#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
GPRC5A	9052	broad.mit.edu	37	12	13061419	13061420	+	Frame_Shift_Ins	INS	-	-	TGGC			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			-	TGGC	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr12:13061419_13061420insTGGC	ENST00000014914.5	+	2	1126_1127	c.236_237insTGGC	c.(235-240)tttggcfs	p.-80fs	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A						signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	TTGGGCATCTTTGGCCTCACCT	0.559																																						ENST00000014914.5	1.000000	0.350000	0.640000	0.400000	0.480000	0.554319	0.480000	0.470000																										0				18						c.(235-240)tttggcfs		G protein-coupled receptor, class C, group 5, member A	Tretinoin(DB00755)																																			SO:0001589	frameshift_variant	9052	0	0					g.chr12:13061419_13061420insTGGC	AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.237_240dupTGGC	chr12.hg19:g.13061420_13061423dupTGGC	ENSP00000014914:p.Gly80fs	1					GPRC5A_ENST00000542056.1_Intron	p.-80fs	NM_003979.3	NP_003970.1	0	3	3	1.930904	Q8NFJ5	RAI3_HUMAN		2	1126_1127	+		Prostate(47;0.141)	B3KV45|O95357	Frame_Shift_Ins	INS	ENST00000014914.5	0	1	hg19	c.236_237insTGGC	CCDS8657.1	0																																																																																								0.271218		TCGA-IB-7893-01A-11D-2201-08	0.559	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400682.1	1	0	1		2	2		0	0	0	0	184	0	184	180	1	3.310000	-5.748933	1	0.210000			0	48	60	0	1013	987	0	0	1	0	0	0	0	184	0	0	1.000000	9.999669e-01	0	0	0	311	0	48	1013
ACSS3	79611	broad.mit.edu	37	12	81624902	81624902	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr12:81624902delC	ENST00000548058.1	+	12	2491	c.1581delC	c.(1579-1581)tacfs	p.Y527fs	ACSS3_ENST00000261206.3_Frame_Shift_Del_p.Y526fs|ACSS3_ENST00000548324.1_Frame_Shift_Del_p.Y209fs			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	527						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						AGCATTTATACTTTGAAAAAT	0.308																																						ENST00000548058.1	1.000000	0.620000	1.000000	0.790000	0.990000	0.924959	0.990000	1.000000																										0				51						c.(1579-1581)tacfs		acyl-CoA synthetase short-chain family member 3							52.0	53.0	52.0					12																	81624902		2203	4298	6501	SO:0001589	frameshift_variant	79611	0	0					g.chr12:81624902delC		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1581delC	chr12.hg19:g.81624902delC	ENSP00000449535:p.Tyr527fs	1					ACSS3_ENST00000548324.1_Frame_Shift_Del_p.Y209fs|ACSS3_ENST00000261206.3_Frame_Shift_Del_p.Y526fs	p.Y527fs			0	3	3	1.930904	Q9H6R3	ACSS3_HUMAN		12	2491	+			Q8NC66	Frame_Shift_Del	DEL	ENST00000548058.1	0	1	hg19	c.1581delC	CCDS9022.1	1																																																																																								0.271218		TCGA-IB-7893-01A-11D-2201-08	0.308	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	1	0	1		2	2		0	0	0	0	40	0	40	40	1	3.310000	-20.000000	1	0.210000	NM_024560		0	20	20	0	195	191	0	0	1	0	0	0	0	40	0	0	0.999996	8.648634e-01	0	0	0	37	0	20	195
POLR3A	11128	broad.mit.edu	37	10	79761987	79761987	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr10:79761987C>A	ENST00000372371.3	-	17	2464	c.2327G>T	c.(2326-2328)aGc>aTc	p.S776I		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	776					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GGTGAGGGGGCTGTTGCTCTT	0.587																																						ENST00000372371.3	1.000000	0.240000	1.000000	0.470000	0.830000	0.770678	0.830000	1.000000																										0				59						c.(2326-2328)aGc>aTc		polymerase (RNA) III (DNA directed) polypeptide A, 155kDa							78.0	63.0	68.0					10																	79761987		2203	4299	6502	SO:0001583	missense	11128	0	0					g.chr10:79761987C>A	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2327G>T	chr10.hg19:g.79761987C>A	ENSP00000361446:p.Ser776Ile	0						p.S776I	NM_007055.3	NP_008986.2	1	2	3	1.779255	O14802	RPC1_HUMAN	Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)	17	2464	-	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	0	1	hg19	c.2327G>T	CCDS7354.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.579888	0.96565	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.70631	-0.5	5.49	5.49	0.81192	5.49	5.49	0.81192	RNA polymerase Rpb1, domain 4 (1);	0.000000	0.85682	D	0.000000	D	0.85969	0.5821	M	0.89658	3.05	0.80722	D	1	D	0.56287	0.975	P	0.59056	0.851	D	0.87645	0.2524	9	.	.	.	-31.3285	19.7347	0.96198	0.0:1.0:0.0:0.0	.	776	O14802	RPC1_HUMAN	I	776	ENSP00000361446:S776I	.	S	-	2	0	0	POLR3A	79431993	79431993	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.206000	0.77891	2.746000	0.94184	0.655000	0.94253	AGC	0.217396		TCGA-IB-7893-01A-11D-2201-08	0.587	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	0	0	0	2	2	2	2	0	0	0	0	9	9	9	9	1	3.310000	-7.853695	1	0.210000	NM_007055		0	3	2	0	36	35	0		1	0		0	0	9	0	0	0.795552	6.913960e-01	0	0	0	28	0	3	36
PNLIP	5406	broad.mit.edu	37	10	118315573	118315573	+	Silent	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr10:118315573C>T	ENST00000369221.2	+	9	901	c.873C>T	c.(871-873)atC>atT	p.I291I		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	291					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	CTGATAGCATCGTCAACCCTG	0.433																																						ENST00000369221.2	1.000000	0.810000	1.000000	0.910000	0.990000	0.969318	0.990000	1.000000																										0				43						c.(871-873)atC>atT		pancreatic lipase	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)						213.0	186.0	195.0					10																	118315573		2203	4300	6503	SO:0001819	synonymous_variant	5406	0	0					g.chr10:118315573C>T	BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.873C>T	chr10.hg19:g.118315573C>T		0						p.I291I	NM_000936.2	NP_000927.1	1	2	3	1.779255	P16233	LIPP_HUMAN		9	901	+			Q5VSQ2	Silent	SNP	ENST00000369221.2	1	1	hg19	c.873C>T	CCDS7594.1	1																																																																																								0.217396		TCGA-IB-7893-01A-11D-2201-08	0.433	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	1	0	1	2	2	2	2	0	0	0	0	121	121	121	120	1	3.310000	-19.999430	1	0.210000	NM_000936		0	75	75	0	633	627	1		1	0		0	0	121	0	0	1.000000	2.086118e-01	0	0	0	8	0	75	633
CNTN5	53942	broad.mit.edu	37	11	100211266	100211266	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr11:100211266C>A	ENST00000524871.1	+	22	3092	c.2802C>A	c.(2800-2802)ttC>ttA	p.F934L	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000418526.2_Missense_Mutation_p.F860L|CNTN5_ENST00000279463.3_Missense_Mutation_p.F934L|CNTN5_ENST00000528682.1_Missense_Mutation_p.F934L	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	934	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.F934F(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ATGAGTCTTTCGTCATCCTAA	0.423																																						ENST00000524871.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - coding silent(1)	p.F934F(1)	large_intestine(1)	81						c.(2800-2802)ttC>ttA		contactin 5							92.0	92.0	92.0					11																	100211266		1927	4147	6074	SO:0001583	missense	53942	0	0					g.chr11:100211266C>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2802C>A	chr11.hg19:g.100211266C>A	ENSP00000435637:p.Phe934Leu	1					CNTN5_ENST00000528682.1_Missense_Mutation_p.F934L|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000418526.2_Missense_Mutation_p.F860L|CNTN5_ENST00000279463.3_Missense_Mutation_p.F934L	p.F934L	NM_014361.3	NP_055176.1	2	2	4	2.136612	O94779	CNTN5_HUMAN		22	3092	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	1	1	hg19	c.2802C>A	CCDS53696.1	1	.	.	.	.	.	.	.	.	.	.	C	4.092	0.014996	0.07959	.	.	ENSG00000149972	ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.18	-5.25	0.02781	5.18	-5.25	0.02781	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.412070	0.29053	N	0.013284	T	0.19886	0.0478	N	0.01576	-0.805	0.09310	N	0.999997	B;B	0.21688	0.019;0.059	B;B	0.23716	0.01;0.048	T	0.23797	-1.0178	9	.	.	.	.	14.7843	0.69790	0.0:0.4529:0.0:0.5471	.	860;934	O94779-2;O94779	.;CNTN5_HUMAN	L	934;934;860;934	ENSP00000436185:F934L;ENSP00000435637:F934L;ENSP00000393229:F860L;ENSP00000279463:F934L	.	F	+	3	2	2	CNTN5	99716476	99716476	0.000000	0.05858	0.031000	0.17742	0.006000	0.05464	-1.952000	0.01528	-0.884000	0.03976	-0.216000	0.12614	TTC	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.423	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	3.310000	-19.999680	1	0.210000	NM_014361		0	33	31	0	113	112	1		1			0	0	15	0	0	1.000000	0	0	0	0	0	0	33	113
AMPD3	272	broad.mit.edu	37	11	10518392	10518392	+	Silent	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr11:10518392C>T	ENST00000396554.3	+	10	1832	c.1491C>T	c.(1489-1491)aaC>aaT	p.N497N	AMPD3_ENST00000444303.2_Silent_p.N329N	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	488					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		TGCTGCCAAACTTTGGGAAGA	0.502																																						ENST00000396554.3	1.000000	0.620000	0.990000	0.730000	0.850000	0.857157	0.850000	1.000000																										0				25						c.(1489-1491)aaC>aaT		adenosine monophosphate deaminase 3							131.0	116.0	121.0					11																	10518392		2201	4294	6495	SO:0001819	synonymous_variant	272	0	0					g.chr11:10518392C>T	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.1491C>T	chr11.hg19:g.10518392C>T		1					AMPD3_ENST00000444303.2_Silent_p.N329N	p.N497N	NM_000480.2	NP_000471.1	2	2	4	2.130237	Q01432	AMPD3_HUMAN		10	1832	+			A0AUX0|B7Z2S2|B7Z763|B7Z877	Silent	SNP	ENST00000396554.3	1	1	hg19	c.1491C>T	CCDS7802.1	1																																																																																								0.347107		TCGA-IB-7893-01A-11D-2201-08	0.502	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	1	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	3.310000	-20.000000	1	0.210000	NM_000480		0	41	41	0	512	500	0		1	1		0	0	105	0	0	1.000000	6.998343e-01	0	3	0	29	0	41	512
AGBL2	79841	broad.mit.edu	37	11	47684620	47684620	+	Silent	SNP	T	T	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr11:47684620T>A	ENST00000525123.1	-	18	2778	c.2493A>T	c.(2491-2493)tcA>tcT	p.S831S	AGBL2_ENST00000357610.3_Silent_p.S833S|AGBL2_ENST00000298861.4_Silent_p.S831S	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	831						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						GGGTGGCCATTGATGGGTCCA	0.353																																						ENST00000525123.1	1.000000	0.850000	1.000000	0.930000	0.990000	0.977639	0.990000	1.000000																										0				34						c.(2491-2493)tcA>tcT		ATP/GTP binding protein-like 2							131.0	140.0	137.0					11																	47684620		2201	4298	6499	SO:0001819	synonymous_variant	79841	0	0					g.chr11:47684620T>A		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.2493A>T	chr11.hg19:g.47684620T>A		1					AGBL2_ENST00000298861.4_Silent_p.S831S|AGBL2_ENST00000357610.3_Silent_p.S833S	p.S831S	NM_024783.3	NP_079059.2	2	2	4	2.130237	Q5U5Z8	CBPC2_HUMAN		18	2778	-			A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Silent	SNP	ENST00000525123.1	1	1	hg19	c.2493A>T	CCDS7944.1	1																																																																																								0.347107		TCGA-IB-7893-01A-11D-2201-08	0.353	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	1	0	1	2	2	2	2	0	0	0	0	160	160	160	159	1	3.310000	-20.000000	1	0.210000	NM_024783		0	120	117	0	1228	1193	0		1	0		0	0	160	0	0	1.000000	8.069948e-03	0	0	0	2	0	120	1228
OR4C6	219432	broad.mit.edu	37	11	55433006	55433006	+	Missense_Mutation	SNP	G	G	A	rs367948844		TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr11:55433006G>A	ENST00000314259.3	+	1	393	c.364G>A	c.(364-366)Gtg>Atg	p.V122M		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V122L(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						TGACCGCTACGTGGCCATCTG	0.547																																						ENST00000314259.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.V122L(1)	lung(1)	71						c.(364-366)Gtg>Atg		olfactory receptor, family 4, subfamily C, member 6		G	MET/VAL	1,4399	2.1+/-5.4	0,1,2199	108.0	99.0	102.0		364	2.8	1.0	11		102	0,8592		0,0,4296	no	missense	OR4C6	NM_001004704.1	21	0,1,6495	AA,AG,GG		0.0,0.0227,0.0077	benign	122/310	55433006	1,12991	2200	4296	6496	SO:0001583	missense	219432	4	121406	39				g.chr11:55433006G>A	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.364G>A	chr11.hg19:g.55433006G>A	ENSP00000324769:p.Val122Met	1						p.V122M	NM_001004704.1	NP_001004704.1	2	2	4	2.130237	Q8NH72	OR4C6_HUMAN		1	393	+			B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	1	1	hg19	c.364G>A	CCDS31506.1	1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830823	0.32329	2.27E-4	0.0	ENSG00000181903	ENST00000314259	T	0.20463	2.07	3.77	2.85	0.33270	3.77	2.85	0.33270	GPCR, rhodopsin-like superfamily (1);	0.222920	0.22609	N	0.057844	T	0.19725	0.0474	M	0.69523	2.12	0.21802	N	0.999532	P	0.52170	0.951	B	0.40038	0.317	T	0.27123	-1.0083	10	0.62326	D	0.03	.	4.2775	0.10816	0.219:0.1919:0.5891:0.0	.	122	Q8NH72	OR4C6_HUMAN	M	122	ENSP00000324769:V122M	ENSP00000324769:V122M	V	+	1	0	0	OR4C6	55189582	55189582	0.009000	0.17119	0.983000	0.44433	0.942000	0.58702	0.122000	0.15687	0.604000	0.29930	0.536000	0.68110	GTG	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.547	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	1	0	1	2	2	2	2	0	0	0	0	101	101	101	99	1	3.310000	-20.000000	1	0.210000	NM_001004704		0	111	109	0	444	431	1		1			0	0	101	0	0	1.000000	0	0	0	0	0	0	111	444
RAB6A	5870	broad.mit.edu	37	11	73471653	73471653	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr11:73471653G>T	ENST00000336083.3	-	1	483	c.28C>A	c.(28-30)Ccg>Acg	p.P10T	RP11-707G14.1_ENST00000540547.1_RNA|RAB6A_ENST00000536566.1_5'Flank|RAB6A_ENST00000310653.6_Missense_Mutation_p.P10T|RAB6A_ENST00000541588.1_Missense_Mutation_p.P10T	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	10					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						TTCCTCAGCGGATTCCCGAAG	0.667																																						ENST00000336083.3	0.990000	0.160000	0.720000	0.290000	0.470000	0.510379	0.470000	1.000000																										0				4						c.(28-30)Ccg>Acg		RAB6A, member RAS oncogene family							35.0	30.0	32.0					11																	73471653		2200	4293	6493	SO:0001583	missense	5870	0	0					g.chr11:73471653G>T	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.28C>A	chr11.hg19:g.73471653G>T	ENSP00000336850:p.Pro10Thr	1					RAB6A_ENST00000541588.1_Missense_Mutation_p.P10T|RAB6A_ENST00000536566.1_5'Flank|RP11-707G14.1_ENST00000540547.1_RNA|RAB6A_ENST00000310653.6_Missense_Mutation_p.P10T	p.P10T	NM_198896.1	NP_942599.1	2	2	4	2.136612	P20340	RAB6A_HUMAN		1	483	-			A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	ENST00000336083.3	0	1	hg19	c.28C>A	CCDS8224.1	0	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084059	0.76642	.	.	ENSG00000175582	ENST00000310653;ENST00000336083;ENST00000393571;ENST00000541588;ENST00000540771;ENST00000539750;ENST00000535748;ENST00000542366	T;T;T	0.64803	-0.12;-0.12;-0.11	4.89	3.98	0.46160	4.89	3.98	0.46160	.	0.057059	0.64402	D	0.000001	T	0.65176	0.2666	L	0.53561	1.675	0.80722	D	1	B;D;B;B	0.53312	0.057;0.959;0.136;0.041	B;P;B;B	0.51615	0.05;0.675;0.059;0.051	T	0.68010	-0.5522	10	0.66056	D	0.02	.	10.9382	0.47257	0.0903:0.0:0.9097:0.0	.	10;10;10;10	Q1W5D8;F5H3K7;P20340;P20340-2	.;.;RAB6A_HUMAN;.	T	10	ENSP00000311449:P10T;ENSP00000336850:P10T;ENSP00000445350:P10T	ENSP00000311449:P10T	P	-	1	0	0	RAB6A	73149301	73149301	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.901000	0.75693	1.289000	0.44618	0.650000	0.86243	CCG	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.667	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259241.2	0	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	3.310000	-7.158389	1	0.210000			0	4	5	0	104	96	0		1	0		0	0	20	0	0	0.875271	9.958214e-01	0	0	0	331	0	4	104
