#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
NRAP	4892	broad.mit.edu	37	10	115374049	115374049	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr10:115374049A>G	ENST00000359988.3	-	29	3437	c.3193T>C	c.(3193-3195)Tac>Cac	p.Y1065H	NRAP_ENST00000369358.4_Missense_Mutation_p.Y1073H|NRAP_ENST00000360478.3_Missense_Mutation_p.Y1030H|NRAP_ENST00000369360.3_Missense_Mutation_p.Y1038H	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCCTCTTTGTATTTGTACTAA	0.453																																						ENST00000359988.3	0.330000	0.100000	0.260000	0.140000	0.190000	0.209900	0.190000	0.200000																										0				95						c.(3193-3195)Tac>Cac		nebulin-related anchoring protein							150.0	134.0	140.0					10																	115374049		2203	4300	6503	SO:0001583	missense	4892	0	0					g.chr10:115374049A>G		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3193T>C	chr10.hg19:g.115374049A>G	ENSP00000353078:p.Tyr1065His	0					NRAP_ENST00000369360.3_Missense_Mutation_p.Y1038H|NRAP_ENST00000369358.4_Missense_Mutation_p.Y1073H|NRAP_ENST00000360478.3_Missense_Mutation_p.Y1030H	p.Y1065H	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2	0	1	1	1.996160				29	3437	-		Colorectal(252;0.0233)|Breast(234;0.188)		Missense_Mutation	SNP	ENST00000359988.3	0	1	hg19	c.3193T>C	CCDS7579.1	0	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298801	0.81025	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	D;D;D;D	0.99958	-9.03;-9.03;-9.03;-9.03	5.65	5.65	0.86999	5.650000	5.650000	0.869990	.	0.000000	0.85682	D	0.000000	D	0.99955	0.9981	M	0.89601	3.045	0.48571	D	0.999672	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.95382	0.8474	10	0.87932	D	0	.	15.8761	0.79162	1.0:0.0:0.0:0.0	.	1065;1030;1065	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	H	1073;1038;1065;1030	ENSP00000358365:Y1073H;ENSP00000358367:Y1038H;ENSP00000353078:Y1065H;ENSP00000353666:Y1030H	ENSP00000353078:Y1065H	Y	-	1	0	0	NRAP	115364039	115364039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.290000	0.89925	2.153000	0.67306	0.528000	0.53228	TAC	0.155949		TCGA-IB-7897-01A-21D-2201-08	0.453	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	0	0	1	2	2	2	2	0	0	0	0	113	113	113	114	1	2	-3.225686	1	0.160000	NM_006175		0	12	12	0	751	737	0		1			0	0	113	0	0	9.990121e-01	0	0	0	0	0	0	12	751
TUB	7275	broad.mit.edu	37	11	8123100	8123100	+	Silent	SNP	G	G	A	rs147880022	byFrequency	TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr11:8123100G>A	ENST00000299506.2	+	12	1604	c.1455G>A	c.(1453-1455)ccG>ccA	p.P485P	TUB_ENST00000534099.1_Silent_p.P491P|TUB_ENST00000305253.4_Silent_p.P540P	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	485					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		ACAACTACCCGCTGTGTGCAC	0.582													G|||	4	0.000798722	0.0	0.0	5008	,	,		20364	0.0		0.0	False		,,,				2504	0.0041					ENST00000299506.2	0.510000	0.220000	0.440000	0.280000	0.350000	0.363537	0.350000	0.350000																										0				26						c.(1453-1455)ccG>ccA		tubby bipartite transcription factor		G	,	4,4398	8.1+/-20.4	0,4,2197	170.0	125.0	141.0		1620,1455	-3.8	1.0	11	dbSNP_134	141	2,8590	2.2+/-6.3	0,2,4294	no	coding-synonymous,coding-synonymous	TUB	NM_003320.4,NM_177972.2	,	0,6,6491	AA,AG,GG		0.0233,0.0909,0.0462	,	540/562,485/507	8123100	6,12988	2201	4296	6497	SO:0001819	synonymous_variant	7275	46	121412	49				g.chr11:8123100G>A	U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1455G>A	chr11.hg19:g.8123100G>A		0					TUB_ENST00000305253.4_Silent_p.P540P|TUB_ENST00000534099.1_Silent_p.P491P	p.P485P	NM_177972.2	NP_813977.1	0	1	1	1.998490	P50607	TUB_HUMAN		12	1604	+		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)	D3DQU4|O00293|Q6B007	Silent	SNP	ENST00000299506.2	0	1	hg19	c.1455G>A	CCDS7787.1	0																																																																																								0.156627		TCGA-IB-7897-01A-21D-2201-08	0.582	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	0	0	1	2	23	2	2	1	1	1	1	100	100	100	100	1	2	-2.747571	1	0.160000	NM_003320		0	21	20	0	725	715	0		0	0		1	0	100	0	0	4.178368e-01	7.176845e-02	0	0	0	15	0	21	725
AKAP3	10566	broad.mit.edu	37	12	4737445	4737445	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr12:4737445C>A	ENST00000545990.2	-	5	1147	c.623G>T	c.(622-624)aGt>aTt	p.S208I	AKAP3_ENST00000228850.1_Missense_Mutation_p.S208I|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	208					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						ATTTGGGGGACTTTGTGATGA	0.488																																						ENST00000545990.2	1.000000	0.090000	0.330000	0.130000	0.200000	0.301733	0.200000	0.180000																										0				51						c.(622-624)aGt>aTt		A kinase (PRKA) anchor protein 3							94.0	94.0	94.0					12																	4737445		2203	4300	6503	SO:0001583	missense	10566	0	0					g.chr12:4737445C>A	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.623G>T	chr12.hg19:g.4737445C>A	ENSP00000440994:p.Ser208Ile	0					RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.S208I	p.S208I	NM_001278309.1	NP_001265238.1	1	2	3	2.034411	O75969	AKAP3_HUMAN		5	1147	-			O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	ENST00000545990.2	0	1	hg19	c.623G>T	CCDS8531.1	0	.	.	.	.	.	.	.	.	.	.	C	4.255	0.046299	0.08243	.	.	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.10668	2.85;2.85	4.61	-1.24	0.09435	4.610000	-1.240000	0.094350	A-kinase anchor 110kDa, C-terminal (1);	0.765712	0.12130	N	0.496807	T	0.09335	0.0230	L	0.57536	1.79	0.09310	N	1	B	0.12630	0.006	B	0.12837	0.008	T	0.37663	-0.9696	10	0.87932	D	0	.	1.3901	0.02249	0.303:0.3889:0.1314:0.1767	.	208	O75969	AKAP3_HUMAN	I	208	ENSP00000228850:S208I;ENSP00000440994:S208I	ENSP00000228850:S208I	S	-	2	0	0	AKAP3	4607706	4607706	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.674000	0.05233	-0.341000	0.08376	-0.459000	0.05422	AGT	0.170616		TCGA-IB-7897-01A-21D-2201-08	0.488	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	0	0	0	2	2	2	2	0	0	0	0	106	106	106	106	1	2	-6.999037	1	0.160000	NM_006422		0	9	9	0	613	603	0		1	0		0	0	106	0	0	9.937834e-01	3.156426e-02	0	0	0	17	0	9	613
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.010000	0.250000	0.040000	0.110000	0.172109	0.110000	0.070000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.001917	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4			hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.163347		TCGA-IB-7897-01A-21D-2201-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1		0	1	2	2	2	2	0	0	0	0	20	20	20	0	1	2	-3.039667	1	0.160000	NM_033360		96	1	0	7928	173	0		1		1	1	0	0	20	255	9.986617e-01	0	9.654497e-02	7.486278e-01	5	8	37	351	1	173
LTBR	4055	broad.mit.edu	37	12	6494502	6494502	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr12:6494502G>T	ENST00000228918.4	+	4	755	c.429G>T	c.(427-429)gaG>gaT	p.E143D	LTBR_ENST00000539925.1_Missense_Mutation_p.E124D|LTBR_ENST00000541102.1_Missense_Mutation_p.E36D|LTBR_ENST00000543190.1_Missense_Mutation_p.E36D	NM_002342.2	NP_002333.1	P36941	TNR3_HUMAN	lymphotoxin beta receptor (TNFR superfamily, member 3)	143					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15						CACACTGCGAGCTACTTTCTG	0.607																																						ENST00000228918.4	1.000000	0.090000	0.440000	0.160000	0.250000	0.346511	0.250000	0.220000																										0				15						c.(427-429)gaG>gaT		lymphotoxin beta receptor (TNFR superfamily, member 3)							48.0	49.0	49.0					12																	6494502		2203	4300	6503	SO:0001583	missense	4055	0	0					g.chr12:6494502G>T	L04270	CCDS8544.1, CCDS59233.1	12p13	2013-05-22				ENSG00000111321		"""Tumor necrosis factor receptor superfamily"""	6718	protein-coding gene	gene with protein product		600979		D12S370		8171323, 8486360	Standard	NM_002342		Approved	TNFCR, TNFR-RP, TNFR2-RP, TNF-R-III, TNFRSF3	uc001qny.2	P36941		ENST00000228918.4:c.429G>T	chr12.hg19:g.6494502G>T	ENSP00000228918:p.Glu143Asp	0					LTBR_ENST00000543190.1_Missense_Mutation_p.E36D|LTBR_ENST00000539925.1_Missense_Mutation_p.E124D|LTBR_ENST00000541102.1_Missense_Mutation_p.E36D	p.E143D	NM_002342.2	NP_002333.1	1	2	3	2.034411	P36941	TNR3_HUMAN		4	755	+			B7Z1D2|D3DUR2|F5GXE7	Missense_Mutation	SNP	ENST00000228918.4	0	1	hg19	c.429G>T	CCDS8544.1	0	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303124	0.40795	.	.	ENSG00000111321	ENST00000539925;ENST00000228918;ENST00000540343;ENST00000536876;ENST00000543190;ENST00000541102	T;T;T;T;T	0.73047	0.12;0.12;0.12;-0.71;0.12	4.79	1.89	0.25635	4.790000	1.890000	0.256350	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.432883	0.23340	N	0.049255	T	0.78227	0.4250	M	0.69358	2.11	0.09310	N	0.999996	D;D;D	0.76494	0.996;0.993;0.999	D;D;D	0.76071	0.986;0.967;0.987	T	0.66913	-0.5803	9	.	.	.	-1.2798	6.5625	0.22493	0.1755:0.0:0.6788:0.1457	.	124;124;143	F5GXE7;B7Z1D2;P36941	.;.;TNR3_HUMAN	D	124;143;36;138;36;36	ENSP00000440875:E124D;ENSP00000228918:E143D;ENSP00000437647:E138D;ENSP00000438955:E36D;ENSP00000438605:E36D	.	E	+	3	2	2	LTBR	6364763	6364763	0.749000	0.28305	0.076000	0.20297	0.307000	0.27823	0.698000	0.25571	-0.127000	0.11661	-1.134000	0.01955	GAG	0.170616		TCGA-IB-7897-01A-21D-2201-08	0.607	LTBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399422.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	42	1	2	-6.478423	1	0.160000			0	6	6	0	338	326	1		1	1		0	0	45	0	0	9.613008e-01	9.671553e-01	0	44	0	306	0	6	338
