	-0.69	0.19575	N	0.999967	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	8	0.02654	T	1	-0.0421	5.2187	0.15356	0.0:0.727:0.0:0.273	.	5	O94992	HEXI1_HUMAN	L	5	.	ENSP00000328773:F5L	F	+	1	0	0	HEXIM1	40582353	40582353	0.400000	0.25295	0.983000	0.44433	0.946000	0.59487	0.061000	0.14366	0.997000	0.38969	-0.242000	0.12053	TTC	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.458	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	1	0	1	2	2	2	2	0	0	0	0	221	221	221	217	1	2.800000	-20.000000	1	0.360000	NM_006460		0	243	219	0	480	460	1		1	1		0	0	221	0	0	1.000000	1	0	32	0	49	0	243	480
DLG4	1742	broad.mit.edu	37	17	7106623	7106623	+	Silent	SNP	G	G	A	rs201944473	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:7106623G>A	ENST00000399506.2	-	7	722	c.531C>T	c.(529-531)ggC>ggT	p.G177G	DLG4_ENST00000399510.2_Silent_p.G220G|DLG4_ENST00000485100.1_Silent_p.G174G|DLG4_ENST00000302955.6_Silent_p.G174G			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	177	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	GGTTCCCTACGCCCCCTGCGA	0.587													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19350	0.001		0.0	False		,,,				2504	0.0					ENST00000399506.2	1.000000	0.840000	1.000000	0.990000	0.990000	0.988287	0.990000	1.000000																										0				18						c.(529-531)ggC>ggT		discs, large homolog 4 (Drosophila)	Guanidine(DB00536)	G	,	0,4036		0,0,2018	70.0	68.0	69.0		522,660	-5.1	0.9	17		69	1,8365		0,1,4182	no	coding-synonymous,coding-synonymous	DLG4	NM_001128827.1,NM_001365.3	,	0,1,6200	AA,AG,GG		0.012,0.0,0.0081	,	174/722,220/768	7106623	1,12401	2018	4183	6201	SO:0001819	synonymous_variant	1742	56	120950	46				g.chr17:7106623G>A	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.531C>T	chr17.hg19:g.7106623G>A		1					DLG4_ENST00000485100.1_Silent_p.G174G|DLG4_ENST00000399510.2_Silent_p.G220G|DLG4_ENST00000302955.6_Silent_p.G174G	p.G177G			0	2	2	1.785620	P78352	DLG4_HUMAN		7	722	-			B7Z1S1|G5E939|Q92941|Q9UKK8	Silent	SNP	ENST00000399506.2	1	1	hg19	c.531C>T		1																																																																																								0.360000		TCGA-IB-7890-01A-12D-2201-08	0.587	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	2.800000	-3.150560	1	0.360000	NM_001365		0	26	25	0	92	86	1		1	0		0	0	46	0	0	1.000000	9.783003e-01	0	1	0	24	0	26	92
TP53	7157	broad.mit.edu	37	17	7578254	7578254	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:7578254C>A	ENST00000269305.4	-	6	784	c.595G>T	c.(595-597)Gga>Tga	p.G199*	TP53_ENST00000445888.2_Nonsense_Mutation_p.G199*|TP53_ENST00000359597.4_Nonsense_Mutation_p.G199*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.G199*|TP53_ENST00000455263.2_Nonsense_Mutation_p.G199*|TP53_ENST00000420246.2_Nonsense_Mutation_p.G199*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	199	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		G -> A (in a sporadic cancer; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G199R(9)|p.0?(8)|p.?(5)|p.G199*(3)|p.E198_L201>V(1)|p.N200fs*4(1)|p.E198_G199ins21(1)|p.E198fs*7(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.G199fs*48(1)|p.G199fs*42(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCAAATTTCCTTCCACTCGG	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		33	Substitution - Missense(9)|Whole gene deletion(8)|Unknown(6)|Deletion - Frameshift(4)|Substitution - Nonsense(3)|Deletion - In frame(1)|Complex - frameshift(1)|Insertion - In frame(1)	p.G199R(9)|p.0?(8)|p.?(5)|p.G199*(3)|p.E198_L201>V(1)|p.N200fs*4(1)|p.E198_G199ins21(1)|p.E198fs*7(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.G199fs*48(1)|p.G199fs*42(1)	central_nervous_system(6)|biliary_tract(5)|bone(4)|oesophagus(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)|large_intestine(1)|pancreas(1)	24185						c.(595-597)Gga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						117.0	104.0	108.0					17																	7578254		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578254C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.595G>T	chr17.hg19:g.7578254C>A	ENSP00000269305:p.Gly199*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.G199*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.G199*|TP53_ENST00000420246.2_Nonsense_Mutation_p.G199*|TP53_ENST00000359597.4_Nonsense_Mutation_p.G199*|TP53_ENST00000413465.2_Nonsense_Mutation_p.G199*	p.G199*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.785620	P04637	P53_HUMAN		6	784	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.595G>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.620630	0.46736	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	4.32	0.51571	5.28	4.32	0.51571	.	0.052866	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.2871	12.0218	0.53348	0.0:0.9154:0.0:0.0846	.	.	.	.	X	199;199;199;199;199;199;188;106;67;106;67	.	ENSP00000269305:G199X	G	-	1	0	0	TP53	7518979	7518979	1.000000	0.71417	0.996000	0.52242	0.023000	0.10783	7.775000	0.85489	1.374000	0.46228	-0.253000	0.11424	GGA	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	2.800000	-20.000000	1	0.360000	NM_000546		0	100	99	0	180	178	1		1	0	1	0	0	72	1634	0	1.000000	9.999867e-01	1	1	367	33	671	100	180
XYLT2	64132	broad.mit.edu	37	17	48435627	48435627	+	Silent	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr17:48435627G>A	ENST00000017003.2	+	10	2050	c.2001G>A	c.(1999-2001)ggG>ggA	p.G667G	XYLT2_ENST00000507602.1_Intron	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	667					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					GGTTACTGGGGCCGCTGGACG	0.627																																						ENST00000017003.2	1.000000	0.910000	1.000000	0.990000	0.990000	0.995151	0.990000	1.000000																										0				12						c.(1999-2001)ggG>ggA		xylosyltransferase II							22.0	24.0	23.0					17																	48435627		2202	4298	6500	SO:0001819	synonymous_variant	64132	0	0					g.chr17:48435627G>A	AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.2001G>A	chr17.hg19:g.48435627G>A		1					XYLT2_ENST00000507602.1_Intron	p.G667G	NM_022167.2	NP_071450.2	1	2	3	2.104474	Q9H1B5	XYLT2_HUMAN		10	2050	+	Breast(11;7.18e-19)		Q6UY41|Q86V00	Silent	SNP	ENST00000017003.2	1	1	hg19	c.2001G>A	CCDS11563.1	1																																																																																								0.457627		TCGA-IB-7890-01A-12D-2201-08	0.627	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367046.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	2.800000	-20.000000	1	0.360000	NM_022167		0	33	32	0	137	130	1		1	1		0	0	62	0	0	1.000000	9.560030e-01	0	9	0	15	0	33	137
EPB41L3	23136	broad.mit.edu	37	18	5415859	5415859	+	Silent	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr18:5415859G>A	ENST00000341928.2	-	13	2365	c.2025C>T	c.(2023-2025)agC>agT	p.S675S	EPB41L3_ENST00000542146.1_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000342933.3_Silent_p.S675S|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000427684.2_Intron|EPB41L3_ENST00000542652.2_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	675	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CTAGGGAGGCGCTCAAGGAGG	0.577																																						ENST00000341928.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999949	0.990000	1.000000																										0				105						c.(2023-2025)agC>agT		erythrocyte membrane protein band 4.1-like 3							87.0	83.0	84.0					18																	5415859		2203	4300	6503	SO:0001819	synonymous_variant	23136	0	0					g.chr18:5415859G>A	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2025C>T	chr18.hg19:g.5415859G>A		1					EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000427684.2_Intron|EPB41L3_ENST00000542146.1_Intron|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000342933.3_Silent_p.S675S|EPB41L3_ENST00000400111.3_Intron	p.S675S	NM_012307.2	NP_036439.2	2	2	4	1.887211	Q9Y2J2	E41L3_HUMAN		13	2365	-			B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	ENST00000341928.2	1	1	hg19	c.2025C>T	CCDS11838.1	1																																																																																								0.408940		TCGA-IB-7890-01A-12D-2201-08	0.577	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	1	0	1	2	2	2	2	0	0	0	0	81	81	81	77	1	2.800000	-4.280753	1	0.360000	NM_012307		0	72	72	0	241	234	0		1			0	0	81	0	0	1.000000	0	0	0	0	0	0	72	241
GZMM	3004	broad.mit.edu	37	19	547332	547332	+	Silent	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:547332G>A	ENST00000264553.3	+	2	146	c.108G>A	c.(106-108)tcG>tcA	p.S36S		NM_001258351.1|NM_005317.3	NP_001245280.1|NP_005308	P51124	GRAM_HUMAN	granzyme M (lymphocyte met-ase 1)	36	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(1)|prostate(1)	3		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCCCACTCGCGCCCGTACA	0.667																																						ENST00000264553.3	1.000000	0.190000	0.400000	0.240000	0.300000	0.382899	0.300000	0.290000																										0				3						c.(106-108)tcG>tcA		granzyme M (lymphocyte met-ase 1)							60.0	62.0	61.0					19																	547332		2203	4300	6503	SO:0001819	synonymous_variant	3004	1	121388	36				g.chr19:547332G>A		CCDS12031.1, CCDS74240.1	19p13.3	2008-07-16				ENSG00000197540			4712	protein-coding gene	gene with protein product	"""lymphocyte met-ase 1"""	600311				8119738	Standard	NM_005317		Approved	MET1, LMET1	uc002low.2	P51124		ENST00000264553.3:c.108G>A	chr19.hg19:g.547332G>A		1						p.S36S	NM_001258351.1|NM_005317.3	NP_001245280.1|NP_005308	1	2	3	1.998603	P51124	GRAM_HUMAN		2	146	+		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		Silent	SNP	ENST00000264553.3	1	1	hg19	c.108G>A	CCDS12031.1	0																																																																																								0.445791		TCGA-IB-7890-01A-12D-2201-08	0.667	GZMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451895.2	0	0	1	2	2	2	2	0	0	0	0	205	205	205	204	1	2.800000	-4.888592	1	0.360000	NM_005317		0	27	26	0	558	547	0		1	0		0	0	205	0	0	1.000000	1.317565e-02	0	0	0	4	0	27	558
STAP2	55620	broad.mit.edu	37	19	4328730	4328730	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:4328730G>A	ENST00000594605.1	-	6	655	c.532C>T	c.(532-534)Cgg>Tgg	p.R178W	STAP2_ENST00000597593.1_5'Flank|STAP2_ENST00000600324.1_Missense_Mutation_p.R178W	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	178	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCTGGGCCGCAGCAGCAGG	0.711																																						ENST00000594605.1	0.750000	0.080000	0.490000	0.160000	0.290000	0.332354	0.290000	0.250000																										0				23						c.(532-534)Cgg>Tgg		signal transducing adaptor family member 2							18.0	20.0	20.0					19																	4328730		2196	4295	6491	SO:0001583	missense	55620	0	0					g.chr19:4328730G>A	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.532C>T	chr19.hg19:g.4328730G>A	ENSP00000471052:p.Arg178Trp	1					STAP2_ENST00000600324.1_Missense_Mutation_p.R178W|STAP2_ENST00000597593.1_5'Flank	p.R178W	NM_001013841.1	NP_001013863.1	1	2	3	2.059460	Q9UGK3	STAP2_HUMAN		6	655	-		Hepatocellular(1079;0.137)	A6NKK3|Q9NXI2	Missense_Mutation	SNP	ENST00000594605.1	0	1	hg19	c.532C>T	CCDS45926.1	0	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644273	0.87859	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.47	2.02	0.26589	4.47	2.02	0.26589	SH2 motif (3);	0.082621	0.50627	U	0.000106	T	0.76608	0.4011	M	0.82716	2.605	0.43857	D	0.996459	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78964	-0.1996	9	0.87932	D	0	-13.5939	9.2504	0.37551	0.0:0.0:0.6804:0.3196	.	178;178	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	W	178	.	ENSP00000317912:R178W	R	-	1	2	2	STAP2	4279730	4279730	0.986000	0.35501	1.000000	0.80357	0.894000	0.52154	0.524000	0.22940	2.035000	0.60131	0.479000	0.44913	CGG	0.455967		TCGA-IB-7890-01A-12D-2201-08	0.711	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	0	0	0	2	2	2	2	0	0	0	0	30	30	30	30	1	2.800000	-6.450746	1	0.360000	NM_001013841		0	3	2	0	74	73	0		1	0		0	0	30	0	0	0.804153	2.690479e-01	0	0	0	20	0	3	74