DYNC2H1	79659	broad.mit.edu	37	11	103175414	103175414	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr11:103175414C>A	ENST00000375735.2	+	77	11491	c.11347C>A	c.(11347-11349)Cat>Aat	p.H3783N	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.H3790N	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3783	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GAAGAACTTACATCTTGTGGT	0.398																																						ENST00000375735.2	0.780000	0.320000	0.660000	0.410000	0.520000	0.542072	0.520000	0.520000																										0				33						c.(11347-11349)Cat>Aat		dynein, cytoplasmic 2, heavy chain 1							100.0	99.0	99.0					11																	103175414		1871	4107	5978	SO:0001583	missense	79659	0	0					g.chr11:103175414C>A	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11347C>A	chr11.hg19:g.103175414C>A	ENSP00000364887:p.His3783Asn	1					DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.H3790N	p.H3783N	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	2	2	4	2.136612	Q8NCM8	DYHC2_HUMAN		77	11491	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	1	1	hg19	c.11347C>A	CCDS53701.1	0	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549973	0.86127	.	.	ENSG00000187240	ENST00000375735;ENST00000398093;ENST00000540621	T;T	0.34275	1.37;1.37	5.37	5.37	0.77165	5.37	5.37	0.77165	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.69691	0.3139	M	0.92738	3.34	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.982;0.987	T	0.77544	-0.2548	10	0.87932	D	0	.	17.6563	0.88179	0.0:1.0:0.0:0.0	.	3783;3790	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	N	3783;3790;29	ENSP00000364887:H3783N;ENSP00000381167:H3790N	ENSP00000364887:H3783N	H	+	1	0	0	DYNC2H1	102680624	102680624	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.557000	0.82243	2.687000	0.91594	0.655000	0.94253	CAT	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.398	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	3.310000	-18.580900	1	0.210000	XM_370652		0	18	19	0	382	378	1		1	1		0	0	47	0	0	0.999982	6.732132e-01	0	12	0	38	0	18	382
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999940	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	3	3	1.930904	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.271218		TCGA-IB-7893-01A-11D-2201-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	3.310000	-15.978220	1	0.210000	NM_033360		2010	24	24	6004	107	102	1	1	1	1	1	0	0	18	314	1	1.000000	9.954361e-01	1	18	51	24	240	24	107
GAS6	2621	broad.mit.edu	37	13	114535736	114535736	+	Missense_Mutation	SNP	C	C	T	rs141710031	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr13:114535736C>T	ENST00000357389.3	-	9	1105	c.953G>A	c.(952-954)cGt>cAt	p.R318H	GAS6_ENST00000327773.6_Intron|GAS6_ENST00000450766.1_Intron|GAS6_ENST00000418959.3_5'UTR|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000355761.4_Intron			Q14393	GAS6_HUMAN	growth arrest-specific 6	318					activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CTGCCACGGACGGGGGCCACG	0.692													c|||	31	0.0061901	0.0234	0.0	5008	,	,		14575	0.0		0.0	False		,,,				2504	0.0					ENST00000357389.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				5						c.(952-954)cGt>cAt		growth arrest-specific 6		T	,,	77,4317	68.1+/-105.8	1,75,2121	102.0	67.0	78.0		,,	-3.4	0.0	13	dbSNP_134	78	1,8579	1.2+/-3.3	0,1,4289	no	intron,intron,utr-5	GAS6	NM_000820.2,NM_001143945.1,NM_001143946.1	,,	1,76,6410	TT,TC,CC		0.0117,1.7524,0.6012	,,	,,	114535736	78,12896	2197	4290	6487	SO:0001583	missense	2621	216	120582	55				g.chr13:114535736C>T		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000357389.3:c.953G>A	chr13.hg19:g.114535736C>T	ENSP00000349962:p.Arg318His	1					GAS6_ENST00000355761.4_Intron|GAS6_ENST00000450766.1_Intron|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000327773.6_Intron|GAS6_ENST00000418959.3_5'UTR	p.R318H			0	3	3	1.939427	Q14393	GAS6_HUMAN		9	1105	-	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000357389.3	1	0	hg19	c.953G>A		1	16	0.007326007326007326	16	0.032520325203252036	0	0.0	0	0.0	0	0.0	c	0.020	-1.436583	0.01108	0.017524	1.17E-4	ENSG00000183087	ENST00000357389	D	0.90620	-2.7	1.72	-3.43	0.04810	1.72	-3.43	0.04810	.	.	.	.	.	T	0.64929	0.2643	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.63198	-0.6691	6	0.39692	T	0.17	.	0.1497	0.00092	0.3614:0.16:0.1761:0.3025	.	.	.	.	H	318	ENSP00000349962:R318H	ENSP00000349962:R318H	R	-	2	0	0	GAS6	113578207	113578207	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.259000	0.08721	-2.506000	0.00507	-2.626000	0.00155	CGT	0.283707		TCGA-IB-7893-01A-11D-2201-08	0.692	GAS6-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	65	65	65	61	1	3.310000	-2.647298	1	0.210000	NM_000820		0	79	78	0	298	279	1		1			0	0	65	0	0	1.000000	0	0	0	0	0	0	79	298
JAG2	3714	broad.mit.edu	37	14	105609113	105609113	+	Silent	SNP	C	C	A	rs3122382	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr14:105609113C>A	ENST00000331782.3	-	26	4039	c.3636G>T	c.(3634-3636)ccG>ccT	p.P1212P	JAG2_ENST00000347004.2_Silent_p.P1174P	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	1212					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CCCAGTGGGCCGGCCTCCCCG	0.672																																						ENST00000331782.3	1.000000	0.100000	0.650000	0.210000	0.380000	0.435622	0.380000	0.320000																										0				22						c.(3634-3636)ccG>ccT		jagged 2							18.0	19.0	18.0					14																	105609113		2193	4296	6489	SO:0001819	synonymous_variant	3714	0	0					g.chr14:105609113C>A	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.3636G>T	chr14.hg19:g.105609113C>A		0					JAG2_ENST00000347004.2_Silent_p.P1174P	p.P1212P	NM_002226.4	NP_002217.3	1	2	3	1.937806	Q9Y219	JAG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	26	4039	-		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Silent	SNP	ENST00000331782.3	0	1	hg19	c.3636G>T	CCDS9998.1	0																																																																																								0.280281		TCGA-IB-7893-01A-11D-2201-08	0.672	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2	0	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	3.310000	-6.147521	1	0.210000			0	3	3	0	96	92	0		1	0		0	0	29	0	0	0.799303	1.262102e-01	0	0	0	15	0	3	96
TMX1	81542	broad.mit.edu	37	14	51716045	51716045	+	Splice_Site	SNP	A	A	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr14:51716045A>T	ENST00000457354.2	+	5	570	c.445A>T	c.(445-447)Atg>Ttg	p.M149L		NM_030755.4	NP_110382.3	Q9H3N1	TMX1_HUMAN	thioredoxin-related transmembrane protein 1	149					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide isomerase activity (GO:0003756)			endometrium(2)|large_intestine(2)|urinary_tract(1)	5						TATTTTTAGGATGAGTAGTAT	0.284																																						ENST00000457354.2	1.000000	0.800000	1.000000	0.940000	0.990000	0.977528	0.990000	1.000000																										0				5						c.(445-447)Atg>Ttg		thioredoxin-related transmembrane protein 1							92.0	87.0	89.0					14																	51716045		1807	4062	5869	SO:0001630	splice_region_variant	81542	0	0					g.chr14:51716045A>T	AB048246	CCDS41953.1	14q22.1	2011-10-19	2009-02-23	2009-02-23				"""Protein disulfide isomerases"""	15487	protein-coding gene	gene with protein product	"""thioredoxin-related transmembrane protein"", ""protein disulfide isomerase family A, member 11"""	610527	"""thioredoxin domain-containing"", ""thioredoxin domain containing"", ""thioredoxin domain containing 1"""	TXNDC, TXNDC1		11152479	Standard	NM_030755		Approved	TMX, PDIA11	uc001wza.4	Q9H3N1		ENST00000457354.2:c.444-1A>T	chr14.hg19:g.51716045A>T		0						p.M149L	NM_030755.4	NP_110382.3	1	2	3	1.948275	Q9H3N1	TMX1_HUMAN		5	570	+			B2R7A4|Q8N487|Q8NBN5|Q9Y4T6	Splice_Site	SNP	ENST00000457354.2	1	0	hg19	c.445A>T	CCDS41953.1	1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.858882	0.71834	.	.	ENSG00000139921	ENST00000457354	T	0.63913	-0.07	5.75	5.75	0.90469	5.75	5.75	0.90469	Thioredoxin-like fold (1);	0.070753	0.85682	D	0.000000	T	0.65312	0.2679	M	0.66506	2.035	0.58432	D	0.999995	P;P	0.45283	0.537;0.855	B;P	0.48334	0.391;0.574	T	0.64015	-0.6506	10	0.28530	T	0.3	-22.9158	10.7708	0.46321	0.8579:0.0:0.0:0.1421	.	65;149	B4DZX7;Q9H3N1	.;TMX1_HUMAN	L	149	ENSP00000393316:M149L	ENSP00000393316:M149L	M	+	1	0	0	TMX1	50785795	50785795	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.210000	0.65214	2.185000	0.69588	0.533000	0.62120	ATG	0.285068		TCGA-IB-7893-01A-11D-2201-08	0.284	TMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411206.1	1	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	3.310000	-13.679730	1	0.210000	NM_030755	Missense_Mutation	0	37	35	0	315	306	1		1	1		0	0	38	0	0	1.000000	9.999993e-01	0	19	0	168	0	37	315
NUDT14	256281	broad.mit.edu	37	14	105639421	105639421	+	Silent	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr14:105639421G>A	ENST00000392568.2	-	5	699	c.606C>T	c.(604-606)ctC>ctT	p.L202L	RP11-44N21.4_ENST00000548203.1_RNA|NUDT14_ENST00000550912.1_5'UTR	NM_177533.4	NP_803877.2	O95848	NUD14_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 14	202	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ADP-ribose diphosphatase activity (GO:0047631)|metal ion binding (GO:0046872)|UDP-sugar diphosphatase activity (GO:0008768)			cervix(2)|endometrium(1)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	14		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		AGATGACGCCGAGGGTCTTGG	0.632										HNSCC(42;0.11)																												ENST00000392568.2	1.000000	0.830000	1.000000	0.990000	0.990000	0.985343	0.990000	1.000000																										0				14						c.(604-606)ctC>ctT		nudix (nucleoside diphosphate linked moiety X)-type motif 14							79.0	80.0	79.0					14																	105639421		2202	4294	6496	SO:0001819	synonymous_variant	256281	0	0					g.chr14:105639421G>A	AB087802	CCDS10000.1	14q32.33	2013-02-15			ENSG00000183828	ENSG00000183828		"""Nudix motif containing"""	20141	protein-coding gene	gene with protein product		609219				12429023	Standard	NM_177533		Approved	UGPP	uc010tyn.3	O95848	OTTHUMG00000170372	ENST00000392568.2:c.606C>T	chr14.hg19:g.105639421G>A		0	HNSCC(42;0.11)				NUDT14_ENST00000550912.1_5'UTR|RP11-44N21.4_ENST00000548203.1_RNA	p.L202L	NM_177533.4	NP_803877.2	1	2	3	1.937806	O95848	NUD14_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	5	699	-		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	Q86SJ8	Silent	SNP	ENST00000392568.2	1	1	hg19	c.606C>T	CCDS10000.1	1																																																																																								0.280281		TCGA-IB-7893-01A-11D-2201-08	0.632	NUDT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074544.4	0	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	3.310000	-3.318806	1	0.210000	NM_177533		0	33	31	0	264	258	1		1	1		0	0	65	0	0	1.000000	9.918784e-01	0	12	0	51	0	33	264
PTX4	390667	broad.mit.edu	37	16	1536305	1536305	+	Missense_Mutation	SNP	C	C	T	rs139020235	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr16:1536305C>T	ENST00000447419.2	-	3	1097	c.1072G>A	c.(1072-1074)Ggc>Agc	p.G358S	PTX4_ENST00000440447.2_3'UTR|PTX4_ENST00000293922.1_Missense_Mutation_p.G353S			Q96A99	PTX4_HUMAN	pentraxin 4, long	358	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						TGCCACTGGCCGTCCAGCAGC	0.672													C|||	8	0.00159744	0.0061	0.0	5008	,	,		15960	0.0		0.0	False		,,,				2504	0.0					ENST00000447419.2	1.000000	0.130000	0.540000	0.220000	0.340000	0.405432	0.340000	0.310000																										0				17						c.(1072-1074)Ggc>Agc		pentraxin 4, long		C	SER/GLY	23,4375	28.1+/-56.4	0,23,2176	29.0	33.0	32.0		1057	-1.3	0.1	16	dbSNP_134	32	0,8596		0,0,4298	yes	missense	PTX4	NM_001013658.1	56	0,23,6474	TT,TC,CC		0.0,0.523,0.177	probably-damaging	353/474	1536305	23,12971	2199	4298	6497	SO:0001583	missense	390667	54	121394	47				g.chr16:1536305C>T		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.1072G>A	chr16.hg19:g.1536305C>T	ENSP00000445277:p.Gly358Ser	0					PTX4_ENST00000293922.1_Missense_Mutation_p.G353S|PTX4_ENST00000440447.2_3'UTR	p.G358S			1	2	3	1.935424	Q96A99	PTX4_HUMAN		3	1097	-				Missense_Mutation	SNP	ENST00000447419.2	0	1	hg19	c.1072G>A		0	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555929	0.27827	0.00523	0.0	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.70399	-0.48;-0.48	5.58	-1.27	0.09347	5.58	-1.27	0.09347	.	0.344788	0.28877	N	0.013853	T	0.64011	0.2560	L	0.55103	1.725	0.36413	D	0.863864	P	0.49783	0.928	P	0.56434	0.798	T	0.70011	-0.4989	10	0.72032	D	0.01	.	6.632	0.22861	0.0:0.5363:0.1133:0.3505	.	353	Q96A99-2	.	S	358;353	ENSP00000445277:G358S;ENSP00000293922:G353S	ENSP00000293922:G353S	G	-	1	0	0	PTX4	1476306	1476306	0.000000	0.05858	0.060000	0.19600	0.388000	0.30384	0.231000	0.17872	-0.153000	0.11137	-0.878000	0.02970	GGC	0.278209		TCGA-IB-7893-01A-11D-2201-08	0.672	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	3.310000	-7.852806	1	0.210000	NM_001013658		0	6	5	0	196	191	0		1			0	0	63	0	0	0.962291	0	0	0	0	0	0	6	196
UBN1	29855	broad.mit.edu	37	16	4920917	4920917	+	Silent	SNP	A	A	G			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr16:4920917A>G	ENST00000396658.4	+	10	2206	c.1503A>G	c.(1501-1503)aaA>aaG	p.K501K	UBN1_ENST00000262376.6_Silent_p.K501K|UBN1_ENST00000590769.1_Silent_p.K501K|UBN1_ENST00000545171.1_Silent_p.K501K	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	501					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K501K(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						ATGAAGAAAAAGGGGGCAGGA	0.522																																						ENST00000396658.4	1.000000	0.060000	0.310000	0.110000	0.180000	0.258525	0.180000	0.170000																										1	Substitution - coding silent(1)	p.K501K(1)	lung(1)	38						c.(1501-1503)aaA>aaG		ubinuclein 1							72.0	71.0	72.0					16																	4920917		2197	4300	6497	SO:0001819	synonymous_variant	29855	0	0					g.chr16:4920917A>G	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1503A>G	chr16.hg19:g.4920917A>G		0					UBN1_ENST00000262376.6_Silent_p.K501K|UBN1_ENST00000545171.1_Silent_p.K501K|UBN1_ENST00000590769.1_Silent_p.K501K	p.K501K	NM_016936.3	NP_058632.2	1	2	3	1.935424	Q9NPG3	UBN1_HUMAN		10	2206	+			B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	ENST00000396658.4	0	1	hg19	c.1503A>G	CCDS10525.1	0																																																																																								0.278209		TCGA-IB-7893-01A-11D-2201-08	0.522	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	56	1	3.310000	-1.931542	0	0.210000	NM_016936		0	5	5	0	314	303	0		1	0		0	0	58	0	0	0.932083	3.424384e-01	0	0	0	66	0	5	314
