#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
GAD2	2572	broad.mit.edu	37	10	26508064	26508064	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr10:26508064G>A	ENST00000376261.3	+	4	882	c.379G>A	c.(379-381)Gat>Aat	p.D127N	GAD2_ENST00000259271.3_Missense_Mutation_p.D127N|GAD2_ENST00000376248.1_Missense_Mutation_p.D13N	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	127					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GAAAAGTTTCGATAGATCAAC	0.393																																						ENST00000376261.3	0.670000	0.210000	5.400000e-01	2.900000e-01	0.400000	0.423258	0.400000	0.390000																										0				48						c.(379-381)Gat>Aat		glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)							123.0	121.0	122.0					10																	26508064		2203	4300	6503	SO:0001583	missense	2572	0	0					g.chr10:26508064G>A	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.379G>A	chr10.hg19:g.26508064G>A	ENSP00000365437:p.Asp127Asn	0					GAD2_ENST00000259271.3_Missense_Mutation_p.D127N|GAD2_ENST00000376248.1_Missense_Mutation_p.D13N	p.D127N	NM_001134366.1	NP_001127838.1	0	0	0	1.981470	Q05329	DCE2_HUMAN		4	882	+			Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	0	1	hg19	c.379G>A	CCDS7149.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.081306	0.94050	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000428517;ENST00000376248	T;T;T;T	0.59638	1.2;1.2;0.25;1.2	5.61	5.61	0.85477	5.61	5.61	0.85477	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.78285	0.4259	M	0.81497	2.545	0.80722	D	1	D;P	0.89917	1.0;0.903	D;B	0.87578	0.998;0.192	T	0.76691	-0.2866	10	0.37606	T	0.19	-20.8562	19.6436	0.95767	0.0:0.0:1.0:0.0	.	127;127	Q4G154;Q05329	.;DCE2_HUMAN	N	127;127;127;13	ENSP00000365437:D127N;ENSP00000259271:D127N;ENSP00000390434:D127N;ENSP00000365424:D13N	ENSP00000259271:D127N	D	+	1	0	0	GAD2	26548070	26548070	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.621000	0.88768	0.650000	0.86243	GAT	0.085366		TCGA-IB-7891-01A-11D-2201-08	0.393	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	0	0	1		2	2	2	0	0	0	0	100	0	100	100	1	2	-2.666951	1	0.100000	NM_000818		0	11	11	0	534	531	0	0	1	0		0	0	100	0	0	9.983088e-01	2.361929e-01	0	0	0	42	0	11	534
MICAL2	9645	broad.mit.edu	37	11	12278458	12278458	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr11:12278458C>T	ENST00000256194.4	+	24	3370	c.3082C>T	c.(3082-3084)Cgc>Tgc	p.R1028C	MICAL2_ENST00000342902.5_Missense_Mutation_p.R1007C|MICAL2_ENST00000379612.3_Missense_Mutation_p.R802C|MICAL2_ENST00000537344.1_Missense_Mutation_p.R838C|MICAL2_ENST00000527546.1_Missense_Mutation_p.R838C	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1028	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GGAGTGTTTCCGCTGCAGCAT	0.607																																						ENST00000256194.4	1.000000	0.780000	9.900000e-01	8.700000e-01	0.950000	0.939154	0.950000	0.990000																										0				47						c.(3082-3084)Cgc>Tgc		microtubule associated monooxygenase, calponin and LIM domain containing 2							112.0	91.0	98.0					11																	12278458		2201	4294	6495	SO:0001583	missense	9645	2	121412	32				g.chr11:12278458C>T	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3082C>T	chr11.hg19:g.12278458C>T	ENSP00000256194:p.Arg1028Cys	1					MICAL2_ENST00000537344.1_Missense_Mutation_p.R838C|MICAL2_ENST00000527546.1_Missense_Mutation_p.R838C|MICAL2_ENST00000342902.5_Missense_Mutation_p.R1007C|MICAL2_ENST00000379612.3_Missense_Mutation_p.R802C	p.R1028C	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	0	1	1	1.870329	O94851	MICA2_HUMAN		24	3370	+			B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	1	1	hg19	c.3082C>T	CCDS7809.1	1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832011	0.71258	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33	5.17	3.13	0.36017	5.17	3.13	0.36017	Zinc finger, LIM-type (5);	0.145385	0.40064	N	0.001192	D	0.89829	0.6828	M	0.69463	2.115	0.43734	D	0.996226	D;B;B;D;B;B	0.89917	1.0;0.015;0.019;0.977;0.019;0.024	D;B;B;P;B;B	0.65874	0.939;0.007;0.005;0.832;0.008;0.024	D	0.88234	0.2905	10	0.54805	T	0.06	.	5.9676	0.19334	0.4069:0.4919:0.0:0.1012	.	371;1007;838;781;802;1028	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	C	838;371;1028;838;1007;802	ENSP00000441689:R838C;ENSP00000256194:R1028C;ENSP00000433965:R838C;ENSP00000344894:R1007C;ENSP00000368932:R802C	ENSP00000256194:R1028C	R	+	1	0	0	MICAL2	12235034	12235034	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.222000	0.58580	1.180000	0.42898	0.655000	0.94253	CGC	0.052632		TCGA-IB-7891-01A-11D-2201-08	0.607	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	1	0	1		2	2	2	0	0	0	0	73	0	73	73	1	2	-2.841672	1	0.100000	NM_014632		0	29	29	0	307	305	0	0	1	1		0	0	73	0	0	1	9.997447e-01	0	13	0	124	0	29	307
GDPD5	81544	broad.mit.edu	37	11	75152278	75152278	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr11:75152278G>A	ENST00000336898.3	-	14	2240	c.1403C>T	c.(1402-1404)gCg>gTg	p.A468V	GDPD5_ENST00000533784.1_Missense_Mutation_p.A349V|GDPD5_ENST00000529721.1_Missense_Mutation_p.A468V|GDPD5_ENST00000376282.3_Missense_Mutation_p.A349V|GDPD5_ENST00000533805.1_Missense_Mutation_p.A223V|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000526177.1_Missense_Mutation_p.A330V	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	468	GP-PDE.				cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)	p.A468V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						TGGGACCCCCGCACACCACAG	0.657																																						ENST00000336898.3	1.000000	0.610000	1	8.000000e-01	0.990000	0.930913	0.990000	1.000000																										1	Substitution - Missense(1)	p.A468V(1)	large_intestine(1)	20						c.(1402-1404)gCg>gTg		glycerophosphodiester phosphodiesterase domain containing 5							105.0	68.0	80.0					11																	75152278		2200	4293	6493	SO:0001583	missense	81544	3	121412	35				g.chr11:75152278G>A	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1403C>T	chr11.hg19:g.75152278G>A	ENSP00000337972:p.Ala468Val	0					GDPD5_ENST00000526177.1_Missense_Mutation_p.A330V|GDPD5_ENST00000376282.3_Missense_Mutation_p.A349V|GDPD5_ENST00000529721.1_Missense_Mutation_p.A468V|GDPD5_ENST00000533784.1_Missense_Mutation_p.A349V|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000533805.1_Missense_Mutation_p.A223V	p.A468V	NM_030792.6	NP_110419.5	0	1	1	1.998681	Q8WTR4	GDPD5_HUMAN		14	2240	-			Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	ENST00000336898.3	1	1	hg19	c.1403C>T	CCDS8238.1	1	.	.	.	.	.	.	.	.	.	.	g	12.44	1.938166	0.34189	.	.	ENSG00000158555	ENST00000526177;ENST00000533784;ENST00000529721;ENST00000336898;ENST00000533805;ENST00000376282;ENST00000534322	T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56	4.84	3.93	0.45458	4.84	3.93	0.45458	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.567129	0.19640	N	0.109472	T	0.36717	0.0977	L	0.32530	0.975	0.32212	N	0.576458	P;B	0.40360	0.714;0.15	B;B	0.34138	0.176;0.02	T	0.45862	-0.9232	10	0.25751	T	0.34	-13.6432	11.2242	0.48873	0.0897:0.0:0.9103:0.0	.	349;468	Q8WTR4-2;Q8WTR4	.;GDPD5_HUMAN	V	330;349;468;468;223;349;52	ENSP00000434050:A330V;ENSP00000437049:A349V;ENSP00000433214:A468V;ENSP00000337972:A468V;ENSP00000435196:A223V;ENSP00000365459:A349V;ENSP00000435728:A52V	ENSP00000337972:A468V	A	-	2	0	0	GDPD5	74829926	74829926	0.958000	0.32768	0.015000	0.15790	0.379000	0.30106	4.329000	0.59260	1.416000	0.47057	0.645000	0.84053	GCG	0.094112		TCGA-IB-7891-01A-11D-2201-08	0.657	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	1	0	1		2	2	2	0	0	0	0	78	0	78	77	1	2	-2.917329	1	0.100000	NM_030792		0	15	15	0	270	267	0	0	1	1		0	0	78	0	0	9.998736e-01	8.401311e-01	0	3	0	59	0	15	270
DSCAML1	57453	broad.mit.edu	37	11	117387200	117387200	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr11:117387200C>T	ENST00000321322.6	-	8	1946	c.1945G>A	c.(1945-1947)Gtt>Att	p.V649I	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V379I	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	589	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCTACGTGAACGCTCTGGCTG	0.632																																						ENST00000321322.6	1.000000	0.550000	1	7.200000e-01	0.930000	0.887000	0.930000	1.000000																										0				110						c.(1945-1947)Gtt>Att		Down syndrome cell adhesion molecule like 1							99.0	79.0	86.0					11																	117387200		2201	4296	6497	SO:0001583	missense	57453	1	121396	30				g.chr11:117387200C>T		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1945G>A	chr11.hg19:g.117387200C>T	ENSP00000315465:p.Val649Ile	0					DSCAML1_ENST00000527706.1_Missense_Mutation_p.V379I	p.V649I	NM_020693.2	NP_065744.2	0	1	1	1.998681	Q8TD84	DSCL1_HUMAN		8	1946	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	1	1	hg19	c.1945G>A	CCDS8384.1	1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098394	0.37048	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.77750	-1.12;-1.12	3.95	3.95	0.45737	3.95	3.95	0.45737	Immunoglobulin-like fold (1);	.	.	.	.	T	0.70168	0.3193	L	0.39020	1.185	0.54753	D	0.999985	B	0.32918	0.39	B	0.33846	0.171	T	0.69847	-0.5034	9	0.33141	T	0.24	.	16.528	0.84336	0.0:1.0:0.0:0.0	.	589	Q8TD84	DSCL1_HUMAN	I	379;649;356	ENSP00000434335:V379I;ENSP00000315465:V649I	ENSP00000315465:V649I	V	-	1	0	0	DSCAML1	116892410	116892410	0.998000	0.40836	0.961000	0.40146	0.497000	0.33675	3.807000	0.55591	2.202000	0.70862	0.462000	0.41574	GTT	0.094112		TCGA-IB-7891-01A-11D-2201-08	0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	1	0	1		2	2	2	0	0	0	0	90	0	90	90	1	2	-16.403120	1	0.100000	NM_020693		0	15	14	0	303	302	0	0	1	0		0	0	90	0	0	9.998755e-01	3.417779e-02	0	0	0	6	0	15	303
GRIN2B	2904	broad.mit.edu	37	12	13717016	13717016	+	Silent	SNP	G	G	A	rs543452359		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr12:13717016G>A	ENST00000609686.1	-	13	3365	c.3156C>T	c.(3154-3156)caC>caT	p.H1052H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1052					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCAAGTCGTCGTGGCCACTGT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		17988	0.001		0.0	False		,,,				2504	0.0					ENST00000609686.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.998495	0.990000	1.000000																										0				143						c.(3154-3156)caC>caT		glutamate receptor, ionotropic, N-methyl D-aspartate 2B	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)						61.0	52.0	55.0					12																	13717016		2203	4300	6503	SO:0001819	synonymous_variant	2904	1	121412	35				g.chr12:13717016G>A		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3156C>T	chr12.hg19:g.13717016G>A		0						p.H1052H	NM_000834.3	NP_000825.2	1	2	3	2.055412	Q13224	NMDE2_HUMAN		13	3365	-			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	1	1	hg19	c.3156C>T	CCDS8662.1	1																																																																																								0.117647		TCGA-IB-7891-01A-11D-2201-08	0.572	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2	1	0	1		2	2	2	0	0	0	0	37	0	37	37	1	2	-19.900610	1	0.100000			0	15	15	0	160	155	0	0	1			0	0	37	0	0	9.998632e-01	0	0	0	0	0	0	15	160
USP15	9958	broad.mit.edu	37	12	62715327	62715327	+	Silent	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr12:62715327C>T	ENST00000280377.5	+	5	616	c.558C>T	c.(556-558)aaC>aaT	p.N186N	USP15_ENST00000550632.1_3'UTR|USP15_ENST00000353364.3_Silent_p.N186N|USP15_ENST00000393654.3_Silent_p.N186N|USP15_ENST00000312635.6_Silent_p.N186N	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	186					BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ACATGAGTAACACATTTGAAC	0.333																																					Melanoma(181;615 2041 39364 49691 50001)	ENST00000280377.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999994	0.990000	1.000000																										0				37						c.(556-558)aaC>aaT		ubiquitin specific peptidase 15							79.0	80.0	79.0					12																	62715327		2203	4300	6503	SO:0001819	synonymous_variant	9958	0	0					g.chr12:62715327C>T	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.558C>T	chr12.hg19:g.62715327C>T		0					USP15_ENST00000550632.1_3'UTR|USP15_ENST00000312635.6_Silent_p.N186N|USP15_ENST00000393654.3_Silent_p.N186N|USP15_ENST00000353364.3_Silent_p.N186N	p.N186N	NM_001252078.1	NP_001239007.1	1	2	3	2.055412	Q9Y4E8	UBP15_HUMAN	GBM - Glioblastoma multiforme(1;0.000276)	5	616	+			Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	1	1	hg19	c.558C>T	CCDS58251.1	1	.	.	.	.	.	.	.	.	.	.	C	8.794	0.931159	0.18131	.	.	ENSG00000135655	ENST00000549237	.	.	.	5.42	0.448	0.16614	5.42	0.448	0.16614	.	.	.	.	.	T	0.57417	0.2052	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49624	-0.8920	4	.	.	.	-16.2298	9.7353	0.40384	0.0:0.3589:0.0:0.6411	.	.	.	.	I	182	.	.	T	+	2	0	0	USP15	61001594	61001594	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.192000	0.32150	-0.160000	0.11002	-0.295000	0.09555	ACA	0.117647		TCGA-IB-7891-01A-11D-2201-08	0.333	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	1	0	1		2	2	2	0	0	0	0	36	0	36	35	1	2	-11.612690	1	0.100000	NM_006313		0	27	27	0	227	226	1	0	1	1		0	0	36	0	0	1	8.622018e-01	0	3	0	29	0	27	227