PTPRS	5802	broad.mit.edu	37	19	5210704	5210704	+	Silent	SNP	G	G	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:5210704G>T	ENST00000587303.1	-	33	5446	c.5347C>A	c.(5347-5349)Cgg>Agg	p.R1783R	PTPRS_ENST00000357368.4_Silent_p.R1783R|PTPRS_ENST00000353284.2_Silent_p.R1336R|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000348075.2_Silent_p.R1745R|PTPRS_ENST00000588012.1_Silent_p.R1745R|PTPRS_ENST00000262963.6_Silent_p.R1763R|PTPRS_ENST00000592099.1_Silent_p.R1336R|PTPRS_ENST00000372412.4_Silent_p.R1784R			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1783	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CCCATCTCCCGCAGCTTGGTC	0.647																																						ENST00000587303.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000																										0				61						c.(5347-5349)Cgg>Agg		protein tyrosine phosphatase, receptor type, S	Alendronate(DB00630)|Etidronic acid(DB01077)						85.0	70.0	75.0					19																	5210704		2203	4300	6503	SO:0001819	synonymous_variant	5802	0	0					g.chr19:5210704G>T	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.5347C>A	chr19.hg19:g.5210704G>T		1					PTPRS_ENST00000348075.2_Silent_p.R1745R|PTPRS_ENST00000372412.4_Silent_p.R1784R|PTPRS_ENST00000592099.1_Silent_p.R1336R|PTPRS_ENST00000357368.4_Silent_p.R1783R|PTPRS_ENST00000353284.2_Silent_p.R1336R|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000588012.1_Silent_p.R1745R|PTPRS_ENST00000262963.6_Silent_p.R1763R	p.R1783R			1	2	3	2.059460	Q13332	PTPRS_HUMAN		33	5446	-			O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	ENST00000587303.1	1	1	hg19	c.5347C>A	CCDS45930.1	1																																																																																								0.455967		TCGA-IB-7890-01A-12D-2201-08	0.647	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2	1	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	2.800000	-4.621529	1	0.360000			0	68	67	0	217	210	1		1	1		0	0	85	0	0	1.000000	1	0	4	0	105	0	68	217
ATP4A	495	broad.mit.edu	37	19	36053403	36053403	+	Silent	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:36053403G>A	ENST00000262623.3	-	4	382	c.354C>T	c.(352-354)gcC>gcT	p.A118A		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	118					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	AGATGGCGGCGGCAACCCACA	0.657																																						ENST00000262623.3	1.000000	0.190000	0.570000	0.260000	0.370000	0.447910	0.370000	0.340000																										0				53						c.(352-354)gcC>gcT		ATPase, H+/K+ exchanging, alpha polypeptide	Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)						54.0	44.0	47.0					19																	36053403		2203	4299	6502	SO:0001819	synonymous_variant	495	2	121404	37				g.chr19:36053403G>A		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.354C>T	chr19.hg19:g.36053403G>A		1						p.A118A	NM_000704.2	NP_000695.2	1	2	3	2.000861	P20648	ATP4A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)	4	382	-	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		O00738	Silent	SNP	ENST00000262623.3	1	1	hg19	c.354C>T	CCDS12467.1	0																																																																																								0.444058		TCGA-IB-7890-01A-12D-2201-08	0.657	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	0	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	2.800000	-4.788962	1	0.360000	NM_000704		0	11	11	0	194	182	0		1			0	0	58	0	0	0.997864	0	0	0	0	0	0	11	194
MUC16	94025	broad.mit.edu	37	19	9070332	9070332	+	Missense_Mutation	SNP	G	G	A	rs200898366		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:9070332G>A	ENST00000397910.4	-	3	17317	c.17114C>T	c.(17113-17115)gCg>gTg	p.A5705V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5707	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCTGTGTGCGCAGTGTCTTT	0.502																																						ENST00000397910.4	1.000000	0.730000	1.000000	0.830000	0.940000	0.925974	0.940000	1.000000																										0				590						c.(17113-17115)gCg>gTg		mucin 16, cell surface associated		G	VAL/ALA	3,4189		0,3,2093	166.0	162.0	163.0		17114	-1.2	0.0	19		163	0,8422		0,0,4211	yes	missense	MUC16	NM_024690.2	64	0,3,6304	AA,AG,GG		0.0,0.0716,0.0238	possibly-damaging	5705/14508	9070332	3,12611	2096	4211	6307	SO:0001583	missense	94025	11	121054	44				g.chr19:9070332G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17114C>T	chr19.hg19:g.9070332G>A	ENSP00000381008:p.Ala5705Val	1						p.A5705V	NM_024690.2	NP_078966.2	1	2	3	2.059460	Q8WXI7	MUC16_HUMAN		3	17317	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.17114C>T	CCDS54212.1	1	.	.	.	.	.	.	.	.	.	.	g	5.554	0.287072	0.10513	7.16E-4	0.0	ENSG00000181143	ENST00000397910	T	0.17854	2.25	1.54	-1.16	0.09678	1.54	-1.16	0.09678	.	.	.	.	.	T	0.04952	0.0133	N	0.08118	0	.	.	.	P	0.44578	0.838	B	0.24155	0.051	T	0.31806	-0.9930	8	0.87932	D	0	.	3.5904	0.07986	0.0:0.2807:0.4342:0.285	.	5705	B5ME49	.	V	5705	ENSP00000381008:A5705V	ENSP00000381008:A5705V	A	-	2	0	0	MUC16	8931332	8931332	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.207000	0.09384	-0.197000	0.10350	0.456000	0.33151	GCG	0.455967		TCGA-IB-7890-01A-12D-2201-08	0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	2.800000	-3.222927	1	0.360000	NM_024690		0	57	58	0	338	336	1		1			0	0	74	0	0	1.000000	0	0	0	0	0	0	57	338
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																						ENST00000397910.4	0.230000	0.040000	0.160000	0.070000	0.110000	0.127691	0.110000	0.110000																										0				590						c.(982-984)ccT>ccC		mucin 16, cell surface associated							96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9090831A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	chr19.hg19:g.9090831A>G		1						p.P328P	NM_024690.2	NP_078966.2	1	2	3	2.059460	Q8WXI7	MUC16_HUMAN		1	1187	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.984T>C	CCDS54212.1	0																																																																																								0.455967		TCGA-IB-7890-01A-12D-2201-08	0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	122	122	122	120	1	2.800000	-2.339787	0	0.360000	NM_024690		0	7	6	0	429	424	0		1			0	0	122	0	0	0.979809	0	0	0	0	0	0	7	429
PEG3	5178	broad.mit.edu	37	19	57328017	57328017	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr19:57328017C>T	ENST00000326441.9	-	10	2156	c.1793G>A	c.(1792-1794)cGt>cAt	p.R598H	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R598H|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R472H|PEG3_ENST00000598410.1_Missense_Mutation_p.R474H	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	598					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R598H(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ttcacgttcacgttcatgttc	0.458																																						ENST00000326441.9	1.000000	0.910000	1.000000	0.990000	0.990000	0.994469	0.990000	1.000000																										2	Substitution - Missense(2)	p.R598H(2)	ovary(2)	170						c.(1792-1794)cGt>cAt		paternally expressed 3							106.0	83.0	91.0					19																	57328017		2203	4300	6503	SO:0001583	missense	5178	0	0					g.chr19:57328017C>T	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1793G>A	chr19.hg19:g.57328017C>T	ENSP00000326581:p.Arg598His	1					PEG3_ENST00000598410.1_Missense_Mutation_p.R474H|PEG3_ENST00000423103.2_Missense_Mutation_p.R598H|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R472H|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron	p.R598H	NM_006210.2	NP_006201.1	1	2	3	2.074068	Q9GZU2	PEG3_HUMAN		10	2156	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	1	1	hg19	c.1793G>A	CCDS12948.1	1	.	.	.	.	.	.	.	.	.	.	C	0.743	-0.775804	0.02951	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02863	4.13;4.13	1.08	-0.0769	0.13721	1.08	-0.0769	0.13721	.	.	.	.	.	T	0.02193	0.0068	L	0.50333	1.59	.	.	.	B;B;P	0.40107	0.055;0.291;0.703	B;B;B	0.23150	0.001;0.013;0.044	T	0.41251	-0.9519	8	0.56958	D	0.05	.	3.4582	0.07523	0.0:0.7126:0.0:0.2874	.	474;598;533	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	H	598	ENSP00000326581:R598H;ENSP00000403051:R598H	ENSP00000326581:R598H	R	-	2	0	0	ZIM2	62019829	62019829	0.000000	0.05858	0.010000	0.14722	0.165000	0.22458	-0.044000	0.12023	0.063000	0.16370	0.525000	0.51046	CGT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.458	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2	1	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	2.800000	-20.000000	1	0.360000			0	54	54	0	246	244	1		1	0		0	0	60	0	0	1.000000	8.835486e-02	0	0	0	3	0	54	246
CDC42	998	broad.mit.edu	37	1	22405018	22405018	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr1:22405018A>G	ENST00000344548.3	+	3	298	c.47A>G	c.(46-48)aAa>aGa	p.K16R	CDC42_ENST00000421089.2_5'UTR|CDC42_ENST00000315554.8_Missense_Mutation_p.K16R|CDC42_ENST00000498236.1_3'UTR|CDC42_ENST00000400259.1_Missense_Mutation_p.K16R	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	16					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		GCTGTTGGTAAAACATGTCTC	0.358																																						ENST00000344548.3	1.000000	0.810000	1.000000	0.910000	0.990000	0.967916	0.990000	1.000000																										0				12						c.(46-48)aAa>aGa		cell division cycle 42							118.0	108.0	112.0					1																	22405018		2203	4300	6503	SO:0001583	missense	998	0	0					g.chr1:22405018A>G	BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.47A>G	chr1.hg19:g.22405018A>G	ENSP00000341072:p.Lys16Arg	0					CDC42_ENST00000498236.1_3'UTR|CDC42_ENST00000400259.1_Missense_Mutation_p.K16R|CDC42_ENST00000315554.8_Missense_Mutation_p.K16R|CDC42_ENST00000421089.2_5'UTR	p.K16R	NM_001039802.1	NP_001034891.1	1	2	3	1.828731	P60953	CDC42_HUMAN		3	298	+		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)	P21181|P25763|Q7L8R5|Q9UDI2	Missense_Mutation	SNP	ENST00000344548.3	1	1	hg19	c.47A>G	CCDS221.1	1	.	.	.	.	.	.	.	.	.	.	a	26.3	4.721851	0.89298	.	.	ENSG00000070831	ENST00000400259;ENST00000344548;ENST00000315554;ENST00000411827	D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65	4.91	4.91	0.64330	4.91	4.91	0.64330	Small GTP-binding protein domain (1);	0.048902	0.85682	D	0.000000	D	0.98118	0.9379	H	0.99997	5.475	0.80722	D	1	D;D;D	0.71674	0.985;0.998;0.987	D;D;P	0.73380	0.928;0.98;0.88	D	0.98100	1.0414	10	0.87932	D	0	.	13.365	0.60678	1.0:0.0:0.0:0.0	.	16;16;16	B4E1U9;P60953;P60953-1	.;CDC42_HUMAN;.	R	16	ENSP00000383118:K16R;ENSP00000341072:K16R;ENSP00000314458:K16R;ENSP00000398327:K16R	ENSP00000314458:K16R	K	+	2	0	0	CDC42	22277605	22277605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.630000	0.90987	1.854000	0.53819	0.528000	0.53228	AAA	0.375732		TCGA-IB-7890-01A-12D-2201-08	0.358	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1	1	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	2.800000	-20.000000	1	0.360000	NM_001791		0	75	69	0	349	340	1		1	1		0	0	89	0	0	1.000000	1	0	103	0	469	0	75	349
HSD3B1	3283	broad.mit.edu	37	1	120056677	120056677	+	Silent	SNP	C	C	T	rs190598307	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr1:120056677C>T	ENST00000369413.3	+	4	676	c.531C>T	c.(529-531)ggC>ggT	p.G177G	HSD3B1_ENST00000235547.6_Silent_p.G179G|HSD3B1_ENST00000528909.1_Silent_p.G177G			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	177					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	TGAAAAACGGCGGCACCCTGT	0.512																																						ENST00000369413.3	1.000000	0.920000	1.000000	0.990000	0.990000	0.995412	0.990000	1.000000																										0				32						c.(529-531)ggC>ggT		hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	Trilostane(DB01108)						71.0	70.0	70.0					1																	120056677		2203	4300	6503	SO:0001819	synonymous_variant	3283	22	121412	47				g.chr1:120056677C>T	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.531C>T	chr1.hg19:g.120056677C>T		0					HSD3B1_ENST00000235547.6_Silent_p.G179G|HSD3B1_ENST00000528909.1_Silent_p.G177G	p.G177G			1	2	3	1.807388	P14060	3BHS1_HUMAN		4	676	+	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)	A8K691|Q14545|Q8IV65	Silent	SNP	ENST00000369413.3	1	1	hg19	c.531C>T	CCDS903.1	1																																																																																								0.372426		TCGA-IB-7890-01A-12D-2201-08	0.512	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	1	0	1	2	2	2	2	0	0	0	0	152	152	152	147	1	2.800000	-3.107943	1	0.360000	NM_000862		0	89	87	0	358	350	1		1			0	0	152	0	0	1.000000	0	0	0	0	0	0	89	358