SMG1	23049	broad.mit.edu	37	16	18882786	18882786	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr16:18882786C>A	ENST00000446231.2	-	16	2614	c.2202G>T	c.(2200-2202)tgG>tgT	p.W734C	SMG1_ENST00000389467.3_Missense_Mutation_p.W734C|snoU13_ENST00000459248.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	734	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTTCCAAAGCCCAAGTCATTA	0.338																																						ENST00000446231.2	1.000000	0.240000	0.830000	0.370000	0.540000	0.587621	0.540000	0.500000																										0				92						c.(2200-2202)tgG>tgT		SMG1 phosphatidylinositol 3-kinase-related kinase							53.0	48.0	50.0					16																	18882786		1812	4083	5895	SO:0001583	missense	23049	0	0					g.chr16:18882786C>A	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.2202G>T	chr16.hg19:g.18882786C>A	ENSP00000402515:p.Trp734Cys	0					SMG1_ENST00000389467.3_Missense_Mutation_p.W734C|snoU13_ENST00000459248.1_RNA	p.W734C			1	2	3	1.935424	Q96Q15	SMG1_HUMAN		16	2614	-			O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	0	1	hg19	c.2202G>T	CCDS45430.1	0	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287871	0.80803	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.17691	2.26;2.26	5.21	5.21	0.72293	5.21	5.21	0.72293	Armadillo-type fold (1);	0.091723	0.47455	U	0.000236	T	0.31482	0.0798	M	0.65975	2.015	0.80722	D	1	D	0.63046	0.992	P	0.49561	0.615	T	0.08911	-1.0699	10	0.87932	D	0	.	19.116	0.93340	0.0:1.0:0.0:0.0	.	734	Q96Q15	SMG1_HUMAN	C	734	ENSP00000402515:W734C;ENSP00000374118:W734C	ENSP00000374118:W734C	W	-	3	0	0	SMG1	18790287	18790287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.857000	0.69525	2.589000	0.87451	0.555000	0.69702	TGG	0.278209		TCGA-IB-7893-01A-11D-2201-08	0.338	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	0	0	0	2	2	2	2	0	0	0	0	25	25	25	26	1	3.310000	-10.153060	1	0.210000	NM_015092		0	7	4	0	139	131	0		1	0		0	0	25	0	0	0.975467	3.681418e-01	0	0	0	24	0	7	139
SLC12A3	6559	broad.mit.edu	37	16	56924262	56924262	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr16:56924262G>A	ENST00000563236.1	+	19	2387	c.2362G>A	c.(2362-2364)Gcg>Acg	p.A788T	SLC12A3_ENST00000438926.2_Missense_Mutation_p.A788T|SLC12A3_ENST00000262502.5_Missense_Mutation_p.A787T|SLC12A3_ENST00000566786.1_Missense_Mutation_p.A787T			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	788					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GATGATGCAGGCGCACAGTGA	0.458																																						ENST00000563236.1	1.000000	0.070000	0.310000	0.130000	0.200000	0.245367	0.200000	0.190000																										0				50						c.(2362-2364)Gcg>Acg		solute carrier family 12 (sodium/chloride transporter), member 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)						152.0	105.0	121.0					16																	56924262		2198	4300	6498	SO:0001583	missense	6559	0	0					g.chr16:56924262G>A		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2362G>A	chr16.hg19:g.56924262G>A	ENSP00000456149:p.Ala788Thr	1					SLC12A3_ENST00000262502.5_Missense_Mutation_p.A787T|SLC12A3_ENST00000438926.2_Missense_Mutation_p.A788T|SLC12A3_ENST00000566786.1_Missense_Mutation_p.A787T	p.A788T			2	2	4	2.102362	P55017	S12A3_HUMAN		19	2387	+			A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	0	1	hg19	c.2362G>A	CCDS58464.1	0	.	.	.	.	.	.	.	.	.	.	G	10.57	1.387157	0.25031	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.63	3.62	0.41486	5.63	3.62	0.41486	.	0.299899	0.36002	N	0.002841	T	0.43986	0.1272	L	0.38838	1.175	0.40083	D	0.976162	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.001;0.003	T	0.25363	-1.0134	9	0.27082	T	0.32	.	9.6378	0.39819	0.0777:0.143:0.7794:0.0	.	787;788;788	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	T	787;788	.	ENSP00000262502:A788T	A	+	1	0	0	SLC12A3	55481763	55481763	1.000000	0.71417	0.970000	0.41538	0.411000	0.31082	4.456000	0.60081	0.683000	0.31428	0.655000	0.94253	GCG	0.341392		TCGA-IB-7893-01A-11D-2201-08	0.458	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1	0	0	0	2	2	2	2	0	0	0	0	50	50	50	50	1	3.310000	-6.276320	1	0.210000			0	6	6	0	361	352	0		1			0	0	50	0	0	0.962200	0	0	0	0	0	0	6	361
FUK	197258	broad.mit.edu	37	16	70500121	70500121	+	Silent	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr16:70500121C>A	ENST00000288078.6	+	5	604	c.372C>A	c.(370-372)gtC>gtA	p.V124V	FUK_ENST00000571514.1_Intron|FUK_ENST00000428974.2_Silent_p.V107V|FUK_ENST00000378912.2_Silent_p.V156V	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	124						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				AAGCCTTGGTCTGCAACCTGG	0.637																																						ENST00000288078.6	1.000000	0.080000	0.330000	0.140000	0.220000	0.260997	0.220000	0.200000																										0				23						c.(370-372)gtC>gtA		fucokinase							56.0	63.0	61.0					16																	70500121		2011	4159	6170	SO:0001819	synonymous_variant	197258	0	0					g.chr16:70500121C>A		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.372C>A	chr16.hg19:g.70500121C>A		1					FUK_ENST00000378912.2_Silent_p.V156V|FUK_ENST00000428974.2_Silent_p.V107V|FUK_ENST00000571514.1_Intron	p.V124V	NM_145059.2	NP_659496.2	2	2	4	2.102362	Q8N0W3	FUK_HUMAN		5	604	+		Ovarian(137;0.0694)	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	ENST00000288078.6	0	1	hg19	c.372C>A	CCDS10891.2	0																																																																																								0.341392		TCGA-IB-7893-01A-11D-2201-08	0.637	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	0	0	0	2	2	2	2	0	0	0	0	78	78	78	73	1	3.310000	-6.550677	1	0.210000	NM_145059		0	6	1	0	335	319	0		0	0		0	0	78	0	0	0.957872	7.829084e-02	0	0	0	22	0	6	335
TP53	7157	broad.mit.edu	37	17	7577520	7577520	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr17:7577520A>C	ENST00000269305.4	-	7	950	c.761T>G	c.(760-762)aTc>aGc	p.I254S	TP53_ENST00000359597.4_Missense_Mutation_p.I254S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.I254S|TP53_ENST00000420246.2_Missense_Mutation_p.I254S|TP53_ENST00000445888.2_Missense_Mutation_p.I254S|TP53_ENST00000413465.2_Missense_Mutation_p.I254S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	254	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> D (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|I -> F (in a sporadic cancer; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> M (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I254S(6)|p.L252_I254delLTI(4)|p.I254T(3)|p.I254N(3)|p.I254D(3)|p.T253_I255del(2)|p.I254del(2)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGTGTGATGATGGTGAGGAT	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		35	Substitution - Missense(15)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(1)|Unknown(1)	p.0?(8)|p.I254S(6)|p.L252_I254delLTI(4)|p.I254T(3)|p.I254N(3)|p.I254D(3)|p.T253_I255del(2)|p.I254del(2)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)	haematopoietic_and_lymphoid_tissue(9)|large_intestine(7)|bone(4)|central_nervous_system(3)|stomach(2)|oesophagus(2)|breast(2)|ovary(2)|endometrium(1)|skin(1)|lung(1)|liver(1)	24185						c.(760-762)aTc>aGc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						148.0	106.0	120.0					17																	7577520		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577520A>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.761T>G	chr17.hg19:g.7577520A>C	ENSP00000269305:p.Ile254Ser	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.I254S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.I254S|TP53_ENST00000420246.2_Missense_Mutation_p.I254S|TP53_ENST00000359597.4_Missense_Mutation_p.I254S|TP53_ENST00000413465.2_Missense_Mutation_p.I254S	p.I254S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.760364	P04637	P53_HUMAN		7	950	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.761T>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	A	17.59	3.426944	0.62733	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99841	-7.09;-7.09;-7.09;-7.09;-7.09;-7.09;-7.09	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.84219	2.685	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.951;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.968;1.0;1.0;0.997	D	0.96936	0.9684	10	0.87932	D	0	-30.4212	12.3101	0.54924	1.0:0.0:0.0:0.0	.	254;254;254;254;254	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	254;254;254;254;254;254;243;122	ENSP00000410739:I254S;ENSP00000352610:I254S;ENSP00000269305:I254S;ENSP00000398846:I254S;ENSP00000391127:I254S;ENSP00000391478:I254S;ENSP00000425104:I122S	ENSP00000269305:I254S	I	-	2	0	0	TP53	7518245	7518245	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	9.087000	0.94110	2.074000	0.62210	0.379000	0.24179	ATC	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.587	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	3.310000	-20.000000	1	0.210000	NM_000546		0	70	67	0	233	224	1		1	1	1	0	0	62	601	0	1.000000	9.999999e-01	1	26	106	57	450	70	233
KRT37	8688	broad.mit.edu	37	17	39579066	39579066	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr17:39579066C>A	ENST00000225550.3	-	3	695	c.696G>T	c.(694-696)aaG>aaT	p.K232N	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	232	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				GCTGCTCCTCCTTCAGGGACT	0.682																																						ENST00000225550.3	1.000000	0.780000	1.000000	0.950000	0.990000	0.977208	0.990000	1.000000																										0				25						c.(694-696)aaG>aaT		keratin 37							55.0	47.0	50.0					17																	39579066		2203	4297	6500	SO:0001583	missense	8688	0	0					g.chr17:39579066C>A	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.696G>T	chr17.hg19:g.39579066C>A	ENSP00000225550:p.Lys232Asn	1					AC003958.2_ENST00000432258.1_RNA	p.K232N	NM_003770.4	NP_003761.3	2	2	4	2.157474	O76014	KRT37_HUMAN		3	695	-		Breast(137;0.000496)		Missense_Mutation	SNP	ENST00000225550.3	1	1	hg19	c.696G>T	CCDS32653.1	1	.	.	.	.	.	.	.	.	.	.	.	19.52	3.842774	0.71488	.	.	ENSG00000108417	ENST00000225550	D	0.89050	-2.46	4.86	3.89	0.44902	4.86	3.89	0.44902	Filament (1);	0.000000	0.48767	D	0.000168	D	0.93229	0.7843	M	0.84773	2.715	0.36535	D	0.870956	D	0.65815	0.995	D	0.65443	0.935	D	0.93696	0.7011	10	0.48119	T	0.1	.	8.3474	0.32281	0.0:0.7613:0.1549:0.0839	.	232	O76014	KRT37_HUMAN	N	232	ENSP00000225550:K232N	ENSP00000225550:K232N	K	-	3	2	2	KRT37	36832592	36832592	0.750000	0.28316	1.000000	0.80357	0.981000	0.71138	0.281000	0.18810	1.058000	0.40530	-0.126000	0.14955	AAG	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.682	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	3.310000	-20.000000	1	0.210000	NM_003770		0	27	25	0	246	230	0		1			0	0	61	0	0	1.000000	0	0	0	0	0	0	27	246
COPE	11316	broad.mit.edu	37	19	19016396	19016396	+	Silent	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr19:19016396C>A	ENST00000262812.4	-	5	534	c.486G>T	c.(484-486)ctG>ctT	p.L162L	COPE_ENST00000351079.4_Silent_p.L111L|COPE_ENST00000349893.4_Silent_p.L162L|COPE_ENST00000600932.1_Silent_p.L185L|COPE_ENST00000598969.1_5'UTR	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon	162					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						GGGCGAGGTCCAGGCGGTCCA	0.682																																						ENST00000262812.4	1.000000	0.140000	0.710000	0.260000	0.430000	0.484811	0.430000	0.380000																										0				11						c.(484-486)ctG>ctT		coatomer protein complex, subunit epsilon							69.0	70.0	70.0					19																	19016396		2201	4297	6498	SO:0001819	synonymous_variant	11316	0	0					g.chr19:19016396C>A	AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.486G>T	chr19.hg19:g.19016396C>A		0					COPE_ENST00000598969.1_5'UTR|COPE_ENST00000351079.4_Silent_p.L111L|COPE_ENST00000600932.1_Silent_p.L185L|COPE_ENST00000349893.4_Silent_p.L162L	p.L162L	NM_007263.3	NP_009194.2	1	2	3	1.916326	O14579	COPE_HUMAN		5	534	-			A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	Silent	SNP	ENST00000262812.4	0	1	hg19	c.486G>T	CCDS12387.1	0																																																																																								0.280281		TCGA-IB-7893-01A-11D-2201-08	0.682	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464801.1	0	0	0	2	2	2	2	0	0	0	0	8	8	8	6	1	3.310000	-7.003333	1	0.210000	NM_007263		0	4	4	0	106	100	0		1	0		0	0	8	0	0	0.875721	9.928555e-01	0	0	0	291	0	4	106
ZNF493	284443	broad.mit.edu	37	19	21606442	21606442	+	Silent	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr19:21606442C>T	ENST00000355504.4	+	2	863	c.597C>T	c.(595-597)ggC>ggT	p.G199G	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Silent_p.G327G	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AAGAATGTGGCAAAGCCTTTA	0.333																																						ENST00000355504.4	1.000000	0.510000	0.960000	0.630000	0.770000	0.784464	0.770000	1.000000																										0				30						c.(595-597)ggC>ggT		zinc finger protein 493							34.0	38.0	36.0					19																	21606442		2202	4296	6498	SO:0001819	synonymous_variant	284443	0	0					g.chr19:21606442C>T	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.597C>T	chr19.hg19:g.21606442C>T		0					CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Silent_p.G327G	p.G199G	NM_175910.6	NP_787106.4	1	2	3	1.916326	Q6ZR52	ZN493_HUMAN		2	863	+			G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Silent	SNP	ENST00000355504.4	1	1	hg19	c.597C>T	CCDS12412.1	0																																																																																								0.280281		TCGA-IB-7893-01A-11D-2201-08	0.333	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	3.310000	-20.000000	1	0.210000	NM_175910		0	25	23	0	320	305	0		1	0		0	0	62	0	0	1.000000	5.780061e-03	0	0	0	2	0	25	320