HEATR5A	25938	broad.mit.edu	37	14	31785103	31785103	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr14:31785103C>T	ENST00000389961.3	-	26	4072	c.4073G>A	c.(4072-4074)cGa>cAa	p.R1358Q	HEATR5A_ENST00000439348.1_Missense_Mutation_p.R1358Q|HEATR5A_ENST00000543095.2_Missense_Mutation_p.R1364Q|HEATR5A_ENST00000439727.1_Missense_Mutation_p.R1071Q			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1358										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		ATGAACTCTTCGGAGATCATT	0.343																																						ENST00000389961.3	1.000000	0.370000	1	6.300000e-01	0.960000	0.856391	0.960000	1.000000																										0				26						c.(4072-4074)cGa>cAa		HEAT repeat containing 5A							40.0	36.0	37.0					14																	31785103		1838	4096	5934	SO:0001583	missense	25938	6	119840	33				g.chr14:31785103C>T	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.4073G>A	chr14.hg19:g.31785103C>T	ENSP00000374611:p.Arg1358Gln	0					HEATR5A_ENST00000439727.1_Missense_Mutation_p.R1071Q|HEATR5A_ENST00000543095.2_Missense_Mutation_p.R1364Q|HEATR5A_ENST00000439348.1_Missense_Mutation_p.R1358Q	p.R1358Q			0	0	0	1.957353	Q86XA9	HTR5A_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	26	4072	-	Hepatocellular(127;0.0877)|Breast(36;0.137)		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	0	1	hg19	c.4073G>A		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.09|17.09	3.301200|3.301200	0.60195|0.60195	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000538864|ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	.|T;T;T;T	.|0.55052	.|0.54;0.54;0.54;0.54	5.39|5.39	5.39|5.39	0.77823|0.77823	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	.|0.070047	.|0.64402	.|D	.|0.000017	T|T	0.44244|0.44244	0.1284|0.1284	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	.|P	.|0.34892	.|0.474	.|B	.|0.34652	.|0.187	T|T	0.46582|0.46582	-0.9181|-0.9181	5|10	.|0.56958	.|D	.|0.05	.|.	9.7874|9.7874	0.40684|0.40684	0.0:0.847:0.0:0.153|0.0:0.847:0.0:0.153	.|.	.|1358	.|Q86XA9-2	.|.	K|Q	992|1358;1358;1071;1364	.|ENSP00000374611:R1358Q;ENSP00000405407:R1358Q;ENSP00000408681:R1071Q;ENSP00000437968:R1364Q	.|ENSP00000374611:R1358Q	E|R	-|-	1|2	0|0	0|0	HEATR5A|HEATR5A	30854854|30854854	30854854|30854854	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.972000|3.972000	0.56838|0.56838	2.531000|2.531000	0.85337|0.85337	0.563000|0.563000	0.77884|0.77884	GAA|CGA	0.074074		TCGA-IB-7891-01A-11D-2201-08	0.343	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	1		2	2	2	0	0	0	0	11	0	11	10	1	2	-8.418516	1	0.100000	NM_015473		0	4	4	0	63	63	1	0	1	1		0	0	11	0	0	8.924538e-01	5.670895e-01	0	6	0	22	0	4	63
LRRK1	79705	broad.mit.edu	37	15	101593294	101593294	+	Splice_Site	SNP	G	G	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr15:101593294G>T	ENST00000388948.3	+	25	4215		c.e25+1		RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Splice_Site	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTACCGGCAGGTAAGCGGGTC	0.582																																						ENST00000388948.3	1.000000	0.730000	1	8.900000e-01	0.990000	0.958345	0.990000	1.000000																										0				72						c.e25+1		leucine-rich repeat kinase 1							35.0	42.0	40.0					15																	101593294		2041	4179	6220	SO:0001630	splice_region_variant	79705	0	0					g.chr15:101593294G>T	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3856+1G>T	chr15.hg19:g.101593294G>T		0					LRRK1_ENST00000284395.5_Splice_Site|RP11-505E24.2_ENST00000559857.1_RNA		NM_024652.3	NP_078928.3	0	0	0	1.926108			OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)	25	4215	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)			Splice_Site	SNP	ENST00000388948.3	1	1	hg19		CCDS42086.1	1	.	.	.	.	.	.	.	.	.	.	G	8.642	0.896292	0.17686	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	.	.	.	4.79	4.79	0.61399	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0726	0.59070	0.0:0.0:0.8402:0.1598	.	.	.	.	.	-1	.	.	.	+	.	.	.	LRRK1	99410817	99410817	1.000000	0.71417	1.000000	0.80357	0.168000	0.22595	5.192000	0.65115	2.352000	0.79861	0.650000	0.86243	.	0.058577		TCGA-IB-7891-01A-11D-2201-08	0.582	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	1	0	1		2	2	2	0	0	0	0	39	0	39	36	1	2	-19.996220	1	0.100000	NM_024652	Intron	0	16	15	0	171	167	0	0	1	0		0	0	39	0	0	9.999325e-01	0	0	1	0	0	0	16	171
XYLT1	64131	broad.mit.edu	37	16	17211716	17211716	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr16:17211716C>T	ENST00000261381.6	-	11	2428	c.2344G>A	c.(2344-2346)Gtc>Atc	p.V782I		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	782					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACCCAAATGACGGTCACGGTC	0.557																																						ENST00000261381.6	1.000000	0.990000	1	9.900000e-01	0.990000	0.999955	0.990000	1.000000																										0				67						c.(2344-2346)Gtc>Atc		xylosyltransferase I							188.0	155.0	166.0					16																	17211716		2197	4300	6497	SO:0001583	missense	64131	8	121412	40				g.chr16:17211716C>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2344G>A	chr16.hg19:g.17211716C>T	ENSP00000261381:p.Val782Ile	0						p.V782I	NM_022166.3	NP_071449.1	0	1	1	1.997319	Q86Y38	XYLT1_HUMAN		11	2428	-			Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	1	1	hg19	c.2344G>A	CCDS10569.1	1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690680	0.48097	.	.	ENSG00000103489	ENST00000261381	T	0.48201	0.82	4.98	1.94	0.25998	4.98	1.94	0.25998	.	0.110450	0.64402	N	0.000009	T	0.28732	0.0712	N	0.21373	0.66	0.58432	D	0.999995	P	0.51933	0.949	B	0.41374	0.355	T	0.02797	-1.1109	10	0.21014	T	0.42	-34.163	9.245	0.37520	0.0:0.7638:0.0:0.2362	.	782	Q86Y38	XYLT1_HUMAN	I	782	ENSP00000261381:V782I	ENSP00000261381:V782I	V	-	1	0	0	XYLT1	17119217	17119217	0.996000	0.38824	0.294000	0.24946	0.888000	0.51559	3.356000	0.52269	0.222000	0.20900	0.462000	0.41574	GTC	0.093656		TCGA-IB-7891-01A-11D-2201-08	0.557	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	1	0	1		2	2	2	0	0	0	0	93	0	93	91	1	2	-11.570400	1	0.100000	NM_022166		0	37	36	0	382	376	0	0	1	1		0	0	93	0	0	1	7.230593e-01	0	2	0	26	0	37	382
SPACA3	124912	broad.mit.edu	37	17	31322436	31322436	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:31322436C>T	ENST00000269053.3	+	2	114	c.44C>T	c.(43-45)tCa>tTa	p.S15L	SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000394638.1_Intron|SPACA3_ENST00000580599.1_5'UTR	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	15					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			GGGGTGCACTCAAGCCCTGTT	0.607																																						ENST00000269053.3	1.000000	0.870000	1	9.900000e-01	0.990000	0.991823	0.990000	1.000000																										0				18						c.(43-45)tCa>tTa		sperm acrosome associated 3							70.0	73.0	72.0					17																	31322436		2203	4300	6503	SO:0001583	missense	124912	0	0					g.chr17:31322436C>T	AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.44C>T	chr17.hg19:g.31322436C>T	ENSP00000269053:p.Ser15Leu	0					SPACA3_ENST00000394638.1_Intron|SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000580599.1_5'UTR	p.S15L	NM_173847.3	NP_776246.1	1	2	3	2.020142	Q8IXA5	SACA3_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.193)	2	114	+			Q7Z4Y5	Missense_Mutation	SNP	ENST00000269053.3	1	1	hg19	c.44C>T	CCDS11275.1	1	.	.	.	.	.	.	.	.	.	.	c	12.96	2.094702	0.36952	.	.	ENSG00000141316	ENST00000269053;ENST00000394637	T	0.70282	-0.47	3.91	2.9	0.33743	3.91	2.9	0.33743	.	3.623610	0.01194	N	0.007405	T	0.60340	0.2261	N	0.19112	0.55	0.09310	N	1	P	0.37061	0.58	B	0.34536	0.185	T	0.50440	-0.8828	10	0.72032	D	0.01	-4.9368	9.1863	0.37172	0.2182:0.7818:0.0:0.0	.	15	Q8IXA5	SACA3_HUMAN	L	15;16	ENSP00000269053:S15L	ENSP00000269053:S15L	S	+	2	0	0	SPACA3	28346549	28346549	0.004000	0.15560	0.000000	0.03702	0.003000	0.03518	1.526000	0.35964	-1.019000	0.03358	-0.640000	0.03970	TCA	0.110232		TCGA-IB-7891-01A-11D-2201-08	0.607	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256380.1	1	0	1		2	2	2	0	0	0	0	115	0	115	111	1	2	-7.086114	1	0.100000	NM_173847		0	28	26	0	423	414	0	0	1			0	0	115	0	0	1	0	0	0	0	0	0	28	423
GPR179	440435	broad.mit.edu	37	17	36486065	36486065	+	Silent	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:36486065C>T	ENST00000342292.4	-	11	3407	c.3387G>A	c.(3385-3387)tcG>tcA	p.S1129S	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1129					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTAGCCTGGGCGATCGGGAGG	0.627																																						ENST00000342292.4	0.880000	0.320000	7.300000e-01	4.300000e-01	0.560000	0.583490	0.560000	0.550000																										0				60						c.(3385-3387)tcG>tcA		G protein-coupled receptor 179							70.0	74.0	73.0					17																	36486065		2002	4169	6171	SO:0001819	synonymous_variant	440435	14	120824	43				g.chr17:36486065C>T		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3387G>A	chr17.hg19:g.36486065C>T		1					GPR179_ENST00000584976.1_5'Flank	p.S1129S	NM_001004334.2	NP_001004334.2	1	4	5	2.349228	Q6PRD1	GP179_HUMAN		11	3407	-	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)		Silent	SNP	ENST00000342292.4	0	1	hg19	c.3387G>A	CCDS42308.1	0																																																																																								0.217391		TCGA-IB-7891-01A-11D-2201-08	0.627	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2	0	0	1		2	2	2	0	0	0	0	127	0	127	122	1	2	-3.433975	1	0.100000			0	14	14	0	571	567	0	0	1			0	0	127	0	0	9.997391e-01	0	0	0	0	0	0	14	571
FBXO47	494188	broad.mit.edu	37	17	37119246	37119246	+	Missense_Mutation	SNP	C	C	G	rs140430888	byFrequency	TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:37119246C>G	ENST00000378079.2	-	2	232	c.33G>C	c.(31-33)ttG>ttC	p.L11F		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	11										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						GGTTGGGAATCAAAGTGAAAT	0.363																																						ENST00000378079.2			0	0																														0				20						c.(31-33)ttG>ttC		F-box protein 47							161.0	165.0	164.0					17																	37119246		2202	4300	6502	SO:0001583	missense	494188	156	121408	54				g.chr17:37119246C>G		CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.33G>C	chr17.hg19:g.37119246C>G	ENSP00000367319:p.Leu11Phe							p.L11F	NM_001008777.2	NP_001008777.2					Q5MNV8	FBX47_HUMAN		2	232	-			B2RTZ4	Missense_Mutation	SNP	ENST00000378079.2	1	0	hg19	c.33G>C	CCDS32639.1		.	.	.	.	.	.	.	.	.	.	C	11.13	1.547742	0.27652	.	.	ENSG00000204952	ENST00000378079	T	0.48201	0.82	4.69	4.69	0.59074	4.69	4.69	0.59074	.	0.532223	0.16454	N	0.213717	T	0.30572	0.0769	L	0.32530	0.975	0.35373	D	0.789263	P	0.39216	0.664	B	0.32289	0.143	T	0.29671	-1.0004	10	0.11485	T	0.65	-0.178	11.1322	0.48354	0.0:0.813:0.187:0.0	.	11	Q5MNV8	FBX47_HUMAN	F	11	ENSP00000367319:L11F	ENSP00000367319:L11F	L	-	3	2	2	FBXO47	34372772	34372772	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	1.816000	0.38992	2.151000	0.67156	0.313000	0.20887	TTG			TCGA-IB-7891-01A-11D-2201-08	0.363	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	1	0	1		2	2	2	0	0	0	0	116	0	116	116	1	2	-3.300245	1	0.100000	NM_001008777		0	143	140	0	624	616	1	0	1			0	0	116	0	0	1	0	0	0	0	0	0	143	624