AJAP1	55966	broad.mit.edu	37	1	4772349	4772349	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr1:4772349C>T	ENST00000378191.4	+	2	800	c.419C>T	c.(418-420)gCg>gTg	p.A140V	AJAP1_ENST00000378190.3_Missense_Mutation_p.A140V	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	140					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TCGTCCTCCGCGGTGGCCGGT	0.716																																						ENST00000378191.4	1.000000	0.680000	1.000000	0.940000	0.990000	0.967865	0.990000	1.000000																										0				24						c.(418-420)gCg>gTg		adherens junctions associated protein 1							7.0	7.0	7.0					1																	4772349		2075	4103	6178	SO:0001583	missense	55966	7	118208	29				g.chr1:4772349C>T	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.419C>T	chr1.hg19:g.4772349C>T	ENSP00000367433:p.Ala140Val	0					AJAP1_ENST00000378190.3_Missense_Mutation_p.A140V	p.A140V	NM_018836.3	NP_061324.1	1	2	3	1.787418	Q9UKB5	AJAP1_HUMAN		2	800	+	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	1	1	hg19	c.419C>T	CCDS54.1	1	.	.	.	.	.	.	.	.	.	.	C	1.639	-0.516965	0.04171	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.44482	0.92;0.92	4.55	-0.916	0.10489	4.55	-0.916	0.10489	.	2.012640	0.02618	N	0.102845	T	0.26484	0.0647	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15954	-1.0419	10	0.30078	T	0.28	1.4174	7.1766	0.25749	0.0:0.4287:0.0:0.5713	.	140	Q9UKB5	AJAP1_HUMAN	V	140	ENSP00000367432:A140V;ENSP00000367433:A140V	ENSP00000367432:A140V	A	+	2	0	0	AJAP1	4672209	4672209	0.000000	0.05858	0.000000	0.03702	0.177000	0.22998	-1.001000	0.03690	-0.051000	0.13334	-0.362000	0.07510	GCG	0.367964		TCGA-IB-7890-01A-12D-2201-08	0.716	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	2.800000	-19.928010	1	0.360000	NM_018836		0	10	10	0	35	31	0		1			0	0	17	0	0	0.996697	0	0	0	0	0	0	10	35
GLMN	11146	broad.mit.edu	37	1	92737124	92737124	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr1:92737124A>G	ENST00000370360.3	-	8	902	c.821T>C	c.(820-822)tTt>tCt	p.F274S	GLMN_ENST00000534881.1_Missense_Mutation_p.F274S	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	274	Poly-Glu.				muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TTCTTCTTCAAATTCAAGGTA	0.353									Multiple Glomus Tumors (of the Skin), Familial																													ENST00000370360.3	1.000000	0.860000	1.000000	0.950000	0.990000	0.984102	0.990000	1.000000																										0				17						c.(820-822)tTt>tCt		glomulin, FKBP associated protein							155.0	151.0	152.0					1																	92737124		2203	4300	6503	SO:0001583	missense	11146	0	0		Multiple Glomus Tumors (of the Skin), Familial	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	g.chr1:92737124A>G	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.821T>C	chr1.hg19:g.92737124A>G	ENSP00000359385:p.Phe274Ser	0					GLMN_ENST00000534881.1_Missense_Mutation_p.F274S	p.F274S	NM_053274.2	NP_444504.1	1	2	3	1.807388	Q92990	GLMN_HUMAN		8	902	-		all_lung(203;0.00827)|Lung NSC(277;0.0295)	Q5VVC3|Q9BVE8	Missense_Mutation	SNP	ENST00000370360.3	1	1	hg19	c.821T>C	CCDS738.1	1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.171313	0.57584	.	.	ENSG00000174842	ENST00000370360;ENST00000534881	T;T	0.47528	0.84;0.84	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.151067	0.64402	D	0.000010	T	0.38081	0.1027	L	0.56769	1.78	0.40471	D	0.980344	P;P	0.43633	0.813;0.492	P;B	0.44647	0.456;0.193	T	0.35076	-0.9803	10	0.45353	T	0.12	-13.5471	14.0348	0.64638	1.0:0.0:0.0:0.0	.	274;274	B4DJ85;Q92990	.;GLMN_HUMAN	S	274	ENSP00000359385:F274S;ENSP00000440156:F274S	ENSP00000359385:F274S	F	-	2	0	0	GLMN	92509712	92509712	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.565000	0.67365	1.902000	0.55061	0.482000	0.46254	TTT	0.372426		TCGA-IB-7890-01A-12D-2201-08	0.353	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028358.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	2.800000	-20.000000	1	0.360000	NM_007070		0	82	82	0	357	351	1		1	0		0	0	91	0	0	1.000000	3.890263e-01	0	0	0	7	0	82	357
FMN2	56776	broad.mit.edu	37	1	240370125	240370125	+	Silent	SNP	A	A	G	rs568308648		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr1:240370125A>G	ENST00000319653.9	+	5	2243	c.2013A>G	c.(2011-2013)ggA>ggG	p.G671G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	671					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGTCTGAGGGACAGGCCACTG	0.433																																						ENST00000319653.9	1.000000	0.770000	1.000000	0.910000	0.990000	0.970587	0.990000	1.000000																										0				178						c.(2011-2013)ggA>ggG		formin 2							49.0	51.0	50.0					1																	240370125		2203	4300	6503	SO:0001819	synonymous_variant	56776	0	0					g.chr1:240370125A>G	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2013A>G	chr1.hg19:g.240370125A>G		1						p.G671G	NM_020066.4	NP_064450.3	1	3	4	2.138298	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	5	2243	+	Ovarian(103;0.127)	all_cancers(173;0.013)	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	1	1	hg19	c.2013A>G	CCDS31069.2	1																																																																																								0.470549		TCGA-IB-7890-01A-12D-2201-08	0.433	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	1	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	2.800000	-19.001430	1	0.360000	XM_371352		0	37	37	0	202	200	1		1	0		0	0	71	0	0	1.000000	2.426887e-01	0	0	0	6	0	37	202
MC3R	4159	broad.mit.edu	37	20	54824818	54824818	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr20:54824818C>T	ENST00000243911.2	+	1	1031	c.919C>T	c.(919-921)Cgc>Tgc	p.R307C		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	307					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.R344C(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CCTGGAATTGCGCAACACCTT	0.517																																						ENST00000243911.2	1.000000	0.220000	0.380000	0.260000	0.310000	0.375074	0.310000	0.300000																										1	Substitution - Missense(1)	p.R344C(1)	breast(1)	26						c.(919-921)Cgc>Tgc		melanocortin 3 receptor							171.0	162.0	165.0					20																	54824818		2203	4300	6503	SO:0001583	missense	4159	0	0					g.chr20:54824818C>T		CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.919C>T	chr20.hg19:g.54824818C>T	ENSP00000243911:p.Arg307Cys	1						p.R307C	NM_019888.3	NP_063941.3	2	2	4	2.306405	P41968	MC3R_HUMAN	Colorectal(105;0.202)	1	1031	+			Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	1	1	hg19	c.919C>T	CCDS13449.2	0	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967174	0.34754	.	.	ENSG00000124089	ENST00000243911	T	0.58358	0.34	5.09	3.06	0.35304	5.09	3.06	0.35304	.	0.000000	0.64402	D	0.000014	T	0.80989	0.4730	H	0.97440	4.005	0.54753	D	0.999986	D	0.89917	1.0	D	0.83275	0.996	D	0.85842	0.1398	10	0.87932	D	0	.	13.1951	0.59734	0.4134:0.5866:0.0:0.0	.	344	P41968	MC3R_HUMAN	C	307	ENSP00000243911:R307C	ENSP00000243911:R307C	R	+	1	0	0	MC3R	54258225	54258225	1.000000	0.71417	0.993000	0.49108	0.191000	0.23601	2.103000	0.41806	0.477000	0.27464	0.555000	0.69702	CGC	0.515298		TCGA-IB-7890-01A-12D-2201-08	0.517	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2	1	0	1	2	2	2	2	0	0	0	0	167	167	167	164	1	2.800000	-4.402638	1	0.360000			0	47	47	0	1071	1052	0		1			0	0	167	0	0	1.000000	0	0	0	0	0	0	47	1071
ZNF831	128611	broad.mit.edu	37	20	57769548	57769548	+	Silent	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr20:57769548G>A	ENST00000371030.2	+	1	3474	c.3474G>A	c.(3472-3474)acG>acA	p.T1158T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1158							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T1158T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					ACTCAGGGACGTCCCGGAGCC	0.672																																						ENST00000371030.2	1.000000	0.880000	1.000000	0.990000	0.990000	0.990513	0.990000	1.000000																										1	Substitution - coding silent(1)	p.T1158T(1)	prostate(1)	125						c.(3472-3474)acG>acA		zinc finger protein 831							44.0	51.0	48.0					20																	57769548		2038	4178	6216	SO:0001819	synonymous_variant	128611	1	120958	31				g.chr20:57769548G>A	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3474G>A	chr20.hg19:g.57769548G>A		1						p.T1158T	NM_178457.1	NP_848552.1	2	2	4	2.306405	Q5JPB2	ZN831_HUMAN		1	3474	+	all_lung(29;0.0085)		Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	1	1	hg19	c.3474G>A	CCDS42894.1	1																																																																																								0.515298		TCGA-IB-7890-01A-12D-2201-08	0.672	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	1	0	1	2	2	2	2	0	0	0	0	161	161	161	158	1	2.800000	-20.000000	1	0.360000	NM_178457		0	84	82	0	480	468	1		1			0	0	161	0	0	1.000000	0	0	0	0	0	0	84	480
TCN2	6948	broad.mit.edu	37	22	31011344	31011344	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr22:31011344C>T	ENST00000215838.3	+	5	1131	c.637C>T	c.(637-639)Cct>Tct	p.P213S	TCN2_ENST00000407817.3_Missense_Mutation_p.P186S|TCN2_ENST00000405742.3_Missense_Mutation_p.P209S			P20062	TCO2_HUMAN	transcobalamin II	213					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAACTTCAACCCTGGTCGGAG	0.557																																						ENST00000215838.3	1.000000	0.720000	1.000000	0.820000	0.920000	0.915268	0.920000	1.000000																										0				22						c.(637-639)Cct>Tct		transcobalamin II	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						86.0	77.0	80.0					22																	31011344		2203	4300	6503	SO:0001583	missense	6948	0	0					g.chr22:31011344C>T		CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.637C>T	chr22.hg19:g.31011344C>T	ENSP00000215838:p.Pro213Ser	1					TCN2_ENST00000405742.3_Missense_Mutation_p.P209S|TCN2_ENST00000407817.3_Missense_Mutation_p.P186S	p.P213S			1	2	3	2.080136	P20062	TCO2_HUMAN		5	1131	+			Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	ENST00000215838.3	1	1	hg19	c.637C>T	CCDS13881.1	1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293005	0.23564	.	.	ENSG00000185339	ENST00000215838;ENST00000405742;ENST00000407817	T;T;T	0.33865	1.39;1.39;1.39	5.82	2.59	0.31030	5.82	2.59	0.31030	.	0.407958	0.29684	N	0.011470	T	0.20129	0.0484	N	0.22421	0.69	0.80722	D	1	B;B;B	0.27166	0.17;0.113;0.113	B;B;B	0.30029	0.11;0.031;0.031	T	0.05386	-1.0888	10	0.14252	T	0.57	-3.8544	5.8302	0.18577	0.1552:0.6812:0.0:0.1636	.	186;209;213	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	S	213;209;186	ENSP00000215838:P213S;ENSP00000385914:P209S;ENSP00000384914:P186S	ENSP00000215838:P213S	P	+	1	0	0	TCN2	29341344	29341344	0.001000	0.12720	0.636000	0.29352	0.333000	0.28666	0.476000	0.22180	0.357000	0.24183	0.561000	0.74099	CCT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.557	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321282.2	1	0	1	2	2	2	2	0	0	0	0	123	123	123	121	1	2.800000	-3.222205	1	0.360000	NM_000355		0	63	63	0	383	379	1		1	1		0	0	123	0	0	1.000000	9.997559e-01	0	6	0	70	0	63	383
BUB1	699	broad.mit.edu	37	2	111399371	111399371	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:111399371G>T	ENST00000302759.6	-	21	2591	c.2473C>A	c.(2473-2475)Cct>Act	p.P825T	BUB1_ENST00000535254.1_Missense_Mutation_p.P805T|BUB1_ENST00000478175.1_5'UTR|BUB1_ENST00000409311.1_Missense_Mutation_p.P825T	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	825	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		GGGTTGGCAGGCTTTTGGACC	0.398																																						ENST00000302759.6	1.000000	0.810000	1.000000	0.880000	0.960000	0.952582	0.960000	1.000000																										0				45						c.(2473-2475)Cct>Act		BUB1 mitotic checkpoint serine/threonine kinase							141.0	153.0	149.0					2																	111399371		2203	4300	6503	SO:0001583	missense	699	0	0					g.chr2:111399371G>T	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.2473C>A	chr2.hg19:g.111399371G>T	ENSP00000302530:p.Pro825Thr	1					BUB1_ENST00000478175.1_5'UTR|BUB1_ENST00000409311.1_Missense_Mutation_p.P825T|BUB1_ENST00000535254.1_Missense_Mutation_p.P805T	p.P825T	NM_004336.3	NP_004327.1	1	2	3	2.079998	O43683	BUB1_HUMAN		21	2591	-		Ovarian(717;0.0822)	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	1	1	hg19	c.2473C>A	CCDS33273.1	1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326955	0.81690	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759	T;T;T	0.64085	-0.08;2.08;-0.08	6.16	5.29	0.74685	6.16	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.049093	0.85682	D	0.000000	T	0.80380	0.4612	M	0.83312	2.635	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.83628	0.0143	10	0.87932	D	0	-15.6873	14.2663	0.66121	0.0712:0.0:0.9288:0.0	.	805;825;825	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	T	805;825;825	ENSP00000441013:P805T;ENSP00000386701:P825T;ENSP00000302530:P825T	ENSP00000302530:P825T	P	-	1	0	0	BUB1	111115843	111115843	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.376000	0.73141	1.631000	0.50456	0.650000	0.86243	CCT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.398	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	1	0	1	2	2	2	2	0	0	0	0	180	180	180	179	1	2.800000	-20.000000	1	0.360000	NM_004336		0	128	127	0	738	730	1		1	1		0	0	180	0	0	1.000000	8.169202e-01	0	9	0	11	0	128	738