TRPM4	54795	broad.mit.edu	37	19	49713525	49713525	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr19:49713525G>A	ENST00000252826.5	+	21	3317	c.3191G>A	c.(3190-3192)cGc>cAc	p.R1064H	TRPM4_ENST00000427978.2_Missense_Mutation_p.R919H|TRPM4_ENST00000355712.5_Missense_Mutation_p.R710H	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	1064					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CAGCGTTACCGCCTCATCCGG	0.607																																						ENST00000252826.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				49						c.(3190-3192)cGc>cAc		transient receptor potential cation channel, subfamily M, member 4							82.0	78.0	79.0					19																	49713525		2203	4300	6503	SO:0001583	missense	54795	0	0					g.chr19:49713525G>A	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.3191G>A	chr19.hg19:g.49713525G>A	ENSP00000252826:p.Arg1064His	1					TRPM4_ENST00000427978.2_Missense_Mutation_p.R919H|TRPM4_ENST00000355712.5_Missense_Mutation_p.R710H	p.R1064H	NM_017636.3	NP_060106.2	0	3	3	1.944366	Q8TD43	TRPM4_HUMAN		21	3317	+		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	1	1	hg19	c.3191G>A	CCDS33073.1	1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803763	0.50315	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.43294	0.95;0.95;0.95	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.224765	0.45361	D	0.000374	T	0.24812	0.0602	L	0.28458	0.855	0.27576	N	0.949747	P;P;P;P	0.43519	0.809;0.575;0.575;0.626	B;B;B;B	0.34722	0.092;0.188;0.123;0.092	T	0.16660	-1.0395	10	0.22109	T	0.4	-22.6616	8.6965	0.34298	0.1643:0.0:0.8357:0.0	.	710;890;919;1064	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	H	1064;919;710	ENSP00000252826:R1064H;ENSP00000407492:R919H;ENSP00000347944:R710H	ENSP00000252826:R1064H	R	+	2	0	0	TRPM4	54405337	54405337	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.257000	0.51500	2.704000	0.92352	0.491000	0.48974	CGC	0.285068		TCGA-IB-7893-01A-11D-2201-08	0.607	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	1	0	1	2	2	2	2	0	0	0	0	73	73	73	69	1	3.310000	-5.419058	1	0.210000	NM_017636		0	140	134	0	439	419	1		1	1		0	0	73	0	0	1.000000	9.999999e-01	0	37	0	40	0	140	439
ATAD3A	55210	broad.mit.edu	37	1	1447653	1447653	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr1:1447653C>A	ENST00000378755.5	+	1	99	c.5C>A	c.(4-6)tCg>tAg	p.S2*	ATAD3A_ENST00000378756.3_Nonsense_Mutation_p.S2*|ATAD3A_ENST00000536055.1_5'Flank	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	2	Required for interaction with the inner surface of the mitochondrial outer membrane.				cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		GCGAGCATGTCGTGGCTCTTC	0.786																																						ENST00000378755.5	1.000000	0.200000	1.000000	0.400000	0.750000	0.722879	0.750000	1.000000																										0				20						c.(4-6)tCg>tAg		ATPase family, AAA domain containing 3A							3.0	5.0	4.0					1																	1447653		1700	3711	5411	SO:0001587	stop_gained	55210	0	0					g.chr1:1447653C>A	AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.5C>A	chr1.hg19:g.1447653C>A	ENSP00000368030:p.Ser2*	1					ATAD3A_ENST00000378756.3_Nonsense_Mutation_p.S2*|ATAD3A_ENST00000536055.1_5'Flank	p.S2*	NM_018188.3	NP_060658.3	1	3	4	1.986815	Q9NVI7	ATD3A_HUMAN		1	99	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Nonsense_Mutation	SNP	ENST00000378755.5	0	1	hg19	c.5C>A	CCDS31.1	0	.	.	.	.	.	.	.	.	.	.	c	37	6.121231	0.97300	.	.	ENSG00000197785	ENST00000378756;ENST00000378755	.	.	.	3.98	3.98	0.46160	3.98	3.98	0.46160	.	0.133058	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6121	0.68522	0.0:1.0:0.0:0.0	.	.	.	.	X	2	.	ENSP00000368030:S2X	S	+	2	0	0	ATAD3A	1437516	1437516	1.000000	0.71417	0.992000	0.48379	0.499000	0.33736	3.954000	0.56708	1.749000	0.51849	0.400000	0.26472	TCG	0.302305		TCGA-IB-7893-01A-11D-2201-08	0.786	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000001365.1	0	0	0	2	2	2	2	0	0	0	0	19	19	19	17	1	3.310000	-7.552859	1	0.210000	NM_018188		0	3	2	0	56	50	0		1			0	0	19	0	0	0.770274	0	0	0	0	0	0	3	56
AJAP1	55966	broad.mit.edu	37	1	4772232	4772232	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr1:4772232C>A	ENST00000378191.4	+	2	683	c.302C>A	c.(301-303)gCc>gAc	p.A101D	AJAP1_ENST00000378190.3_Missense_Mutation_p.A101D	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	101					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GCCAGACGGGCCCACAGGCCC	0.736																																						ENST00000378191.4	1.000000	0.470000	1.000000	0.840000	0.990000	0.936761	0.990000	1.000000																										0				24						c.(301-303)gCc>gAc		adherens junctions associated protein 1							6.0	6.0	6.0					1																	4772232		1854	3721	5575	SO:0001583	missense	55966	0	0					g.chr1:4772232C>A	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.302C>A	chr1.hg19:g.4772232C>A	ENSP00000367433:p.Ala101Asp	1					AJAP1_ENST00000378190.3_Missense_Mutation_p.A101D	p.A101D	NM_018836.3	NP_061324.1	1	3	4	1.986815	Q9UKB5	AJAP1_HUMAN		2	683	+	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	0	1	hg19	c.302C>A	CCDS54.1	1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741503	0.49151	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.46819	0.86;0.86	5.2	4.29	0.51040	5.2	4.29	0.51040	.	0.632555	0.15632	N	0.252341	T	0.40546	0.1121	N	0.24115	0.695	0.37947	D	0.932537	P	0.52061	0.95	P	0.49887	0.625	T	0.24119	-1.0169	10	0.30854	T	0.27	-24.4186	9.7068	0.40220	0.0:0.9031:0.0:0.0969	.	101	Q9UKB5	AJAP1_HUMAN	D	101	ENSP00000367432:A101D;ENSP00000367433:A101D	ENSP00000367432:A101D	A	+	2	0	0	AJAP1	4672092	4672092	0.077000	0.21312	0.909000	0.35828	0.089000	0.18198	1.256000	0.32921	1.162000	0.42619	0.563000	0.77884	GCC	0.302305		TCGA-IB-7893-01A-11D-2201-08	0.736	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	0	0	0	2	2	2	2	0	0	0	0	18	18	18	17	1	3.310000	-11.334520	1	0.210000	NM_018836		0	4	2	0	33	32	0		1			0	0	18	0	0	0.873100	0	0	0	0	0	0	4	33
IVNS1ABP	10625	broad.mit.edu	37	1	185267230	185267230	+	Silent	SNP	C	C	T	rs74132213	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr1:185267230C>T	ENST00000367498.3	-	15	2488	c.1866G>A	c.(1864-1866)acG>acA	p.T622T	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Silent_p.T404T	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	622					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						AGACTTCCACCGTATTCAGAA	0.408													C|||	8	0.00159744	0.0053	0.0014	5008	,	,		18385	0.0		0.0	False		,,,				2504	0.0					ENST00000367498.3	1.000000	0.830000	1.000000	0.920000	0.990000	0.972723	0.990000	1.000000																										0				29						c.(1864-1866)acG>acA		influenza virus NS1A binding protein		C		27,4379	32.6+/-62.9	0,27,2176	196.0	187.0	190.0		1866	-5.0	0.9	1	dbSNP_130	190	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	IVNS1ABP	NM_006469.4		0,28,6475	TT,TC,CC		0.0116,0.6128,0.2153		622/643	185267230	28,12978	2203	4300	6503	SO:0001819	synonymous_variant	10625	66	121412	55				g.chr1:185267230C>T	AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1866G>A	chr1.hg19:g.185267230C>T		1					IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Silent_p.T404T	p.T622T	NM_006469.4	NP_006460.2	3	4	7	2.320980	Q9Y6Y0	NS1BP_HUMAN		15	2488	-			A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Silent	SNP	ENST00000367498.3	1	0	hg19	c.1866G>A	CCDS1368.1	1																																																																																								0.403998		TCGA-IB-7893-01A-11D-2201-08	0.408	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	1	0	1	2	2	2	2	0	0	0	0	205	205	205	205	1	3.310000	-2.389375	0	0.210000	NM_006469		0	108	103	0	1258	1228	0		1	1		0	0	205	0	0	1.000000	1	0	20	0	452	0	108	1258
ZHX3	23051	broad.mit.edu	37	20	39830760	39830760	+	Missense_Mutation	SNP	G	G	A	rs148495510		TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr20:39830760G>A	ENST00000309060.3	-	4	3212	c.2797C>T	c.(2797-2799)Cgt>Tgt	p.R933C	ZHX3_ENST00000544979.2_Intron|ZHX3_ENST00000559234.1_Missense_Mutation_p.R933C|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.R933C|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000432768.2_Missense_Mutation_p.R933C|ZHX3_ENST00000540170.1_Missense_Mutation_p.R933C			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	933					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				TCAGGGACACGGGGCTCCCAC	0.597																																						ENST00000309060.3	1.000000	0.820000	1.000000	0.950000	0.990000	0.981116	0.990000	1.000000																										0				31						c.(2797-2799)Cgt>Tgt		zinc fingers and homeoboxes 3		T	CYS/ARG	0,4406		0,0,2203	91.0	83.0	85.0		2797	-2.4	0.0	20	dbSNP_134	85	1,8599		0,1,4299	no	missense	ZHX3	NM_015035.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	933/957	39830760	1,13005	2203	4300	6503	SO:0001583	missense	23051	3	121412	37				g.chr20:39830760G>A	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.2797C>T	chr20.hg19:g.39830760G>A	ENSP00000312222:p.Arg933Cys	0					ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.R933C|ZHX3_ENST00000432768.2_Missense_Mutation_p.R933C|ZHX3_ENST00000544979.2_Intron|ZHX3_ENST00000559234.1_Missense_Mutation_p.R933C|ZHX3_ENST00000540170.1_Missense_Mutation_p.R933C|ZHX3_ENST00000558993.1_Intron	p.R933C			1	2	3	1.936666	Q9H4I2	ZHX3_HUMAN		4	3212	-		Myeloproliferative disorder(115;0.00425)	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	1	1	hg19	c.2797C>T	CCDS13315.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.58|16.58	3.162238|3.162238	0.57368|0.57368	0.0|0.0	1.16E-4|1.16E-4	ENSG00000174306|ENSG00000174306	ENST00000421422|ENST00000309060;ENST00000373263;ENST00000540170;ENST00000373262	T|T;T	0.09817|0.10477	2.94|2.87;2.87	6.02|6.02	-2.37|-2.37	0.06643|0.06643	6.02|6.02	-2.37|-2.37	0.06643|0.06643	.|.	.|1.070770	.|0.07293	.|N	.|0.872760	T|T	0.03695|0.03695	0.0105|0.0105	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P;P	.|0.40000	.|0.698;0.698	.|B;B	.|0.27796	.|0.083;0.083	T|T	0.28996|0.28996	-1.0026|-1.0026	7|10	0.56958|0.59425	D|D	0.05|0.04	2.5672|2.5672	3.3151|3.3151	0.07030|0.07030	0.1075:0.3462:0.33:0.2163|0.1075:0.3462:0.33:0.2163	.|.	.|933;933	.|A8K8Q0;Q9H4I2	.|.;ZHX3_HUMAN	L|C	641|933;933;933;711	ENSP00000405421:P641L|ENSP00000362360:R933C;ENSP00000442290:R933C	ENSP00000405421:P641L|ENSP00000312222:R933C	P|R	-|-	2|1	0|0	0|0	ZHX3|ZHX3	39264174|39264174	39264174|39264174	.|.	.|.	0.004000|0.004000	0.12327|0.12327	0.942000|0.942000	0.58702|0.58702	.|.	.|.	-1.152000|-1.152000	0.02832|0.02832	-0.256000|-0.256000	0.11100|0.11100	CCG|CGT	0.282340		TCGA-IB-7893-01A-11D-2201-08	0.597	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	1	0	1	2	2	2	2	0	0	0	0	118	118	118	115	1	3.310000	-2.415704	0	0.210000	NM_015035		0	47	45	0	402	389	0		1	0		0	0	118	0	0	1.000000	8.206825e-01	0	0	0	29	0	47	402
ZMYND8	23613	broad.mit.edu	37	20	45839477	45839477	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr20:45839477C>T	ENST00000311275.7	-	22	3743	c.3490G>A	c.(3490-3492)Gat>Aat	p.D1164N	ZMYND8_ENST00000372023.3_Missense_Mutation_p.D1114N|ZMYND8_ENST00000540497.1_Missense_Mutation_p.D1112N|ZMYND8_ENST00000360911.3_Missense_Mutation_p.D1113N|ZMYND8_ENST00000352431.2_Missense_Mutation_p.D1138N|ZMYND8_ENST00000536340.1_Missense_Mutation_p.D1219N|ZMYND8_ENST00000458360.2_Missense_Mutation_p.D1032N|ZMYND8_ENST00000396281.4_Missense_Mutation_p.D1164N|ZMYND8_ENST00000262975.4_Missense_Mutation_p.D1146N|ZMYND8_ENST00000461685.1_Missense_Mutation_p.D1166N|ZMYND8_ENST00000471951.2_Missense_Mutation_p.D1212N|ZMYND8_ENST00000446994.2_Missense_Mutation_p.D1083N|ZMYND8_ENST00000355972.4_Missense_Mutation_p.D1192N	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	1164	Interacts with PRKCB1.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GTGTTGTGATCGGAACGTGTC	0.547																																						ENST00000311275.7	1.000000	0.840000	1.000000	0.970000	0.990000	0.984811	0.990000	1.000000																										0				62						c.(3490-3492)Gat>Aat		zinc finger, MYND-type containing 8							207.0	179.0	188.0					20																	45839477		2203	4300	6503	SO:0001583	missense	23613	3	121412	36				g.chr20:45839477C>T	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.3490G>A	chr20.hg19:g.45839477C>T	ENSP00000312237:p.Asp1164Asn	0					ZMYND8_ENST00000352431.2_Missense_Mutation_p.D1138N|ZMYND8_ENST00000446994.2_Missense_Mutation_p.D1083N|ZMYND8_ENST00000372023.3_Missense_Mutation_p.D1114N|ZMYND8_ENST00000262975.4_Missense_Mutation_p.D1146N|ZMYND8_ENST00000471951.2_Missense_Mutation_p.D1212N|ZMYND8_ENST00000536340.1_Missense_Mutation_p.D1219N|ZMYND8_ENST00000360911.3_Missense_Mutation_p.D1113N|ZMYND8_ENST00000458360.2_Missense_Mutation_p.D1032N|ZMYND8_ENST00000461685.1_Missense_Mutation_p.D1166N|ZMYND8_ENST00000540497.1_Missense_Mutation_p.D1112N|ZMYND8_ENST00000355972.4_Missense_Mutation_p.D1192N|ZMYND8_ENST00000396281.4_Missense_Mutation_p.D1164N	p.D1164N	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	1	2	3	1.936666	Q9ULU4	PKCB1_HUMAN	Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)	22	3743	-			B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	1	1	hg19	c.3490G>A		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.40|12.40	1.926139|1.926139	0.34002|0.34002	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497|ENST00000467200	D;D;D;D;D;D;D;D;D;D;D|.	0.90444|.	-1.72;-1.6;-1.72;-1.61;-1.71;-1.7;-1.69;-2.67;-1.71;-1.84;-1.72|.	4.86|4.86	4.86|4.86	0.63082|0.63082	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	0.398191|.	0.22055|.	N|.	0.065245|.	T|T	0.35098|0.35098	0.0920|0.0920	N|N	0.22421|0.22421	0.69|0.69	0.20926|0.20926	N|N	0.999822|0.999822	B;P;B;P;B;B;B;B;B;B;B;P;P;B;P|.	0.42409|.	0.002;0.482;0.074;0.482;0.233;0.001;0.373;0.233;0.305;0.305;0.305;0.555;0.779;0.0;0.555|.	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B|.	0.40066|.	0.0;0.152;0.014;0.152;0.038;0.002;0.052;0.072;0.045;0.045;0.032;0.033;0.318;0.001;0.033|.	T|T	0.20739|0.20739	-1.0266|-1.0266	10|5	0.72032|.	D|.	0.01|.	4.4285|4.4285	12.7927|12.7927	0.57543|0.57543	0.0:0.9207:0.0:0.0793|0.0:0.9207:0.0:0.0793	.|.	1032;1219;1114;1212;1146;1113;1138;1166;1164;1083;1141;1112;1085;1066;1164|.	B7ZM62;F5H0X3;Q2HXV3;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8|.	.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.|.	N|Q	1113;1164;1032;1147;1213;1138;1164;1219;1192;1083;1166;1114;1112|1073	ENSP00000354166:D1113N;ENSP00000312237:D1164N;ENSP00000392964:D1032N;ENSP00000335537:D1138N;ENSP00000379577:D1164N;ENSP00000439800:D1219N;ENSP00000348246:D1192N;ENSP00000396725:D1083N;ENSP00000418210:D1166N;ENSP00000361093:D1114N;ENSP00000443086:D1112N|.	ENSP00000262975:D1147N|.	D|R	-|-	1|2	0|0	0|0	ZMYND8|ZMYND8	45272884|45272884	45272884|45272884	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.036000|0.036000	0.12997|0.12997	3.683000|3.683000	0.54663|0.54663	2.399000|2.399000	0.81585|0.81585	0.462000|0.462000	0.41574|0.41574	GAT|CGA	0.282340		TCGA-IB-7893-01A-11D-2201-08	0.547	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	3.310000	-3.075755	1	0.210000	NM_183047		0	55	53	0	468	449	1		1	1		0	0	87	0	0	1.000000	9.864302e-01	0	9	0	50	0	55	468