CHD4	1108	broad.mit.edu	37	12	6686950	6686950	+	Splice_Site	SNP	C	C	T	rs529117126		TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr12:6686950C>T	ENST00000357008.2	-	37	5525		c.e37+1		CHD4_ENST00000544040.1_Splice_Site|CHD4_ENST00000544484.1_Splice_Site|CHD4_ENST00000309577.6_Splice_Site|RP5-940J5.6_ENST00000501075.2_RNA	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.?(3)		central_nervous_system(2)	2						CAACCGCTCACCTTAAACCTT	0.463																																					Colon(32;586 792 4568 16848 45314)	ENST00000357008.2	1.000000	0.080000	0.280000	0.120000	0.170000	0.279661	0.170000	0.170000																										3	Unknown(3)	p.?(3)	prostate(3)	2						c.e37+1		chromodomain helicase DNA binding protein 4							103.0	102.0	102.0					12																	6686950		2203	4300	6503	SO:0001630	splice_region_variant	1108	0	0					g.chr12:6686950C>T	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.5361+1G>A	chr12.hg19:g.6686950C>T		0					CHD4_ENST00000544484.1_Splice_Site|CHD4_ENST00000309577.6_Splice_Site|CHD4_ENST00000544040.1_Splice_Site|RP5-940J5.6_ENST00000501075.2_RNA		NM_001273.2	NP_001264.2	1	2	3	2.034411	Q14839	CHD4_HUMAN		37	5525	-			Q8IXZ5	Splice_Site	SNP	ENST00000357008.2	0	1	hg19		CCDS8552.1	0	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616076	0.87359	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	.	.	.	5.51	5.51	0.81932	5.510000	5.510000	0.819320	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7859	0.96437	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	CHD4	6557211	6557211	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.464000	0.80887	2.746000	0.94184	0.655000	0.94253	.	0.170616		TCGA-IB-7897-01A-21D-2201-08	0.463	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	0	2	2	2	2	0	0	0	0	122	122	122	122	1	2	-7.260967	1	0.160000	NM_001273	Intron	0	11	11	0	845	826	0		1	1	1	0	0	122	152	0	9.981142e-01	4.209928e-03	8.221828e-01	2	4	5	241	11	845
CLEC4A	50856	broad.mit.edu	37	12	8276535	8276535	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr12:8276535A>G	ENST00000229332.5	+	1	308	c.61A>G	c.(61-63)Atc>Gtc	p.I21V	CLEC4A_ENST00000345999.3_Missense_Mutation_p.I21V|CLEC4A_ENST00000352620.3_Missense_Mutation_p.I21V|CLEC4A_ENST00000360500.3_Missense_Mutation_p.I21V	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A	21					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)	11				Kidney(36;0.0915)		GTCCTCAGGCATCAACACAGC	0.418																																						ENST00000229332.5	1.000000	0.100000	0.410000	0.160000	0.240000	0.340927	0.240000	0.220000																										0				11						c.(61-63)Atc>Gtc		C-type lectin domain family 4, member A							92.0	80.0	84.0					12																	8276535		2203	4300	6503	SO:0001583	missense	50856	2	121412	35				g.chr12:8276535A>G	AJ133532	CCDS8590.1, CCDS8591.1, CCDS8592.1, CCDS41745.1	12p13	2005-02-09	2005-02-09	2005-02-09	ENSG00000111729	ENSG00000111729		"""C-type lectin domain containing"""	13257	protein-coding gene	gene with protein product		605306	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6"""	CLECSF6		10438934	Standard	NM_016184		Approved	DCIR, DDB27	uc001qtz.1	Q9UMR7	OTTHUMG00000168571	ENST00000229332.5:c.61A>G	chr12.hg19:g.8276535A>G	ENSP00000229332:p.Ile21Val	0					CLEC4A_ENST00000345999.3_Missense_Mutation_p.I21V|CLEC4A_ENST00000352620.3_Missense_Mutation_p.I21V|CLEC4A_ENST00000360500.3_Missense_Mutation_p.I21V	p.I21V	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	1	2	3	2.034411	Q9UMR7	CLC4A_HUMAN		1	308	+			Q17R69|Q8WXW9|Q9H2Z9|Q9NS33|Q9UI34	Missense_Mutation	SNP	ENST00000229332.5	0	1	hg19	c.61A>G	CCDS8590.1	0	.	.	.	.	.	.	.	.	.	.	A	5.547	0.285885	0.10513	.	.	ENSG00000111729	ENST00000229332;ENST00000345999;ENST00000352620;ENST00000360500;ENST00000546339	T;T;T;T;T	0.44083	5.49;5.5;5.33;5.33;0.93	4.07	-0.299	0.12808	4.070000	-0.299000	0.128080	.	.	.	.	.	T	0.26882	0.0658	L	0.43152	1.355	0.09310	N	1	B;B;B;P	0.36990	0.32;0.048;0.32;0.577	B;B;B;B	0.31442	0.058;0.024;0.129;0.13	T	0.11842	-1.0571	9	0.27785	T	0.31	.	5.5206	0.16931	0.5456:0.3515:0.1029:0.0	.	21;21;21;21	Q9UMR7-3;Q9UMR7-4;Q9UMR7-2;Q9UMR7	.;.;.;CLC4A_HUMAN	V	21;21;21;21;10	ENSP00000229332:I21V;ENSP00000344646:I21V;ENSP00000247243:I21V;ENSP00000353690:I21V;ENSP00000443082:I10V	ENSP00000229332:I21V	I	+	1	0	0	CLEC4A	8167802	8167802	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.061000	0.11693	-0.051000	0.13334	0.528000	0.53228	ATC	0.170616		TCGA-IB-7897-01A-21D-2201-08	0.418	CLEC4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400257.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	2	-7.503095	1	0.160000	NM_194450		0	8	7	0	448	442	0		1	0		0	0	58	0	0	9.888124e-01	2.581110e-01	0	0	0	50	0	8	448
LRP1	4035	broad.mit.edu	37	12	57587450	57587450	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr12:57587450G>A	ENST00000243077.3	+	47	8252	c.7786G>A	c.(7786-7788)Gac>Aac	p.D2596N	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2596	LDL-receptor class A 12. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGATGGCTCTGACGAGATCCC	0.622																																						ENST00000243077.3	1.000000	0.220000	1.000000	0.300000	0.420000	0.517308	0.420000	0.370000																										0				184						c.(7786-7788)Gac>Aac		low density lipoprotein receptor-related protein 1	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						94.0	84.0	87.0					12																	57587450		2203	4300	6503	SO:0001583	missense	4035	0	0					g.chr12:57587450G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7786G>A	chr12.hg19:g.57587450G>A	ENSP00000243077:p.Asp2596Asn	0					MIR1228_ENST00000408438.1_RNA	p.D2596N	NM_002332.2	NP_002323.2	1	2	3	2.048807	Q07954	LRP1_HUMAN		47	8252	+			Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	1	1	hg19	c.7786G>A	CCDS8932.1	0	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529304	0.44969	.	.	ENSG00000123384	ENST00000243077	D	0.99214	-5.57	5.01	4.1	0.47936	5.010000	4.100000	0.479360	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.99594	0.9853	H	0.97214	3.96	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.97659	1.0159	10	0.59425	D	0.04	.	12.9517	0.58405	0.0821:0.0:0.9179:0.0	.	2596	Q07954	LRP1_HUMAN	N	2596	ENSP00000243077:D2596N	ENSP00000243077:D2596N	D	+	1	0	0	LRP1	55873717	55873717	1.000000	0.71417	0.100000	0.21137	0.069000	0.16628	7.767000	0.85331	2.606000	0.88127	0.655000	0.94253	GAC	0.177760		TCGA-IB-7897-01A-21D-2201-08	0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	0	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	2	-12.209560	1	0.160000	NM_002332		0	13	12	0	422	413	0		1	1		0	0	56	0	0	9.994651e-01	9.998884e-01	0	3	0	531	0	13	422
NALCN	259232	broad.mit.edu	37	13	101755619	101755619	+	Silent	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr13:101755619G>A	ENST00000251127.6	-	26	3042	c.2961C>T	c.(2959-2961)gtC>gtT	p.V987V		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	987					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGCACCGAAGGACCATTAGAA	0.443																																						ENST00000251127.6	0.440000	0.150000	0.370000	0.210000	0.280000	0.293889	0.280000	0.270000																										0				177						c.(2959-2961)gtC>gtT		sodium leak channel, non-selective							91.0	89.0	90.0					13																	101755619		2203	4300	6503	SO:0001819	synonymous_variant	259232	0	0					g.chr13:101755619G>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2961C>T	chr13.hg19:g.101755619G>A		0						p.V987V	NM_052867.2	NP_443099.1	0	1	1	1.998708	Q8IZF0	NALCN_HUMAN		26	3042	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	ENST00000251127.6	1	1	hg19	c.2961C>T	CCDS9498.1	0																																																																																								0.156627		TCGA-IB-7897-01A-21D-2201-08	0.443	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	0	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	2	-3.390712	1	0.160000	NM_052867		0	14	14	0	614	599	0		1	0		0	0	84	0	0	9.997110e-01	1.058279e-01	0	0	0	23	0	14	614