GAD1	2571	broad.mit.edu	37	2	171687567	171687567	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:171687567G>T	ENST00000358196.3	+	5	962	c.412G>T	c.(412-414)Gtg>Ttg	p.V138L	GAD1_ENST00000375272.1_Missense_Mutation_p.V138L|GAD1_ENST00000344257.5_Missense_Mutation_p.V138L|GAD1_ENST00000429023.1_3'UTR	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	138					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CTCCACCAAGGTGCTGGACTT	0.547																																						ENST00000358196.3	1.000000	0.710000	1.000000	0.800000	0.910000	0.905526	0.910000	1.000000																										0				35						c.(412-414)Gtg>Ttg		glutamate decarboxylase 1 (brain, 67kDa)							115.0	99.0	104.0					2																	171687567		2203	4300	6503	SO:0001583	missense	2571	0	0					g.chr2:171687567G>T		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.412G>T	chr2.hg19:g.171687567G>T	ENSP00000350928:p.Val138Leu	1					GAD1_ENST00000429023.1_3'UTR|GAD1_ENST00000375272.1_Missense_Mutation_p.V138L|GAD1_ENST00000344257.5_Missense_Mutation_p.V138L	p.V138L	NM_000817.2	NP_000808.2	1	2	3	2.079998	Q99259	DCE1_HUMAN		5	962	+			Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	1	1	hg19	c.412G>T	CCDS2239.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.180048	0.94846	.	.	ENSG00000128683	ENST00000358196;ENST00000375272;ENST00000344257	T;T;T	0.44083	0.93;0.93;0.93	5.9	5.9	0.94986	5.9	5.9	0.94986	Pyridoxal phosphate-dependent transferase, major domain (1);	0.167622	0.51477	D	0.000087	T	0.53818	0.1820	M	0.75615	2.305	0.80722	D	1	B;P	0.35348	0.023;0.496	B;B	0.40228	0.088;0.323	T	0.56854	-0.7910	10	0.87932	D	0	-18.4861	20.2673	0.98463	0.0:0.0:1.0:0.0	.	138;138	Q99259;Q99259-3	DCE1_HUMAN;.	L	138	ENSP00000350928:V138L;ENSP00000364421:V138L;ENSP00000341167:V138L	ENSP00000341167:V138L	V	+	1	0	0	GAD1	171395813	171395813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.638000	0.83328	2.786000	0.95864	0.643000	0.83706	GTG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.547	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	92	1	2.800000	-20.000000	1	0.360000			0	61	57	0	377	369	1		1	0		0	0	96	0	0	1.000000	2.012987e-02	0	1	0	1	0	61	377
DCAF17	80067	broad.mit.edu	37	2	172330428	172330428	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:172330428T>A	ENST00000375255.3	+	10	1361	c.1034T>A	c.(1033-1035)aTc>aAc	p.I345N	DCAF17_ENST00000468592.1_3'UTR|DCAF17_ENST00000539783.1_Intron	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	345					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						TCTGACTGGATCTATTTCCAT	0.348																																						ENST00000375255.3	1.000000	0.540000	0.900000	0.640000	0.760000	0.777277	0.760000	1.000000																										0				17						c.(1033-1035)aTc>aAc		DDB1 and CUL4 associated factor 17							96.0	92.0	93.0					2																	172330428		2203	4300	6503	SO:0001583	missense	80067	0	0					g.chr2:172330428T>A	AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.1034T>A	chr2.hg19:g.172330428T>A	ENSP00000364404:p.Ile345Asn	1					DCAF17_ENST00000539783.1_Intron|DCAF17_ENST00000468592.1_3'UTR	p.I345N	NM_025000.3	NP_079276.2	1	2	3	2.079998	Q5H9S7	DCA17_HUMAN		10	1361	+			B2RTW5|Q53TN3|Q9H908	Missense_Mutation	SNP	ENST00000375255.3	1	1	hg19	c.1034T>A	CCDS2243.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.5|24.5	4.534753|4.534753	0.85812|0.85812	.|.	.|.	ENSG00000115827|ENSG00000115827	ENST00000375255;ENST00000429466|ENST00000339506;ENST00000431110	T|.	0.53423|.	0.62|.	5.53|5.53	5.53|5.53	0.82687|0.82687	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.048318|.	0.85682|.	D|.	0.000000|.	T|T	0.70579|0.70579	0.3240|0.3240	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.79108|.	0.992|.	T|T	0.69383|0.69383	-0.5160|-0.5160	10|5	0.66056|.	D|.	0.02|.	-10.6448|-10.6448	15.6457|15.6457	0.77049|0.77049	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	345|.	Q5H9S7|.	DCA17_HUMAN|.	N|T	345;95|96;47	ENSP00000364404:I345N|.	ENSP00000364404:I345N|.	I|S	+|+	2|1	0|0	0|0	DCAF17|DCAF17	172038674|172038674	172038674|172038674	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.618000|7.618000	0.83043|0.83043	2.075000|2.075000	0.62263|0.62263	0.533000|0.533000	0.62120|0.62120	ATC|TCT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.348	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255342.2	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	2.800000	-20.000000	1	0.360000	NM_025000		0	32	32	0	242	238	1		1	1		0	0	44	0	0	1.000000	2.013880e-01	0	2	0	5	0	32	242
TTN	7273	broad.mit.edu	37	2	179638314	179638314	+	Missense_Mutation	SNP	C	C	T	rs148920986		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:179638314C>T	ENST00000591111.1	-	32	7693	c.7469G>A	c.(7468-7470)cGt>cAt	p.R2490H	TTN_ENST00000360870.5_Missense_Mutation_p.R2490H|TTN_ENST00000342175.6_Missense_Mutation_p.R2444H|TTN_ENST00000342992.6_Missense_Mutation_p.R2490H|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R2444H|TTN_ENST00000460472.2_Missense_Mutation_p.R2444H|TTN_ENST00000589042.1_Missense_Mutation_p.R2490H			Q8WZ42	TITIN_HUMAN	titin	12811	Ig-like 14.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCCTGTACACGGTCATCAGG	0.438																																						ENST00000591111.1	1.000000	0.080000	0.230000	0.110000	0.160000	0.226666	0.160000	0.150000																										0				1448						c.(7468-7470)cGt>cAt		titin							147.0	133.0	138.0					2																	179638314		2203	4300	6503	SO:0001583	missense	7273	1	121406	39				g.chr2:179638314C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7469G>A	chr2.hg19:g.179638314C>T	ENSP00000465570:p.Arg2490His	1					TTN_ENST00000360870.5_Missense_Mutation_p.R2490H|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R2490H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R2444H|TTN_ENST00000589042.1_Missense_Mutation_p.R2490H|TTN_ENST00000342175.6_Missense_Mutation_p.R2444H|TTN_ENST00000359218.5_Missense_Mutation_p.R2444H|TTN-AS1_ENST00000584485.1_RNA	p.R2490H			1	2	3	2.027219	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	32	7693	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.7469G>A		0	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031724	0.35797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	5.82	5.82	0.92795	5.82	5.82	0.92795	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70334	0.3212	M	0.70903	2.155	0.31701	N	0.640681	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0	D;D;D;D;D	0.74348	0.947;0.947;0.947;0.971;0.983	T	0.72988	-0.4124	9	0.87932	D	0	.	20.1143	0.97922	0.0:1.0:0.0:0.0	.	2444;2444;2444;2490;2490	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	2490;2444;2444;2444;2444;2490	ENSP00000343764:R2490H;ENSP00000434586:R2444H;ENSP00000340554:R2444H;ENSP00000352154:R2444H;ENSP00000354117:R2490H	ENSP00000340554:R2444H	R	-	2	0	0	TTN	179346559	179346559	1.000000	0.71417	0.966000	0.40874	0.554000	0.35429	7.818000	0.86416	2.765000	0.95021	0.650000	0.86243	CGT	0.450077		TCGA-IB-7890-01A-12D-2201-08	0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	2.800000	-2.613097	1	0.360000	NM_133378		0	13	13	0	529	523	0		1			0	0	73	0	0	0.999506	0	0	0	0	0	0	13	529
PKDCC	91461	broad.mit.edu	37	2	42281326	42281326	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:42281326C>T	ENST00000294964.5	+	3	1093	c.913C>T	c.(913-915)Ccg>Tcg	p.P305S		NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic											breast(2)|kidney(1)|lung(5)	8						GGAGGAGACGCCGTGTGCAGG	0.637																																						ENST00000294964.5	1.000000	0.520000	1.000000	0.710000	0.940000	0.882651	0.940000	1.000000																										0				8						c.(913-915)Ccg>Tcg		protein kinase domain containing, cytoplasmic							66.0	51.0	56.0					2																	42281326		2203	4300	6503	SO:0001583	missense	91461	0	0					g.chr2:42281326C>T		CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.913C>T	chr2.hg19:g.42281326C>T	ENSP00000294964:p.Pro305Ser	1						p.P305S	NM_138370.2	NP_612379.2	0	2	2	1.840964				3	1093	+				Missense_Mutation	SNP	ENST00000294964.5	1	1	hg19	c.913C>T	CCDS33186.2	1	.	.	.	.	.	.	.	.	.	.	C	8.736	0.917815	0.17982	.	.	ENSG00000162878	ENST00000294964	.	.	.	5.08	5.08	0.68730	5.08	5.08	0.68730	Protein kinase, catalytic domain (1);	0.270435	0.42548	D	0.000699	T	0.33352	0.0860	N	0.21194	0.64	0.45015	D	0.998034	B	0.30326	0.276	B	0.29267	0.1	T	0.13764	-1.0497	9	0.07482	T	0.82	-25.5501	10.9735	0.47452	0.0:0.9047:0.0:0.0953	.	305	Q504Y2	PKDCC_HUMAN	S	305	.	ENSP00000294964:P305S	P	+	1	0	0	PKDCC	42134830	42134830	0.232000	0.23762	0.252000	0.24328	0.754000	0.42855	1.211000	0.32382	2.367000	0.80283	0.561000	0.74099	CCG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.637	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325745.3	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	2.800000	-19.869220	1	0.360000			0	11	11	0	54	53	1		1	0		0	0	27	0	0	0.998717	9.999338e-01	0	0	0	101	0	11	54
ALMS1	7840	broad.mit.edu	37	2	73675916	73675916	+	Silent	SNP	T	T	C			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:73675916T>C	ENST00000264448.6	+	8	2370	c.2259T>C	c.(2257-2259)acT>acC	p.T753T	ALMS1_ENST00000409009.1_Silent_p.T711T|ALMS1_ENST00000377715.1_Silent_p.T753T	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	753	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ACCAGAAGACTGAGATACCAG	0.443																																						ENST00000264448.6	0.970000	0.710000	0.910000	0.770000	0.830000	0.845819	0.830000	0.840000																										0				147						c.(2257-2259)acT>acC		Alstrom syndrome 1							147.0	147.0	147.0					2																	73675916		1895	4116	6011	SO:0001819	synonymous_variant	7840	0	0					g.chr2:73675916T>C	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2259T>C	chr2.hg19:g.73675916T>C		1					ALMS1_ENST00000377715.1_Silent_p.T753T|ALMS1_ENST00000409009.1_Silent_p.T711T	p.T753T	NM_015120.4	NP_055935	1	2	3	2.079998	Q8TCU4	ALMS1_HUMAN		8	2370	+			Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	1	1	hg19	c.2259T>C	CCDS42697.1	0																																																																																								0.457627		TCGA-IB-7890-01A-12D-2201-08	0.443	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	1	0	1	2	2	2	2	0	0	0	0	207	207	207	205	1	2.800000	-20.000000	1	0.360000	NM_015120		0	149	144	0	1010	997	1		1	0		0	0	207	0	0	1.000000	1.281800e-01	0	1	0	4	0	149	1010
ZNF804A	91752	broad.mit.edu	37	2	185801329	185801329	+	Silent	SNP	A	A	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr2:185801329A>G	ENST00000302277.6	+	4	1800	c.1206A>G	c.(1204-1206)tcA>tcG	p.S402S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	402							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TGGCCCCTTCAAATACTGAAG	0.388																																						ENST00000302277.6	1.000000	0.650000	0.990000	0.740000	0.850000	0.860113	0.850000	1.000000																										0				146						c.(1204-1206)tcA>tcG		zinc finger protein 804A							72.0	78.0	76.0					2																	185801329		2202	4299	6501	SO:0001819	synonymous_variant	91752	0	0					g.chr2:185801329A>G	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1206A>G	chr2.hg19:g.185801329A>G		1						p.S402S	NM_194250.1	NP_919226.1	1	2	3	2.027219	Q7Z570	Z804A_HUMAN		4	1800	+			A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	1	1	hg19	c.1206A>G	CCDS2291.1	1																																																																																								0.450077		TCGA-IB-7890-01A-12D-2201-08	0.388	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	71	1	2.800000	-20.000000	1	0.360000	NM_194250		0	57	56	0	379	377	1		1			0	0	73	0	0	1.000000	0	0	0	0	0	0	57	379