CDC45	8318	broad.mit.edu	37	22	19492919	19492919	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr22:19492919C>T	ENST00000407835.1	+	11	995	c.739C>T	c.(739-741)Cgc>Tgc	p.R247C	CDC45_ENST00000437685.2_Missense_Mutation_p.R279C|CDC45_ENST00000404724.3_Missense_Mutation_p.R201C|CDC45_ENST00000263201.1_Missense_Mutation_p.R247C			O75419	CDC45_HUMAN	cell division cycle 45	247					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						TGTCCTGCAGCGCCACGTTTC	0.537																																						ENST00000407835.1	1.000000	0.550000	1.000000	0.730000	0.970000	0.894481	0.970000	1.000000																										0				19						c.(739-741)Cgc>Tgc		cell division cycle 45							102.0	80.0	88.0					22																	19492919		2203	4300	6503	SO:0001583	missense	8318	1	121412	26				g.chr22:19492919C>T	AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.739C>T	chr22.hg19:g.19492919C>T	ENSP00000385240:p.Arg247Cys	1					CDC45_ENST00000437685.2_Missense_Mutation_p.R279C|CDC45_ENST00000263201.1_Missense_Mutation_p.R247C|CDC45_ENST00000404724.3_Missense_Mutation_p.R201C	p.R247C			3	3	6	2.179621	O75419	CDC45_HUMAN		11	995	+			B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	ENST00000407835.1	1	1	hg19	c.739C>T	CCDS13762.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502953	0.85176	.	.	ENSG00000093009	ENST00000407835;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.21	5.21	0.72293	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.53351	0.1791	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.987;0.964;0.991;0.987;0.991	T	0.55823	-0.8080	10	0.56958	D	0.05	-20.991	18.7616	0.91853	0.0:1.0:0.0:0.0	.	279;242;201;279;247	E9PDH7;B4E092;B4DDB4;B4DDU3;O75419	.;.;.;.;CDC45_HUMAN	C	247;279;247;201	ENSP00000385240:R247C;ENSP00000405726:R279C;ENSP00000263201:R247C;ENSP00000384978:R201C	ENSP00000263201:R247C	R	+	1	0	0	CDC45	17872919	17872919	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	4.500000	0.60387	2.427000	0.82271	0.462000	0.41574	CGC	0.364748		TCGA-IB-7893-01A-11D-2201-08	0.537	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	3.310000	-19.994420	1	0.210000	NM_003504		0	17	16	0	214	205	0		1	1		0	0	42	0	0	0.999957	5.728908e-01	0	4	0	21	0	17	214
GGT1	2678	broad.mit.edu	37	22	25023539	25023539	+	Silent	SNP	C	C	G			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr22:25023539C>G	ENST00000400382.1	+	12	1916	c.1161C>G	c.(1159-1161)gtC>gtG	p.V387V	GGT1_ENST00000404532.1_Silent_p.V43V|GGT1_ENST00000406383.2_Silent_p.V387V|GGT1_ENST00000400380.1_Silent_p.V387V|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000403838.1_Silent_p.V43V|GGT1_ENST00000400383.1_Silent_p.V387V|GGT1_ENST00000248923.4_Silent_p.V387V|GGT1_ENST00000404223.1_Silent_p.V43V|GGT1_ENST00000404920.1_Silent_p.V43V|GGT1_ENST00000401885.1_Silent_p.V43V			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	387					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	TGTCTGTCGTCGCAGAGGACG	0.657																																						ENST00000400382.1	0.690000	0.110000	0.510000	0.200000	0.330000	0.360181	0.330000	0.280000																										0				40						c.(1159-1161)gtC>gtG		gamma-glutamyltransferase 1	Glutathione(DB00143)						13.0	13.0	13.0					22																	25023539		2193	4246	6439	SO:0001819	synonymous_variant	2678	0	0					g.chr22:25023539C>G	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1161C>G	chr22.hg19:g.25023539C>G		1					GGT1_ENST00000403838.1_Silent_p.V43V|GGT1_ENST00000400380.1_Silent_p.V387V|GGT1_ENST00000248923.4_Silent_p.V387V|GGT1_ENST00000401885.1_Silent_p.V43V|GGT1_ENST00000400383.1_Silent_p.V387V|GGT1_ENST00000406383.2_Silent_p.V387V|GGT1_ENST00000404532.1_Silent_p.V43V|GGT1_ENST00000404920.1_Silent_p.V43V|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000404223.1_Silent_p.V43V	p.V387V			2	2	4	2.165217	P19440	GGT1_HUMAN		12	1916	+			Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	ENST00000400382.1	0	1	hg19	c.1161C>G	CCDS42992.1	0																																																																																								0.347107		TCGA-IB-7893-01A-11D-2201-08	0.657	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	0	0	0	2	2	2	2	0	0	0	0	23	23	23	33	1	3.310000	-6.114671	1	0.210000	NM_013430		0	4	3	0	152	94	0		1	0		0	0	23	0	0	0.740525	3.420830e-01	0	0	0	39	0	4	152
MYO18B	84700	broad.mit.edu	37	22	26164985	26164985	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr22:26164985G>T	ENST00000407587.2	+	4	1271	c.1102G>T	c.(1102-1104)Gat>Tat	p.D368Y	MYO18B_ENST00000536101.1_Missense_Mutation_p.D368Y|MYO18B_ENST00000335473.7_Missense_Mutation_p.D368Y			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	368						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D368N(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTTGGGGGACGATCTGAGAAT	0.552																																						ENST00000407587.2	1.000000	0.200000	0.910000	0.360000	0.600000	0.626233	0.600000	1.000000																										1	Substitution - Missense(1)	p.D368N(1)	large_intestine(1)	146						c.(1102-1104)Gat>Tat		myosin XVIIIB							36.0	40.0	38.0					22																	26164985		2095	4206	6301	SO:0001583	missense	84700	0	0					g.chr22:26164985G>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1102G>T	chr22.hg19:g.26164985G>T	ENSP00000386096:p.Asp368Tyr	1					MYO18B_ENST00000335473.7_Missense_Mutation_p.D368Y|MYO18B_ENST00000536101.1_Missense_Mutation_p.D368Y	p.D368Y			2	2	4	2.165217	Q8IUG5	MY18B_HUMAN		4	1271	+			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	0	1	hg19	c.1102G>T		0	.	.	.	.	.	.	.	.	.	.	g	11.39	1.625277	0.28889	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86769	-2.15;-2.15;-2.17	3.98	0.318	0.15867	3.98	0.318	0.15867	.	1.705140	0.04097	N	0.312179	T	0.76948	0.4059	N	0.14661	0.345	0.09310	N	1	B;P;P	0.34909	0.344;0.475;0.475	B;B;B	0.35971	0.106;0.215;0.215	T	0.67225	-0.5724	10	0.33940	T	0.23	.	6.4609	0.21956	0.1491:0.3954:0.4555:0.0	.	368;368;368	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	Y	368	ENSP00000441229:D368Y;ENSP00000334563:D368Y;ENSP00000386096:D368Y	ENSP00000334563:D368Y	D	+	1	0	0	MYO18B	24494985	24494985	0.001000	0.12720	0.003000	0.11579	0.090000	0.18270	0.915000	0.28638	0.388000	0.25054	0.306000	0.20318	GAT	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.552	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	1	0	1	2	2	2	2	0	0	0	0	13	13	13	11	1	3.310000	-7.554825	1	0.210000	NM_032608		0	4	4	0	81	74	0		1			0	0	13	0	0	0.870649	0	0	0	0	0	0	4	81
CYB5R3	1727	broad.mit.edu	37	22	43032758	43032758	+	Missense_Mutation	SNP	G	G	A	rs371323516		TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr22:43032758G>A	ENST00000352397.5	-	2	368	c.116C>T	c.(115-117)cCg>cTg	p.P39L	CYB5R3_ENST00000407332.1_Missense_Mutation_p.P16L|CYB5R3_ENST00000361740.4_Missense_Mutation_p.P72L|CYB5R3_ENST00000396303.3_Missense_Mutation_p.P16L|CYB5R3_ENST00000402438.1_Missense_Mutation_p.P16L|CYB5R3_ENST00000407623.3_Missense_Mutation_p.P16L	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	39					blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	CTTGATGTCCGGGCTCTCGAG	0.617																																						ENST00000352397.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000																										0				6						c.(115-117)cCg>cTg		cytochrome b5 reductase 3	Flavin adenine dinucleotide(DB03147)	G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	58.0	53.0	55.0		116,47,215,47,47	4.8	1.0	22		55	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	CYB5R3	NM_000398.6,NM_001129819.2,NM_001171660.1,NM_001171661.1,NM_007326.4	98,98,98,98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	39/302,16/279,72/335,16/279,16/279	43032758	1,13005	2203	4300	6503	SO:0001583	missense	1727	2	121410	35				g.chr22:43032758G>A	M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.116C>T	chr22.hg19:g.43032758G>A	ENSP00000338461:p.Pro39Leu	1					CYB5R3_ENST00000407623.3_Missense_Mutation_p.P16L|CYB5R3_ENST00000361740.4_Missense_Mutation_p.P72L|CYB5R3_ENST00000402438.1_Missense_Mutation_p.P16L|CYB5R3_ENST00000396303.3_Missense_Mutation_p.P16L|CYB5R3_ENST00000407332.1_Missense_Mutation_p.P16L	p.P39L	NM_000398.6	NP_000389.1	2	2	4	2.156051	P00387	NB5R3_HUMAN		2	368	-			B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Missense_Mutation	SNP	ENST00000352397.5	1	1	hg19	c.116C>T	CCDS33658.1	1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365903	0.61513	0.0	1.16E-4	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	D;D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	4.82	4.82	0.62117	4.82	4.82	0.62117	Riboflavin synthase-like beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.91774	0.7398	M	0.63843	1.955	0.80722	D	1	D;P	0.89917	1.0;0.853	D;B	0.67103	0.949;0.235	D	0.92692	0.6167	10	0.87932	D	0	-34.6456	15.7659	0.78126	0.0:0.0:1.0:0.0	.	72;39	B7Z7L3;P00387	.;NB5R3_HUMAN	L	72;16;39;16;16;16;16	ENSP00000354468:P72L;ENSP00000379597:P16L;ENSP00000338461:P39L;ENSP00000384834:P16L;ENSP00000384457:P16L;ENSP00000385679:P16L;ENSP00000403439:P16L	ENSP00000338461:P39L	P	-	2	0	0	CYB5R3	41362702	41362702	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	8.716000	0.91420	2.387000	0.81309	0.313000	0.20887	CCG	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.617	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	32	1	3.310000	-3.227480	1	0.210000			0	31	30	0	140	139	1		1	1		0	0	34	0	0	1.000000	1	0	73	0	710	0	31	140
SULT1C2	6819	broad.mit.edu	37	2	108917367	108917367	+	Silent	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr2:108917367G>A	ENST00000437390.2	+	4	570	c.393G>A	c.(391-393)ccG>ccA	p.P131P	SULT1C2_ENST00000251481.6_Silent_p.P117P|SULT1C2_ENST00000409880.1_Intron|SULT1C2_ENST00000326853.5_Silent_p.P128P			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	123					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						TGCTGCCACCGTCTTTCTGGG	0.488																																						ENST00000437390.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				20						c.(391-393)ccG>ccA		sulfotransferase family, cytosolic, 1C, member 2							147.0	160.0	156.0					2																	108917367		2203	4300	6503	SO:0001819	synonymous_variant	6819	0	0					g.chr2:108917367G>A	U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.393G>A	chr2.hg19:g.108917367G>A		1					SULT1C2_ENST00000251481.6_Silent_p.P117P|SULT1C2_ENST00000409880.1_Intron|SULT1C2_ENST00000326853.5_Silent_p.P128P	p.P131P			2	2	4	2.130471	O75897	ST1C4_HUMAN		4	570	+			Q069I8|Q08AS5|Q53S63	Silent	SNP	ENST00000437390.2	1	0	hg19	c.393G>A		1	.	.	.	.	.	.	.	.	.	.	G	6.403	0.442392	0.12164	.	.	ENSG00000198203	ENST00000438339;ENST00000409067	T	0.07021	3.23	4.31	-2.98	0.05513	4.31	-2.98	0.05513	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.35515	D	0.800953	.	.	.	.	.	.	T	0.44982	-0.9292	5	.	.	.	.	2.1177	0.03718	0.4494:0.1239:0.3063:0.1205	.	.	.	.	I	97;114	ENSP00000401996:V97I	.	V	+	1	0	0	SULT1C2	108283799	108283799	0.000000	0.05858	0.267000	0.24556	0.795000	0.44927	-2.523000	0.00949	-0.761000	0.04670	-0.312000	0.09012	GTC	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.488	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000329969.2	0	0	1	2	2	2	2	0	0	0	0	85	85	85	82	1	3.310000	-20.000000	1	0.210000	NM_176825		0	119	116	0	517	505	1		1	1		0	0	85	0	0	1.000000	9.299904e-02	0	2	0	1	0	119	517
LRP1B	53353	broad.mit.edu	37	2	141771238	141771238	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr2:141771238T>A	ENST00000389484.3	-	14	3238	c.2267A>T	c.(2266-2268)tAt>tTt	p.Y756F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	756					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCATTCATATAATCAGTCCA	0.388										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	ENST00000389484.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				606						c.(2266-2268)tAt>tTt		low density lipoprotein receptor-related protein 1B							132.0	126.0	128.0					2																	141771238		2203	4300	6503	SO:0001583	missense	53353	0	0					g.chr2:141771238T>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2267A>T	chr2.hg19:g.141771238T>A	ENSP00000374135:p.Tyr756Phe	1	TSP Lung(27;0.18)					p.Y756F	NM_018557.2	NP_061027.2	2	2	4	2.134613	Q9NZR2	LRP1B_HUMAN		14	3238	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	1	1	hg19	c.2267A>T	CCDS2182.1	1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854521	0.71719	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91124	-2.79	5.77	5.77	0.91146	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	U	0.000002	D	0.92750	0.7695	L	0.42008	1.315	0.53005	D	0.999968	D	0.69078	0.997	D	0.75020	0.985	D	0.91144	0.4948	10	0.25751	T	0.34	.	16.0884	0.81073	0.0:0.0:0.0:1.0	.	756	Q9NZR2	LRP1B_HUMAN	F	756;694	ENSP00000374135:Y756F	ENSP00000374135:Y756F	Y	-	2	0	0	LRP1B	141487708	141487708	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.900000	0.87376	2.203000	0.70933	0.533000	0.62120	TAT	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	1	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	3.310000	-20.000000	1	0.210000	NM_018557		0	129	126	0	545	529	1		1			0	0	85	0	0	1.000000	0	0	0	0	0	0	129	545
LRP2	4036	broad.mit.edu	37	2	170092528	170092528	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr2:170092528C>T	ENST00000263816.3	-	29	5027	c.4742G>A	c.(4741-4743)cGa>cAa	p.R1581Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1581					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CATGCTGGCTCGCTCGATGCG	0.512																																						ENST00000263816.3	1.000000	0.630000	1.000000	0.810000	0.990000	0.930292	0.990000	1.000000																										0				315						c.(4741-4743)cGa>cAa		low density lipoprotein receptor-related protein 2	"""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"						73.0	61.0	65.0					2																	170092528		2203	4300	6503	SO:0001583	missense	4036	2	121412	32				g.chr2:170092528C>T		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.4742G>A	chr2.hg19:g.170092528C>T	ENSP00000263816:p.Arg1581Gln	1						p.R1581Q	NM_004525.2	NP_004516.2	2	2	4	2.134613	P98164	LRP2_HUMAN		29	5027	-			O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	1	1	hg19	c.4742G>A	CCDS2232.1	1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378336	0.61735	.	.	ENSG00000081479	ENST00000263816	D	0.96300	-3.97	5.59	5.59	0.84812	5.59	5.59	0.84812	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.103871	0.64402	D	0.000006	D	0.97411	0.9153	M	0.80982	2.52	0.80722	D	1	D	0.69078	0.997	P	0.57960	0.83	D	0.97434	1.0017	10	0.72032	D	0.01	.	13.6684	0.62409	0.0:0.9199:0.0:0.0801	.	1581	P98164	LRP2_HUMAN	Q	1581	ENSP00000263816:R1581Q	ENSP00000263816:R1581Q	R	-	2	0	0	LRP2	169800774	169800774	1.000000	0.71417	0.990000	0.47175	0.288000	0.27193	2.417000	0.44653	2.793000	0.96121	0.655000	0.94253	CGA	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	1	0	0	2	2	2	2	0	0	0	0	32	32	32	32	1	3.310000	-19.999960	1	0.210000	NM_004525		0	18	18	0	188	181	0		1			0	0	32	0	0	0.999981	0	0	0	0	0	0	18	188