KLHDC4	54758	broad.mit.edu	37	16	87790046	87790046	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr16:87790046C>A	ENST00000270583.5	-	3	287	c.229G>T	c.(229-231)Gag>Tag	p.E77*	KLHDC4_ENST00000347925.5_Nonsense_Mutation_p.E77*|KLHDC4_ENST00000353170.5_Intron	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	77										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		AGGATTAACTCATCTTTCTCA	0.438																																						ENST00000270583.5	1.000000	0.120000	0.450000	0.190000	0.290000	0.349561	0.290000	0.270000																										0				21						c.(229-231)Gag>Tag		kelch domain containing 4							68.0	66.0	66.0					16																	87790046		2198	4300	6498	SO:0001587	stop_gained	54758	0	0					g.chr16:87790046C>A	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.229G>T	chr16.hg19:g.87790046C>A	ENSP00000270583:p.Glu77*	0					KLHDC4_ENST00000353170.5_Intron|KLHDC4_ENST00000347925.5_Nonsense_Mutation_p.E77*	p.E77*	NM_017566.3	NP_060036.2	1	2	3	2.009794	Q8TBB5	KLDC4_HUMAN		3	287	-			D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Nonsense_Mutation	SNP	ENST00000270583.5	0	1	hg19	c.229G>T	CCDS10963.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.966446	0.97156	.	.	ENSG00000104731	ENST00000270583;ENST00000347925	.	.	.	5.18	5.18	0.71444	5.180000	5.180000	0.714440	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-15.5645	15.8539	0.78960	0.0:1.0:0.0:0.0	.	.	.	.	X	77	.	ENSP00000270583:E77X	E	-	1	0	0	KLHDC4	86347547	86347547	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	7.019000	0.76412	2.417000	0.82017	0.655000	0.94253	GAG	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.438	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2	-7.256089	1	0.160000	NM_017566		0	7	7	0	316	313	0		1	0		0	0	48	0	0	9.802506e-01	1.721969e-01	0	0	0	30	0	7	316
KRT26	353288	broad.mit.edu	37	17	38928255	38928255	+	Silent	SNP	C	C	T	rs376310686		TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr17:38928255C>T	ENST00000335552.4	-	1	159	c.111G>A	c.(109-111)tcG>tcA	p.S37S		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				TTCTTGCTCCCGATCCAACAC	0.557																																						ENST00000335552.4	0.250000	0.080000	0.200000	0.110000	0.150000	0.165394	0.150000	0.160000																										0				16						c.(109-111)tcG>tcA		keratin 26		C		0,4406		0,0,2203	121.0	124.0	123.0		111	-11.3	0.0	17		123	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT26	NM_181539.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		37/469	38928255	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	353288	3	121412	40				g.chr17:38928255C>T	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.111G>A	chr17.hg19:g.38928255C>T		0						p.S37S	NM_181539.4	NP_853517.2	0	1	1	1.997116				1	159	-		Breast(137;0.00526)		Silent	SNP	ENST00000335552.4	0	1	hg19	c.111G>A	CCDS11374.1	0																																																																																								0.155949		TCGA-IB-7897-01A-21D-2201-08	0.557	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	0	0	1	2	2	2	2	0	0	0	0	166	166	166	163	1	2	-1.774740	0	0.160000	NM_181539		0	15	16	0	1181	1155	0		1			0	0	166	0	0	9.998441e-01	0	0	0	0	0	0	15	1181
VEZF1	7716	broad.mit.edu	37	17	56060697	56060697	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr17:56060697G>T	ENST00000581208.1	-	2	131	c.91C>A	c.(91-93)Ctg>Atg	p.L31M	VEZF1_ENST00000584396.1_Missense_Mutation_p.L22M	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	31					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						GCAGAGCTCAGGAGGGGCAGC	0.498																																						ENST00000581208.1	1.000000	0.100000	0.260000	0.140000	0.190000	0.247287	0.190000	0.180000																										0				10						c.(91-93)Ctg>Atg		vascular endothelial zinc finger 1							84.0	92.0	90.0					17																	56060697		2203	4299	6502	SO:0001583	missense	7716	0	0					g.chr17:56060697G>T	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.91C>A	chr17.hg19:g.56060697G>T	ENSP00000462337:p.Leu31Met	0					VEZF1_ENST00000584396.1_Missense_Mutation_p.L22M	p.L31M	NM_007146.2	NP_009077.2	1	2	3	2.009361	Q14119	VEZF1_HUMAN		2	131	-				Missense_Mutation	SNP	ENST00000581208.1	0	1	hg19	c.91C>A	CCDS32687.1	0	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741196	0.49151	.	.	ENSG00000136451	ENST00000258963	.	.	.	5.94	5.94	0.96194	5.940000	5.940000	0.961940	.	0.000000	0.85682	D	0.000000	T	0.61751	0.2372	L	0.27053	0.805	0.80722	D	1	D	0.65815	0.995	P	0.61874	0.895	T	0.63102	-0.6712	9	0.59425	D	0.04	-1.2014	13.5589	0.61777	0.0706:0.0:0.9294:0.0	.	31	Q14119	VEZF1_HUMAN	M	31	.	ENSP00000258963:L31M	L	-	1	2	2	VEZF1	53415696	53415696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.455000	0.66658	2.823000	0.97156	0.643000	0.83706	CTG	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.498	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1	0	0	1	2	2	2	2	0	0	0	0	128	128	128	129	1	2	-2.523497	1	0.160000			0	14	14	0	944	913	0		1	1		0	0	128	0	0	9.996863e-01	5.631268e-01	0	7	0	117	0	14	944
RPTOR	57521	broad.mit.edu	37	17	78914377	78914377	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr17:78914377C>A	ENST00000306801.3	+	25	3363	c.3001C>A	c.(3001-3003)Cag>Aag	p.Q1001K	CTD-2561B21.4_ENST00000576032.1_RNA|RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.Q843K	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1001					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TGTCAGGAGGCAGGCCCAGCA	0.632																																						ENST00000306801.3	1.000000	0.150000	0.730000	0.260000	0.440000	0.494581	0.440000	0.390000																										0				44						c.(3001-3003)Cag>Aag		regulatory associated protein of MTOR, complex 1							45.0	39.0	41.0					17																	78914377		2200	4299	6499	SO:0001583	missense	57521	0	0					g.chr17:78914377C>A		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3001C>A	chr17.hg19:g.78914377C>A	ENSP00000307272:p.Gln1001Lys	0					CTD-2561B21.4_ENST00000576032.1_RNA|RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.Q843K	p.Q1001K	NM_020761.2	NP_065812.1	1	2	3	2.009361	Q8N122	RPTOR_HUMAN		25	3363	+			B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	0	1	hg19	c.3001C>A	CCDS11773.1	0	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165535	0.78339	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.41758	1.01;0.99	4.8	4.8	0.61643	4.800000	4.800000	0.616430	.	0.070570	0.64402	D	0.000019	T	0.56804	0.2010	L	0.50333	1.59	0.80722	D	1	P;B	0.43578	0.811;0.111	P;B	0.57846	0.828;0.026	T	0.55173	-0.8182	10	0.42905	T	0.14	.	17.8504	0.88746	0.0:1.0:0.0:0.0	.	843;1001	F5H7J5;Q8N122	.;RPTOR_HUMAN	K	1001;843	ENSP00000307272:Q1001K;ENSP00000442479:Q843K	ENSP00000307272:Q1001K	Q	+	1	0	0	RPTOR	76528972	76528972	1.000000	0.71417	0.962000	0.40283	0.334000	0.28698	6.977000	0.76141	2.209000	0.71365	0.561000	0.74099	CAG	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.632	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	0	0	0	2	2	2	2	0	0	0	0	17	17	17	17	1	2	-7.273564	1	0.160000	NM_020761		0	4	4	0	125	123	0		1	0		0	0	17	0	0	8.878568e-01	4.948841e-01	0	0	0	45	0	4	125