EFTUD2	9343	broad.mit.edu	37	17	42961062	42961062	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:42961062C>G	ENST00000426333.2	-	5	678	c.381G>C	c.(379-381)gaG>gaC	p.E127D	EFTUD2_ENST00000591382.1_Missense_Mutation_p.E127D|EFTUD2_ENST00000402521.3_Missense_Mutation_p.E92D|EFTUD2_ENST00000592576.1_Missense_Mutation_p.E127D|EFTUD2_ENST00000589211.1_5'Flank|RN7SL405P_ENST00000582502.1_RNA	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	127	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				TTCTGATGAGCTCTGAGTTAT	0.438																																					Ovarian(10;65 485 10258 29980 30707)	ENST00000426333.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999611	0.990000	1.000000																										0				32						c.(379-381)gaG>gaC		elongation factor Tu GTP binding domain containing 2							125.0	117.0	120.0					17																	42961062		2203	4300	6503	SO:0001583	missense	9343	0	0					g.chr17:42961062C>G	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.381G>C	chr17.hg19:g.42961062C>G	ENSP00000392094:p.Glu127Asp	0					EFTUD2_ENST00000591382.1_Missense_Mutation_p.E127D|EFTUD2_ENST00000402521.3_Missense_Mutation_p.E92D|EFTUD2_ENST00000589211.1_5'Flank|RN7SL405P_ENST00000582502.1_RNA|EFTUD2_ENST00000592576.1_Missense_Mutation_p.E127D	p.E127D	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	0	1	1	1.988717	Q15029	U5S1_HUMAN		5	678	-		Prostate(33;0.109)	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	1	1	hg19	c.381G>C	CCDS11489.1	1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.782446	0.31502	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.76839	-1.05;-1.05	5.23	2.11	0.27256	5.23	2.11	0.27256	.	0.097934	0.64402	D	0.000002	T	0.63200	0.2491	L	0.37800	1.135	0.51233	D	0.999919	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.51450	-0.8704	10	0.15499	T	0.54	-30.6821	8.7092	0.34374	0.0:0.6381:0.0:0.3619	.	127;127	B4DMC0;Q15029	.;U5S1_HUMAN	D	127;117;92	ENSP00000392094:E127D;ENSP00000385873:E92D	ENSP00000262414:E117D	E	-	3	2	2	EFTUD2	40316588	40316588	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.674000	0.25218	0.778000	0.33520	-0.170000	0.13304	GAG	0.091826		TCGA-IB-7891-01A-11D-2201-08	0.438	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	1	0	1		2	2	2	0	0	0	0	70	0	70	70	1	2	-9.584255	1	0.100000	NM_004247		0	30	30	0	332	328	0	0	1	1		0	0	70	0	0	1	9.979058e-01	0	22	0	83	0	30	332
ITGA3	3675	broad.mit.edu	37	17	48151552	48151552	+	Silent	SNP	C	C	T	rs78768954	byFrequency	TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:48151552C>T	ENST00000320031.8	+	9	1620	c.1290C>T	c.(1288-1290)ttC>ttT	p.F430F	ITGA3_ENST00000544892.1_Silent_p.F205F|ITGA3_ENST00000007722.7_Silent_p.F430F	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	430					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TGGCCACCTTCGGCTATTCCC	0.612													C|||	3	0.000599042	0.0023	0.0	5008	,	,		16284	0.0		0.0	False		,,,				2504	0.0					ENST00000320031.8	1.000000	0.370000	8.300000e-01	5.000000e-01	0.650000	0.670098	0.650000	1.000000																										0				31						c.(1288-1290)ttC>ttT		integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)		C	,	14,4392	20.2+/-43.8	0,14,2189	104.0	99.0	101.0		1290,1290	-5.8	0.9	17	dbSNP_134	101	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ITGA3	NM_002204.2,NM_005501.2	,	0,14,6489	TT,TC,CC		0.0,0.3177,0.1076	,	430/1052,430/1067	48151552	14,12992	2203	4300	6503	SO:0001819	synonymous_variant	3675	29	121412	48				g.chr17:48151552C>T	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.1290C>T	chr17.hg19:g.48151552C>T		1					ITGA3_ENST00000544892.1_Silent_p.F205F|ITGA3_ENST00000007722.7_Silent_p.F430F	p.F430F	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	1	15	16	3.628096	P26006	ITA3_HUMAN		9	1620	+			A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Silent	SNP	ENST00000320031.8	1	1	hg19	c.1290C>T	CCDS11558.1	0																																																																																								0.470588		TCGA-IB-7891-01A-11D-2201-08	0.612	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	0	0	1		2	2	2	0	0	0	0	145	0	145	144	1	2	-2.670600	1	0.100000	NM_005501		0	18	18	0	939	932	0	0	1	1		0	0	145	0	0	9.999801e-01	9.999989e-01	0	36	0	1239	0	18	939
TP53	7157	broad.mit.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	A	rs121912656|rs397516437		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:7577547C>A	ENST00000269305.4	-	7	923	c.734G>T	c.(733-735)gGc>gTc	p.G245V	TP53_ENST00000455263.2_Missense_Mutation_p.G245V|TP53_ENST00000359597.4_Missense_Mutation_p.G245V|TP53_ENST00000413465.2_Missense_Mutation_p.G245V|TP53_ENST00000445888.2_Missense_Mutation_p.G245V|TP53_ENST00000420246.2_Missense_Mutation_p.G245V|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.820000	9.900000e-01	9.000000e-01	0.960000	0.952674	0.960000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	24185	GRCh37	CM010464|CM900209	TP53	M	rs121912656	c.(733-735)gGc>gTc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						151.0	113.0	126.0					17																	7577547		2203	4300	6503	SO:0001583	missense	7157	1	121412	29	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577547C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>T	chr17.hg19:g.7577547C>A	ENSP00000269305:p.Gly245Val	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.G245V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G245V|TP53_ENST00000420246.2_Missense_Mutation_p.G245V|TP53_ENST00000359597.4_Missense_Mutation_p.G245V|TP53_ENST00000413465.2_Missense_Mutation_p.G245V	p.G245V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.867046	P04637	P53_HUMAN		7	923	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	0	hg19	c.734G>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563102	0.86335	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	V	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245V;ENSP00000352610:G245V;ENSP00000269305:G245V;ENSP00000398846:G245V;ENSP00000391127:G245V;ENSP00000391478:G245V;ENSP00000425104:G113V;ENSP00000423862:G152V	ENSP00000269305:G245V	G	-	2	0	0	TP53	7518272	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	0.052632		TCGA-IB-7891-01A-11D-2201-08	0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0	0	0	0	67	0	67	67	1	2	-2.230658	0	0.100000	NM_000546		0	32	31	0	280	277	1	0	1	1	1	0	0	67	655	0	1	9.998520e-01	1	28	81	92	1226	32	280
CACNA1G	8913	broad.mit.edu	37	17	48678109	48678109	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr17:48678109C>T	ENST00000359106.5	+	18	3713	c.3713C>T	c.(3712-3714)gCg>gTg	p.A1238V	CACNA1G_ENST00000515411.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000354983.4_Missense_Mutation_p.A1215V|CACNA1G_ENST00000352832.5_Missense_Mutation_p.A1215V|CACNA1G_ENST00000514181.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000512389.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000513964.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000515165.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000513689.2_Missense_Mutation_p.A1238V|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A1215V|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A1215V|CACNA1G_ENST00000510115.1_Missense_Mutation_p.A1215V|CACNA1G_ENST00000505165.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000515765.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000416767.4_Missense_Mutation_p.A1238V|CACNA1G_ENST00000510366.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A1215V|CACNA1G_ENST00000429973.2_Missense_Mutation_p.A1238V|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000507896.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000358244.5_Missense_Mutation_p.A1215V|CACNA1G_ENST00000442258.2_Missense_Mutation_p.A1215V|CACNA1G_ENST00000507336.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A1238V	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1238					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CGGGTCCGCGCGTGGATCCGA	0.627																																						ENST00000359106.5	1.000000	0.580000	1	7.800000e-01	0.990000	0.921160	0.990000	1.000000																										0				47						c.(3712-3714)gCg>gTg		calcium channel, voltage-dependent, T type, alpha 1G subunit	Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						54.0	66.0	62.0					17																	48678109		2079	4212	6291	SO:0001583	missense	8913	2	121022	38				g.chr17:48678109C>T	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.3713C>T	chr17.hg19:g.48678109C>T	ENSP00000352011:p.Ala1238Val	1					CACNA1G_ENST00000515411.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000354983.4_Missense_Mutation_p.A1215V|CACNA1G_ENST00000507896.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000513689.2_Missense_Mutation_p.A1238V|CACNA1G_ENST00000352832.5_Missense_Mutation_p.A1215V|CACNA1G_ENST00000515765.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A1215V|CACNA1G_ENST00000429973.2_Missense_Mutation_p.A1238V|CACNA1G_ENST00000507336.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000505165.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000510115.1_Missense_Mutation_p.A1215V|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000512389.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000514181.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A1215V|CACNA1G_ENST00000515165.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000416767.4_Missense_Mutation_p.A1238V|CACNA1G_ENST00000510366.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A1215V|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A1238V|CACNA1G_ENST00000358244.5_Missense_Mutation_p.A1215V|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A1238V|CACNA1G_ENST00000442258.2_Missense_Mutation_p.A1215V|CACNA1G_ENST00000513964.1_Missense_Mutation_p.A1238V	p.A1238V	NM_018896.4	NP_061496.2	1	15	16	3.628096	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)	18	3713	+	Breast(11;6.7e-17)		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	1	1	hg19	c.3713C>T	CCDS45730.1	1	.	.	.	.	.	.	.	.	.	.	c	13.30	2.196796	0.38806	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896;ENST00000506520	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97430	-4.02;-4.02;-4.18;-3.97;-4.02;-4.02;-4.06;-4.13;-4.08;-4.11;-4.12;-4.0;-4.0;-4.07;-4.02;-3.97;-4.05;-4.01;-4.0;-4.05;-4.02;-4.0;-4.05;-4.0;-4.05;-4.05;-4.38	5.46	4.46	0.54185	5.46	4.46	0.54185	.	0.272836	0.36409	N	0.002620	D	0.96608	0.8893	L	0.39898	1.24	0.09310	N	0.999999	D;B;B;B;B;B;B;B;B;D;D;B;B;B;B;B;B;B;B;D;D;B;D;B;B;B	0.89917	0.998;0.002;0.001;0.002;0.002;0.003;0.004;0.001;0.004;0.977;0.99;0.001;0.001;0.002;0.002;0.001;0.001;0.003;0.002;0.99;1.0;0.002;0.99;0.001;0.052;0.001	D;B;B;B;B;B;B;B;B;P;P;B;B;B;B;B;B;B;B;P;D;B;P;B;B;B	0.71184	0.95;0.003;0.002;0.005;0.002;0.002;0.004;0.002;0.004;0.565;0.6;0.008;0.003;0.002;0.002;0.002;0.001;0.005;0.002;0.734;0.972;0.003;0.6;0.003;0.003;0.003	D	0.91165	0.4964	10	0.36615	T	0.2	.	8.4476	0.32852	0.1508:0.7688:0.0:0.0804	.	1215;1238;1238;1238;1238;1238;1238;1238;1238;1238;1238;1215;1238;1238;1238;1238;1238;1215;1238;1215;1215;1215;1215;1238;1215;1238	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	V	1215;1215;1238;1215;1215;1215;1238;1238;1215;1238;1238;1238;1238;1238;1238;1215;1238;1238;1238;1238;1215;1238;1238;1238;1238;1238;53	ENSP00000353990:A1215V;ENSP00000339302:A1215V;ENSP00000392390:A1238V;ENSP00000347078:A1215V;ENSP00000409759:A1215V;ENSP00000425522:A1215V;ENSP00000426261:A1238V;ENSP00000425451:A1238V;ENSP00000422407:A1215V;ENSP00000426814:A1238V;ENSP00000427238:A1238V;ENSP00000423112:A1238V;ENSP00000420918:A1238V;ENSP00000426172:A1238V;ENSP00000423045:A1238V;ENSP00000427173:A1215V;ENSP00000426098:A1238V;ENSP00000425698:A1238V;ENSP00000426232:A1238V;ENSP00000423317:A1238V;ENSP00000350979:A1215V;ENSP00000352011:A1238V;ENSP00000414388:A1238V;ENSP00000423155:A1238V;ENSP00000422268:A1238V;ENSP00000421518:A1238V;ENSP00000427697:A53V	ENSP00000339302:A1215V	A	+	2	0	0	CACNA1G	46033108	46033108	0.774000	0.28592	0.063000	0.19743	0.033000	0.12548	1.315000	0.33608	1.243000	0.43853	0.655000	0.94253	GCG	0.470588		TCGA-IB-7891-01A-11D-2201-08	0.627	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	0	0	1		2	2	2	0	0	0	0	63	0	63	63	1	2	-13.907300	1	0.100000	NM_018896		0	16	16	0	532	522	0	0	1			0	0	63	0	0	9.999237e-01	0	0	0	0	0	0	16	532