ZNF142	7701	broad.mit.edu	37	2	219503301	219503301	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr2:219503301G>A	ENST00000449707.1	-	10	5246	c.4825C>T	c.(4825-4827)Cgc>Tgc	p.R1609C	ZNF142_ENST00000411696.2_Missense_Mutation_p.R1609C	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1609					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GCATGATGGCGCAGGCCAGCA	0.612																																					Colon(170;867 1942 8995 15834 18053)	ENST00000449707.1	1.000000	0.740000	1.000000	0.900000	0.990000	0.964485	0.990000	1.000000																										0				38						c.(4825-4827)Cgc>Tgc		zinc finger protein 142							67.0	76.0	73.0					2																	219503301		2165	4261	6426	SO:0001583	missense	7701	1	121176	33				g.chr2:219503301G>A	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.4825C>T	chr2.hg19:g.219503301G>A	ENSP00000408643:p.Arg1609Cys	0					ZNF142_ENST00000411696.2_Missense_Mutation_p.R1609C	p.R1609C	NM_001105537.1	NP_001099007.1	2	2	4	2.099050	P52746	ZN142_HUMAN		10	5246	-		Renal(207;0.0474)	Q92510	Missense_Mutation	SNP	ENST00000449707.1	1	1	hg19	c.4825C>T	CCDS42817.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491651	0.84962	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.15952	2.38;2.38	5.83	5.83	0.93111	5.83	5.83	0.93111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.02156	-1.1204	10	0.38643	T	0.18	-50.1852	20.1133	0.97917	0.0:0.0:1.0:0.0	.	1609;1446	P52746;A8MWU9	ZN142_HUMAN;.	C	1609	ENSP00000408643:R1609C;ENSP00000398798:R1609C	ENSP00000398798:R1609C	R	-	1	0	0	ZNF142	219211545	219211545	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.267000	0.72546	2.758000	0.94735	0.609000	0.83330	CGC	0.340237		TCGA-IB-7893-01A-11D-2201-08	0.612	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	3.310000	-3.017764	1	0.210000	NM_005081		0	29	28	0	281	272	0		1	0		0	0	53	0	0	1.000000	4.600542e-01	0	1	0	15	0	29	281
TMEM18	129787	broad.mit.edu	37	2	669842	669842	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr2:669842G>A	ENST00000281017.3	-	4	335	c.242C>T	c.(241-243)tCg>tTg	p.S81L	TMEM18_ENST00000405941.3_Missense_Mutation_p.S84L|TMEM18_ENST00000355654.2_Missense_Mutation_p.S68L	NM_152834.2	NP_690047.2	Q96B42	TMM18_HUMAN	transmembrane protein 18	81					cell migration (GO:0016477)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)	10	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		CTGGTATTTCGAAAATAATCT	0.368																																						ENST00000281017.3	1.000000	0.940000	1.000000	0.990000	0.990000	0.996572	0.990000	1.000000																										0				10						c.(241-243)tCg>tTg		transmembrane protein 18							44.0	46.0	45.0					2																	669842		2203	4300	6503	SO:0001583	missense	129787	0	0					g.chr2:669842G>A	AL137269	CCDS33141.1	2p25.3	2008-02-05			ENSG00000151353	ENSG00000151353			25257	protein-coding gene	gene with protein product		613220				12477932	Standard	NM_152834		Approved	DKFZp434C1714	uc002qwl.3	Q96B42	OTTHUMG00000151381	ENST00000281017.3:c.242C>T	chr2.hg19:g.669842G>A	ENSP00000281017:p.Ser81Leu	1					TMEM18_ENST00000405941.3_Missense_Mutation_p.S84L|TMEM18_ENST00000355654.2_Missense_Mutation_p.S68L	p.S81L	NM_152834.2	NP_690047.2	2	2	4	2.130471	Q96B42	TMM18_HUMAN		4	335	-	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)	D6W4X9|Q8N5H2|Q9NTH3	Missense_Mutation	SNP	ENST00000281017.3	1	1	hg19	c.242C>T	CCDS33141.1	1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731026	0.69074	.	.	ENSG00000151353	ENST00000281017;ENST00000355654;ENST00000405941	.	.	.	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.118870	0.64402	D	0.000015	T	0.79203	0.4406	M	0.88979	2.995	0.80722	D	1	D	0.76494	0.999	P	0.58172	0.834	T	0.82034	-0.0657	9	0.52906	T	0.07	-8.7508	15.4029	0.74855	0.0:0.0:1.0:0.0	.	81	Q96B42	TMM18_HUMAN	L	81;68;84	.	ENSP00000281017:S81L	S	-	2	0	0	TMEM18	659842	659842	1.000000	0.71417	0.401000	0.26359	0.148000	0.21650	8.083000	0.89515	2.705000	0.92388	0.549000	0.68633	TCG	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.368	TMEM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322427.1	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	3.310000	-20.000000	1	0.210000	NM_152834		0	21	21	0	146	139	0		1	1		0	0	25	0	0	0.999997	9.999982e-01	0	20	0	145	0	21	146
STK36	27148	broad.mit.edu	37	2	219545333	219545333	+	Silent	SNP	C	C	A	rs199949532		TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr2:219545333C>A	ENST00000295709.3	+	10	1423	c.1144C>A	c.(1144-1146)Cgg>Agg	p.R382R	STK36_ENST00000392105.3_Silent_p.R382R|STK36_ENST00000440309.1_Silent_p.R382R|STK36_ENST00000392106.2_Silent_p.R382R	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CAGGGAAAACCGGACCACCCC	0.552																																						ENST00000295709.3	1.000000	0.120000	0.600000	0.220000	0.370000	0.421441	0.370000	0.310000																										0				52						c.(1144-1146)Cgg>Agg		serine/threonine kinase 36							46.0	51.0	49.0					2																	219545333		2203	4300	6503	SO:0001819	synonymous_variant	27148	0	0					g.chr2:219545333C>A	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1144C>A	chr2.hg19:g.219545333C>A		0					STK36_ENST00000440309.1_Silent_p.R382R|STK36_ENST00000392105.3_Silent_p.R382R|STK36_ENST00000392106.2_Silent_p.R382R	p.R382R	NM_015690.4	NP_056505.2	2	2	4	2.099050				10	1423	+		Renal(207;0.0915)		Silent	SNP	ENST00000295709.3	0	1	hg19	c.1144C>A	CCDS2421.1	0																																																																																								0.340237		TCGA-IB-7893-01A-11D-2201-08	0.552	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2	1	0	0	2	2	2	2	0	0	0	0	22	22	22	22	1	3.310000	-6.366978	1	0.210000			0	4	4	0	137	125	0		1	0		0	0	22	0	0	0.869252	3.367398e-02	0	0	0	8	0	4	137
DOCK3	1795	broad.mit.edu	37	3	51370621	51370621	+	Missense_Mutation	SNP	G	G	A	rs370436668	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr3:51370621G>A	ENST00000266037.9	+	35	3571	c.3548G>A	c.(3547-3549)cGc>cAc	p.R1183H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1183					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GAAACATGGCGCGAGACCGGC	0.532													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18678	0.0		0.0	False		,,,				2504	0.001					ENST00000266037.9	1.000000	0.750000	1.000000	0.840000	0.950000	0.937251	0.950000	1.000000																										0				45						c.(3547-3549)cGc>cAc		dedicator of cytokinesis 3		G	HIS/ARG	0,3882		0,0,1941	119.0	120.0	120.0		3548	6.1	1.0	3		120	1,8275		0,1,4137	no	missense	DOCK3	NM_004947.4	29	0,1,6078	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	1183/2031	51370621	1,12157	1941	4138	6079	SO:0001583	missense	1795	9	120844	43				g.chr3:51370621G>A	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3548G>A	chr3.hg19:g.51370621G>A	ENSP00000266037:p.Arg1183His	1						p.R1183H	NM_004947.4	NP_004938.1	2	2	4	2.131415	Q8IZD9	DOCK3_HUMAN		35	3571	+			O15017	Missense_Mutation	SNP	ENST00000266037.9	1	1	hg19	c.3548G>A	CCDS46835.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.411305	0.96072	0.0	1.21E-4	ENSG00000088538	ENST00000266037	T	0.52057	0.68	6.06	6.06	0.98353	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.66297	2.02	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	T	0.57312	-0.7833	10	0.18276	T	0.48	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	1183	Q8IZD9	DOCK3_HUMAN	H	1183	ENSP00000266037:R1183H	ENSP00000266037:R1183H	R	+	2	0	0	DOCK3	51345661	51345661	1.000000	0.71417	0.978000	0.43139	0.895000	0.52256	9.869000	0.99810	2.879000	0.98667	0.650000	0.86243	CGC	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.532	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	1	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	3.310000	-16.163120	1	0.210000	NM_004947		0	65	65	0	715	703	0		1	0	1	0	0	110	494	0	1.000000	0	1	0	34	1	516	65	715
PODXL2	50512	broad.mit.edu	37	3	127387409	127387409	+	Silent	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr3:127387409G>A	ENST00000342480.6	+	5	1371	c.1332G>A	c.(1330-1332)caG>caA	p.Q444Q		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	444					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						AGAAGGAGCAGCACCTTCTCA	0.687																																						ENST00000342480.6	1.000000	0.160000	0.870000	0.310000	0.540000	0.579566	0.540000	1.000000																										0				26						c.(1330-1332)caG>caA		podocalyxin-like 2							23.0	21.0	21.0					3																	127387409		2202	4298	6500	SO:0001819	synonymous_variant	50512	1	121082	21				g.chr3:127387409G>A	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.1332G>A	chr3.hg19:g.127387409G>A		1						p.Q444Q	NM_015720.2	NP_056535.1	2	2	4	2.131415	Q9NZ53	PDXL2_HUMAN		5	1371	+			Q6UVY4|Q8WUV6	Silent	SNP	ENST00000342480.6	0	1	hg19	c.1332G>A	CCDS3044.1	0																																																																																								0.347107		TCGA-IB-7893-01A-11D-2201-08	0.687	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	0	0	0	2	2	2	2	0	0	0	0	11	11	11	9	1	3.310000	-6.900455	1	0.210000	NM_015720		0	3	2	0	70	70	0		1	0		0	0	11	0	0	0.808175	1.960961e-01	0	0	0	15	0	3	70
C4orf22	255119	broad.mit.edu	37	4	81791173	81791173	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr4:81791173T>A	ENST00000358105.3	+	4	409	c.360T>A	c.(358-360)aaT>aaA	p.N120K	C4orf22_ENST00000508675.1_Missense_Mutation_p.N137K	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	120										NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						GTGACAGAAATTCTCATGGGC	0.363																																						ENST00000358105.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				15						c.(358-360)aaT>aaA		chromosome 4 open reading frame 22							110.0	112.0	111.0					4																	81791173		2203	4300	6503	SO:0001583	missense	255119	0	0					g.chr4:81791173T>A	BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.360T>A	chr4.hg19:g.81791173T>A	ENSP00000350818:p.Asn120Lys	0					C4orf22_ENST00000508675.1_Missense_Mutation_p.N137K	p.N120K	NM_152770.2	NP_689983.2	1	2	3	1.989324	Q6V702	CD022_HUMAN		4	409	+			E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	ENST00000358105.3	1	1	hg19	c.360T>A	CCDS3587.1	1	.	.	.	.	.	.	.	.	.	.	T	13.51	2.259091	0.39896	.	.	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.30448	1.53;1.53	5.07	1.47	0.22746	5.07	1.47	0.22746	.	0.000000	0.85682	D	0.000000	T	0.56790	0.2009	M	0.91249	3.19	0.35988	D	0.836487	D;D	0.89917	1.0;0.997	D;D	0.79784	0.993;0.987	T	0.66232	-0.5975	10	0.66056	D	0.02	-28.3489	7.5202	0.27624	0.0:0.3305:0.0:0.6695	.	137;120	E7EQ13;Q6V702	.;CD022_HUMAN	K	120;137	ENSP00000350818:N120K;ENSP00000425786:N137K	ENSP00000350818:N120K	N	+	3	2	2	C4orf22	82010197	82010197	0.863000	0.29885	0.981000	0.43875	0.101000	0.19017	0.974000	0.29436	0.775000	0.33450	0.477000	0.44152	AAT	0.285068		TCGA-IB-7893-01A-11D-2201-08	0.363	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252629.2	1	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	3.310000	-20.000000	1	0.210000	NM_152770		0	84	82	0	403	393	1		1			0	0	90	0	0	1.000000	0	0	0	0	0	0	84	403
FAT4	79633	broad.mit.edu	37	4	126372829	126372829	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr4:126372829C>T	ENST00000394329.3	+	9	10671	c.10658C>T	c.(10657-10659)cCt>cTt	p.P3553L	FAT4_ENST00000335110.5_Missense_Mutation_p.P1851L	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3553	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGCACAGGTCCTGCCACCAGT	0.493																																						ENST00000394329.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				355						c.(10657-10659)cCt>cTt		FAT atypical cadherin 4							118.0	119.0	119.0					4																	126372829		2203	4300	6503	SO:0001583	missense	79633	0	0					g.chr4:126372829C>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10658C>T	chr4.hg19:g.126372829C>T	ENSP00000377862:p.Pro3553Leu	0					FAT4_ENST00000335110.5_Missense_Mutation_p.P1851L	p.P3553L	NM_024582.4	NP_078858.4	1	2	3	1.989324	Q6V0I7	FAT4_HUMAN		9	10671	+			A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	1	1	hg19	c.10658C>T	CCDS3732.3	1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451173	0.43531	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.54279	0.58;0.58	5.91	5.91	0.95273	5.91	5.91	0.95273	Cadherin (4);Cadherin-like (1);	0.000000	0.34362	U	0.004024	T	0.50051	0.1593	L	0.41632	1.29	0.80722	D	1	P;P;P	0.46142	0.873;0.72;0.617	B;B;B	0.42282	0.382;0.334;0.178	T	0.42430	-0.9452	10	0.34782	T	0.22	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	1851;3553;3553	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	L	3553;1851	ENSP00000377862:P3553L;ENSP00000335169:P1851L	ENSP00000335169:P1851L	P	+	2	0	0	FAT4	126592279	126592279	0.999000	0.42202	0.574000	0.28523	0.231000	0.25187	7.662000	0.83803	2.793000	0.96121	0.655000	0.94253	CCT	0.285068		TCGA-IB-7893-01A-11D-2201-08	0.493	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	1	0	1	2	2	2	2	0	0	0	0	163	163	163	163	1	3.310000	-3.649024	1	0.210000	NM_024582		0	181	178	0	683	665	1		1	0		0	0	163	0	0	1.000000	9.145973e-01	0	1	0	17	0	181	683
BRPF3	27154	broad.mit.edu	37	6	36182091	36182091	+	Missense_Mutation	SNP	C	C	T	rs148223802	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr6:36182091C>T	ENST00000357641.6	+	8	3170	c.2917C>T	c.(2917-2919)Cgg>Tgg	p.R973W	BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000534400.1_Missense_Mutation_p.R973W|BRPF3_ENST00000339717.7_Intron|BRPF3_ENST00000543502.1_Intron|BRPF3_ENST00000534694.1_Intron	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	973					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.R973W(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GCGCCACTCCCGGAAGCGGCC	0.617													C|||	7	0.00139776	0.0045	0.0014	5008	,	,		17378	0.0		0.0	False		,,,				2504	0.0					ENST00000357641.6	1.000000	0.890000	1.000000	0.990000	0.990000	0.993230	0.990000	1.000000																										1	Substitution - Missense(1)	p.R973W(1)	lung(1)	40						c.(2917-2919)Cgg>Tgg		bromodomain and PHD finger containing, 3		C	TRP/ARG	16,4388		0,16,2186	38.0	45.0	42.0		2917	5.8	1.0	6	dbSNP_134	42	0,8600		0,0,4300	yes	missense	BRPF3	NM_015695.2	101	0,16,6486	TT,TC,CC		0.0,0.3633,0.123	probably-damaging	973/1206	36182091	16,12988	2202	4300	6502	SO:0001583	missense	27154	71	121390	49				g.chr6:36182091C>T	AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2917C>T	chr6.hg19:g.36182091C>T	ENSP00000350267:p.Arg973Trp	1					BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000543502.1_Intron|BRPF3_ENST00000339717.7_Intron|BRPF3_ENST00000534400.1_Missense_Mutation_p.R973W	p.R973W	NM_015695.2	NP_056510.2	0	2	2	1.775172	Q9ULD4	BRPF3_HUMAN		8	3170	+			A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	1	1	hg19	c.2917C>T	CCDS34437.1	1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	23.2	4.385814	0.82792	0.003633	0.0	ENSG00000096070	ENST00000357641;ENST00000534400;ENST00000394572	T;T	0.22336	2.16;1.96	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.300838	0.31784	N	0.007072	T	0.39937	0.1097	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.15607	-1.0431	10	0.66056	D	0.02	.	18.2355	0.89948	0.0:1.0:0.0:0.0	.	973	Q9ULD4	BRPF3_HUMAN	W	973;973;387	ENSP00000350267:R973W;ENSP00000436504:R973W	ENSP00000350267:R973W	R	+	1	2	2	BRPF3	36290069	36290069	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	1.620000	0.36976	2.743000	0.94032	0.455000	0.32223	CGG	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.617	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	1	0	1	2	2	2	2	0	0	0	0	82	82	82	73	1	3.310000	-2.473816	0	0.210000	NM_015695		0	41	37	0	280	247	1		1	1		0	0	82	0	0	1.000000	9.701627e-01	0	5	0	36	0	41	280