UQCR11	10975	broad.mit.edu	37	19	1605381	1605381	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr19:1605381A>G	ENST00000591899.3	-	1	99	c.28T>C	c.(28-30)Tac>Cac	p.Y10H	UQCR11_ENST00000593029.1_5'UTR|UQCR11_ENST00000585937.1_Missense_Mutation_p.Y10H|UQCR11_ENST00000589880.1_Missense_Mutation_p.Y10H|UQCR11_ENST00000585671.1_Missense_Mutation_p.Y10H	NM_006830.3	NP_006821.1	O14957	QCR10_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit XI	10					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	electron carrier activity (GO:0009055)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|lung(2)|ovary(1)|prostate(1)	5						AGCTCCCGGTAGCGTGGGCCC	0.731																																						ENST00000591899.3	1.000000	0.170000	1.000000	0.340000	0.600000	0.632819	0.600000	1.000000																										0				5						c.(28-30)Tac>Cac		ubiquinol-cytochrome c reductase, complex III subunit XI							20.0	20.0	20.0					19																	1605381		2192	4287	6479	SO:0001583	missense	10975	0	0					g.chr19:1605381A>G	D55636	CCDS12073.1	19p13.3	2011-07-04	2010-01-26	2010-01-26	ENSG00000127540	ENSG00000127540		"""Mitochondrial respiratory chain complex / Complex III"""	30862	protein-coding gene	gene with protein product	"""complex III subunit 10"""	609711	"""ubiquinol-cytochrome c reductase, 6.4kDa subunit"""	UQCR		9161705	Standard	NM_006830		Approved	QCR10	uc002ltm.3	O14957		ENST00000591899.3:c.28T>C	chr19.hg19:g.1605381A>G	ENSP00000467262:p.Tyr10His	0					UQCR11_ENST00000593029.1_5'UTR|UQCR11_ENST00000585937.1_Missense_Mutation_p.Y10H|UQCR11_ENST00000585671.1_Missense_Mutation_p.Y10H|UQCR11_ENST00000589880.1_Missense_Mutation_p.Y10H	p.Y10H	NM_006830.3	NP_006821.1	1	2	3	2.019232	O14957	QCR10_HUMAN		1	99	-			B2R542|D6W5Z4|Q9UEA3|Q9UPK4	Missense_Mutation	SNP	ENST00000591899.3	0	1	hg19	c.28T>C	CCDS12073.1	0	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083359	0.55861	.	.	ENSG00000127540	ENST00000262946	.	.	.	4.76	4.76	0.60689	4.760000	4.760000	0.606890	.	0.169791	0.39083	N	0.001465	T	0.62539	0.2436	.	.	.	0.32763	N	0.504898	D	0.59767	0.986	P	0.60541	0.876	T	0.68903	-0.5286	8	0.28530	T	0.3	-13.3155	12.1352	0.53966	1.0:0.0:0.0:0.0	.	10	O14957	QCR10_HUMAN	H	10	.	ENSP00000262946:Y10H	Y	-	1	0	0	UQCR11	1556381	1556381	0.990000	0.36364	0.970000	0.41538	0.042000	0.13812	4.876000	0.63079	2.002000	0.58637	0.533000	0.62120	TAC	0.167328		TCGA-IB-7897-01A-21D-2201-08	0.731	UQCR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449668.3	0	0	0	2	2	2	2	0	0	0	0	11	11	11	11	1	2	-6.985544	1	0.160000	NM_006830		0	3	2	0	71	68	0		1	0		0	0	11	0	0	7.945735e-01	7.061626e-01	0	0	0	55	0	3	71
MAP1S	55201	broad.mit.edu	37	19	17838243	17838243	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr19:17838243G>A	ENST00000324096.4	+	5	2201	c.2050G>A	c.(2050-2052)Gca>Aca	p.A684T	MAP1S_ENST00000544059.2_Missense_Mutation_p.A658T|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000597681.1_3'UTR	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	684	Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the microtubule-organizing center localization.|Pro-rich.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CTCACTACCCGCAGAGGTGGG	0.711																																						ENST00000324096.4	1.000000	0.190000	1.000000	0.370000	0.670000	0.679057	0.670000	1.000000																										0				25						c.(2050-2052)Gca>Aca		microtubule-associated protein 1S							15.0	13.0	14.0					19																	17838243		2179	4287	6466	SO:0001583	missense	55201	0	0					g.chr19:17838243G>A	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2050G>A	chr19.hg19:g.17838243G>A	ENSP00000325313:p.Ala684Thr	0					CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.A658T|MAP1S_ENST00000597681.1_3'UTR	p.A684T	NM_018174.4	NP_060644.4	1	2	3	2.019232	Q66K74	MAP1S_HUMAN		5	2201	+			B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	0	1	hg19	c.2050G>A	CCDS32954.1	0	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120183	0.56613	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.24350	1.86;1.87	4.16	3.11	0.35812	4.160000	3.110000	0.358120	.	0.000000	0.49916	D	0.000137	T	0.43344	0.1243	L	0.61218	1.895	0.30145	N	0.80357	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.975	T	0.38779	-0.9645	10	0.46703	T	0.11	-18.582	10.0188	0.42031	0.1039:0.0:0.8961:0.0	.	658;684	B4DH53;Q66K74	.;MAP1S_HUMAN	T	684;658	ENSP00000325313:A684T;ENSP00000439243:A658T	ENSP00000325313:A684T	A	+	1	0	0	MAP1S	17699243	17699243	1.000000	0.71417	0.007000	0.13788	0.236000	0.25371	7.147000	0.77382	0.855000	0.35359	0.484000	0.47621	GCA	0.167328		TCGA-IB-7897-01A-21D-2201-08	0.711	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	0	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	2	-6.837779	1	0.160000	NM_018174		0	3	3	0	63	63	0		1	0		0	0	12	0	0	8.125546e-01	2.246807e-01	0	0	0	15	0	3	63
FCGBP	8857	broad.mit.edu	37	19	40398010	40398010	+	Silent	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr19:40398010G>A	ENST00000221347.6	-	14	6964	c.6957C>T	c.(6955-6957)gcC>gcT	p.A2319A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2319						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGGCCCCAGCGGCCTGACAGG	0.652																																						ENST00000221347.6	1.000000	0.320000	0.800000	0.430000	0.580000	0.618611	0.580000	0.550000																										0				165						c.(6955-6957)gcC>gcT		Fc fragment of IgG binding protein							37.0	38.0	38.0					19																	40398010		2102	3822	5924	SO:0001819	synonymous_variant	8857	3	111138	32				g.chr19:40398010G>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.6957C>T	chr19.hg19:g.40398010G>A		0						p.A2319A	NM_003890.2	NP_003881.2	1	2	3	2.019232	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)	14	6964	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		O95784	Silent	SNP	ENST00000221347.6	0	1	hg19	c.6957C>T	CCDS12546.1	0																																																																																								0.167328		TCGA-IB-7897-01A-21D-2201-08	0.652	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	0	0	1	2	2	2	2	0	0	0	0	44	44	44	70	1	2	-15.308550	1	0.160000	NM_003890		0	14	13	0	304	280	0		1			0	0	44	0	0	9.995947e-01	0	0	0	0	0	0	14	304
FEM1A	55527	broad.mit.edu	37	19	4793864	4793864	+	Silent	SNP	C	C	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr19:4793864C>A	ENST00000269856.3	+	1	2137	c.1998C>A	c.(1996-1998)atC>atA	p.I666I	AC005523.2_ENST00000596170.1_RNA|AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000601192.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	666					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		AGGCGTTCATCGAACTGCACT	0.592																																						ENST00000269856.3	1.000000	0.130000	0.870000	0.270000	0.480000	0.537298	0.480000	1.000000																										0				17						c.(1996-1998)atC>atA		fem-1 homolog a (C. elegans)							16.0	15.0	15.0					19																	4793864		2202	4297	6499	SO:0001819	synonymous_variant	55527	0	0					g.chr19:4793864C>A	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1998C>A	chr19.hg19:g.4793864C>A		0					AC005523.2_ENST00000596170.1_RNA|AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000601192.1_RNA	p.I666I	NM_018708.2	NP_061178.1	1	2	3	2.019232	Q9BSK4	FEM1A_HUMAN		1	2137	+		Hepatocellular(1079;0.137)	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	0	1	hg19	c.1998C>A	CCDS12135.1	0																																																																																								0.167328		TCGA-IB-7897-01A-21D-2201-08	0.592	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1	0	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	2	-6.428781	1	0.160000			0	3	3	0	91	88	0		1	0		0	0	17	0	0	8.021710e-01	7.911232e-01	0	0	0	88	0	3	91
PNMAL2	57469	broad.mit.edu	37	19	46998201	46998201	+	Silent	SNP	G	G	C			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr19:46998201G>C	ENST00000377655.2	-	1	521	c.522C>G	c.(520-522)acC>acG	p.T174T	PNMAL2_ENST00000594749.1_Intron|AC011484.1_ENST00000377652.3_Missense_Mutation_p.W104C|PNMAL2_ENST00000599531.1_Silent_p.T174T			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2	174	Arg-rich.									central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TGCCCTTCTGGGTCAACCTGT	0.647																																						ENST00000377655.2	1.000000	0.090000	0.300000	0.140000	0.200000	0.279209	0.200000	0.190000																										0				8						c.(520-522)acC>acG		paraneoplastic Ma antigen family-like 2							69.0	68.0	69.0					19																	46998201		2203	4300	6503	SO:0001819	synonymous_variant	57469	0	0					g.chr19:46998201G>C	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.522C>G	chr19.hg19:g.46998201G>C		0					PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_Silent_p.T174T|AC011484.1_ENST00000377652.3_Missense_Mutation_p.W104C	p.T174T			1	2	3	2.019232	Q9ULN7	PNML2_HUMAN		1	521	-		Ovarian(192;0.00965)|all_neural(266;0.0459)	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Silent	SNP	ENST00000377655.2	0	1	hg19	c.522C>G		0	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229867	0.39399	.	.	ENSG00000204850	ENST00000377652	.	.	.	2.83	-0.738	0.11125	2.830000	-0.738000	0.111250	.	.	.	.	.	T	0.34658	0.0905	.	.	.	0.52501	D	0.999953	D	0.56968	0.978	B	0.42030	0.373	T	0.29701	-1.0003	7	0.87932	D	0	-1.6491	3.1252	0.06405	0.2934:0.2286:0.478:0.0	.	104	Q6ZVU4	.	C	104	.	ENSP00000366880:W104C	W	+	3	0	0	AC011484.1	51690041	51690041	0.576000	0.26700	0.626000	0.29213	0.859000	0.49053	-0.415000	0.07106	-0.071000	0.12886	-0.424000	0.05967	TGG	0.167328		TCGA-IB-7897-01A-21D-2201-08	0.647	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	134	134	134	130	1	2	-2.543759	1	0.160000	NM_020709		0	10	10	0	647	625	0		1	0		0	0	134	0	0	9.963332e-01	2.045703e-02	0	0	0	13	0	10	647