SMAD4	4089	broad.mit.edu	37	18	48575132	48575132	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr18:48575132T>A	ENST00000342988.3	+	3	864	c.326T>A	c.(325-327)cTa>cAa	p.L109Q	SMAD4_ENST00000588745.1_Missense_Mutation_p.L109Q|SMAD4_ENST00000452201.2_Missense_Mutation_p.L109Q|SMAD4_ENST00000398417.2_Missense_Mutation_p.L109Q|RP11-729L2.2_ENST00000590722.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	109	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AAAAATGAACTAAAACATGTT	0.393																																						ENST00000342988.3	1.000000	0.790000	9.900000e-01	8.800000e-01	0.950000	0.940438	0.950000	0.990000																										40	Whole gene deletion(36)|Unknown(4)	p.0?(36)|p.?(4)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	454						c.(325-327)cTa>cAa		SMAD family member 4							165.0	150.0	155.0					18																	48575132		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48575132T>A	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.326T>A	chr18.hg19:g.48575132T>A	ENSP00000341551:p.Leu109Gln	1					SMAD4_ENST00000452201.2_Missense_Mutation_p.L109Q|SMAD4_ENST00000588745.1_Missense_Mutation_p.L109Q|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.L109Q	p.L109Q	NM_005359.5	NP_005350.1	0	1	1	1.865644	Q13485	SMAD4_HUMAN		3	864	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.326T>A	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.799226	0.90538	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	D;D;D	0.82803	-1.65;-1.65;-1.65	5.48	5.48	0.80851	5.48	5.48	0.80851	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.64402	D	0.000001	D	0.92906	0.7743	M	0.92833	3.35	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94459	0.7674	10	0.87932	D	0	.	14.5339	0.67947	0.0:0.0:0.0:1.0	.	109	Q13485	SMAD4_HUMAN	Q	109	ENSP00000409551:L109Q;ENSP00000341551:L109Q;ENSP00000381452:L109Q	ENSP00000341551:L109Q	L	+	2	0	0	SMAD4	46829130	46829130	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	8.014000	0.88676	2.053000	0.61076	0.477000	0.44152	CTA	0.052632		TCGA-IB-7891-01A-11D-2201-08	0.393	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	2	0	0	0	0	91	0	91	91	1	2	-10.046060	1	0.100000	NM_005359		0	33	33	0	380	378	1	0	1	1	1	0	0	91	485	0	1	9.583380e-01	1	5	60	57	746	33	380
ZNF486	90649	broad.mit.edu	37	19	20308264	20308264	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr19:20308264T>A	ENST00000335117.8	+	4	802	c.745T>A	c.(745-747)Tac>Aac	p.Y249N	CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						AGTCTTTAAGTACTTCTCTAG	0.393																																						ENST00000335117.8	1.000000	0.940000	1	9.900000e-01	0.990000	0.996341	0.990000	1.000000																										0				11						c.(745-747)Tac>Aac		zinc finger protein 486							36.0	39.0	38.0					19																	20308264		2144	4265	6409	SO:0001583	missense	90649	0	0					g.chr19:20308264T>A	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.745T>A	chr19.hg19:g.20308264T>A	ENSP00000335042:p.Tyr249Asn	0					CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	p.Y249N	NM_052852.3	NP_443084.2	0	0	0	1.964666	Q96H40	ZN486_HUMAN		4	802	+			Q0VG00	Missense_Mutation	SNP	ENST00000335117.8	1	1	hg19	c.745T>A	CCDS46029.1	1	.	.	.	.	.	.	.	.	.	.	a	6.041	0.376005	0.11466	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.47177	0.85	0.85	-1.7	0.08159	0.85	-1.7	0.08159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33030	0.0849	L	0.28556	0.865	0.09310	N	1	B	0.29432	0.244	B	0.38755	0.281	T	0.35822	-0.9773	9	0.30854	T	0.27	.	2.0183	0.03503	0.4435:0.2683:0.0:0.2882	.	249	Q96H40	ZN486_HUMAN	N	288;249	ENSP00000335042:Y249N	ENSP00000335042:Y249N	Y	+	1	0	0	ZNF486	20169264	20169264	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.996000	0.01471	-1.290000	0.02372	-1.322000	0.01289	TAC	0.077869		TCGA-IB-7891-01A-11D-2201-08	0.393	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447843.2	1	0	1		2	2	2	0	0	0	0	40	0	40	39	1	2	-20.000000	1	0.100000	NM_052852		0	23	23	0	267	266	0	0	1	0		0	0	40	0	0	9.999995e-01	6.302786e-01	0	0	0	26	0	23	267
NLRP8	126205	broad.mit.edu	37	19	56466153	56466153	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr19:56466153C>A	ENST00000291971.3	+	3	800	c.729C>A	c.(727-729)ttC>ttA	p.F243L	NLRP8_ENST00000590542.1_Missense_Mutation_p.F243L	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	243	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTTTCTACTTCCATTGCCAAG	0.507																																						ENST00000291971.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				35						c.(727-729)ttC>ttA		NLR family, pyrin domain containing 8							128.0	117.0	121.0					19																	56466153		2203	4300	6503	SO:0001583	missense	126205	0	0					g.chr19:56466153C>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.729C>A	chr19.hg19:g.56466153C>A	ENSP00000291971:p.Phe243Leu	1					NLRP8_ENST00000590542.1_Missense_Mutation_p.F243L	p.F243L	NM_176811.2	NP_789781.2	1	4	5	2.247689	Q86W28	NALP8_HUMAN		3	800	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	1	1	hg19	c.729C>A	CCDS12937.1	1	.	.	.	.	.	.	.	.	.	.	C	1.476	-0.558500	0.03967	.	.	ENSG00000179709	ENST00000291971	T	0.76186	-1.0	2.04	2.04	0.26737	2.04	2.04	0.26737	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.46347	0.1388	N	0.05050	-0.12	0.26881	N	0.967548	B;B	0.18610	0.029;0.007	B;B	0.20577	0.018;0.03	T	0.39375	-0.9617	9	0.02654	T	1	.	7.6199	0.28179	0.0:1.0:0.0:0.0	.	243;243	Q86W28-2;Q86W28	.;NALP8_HUMAN	L	243	ENSP00000291971:F243L	ENSP00000291971:F243L	F	+	3	2	2	NLRP8	61157965	61157965	0.000000	0.05858	0.039000	0.18376	0.132000	0.20833	-0.407000	0.07178	1.453000	0.47775	0.514000	0.50259	TTC	0.204947		TCGA-IB-7891-01A-11D-2201-08	0.507	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	1	0	1		2	2	2	0	0	0	0	144	0	144	144	1	2	-20.000000	1	0.100000	NM_176811		0	120	119	0	617	615	1	0	1			0	0	144	0	0	1	0	0	0	0	0	0	120	617
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																						ENST00000397910.4	0.590000	0.140000	4.600000e-01	2.200000e-01	0.320000	0.343812	0.320000	0.300000																										0				590						c.(982-984)ccT>ccC		mucin 16, cell surface associated							96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9090831A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	chr19.hg19:g.9090831A>G		0						p.P328P	NM_024690.2	NP_078966.2	0	0	0	1.964666	Q8WXI7	MUC16_HUMAN		1	1187	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.984T>C	CCDS54212.1	0																																																																																								0.077869		TCGA-IB-7891-01A-11D-2201-08	0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1		2	2	2	0	0	0	0	82	0	82	81	1	2	-2.339845	0	0.100000	NM_024690		0	7	7	0	433	429	0	0	1			0	0	82	0	0	9.801458e-01	0	0	0	0	0	0	7	433
NLRP8	126205	broad.mit.edu	37	19	56466562	56466562	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr19:56466562T>A	ENST00000291971.3	+	3	1209	c.1138T>A	c.(1138-1140)Ttg>Atg	p.L380M	NLRP8_ENST00000590542.1_Missense_Mutation_p.L380M	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	380	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGACCAAGTCTTGAGTTTCGC	0.478																																						ENST00000291971.3	1.000000	0.350000	8.500000e-01	4.700000e-01	0.620000	0.653168	0.620000	0.600000																										0				35						c.(1138-1140)Ttg>Atg		NLR family, pyrin domain containing 8							82.0	78.0	80.0					19																	56466562		2203	4300	6503	SO:0001583	missense	126205	0	0					g.chr19:56466562T>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1138T>A	chr19.hg19:g.56466562T>A	ENSP00000291971:p.Leu380Met	1					NLRP8_ENST00000590542.1_Missense_Mutation_p.L380M	p.L380M	NM_176811.2	NP_789781.2	1	4	5	2.247689	Q86W28	NALP8_HUMAN		3	1209	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	0	1	hg19	c.1138T>A	CCDS12937.1	0	.	.	.	.	.	.	.	.	.	.	T	8.935	0.964412	0.18583	.	.	ENSG00000179709	ENST00000291971	T	0.77750	-1.12	2.04	-4.08	0.03963	2.04	-4.08	0.03963	.	.	.	.	.	T	0.80999	0.4732	M	0.70595	2.14	0.09310	N	1	D;D	0.76494	0.999;0.992	D;D	0.69824	0.966;0.957	T	0.69723	-0.5068	9	0.62326	D	0.03	.	1.0278	0.01531	0.1712:0.2645:0.3455:0.2188	.	380;380	Q86W28-2;Q86W28	.;NALP8_HUMAN	M	380	ENSP00000291971:L380M	ENSP00000291971:L380M	L	+	1	2	2	NLRP8	61158374	61158374	0.021000	0.18746	0.000000	0.03702	0.008000	0.06430	-0.103000	0.10940	-1.828000	0.01202	-1.436000	0.01078	TTG	0.204947		TCGA-IB-7891-01A-11D-2201-08	0.478	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	0	0	1		2	2	2	0	0	0	0	122	0	122	122	1	2	-3.391373	1	0.100000	NM_176811		0	16	15	0	602	599	0	0	1			0	0	122	0	0	9.999299e-01	0	0	0	0	0	0	16	602
ADORA3	140	broad.mit.edu	37	1	112043018	112043018	+	Missense_Mutation	SNP	C	C	T	rs139935750	byFrequency	TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr1:112043018C>T	ENST00000241356.4	-	2	916	c.511G>A	c.(511-513)Gtc>Atc	p.V171I	ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Intron	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	171					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	ATTCTCATGACGGAAACAAAT	0.453																																						ENST00000241356.4	0.510000	0.170000	4.200000e-01	2.400000e-01	0.310000	0.332830	0.310000	0.310000																										0				12						c.(511-513)Gtc>Atc		adenosine A3 receptor	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	C	ILE/VAL,,	1,4405	2.1+/-5.4	0,1,2202	154.0	143.0	147.0		511,,	4.1	0.0	1	dbSNP_134	147	13,8587	9.8+/-36.6	0,13,4287	yes	missense,intron,intron	ADORA3	NM_000677.3,NM_001081976.1,NM_020683.6	29,,	0,14,6489	TT,TC,CC		0.1512,0.0227,0.1076	probably-damaging,,	171/319,,	112043018	14,12992	2203	4300	6503	SO:0001583	missense	140	51	121412	52				g.chr1:112043018C>T	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.511G>A	chr1.hg19:g.112043018C>T	ENSP00000241356:p.Val171Ile	0					ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Intron|ADORA3_ENST00000369717.4_Intron	p.V171I	NM_000677.3	NP_000668.1	0	0	0	1.955937	P33765	AA3R_HUMAN		2	916	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000241356.4	0	1	hg19	c.511G>A	CCDS839.1	0	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147668	0.57151	2.27E-4	0.001512	ENSG00000121933	ENST00000241356	T	0.36520	1.25	5.01	4.1	0.47936	5.01	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.43743	0.1261	M	0.71920	2.185	0.44816	D	0.997825	D	0.59767	0.986	P	0.61800	0.894	T	0.44143	-0.9347	9	0.46703	T	0.11	.	13.1322	0.59389	0.0:0.9212:0.0:0.0787	.	171	P33765	AA3R_HUMAN	I	171	ENSP00000241356:V171I	ENSP00000241356:V171I	V	-	1	0	0	ADORA3	111844541	111844541	1.000000	0.71417	0.014000	0.15608	0.066000	0.16364	4.978000	0.63799	1.241000	0.43820	0.655000	0.94253	GTC	0.074074		TCGA-IB-7891-01A-11D-2201-08	0.453	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1	0	0	1		2	2	2	0	0	0	0	140	0	140	139	1	2	-2.669626	1	0.100000	NM_000677, NM_020683		0	13	13	0	790	788	0	0	1	0		0	0	140	0	0	9.995237e-01	1.439858e-01	0	0	0	38	0	13	790
PADI3	51702	broad.mit.edu	37	1	17609365	17609365	+	Missense_Mutation	SNP	C	C	A	rs147308107		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr1:17609365C>A	ENST00000375460.3	+	16	1826	c.1786C>A	c.(1786-1788)Cac>Aac	p.H596N		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	596					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GCTGGGGAAGCACCTGGGCAT	0.627																																						ENST00000375460.3	1.000000	0.590000	1	8.500000e-01	0.990000	0.946439	0.990000	1.000000																										0				32						c.(1786-1788)Cac>Aac		peptidyl arginine deiminase, type III	L-Citrulline(DB00155)						56.0	46.0	50.0					1																	17609365		2203	4300	6503	SO:0001583	missense	51702	0	0					g.chr1:17609365C>A	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1786C>A	chr1.hg19:g.17609365C>A	ENSP00000364609:p.His596Asn	0						p.H596N	NM_016233.2	NP_057317.2	0	0	0	1.956872	Q9ULW8	PADI3_HUMAN		16	1826	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	0	1	hg19	c.1786C>A	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	C	9.877	1.200613	0.22121	.	.	ENSG00000142619	ENST00000375460	T	0.21191	2.02	5.13	-0.204	0.13200	5.13	-0.204	0.13200	Protein-arginine deiminase, C-terminal (1);	0.384936	0.29172	N	0.012929	T	0.14399	0.0348	L	0.45228	1.405	0.33681	D	0.61211	B	0.30937	0.301	B	0.35727	0.209	T	0.29882	-0.9997	10	0.12103	T	0.63	-15.6138	5.9736	0.19367	0.0:0.2911:0.1484:0.5604	.	596	Q9ULW8	PADI3_HUMAN	N	596	ENSP00000364609:H596N	ENSP00000364609:H596N	H	+	1	0	0	PADI3	17481952	17481952	0.000000	0.05858	0.806000	0.32338	0.993000	0.82548	-1.294000	0.02767	-0.086000	0.12550	-0.143000	0.13931	CAC	0.074074		TCGA-IB-7891-01A-11D-2201-08	0.627	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1	0	0	1		2	2	2	0	0	0	0	29	0	29	29	1	2	-11.911050	1	0.100000			0	7	7	0	82	82	0	0	1			0	0	29	0	0	9.820546e-01	0	0	0	0	0	0	7	82