TMCC1	23023	broad.mit.edu	37	3	129370592	129370592	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr3:129370592T>A	ENST00000393238.3	-	6	2034	c.1694A>T	c.(1693-1695)cAg>cTg	p.Q565L	TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L|TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	565						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CTGCTGCTGCTGCAGCTCCAT	0.572																																						ENST00000393238.3	0.230000	0.040000	0.180000	0.070000	0.120000	0.130371	0.120000	0.120000																									PLXND1/TMCC1(4)	0				25						c.(1693-1695)cAg>cTg		transmembrane and coiled-coil domain family 1							79.0	76.0	77.0					3																	129370592		2203	4300	6503	SO:0001583	missense	23023	0	0					g.chr3:129370592T>A	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1694A>T	chr3.hg19:g.129370592T>A	ENSP00000376930:p.Gln565Leu	1					TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L|TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L	p.Q565L	NM_001017395.3	NP_001017395.2	1	3	4	2.397542	O94876	TMCC1_HUMAN		6	2034	-			A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	0	1	hg19	c.1694A>T	CCDS33855.1	0	.	.	.	.	.	.	.	.	.	.	T	20.6	4.009576	0.75046	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	L	0.46614	1.455	0.80722	D	1	D;D	0.67145	0.996;0.985	D;D	0.85130	0.997;0.973	T	0.58278	-0.7664	10	0.33940	T	0.23	-18.4911	15.1509	0.72696	0.0:0.0:0.0:1.0	.	386;565	B4DE04;O94876	.;TMCC1_HUMAN	L	241;565;451;386	ENSP00000404711:Q241L;ENSP00000376930:Q565L;ENSP00000389892:Q451L;ENSP00000327349:Q386L	ENSP00000327349:Q386L	Q	-	2	0	0	TMCC1	130853282	130853282	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.735000	0.84939	2.172000	0.68678	0.533000	0.62120	CAG	0.529412		TCGA-IB-7890-01A-12D-2201-08	0.572	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	0	0	1	2	2	2	2	0	0	0	0	102	102	102	103	1	2.800000	-2.087369	0	0.360000	NM_015008		0	7	6	0	454	468	0		1	0		0	0	102	0	0	0.982627	3.361927e-01	0	0	0	70	0	7	454
IGSF10	285313	broad.mit.edu	37	3	151155880	151155880	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr3:151155880C>A	ENST00000282466.3	-	6	6468	c.6469G>T	c.(6469-6471)Gac>Tac	p.D2157Y	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2157	Ig-like C2-type 8.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACAGCTGTGTCTCCAGCTTTG	0.443																																						ENST00000282466.3	1.000000	0.820000	1.000000	0.920000	0.990000	0.973781	0.990000	1.000000																										0				116						c.(6469-6471)Gac>Tac		immunoglobulin superfamily, member 10							116.0	104.0	108.0					3																	151155880		2203	4300	6503	SO:0001583	missense	285313	0	0					g.chr3:151155880C>A	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6469G>T	chr3.hg19:g.151155880C>A	ENSP00000282466:p.Asp2157Tyr	1					IGSF10_ENST00000495443.1_5'UTR	p.D2157Y	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	1	3	4	2.397542	Q6WRI0	IGS10_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)	6	6468	-			Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	1	1	hg19	c.6469G>T	CCDS3160.1	1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170322	0.57584	.	.	ENSG00000152580	ENST00000282466	T	0.30714	1.52	5.86	5.86	0.93980	5.86	5.86	0.93980	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.270973	0.25968	N	0.027154	T	0.51669	0.1688	L	0.47016	1.485	0.58432	D	0.999999	D;D	0.63880	0.993;0.984	D;P	0.68192	0.956;0.847	T	0.47787	-0.9090	10	0.87932	D	0	.	20.1865	0.98220	0.0:1.0:0.0:0.0	.	2157;184	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	Y	2157	ENSP00000282466:D2157Y	ENSP00000282466:D2157Y	D	-	1	0	0	IGSF10	152638570	152638570	1.000000	0.71417	0.734000	0.30879	0.291000	0.27294	5.741000	0.68638	2.775000	0.95449	0.655000	0.94253	GAC	0.529412		TCGA-IB-7890-01A-12D-2201-08	0.443	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	71	1	2.800000	-20.000000	1	0.360000	NM_178822		0	69	67	0	433	428	1		1			0	0	73	0	0	1.000000	0	0	0	0	0	0	69	433
ZNF385D	79750	broad.mit.edu	37	3	21462858	21462858	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr3:21462858C>T	ENST00000281523.2	-	8	1554	c.1036G>A	c.(1036-1038)Gca>Aca	p.A346T		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	346	Poly-Ala.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						actgctgctgcggctgctgca	0.517																																						ENST00000281523.2	1.000000	0.670000	1.000000	0.840000	0.990000	0.943939	0.990000	1.000000																										0				46						c.(1036-1038)Gca>Aca		zinc finger protein 385D							34.0	38.0	37.0					3																	21462858		2203	4300	6503	SO:0001583	missense	79750	6	121336	35				g.chr3:21462858C>T	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.1036G>A	chr3.hg19:g.21462858C>T	ENSP00000281523:p.Ala346Thr	0						p.A346T	NM_024697.2	NP_078973.1	1	2	3	1.763537	Q9H6B1	Z385D_HUMAN		8	1554	-				Missense_Mutation	SNP	ENST00000281523.2	1	1	hg19	c.1036G>A	CCDS2636.1	1	.	.	.	.	.	.	.	.	.	.	C	8.978	0.974663	0.18736	.	.	ENSG00000151789	ENST00000281523	T	0.33865	1.39	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.053442	0.85682	D	0.000000	T	0.31009	0.0783	L	0.34521	1.04	0.48452	D	0.999653	B	0.25390	0.125	B	0.13407	0.009	T	0.05582	-1.0876	10	0.19590	T	0.45	-47.3476	20.6593	0.99626	0.0:1.0:0.0:0.0	.	346	Q9H6B1	Z385D_HUMAN	T	346	ENSP00000281523:A346T	ENSP00000281523:A346T	A	-	1	0	0	ZNF385D	21437862	21437862	0.998000	0.40836	0.210000	0.23637	0.083000	0.17756	3.858000	0.55979	2.887000	0.99086	0.650000	0.86243	GCA	0.364575		TCGA-IB-7890-01A-12D-2201-08	0.517	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	2.800000	-20.000000	1	0.360000	NM_024697		0	20	18	0	88	81	1		1			0	0	32	0	0	0.999994	0	0	0	0	0	0	20	88
GLB1	2720	broad.mit.edu	37	3	33038656	33038656	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr3:33038656C>T	ENST00000399402.3	-	16	1956	c.1825G>A	c.(1825-1827)Gtg>Atg	p.V609M	GLB1_ENST00000307377.8_Missense_Mutation_p.V508M|GLB1_ENST00000445488.2_Missense_Mutation_p.V687M|GLB1_ENST00000307363.5_Missense_Mutation_p.V639M	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	639					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GGCCTGTCCACGAACGTCACA	0.527																																						ENST00000399402.3	1.000000	0.710000	1.000000	0.790000	0.890000	0.892979	0.890000	1.000000																										0				21						c.(1825-1827)Gtg>Atg		galactosidase, beta 1							104.0	101.0	102.0					3																	33038656		2065	4194	6259	SO:0001583	missense	2720	0	0					g.chr3:33038656C>T	M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.1825G>A	chr3.hg19:g.33038656C>T	ENSP00000382333:p.Val609Met	0					GLB1_ENST00000445488.2_Missense_Mutation_p.V687M|GLB1_ENST00000307363.5_Missense_Mutation_p.V639M|GLB1_ENST00000307377.8_Missense_Mutation_p.V508M	p.V609M	NM_001079811.1	NP_001073279	1	2	3	1.763537	P16278	BGAL_HUMAN		16	1956	-		Melanoma(143;0.104)	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	ENST00000399402.3	1	1	hg19	c.1825G>A	CCDS43062.1	1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241095	0.39598	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83	5.44	4.54	0.55810	5.44	4.54	0.55810	Galactose-binding domain-like (1);	0.238643	0.42964	D	0.000639	D	0.94971	0.8373	M	0.67700	2.07	0.37730	D	0.925223	D;D;D;D	0.64830	0.987;0.994;0.987;0.987	P;P;P;P	0.46299	0.46;0.511;0.46;0.46	D	0.95168	0.8287	10	0.48119	T	0.1	-10.5338	15.5983	0.76606	0.0:0.8614:0.1386:0.0	.	639;508;639;687	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	M	609;639;687;508	ENSP00000382333:V609M;ENSP00000306920:V639M;ENSP00000393377:V687M;ENSP00000305920:V508M	ENSP00000306920:V639M	V	-	1	0	0	GLB1	33013660	33013660	0.991000	0.36638	0.794000	0.32065	0.166000	0.22503	2.596000	0.46205	1.253000	0.44018	0.555000	0.69702	GTG	0.364575		TCGA-IB-7890-01A-12D-2201-08	0.527	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	0	0	1	2	2	2	2	0	0	0	0	136	136	136	133	1	2.800000	-20.000000	1	0.360000	NM_000404		0	74	73	0	390	380	1		1	1		0	0	136	0	0	1.000000	1	0	23	0	119	0	74	390
CCDC39	339829	broad.mit.edu	37	3	180334120	180334120	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr3:180334120T>G	ENST00000442201.2	-	19	2737	c.2618A>C	c.(2617-2619)aAa>aCa	p.K873T	TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	873	Ser-rich.				axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ACGACTGCCTTTTGTGCTAGC	0.373																																						ENST00000442201.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				45						c.(2617-2619)aAa>aCa		coiled-coil domain containing 39							113.0	106.0	108.0					3																	180334120		1874	4112	5986	SO:0001583	missense	339829	0	0					g.chr3:180334120T>G	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2618A>C	chr3.hg19:g.180334120T>G	ENSP00000405708:p.Lys873Thr	1					TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	p.K873T	NM_181426.1	NP_852091.1	1	3	4	2.397542	Q9UFE4	CCD39_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)	19	2737	-	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	1	1	hg19	c.2618A>C	CCDS46964.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.12|13.12	2.143344|2.143344	0.37825|0.37825	.|.	.|.	ENSG00000145075|ENSG00000145075	ENST00000473854|ENST00000489868;ENST00000442201	.|.	.|.	.|.	5.23|5.23	0.0174|0.0174	0.14112|0.14112	5.23|5.23	0.0174|0.0174	0.14112|0.14112	.|.	.|.	.|.	.|.	.|.	T|T	0.16854|0.16854	0.0405|0.0405	N|N	0.20685|0.20685	0.6|0.6	0.09310|0.09310	N|N	1|1	.|B	.|0.13145	.|0.007	.|B	.|0.15484	.|0.013	T|T	0.24297|0.24297	-1.0164|-1.0164	6|8	0.41790|0.21014	T|T	0.15|0.42	.|.	0.3031|0.3031	0.00276|0.00276	0.2106:0.1895:0.2605:0.3393|0.2106:0.1895:0.2605:0.3393	.|.	.|873	.|Q9UFE4	.|CCD39_HUMAN	Q|T	57|45;873	.|.	ENSP00000418482:K57Q|ENSP00000405708:K873T	K|K	-|-	1|2	0|0	0|0	CCDC39|CCDC39	181816814|181816814	181816814|181816814	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.089000|0.089000	0.18198|0.18198	-0.057000|-0.057000	0.11768|0.11768	0.399000|0.399000	0.25367|0.25367	0.374000|0.374000	0.22700|0.22700	AAG|AAA	0.529412		TCGA-IB-7890-01A-12D-2201-08	0.373	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	2.800000	-20.000000	1	0.360000	XM_291028		0	113	113	0	182	176	1		1	0		0	0	26	0	0	1.000000	4.962553e-01	0	0	0	4	0	113	182
AGPAT9	84803	broad.mit.edu	37	4	84508424	84508424	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr4:84508424A>T	ENST00000395226.2	+	5	714	c.496A>T	c.(496-498)Att>Ttt	p.I166F	AGPAT9_ENST00000264409.4_Missense_Mutation_p.I166F	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	166					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				CTTGGCTTTCATTGGGATCAG	0.398																																						ENST00000395226.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				13						c.(496-498)Att>Ttt		1-acylglycerol-3-phosphate O-acyltransferase 9							158.0	155.0	156.0					4																	84508424		2203	4300	6503	SO:0001583	missense	84803	0	0					g.chr4:84508424A>T	AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.496A>T	chr4.hg19:g.84508424A>T	ENSP00000378651:p.Ile166Phe	1					AGPAT9_ENST00000264409.4_Missense_Mutation_p.I166F	p.I166F	NM_001256421.1	NP_001243350.1	1	2	3	2.062099	Q53EU6	GPAT3_HUMAN		5	714	+		Hepatocellular(203;0.114)	Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	ENST00000395226.2	1	1	hg19	c.496A>T	CCDS3606.1	1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.739003	0.49045	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	T;T	0.49432	0.78;0.78	5.55	-1.01	0.10169	5.55	-1.01	0.10169	.	0.147943	0.64402	N	0.000012	T	0.30572	0.0769	L	0.46670	1.46	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.04693	-1.0933	10	0.21540	T	0.41	-12.882	4.0871	0.09951	0.6087:0.1039:0.0645:0.223	.	166	Q53EU6	GPAT3_HUMAN	F	166	ENSP00000378651:I166F;ENSP00000264409:I166F	ENSP00000264409:I166F	I	+	1	0	0	AGPAT9	84727448	84727448	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.057000	0.64294	0.038000	0.15604	0.528000	0.53228	ATT	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.398	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	1	0	1	2	2	2	2	0	0	0	0	126	126	126	125	1	2.800000	-20.000000	1	0.360000	NM_032717		0	182	182	0	501	489	1		1	1		0	0	126	0	0	1.000000	4.032278e-01	0	3	0	2	0	182	501