PUSL1	126789	broad.mit.edu	37	1	1244619	1244619	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:1244619G>A	ENST00000379031.5	+	3	366	c.289G>A	c.(289-291)Gcc>Acc	p.A97T	PUSL1_ENST00000470520.1_3'UTR|ACAP3_ENST00000353662.3_5'Flank|CPSF3L_ENST00000462432.1_5'Flank|ACAP3_ENST00000354700.5_5'Flank	NM_153339.1	NP_699170.1	Q8N0Z8	PUSL1_HUMAN	pseudouridylate synthase-like 1	97					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			lung(3)|skin(1)|urinary_tract(1)	5	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCTGGCCGAGGCCCTCAACAC	0.746																																						ENST00000379031.5	1.000000	0.290000	1.000000	0.560000	0.980000	0.832256	0.980000	1.000000																										0				5						c.(289-291)Gcc>Acc		pseudouridylate synthase-like 1							5.0	6.0	6.0					1																	1244619		2017	4041	6058	SO:0001583	missense	126789	0	0					g.chr1:1244619G>A	AK027721	CCDS20.1	1p36.33	2008-02-05			ENSG00000169972	ENSG00000169972			26914	protein-coding gene	gene with protein product						12477932	Standard	NM_153339		Approved	FLJ90811	uc001aed.3	Q8N0Z8	OTTHUMG00000003361	ENST00000379031.5:c.289G>A	chr1.hg19:g.1244619G>A	ENSP00000368318:p.Ala97Thr	0					PUSL1_ENST00000470520.1_3'UTR|ACAP3_ENST00000354700.5_5'Flank|CPSF3L_ENST00000462432.1_5'Flank|ACAP3_ENST00000353662.3_5'Flank	p.A97T	NM_153339.1	NP_699170.1	1	2	3	2.023424	Q8N0Z8	PUSL1_HUMAN		3	366	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	B4DP76|Q5TA41	Missense_Mutation	SNP	ENST00000379031.5	0	1	hg19	c.289G>A	CCDS20.1	1	.	.	.	.	.	.	.	.	.	.	g	16.09	3.025366	0.54683	.	.	ENSG00000169972	ENST00000379031	T	0.56275	0.47	4.63	2.5	0.30297	4.630000	2.500000	0.302970	Pseudouridine synthase I, TruA, N-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.420768	0.18516	N	0.138901	T	0.73032	0.3535	M	0.90922	3.16	0.32924	D	0.516194	D	0.63880	0.993	P	0.61070	0.883	T	0.82554	-0.0399	10	0.87932	D	0	-24.0168	12.1582	0.54089	0.0:0.2825:0.7175:0.0	.	97	Q8N0Z8	PUSL1_HUMAN	T	97	ENSP00000368318:A97T	ENSP00000368318:A97T	A	+	1	0	0	PUSL1	1234482	1234482	0.975000	0.34042	0.971000	0.41717	0.211000	0.24417	2.775000	0.47702	2.141000	0.66446	0.450000	0.29827	GCC	0.167987		TCGA-IB-7897-01A-21D-2201-08	0.746	PUSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009438.1	0	0	0	2	2	2	2	0	0	0	0	10	10	10	10	1	2	-8.098799	1	0.160000	NM_153339		0	3	2	0	40	40	0		1			0	0	10	0	0	8.051028e-01	0	0	0	0	0	0	3	40
PINK1	65018	broad.mit.edu	37	1	20975596	20975596	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:20975596T>G	ENST00000321556.4	+	7	1454	c.1360T>G	c.(1360-1362)Tac>Gac	p.Y454D	PINK1_ENST00000492302.1_3'UTR|PINK1-AS_ENST00000451424.1_RNA	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CAATCCCTTCTACGGCCAGGG	0.607																																					Esophageal Squamous(145;853 1803 8146 34412 35011)	ENST00000321556.4	1.000000	0.100000	0.460000	0.170000	0.280000	0.347252	0.280000	0.250000																										0				14						c.(1360-1362)Tac>Gac		PTEN induced putative kinase 1							69.0	61.0	64.0					1																	20975596		2203	4300	6503	SO:0001583	missense	65018	0	0					g.chr1:20975596T>G	AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.1360T>G	chr1.hg19:g.20975596T>G	ENSP00000364204:p.Tyr454Asp	0					PINK1-AS_ENST00000451424.1_RNA|PINK1_ENST00000492302.1_3'UTR	p.Y454D	NM_032409.2	NP_115785.1	1	2	3	2.013505	Q9BXM7	PINK1_HUMAN		7	1454	+		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	Q8N6T9|Q8NBU3|Q96DE4	Missense_Mutation	SNP	ENST00000321556.4	0	1	hg19	c.1360T>G	CCDS211.1	0	.	.	.	.	.	.	.	.	.	.	T	20.4	3.986271	0.74589	.	.	ENSG00000158828	ENST00000321556	T	0.64260	-0.09	6.05	6.05	0.98169	6.050000	6.050000	0.981690	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057544	0.64402	D	0.000001	T	0.72922	0.3521	L	0.45470	1.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	T	0.74225	-0.3734	10	0.56958	D	0.05	-10.0039	12.9918	0.58622	0.0:0.0:0.0:1.0	.	147;454	Q9BXM7-2;Q9BXM7	.;PINK1_HUMAN	D	454	ENSP00000364204:Y454D	ENSP00000364204:Y454D	Y	+	1	0	0	PINK1	20848183	20848183	1.000000	0.71417	0.970000	0.41538	0.633000	0.38033	7.179000	0.77665	2.323000	0.78572	0.533000	0.62120	TAC	0.166005		TCGA-IB-7897-01A-21D-2201-08	0.607	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	0	0	0	2	2	2	2	0	0	0	0	43	43	43	43	1	2	-7.034824	1	0.160000	NM_032409		0	5	4	0	243	235	0		1	1		0	0	43	0	0	9.319124e-01	9.518734e-01	0	8	0	264	0	5	243
ACBD6	84320	broad.mit.edu	37	1	180461444	180461444	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:180461444A>G	ENST00000367595.3	-	3	1031	c.344T>C	c.(343-345)aTc>aCc	p.I115T		NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6	115	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.					cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						AACTACTGCGATATATTCCTG	0.358																																						ENST00000367595.3	1.000000	0.150000	0.410000	0.210000	0.290000	0.345086	0.290000	0.280000																									ACBD6/RRP15(2)	0				7						c.(343-345)aTc>aCc		acyl-CoA binding domain containing 6							113.0	115.0	114.0					1																	180461444		2203	4300	6503	SO:0001583	missense	84320	0	0					g.chr1:180461444A>G	BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.344T>C	chr1.hg19:g.180461444A>G	ENSP00000356567:p.Ile115Thr	0						p.I115T	NM_032360.3	NP_115736.1	1	2	3	2.009767	Q9BR61	ACBD6_HUMAN		3	1031	-				Missense_Mutation	SNP	ENST00000367595.3	1	1	hg19	c.344T>C	CCDS1339.1	0	.	.	.	.	.	.	.	.	.	.	A	18.53	3.645038	0.67358	.	.	ENSG00000135847	ENST00000367595	T	0.33654	1.4	5.05	5.05	0.67936	5.050000	5.050000	0.679360	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	0.228453	0.45126	D	0.000387	T	0.54159	0.1841	M	0.78223	2.4	0.49915	D	0.999832	B	0.28026	0.198	P	0.45712	0.491	T	0.57533	-0.7795	10	0.51188	T	0.08	-8.125	13.7956	0.63168	1.0:0.0:0.0:0.0	.	115	Q9BR61	ACBD6_HUMAN	T	115	ENSP00000356567:I115T	ENSP00000356567:I115T	I	-	2	0	0	ACBD6	178728067	178728067	1.000000	0.71417	0.961000	0.40146	0.726000	0.41606	6.617000	0.74210	1.903000	0.55091	0.528000	0.53228	ATC	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.358	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084998.1	0	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	2	-9.696806	1	0.160000	NM_032360		0	11	10	0	485	467	0		1	1		0	0	51	0	0	9.979724e-01	8.257995e-01	0	8	0	135	0	11	485
SLC35F3	148641	broad.mit.edu	37	1	234454518	234454518	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:234454518G>A	ENST00000366617.3	+	5	997	c.769G>A	c.(769-771)Ggc>Agc	p.G257S	SLC35F3_ENST00000366618.3_Missense_Mutation_p.G326S			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	257					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GCTCCTCCTGGGCAGTGCTAA	0.468																																						ENST00000366617.3	1.000000	0.100000	0.260000	0.140000	0.180000	0.245936	0.180000	0.180000																										0				32						c.(769-771)Ggc>Agc		solute carrier family 35, member F3							174.0	168.0	170.0					1																	234454518		2203	4300	6503	SO:0001583	missense	148641	0	0					g.chr1:234454518G>A		CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.769G>A	chr1.hg19:g.234454518G>A	ENSP00000355576:p.Gly257Ser	0					SLC35F3_ENST00000366618.3_Missense_Mutation_p.G326S	p.G257S			1	2	3	2.009767	Q8IY50	S35F3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00531)	5	997	+	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	0	1	hg19	c.769G>A		0	.	.	.	.	.	.	.	.	.	.	G	36	5.759291	0.96898	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.73469	-0.75;-0.75	5.71	5.71	0.89125	5.710000	5.710000	0.891250	.	0.000000	0.85682	D	0.000000	D	0.87736	0.6252	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.86546	0.1831	10	0.40728	T	0.16	-24.7144	19.8559	0.96758	0.0:0.0:1.0:0.0	.	257;326	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	S	326;257	ENSP00000355577:G326S;ENSP00000355576:G257S	ENSP00000355576:G257S	G	+	1	0	0	SLC35F3	232521141	232521141	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.693000	0.91896	0.655000	0.94253	GGC	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.468	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	0	0	1	2	2	2	2	0	0	0	0	141	141	141	139	1	2	-2.240007	0	0.160000	NM_173508		0	15	15	0	1015	991	0		1	0		0	0	141	0	0	9.998431e-01	1.045027e-01	0	0	0	35	0	15	1015