NTRK1	4914	broad.mit.edu	37	1	156849848	156849848	+	Missense_Mutation	SNP	C	C	T	rs374918502		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr1:156849848C>T	ENST00000524377.1	+	16	2145	c.2104C>T	c.(2104-2106)Cgt>Tgt	p.R702C	NTRK1_ENST00000358660.3_Missense_Mutation_p.R699C|NTRK1_ENST00000531606.1_3'UTR|NTRK1_ENST00000392302.2_Missense_Mutation_p.R666C|NTRK1_ENST00000368196.3_Missense_Mutation_p.R696C	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	702	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CATCCTGTACCGTAAGTTCAC	0.637			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																												ENST00000524377.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000				Dom	yes			Dom	yes		1	1q21-q22	1q21-q22	4914	T	"""neurotrophic tyrosine kinase, receptor, type 1"""				E	E	TPM3, TPR, TFG		papillary thyroid		0				74						c.(2104-2106)Cgt>Tgt		neurotrophic tyrosine kinase, receptor, type 1	Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	81.0	76.0	78.0		1996,2086,2104	4.2	1.0	1		78	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense,missense	NTRK1	NM_001007792.1,NM_001012331.1,NM_002529.3	180,180,180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	666/761,696/791,702/797	156849848	2,13004	2203	4300	6503	SO:0001583	missense	4914	7	121404	41				g.chr1:156849848C>T	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2104C>T	chr1.hg19:g.156849848C>T	ENSP00000431418:p.Arg702Cys	1	TSP Lung(10;0.080)				NTRK1_ENST00000358660.3_Missense_Mutation_p.R699C|NTRK1_ENST00000531606.1_3'UTR|NTRK1_ENST00000368196.3_Missense_Mutation_p.R696C|NTRK1_ENST00000392302.2_Missense_Mutation_p.R666C	p.R702C	NM_002529.3	NP_002520.2	2	2	4	2.110276	P04629	NTRK1_HUMAN		16	2145	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	1	1	hg19	c.2104C>T	CCDS1161.1	1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490712	0.64074	0.0	2.33E-4	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	4.23	4.23	0.50019	4.23	4.23	0.50019	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000030	D	0.85305	0.5666	L	0.55834	1.745	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.921;0.938;0.99	D	0.86696	0.1926	10	0.87932	D	0	.	11.0171	0.47696	0.1861:0.8139:0.0:0.0	.	699;696;702;666	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	C	666;696;702;699	ENSP00000376120:R666C;ENSP00000357179:R696C;ENSP00000431418:R702C;ENSP00000351486:R699C	ENSP00000351486:R699C	R	+	1	0	0	NTRK1	155116472	155116472	0.981000	0.34729	1.000000	0.80357	0.912000	0.54170	0.138000	0.16016	2.362000	0.80069	0.561000	0.74099	CGT	0.151744		TCGA-IB-7891-01A-11D-2201-08	0.637	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	1	0	1		2	2	2	0	0	0	0	102	0	102	99	1	2	-2.690405	1	0.100000	NM_002529		0	47	47	0	412	401	1	0	1	0		0	0	102	0	0	1	8.848806e-02	0	0	0	5	0	47	412
NUAK2	81788	broad.mit.edu	37	1	205273591	205273591	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr1:205273591C>T	ENST00000367157.3	-	7	1000	c.874G>A	c.(874-876)Gcc>Acc	p.A292T		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TCCAGGGTGGCCCGGCGGGTG	0.637																																						ENST00000367157.3	1.000000	0.430000	1	7.700000e-01	0.990000	0.920859	0.990000	1.000000																										0				23						c.(874-876)Gcc>Acc		NUAK family, SNF1-like kinase, 2							13.0	15.0	14.0					1																	205273591		2196	4293	6489	SO:0001583	missense	81788	0	0					g.chr1:205273591C>T	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.874G>A	chr1.hg19:g.205273591C>T	ENSP00000356125:p.Ala292Thr	1						p.A292T	NM_030952.1	NP_112214.1	2	2	4	2.119693			BRCA - Breast invasive adenocarcinoma(75;0.117)	7	1000	-	Breast(84;0.186)			Missense_Mutation	SNP	ENST00000367157.3	0	1	hg19	c.874G>A	CCDS1453.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.319851	0.95682	.	.	ENSG00000163545	ENST00000367157	T	0.24908	1.83	5.12	5.12	0.69794	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42172	D	0.000754	T	0.51483	0.1677	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54351	-0.8307	10	0.72032	D	0.01	.	18.1508	0.89674	0.0:1.0:0.0:0.0	.	292	Q9H093	NUAK2_HUMAN	T	292	ENSP00000356125:A292T	ENSP00000356125:A292T	A	-	1	0	0	NUAK2	203540214	203540214	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.474000	0.81024	2.375000	0.81037	0.511000	0.50034	GCC	0.155722		TCGA-IB-7891-01A-11D-2201-08	0.637	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	0	0	0		2	2	2	0	0	0	0	15	0	15	15	1	2	-7.990884	1	0.100000	NM_030952		0	4	3	0	75	70	0	0	1	1		0	0	15	0	0	8.725963e-01	2.609442e-01	0	6	0	10	0	4	75
PTPN14	5784	broad.mit.edu	37	1	214556939	214556939	+	Silent	SNP	G	G	A	rs548947717		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr1:214556939G>A	ENST00000366956.5	-	13	2453	c.2259C>T	c.(2257-2259)ccC>ccT	p.P753P	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	753					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TCCTTGGACCGGGGTACTCAG	0.672													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15929	0.0		0.0	False		,,,				2504	0.0				Colon(92;557 1424 24372 34121 40073)	ENST00000366956.5	1.000000	0.330000	1	4.700000e-01	0.680000	0.715574	0.680000	1.000000																										0				58						c.(2257-2259)ccC>ccT		protein tyrosine phosphatase, non-receptor type 14							31.0	36.0	34.0					1																	214556939		2203	4299	6502	SO:0001819	synonymous_variant	5784	1	121394	29				g.chr1:214556939G>A	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2259C>T	chr1.hg19:g.214556939G>A		1					PTPN14_ENST00000543945.1_3'UTR	p.P753P	NM_005401.4	NP_005392.2	2	2	4	2.119693	Q15678	PTN14_HUMAN		13	2453	-			Q5VSI0	Silent	SNP	ENST00000366956.5	1	1	hg19	c.2259C>T	CCDS1514.1	0																																																																																								0.155722		TCGA-IB-7891-01A-11D-2201-08	0.672	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	0	0	1		2	2	2	0	0	0	0	86	0	86	83	1	2	-3.154869	1	0.100000	NM_005401		0	10	10	0	348	342	0	0	1	0		0	0	86	0	0	9.967114e-01	1.472492e-01	0	1	0	20	0	10	348
KRTAP6-2	337967	broad.mit.edu	37	21	31971102	31971102	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr21:31971102C>T	ENST00000334897.3	-	1	117	c.92G>A	c.(91-93)cGc>cAc	p.R31H	KRTAP22-1_ENST00000334680.2_5'Flank	NM_181604.1	NP_853635.1	Q3LI66	KRA62_HUMAN	keratin associated protein 6-2	31						intermediate filament (GO:0005882)				endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11						ATAGCCACAGCGCAGGCTTCC	0.562																																						ENST00000334897.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999915	0.990000	1.000000																										0				11						c.(91-93)cGc>cAc		keratin associated protein 6-2							147.0	122.0	131.0					21																	31971102		2203	4300	6503	SO:0001583	missense	337967	0	0					g.chr21:31971102C>T	AP001708	CCDS13600.1	21q22.1	2011-02-10			ENSG00000186930	ENSG00000186930		"""Keratin associated proteins"""	18932	protein-coding gene	gene with protein product						12359730	Standard	NM_181604		Approved	KAP6.2	uc011adc.2	Q3LI66	OTTHUMG00000057794	ENST00000334897.3:c.92G>A	chr21.hg19:g.31971102C>T	ENSP00000334560:p.Arg31His	0					KRTAP22-1_ENST00000334680.2_5'Flank	p.R31H	NM_181604.1	NP_853635.1	1	2	3	2.009220	Q3LI66	KRA62_HUMAN		1	117	-				Missense_Mutation	SNP	ENST00000334897.3	1	1	hg19	c.92G>A	CCDS13600.1	1	.	.	.	.	.	.	.	.	.	.	C	6.908	0.537123	0.13188	.	.	ENSG00000186930	ENST00000334897	T	0.31510	1.49	2.52	1.63	0.23807	2.52	1.63	0.23807	.	.	.	.	.	T	0.19366	0.0465	.	.	.	0.09310	N	0.999999	B	0.28605	0.217	B	0.12837	0.008	T	0.19451	-1.0305	8	0.87932	D	0	.	5.1408	0.14957	0.0:0.8308:0.0:0.1692	.	31	Q3LI66	KRA62_HUMAN	H	31	ENSP00000334560:R31H	ENSP00000334560:R31H	R	-	2	0	0	KRTAP6-2	30892973	30892973	0.999000	0.42202	1.000000	0.80357	0.515000	0.34225	0.851000	0.27751	0.622000	0.30249	0.650000	0.86243	CGC	0.107586		TCGA-IB-7891-01A-11D-2201-08	0.562	KRTAP6-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128246.3	1	0	1		2	2	2	0	0	0	0	93	0	93	91	1	2	-9.940024	1	0.100000			0	29	29	0	298	288	0	0	1			0	0	93	0	0	1	0	0	0	0	0	0	29	298
HOXD13	3239	broad.mit.edu	37	2	176959381	176959381	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr2:176959381C>T	ENST00000392539.3	+	2	955	c.955C>T	c.(955-957)Caa>Taa	p.Q319*		NM_000523.3	NP_000514.2	P35453	HXD13_HUMAN	homeobox D13	319					anterior/posterior pattern specification (GO:0009952)|branch elongation of an epithelium (GO:0060602)|embryonic digit morphogenesis (GO:0042733)|embryonic hindgut morphogenesis (GO:0048619)|male genitalia development (GO:0030539)|morphogenesis of an epithelial fold (GO:0060571)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		ATCTGAGAGACAAGTGACCAT	0.463			T	NUP98	AML*																																	ENST00000392539.3	1.000000	0.630000	1	8.100000e-01	0.990000	0.934768	0.990000	1.000000				Dom	yes			Dom	yes		2	2q31-q32	2q31-q32	3239	T	homeo box D13				L	L	NUP98		AML*		0				6						c.(955-957)Caa>Taa		homeobox D13							89.0	83.0	85.0					2																	176959381		2203	4300	6503	SO:0001587	stop_gained	3239	0	0					g.chr2:176959381C>T	AF005219	CCDS2264.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128714	ENSG00000128714		"""Homeoboxes / ANTP class : HOXL subclass"""	5136	protein-coding gene	gene with protein product		142989	"""homeo box D13"""	HOX4I, SPD		2574852, 1973146	Standard	NM_000523		Approved		uc002ukf.1	P35453	OTTHUMG00000132431	ENST00000392539.3:c.955C>T	chr2.hg19:g.176959381C>T	ENSP00000376322:p.Gln319*	1						p.Q319*	NM_000523.3	NP_000514.2	1	2	3	2.044923	P35453	HXD13_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	2	955	+				Nonsense_Mutation	SNP	ENST00000392539.3	0	1	hg19	c.955C>T	CCDS2264.2	1	.	.	.	.	.	.	.	.	.	.	C	33	5.265300	0.95399	.	.	ENSG00000128714	ENST00000392539	.	.	.	4.84	4.84	0.62591	4.84	4.84	0.62591	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5076	0.90902	0.0:1.0:0.0:0.0	.	.	.	.	X	319	.	ENSP00000376322:Q319X	Q	+	1	0	0	HOXD13	176667627	176667627	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.687000	0.91594	0.655000	0.94253	CAA	0.142857		TCGA-IB-7891-01A-11D-2201-08	0.463	HOXD13-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359256.1	1	0	1		2	2	2	0	0	0	0	69	0	69	69	1	2	-18.566330	1	0.100000			0	17	17	0	329	325	0	0	1			0	0	69	0	0	9.999647e-01	0	0	0	0	0	0	17	329
PRKRA	8575	broad.mit.edu	37	2	179300952	179300952	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr2:179300952C>A	ENST00000325748.4	-	7	904	c.704G>T	c.(703-705)aGt>aTt	p.S235I	PRKRA_ENST00000487082.1_Missense_Mutation_p.S210I|PRKRA_ENST00000438687.3_Missense_Mutation_p.S122I|PRKRA_ENST00000432031.2_Missense_Mutation_p.S224I|AC009948.5_ENST00000454488.1_RNA|AC009948.5_ENST00000453026.2_RNA|AC009948.5_ENST00000436616.2_RNA	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	235	Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			ATTTGGAATACTAAGGAGGCT	0.338																																					Melanoma(200;68 3001 23825 48764)	ENST00000325748.4	1.000000	0.690000	1	8.000000e-01	0.940000	0.916859	0.940000	1.000000																										0				19						c.(703-705)aGt>aTt		protein kinase, interferon-inducible double stranded RNA dependent activator							153.0	179.0	170.0					2																	179300952		2203	4300	6503	SO:0001583	missense	8575	0	0					g.chr2:179300952C>A	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.704G>T	chr2.hg19:g.179300952C>A	ENSP00000318176:p.Ser235Ile	1					AC009948.5_ENST00000454488.1_RNA|AC009948.5_ENST00000453026.2_RNA|AC009948.5_ENST00000436616.2_RNA|PRKRA_ENST00000432031.2_Missense_Mutation_p.S224I|PRKRA_ENST00000487082.1_Missense_Mutation_p.S210I|PRKRA_ENST00000438687.3_Missense_Mutation_p.S122I	p.S235I	NM_003690.4	NP_003681.1	1	2	3	2.044923	O75569	PRKRA_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)	7	904	-			A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Missense_Mutation	SNP	ENST00000325748.4	1	1	hg19	c.704G>T	CCDS2279.1	1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956621	0.92726	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.89086	0.6615	M	0.62723	1.935	0.52501	D	0.999959	D;P	0.67145	0.996;0.885	P;B	0.62382	0.901;0.31	D	0.89369	0.3673	10	0.72032	D	0.01	.	17.2511	0.87042	0.0:1.0:0.0:0.0	.	235;224	O75569;O75569-2	PRKRA_HUMAN;.	I	235;122;210;224	ENSP00000318176:S235I;ENSP00000398980:S122I;ENSP00000430604:S210I;ENSP00000393883:S224I	ENSP00000318176:S235I	S	-	2	0	0	PRKRA	179009198	179009198	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.734000	0.55037	2.822000	0.97130	0.650000	0.86243	AGT	0.142857		TCGA-IB-7891-01A-11D-2201-08	0.338	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	1	0	1		2	2	2	0	0	0	0	169	0	169	168	1	2	-5.055489	1	0.100000	NM_003690		0	43	43	0	918	913	0	0	1	0		0	0	169	0	0	1	9.767496e-01	0	0	0	127	0	43	918