COL25A1	84570	broad.mit.edu	37	4	109784536	109784536	+	Missense_Mutation	SNP	C	C	T	rs199876449		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr4:109784536C>T	ENST00000399132.1	-	21	1621	c.1091G>A	c.(1090-1092)cGg>cAg	p.R364Q	COL25A1_ENST00000399126.1_Missense_Mutation_p.R364Q|COL25A1_ENST00000399127.1_Missense_Mutation_p.R360Q	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TGCTTCCCCCCGTTCACCCTG	0.502																																						ENST00000399132.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				49						c.(1090-1092)cGg>cAg		collagen, type XXV, alpha 1		C	GLN/ARG,GLN/ARG	0,3672		0,0,1836	45.0	46.0	46.0		1091,1091	4.7	1.0	4		46	1,8175		0,1,4087	yes	missense,missense	COL25A1	NM_032518.2,NM_198721.1	43,43	0,1,5923	TT,TC,CC		0.0122,0.0,0.0084	possibly-damaging,possibly-damaging	364/643,364/655	109784536	1,11847	1836	4088	5924	SO:0001583	missense	84570	13	120798	40				g.chr4:109784536C>T	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1091G>A	chr4.hg19:g.109784536C>T	ENSP00000382083:p.Arg364Gln	1					COL25A1_ENST00000399126.1_Missense_Mutation_p.R364Q|COL25A1_ENST00000399127.1_Missense_Mutation_p.R360Q	p.R364Q	NM_198721.2	NP_942014.1	1	2	3	2.062099				21	1621	-		Hepatocellular(203;0.217)		Missense_Mutation	SNP	ENST00000399132.1	1	1	hg19	c.1091G>A	CCDS43258.1	1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.472391	0.63737	0.0	1.22E-4	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;T;D	0.93547	-3.24;2.3;-3.24	5.52	4.69	0.59074	5.52	4.69	0.59074	.	0.121454	0.50627	D	0.000106	D	0.94019	0.8084	L	0.33293	1	0.42993	D	0.994495	D;D	0.76494	0.999;0.998	D;D	0.79108	0.975;0.992	D	0.93272	0.6652	9	.	.	.	-7.1172	14.6461	0.68762	0.0:0.9299:0.0:0.0701	.	364;364	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	Q	364;366;345;360;364;294	ENSP00000382083:R364Q;ENSP00000382078:R360Q;ENSP00000382077:R364Q	.	R	-	2	0	0	COL25A1	110003985	110003985	0.997000	0.39634	0.997000	0.53966	0.955000	0.61496	2.451000	0.44952	1.332000	0.45431	-0.128000	0.14901	CGG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.502	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	2.800000	-4.293586	1	0.360000	NM_032518		0	60	57	0	178	175	1		1			0	0	29	0	0	1.000000	0	0	0	0	0	0	60	178
PCDHGA6	56109	broad.mit.edu	37	5	140755877	140755877	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr5:140755877G>A	ENST00000517434.1	+	1	2227	c.2227G>A	c.(2227-2229)Gtg>Atg	p.V743M	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	743					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V743M(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGTGGGCGTGGAAGGGGT	0.612																																						ENST00000517434.1	1.000000	0.700000	1.000000	0.790000	0.900000	0.901044	0.900000	1.000000																										1	Substitution - Missense(1)	p.V743M(1)	large_intestine(1)	2						c.(2227-2229)Gtg>Atg		protocadherin gamma subfamily A, 6							75.0	80.0	78.0					5																	140755877		2203	4300	6503	SO:0001583	missense	56109	0	0					g.chr5:140755877G>A	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2227G>A	chr5.hg19:g.140755877G>A	ENSP00000429601:p.Val743Met	1					PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	p.V743M	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	1	2	3	2.041096	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2227	+			A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	1	1	hg19	c.2227G>A	CCDS54926.1	1	.	.	.	.	.	.	.	.	.	.	.	7.493	0.651010	0.14516	.	.	ENSG00000253731	ENST00000517434	T	0.50548	0.74	5.15	-0.377	0.12501	5.15	-0.377	0.12501	.	0.398307	0.14856	N	0.294369	T	0.45115	0.1326	M	0.81497	2.545	0.20638	N	0.99987	B;B	0.30482	0.095;0.281	B;B	0.24394	0.053;0.043	T	0.40997	-0.9533	10	0.51188	T	0.08	.	9.8004	0.40761	0.4966:0.0:0.5034:0.0	.	743;743	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	M	743	ENSP00000429601:V743M	ENSP00000429601:V743M	V	+	1	0	0	PCDHGA6	140736061	140736061	0.000000	0.05858	0.756000	0.31282	0.025000	0.11179	-0.171000	0.09883	0.011000	0.14865	-0.812000	0.03155	GTG	0.452617		TCGA-IB-7890-01A-12D-2201-08	0.612	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	1	0	1	2	2	2	2	0	0	0	0	146	146	146	140	1	2.800000	-19.999990	1	0.360000	NM_018919		0	58	56	0	360	348	1		1	0		0	0	146	0	0	1.000000	9.824316e-02	0	0	0	4	0	58	360
GPR98	84059	broad.mit.edu	37	5	89977223	89977223	+	Silent	SNP	T	T	C			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr5:89977223T>C	ENST00000405460.2	+	27	5712	c.5616T>C	c.(5614-5616)ttT>ttC	p.F1872F		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1872	Calx-beta 13. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGTCACTCTTTGTCAGTGGAA	0.423																																						ENST00000405460.2	1.000000	0.670000	1.000000	0.810000	0.970000	0.925406	0.970000	1.000000																										0				269						c.(5614-5616)ttT>ttC		G protein-coupled receptor 98							94.0	89.0	91.0					5																	89977223		1887	4112	5999	SO:0001819	synonymous_variant	84059	0	0					g.chr5:89977223T>C	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5616T>C	chr5.hg19:g.89977223T>C		1						p.F1872F	NM_032119.3	NP_115495.3	0	2	2	1.734642	Q8WXG9	GPR98_HUMAN		27	5712	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	1	1	hg19	c.5616T>C	CCDS47246.1	1																																																																																								0.360000		TCGA-IB-7890-01A-12D-2201-08	0.423	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	2.800000	-17.103450	1	0.360000	NM_032119		0	28	28	0	132	128	1		1			0	0	22	0	0	1.000000	0	0	0	0	0	0	28	132
GPR151	134391	broad.mit.edu	37	5	145895652	145895652	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr5:145895652A>C	ENST00000311104.2	-	1	101	c.25T>G	c.(25-27)Tct>Gct	p.S9A		NM_194251.2	NP_919227.2	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(2)	14			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGAGTTAGAGTCTGCAAAG	0.498																																					Pancreas(78;420 1386 18535 37114 49710)	ENST00000311104.2	1.000000	0.730000	1.000000	0.800000	0.890000	0.896039	0.890000	1.000000																										0				14						c.(25-27)Tct>Gct		G protein-coupled receptor 151							83.0	90.0	87.0					5																	145895652		2203	4300	6503	SO:0001583	missense	134391	0	0					g.chr5:145895652A>C	AY255557	CCDS34266.1	5q32	2012-08-21						"""GPCR / Class A : Orphans"""	23624	protein-coding gene	gene with protein product	"""galanin receptor 4"""					12679517	Standard	NM_194251		Approved	PGR7, GALR4	uc003lod.1	Q8TDV0		ENST00000311104.2:c.25T>G	chr5.hg19:g.145895652A>C	ENSP00000308733:p.Ser9Ala	1						p.S9A	NM_194251.2	NP_919227.2	1	2	3	2.041096	Q8TDV0	GP151_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	1	101	-			Q86SN8|Q8NGV2	Missense_Mutation	SNP	ENST00000311104.2	1	1	hg19	c.25T>G	CCDS34266.1	1	.	.	.	.	.	.	.	.	.	.	A	2.160	-0.392320	0.04932	.	.	ENSG00000173250	ENST00000311104	T	0.37915	1.17	5.9	3.48	0.39840	5.9	3.48	0.39840	.	0.650871	0.16005	N	0.234105	T	0.25082	0.0609	L	0.54323	1.7	0.21967	N	0.999449	B	0.06786	0.001	B	0.06405	0.002	T	0.36529	-0.9744	10	0.07482	T	0.82	.	2.9555	0.05875	0.6321:0.1483:0.0774:0.1422	.	9	Q8TDV0	GP151_HUMAN	A	9	ENSP00000308733:S9A	ENSP00000308733:S9A	S	-	1	0	0	GPR151	145875845	145875845	0.992000	0.36948	0.959000	0.39883	0.576000	0.36127	1.388000	0.34442	0.465000	0.27167	-0.353000	0.07706	TCT	0.452617		TCGA-IB-7890-01A-12D-2201-08	0.498	GPR151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373457.1	1	0	1	2	2	2	2	0	0	0	0	165	165	165	164	1	2.800000	-20.000000	1	0.360000	NM_194251		0	96	95	0	604	599	1		1			0	0	165	0	0	1.000000	0	0	0	0	0	0	96	604
GCM2	9247	broad.mit.edu	37	6	10882008	10882008	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr6:10882008G>A	ENST00000379491.4	-	1	166	c.19C>T	c.(19-21)Cag>Tag	p.Q7*	RP11-637O19.2_ENST00000436249.3_RNA|RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	7					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				ACCGCTTCCTGCACCGCGGCC	0.602																																						ENST00000379491.4	1.000000	0.680000	1.000000	0.810000	0.950000	0.920909	0.950000	1.000000																										0				30						c.(19-21)Cag>Tag		glial cells missing homolog 2 (Drosophila)							34.0	33.0	34.0					6																	10882008		2201	4300	6501	SO:0001587	stop_gained	9247	0	0					g.chr6:10882008G>A	AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.19C>T	chr6.hg19:g.10882008G>A	ENSP00000368805:p.Gln7*	0					RP11-637O19.2_ENST00000436249.3_RNA|SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	p.Q7*	NM_004752.3	NP_004743.1	1	2	3	1.757599	O75603	GCM2_HUMAN		1	166	-	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	D3GDV6|Q5THN5	Nonsense_Mutation	SNP	ENST00000379491.4	0	1	hg19	c.19C>T	CCDS4517.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.409039	0.96072	.	.	ENSG00000124827	ENST00000379491	.	.	.	5.23	3.37	0.38596	5.23	3.37	0.38596	.	0.740013	0.12306	N	0.480643	.	.	.	.	.	.	0.22552	N	0.998994	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	0.1498	8.3322	0.32193	0.0:0.401:0.476:0.123	.	.	.	.	X	7	.	ENSP00000368805:Q7X	Q	-	1	0	0	GCM2	10989994	10989994	0.000000	0.05858	0.008000	0.14137	0.053000	0.15095	0.153000	0.16323	1.155000	0.42497	0.561000	0.74099	CAG	0.362296		TCGA-IB-7890-01A-12D-2201-08	0.602	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039844.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	62	1	2.800000	-20.000000	1	0.360000			0	35	34	0	170	167	0		1	0		0	0	63	0	0	1.000000	0	0	0	0	1	0	35	170
NRSN1	140767	broad.mit.edu	37	6	24146060	24146060	+	Silent	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr6:24146060C>T	ENST00000378491.4	+	4	775	c.474C>T	c.(472-474)atC>atT	p.I158I		NM_080723.4	NP_542454.3			neurensin 1									p.I158I(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						AAGAACGAATCGCAGACATCA	0.498																																						ENST00000378491.4	1.000000	0.670000	1.000000	0.780000	0.890000	0.890551	0.890000	1.000000																										1	Substitution - coding silent(1)	p.I158I(1)	lung(1)	22						c.(472-474)atC>atT		neurensin 1							60.0	62.0	61.0					6																	24146060		2203	4300	6503	SO:0001819	synonymous_variant	140767	3	121412	32				g.chr6:24146060C>T	AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.474C>T	chr6.hg19:g.24146060C>T		0						p.I158I	NM_080723.4	NP_542454.3	1	2	3	1.757599				4	775	+				Silent	SNP	ENST00000378491.4	1	1	hg19	c.474C>T	CCDS4549.1	1																																																																																								0.362296		TCGA-IB-7890-01A-12D-2201-08	0.498	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043866.1	1	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	2.800000	-3.097887	1	0.360000	NM_080723		0	47	47	0	245	243	1		1			0	0	88	0	0	1.000000	0	0	0	0	0	0	47	245