PHACTR4	65979	broad.mit.edu	37	1	28807088	28807088	+	Silent	SNP	C	C	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:28807088C>A	ENST00000373839.3	+	9	1993	c.1732C>A	c.(1732-1734)Cgg>Agg	p.R578R	PHACTR4_ENST00000493669.1_3'UTR|RNU6ATAC27P_ENST00000408289.1_RNA|PHACTR4_ENST00000373836.3_Silent_p.R588R	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	578					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GAATGAAATACGGCACCAGAT	0.428																																						ENST00000373839.3	1.000000	0.180000	0.340000	0.220000	0.270000	0.324927	0.270000	0.270000																										0				32						c.(1732-1734)Cgg>Agg		phosphatase and actin regulator 4							225.0	207.0	213.0					1																	28807088		2001	4171	6172	SO:0001819	synonymous_variant	65979	0	0					g.chr1:28807088C>A	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1732C>A	chr1.hg19:g.28807088C>A		0					PHACTR4_ENST00000373836.3_Silent_p.R588R|PHACTR4_ENST00000493669.1_3'UTR|RNU6ATAC27P_ENST00000408289.1_RNA	p.R578R	NM_001048183.1	NP_001041648.1	1	2	3	2.008535	Q8IZ21	PHAR4_HUMAN		9	1993	+		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Silent	SNP	ENST00000373839.3	1	1	hg19	c.1732C>A	CCDS41293.1	0																																																																																								0.165342		TCGA-IB-7897-01A-21D-2201-08	0.428	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	0	0	1	2	2	2	2	0	0	0	0	202	202	202	201	1	2	-2.237376	0	0.160000	NM_023923		0	29	28	0	1319	1287	0		1	1		0	0	202	0	0	1	5.938299e-01	0	6	0	85	0	29	1319
CYB5RL	606495	broad.mit.edu	37	1	54640404	54640404	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:54640404C>T	ENST00000534324.1	-	6	835	c.836G>A	c.(835-837)tGc>tAc	p.C279Y	CYB5RL_ENST00000401046.3_Missense_Mutation_p.C131Y|RP11-446E24.4_ENST00000525949.1_5'Flank|CYB5RL_ENST00000537208.1_Missense_Mutation_p.C211Y|CYB5RL_ENST00000542737.1_Missense_Mutation_p.C279Y|AL357673.1_ENST00000536061.1_5'Flank|RP11-446E24.4_ENST00000311841.7_Intron|CYB5RL_ENST00000287899.8_Missense_Mutation_p.C211Y|CYB5RL_ENST00000419823.2_Missense_Mutation_p.C279Y			Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	279							cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|urinary_tract(1)	8						TCTCCGACAGCAGCTGACCAG	0.552																																						ENST00000534324.1	1.000000	0.200000	0.650000	0.300000	0.440000	0.489363	0.440000	0.410000																										0				8						c.(835-837)tGc>tAc		cytochrome b5 reductase-like							43.0	45.0	44.0					1																	54640404		1937	4156	6093	SO:0001583	missense	606495	0	0					g.chr1:54640404C>T		CCDS44151.1	1p32.3	2011-04-08			ENSG00000215883	ENSG00000215883			32220	protein-coding gene	gene with protein product						12477932	Standard	NM_001031672		Approved	LOC606495	uc009vzo.3	Q6IPT4	OTTHUMG00000008082	ENST00000534324.1:c.836G>A	chr1.hg19:g.54640404C>T	ENSP00000434343:p.Cys279Tyr	0					RP11-446E24.4_ENST00000311841.7_Intron|CYB5RL_ENST00000419823.2_Missense_Mutation_p.C279Y|CYB5RL_ENST00000401046.3_Missense_Mutation_p.C131Y|CYB5RL_ENST00000542737.1_Missense_Mutation_p.C279Y|AL357673.1_ENST00000536061.1_5'Flank|CYB5RL_ENST00000287899.8_Missense_Mutation_p.C211Y|CYB5RL_ENST00000537208.1_Missense_Mutation_p.C211Y|RP11-446E24.4_ENST00000525949.1_5'Flank	p.C279Y			1	2	3	2.008535	Q6IPT4	NB5R5_HUMAN		6	835	-			B7ZBS4|Q8NF25	Missense_Mutation	SNP	ENST00000534324.1	1	1	hg19	c.836G>A	CCDS44151.1	0	.	.	.	.	.	.	.	.	.	.	C	7.486	0.649652	0.14516	.	.	ENSG00000215883	ENST00000419823;ENST00000401046;ENST00000534324;ENST00000287899;ENST00000542737;ENST00000537208	D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-1.9;-2.04;-1.9	5.14	3.21	0.36854	5.140000	3.210000	0.368540	Oxidoreductase FAD/NAD(P)-binding (1);	0.413252	0.17337	U	0.177898	T	0.77356	0.4118	L	0.36672	1.1	0.24354	N	0.994901	B;B	0.22414	0.069;0.001	B;B	0.28553	0.091;0.001	T	0.64219	-0.6459	10	0.32370	T	0.25	-19.4038	7.8496	0.29446	0.0:0.2439:0.6084:0.1477	.	279;131	Q6IPT4;Q6IPT4-3	NB5R5_HUMAN;.	Y	279;131;279;211;279;211	ENSP00000409075:C279Y;ENSP00000383825:C131Y;ENSP00000434343:C279Y;ENSP00000287899:C211Y;ENSP00000438151:C279Y;ENSP00000443797:C211Y	ENSP00000287899:C211Y	C	-	2	0	0	CYB5RL	54412992	54412992	0.984000	0.35163	0.465000	0.27155	0.376000	0.30014	2.109000	0.41863	0.696000	0.31696	0.555000	0.69702	TGC	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.552	CYB5RL-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388318.1	0	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	2	-9.592363	1	0.160000	NM_001031672		0	8	7	0	234	222	0		1	0		0	0	38	0	0	9.871359e-01	6.308051e-02	0	0	0	11	0	8	234
GREM2	64388	broad.mit.edu	37	1	240656720	240656720	+	Missense_Mutation	SNP	G	G	A	rs200521974		TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr1:240656720G>A	ENST00000318160.4	-	2	322	c.56C>T	c.(55-57)gCg>gTg	p.A19V		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	19					BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CCGGGCTTCCGCCACCTTCAC	0.612																																						ENST00000318160.4	1.000000	0.240000	0.810000	0.360000	0.540000	0.581787	0.540000	1.000000																										0				10						c.(55-57)gCg>gTg		gremlin 2, DAN family BMP antagonist							10.0	12.0	12.0					1																	240656720		2175	4253	6428	SO:0001583	missense	64388	22	121222	41				g.chr1:240656720G>A	AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.56C>T	chr1.hg19:g.240656720G>A	ENSP00000318650:p.Ala19Val	0						p.A19V	NM_022469.3	NP_071914.3	1	2	3	2.009767	Q9H772	GREM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0123)	2	322	-		all_cancers(173;0.0196)	Q86UD9	Missense_Mutation	SNP	ENST00000318160.4	0	1	hg19	c.56C>T	CCDS31070.1	0	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361699	0.61403	.	.	ENSG00000180875	ENST00000318160	T	0.32753	1.44	5.15	3.22	0.36961	5.150000	3.220000	0.369610	.	0.235752	0.35378	U	0.003251	T	0.22205	0.0535	L	0.38175	1.15	0.40552	D	0.981126	B	0.27971	0.196	B	0.16722	0.016	T	0.04708	-1.0932	10	0.48119	T	0.1	-3.9963	10.411	0.44294	0.0:0.1461:0.7017:0.1522	.	19	Q9H772	GREM2_HUMAN	V	19	ENSP00000318650:A19V	ENSP00000318650:A19V	A	-	2	0	0	GREM2	238723343	238723343	0.411000	0.25384	0.818000	0.32626	0.995000	0.86356	3.465000	0.53064	0.524000	0.28502	0.557000	0.71058	GCG	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.612	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096286.1	0	0	0	2	2	2	2	0	0	0	0	27	27	27	25	1	2	-9.404836	1	0.160000	NM_022469		0	7	5	0	167	148	0		1	0		0	0	27	0	0	9.706459e-01	4.024150e-02	0	0	0	7	0	7	167