CASP8	841	broad.mit.edu	37	2	202131315	202131315	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr2:202131315G>T	ENST00000432109.2	+	3	295	c.106G>T	c.(106-108)Gaa>Taa	p.E36*	CASP8_ENST00000358485.4_Nonsense_Mutation_p.E95*|CASP8_ENST00000323492.7_Nonsense_Mutation_p.E36*|CASP8_ENST00000392266.3_Nonsense_Mutation_p.E36*|CASP8_ENST00000392259.2_Nonsense_Mutation_p.E36*|CASP8_ENST00000392258.3_Nonsense_Mutation_p.E36*|CASP8_ENST00000264275.5_Nonsense_Mutation_p.E36*|CASP8_ENST00000264274.9_Nonsense_Mutation_p.E36*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	36	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						AAGGAAGCAAGAACCCATCAA	0.468										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	ENST00000432109.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999996	0.990000	1.000000																										0				52						c.(106-108)Gaa>Taa		caspase 8, apoptosis-related cysteine peptidase							75.0	76.0	76.0					2																	202131315		2203	4300	6503	SO:0001587	stop_gained	841	0	0					g.chr2:202131315G>T	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.106G>T	chr2.hg19:g.202131315G>T	ENSP00000412523:p.Glu36*	1	HNSCC(4;0.00038)				CASP8_ENST00000392259.2_Nonsense_Mutation_p.E36*|CASP8_ENST00000392266.3_Nonsense_Mutation_p.E36*|CASP8_ENST00000264274.9_Nonsense_Mutation_p.E36*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.E95*|CASP8_ENST00000323492.7_Nonsense_Mutation_p.E36*|CASP8_ENST00000264275.5_Nonsense_Mutation_p.E36*|CASP8_ENST00000392258.3_Nonsense_Mutation_p.E36*	p.E36*	NM_033355.3	NP_203519.1	1	2	3	2.033567	Q14790	CASP8_HUMAN		3	295	+			O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	ENST00000432109.2	0	1	hg19	c.106G>T	CCDS2342.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.515100	0.96402	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	.	.	.	5.47	4.56	0.56223	5.47	4.56	0.56223	.	0.104160	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	15.3738	0.74587	0.0:0.1392:0.8607:0.0	.	.	.	.	X	36;36;36;36;36;36;36;36;36;95;36;36;36;36	.	ENSP00000264274:E36X	E	+	1	0	0	CASP8	201839560	201839560	1.000000	0.71417	1.000000	0.80357	0.410000	0.31052	5.578000	0.67450	2.554000	0.86153	0.561000	0.74099	GAA	0.142857		TCGA-IB-7891-01A-11D-2201-08	0.468	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	1	0	1		2	2	2	0	0	0	0	61	0	61	61	1	2	-20.000000	1	0.100000	NM_001228		0	30	31	0	270	269	1	0	1	1		0	0	61	0	0	1	9.915589e-01	0	18	0	52	0	30	270
PCDHB1	29930	broad.mit.edu	37	5	140431928	140431928	+	Silent	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr5:140431928G>A	ENST00000306549.3	+	1	950	c.873G>A	c.(871-873)acG>acA	p.T291T		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	291	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T291T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCTCAAGACGTTTCAGATTG	0.468																																						ENST00000306549.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999975	0.990000	1.000000																										1	Substitution - coding silent(1)	p.T291T(1)	large_intestine(1)	53						c.(871-873)acG>acA		protocadherin beta 1							73.0	74.0	74.0					5																	140431928		2203	4300	6503	SO:0001819	synonymous_variant	29930	0	0					g.chr5:140431928G>A	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.873G>A	chr5.hg19:g.140431928G>A		0						p.T291T	NM_013340.2	NP_037472.2	1	2	3	2.046249	Q9Y5F3	PCDB1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	950	+			Q2M257	Silent	SNP	ENST00000306549.3	1	1	hg19	c.873G>A	CCDS4243.1	1																																																																																								0.115914		TCGA-IB-7891-01A-11D-2201-08	0.468	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	1	0	1		2	2	2	0	0	0	0	62	0	62	62	1	2	-20.000000	1	0.100000	NM_013340		0	29	27	0	280	273	0	0	1			0	0	62	0	0	1	0	0	0	0	0	0	29	280
MYO10	4651	broad.mit.edu	37	5	16694499	16694499	+	Missense_Mutation	SNP	C	C	T	rs375436981		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr5:16694499C>T	ENST00000513610.1	-	27	4235	c.3781G>A	c.(3781-3783)Gta>Ata	p.V1261I	MYO10_ENST00000274203.9_Missense_Mutation_p.V618I|MYO10_ENST00000515803.1_Missense_Mutation_p.V600I|MYO10_ENST00000427430.2_Missense_Mutation_p.V618I|MYO10_ENST00000505695.1_Missense_Mutation_p.V600I	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1261	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CGCACTTCTACGGTGCCCTTG	0.537																																						ENST00000513610.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999523	0.990000	1.000000																										0				86						c.(3781-3783)Gta>Ata		myosin X		C	ILE/VAL	0,4090		0,0,2045	149.0	151.0	150.0		3781	-6.1	0.0	5		150	1,8401		0,1,4200	no	missense	MYO10	NM_012334.2	29	0,1,6245	TT,TC,CC		0.0119,0.0,0.0080	benign	1261/2059	16694499	1,12491	2045	4201	6246	SO:0001583	missense	4651	3	120922	42				g.chr5:16694499C>T	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.3781G>A	chr5.hg19:g.16694499C>T	ENSP00000421280:p.Val1261Ile	0					MYO10_ENST00000505695.1_Missense_Mutation_p.V600I|MYO10_ENST00000515803.1_Missense_Mutation_p.V600I|MYO10_ENST00000427430.2_Missense_Mutation_p.V618I|MYO10_ENST00000274203.9_Missense_Mutation_p.V618I	p.V1261I	NM_012334.2	NP_036466.2	1	2	3	2.046249	Q9HD67	MYO10_HUMAN		27	4235	-			A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	1	1	hg19	c.3781G>A	CCDS54834.1	1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.452233	0.01080	0.0	1.19E-4	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	5.33	-6.13	0.02118	5.33	-6.13	0.02118	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	T	0.21307	0.0513	N	0.01800	-0.715	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.08055	0.0;0.0;0.003	T	0.32981	-0.9886	9	0.02654	T	1	.	2.5747	0.04803	0.5273:0.0964:0.1871:0.1893	.	140;902;1261	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	I	1261;600;618;600;618	ENSP00000421280:V1261I;ENSP00000425051:V600I;ENSP00000274203:V618I;ENSP00000421170:V600I;ENSP00000391106:V618I	ENSP00000274203:V618I	V	-	1	0	0	MYO10	16747499	16747499	0.003000	0.15002	0.024000	0.17045	0.416000	0.31233	-0.127000	0.10547	-0.714000	0.04975	-0.274000	0.10170	GTA	0.115914		TCGA-IB-7891-01A-11D-2201-08	0.537	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	0	0	1		15	4	2	1	0	1	1	220	0	220	216	1	2	-10.169360	1	0.100000	NM_012334		0	56	56	0	787	775	1	0	1	1		1	0	220	0	0	9.999999e-01	9.452486e-01	0	19	0	96	0	56	787
PCDHGA7	56108	broad.mit.edu	37	5	140764634	140764634	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr5:140764634G>A	ENST00000518325.1	+	1	2168	c.2168G>A	c.(2167-2169)cGc>cAc	p.R723H	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	723					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACAAGTCACGCCTGCTGCAG	0.627																																						ENST00000518325.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.998871	0.990000	1.000000																										0				49						c.(2167-2169)cGc>cAc		protocadherin gamma subfamily A, 7							54.0	59.0	57.0					5																	140764634		2202	4300	6502	SO:0001583	missense	56108	0	0					g.chr5:140764634G>A	AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2168G>A	chr5.hg19:g.140764634G>A	ENSP00000430024:p.Arg723His	0					PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron	p.R723H	NM_018920.2	NP_061743.1	1	2	3	2.046249	Q9Y5G6	PCDG7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2168	+			B2RN87|Q9Y5D0	Missense_Mutation	SNP	ENST00000518325.1	1	1	hg19	c.2168G>A	CCDS54927.1	1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.033890	0.35893	.	.	ENSG00000253537	ENST00000518325	T	0.51574	0.7	4.73	0.789	0.18607	4.73	0.789	0.18607	.	.	.	.	.	T	0.37461	0.1004	L	0.49699	1.58	0.09310	N	1	B;B	0.20550	0.013;0.046	B;B	0.18263	0.009;0.021	T	0.31861	-0.9928	9	0.49607	T	0.09	.	5.0984	0.14747	0.5194:0.0:0.3384:0.1421	.	723;723	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	H	723	ENSP00000430024:R723H	ENSP00000430024:R723H	R	+	2	0	0	PCDHGA7	140744818	140744818	0.000000	0.05858	0.001000	0.08648	0.147000	0.21601	0.046000	0.14035	0.155000	0.19261	0.563000	0.77884	CGC	0.115914		TCGA-IB-7891-01A-11D-2201-08	0.627	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	1	0	1		2	2	2	0	0	0	0	108	0	108	108	1	2	-8.225527	1	0.100000	NM_018920		0	25	25	0	308	305	0	0	1	0		0	0	108	0	0	9.999998e-01	5.265428e-02	0	0	0	5	0	25	308
WWC1	23286	broad.mit.edu	37	5	167881063	167881063	+	Silent	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr5:167881063C>T	ENST00000265293.4	+	18	3118	c.2616C>T	c.(2614-2616)acC>acT	p.T872T	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Silent_p.T872T	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	872	Glu-rich.|Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		aTGTTTTCACCGAGAAAGCCT	0.542																																						ENST00000265293.4	1.000000	0.620000	1	7.500000e-01	0.920000	0.891245	0.920000	1.000000																										0				43						c.(2614-2616)acC>acT		WW and C2 domain containing 1							149.0	134.0	139.0					5																	167881063		2203	4300	6503	SO:0001819	synonymous_variant	23286	5	121412	39				g.chr5:167881063C>T	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2616C>T	chr5.hg19:g.167881063C>T		0					WWC1_ENST00000521089.1_Silent_p.T872T|WWC1_ENST00000522140.1_3'UTR	p.T872T	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	1	2	3	2.046249	Q8IX03	KIBRA_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	18	3118	+	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	ENST00000265293.4	1	1	hg19	c.2616C>T	CCDS4366.1	1	.	.	.	.	.	.	.	.	.	.	C	2.764	-0.257209	0.05791	.	.	ENSG00000113645	ENST00000393895;ENST00000524228	.	.	.	4.64	-9.28	0.00656	4.64	-9.28	0.00656	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999977	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7003	0.17879	0.3508:0.4177:0.0:0.2315	.	.	.	.	X	834;649	.	.	R	+	1	2	2	WWC1	167813641	167813641	0.001000	0.12720	0.000000	0.03702	0.027000	0.11550	-1.067000	0.03451	-2.469000	0.00531	-3.152000	0.00058	CGA	0.115914		TCGA-IB-7891-01A-11D-2201-08	0.542	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	1	0	1		2	2	2	0	0	0	0	155	0	155	154	1	2	-2.570747	1	0.100000	NM_015238		0	33	33	0	745	733	0	0	1	1		0	0	155	0	0	1	8.630526e-01	0	5	0	77	0	33	745