SRPK1	6732	broad.mit.edu	37	6	35810348	35810348	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr6:35810348C>T	ENST00000373825.2	-	14	1939	c.1654G>A	c.(1654-1656)Gaa>Aaa	p.E552K	SRPK1_ENST00000373822.1_Missense_Mutation_p.E444K|SRPK1_ENST00000423325.2_Missense_Mutation_p.E536K					SRSF protein kinase 1									p.E551Q(1)		endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						GAATGAGGTTCAAACAAATAG	0.418																																					NSCLC(31;67 978 16289 24856 26454)	ENST00000373825.2	1.000000	0.690000	1.000000	0.830000	0.990000	0.939225	0.990000	1.000000																										1	Substitution - Missense(1)	p.E551Q(1)	lung(1)	21						c.(1654-1656)Gaa>Aaa		SRSF protein kinase 1							79.0	73.0	75.0					6																	35810348		1904	4127	6031	SO:0001583	missense	6732	0	0					g.chr6:35810348C>T	U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1654G>A	chr6.hg19:g.35810348C>T	ENSP00000362931:p.Glu552Lys	0					SRPK1_ENST00000373822.1_Missense_Mutation_p.E444K|SRPK1_ENST00000423325.2_Missense_Mutation_p.E536K	p.E552K			1	2	3	1.779925				14	1939	-				Missense_Mutation	SNP	ENST00000373825.2	1	1	hg19	c.1654G>A	CCDS47415.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.529797	0.96446	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325;ENST00000373822	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.18	5.18	0.71444	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.58764	0.2145	N	0.11154	0.105	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.85130	0.997;0.991	T	0.70425	-0.4875	9	0.87932	D	0	-17.1778	19.0463	0.93020	0.0:1.0:0.0:0.0	.	536;552	B4DS61;Q96SB4	.;SRPK1_HUMAN	K	552;568;536;444	ENSP00000362931:E552K;ENSP00000354674:E568K;ENSP00000391069:E536K;ENSP00000362928:E444K	ENSP00000354674:E568K	E	-	1	0	0	SRPK1	35918326	35918326	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.442000	0.80503	2.572000	0.86782	0.491000	0.48974	GAA	0.366838		TCGA-IB-7890-01A-12D-2201-08	0.418	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040319.3	1	0	1	2	2	2	2	0	0	0	0	32	32	32	31	1	2.800000	-20.000000	1	0.360000	NM_003137		0	28	27	0	130	125	1		1	1		0	0	32	0	0	1.000000	9.990422e-01	0	21	0	33	0	28	130
TRRAP	8295	broad.mit.edu	37	7	98609827	98609827	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr7:98609827T>A	ENST00000359863.4	+	72	11638	c.11429T>A	c.(11428-11430)cTg>cAg	p.L3810Q	TRRAP_ENST00000355540.3_Missense_Mutation_p.L3781Q|AC004893.11_ENST00000360902.1_RNA|TRRAP_ENST00000446306.3_Missense_Mutation_p.L3799Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3810	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTGGTGTCCCTGGTTCAGAAA	0.597																																						ENST00000359863.4	0.500000	0.130000	0.390000	0.190000	0.280000	0.300712	0.280000	0.270000																										0				176						c.(11428-11430)cTg>cAg		transformation/transcription domain-associated protein							64.0	57.0	59.0					7																	98609827		2203	4300	6503	SO:0001583	missense	8295	0	0					g.chr7:98609827T>A	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.11429T>A	chr7.hg19:g.98609827T>A	ENSP00000352925:p.Leu3810Gln	1					AC004893.11_ENST00000360902.1_RNA|TRRAP_ENST00000446306.3_Missense_Mutation_p.L3799Q|TRRAP_ENST00000355540.3_Missense_Mutation_p.L3781Q	p.L3810Q	NM_001244580.1	NP_001231509.1	1	2	3	2.079462	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)	72	11638	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	1	1	hg19	c.11429T>A	CCDS59066.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.30|14.30	2.495074|2.495074	0.44352|0.44352	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	D;D|.	0.84298|.	-1.83;-1.83|.	5.44|5.44	4.27|4.27	0.50696|0.50696	5.44|5.44	4.27|4.27	0.50696|0.50696	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (2);|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.62024|0.62024	0.2394|0.2394	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D;P;D|.	0.60160|.	0.987;0.956;0.978|.	P;P;P|.	0.62089|.	0.898;0.601;0.737|.	T|T	0.58323|0.58323	-0.7656|-0.7656	10|5	0.18710|.	T|.	0.47|.	.|.	12.5371|12.5371	0.56147|0.56147	0.0:0.0:0.1395:0.8605|0.0:0.0:0.1395:0.8605	.|.	3781;3538;3810|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	Q|R	3810;3781;3798|3539	ENSP00000352925:L3810Q;ENSP00000347733:L3781Q|.	ENSP00000347733:L3781Q|.	L|W	+|+	2|1	0|0	0|0	TRRAP|TRRAP	98447763|98447763	98447763|98447763	1.000000|1.000000	0.71417|0.71417	0.167000|0.167000	0.22817|0.22817	0.021000|0.021000	0.10359|0.10359	7.690000|7.690000	0.84178|0.84178	0.881000|0.881000	0.35993|0.35993	-0.313000|-0.313000	0.08912|0.08912	CTG|TGG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.597	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	57	1	2.800000	-10.748270	1	0.360000	NM_003496		0	8	8	0	185	180	0		1	1		0	0	59	0	0	0.988668	5.700693e-01	0	3	0	40	0	8	185
FAM83H	286077	broad.mit.edu	37	8	144808660	144808660	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr8:144808660G>A	ENST00000388913.3	-	5	3096	c.2971C>T	c.(2971-2973)Cag>Tag	p.Q991*		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	991					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CCGTTCTCCTGCGGCACTGGG	0.692																																						ENST00000388913.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999981	0.990000	1.000000																										0				21						c.(2971-2973)Cag>Tag		family with sequence similarity 83, member H							11.0	13.0	13.0					8																	144808660		1971	4118	6089	SO:0001587	stop_gained	286077	0	0					g.chr8:144808660G>A	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2971C>T	chr8.hg19:g.144808660G>A	ENSP00000373565:p.Gln991*	1						p.Q991*	NM_198488.3	NP_940890	2	3	5	2.664308	Q6ZRV2	FA83H_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)	5	3096	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		A0JLS2|Q8N4W0	Nonsense_Mutation	SNP	ENST00000388913.3	0	1	hg19	c.2971C>T	CCDS6410.2	1	.	.	.	.	.	.	.	.	.	.	g	25.1	4.597837	0.87055	.	.	ENSG00000180921	ENST00000388913	.	.	.	5.01	5.01	0.66863	5.01	5.01	0.66863	.	2.505490	0.02148	N	0.057769	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.2957	0.49277	0.0:0.0:0.7074:0.2926	.	.	.	.	X	991	.	ENSP00000373565:Q991X	Q	-	1	0	0	FAM83H	144880648	144880648	0.998000	0.40836	0.913000	0.36048	0.106000	0.19336	2.042000	0.41222	2.334000	0.79466	0.550000	0.68814	CAG	0.582953		TCGA-IB-7890-01A-12D-2201-08	0.692	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	1	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	2.800000	-20.000000	1	0.360000	NM_198488		0	29	29	0	103	101	0		1	1		0	0	35	0	0	1.000000	9.691176e-01	0	7	0	16	0	29	103
GPR124	25960	broad.mit.edu	37	8	37692836	37692836	+	Missense_Mutation	SNP	G	G	A	rs532653294		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr8:37692836G>A	ENST00000412232.2	+	12	1766	c.1753G>A	c.(1753-1755)Gag>Aag	p.E585K	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	585					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			ACCTGAGCCCGAGCCCCCAGC	0.687													G|||	1	0.000199681	0.0	0.0	5008	,	,		13603	0.0		0.0	False		,,,				2504	0.001					ENST00000412232.2	1.000000	0.490000	0.990000	0.630000	0.800000	0.804000	0.800000	1.000000																										0				37						c.(1753-1755)Gag>Aag		G protein-coupled receptor 124							28.0	35.0	32.0					8																	37692836		2202	4300	6502	SO:0001583	missense	25960	2	121396	33				g.chr8:37692836G>A	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1753G>A	chr8.hg19:g.37692836G>A	ENSP00000406367:p.Glu585Lys	1					GPR124_ENST00000315215.7_Intron	p.E585K	NM_032777.9	NP_116166.9	0	2	2	1.817945	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)	12	1766	+			A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	1	1	hg19	c.1753G>A	CCDS6097.2	0	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481400	0.84747	.	.	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.57907	0.37	5.34	5.34	0.76211	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000001	T	0.55545	0.1927	N	0.22421	0.69	0.58432	D	0.999996	D	0.76494	0.999	P	0.57679	0.825	T	0.53920	-0.8370	10	0.34782	T	0.22	-25.1986	18.6353	0.91376	0.0:0.0:1.0:0.0	.	585	Q96PE1	GP124_HUMAN	K	578;585	ENSP00000406367:E585K	ENSP00000406367:E585K	E	+	1	0	0	GPR124	37811994	37811994	1.000000	0.71417	0.565000	0.28409	0.052000	0.14988	7.123000	0.77176	2.507000	0.84556	0.655000	0.94253	GAG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.687	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	2.800000	-20.000000	1	0.360000			0	17	16	0	101	100	1		1	0		0	0	61	0	0	0.999974	9.999996e-01	0	0	0	176	0	17	101
PRKDC	5591	broad.mit.edu	37	8	48790345	48790345	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr8:48790345C>T	ENST00000314191.2	-	41	5356	c.5300G>A	c.(5299-5301)cGg>cAg	p.R1767Q	PRKDC_ENST00000338368.3_Missense_Mutation_p.R1767Q|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1768					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CTGCTGTTCCCGACAAAGAAC	0.383								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	ENST00000314191.2	0.640000	0.350000	0.560000	0.410000	0.480000	0.493380	0.480000	0.500000																										0				147						c.(5299-5301)cGg>cAg	Non-homologous end-joining	protein kinase, DNA-activated, catalytic polypeptide	Caffeine(DB00201)						125.0	121.0	122.0					8																	48790345		1868	4103	5971	SO:0001583	missense	5591	0	0					g.chr8:48790345C>T		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.5300G>A	chr8.hg19:g.48790345C>T	ENSP00000313420:p.Arg1767Gln	1					PRKDC_ENST00000338368.3_Missense_Mutation_p.R1767Q|PRKDC_ENST00000523565.1_5'UTR	p.R1767Q	NM_006904.6	NP_008835.5	2	3	5	2.664308	P78527	PRKDC_HUMAN		41	5356	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	1	1	hg19	c.5300G>A		0	.	.	.	.	.	.	.	.	.	.	C	31	5.098326	0.94197	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.63580	-0.05;-0.05	5.65	5.65	0.86999	5.65	5.65	0.86999	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81569	0.4850	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.83324	-0.0016	10	0.87932	D	0	.	19.7092	0.96085	0.0:1.0:0.0:0.0	.	1767;1768	E7EUY0;P78527	.;PRKDC_HUMAN	Q	1767	ENSP00000313420:R1767Q;ENSP00000345182:R1767Q	ENSP00000313420:R1767Q	R	-	2	0	0	PRKDC	48952898	48952898	1.000000	0.71417	0.996000	0.52242	0.677000	0.39632	5.203000	0.65174	2.664000	0.90586	0.585000	0.79938	CGG	0.582953		TCGA-IB-7890-01A-12D-2201-08	0.383	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	2.800000	-2.135519	0	0.360000	NM_001081640		0	48	47	0	796	787	0		1	1		0	0	102	0	0	1.000000	9.371534e-01	0	5	0	73	0	48	796
PXDNL	137902	broad.mit.edu	37	8	52321614	52321614	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr8:52321614G>A	ENST00000356297.4	-	17	2670	c.2570C>T	c.(2569-2571)gCg>gTg	p.A857V	PXDNL_ENST00000543296.1_Missense_Mutation_p.A857V	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	857					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CATGCAGGGCGCGTGGGTGCC	0.682																																						ENST00000356297.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				48						c.(2569-2571)gCg>gTg		peroxidasin homolog (Drosophila)-like							19.0	23.0	22.0					8																	52321614		2025	4143	6168	SO:0001583	missense	137902	0	0					g.chr8:52321614G>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2570C>T	chr8.hg19:g.52321614G>A	ENSP00000348645:p.Ala857Val	1					PXDNL_ENST00000543296.1_Missense_Mutation_p.A857V	p.A857V	NM_144651.4	NP_653252	2	3	5	2.664308	A1KZ92	PXDNL_HUMAN		17	2670	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	1	1	hg19	c.2570C>T	CCDS47855.1	1	.	.	.	.	.	.	.	.	.	.	G	7.521	0.656623	0.14580	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.68479	-0.33;-0.33	3.49	0.493	0.16878	3.49	0.493	0.16878	.	0.753446	0.11213	N	0.587551	T	0.38746	0.1052	N	0.11756	0.17	0.09310	N	1	P	0.37398	0.593	B	0.29862	0.108	T	0.15009	-1.0452	10	0.30854	T	0.27	.	4.9674	0.14098	0.2166:0.1744:0.609:0.0	.	857	A1KZ92	PXDNL_HUMAN	V	857	ENSP00000348645:A857V;ENSP00000444865:A857V	ENSP00000348645:A857V	A	-	2	0	0	PXDNL	52484167	52484167	0.814000	0.29104	0.000000	0.03702	0.000000	0.00434	3.338000	0.52128	-0.162000	0.10964	-1.087000	0.02190	GCG	0.582953		TCGA-IB-7890-01A-12D-2201-08	0.682	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	1	0	1	2	2	2	2	0	0	0	0	33	33	33	31	1	2.800000	-20.000000	1	0.360000	NM_144651		0	66	66	0	125	121	0		1			0	0	33	0	0	1.000000	0	0	0	0	0	0	66	125
EPPK1	83481	broad.mit.edu	37	8	144945204	144945204	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr8:144945204C>T	ENST00000525985.1	-	2	2289	c.2218G>A	c.(2218-2220)Gtg>Atg	p.V740M				P58107	EPIPL_HUMAN	epiplakin 1	740						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCACGTCCACGGGCACGCGG	0.657																																						ENST00000525985.1	1.000000	0.730000	1.000000	0.830000	0.940000	0.927141	0.940000	1.000000																										0				71						c.(2218-2220)Gtg>Atg		epiplakin 1							77.0	82.0	81.0					8																	144945204		2043	4160	6203	SO:0001583	missense	83481	2	120830	37				g.chr8:144945204C>T	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.2218G>A	chr8.hg19:g.144945204C>T	ENSP00000436337:p.Val740Met	1						p.V740M			3	3	6	2.621629	P58107	EPIPL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)	2	2289	-	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	1	1	hg19	c.2218G>A		1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.058913	0.76074	.	.	ENSG00000227184	ENST00000525985	T	0.77877	-1.13	5.06	5.06	0.68205	5.06	5.06	0.68205	.	.	.	.	.	D	0.89298	0.6675	M	0.87971	2.92	0.32551	N	0.532326	D	0.89917	1.0	D	0.75484	0.986	D	0.91472	0.5197	9	0.59425	D	0.04	.	15.9742	0.80049	0.0:1.0:0.0:0.0	.	740	E9PPU0	.	M	740	ENSP00000436337:V740M	ENSP00000436337:V740M	V	-	1	0	0	EPPK1	145017192	145017192	0.723000	0.28027	1.000000	0.80357	0.892000	0.51952	1.471000	0.35365	2.643000	0.89663	0.655000	0.94253	GTG	0.574468		TCGA-IB-7890-01A-12D-2201-08	0.657	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	0	0	1	2	2	2	2	0	0	0	0	168	168	168	174	1	2.800000	-19.999990	1	0.360000	NM_031308		0	76	71	0	619	574	0		1	0		0	0	168	0	0	1.000000	9.761841e-02	0	1	0	4	0	76	619