TMPRSS3	64699	broad.mit.edu	37	21	43796648	43796648	+	Splice_Site	SNP	A	A	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr21:43796648A>T	ENST00000291532.3	-	11	2150		c.e11+1		TMPRSS3_ENST00000433957.2_Splice_Site|TMPRSS3_ENST00000380399.1_Splice_Site|TMPRSS3_ENST00000398405.1_Splice_Site|TMPRSS3_ENST00000474596.1_Splice_Site	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3						cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						GCGGCCCCGTACCTGGCAGCT	0.622											OREG0031642	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										ENST00000291532.3	0.440000	0.120000	0.340000	0.170000	0.250000	0.266331	0.250000	0.240000																										0				13						c.e11+1		transmembrane protease, serine 3							68.0	59.0	62.0					21																	43796648		2203	4300	6503	SO:0001630	splice_region_variant	64699	0	0					g.chr21:43796648A>T	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.1194+1T>A	chr21.hg19:g.43796648A>T		0		OREG0031642	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	919	TMPRSS3_ENST00000474596.1_Splice_Site|TMPRSS3_ENST00000380399.1_Splice_Site|TMPRSS3_ENST00000433957.2_Splice_Site|TMPRSS3_ENST00000398405.1_Splice_Site		NM_032404.2	NP_115780.1	0	1	1	1.998541	P57727	TMPS3_HUMAN		11	2150	-			D3DSJ6|Q5USC7|Q6ZMC3	Splice_Site	SNP	ENST00000291532.3	0	1	hg19		CCDS13686.1	0	.	.	.	.	.	.	.	.	.	.	A	22.7	4.329752	0.81690	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399	.	.	.	4.94	4.94	0.65067	4.940000	4.940000	0.650670	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5997	0.68432	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	TMPRSS3	42669717	42669717	1.000000	0.71417	0.945000	0.38365	0.866000	0.49608	8.554000	0.90689	1.840000	0.53500	0.482000	0.46254	.	0.156627		TCGA-IB-7897-01A-21D-2201-08	0.622	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	83	1	2	-8.500725	1	0.160000		Intron	0	9	9	0	451	438	0		1	0		0	0	84	0	0	9.934552e-01	0	0	1	0	0	0	9	451
C2orf71	388939	broad.mit.edu	37	2	29295748	29295748	+	Silent	SNP	C	C	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr2:29295748C>T	ENST00000331664.5	-	1	1379	c.1380G>A	c.(1378-1380)ggG>ggA	p.G460G		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	460					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						AGACCCCAATCCCAAAGGAAT	0.557																																						ENST00000331664.5	1.000000	0.220000	0.510000	0.290000	0.380000	0.428343	0.380000	0.360000																										0				60						c.(1378-1380)ggG>ggA		chromosome 2 open reading frame 71							83.0	87.0	85.0					2																	29295748		1992	4172	6164	SO:0001819	synonymous_variant	388939	0	0					g.chr2:29295748C>T		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1380G>A	chr2.hg19:g.29295748C>T		0						p.G460G	NM_001029883.2	NP_001025054.1	1	2	3	2.012100	A6NGG8	CB071_HUMAN		1	1379	-				Silent	SNP	ENST00000331664.5	0	1	hg19	c.1380G>A	CCDS42669.1	0																																																																																								0.166005		TCGA-IB-7897-01A-21D-2201-08	0.557	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	0	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	2	-3.452277	1	0.160000	NM_001029883		0	16	15	0	535	521	0		1			0	0	92	0	0	9.999178e-01	0	0	0	0	0	0	16	535
SCN5A	6331	broad.mit.edu	37	3	38591931	38591931	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr3:38591931C>G	ENST00000333535.4	-	28	6081	c.5932G>C	c.(5932-5934)Gac>Cac	p.D1978H	SCN5A_ENST00000413689.1_Missense_Mutation_p.D1978H|SCN5A_ENST00000449557.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000423572.2_Missense_Mutation_p.D1977H|SCN5A_ENST00000455624.2_Missense_Mutation_p.D1945H|SCN5A_ENST00000443581.1_Missense_Mutation_p.D1977H|SCN5A_ENST00000414099.2_Missense_Mutation_p.D1960H|SCN5A_ENST00000425664.1_Missense_Mutation_p.D1960H|SCN5A_ENST00000450102.2_Missense_Mutation_p.D1924H			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1978					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGACACTGTCATAGGAGGGT	0.602																																						ENST00000333535.4	0.520000	0.120000	0.400000	0.190000	0.280000	0.304120	0.280000	0.270000																										0				107						c.(5932-5934)Gac>Cac		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						42.0	47.0	45.0					3																	38591931		2022	4172	6194	SO:0001583	missense	6331	5	120936	16				g.chr3:38591931C>G	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5932G>C	chr3.hg19:g.38591931C>G	ENSP00000328968:p.Asp1978His	0					SCN5A_ENST00000450102.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000451551.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000413689.1_Missense_Mutation_p.D1978H|SCN5A_ENST00000423572.2_Missense_Mutation_p.D1977H|SCN5A_ENST00000455624.2_Missense_Mutation_p.D1945H|SCN5A_ENST00000443581.1_Missense_Mutation_p.D1977H|SCN5A_ENST00000425664.1_Missense_Mutation_p.D1960H|SCN5A_ENST00000449557.2_Missense_Mutation_p.D1924H|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000414099.2_Missense_Mutation_p.D1960H	p.D1978H			0	0	0	1.972815	Q14524	SCN5A_HUMAN		28	6081	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	0	1	hg19	c.5932G>C	CCDS46796.1	0	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565807	0.65651	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96856	-4.02;-4.03;-4.03;-4.08;-4.03;-4.02;-4.03;-4.15;-4.08;-4.08	4.95	4.95	0.65309	4.950000	4.950000	0.653090	.	0.058474	0.64402	D	0.000003	D	0.95529	0.8547	N	0.08118	0	0.54753	D	0.999986	D;D;P;D;D;D	0.89917	0.959;1.0;0.64;0.999;0.958;1.0	P;D;B;D;P;D	0.85130	0.496;0.997;0.387;0.973;0.693;0.996	D	0.97067	0.9775	10	0.62326	D	0.03	.	18.3714	0.90408	0.0:1.0:0.0:0.0	.	1924;1945;1960;1978;1977;1978	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	H	1960;1977;1978;1924;1977;1960;1978;1945;1924;1924	ENSP00000398962:D1960H;ENSP00000398266:D1977H;ENSP00000410257:D1978H;ENSP00000388797:D1924H;ENSP00000397915:D1977H;ENSP00000416634:D1960H;ENSP00000328968:D1978H;ENSP00000399524:D1945H;ENSP00000403355:D1924H;ENSP00000413996:D1924H	ENSP00000328968:D1978H	D	-	1	0	0	SCN5A	38566935	38566935	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	4.781000	0.62389	2.573000	0.86826	0.655000	0.94253	GAC	0.144951		TCGA-IB-7897-01A-21D-2201-08	0.602	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	0	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	2	-2.839138	1	0.160000	NM_198056		0	7	7	0	308	297	0		1	0		0	0	42	0	0	9.783250e-01	7.142432e-04	0	0	0	2	0	7	308
RBM6	10180	broad.mit.edu	37	3	50005374	50005374	+	Silent	SNP	A	A	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr3:50005374A>T	ENST00000266022.4	+	3	775	c.516A>T	c.(514-516)ccA>ccT	p.P172P	RBM6_ENST00000539992.1_Intron|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_Silent_p.P40P	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	172					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ATGCTCCTCCATCTGACTTCA	0.468																																						ENST00000266022.4	0.370000	0.080000	0.290000	0.130000	0.200000	0.215443	0.200000	0.190000																										0				33						c.(514-516)ccA>ccT		RNA binding motif protein 6							59.0	62.0	61.0					3																	50005374		2203	4300	6503	SO:0001819	synonymous_variant	10180	0	0					g.chr3:50005374A>T	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.516A>T	chr3.hg19:g.50005374A>T		0					RBM6_ENST00000442092.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_Silent_p.P40P	p.P172P	NM_005777.2	NP_005768.1	0	0	0	1.972815	P78332	RBM6_HUMAN		3	775	+			O60549|O75524|Q86SS3	Silent	SNP	ENST00000266022.4	0	1	hg19	c.516A>T	CCDS2809.1	0																																																																																								0.144951		TCGA-IB-7897-01A-21D-2201-08	0.468	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	2	-6.820942	1	0.160000	NM_005777		0	7	7	0	441	432	0		1	0		0	0	69	0	0	9.793298e-01	4.165537e-01	0	1	0	81	0	7	441
HERC6	55008	broad.mit.edu	37	4	89349856	89349856	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr4:89349856G>A	ENST00000264346.7	+	16	2119	c.2060G>A	c.(2059-2061)cGt>cAt	p.R687H	HERC6_ENST00000380265.5_Missense_Mutation_p.R651H	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	687					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GATGCTCTGCGTCAATTAAGT	0.388																																						ENST00000264346.7	1.000000	0.190000	1.000000	0.380000	0.670000	0.678524	0.670000	1.000000																										0				11						c.(2059-2061)cGt>cAt		HECT and RLD domain containing E3 ubiquitin protein ligase family member 6							30.0	28.0	29.0					4																	89349856		1855	4099	5954	SO:0001583	missense	55008	5	120674	36				g.chr4:89349856G>A	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.2060G>A	chr4.hg19:g.89349856G>A	ENSP00000264346:p.Arg687His	0					HERC6_ENST00000380265.5_Missense_Mutation_p.R651H	p.R687H	NM_017912.3	NP_060382.3	1	2	3	2.012271	Q8IVU3	HERC6_HUMAN		16	2119	+		Hepatocellular(203;0.114)	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	ENST00000264346.7	0	1	hg19	c.2060G>A	CCDS47098.1	0	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340412	0.24339	.	.	ENSG00000138642	ENST00000380265;ENST00000264346	T;T	0.77877	0.88;-1.13	4.25	4.25	0.50352	4.250000	4.250000	0.503520	HECT (1);	0.116551	0.34002	N	0.004344	T	0.63129	0.2485	L	0.41710	1.295	0.80722	D	1	B;B	0.31817	0.341;0.231	B;B	0.19148	0.024;0.01	T	0.60078	-0.7333	10	0.10902	T	0.67	.	12.3559	0.55176	0.0:0.0:1.0:0.0	.	651;687	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	H	651;687	ENSP00000369617:R651H;ENSP00000264346:R687H	ENSP00000264346:R687H	R	+	2	0	0	HERC6	89568879	89568879	0.046000	0.20272	0.997000	0.53966	0.863000	0.49368	0.184000	0.16939	2.356000	0.79943	0.467000	0.42956	CGT	0.166005		TCGA-IB-7897-01A-21D-2201-08	0.388	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2	0	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	2	-6.781291	1	0.160000			0	3	3	0	62	60	0		1	1		0	0	16	0	0	8.025600e-01	7.034706e-01	0	4	0	44	0	3	62