TRIM7	81786	broad.mit.edu	37	5	180622634	180622634	+	Silent	SNP	G	G	T	rs531072907		TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr5:180622634G>T	ENST00000274773.7	-	7	1129	c.1068C>A	c.(1066-1068)atC>atA	p.I356I	TRIM7_ENST00000393315.1_Silent_p.I148I|CTC-338M12.5_ENST00000514487.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000361809.3_Silent_p.I148I|TRIM7_ENST00000422067.2_Silent_p.I148I|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000393319.3_Silent_p.I174I|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000504241.1_5'UTR|CTC-338M12.5_ENST00000508877.1_RNA	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	356	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		CCAGAGAGAGGATGAGGCGCG	0.662																																					Esophageal Squamous(128;2258 2308 35507 48647)	ENST00000274773.7	1.000000	0.340000	1	4.700000e-01	0.660000	0.703345	0.660000	0.580000																										0				17						c.(1066-1068)atC>atA		tripartite motif containing 7							46.0	53.0	51.0					5																	180622634		2181	4225	6406	SO:0001819	synonymous_variant	81786	0	0					g.chr5:180622634G>T	AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.1068C>A	chr5.hg19:g.180622634G>T		0					TRIM7_ENST00000422067.2_Silent_p.I148I|TRIM7_ENST00000504241.1_5'UTR|CTC-338M12.5_ENST00000508877.1_RNA|CTC-338M12.6_ENST00000512508.1_RNA|CTC-338M12.6_ENST00000509080.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000361809.3_Silent_p.I148I|TRIM7_ENST00000393315.1_Silent_p.I148I|CTC-338M12.5_ENST00000514487.1_RNA|TRIM7_ENST00000393319.3_Silent_p.I174I	p.I356I	NM_203293.1	NP_976038.1	1	2	3	2.046249	Q9C029	TRIM7_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	7	1129	-	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Silent	SNP	ENST00000274773.7	1	1	hg19	c.1068C>A	CCDS4462.1	0																																																																																								0.115914		TCGA-IB-7891-01A-11D-2201-08	0.662	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253569.3	0	0	1		2	2	2	0	0	0	0	119	0	119	118	1	2	-12.074030	1	0.100000	NM_203296		0	13	13	0	437	425	0	0	1			0	0	119	0	0	9.994506e-01	0	0	0	0	0	0	13	437
DSP	1832	broad.mit.edu	37	6	7576570	7576570	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr6:7576570C>T	ENST00000379802.3	+	19	3015	c.2674C>T	c.(2674-2676)Cgt>Tgt	p.R892C	DSP_ENST00000418664.2_Missense_Mutation_p.R892C	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	892	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GAGGAATTATCGTGATAACTA	0.388																																						ENST00000379802.3	0.840000	0.240000	6.700000e-01	3.500000e-01	0.490000	0.517775	0.490000	0.480000																										0				101						c.(2674-2676)Cgt>Tgt		desmoplakin							108.0	111.0	110.0					6																	7576570		2203	4300	6503	SO:0001583	missense	1832	1	121412	28				g.chr6:7576570C>T	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2674C>T	chr6.hg19:g.7576570C>T	ENSP00000369129:p.Arg892Cys	0					DSP_ENST00000418664.2_Missense_Mutation_p.R892C	p.R892C	NM_004415.2	NP_004406.2	0	0	0	1.971046	P15924	DESP_HUMAN		19	3015	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	1	1	hg19	c.2674C>T	CCDS4501.1	0	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886848	0.91814	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	T;T	0.35789	1.29;1.68	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.000000	0.64402	D	0.000002	T	0.39009	0.1062	L	0.52011	1.625	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	P;P	0.54706	0.642;0.759	T	0.19484	-1.0304	10	0.87932	D	0	.	15.2786	0.73764	0.1401:0.8599:0.0:0.0	.	939;892	Q4LE79;P15924	.;DESP_HUMAN	C	892;892;697	ENSP00000369129:R892C;ENSP00000396591:R892C	ENSP00000369129:R892C	R	+	1	0	0	DSP	7521569	7521569	0.993000	0.37304	0.991000	0.47740	0.937000	0.57800	3.174000	0.50847	2.865000	0.98341	0.655000	0.94253	CGT	0.080695		TCGA-IB-7891-01A-11D-2201-08	0.388	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	0	0	1		2	2	2	0	0	0	0	92	0	92	92	1	2	-3.058334	1	0.100000	NM_004415		0	9	9	0	355	352	0	0	1	1		0	0	92	0	0	9.941419e-01	9.203133e-01	0	14	0	163	0	9	355
LRFN2	57497	broad.mit.edu	37	6	40399611	40399611	+	Silent	SNP	G	G	A	rs372292437	byFrequency	TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr6:40399611G>A	ENST00000338305.6	-	2	1784	c.1242C>T	c.(1240-1242)ggC>ggT	p.G414G		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	414						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GAGGCTCTCCGCCCCCACTGC	0.652													G|||	2	0.000399361	0.0	0.0014	5008	,	,		15822	0.0		0.0	False		,,,				2504	0.001					ENST00000338305.6	1.000000	0.990000	1	9.900000e-01	0.990000	0.999991	0.990000	1.000000																										0				58						c.(1240-1242)ggC>ggT		leucine rich repeat and fibronectin type III domain containing 2		G		0,4406		0,0,2203	41.0	45.0	44.0		1242	-4.3	0.8	6		44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LRFN2	NM_020737.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		414/790	40399611	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57497	11	121394	39				g.chr6:40399611G>A	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1242C>T	chr6.hg19:g.40399611G>A		0						p.G414G	NM_020737.1	NP_065788.1	0	1	1	1.996284	Q9ULH4	LRFN2_HUMAN		2	1784	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	1	1	hg19	c.1242C>T	CCDS34443.1	1																																																																																								0.093656		TCGA-IB-7891-01A-11D-2201-08	0.652	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	1	0	1		2	2	2	0	0	0	0	81	0	81	78	1	2	-12.760030	1	0.100000	XM_166372		0	34	32	0	297	287	0	0	1			0	0	81	0	0	1	0	0	0	0	0	0	34	297
SYNE1	23345	broad.mit.edu	37	6	152763321	152763321	+	Silent	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr6:152763321C>T	ENST00000367255.5	-	31	4498	c.3897G>A	c.(3895-3897)gcG>gcA	p.A1299A	SYNE1_ENST00000448038.1_Silent_p.A1306A|SYNE1_ENST00000341594.5_Silent_p.A1365A|SYNE1_ENST00000367248.3_Silent_p.A1289A|SYNE1_ENST00000367253.4_Silent_p.A1299A|SYNE1_ENST00000423061.1_Silent_p.A1306A|SYNE1_ENST00000265368.4_Silent_p.A1299A|SYNE1_ENST00000413186.2_Silent_p.A1299A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1299					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A1299A(2)|p.A1306A(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCCTGCTGCGCCTGCGCGA	0.567										HNSCC(10;0.0054)																												ENST00000367255.5	1.000000	0.830000	1	9.900000e-01	0.990000	0.987881	0.990000	1.000000																										3	Substitution - coding silent(3)	p.A1299A(2)|p.A1306A(1)	lung(3)	524						c.(3895-3897)gcG>gcA		spectrin repeat containing, nuclear envelope 1							76.0	68.0	71.0					6																	152763321		2203	4300	6503	SO:0001819	synonymous_variant	23345	0	0					g.chr6:152763321C>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3897G>A	chr6.hg19:g.152763321C>T		0	HNSCC(10;0.0054)				SYNE1_ENST00000341594.5_Silent_p.A1365A|SYNE1_ENST00000265368.4_Silent_p.A1299A|SYNE1_ENST00000448038.1_Silent_p.A1306A|SYNE1_ENST00000367253.4_Silent_p.A1299A|SYNE1_ENST00000413186.2_Silent_p.A1299A|SYNE1_ENST00000367248.3_Silent_p.A1289A|SYNE1_ENST00000423061.1_Silent_p.A1306A	p.A1299A	NM_182961.3	NP_892006.3	0	1	1	1.996284	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	31	4498	-		Ovarian(120;0.0955)	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	1	1	hg19	c.3897G>A	CCDS5236.2	1																																																																																								0.093656		TCGA-IB-7891-01A-11D-2201-08	0.567	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	1	0	1		2	2	2	0	0	0	0	92	0	92	89	1	2	-3.318743	1	0.100000	NM_182961		0	24	24	0	352	347	0	0	1	0		0	0	92	0	0	9.999997e-01	2.471492e-02	0	0	0	4	0	24	352
SDK1	221935	broad.mit.edu	37	7	4185418	4185418	+	Silent	SNP	C	C	T	rs572022075	byFrequency	TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr7:4185418C>T	ENST00000404826.2	+	29	4432	c.4293C>T	c.(4291-4293)ggC>ggT	p.G1431G	SDK1_ENST00000389531.3_Silent_p.G1431G	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1431	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGGAGGTCGGCGCCACAGTGA	0.667													C|||	2	0.000399361	0.0	0.0	5008	,	,		16665	0.0		0.0	False		,,,				2504	0.002					ENST00000404826.2	1.000000	0.900000	1	9.900000e-01	0.990000	0.994276	0.990000	1.000000																										0				153						c.(4291-4293)ggC>ggT		sidekick cell adhesion molecule 1							63.0	57.0	59.0					7																	4185418		2203	4299	6502	SO:0001819	synonymous_variant	221935	26	121406	44				g.chr7:4185418C>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4293C>T	chr7.hg19:g.4185418C>T		0					SDK1_ENST00000389531.3_Silent_p.G1431G	p.G1431G	NM_152744.3	NP_689957.3	1	2	3	2.009592	Q7Z5N4	SDK1_HUMAN		29	4432	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	1	1	hg19	c.4293C>T	CCDS34590.1	1																																																																																								0.107586		TCGA-IB-7891-01A-11D-2201-08	0.667	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	1	0	1		2	2	2	0	0	0	0	116	0	116	113	1	2	-20.000000	1	0.100000	NM_152744		0	26	25	0	370	368	0	0	1	1		0	0	116	0	0	9.999999e-01	2.711081e-01	0	2	0	13	0	26	370
DNAH11	8701	broad.mit.edu	37	7	21659575	21659575	+	Splice_Site	SNP	T	T	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr7:21659575T>A	ENST00000409508.3	+	25	4410	c.4379T>A	c.(4378-4380)gTt>gAt	p.V1460D	DNAH11_ENST00000465593.1_3'UTR|DNAH11_ENST00000328843.6_Splice_Site_p.V1465D	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1465	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GATTACTAGGTTATTACTGAA	0.294									Kartagener syndrome																													ENST00000409508.3	1.000000	0.350000	1	4.900000e-01	0.680000	0.711271	0.680000	1.000000																										0				230						c.(4378-4380)gTt>gAt		dynein, axonemal, heavy chain 11							77.0	72.0	74.0					7																	21659575		1801	4066	5867	SO:0001630	splice_region_variant	8701	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21659575T>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4378-1T>A	chr7.hg19:g.21659575T>A		0					DNAH11_ENST00000465593.1_3'UTR|DNAH11_ENST00000328843.6_Splice_Site_p.V1465D	p.V1460D	NM_001277115.1	NP_001264044.1	1	2	3	2.009592	Q96DT5	DYH11_HUMAN		25	4410	+			Q9UJ82	Splice_Site	SNP	ENST00000409508.3	0	1	hg19	c.4379T>A		0	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665050	0.67700	.	.	ENSG00000105877	ENST00000328843	T	0.60299	0.2	5.47	4.32	0.51571	5.47	4.32	0.51571	Dynein heavy chain, domain-2 (1);	0.385085	0.26631	N	0.023319	T	0.49406	0.1555	.	.	.	0.58432	D	0.999999	P	0.42518	0.782	P	0.46172	0.506	T	0.32824	-0.9892	9	0.13470	T	0.59	.	9.897	0.41324	0.0:0.1423:0.0:0.8577	.	1465	Q96DT5	DYH11_HUMAN	D	1465	ENSP00000330671:V1465D	ENSP00000330671:V1465D	V	+	2	0	0	DNAH11	21626100	21626100	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.373000	0.59537	0.910000	0.36722	0.460000	0.39030	GTT	0.107586		TCGA-IB-7891-01A-11D-2201-08	0.294	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1		2	2	2	0	0	0	0	49	0	49	49	1	2	-3.519019	1	0.100000	NM_003777	Missense_Mutation	0	11	10	0	338	332	0	0	1			0	0	49	0	0	9.982069e-01	0	0	0	0	0	0	11	338
TNC	3371	broad.mit.edu	37	9	117849313	117849313	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr9:117849313T>C	ENST00000350763.4	-	3	1108	c.697A>G	c.(697-699)Aat>Gat	p.N233D	TNC_ENST00000537320.1_Missense_Mutation_p.N233D|TNC_ENST00000535648.1_Missense_Mutation_p.N233D|TNC_ENST00000542877.1_Missense_Mutation_p.N233D|TNC_ENST00000341037.4_Missense_Mutation_p.N233D|TNC_ENST00000345230.3_Missense_Mutation_p.N233D|TNC_ENST00000346706.3_Missense_Mutation_p.N233D|TNC_ENST00000340094.3_Missense_Mutation_p.N233D|TNC_ENST00000423613.2_Missense_Mutation_p.N233D	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	233	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CAGACTCCATTTACGCACTTG	0.602																																						ENST00000350763.4	1.000000	0.800000	1	9.900000e-01	0.990000	0.983834	0.990000	1.000000																										0				120						c.(697-699)Aat>Gat		tenascin C							93.0	76.0	82.0					9																	117849313		2203	4300	6503	SO:0001583	missense	3371	0	0					g.chr9:117849313T>C		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.697A>G	chr9.hg19:g.117849313T>C	ENSP00000265131:p.Asn233Asp	0					TNC_ENST00000535648.1_Missense_Mutation_p.N233D|TNC_ENST00000346706.3_Missense_Mutation_p.N233D|TNC_ENST00000345230.3_Missense_Mutation_p.N233D|TNC_ENST00000423613.2_Missense_Mutation_p.N233D|TNC_ENST00000340094.3_Missense_Mutation_p.N233D|TNC_ENST00000341037.4_Missense_Mutation_p.N233D|TNC_ENST00000542877.1_Missense_Mutation_p.N233D|TNC_ENST00000537320.1_Missense_Mutation_p.N233D	p.N233D	NM_002160.3	NP_002151.2	0	1	1	1.985475	P24821	TENA_HUMAN		3	1108	-			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	1	1	hg19	c.697A>G	CCDS6811.1	1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.143039	0.00332	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.01279	5.06;5.06;5.06;5.06;5.06;5.06;5.06;5.06;5.06	5.43	-5.81	0.02340	5.43	-5.81	0.02340	EGF, extracellular (1);Epidermal growth factor-like (1);	0.721338	0.14577	N	0.311092	T	0.00524	0.0017	N	0.04090	-0.28	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.15484	0.013;0.004	T	0.43605	-0.9381	10	0.02654	T	1	.	2.8079	0.05432	0.102:0.3463:0.2081:0.3436	.	233;233	E9PC84;P24821	.;TENA_HUMAN	D	233	ENSP00000344400:N233D;ENSP00000438152:N233D;ENSP00000344555:N233D;ENSP00000345861:N233D;ENSP00000265131:N233D;ENSP00000339553:N233D;ENSP00000411406:N233D;ENSP00000443478:N233D;ENSP00000442242:N233D	ENSP00000344400:N233D	N	-	1	0	0	TNC	116889134	116889134	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.053000	0.11846	-0.783000	0.04534	-0.456000	0.05471	AAT	0.090909		TCGA-IB-7891-01A-11D-2201-08	0.602	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	1	0	1		2	2	2	0	0	0	0	120	0	120	118	1	2	-20.000000	1	0.100000	NM_002160		0	24	24	0	363	357	0	0	1	0	1	0	0	120	873	0	9.999997e-01	9.024138e-01	1	0	129	63	1482	24	363