PXT1	222659	broad.mit.edu	37	6	36368246	36368246	+	Silent	SNP	A	A	G			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr6:36368246A>G	ENST00000454782.2	-	4	768	c.285T>C	c.(283-285)caT>caC	p.H95H		NM_152990.3	NP_694535.2	Q8NFP0	PXT1_HUMAN	peroxisomal, testis specific 1	95					positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|peroxisome (GO:0005777)											GAACCATCCTATGATCAATGT	0.507																																						ENST00000454782.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0										c.(283-285)caT>caC		peroxisomal, testis specific 1							257.0	207.0	224.0					6																	36368246		2203	4300	6503	SO:0001819	synonymous_variant	222659	2	121412	33				g.chr6:36368246A>G	AF486827	CCDS4820.2	6p21.31	2004-04-30			ENSG00000179165	ENSG00000179165			18312	protein-coding gene	gene with protein product							Standard	NM_152990		Approved	STEPP	uc003omd.2	Q8NFP0	OTTHUMG00000159815	ENST00000454782.2:c.285T>C	chr6.hg19:g.36368246A>G		1						p.H95H	NM_152990.3	NP_694535.2	0	2	2	1.775172	Q8NFP0	PXT1_HUMAN		4	768	-			J3KR74	Silent	SNP	ENST00000454782.2	1	1	hg19	c.285T>C	CCDS4820.2	1	.	.	.	.	.	.	.	.	.	.	A	4.071	0.011025	0.07912	.	.	ENSG00000179165	ENST00000459696	.	.	.	4.9	-4.38	0.03622	4.9	-4.38	0.03622	.	.	.	.	.	T	0.10121	0.0248	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32188	-0.9916	4	.	.	.	-6.1218	5.9208	0.19080	0.2775:0.2882:0.4342:0.0	.	.	.	.	T	19	.	.	I	-	2	0	0	PXT1	36476224	36476224	0.000000	0.05858	0.003000	0.11579	0.737000	0.42083	-1.593000	0.02096	-0.991000	0.03476	0.454000	0.30748	ATA	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.507	PXT1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357516.2	1	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	3.310000	-20.000000	1	0.210000	NM_152990		0	190	187	0	564	542	0		1	0		0	0	135	0	0	1.000000	0	0	0	0	1	0	190	564
LRP11	84918	broad.mit.edu	37	6	150164252	150164252	+	Silent	SNP	T	T	C	rs201434283		TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr6:150164252T>C	ENST00000239367.2	-	3	785	c.780A>G	c.(778-780)caA>caG	p.Q260Q	LRP11_ENST00000546019.1_Silent_p.Q5Q|LRP11_ENST00000367368.2_Silent_p.Q260Q	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	260	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.					integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GGGTTCCTGATTGAGGCACCT	0.577																																						ENST00000239367.2	1.000000	0.890000	1.000000	0.990000	0.990000	0.993431	0.990000	1.000000																										0				8						c.(778-780)caA>caG		low density lipoprotein receptor-related protein 11		T		1,4405	2.1+/-5.4	0,1,2202	102.0	81.0	88.0		780	-1.4	1.0	6		88	0,8600		0,0,4300	no	coding-synonymous	LRP11	NM_032832.5		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		260/501	150164252	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84918	1	121412	31				g.chr6:150164252T>C	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.780A>G	chr6.hg19:g.150164252T>C		1					LRP11_ENST00000546019.1_Silent_p.Q5Q|LRP11_ENST00000367368.2_Silent_p.Q260Q	p.Q260Q	NM_032832.5	NP_116221.3	0	2	2	1.775172	Q86VZ4	LRP11_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.193)	3	785	-		Ovarian(120;0.0907)	Q5VYC0|Q96SN6	Silent	SNP	ENST00000239367.2	1	1	hg19	c.780A>G	CCDS5220.1	1																																																																																								0.210000		TCGA-IB-7893-01A-11D-2201-08	0.577	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	1	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	3.310000	-20.000000	1	0.210000	NM_032832		0	44	41	0	303	296	1		1	1		0	0	60	0	0	1.000000	9.990238e-01	0	11	0	63	0	44	303
DOCK4	9732	broad.mit.edu	37	7	111503593	111503593	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr7:111503593C>T	ENST00000437633.1	-	23	2564	c.2308G>A	c.(2308-2310)Gtg>Atg	p.V770M	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.V770M	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	770					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.V758M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TCTGAGTACACGGCAGGGAAA	0.478																																						ENST00000437633.1	1.000000	0.670000	1.000000	0.910000	0.990000	0.962554	0.990000	1.000000																										1	Substitution - Missense(1)	p.V758M(1)	haematopoietic_and_lymphoid_tissue(1)	72						c.(2308-2310)Gtg>Atg		dedicator of cytokinesis 4							42.0	40.0	41.0					7																	111503593		1913	4104	6017	SO:0001583	missense	9732	2	120830	24				g.chr7:111503593C>T		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2308G>A	chr7.hg19:g.111503593C>T	ENSP00000404179:p.Val770Met	1					DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.V770M	p.V770M	NM_014705.3	NP_055520.3	2	2	4	2.109791	Q8N1I0	DOCK4_HUMAN		23	2564	-		Acute lymphoblastic leukemia(1;0.0441)	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	0	1	hg19	c.2308G>A	CCDS47688.1	1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769804	0.69992	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.03301	3.98;3.98	5.23	5.23	0.72850	5.23	5.23	0.72850	.	0.126462	0.52532	D	0.000063	T	0.07548	0.0190	L	0.45352	1.415	0.80722	D	1	D;D;P;D	0.58268	0.97;0.97;0.947;0.982	P;B;B;P	0.46796	0.522;0.418;0.324;0.527	T	0.11372	-1.0590	10	0.54805	T	0.06	.	18.9943	0.92806	0.0:1.0:0.0:0.0	.	770;770;770;770	Q149N2;Q149N5;Q8N1I0;Q8N1I0-2	.;.;DOCK4_HUMAN;.	M	758;770;770;758;769	ENSP00000410746:V770M;ENSP00000404179:V770M	ENSP00000345432:V758M	V	-	1	0	0	DOCK4	111290829	111290829	0.994000	0.37717	0.985000	0.45067	0.832000	0.47134	3.082000	0.50128	2.706000	0.92434	0.563000	0.77884	GTG	0.344833		TCGA-IB-7893-01A-11D-2201-08	0.478	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	3.310000	-18.641130	1	0.210000	NM_014705		0	12	12	0	105	102	1		1	0		0	0	24	0	0	0.999160	6.847413e-01	0	0	0	22	0	12	105
CFTR	1080	broad.mit.edu	37	7	117250657	117250657	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr7:117250657G>A	ENST00000003084.6	+	19	3205	c.3073G>A	c.(3073-3075)Gct>Act	p.A1025T	AC000111.6_ENST00000456270.1_RNA|CFTR_ENST00000454343.1_Missense_Mutation_p.A964T	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1025	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	AGTGATAGTGGCTTTTATTAT	0.383									Cystic Fibrosis																													ENST00000003084.6	1.000000	0.760000	1.000000	0.910000	0.990000	0.968171	0.990000	1.000000																										0				69						c.(3073-3075)Gct>Act		cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)						134.0	119.0	124.0					7																	117250657		2203	4300	6503	SO:0001583	missense	1080	0	0		Cystic Fibrosis	Familial Cancer Database	CF	g.chr7:117250657G>A	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3073G>A	chr7.hg19:g.117250657G>A	ENSP00000003084:p.Ala1025Thr	1					CFTR_ENST00000454343.1_Missense_Mutation_p.A964T|AC000111.6_ENST00000456270.1_RNA	p.A1025T	NM_000492.3	NP_000483.3	2	2	4	2.109791	P13569	CFTR_HUMAN	STAD - Stomach adenocarcinoma(10;0.000534)	19	3205	+	Lung NSC(10;0.00148)|all_lung(10;0.00171)		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	1	1	hg19	c.3073G>A	CCDS5773.1	1	.	.	.	.	.	.	.	.	.	.	G	9.896	1.205615	0.22205	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.89617	-2.54;-2.54;-2.54	6.16	4.37	0.52481	6.16	4.37	0.52481	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.194135	0.56097	N	0.000040	D	0.85767	0.5773	L	0.49571	1.57	0.35828	D	0.825115	B	0.02656	0.0	B	0.12156	0.007	D	0.84020	0.0353	10	0.48119	T	0.1	-3.1277	13.4064	0.60915	0.1273:0.0:0.8727:0.0	.	1025	P13569	CFTR_HUMAN	T	1025;964;995	ENSP00000003084:A1025T;ENSP00000403677:A964T;ENSP00000389119:A995T	ENSP00000003084:A1025T	A	+	1	0	0	CFTR	117037893	117037893	1.000000	0.71417	0.024000	0.17045	0.185000	0.23345	5.733000	0.68571	0.941000	0.37499	-0.157000	0.13467	GCT	0.344833		TCGA-IB-7893-01A-11D-2201-08	0.383	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	1	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	3.310000	-12.081370	1	0.210000	NM_000492		0	35	33	0	341	333	0		1	0		0	0	40	0	0	1.000000	2.815442e-01	0	0	0	11	0	35	341
DAGLB	221955	broad.mit.edu	37	7	6465643	6465643	+	Silent	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr7:6465643G>A	ENST00000297056.6	-	7	1201	c.1032C>T	c.(1030-1032)ttC>ttT	p.F344F	DAGLB_ENST00000436575.1_Silent_p.F303F|DAGLB_ENST00000421761.2_Silent_p.F88F|DAGLB_ENST00000425398.2_Silent_p.F215F|DAGLB_ENST00000428902.2_Silent_p.F217F	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	344					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		TGACGTGGATGAAGTCCCTGT	0.532																																						ENST00000297056.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				26						c.(1030-1032)ttC>ttT		diacylglycerol lipase, beta							122.0	109.0	113.0					7																	6465643		2203	4300	6503	SO:0001819	synonymous_variant	221955	0	0					g.chr7:6465643G>A	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.1032C>T	chr7.hg19:g.6465643G>A		1					DAGLB_ENST00000436575.1_Silent_p.F303F|DAGLB_ENST00000425398.2_Silent_p.F215F|DAGLB_ENST00000421761.2_Silent_p.F88F|DAGLB_ENST00000428902.2_Silent_p.F217F	p.F344F	NM_139179.3	NP_631918.3	2	2	4	2.109791	Q8NCG7	DGLB_HUMAN		7	1201	-		Ovarian(82;0.232)	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Silent	SNP	ENST00000297056.6	1	1	hg19	c.1032C>T	CCDS5350.1	1																																																																																								0.344833		TCGA-IB-7893-01A-11D-2201-08	0.532	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	3.310000	-20.000000	1	0.210000	NM_139179		0	75	72	0	306	295	0		1	1		0	0	62	0	0	1.000000	9.981203e-01	0	7	0	34	0	75	306
WASL	8976	broad.mit.edu	37	7	123349222	123349222	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr7:123349222G>A	ENST00000223023.4	-	2	505	c.173C>T	c.(172-174)tCa>tTa	p.S58L		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	58	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCACTTCTTTGACCACATACA	0.338																																						ENST00000223023.4	1.000000	0.740000	1.000000	0.880000	0.990000	0.957134	0.990000	1.000000																										0				29						c.(172-174)tCa>tTa		Wiskott-Aldrich syndrome-like							86.0	80.0	82.0					7																	123349222		2203	4300	6503	SO:0001583	missense	8976	0	0					g.chr7:123349222G>A	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.173C>T	chr7.hg19:g.123349222G>A	ENSP00000223023:p.Ser58Leu	1						p.S58L	NM_003941.2	NP_003932.3	2	2	4	2.109791	O00401	WASL_HUMAN		2	505	-			A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	1	1	hg19	c.173C>T	CCDS34743.1	1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.860939	0.71834	.	.	ENSG00000106299	ENST00000223023	D	0.99422	-5.88	5.58	4.68	0.58851	5.58	4.68	0.58851	EVH1 (3);Pleckstrin homology-type (1);	0.524667	0.20818	N	0.085115	D	0.97867	0.9299	L	0.42245	1.32	0.29642	N	0.84463	B	0.02656	0.0	B	0.08055	0.003	D	0.95667	0.8720	10	0.54805	T	0.06	-15.64	10.472	0.44642	0.1453:0.0:0.8547:0.0	.	58	O00401	WASL_HUMAN	L	58	ENSP00000223023:S58L	ENSP00000223023:S58L	S	-	2	0	0	WASL	123136458	123136458	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.849000	0.48286	2.789000	0.95967	0.655000	0.94253	TCA	0.344833		TCGA-IB-7893-01A-11D-2201-08	0.338	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	3.310000	-11.821950	1	0.210000	NM_003941		0	38	37	0	387	378	0		1	1		0	0	50	0	0	1.000000	9.999713e-01	0	3	0	157	0	38	387
CSGALNACT1	55790	broad.mit.edu	37	8	19363332	19363332	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr8:19363332C>T	ENST00000454498.2	-	4	1027	c.14G>A	c.(13-15)cGc>cAc	p.R5H	CSGALNACT1_ENST00000522854.1_Missense_Mutation_p.R5H|CSGALNACT1_ENST00000544602.1_Missense_Mutation_p.R5H|CSGALNACT1_ENST00000311540.4_Missense_Mutation_p.R5H|CSGALNACT1_ENST00000332246.6_Missense_Mutation_p.R5H	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1	5					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		CAGCCCCCGGCGAACCATCAT	0.602																																						ENST00000454498.2	1.000000	0.650000	1.000000	0.770000	0.910000	0.895492	0.910000	1.000000																										0				31						c.(13-15)cGc>cAc		chondroitin sulfate N-acetylgalactosaminyltransferase 1							82.0	87.0	85.0					8																	19363332		2202	4300	6502	SO:0001583	missense	55790	0	0					g.chr8:19363332C>T	AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.14G>A	chr8.hg19:g.19363332C>T	ENSP00000411816:p.Arg5His	1					CSGALNACT1_ENST00000311540.4_Missense_Mutation_p.R5H|CSGALNACT1_ENST00000332246.6_Missense_Mutation_p.R5H|CSGALNACT1_ENST00000522854.1_Missense_Mutation_p.R5H|CSGALNACT1_ENST00000544602.1_Missense_Mutation_p.R5H	p.R5H	NM_001130518.1	NP_001123990.1	2	2	4	2.146082	Q8TDX6	CGAT1_HUMAN		4	1027	-			B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Missense_Mutation	SNP	ENST00000454498.2	1	1	hg19	c.14G>A	CCDS6010.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.259207	0.95368	.	.	ENSG00000147408	ENST00000454498;ENST00000332246;ENST00000311540;ENST00000522854;ENST00000544602;ENST00000523262;ENST00000517494;ENST00000520003;ENST00000524213	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.061588	0.64402	D	0.000004	T	0.54822	0.1882	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	P	0.60117	0.869	T	0.56643	-0.7945	10	0.87932	D	0	-29.161	18.7017	0.91623	0.0:1.0:0.0:0.0	.	5	Q8TDX6	CGAT1_HUMAN	H	5	ENSP00000411816:R5H;ENSP00000330805:R5H;ENSP00000310891:R5H;ENSP00000429809:R5H;ENSP00000442155:R5H	ENSP00000310891:R5H	R	-	2	0	0	CSGALNACT1	19407612	19407612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.364000	0.79526	2.779000	0.95612	0.655000	0.94253	CGC	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.602	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375204.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	101	1	3.310000	-20.000000	1	0.210000	NM_018371		0	37	35	0	433	418	0		1	0		0	0	103	0	0	1.000000	6.410239e-01	0	1	0	26	0	37	433