COL27A1	85301	broad.mit.edu	37	9	117062960	117062960	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr9:117062960G>A	ENST00000356083.3	+	51	5085	c.4694G>A	c.(4693-4695)gGc>gAc	p.G1565D		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1565	Collagen-like 16.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGGCCACCTGGCTTGATGGTG	0.612																																						ENST00000356083.3	1.000000	0.750000	1.000000	0.890000	0.990000	0.963554	0.990000	1.000000																										0				80						c.(4693-4695)gGc>gAc		collagen, type XXVII, alpha 1							40.0	39.0	39.0					9																	117062960		2203	4300	6503	SO:0001583	missense	85301	0	0					g.chr9:117062960G>A	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4694G>A	chr9.hg19:g.117062960G>A	ENSP00000348385:p.Gly1565Asp	1						p.G1565D	NM_032888.2	NP_116277.2	1	2	3	2.067747	Q8IZC6	CORA1_HUMAN		51	5085	+			Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	1	1	hg19	c.4694G>A	CCDS6802.1	1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667078	0.67814	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.99353	-5.77	5.4	5.4	0.78164	5.4	5.4	0.78164	.	.	.	.	.	D	0.99694	0.9884	H	0.98646	4.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97360	0.9969	9	0.87932	D	0	.	17.0516	0.86520	0.0:0.0:1.0:0.0	.	1565	Q8IZC6	CORA1_HUMAN	D	1565	ENSP00000348385:G1565D	ENSP00000348385:G1565D	G	+	2	0	0	COL27A1	116102781	116102781	1.000000	0.71417	0.998000	0.56505	0.120000	0.20174	8.906000	0.92626	2.711000	0.92665	0.655000	0.94253	GGC	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.612	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	2.800000	-20.000000	1	0.360000	NM_032888		0	30	29	0	155	152	1		1	1		0	0	54	0	0	1.000000	8.340496e-01	0	2	0	17	0	30	155
C9orf89	84270	broad.mit.edu	37	9	95875280	95875280	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr9:95875280A>G	ENST00000375464.2	+	6	571	c.443A>G	c.(442-444)aAg>aGg	p.K148R	C9orf89_ENST00000488630.1_3'UTR	NM_032310.3	NP_115686.3	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	155					negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						CTAGACCCCAAGGGCCTGCCA	0.602																																						ENST00000375464.2	0.610000	0.060000	0.390000	0.130000	0.240000	0.270673	0.240000	0.210000																										0				7						c.(442-444)aAg>aGg		chromosome 9 open reading frame 89							45.0	46.0	45.0					9																	95875280		2203	4298	6501	SO:0001583	missense	84270	4	121150	33				g.chr9:95875280A>G	AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000375464.2:c.443A>G	chr9.hg19:g.95875280A>G	ENSP00000364613:p.Lys148Arg	1					C9orf89_ENST00000488630.1_3'UTR	p.K148R	NM_032310.3	NP_115686.3	1	2	3	2.067131	Q96LW7	BINCA_HUMAN		6	571	+			Q5BJH8|Q9BSY2	Missense_Mutation	SNP	ENST00000375464.2	0	1	hg19	c.443A>G	CCDS6702.2	0	.	.	.	.	.	.	.	.	.	.	A	7.776	0.708538	0.15239	.	.	ENSG00000165233	ENST00000375464	.	.	.	4.22	0.545	0.17190	4.22	0.545	0.17190	.	40.080900	0.00166	N	0.000000	T	0.27594	0.0678	.	.	.	0.24896	N	0.992137	B	0.14805	0.011	B	0.14578	0.011	T	0.11616	-1.0580	8	0.30854	T	0.27	.	3.211	0.06682	0.519:0.0:0.3042:0.1768	.	148	Q96LW7-2	.	R	148	.	ENSP00000364613:K148R	K	+	2	0	0	C9orf89	94915101	94915101	0.999000	0.42202	0.998000	0.56505	0.256000	0.26092	1.016000	0.29976	0.247000	0.21414	-0.411000	0.06167	AAG	0.455967		TCGA-IB-7890-01A-12D-2201-08	0.602	C9orf89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053128.1	0	0	0	2	2	2	2	0	0	0	0	32	32	32	32	1	2.800000	-6.482320	1	0.360000	NM_032310		0	3	2	0	93	87	0		1	0		0	0	32	0	0	0.787846	9.460907e-01	0	0	0	178	0	3	93
FBXW5	54461	broad.mit.edu	37	9	139838442	139838442	+	Missense_Mutation	SNP	C	C	G	rs552856691	byFrequency	TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chr9:139838442C>G	ENST00000325285.3	-	2	173	c.94G>C	c.(94-96)Gtg>Ctg	p.V32L	C8G_ENST00000224181.3_5'Flank|FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	32	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		TGGCGGCACACCAGCCCGGCG	0.701																																						ENST00000325285.3	1.000000	0.650000	1.000000	0.960000	0.990000	0.968432	0.990000	1.000000																										0				12						c.(94-96)Gtg>Ctg		F-box and WD repeat domain containing 5							9.0	10.0	10.0					9																	139838442		2130	4208	6338	SO:0001583	missense	54461	0	0					g.chr9:139838442C>G	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.94G>C	chr9.hg19:g.139838442C>G	ENSP00000313034:p.Val32Leu	1					FBXW5_ENST00000483559.1_5'UTR|C8G_ENST00000224181.3_5'Flank	p.V32L	NM_018998.3	NP_061871.1	1	2	3	2.047008	Q969U6	FBXW5_HUMAN	STAD - Stomach adenocarcinoma(284;0.19)	2	173	-	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	ENST00000325285.3	1	1	hg19	c.94G>C	CCDS7014.1	1	.	.	.	.	.	.	.	.	.	.	c	15.55	2.867242	0.51588	.	.	ENSG00000159069	ENST00000325285;ENST00000428398;ENST00000443788	T;T;T	0.54479	0.57;0.57;0.57	4.02	3.12	0.35913	4.02	3.12	0.35913	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.216848	0.40064	N	0.001182	T	0.60573	0.2279	M	0.91249	3.19	0.26388	N	0.976624	B	0.27286	0.174	B	0.33846	0.171	T	0.57476	-0.7805	10	0.41790	T	0.15	-9.6575	8.9065	0.35526	0.0:0.8956:0.0:0.1044	.	32	Q969U6	FBXW5_HUMAN	L	32	ENSP00000313034:V32L;ENSP00000404829:V32L;ENSP00000394011:V32L	ENSP00000313034:V32L	V	-	1	0	0	FBXW5	138958263	138958263	1.000000	0.71417	0.993000	0.49108	0.588000	0.36517	3.941000	0.56607	0.902000	0.36520	0.479000	0.44913	GTG	0.457627		TCGA-IB-7890-01A-12D-2201-08	0.701	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	1	0	1	2	2	2	2	0	0	0	0	21	21	21	20	1	2.800000	-16.160310	1	0.360000	NM_018998		0	7	6	0	27	27	0		1	1		0	0	21	0	0	0.982807	9.254406e-01	0	7	0	14	0	7	27
GUCY2F	2986	broad.mit.edu	37	X	108636151	108636151	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chrX:108636151G>A	ENST00000218006.2	-	13	2849	c.2558C>T	c.(2557-2559)aCg>aTg	p.T853M		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	853					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						AAGCTTTTCCGTTTTCTGTTT	0.383																																						ENST00000218006.2	0.980000	0.730000	0.930000	0.790000	0.860000	0.865296	0.860000	0.870000																										0				67						c.(2557-2559)aCg>aTg		guanylate cyclase 2F, retinal							211.0	176.0	188.0					X																	108636151		2203	4300	6503	SO:0001583	missense	2986	7	121408	43				g.chrX:108636151G>A	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2558C>T	chrX.hg19:g.108636151G>A	ENSP00000218006:p.Thr853Met							p.T853M	NM_001522.2	NP_001513.2	0	1	1		P51841	GUC2F_HUMAN		13	2849	-			Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	1	1	hg19	c.2558C>T	CCDS14545.1	1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527147	0.64860	.	.	ENSG00000101890	ENST00000218006	D	0.90385	-2.66	4.25	3.36	0.38483	4.25	3.36	0.38483	Haem NO binding associated (1);Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.108904	0.64402	D	0.000008	D	0.94473	0.8221	M	0.87097	2.86	0.58432	D	0.999998	D	0.65815	0.995	P	0.61874	0.895	D	0.94367	0.7592	10	0.87932	D	0	.	10.33	0.43816	0.0:0.0:0.8025:0.1975	.	853	P51841	GUC2F_HUMAN	M	853	ENSP00000218006:T853M	ENSP00000218006:T853M	T	-	2	0	0	GUCY2F	108522807	108522807	1.000000	0.71417	0.962000	0.40283	0.997000	0.91878	5.507000	0.66999	1.079000	0.41038	0.513000	0.50165	ACG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.383	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	1	0	1	2	14	2	2	0	0	0	1	92	92	92	90	1	2.800000	-20.000000	1	0.360000	NM_001522		0	108	103	0	236	233	1		1			0	0	92	0	0	1.000000	0	0	0	0	0	0	108	236
AMOT	154796	broad.mit.edu	37	X	112058796	112058796	+	Silent	SNP	C	C	T			TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chrX:112058796C>T	ENST00000524145.1	-	3	1256	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371958.1_Silent_p.Q162Q|AMOT_ENST00000304758.1_5'UTR			Q4VCS5	AMOT_HUMAN	angiomotin	394					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q394Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gctgctgctgctgttgttggt	0.582																																						ENST00000524145.1	0.230000	0.020000	0.160000	0.050000	0.090000	0.111291	0.090000	0.090000																										1	Substitution - coding silent(1)	p.Q394Q(1)	lung(1)	43						c.(1180-1182)caG>caA		angiomotin							38.0	34.0	36.0					X																	112058796		2203	4300	6503	SO:0001819	synonymous_variant	154796	0	0					g.chrX:112058796C>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1182G>A	chrX.hg19:g.112058796C>T							AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371958.1_Silent_p.Q162Q	p.Q394Q			0	1	1		Q4VCS5	AMOT_HUMAN		3	1256	-			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	0	1	hg19	c.1182G>A	CCDS48154.1	0																																																																																								0.360000		TCGA-IB-7890-01A-12D-2201-08	0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	2.800000	-2.477502	0	0.360000	NM_133265		0	3	3	0	93	92	0		1	0		0	0	33	1	0	0.809253	1.168132e-01	0	0	0	14	0	3	93
MAGEA3	4102	broad.mit.edu	37	X	151935450	151935450	+	Missense_Mutation	SNP	C	C	G	rs34645170		TCGA-IB-7890-01A-12D-2201-08	TCGA-IB-7890-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	adbc96e9-990e-4cc9-98c9-14fffe83ed87	e2f62463-40b9-41ef-9ffb-ad2fe036c920	g.chrX:151935450C>G	ENST00000393902.3	-	3	1284	c.717G>C	c.(715-717)ttG>ttC	p.L239F	MAGEA3_ENST00000370278.3_Missense_Mutation_p.L239F			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	239	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TGGGATCCCCCAAGATACTGT	0.537																																						ENST00000393902.3	0.990000	0.790000	0.960000	0.840000	0.890000	0.902064	0.890000	0.910000																										0				15						c.(715-717)ttG>ttC		melanoma antigen family A, 3		C	PHE/LEU	1,3833		0,1,0,1631,570	148.0	142.0	144.0		717	-2.8	0.0	X	dbSNP_126	144	1,6720		0,0,1,2428,1864	no	missense	MAGEA3	NM_005362.3	22	0,1,1,4059,2434	GG,GC,G,CC,C		0.0149,0.0261,0.0189	benign	239/315	151935450	2,10553	2202	4293	6495	SO:0001583	missense	4102	21	121202	45				g.chrX:151935450C>G		CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.717G>C	chrX.hg19:g.151935450C>G	ENSP00000377480:p.Leu239Phe						MAGEA3_ENST00000370278.3_Missense_Mutation_p.L239F	p.L239F			0	1	1		P43357	MAGA3_HUMAN		3	1284	-	Acute lymphoblastic leukemia(192;6.56e-05)		Q6FHI6	Missense_Mutation	SNP	ENST00000393902.3	0	1	hg19	c.717G>C	CCDS14715.1	1	15	0.009041591320072333	0	0.0	1	0.0027624309392265192	1	0.0017482517482517483	13	0.017150395778364115	c	0.243	-1.012051	0.02095	2.61E-4	1.49E-4	ENSG00000221867	ENST00000370278;ENST00000393902	T;T	0.04970	3.52;3.52	1.42	-2.84	0.05751	1.42	-2.84	0.05751	.	0.537671	0.21492	N	0.073674	T	0.00468	0.0015	N	0.00176	-1.92	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39781	-0.9597	9	0.09843	T	0.71	.	2.2524	0.04047	0.4558:0.312:0.2323:0.0	rs34645170	239	P43357	MAGA3_HUMAN	F	239	ENSP00000359301:L239F;ENSP00000377480:L239F	ENSP00000359301:L239F	L	-	3	2	2	MAGEA3	151686106	151686106	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.375000	0.02563	-0.539000	0.06273	-1.891000	0.00535	TTG	0.360000		TCGA-IB-7890-01A-12D-2201-08	0.537	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	0	0	1	2	2	2	2	0	0	0	0	161	161	161	160	1	2.800000	-3.318794	1	0.360000	NM_005362		0	163	138	0	334	332	1		1			0	0	161	0	0	1.000000	0	0	0	0	0	0	163	334