PRUNE2	158471	broad.mit.edu	37	9	79319818	79319818	+	Silent	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr9:79319818G>A	ENST00000376718.3	-	8	7495	c.7372C>T	c.(7372-7374)Ctg>Ttg	p.L2458L	PRUNE2_ENST00000428286.1_Silent_p.L2099L	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2458					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CGAATATGCAGCACAGCCAGC	0.493											OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000376718.3	1.000000	0.220000	1	4.300000e-01	0.740000	0.725274	0.740000	1.000000																										0				16						c.(7372-7374)Ctg>Ttg		prune homolog 2 (Drosophila)							62.0	53.0	56.0					9																	79319818		1568	3582	5150	SO:0001819	synonymous_variant	158471	0	0					g.chr9:79319818G>A	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7372C>T	chr9.hg19:g.79319818G>A		0		OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1190	PRUNE2_ENST00000428286.1_Silent_p.L2099L	p.L2458L	NM_015225.2	NP_056040.2	0	1	1	1.999444	Q8WUY3	PRUN2_HUMAN		8	7495	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	0	1	hg19	c.7372C>T	CCDS47982.1	0	.	.	.	.	.	.	.	.	.	.	G	0.051	-1.251675	0.01469	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.93	2.72	0.32119	5.93	2.72	0.32119	.	.	.	.	.	T	0.25382	0.0617	.	.	.	0.25788	N	0.984653	.	.	.	.	.	.	T	0.15723	-1.0427	4	.	.	.	-8.8671	4.1216	0.10108	0.2139:0.1958:0.5903:0.0	.	.	.	.	V	1779	.	.	A	-	2	0	0	PRUNE2	78509638	78509638	0.055000	0.20627	0.720000	0.30636	0.073000	0.16967	0.757000	0.26433	1.483000	0.48342	0.655000	0.94253	GCT	0.094112		TCGA-IB-7891-01A-11D-2201-08	0.493	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	0	0	0		2	2	2	0	0	0	0	22	0	22	22	1	2	-6.325588	1	0.100000	NM_138818		0	3	3	0	82	81	0	0	1	0		0	0	22	0	0	8.087907e-01	6.907467e-02	0	0	0	9	0	3	82
CEL	1056	broad.mit.edu	37	9	135946986	135946986	+	Silent	SNP	G	G	C			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chr9:135946986G>C	ENST00000372080.4	+	11	2122	c.2106G>C	c.(2104-2106)ggG>ggC	p.G702G	CEL_ENST00000351304.7_Silent_p.G633G	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	699	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		GTGACTCCGGGGCCCCCCCCG	0.826																																						ENST00000372080.4	1.000000	0.450000	1	8.100000e-01	0.990000	0.930294	0.990000	1.000000																										0				20						c.(2104-2106)ggG>ggC		carboxyl ester lipase							2.0	3.0	3.0					9																	135946986		1076	2608	3684	SO:0001819	synonymous_variant	1056	0	0					g.chr9:135946986G>C	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2106G>C	chr9.hg19:g.135946986G>C		0					CEL_ENST00000351304.7_Silent_p.G633G	p.G702G	NM_001807.3	NP_001798.2	0	1	1	1.985475	P19835	CEL_HUMAN		11	2122	+			Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	ENST00000372080.4	0	1	hg19	c.2106G>C	CCDS43896.1	1																																																																																								0.090909		TCGA-IB-7891-01A-11D-2201-08	0.826	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1	1	0	0		2	2	2	0	0	0	0	10	0	10	0	1	2	-8.378833	1	0.100000			0	3	0	0	29	0	0	0		0		0	0	10	0	0	0	6.532324e-01	0	0	0	21	0	3	29
AMOT	154796	broad.mit.edu	37	X	112058796	112058796	+	Silent	SNP	C	C	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chrX:112058796C>T	ENST00000524145.1	-	3	1256	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371958.1_Silent_p.Q162Q			Q4VCS5	AMOT_HUMAN	angiomotin	394					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q394Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gctgctgctgctgttgttggt	0.582																																						ENST00000524145.1	1.000000	0.250000	8.400000e-01	3.900000e-01	0.590000	0.616800	0.590000	1.000000																										1	Substitution - coding silent(1)	p.Q394Q(1)	lung(1)	43						c.(1180-1182)caG>caA		angiomotin							38.0	34.0	36.0					X																	112058796		2203	4300	6503	SO:0001819	synonymous_variant	154796	0	0					g.chrX:112058796C>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1182G>A	chrX.hg19:g.112058796C>T							AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371958.1_Silent_p.Q162Q	p.Q394Q			0	1	1		Q4VCS5	AMOT_HUMAN		3	1256	-			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	0	1	hg19	c.1182G>A	CCDS48154.1	0																																																																																								0.100000		TCGA-IB-7891-01A-11D-2201-08	0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	0	0	1		2	2	2	0	0	0	0	47	0	47	46	1	2	-2.550484	1	0.100000	NM_133265		0	6	6	0	206	200	0	0	1	0	0	0	0	47	2	0	9.624170e-01	5.231641e-02	1.119158e-02	0	0	11	5	6	206
PPEF1	5475	broad.mit.edu	37	X	18797154	18797154	+	Silent	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chrX:18797154G>A	ENST00000361511.4	+	10	1079	c.585G>A	c.(583-585)ccG>ccA	p.P195P	PPEF1_ENST00000359763.6_Silent_p.P142P|PPEF1_ENST00000544635.1_Silent_p.P130P|PPEF1_ENST00000349874.5_Silent_p.P195P|PPEF1_ENST00000543630.1_Silent_p.P195P	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	195	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AGAGGAACCCGTATGTTTTTA	0.408																																						ENST00000361511.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999973	0.990000	1.000000																										0				43						c.(583-585)ccG>ccA		protein phosphatase, EF-hand calcium binding domain 1							153.0	157.0	156.0					X																	18797154		2203	4300	6503	SO:0001819	synonymous_variant	5475	4	121412	36				g.chrX:18797154G>A	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.585G>A	chrX.hg19:g.18797154G>A							PPEF1_ENST00000349874.5_Silent_p.P195P|PPEF1_ENST00000544635.1_Silent_p.P130P|PPEF1_ENST00000543630.1_Silent_p.P195P|PPEF1_ENST00000359763.6_Silent_p.P142P	p.P195P	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	0	1	1		O14829	PPE1_HUMAN		10	1079	+	Hepatocellular(33;0.183)		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Silent	SNP	ENST00000361511.4	1	1	hg19	c.585G>A	CCDS14188.1	1																																																																																								0.100000		TCGA-IB-7891-01A-11D-2201-08	0.408	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	1	0	1		2	2	2	0	0	0	0	227	0	227	225	1	2	-13.644840	1	0.100000	NM_006240		0	71	72	0	893	880	0	0	1	0		0	0	227	0	0	1	0	0	0	0	1	0	71	893
GJB1	2705	broad.mit.edu	37	X	70444246	70444246	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chrX:70444246G>A	ENST00000374022.3	+	2	784	c.689G>A	c.(688-690)cGc>cAc	p.R230H	GJB1_ENST00000374029.1_Missense_Mutation_p.R230H|GJB1_ENST00000361726.6_Missense_Mutation_p.R230H	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	230			R -> C (in CMTX1; localized mainly on the cell membrane forming gap junction-like plaques). {ECO:0000269|PubMed:9361298}.|R -> L (in CMTX1; localized mainly on the cell membrane forming gap junction-like plaques). {ECO:0000269|PubMed:9361298}.		cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					CCACCTTCCCGCAAGGGCTCG	0.602																																						ENST00000374022.3	1.000000	0.490000	1	7.100000e-01	0.980000	0.888600	0.980000	1.000000																										0				10	GRCh37	CM973190	GJB1	M		c.(688-690)cGc>cAc		gap junction protein, beta 1, 32kDa							27.0	22.0	23.0					X																	70444246		2202	4297	6499	SO:0001583	missense	2705	1	121390	33				g.chrX:70444246G>A	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.689G>A	chrX.hg19:g.70444246G>A	ENSP00000363134:p.Arg230His						GJB1_ENST00000361726.6_Missense_Mutation_p.R230H|GJB1_ENST00000374029.1_Missense_Mutation_p.R230H	p.R230H	NM_001097642.2	NP_001091111.1	0	1	1		P08034	CXB1_HUMAN		2	784	+	Renal(35;0.156)		B2R8R2|D3DVV2|Q5U0S4	Missense_Mutation	SNP	ENST00000374022.3	1	1	hg19	c.689G>A	CCDS14408.1	1	.	.	.	.	.	.	.	.	.	.	G	9.312	1.055748	0.19907	.	.	ENSG00000169562	ENST00000374029;ENST00000374022;ENST00000361726	D;D;D	0.97642	-4.47;-4.47;-4.47	4.9	4.9	0.64082	4.9	4.9	0.64082	.	0.768330	0.12125	N	0.497315	D	0.93220	0.7840	N	0.14661	0.345	0.40423	D	0.979864	B	0.12013	0.005	B	0.08055	0.003	D	0.87941	0.2717	10	0.32370	T	0.25	.	17.2761	0.87115	0.0:0.0:1.0:0.0	.	230	P08034	CXB1_HUMAN	H	230	ENSP00000363141:R230H;ENSP00000363134:R230H;ENSP00000354900:R230H	ENSP00000354900:R230H	R	+	2	0	0	GJB1	70360971	70360971	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	4.144000	0.58057	2.260000	0.74910	0.592000	0.82586	CGC	0.100000		TCGA-IB-7891-01A-11D-2201-08	0.602	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	1	0	1		2	2	2	0	0	0	0	57	0	57	43	1	2	-12.009730	1	0.100000	NM_000166		0	9	7	0	175	145	0	0	1	0		0	0	57	0	0	9.874574e-01	9.877933e-01	0	0	0	153	0	9	175
FLNA	2316	broad.mit.edu	37	X	153581753	153581753	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7891-01A-11D-2201-08	TCGA-IB-7891-10A-01D-2201-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	232bda70-597f-4d12-b538-ae907bda8ba5	cceed9ba-fa58-465a-913a-928876675c22	g.chrX:153581753G>T	ENST00000369850.3	-	37	6169	c.5933C>A	c.(5932-5934)aCg>aAg	p.T1978K	FLNA_ENST00000360319.4_Missense_Mutation_p.T1970K|FLNA_ENST00000369856.3_Missense_Mutation_p.T111K|FLNA_ENST00000344736.4_Missense_Mutation_p.T1938K|FLNA_ENST00000422373.1_Missense_Mutation_p.T1970K|FLNA_ENST00000498491.1_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1978					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTGAGATCCGTCTCTGAGAT	0.632																																						ENST00000369850.3	1.000000	0.920000	1	9.900000e-01	0.990000	0.995479	0.990000	1.000000																										0				6						c.(5932-5934)aCg>aAg		filamin A, alpha							56.0	61.0	59.0					X																	153581753		2150	4221	6371	SO:0001583	missense	2316	0	0					g.chrX:153581753G>T	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.5933C>A	chrX.hg19:g.153581753G>T	ENSP00000358866:p.Thr1978Lys						FLNA_ENST00000369856.3_Missense_Mutation_p.T111K|FLNA_ENST00000422373.1_Missense_Mutation_p.T1970K|FLNA_ENST00000344736.4_Missense_Mutation_p.T1938K|FLNA_ENST00000360319.4_Missense_Mutation_p.T1970K|FLNA_ENST00000498491.1_5'Flank	p.T1978K	NM_001110556.1	NP_001104026.1	0	1	1		P21333	FLNA_HUMAN		37	6169	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	1	1	hg19	c.5933C>A	CCDS48194.1	1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240312	0.39598	.	.	ENSG00000196924	ENST00000360319;ENST00000422373;ENST00000369850;ENST00000369856;ENST00000344736	T;T;T;T;T	0.73363	0.96;0.96;0.96;-0.74;0.96	5.69	5.69	0.88448	5.69	5.69	0.88448	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.144833	0.46442	D	0.000290	T	0.81138	0.4760	L	0.58969	1.84	0.44603	D	0.99757	P;P;B;B	0.50617	0.924;0.937;0.059;0.059	P;P;B;B	0.53518	0.728;0.623;0.022;0.022	T	0.81854	-0.0741	10	0.54805	T	0.06	.	18.8633	0.92281	0.0:0.0:1.0:0.0	.	111;1970;1978;1978	E9PHF0;P21333-2;P21333;E9KL45	.;.;FLNA_HUMAN;.	K	1970;1970;1978;111;1938	ENSP00000353467:T1970K;ENSP00000416926:T1970K;ENSP00000358866:T1978K;ENSP00000358872:T111K;ENSP00000358863:T1938K	ENSP00000358863:T1938K	T	-	2	0	0	FLNA	153234947	153234947	1.000000	0.71417	0.883000	0.34634	0.592000	0.36648	4.226000	0.58606	2.402000	0.81655	0.436000	0.28706	ACG	0.100000		TCGA-IB-7891-01A-11D-2201-08	0.632	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3	1	0	1		2	2	2	0	0	0	0	162	0	162	158	1	2	-20.000000	1	0.100000			0	32	33	0	453	444	0	0	1	0		0	0	162	0	0	1	1	0	1	0	1198	0	32	453