VPS13B	157680	broad.mit.edu	37	8	100791108	100791108	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr8:100791108T>C	ENST00000358544.2	+	42	7814	c.7703T>C	c.(7702-7704)gTg>gCg	p.V2568A	VPS13B_ENST00000357162.2_Missense_Mutation_p.V2543A|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2568					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CAAAGTGTGGTGAAACCCTTC	0.448																																					Colon(161;2205 2542 7338 31318)	ENST00000358544.2	1.000000	0.080000	0.270000	0.130000	0.190000	0.229805	0.190000	0.190000																										0				193						c.(7702-7704)gTg>gCg		vacuolar protein sorting 13 homolog B (yeast)							134.0	121.0	126.0					8																	100791108		2203	4300	6503	SO:0001583	missense	157680	0	0					g.chr8:100791108T>C	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7703T>C	chr8.hg19:g.100791108T>C	ENSP00000351346:p.Val2568Ala	1					VPS13B_ENST00000357162.2_Missense_Mutation_p.V2543A|VPS13B_ENST00000395996.1_3'UTR	p.V2568A	NM_017890.4	NP_060360.3	2	3	5	2.282847	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)	42	7814	+	Breast(36;3.73e-07)		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	0	1	hg19	c.7703T>C	CCDS6280.1	0	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501880	0.85176	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.72835	-0.69;-0.69	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.073471	0.53938	D	0.000049	T	0.81456	0.4826	L	0.59436	1.845	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.72625	0.913;0.978	D	0.83533	0.0092	10	0.87932	D	0	.	15.4875	0.75578	0.0:0.0:0.0:1.0	.	2543;2568	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	A	2543;2568	ENSP00000349685:V2543A;ENSP00000351346:V2568A	ENSP00000349685:V2543A	V	+	2	0	0	VPS13B	100860284	100860284	1.000000	0.71417	0.937000	0.37676	0.896000	0.52359	6.126000	0.71635	2.063000	0.61619	0.533000	0.62120	GTG	0.391957		TCGA-IB-7893-01A-11D-2201-08	0.448	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	0	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	3.310000	-7.644808	1	0.210000	NM_184042		0	10	10	0	669	652	0		1	0		0	0	91	0	0	0.996461	7.269072e-02	0	0	0	27	0	10	669
ADAMTSL1	92949	broad.mit.edu	37	9	18753360	18753360	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr9:18753360G>A	ENST00000380548.4	+	16	2410	c.2071G>A	c.(2071-2073)Gtc>Atc	p.V691I		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	691	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GACCAGAGACGTCTTCTGCAG	0.532																																						ENST00000380548.4	0.780000	0.120000	0.570000	0.220000	0.370000	0.402693	0.370000	0.320000																										0				42						c.(2071-2073)Gtc>Atc		ADAMTS-like 1							71.0	68.0	69.0					9																	18753360		2028	4193	6221	SO:0001583	missense	92949	0	0					g.chr9:18753360G>A	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2071G>A	chr9.hg19:g.18753360G>A	ENSP00000369921:p.Val691Ile	1						p.V691I	NM_001040272.5	NP_001035362.3	0	4	4	2.135437	Q8N6G6	ATL1_HUMAN		16	2410	+			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	0	1	hg19	c.2071G>A	CCDS47954.1	0	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801218	0.50315	.	.	ENSG00000178031	ENST00000380548	T	0.54071	0.59	5.85	4.93	0.64822	5.85	4.93	0.64822	.	0.332935	0.13323	N	0.396531	T	0.49236	0.1545	M	0.62154	1.92	0.80722	D	1	B	0.34226	0.443	B	0.29524	0.103	T	0.49303	-0.8954	10	0.54805	T	0.06	.	11.3021	0.49311	0.1505:0.0:0.8495:0.0	.	691	Q8N6G6	ATL1_HUMAN	I	691	ENSP00000369921:V691I	ENSP00000369921:V691I	V	+	1	0	0	ADAMTSL1	18743360	18743360	1.000000	0.71417	0.983000	0.44433	0.706000	0.40770	5.786000	0.69006	1.412000	0.46977	0.655000	0.94253	GTC	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.532	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1	0	0	0	2	2	2	2	0	0	0	0	19	19	19	18	1	3.310000	-6.589179	1	0.210000			0	4	2	0	135	133	0		1	0		0	0	19	0	0	0.884504	1.516992e-01	0	0	0	19	0	4	135
SVEP1	79987	broad.mit.edu	37	9	113205879	113205879	+	Missense_Mutation	SNP	C	C	A	rs201343948	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chr9:113205879C>A	ENST00000401783.2	-	27	4921	c.4585G>T	c.(4585-4587)Gat>Tat	p.D1529Y	SVEP1_ENST00000302728.8_Missense_Mutation_p.D1529Y|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.D1506Y	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1529	Pentaxin.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AATTTCCCATCGATATAGACT	0.438																																						ENST00000401783.2	1.000000	0.930000	1.000000	0.990000	0.990000	0.995872	0.990000	1.000000																										0				147						c.(4585-4587)Gat>Tat		sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1							78.0	82.0	81.0					9																	113205879		1947	4149	6096	SO:0001583	missense	79987	0	0					g.chr9:113205879C>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.4585G>T	chr9.hg19:g.113205879C>A	ENSP00000384917:p.Asp1529Tyr	1					SVEP1_ENST00000302728.8_Missense_Mutation_p.D1529Y|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.D1506Y	p.D1529Y	NM_153366.3	NP_699197.3	2	2	4	2.176361	Q4LDE5	SVEP1_HUMAN		27	4921	-			Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	1	1	hg19	c.4585G>T	CCDS48004.1	1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150519	0.78001	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.81415	-0.5;-0.5;-1.49	5.46	5.46	0.80206	5.46	5.46	0.80206	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.048935	0.85682	D	0.000000	D	0.93478	0.7919	H	0.96080	3.765	0.45216	D	0.998223	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.95016	0.8156	10	0.87932	D	0	.	19.6743	0.95924	0.0:1.0:0.0:0.0	.	1529;1529	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	Y	1529;1506;1529	ENSP00000384917:D1529Y;ENSP00000363593:D1506Y;ENSP00000304118:D1529Y	ENSP00000304118:D1529Y	D	-	1	0	0	SVEP1	112245700	112245700	1.000000	0.71417	0.982000	0.44146	0.866000	0.49608	5.576000	0.67437	2.721000	0.93114	0.655000	0.94253	GAT	0.347107		TCGA-IB-7893-01A-11D-2201-08	0.438	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	3.310000	-5.906780	1	0.210000			0	23	23	0	167	166	1		1	0		0	0	25	0	0	1.000000	9.619518e-01	0	0	0	42	0	23	167
BHLHB9	80823	broad.mit.edu	37	X	102004308	102004308	+	Missense_Mutation	SNP	G	G	T	rs112563174	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chrX:102004308G>T	ENST00000372735.1	+	4	970	c.385G>T	c.(385-387)Gct>Tct	p.A129S	BHLHB9_ENST00000361229.4_Missense_Mutation_p.A129S|BHLHB9_ENST00000448867.1_Missense_Mutation_p.A129S|BHLHB9_ENST00000447531.1_Missense_Mutation_p.A129S|BHLHB9_ENST00000457056.1_Missense_Mutation_p.A129S			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	129					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TGGAGAAGAGGCTGGTAATAG	0.512													G|||	3	0.000794702	0.0023	0.0	3775	,	,		13933	0.0		0.0	False		,,,				2504	0.0					ENST00000372735.1	0.200000	0.030000	0.150000	0.060000	0.100000	0.111541	0.100000	0.100000																										0				26						c.(385-387)Gct>Tct		basic helix-loop-helix domain containing, class B, 9		G	SER/ALA,SER/ALA,SER/ALA,SER/ALA,SER/ALA,SER/ALA,SER/ALA,SER/ALA	19,3816		0,18,1,1614,570	75.0	70.0	72.0		385,385,385,385,385,385,385,385	1.2	0.1	X	dbSNP_132	72	0,6728		0,0,0,2428,1872	yes	missense,missense,missense,missense,missense,missense,missense,missense	BHLHB9	NM_001142524.1,NM_001142525.1,NM_001142526.1,NM_001142527.1,NM_001142528.1,NM_001142529.1,NM_001142530.1,NM_030639.2	99,99,99,99,99,99,99,99	0,18,1,4042,2442	TT,TG,T,GG,G		0.0,0.4954,0.1799	benign,benign,benign,benign,benign,benign,benign,benign	129/548,129/548,129/548,129/548,129/548,129/548,129/548,129/548	102004308	19,10544	2203	4300	6503	SO:0001583	missense	80823	60	121410	50				g.chrX:102004308G>T	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.385G>T	chrX.hg19:g.102004308G>T	ENSP00000361820:p.Ala129Ser						BHLHB9_ENST00000361229.4_Missense_Mutation_p.A129S|BHLHB9_ENST00000447531.1_Missense_Mutation_p.A129S|BHLHB9_ENST00000457056.1_Missense_Mutation_p.A129S|BHLHB9_ENST00000448867.1_Missense_Mutation_p.A129S	p.A129S			0	1	1		Q6PI77	BHLH9_HUMAN		4	970	+			Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	0	1	hg19	c.385G>T	CCDS14502.1	0	2	0.0012055455093429777	0	0.0	0	0.0	0	0.0	0	0.0	G	0.419	-0.909449	0.02434	0.004954	0.0	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58	4.24	1.25	0.21368	4.24	1.25	0.21368	.	1.339950	0.05332	N	0.528551	T	0.14485	0.0350	L	0.59436	1.845	0.09310	N	1	B	0.34103	0.437	B	0.32090	0.14	T	0.30534	-0.9975	9	.	.	.	-8.1436	5.1928	0.15218	0.2257:0.1632:0.6111:0.0	.	129	Q6PI77	BHLH9_HUMAN	S	129	ENSP00000403226:A129S;ENSP00000354675:A129S;ENSP00000405893:A129S;ENSP00000391722:A129S;ENSP00000361820:A129S	.	A	+	1	0	0	BHLHB9	101890964	101890964	0.010000	0.17322	0.092000	0.20876	0.084000	0.17831	-0.220000	0.09215	0.118000	0.18165	0.529000	0.55759	GCT	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.512	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	0	0	1	2	18	2	2	1	1	1	1	51	51	51	51	1	3.310000	-7.016633	1	0.210000	NM_030639		0	6	6	0	287	278	0		0	0		1	0	51	0	0	0.007913	3.467282e-02	0	0	0	12	0	6	287
GUCY2F	2986	broad.mit.edu	37	X	108718972	108718972	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chrX:108718972G>A	ENST00000218006.2	-	2	485	c.194C>T	c.(193-195)tCg>tTg	p.S65L		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	65					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TGAAAACAGCGAATCACAAGC	0.532											OREG0019905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000218006.2	0.220000	0.030000	0.160000	0.060000	0.100000	0.117649	0.100000	0.100000																										0				67						c.(193-195)tCg>tTg		guanylate cyclase 2F, retinal							74.0	64.0	67.0					X																	108718972		2203	4300	6503	SO:0001583	missense	2986	0	0					g.chrX:108718972G>A	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.194C>T	chrX.hg19:g.108718972G>A	ENSP00000218006:p.Ser65Leu			OREG0019905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1414		p.S65L	NM_001522.2	NP_001513.2	0	1	1		P51841	GUC2F_HUMAN		2	485	-			Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	0	1	hg19	c.194C>T	CCDS14545.1	0	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976156	0.34848	.	.	ENSG00000101890	ENST00000218006	T	0.73152	-0.72	4.95	3.15	0.36227	4.95	3.15	0.36227	.	0.187399	0.47852	D	0.000202	T	0.37839	0.1018	N	0.02539	-0.55	0.26327	N	0.977573	B	0.02656	0.0	B	0.01281	0.0	T	0.21586	-1.0241	10	0.11794	T	0.64	.	6.7942	0.23717	0.0986:0.0:0.7215:0.1799	.	65	P51841	GUC2F_HUMAN	L	65	ENSP00000218006:S65L	ENSP00000218006:S65L	S	-	2	0	0	GUCY2F	108605628	108605628	1.000000	0.71417	0.773000	0.31616	0.757000	0.42996	3.428000	0.52792	1.182000	0.42928	0.600000	0.82982	TCG	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.532	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	0	0	0	2	2	2	2	0	0	0	0	50	50	50	48	1	3.310000	-6.414720	1	0.210000	NM_001522		0	5	3	0	232	225	0		1			0	0	50	0	0	0.931638	0	0	0	0	0	0	5	232
UBQLN2	29978	broad.mit.edu	37	X	56590932	56590932	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chrX:56590932C>G	ENST00000338222.5	+	1	907	c.626C>G	c.(625-627)cCa>cGa	p.P209R		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	209					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						ATGGCTAATCCACAGATGCAG	0.463																																					Esophageal Squamous(104;218 1492 6022 10838 28884)	ENST00000338222.5	0.930000	0.520000	0.840000	0.610000	0.720000	0.732012	0.720000	0.720000																										0				21						c.(625-627)cCa>cGa		ubiquilin 2							64.0	61.0	62.0					X																	56590932		2203	4300	6503	SO:0001583	missense	29978	0	0					g.chrX:56590932C>G	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.626C>G	chrX.hg19:g.56590932C>G	ENSP00000345195:p.Pro209Arg							p.P209R	NM_013444.3	NP_038472.2	0	1	1		Q9UHD9	UBQL2_HUMAN		1	907	+			O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	ENST00000338222.5	1	1	hg19	c.626C>G	CCDS14374.1	0	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988504	0.53934	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	T	0.29655	1.56	4.89	4.89	0.63831	4.89	4.89	0.63831	Heat shock chaperonin-binding (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000003	T	0.64360	0.2591	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	0.969;1.0	P;D	0.97110	0.903;1.0	T	0.73675	-0.3908	10	0.72032	D	0.01	-5.6539	14.6449	0.68754	0.0:1.0:0.0:0.0	.	209;209	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	R	209	ENSP00000345195:P209R	ENSP00000345195:P209R	P	+	2	0	0	UBQLN2	56607657	56607657	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	7.604000	0.82830	2.428000	0.82296	0.600000	0.82982	CCA	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.463	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	3.310000	-20.000000	1	0.210000	NM_013444		0	35	34	0	192	188	1		1	1		0	0	43	0	0	1.000000	9.999986e-01	0	24	0	96	0	35	192
GPR112	139378	broad.mit.edu	37	X	135428344	135428344	+	Missense_Mutation	SNP	C	C	G	rs138190399	byFrequency	TCGA-IB-7893-01A-11D-2201-08	TCGA-IB-7893-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	37ed3200-311b-4a5c-b130-04d290ed784d	38718592-ad6d-44ca-b328-88cff2eeaeec	g.chrX:135428344C>G	ENST00000394143.1	+	6	2770	c.2479C>G	c.(2479-2481)Cca>Gca	p.P827A	GPR112_ENST00000394141.1_Missense_Mutation_p.P622A|GPR112_ENST00000412101.1_Missense_Mutation_p.P622A|GPR112_ENST00000370652.1_Missense_Mutation_p.P827A|GPR112_ENST00000287534.4_Missense_Mutation_p.P764A	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	827					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GACCCCTGTACCAAAGTCAGC	0.388													C|||	12	0.00317881	0.0083	0.0014	3775	,	,		16364	0.0		0.0	False		,,,				2504	0.0					ENST00000394143.1	0.180000	0.040000	0.140000	0.060000	0.090000	0.105867	0.090000	0.090000																										0				199						c.(2479-2481)Cca>Gca		G protein-coupled receptor 112		C	ALA/PRO	63,3772		0,52,11,1580,560	123.0	111.0	115.0		2479	0.0	0.0	X	dbSNP_134	115	0,6728		0,0,0,2428,1872	yes	missense	GPR112	NM_153834.3	27	0,52,11,4008,2432	GG,GC,G,CC,C		0.0,1.6428,0.5964	probably-damaging	827/3081	135428344	63,10500	2203	4300	6503	SO:0001583	missense	139378	169	121394	57				g.chrX:135428344C>G	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2479C>G	chrX.hg19:g.135428344C>G	ENSP00000377699:p.Pro827Ala						GPR112_ENST00000412101.1_Missense_Mutation_p.P622A|GPR112_ENST00000370652.1_Missense_Mutation_p.P827A|GPR112_ENST00000394141.1_Missense_Mutation_p.P622A|GPR112_ENST00000287534.4_Missense_Mutation_p.P764A	p.P827A	NM_153834.3	NP_722576.3	0	1	1		Q8IZF6	GP112_HUMAN		6	2770	+	Acute lymphoblastic leukemia(192;0.000127)		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	0	1	hg19	c.2479C>G	CCDS35409.1	0	4	0.0024110910186859553	2	0.004098360655737705	0	0.0	0	0.0	0	0.0	C	12.72	2.021497	0.35701	0.016428	0.0	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.51817	0.73;0.73;0.69;0.77;0.69	2.99	-0.00263	0.14029	2.99	-0.00263	0.14029	.	.	.	.	.	T	0.33059	0.0850	L	0.29908	0.895	0.09310	N	1	B;B;D	0.76494	0.27;0.154;0.999	B;B;D	0.75484	0.095;0.053;0.986	T	0.23084	-1.0198	9	0.87932	D	0	.	4.4262	0.11503	0.0:0.3864:0.4636:0.15	.	764;622;827	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	A	827;827;622;764;622	ENSP00000377699:P827A;ENSP00000359686:P827A;ENSP00000416526:P622A;ENSP00000287534:P764A;ENSP00000377697:P622A	ENSP00000287534:P764A	P	+	1	0	0	GPR112	135256010	135256010	0.000000	0.05858	0.001000	0.08648	0.084000	0.17831	-0.458000	0.06737	0.020000	0.15106	0.284000	0.19432	CCA	0.210000		TCGA-IB-7893-01A-11D-2201-08	0.388	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	3.310000	-3.396111	1	0.210000			0	7	7	0	347	343	0		1			0	0	63	0	0	0.980067	0	0	0	0	0	0	7	347