FGB	2244	broad.mit.edu	37	4	155487741	155487741	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr4:155487741C>A	ENST00000302068.4	+	3	470	c.407C>A	c.(406-408)gCt>gAt	p.A136D	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Intron	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	136					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AATGTGGAAGCTGTTTCCCAG	0.433																																					NSCLC(106;1133 1613 21870 46110 52656)	ENST00000302068.4	1.000000	0.090000	0.300000	0.140000	0.200000	0.264082	0.200000	0.190000																										0				34						c.(406-408)gCt>gAt		fibrinogen beta chain	Sucralfate(DB00364)						170.0	159.0	163.0					4																	155487741		2203	4300	6503	SO:0001583	missense	2244	0	0					g.chr4:155487741C>A		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.407C>A	chr4.hg19:g.155487741C>A	ENSP00000306099:p.Ala136Asp	0					FGB_ENST00000509493.1_Intron|FGB_ENST00000502545.1_3'UTR	p.A136D	NM_005141.4	NP_005132.2	1	2	3	2.012271	P02675	FIBB_HUMAN		3	470	+	all_hematologic(180;0.215)	Renal(120;0.0458)	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	ENST00000302068.4	0	1	hg19	c.407C>A	CCDS3786.1	0	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.403604	0.01165	.	.	ENSG00000171564	ENST00000302068;ENST00000537843	T	0.80738	-1.41	5.14	0.887	0.19200	5.140000	0.887000	0.192000	Fibrinogen, alpha/beta/gamma chain, coiled coil domain (2);	1.797860	0.02358	N	0.076577	T	0.57799	0.2078	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.53739	-0.8396	10	0.07325	T	0.83	.	9.2198	0.37370	0.4197:0.5032:0.0:0.0771	.	119;136	B4E1D3;P02675	.;FIBB_HUMAN	D	136;119	ENSP00000306099:A136D	ENSP00000306099:A136D	A	+	2	0	0	FGB	155707191	155707191	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.058000	0.11750	-0.020000	0.14032	-1.151000	0.01829	GCT	0.166005		TCGA-IB-7897-01A-21D-2201-08	0.433	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	0	0	1	2	2	2	2	0	0	0	0	100	100	100	100	1	2	-7.112338	1	0.160000	NM_005141		0	9	9	0	594	583	0		1	0		0	0	100	0	0	9.937705e-01	8.882272e-04	0	0	0	3	0	9	594
NIPBL	25836	broad.mit.edu	37	5	37044451	37044451	+	Silent	SNP	G	G	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr5:37044451G>T	ENST00000282516.8	+	35	6610	c.6111G>T	c.(6109-6111)acG>acT	p.T2037T	NIPBL_ENST00000448238.2_Silent_p.T2037T	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2037					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCTTATAGACGCAAAATGATT	0.358																																						ENST00000282516.8	1.000000	0.100000	0.530000	0.190000	0.320000	0.380321	0.320000	0.280000																										0				128						c.(6109-6111)acG>acT		Nipped-B homolog (Drosophila)							49.0	49.0	49.0					5																	37044451		2203	4299	6502	SO:0001819	synonymous_variant	25836	0	0					g.chr5:37044451G>T	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6111G>T	chr5.hg19:g.37044451G>T		0					NIPBL_ENST00000448238.2_Silent_p.T2037T	p.T2037T	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	1	2	3	2.010679	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)	35	6610	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	0	1	hg19	c.6111G>T	CCDS3920.1	0																																																																																								0.165342		TCGA-IB-7897-01A-21D-2201-08	0.358	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	0	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	2	-3.275064	1	0.160000	NM_015384		0	4	5	0	175	172	0		1	0		0	0	24	0	0	8.886388e-01	5.566914e-01	0	0	0	73	0	4	175
VARS2	57176	broad.mit.edu	37	6	30892256	30892256	+	Silent	SNP	C	C	G			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr6:30892256C>G	ENST00000321897.5	+	25	3224	c.2592C>G	c.(2590-2592)ctC>ctG	p.L864L	VARS2_ENST00000542001.1_Silent_p.L724L|VARS2_ENST00000416670.2_Silent_p.L864L|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000541562.1_Silent_p.L894L			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	864					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						CTGAAGAGCTCTGGCAGAGGC	0.706																																						ENST00000321897.5	0.490000	0.110000	0.370000	0.180000	0.260000	0.282500	0.260000	0.250000																										0				46						c.(2590-2592)ctC>ctG		valyl-tRNA synthetase 2, mitochondrial							24.0	30.0	28.0					6																	30892256		1508	2708	4216	SO:0001819	synonymous_variant	57176	0	0					g.chr6:30892256C>G	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.2592C>G	chr6.hg19:g.30892256C>G		0					VARS2_ENST00000416670.2_Silent_p.L864L|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000542001.1_Silent_p.L724L|VARS2_ENST00000541562.1_Silent_p.L894L	p.L864L			0	0	0	1.978661	Q5ST30	SYVM_HUMAN		25	3224	+			A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Silent	SNP	ENST00000321897.5	1	1	hg19	c.2592C>G	CCDS34387.1	0																																																																																								0.147727		TCGA-IB-7897-01A-21D-2201-08	0.706	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2	-7.410055	1	0.160000	NM_020442		0	7	5	0	334	312	0		1	0		0	0	48	0	0	9.752468e-01	2.354994e-02	0	0	0	10	0	7	334
HLA-DMA	3108	broad.mit.edu	37	6	32917503	32917503	+	Silent	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr6:32917503G>A	ENST00000374843.4	-	3	622	c.537C>T	c.(535-537)gtC>gtT	p.V179V	XXbac-BPG181M17.5_ENST00000429234.1_Intron|HLA-DMA_ENST00000395305.3_Silent_p.V84V|HLA-DMA_ENST00000464392.1_5'UTR|HLA-DMA_ENST00000395303.3_Silent_p.V145V	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	179	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						TGAGTCCATCGACAGCTGAGA	0.473																																						ENST00000374843.4	0.420000	0.100000	0.320000	0.150000	0.220000	0.244645	0.220000	0.220000																										0				11						c.(535-537)gtC>gtT		major histocompatibility complex, class II, DM alpha							75.0	68.0	71.0					6																	32917503		1509	2709	4218	SO:0001819	synonymous_variant	3108	0	0					g.chr6:32917503G>A		CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.537C>T	chr6.hg19:g.32917503G>A		0					HLA-DMA_ENST00000395305.3_Silent_p.V84V|XXbac-BPG181M17.5_ENST00000429234.1_Intron|HLA-DMA_ENST00000395303.3_Silent_p.V145V|HLA-DMA_ENST00000464392.1_5'UTR	p.V179V	NM_006120.3	NP_006111.2	0	1	1	1.971995	P28067	DMA_HUMAN		3	622	-			Q29639|Q29640	Silent	SNP	ENST00000374843.4	0	1	hg19	c.537C>T	CCDS4761.1	0																																																																																								0.147727		TCGA-IB-7897-01A-21D-2201-08	0.473	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076325.2	0	0	0	2	2	2	2	0	0	0	0	65	65	65	65	1	2	-6.572624	1	0.160000	NM_006120		0	7	6	0	388	382	0		1	1		0	0	65	0	0	9.795516e-01	9.967484e-01	0	14	0	595	0	7	388
DAAM2	23500	broad.mit.edu	37	6	39847105	39847105	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr6:39847105C>T	ENST00000398904.2	+	14	1879	c.1697C>T	c.(1696-1698)cCg>cTg	p.P566L	RP11-61I13.3_ENST00000607675.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.P566L|DAAM2_ENST00000274867.4_Missense_Mutation_p.P566L			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	566	FH1.|Pro-rich.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GGGGGACCCCCGACTCCCCCA	0.672																																						ENST00000398904.2	1.000000	0.130000	0.680000	0.240000	0.400000	0.463179	0.400000	0.340000																										0				49						c.(1696-1698)cCg>cTg		dishevelled associated activator of morphogenesis 2							22.0	23.0	23.0					6																	39847105		1832	4069	5901	SO:0001583	missense	23500	0	0					g.chr6:39847105C>T	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1697C>T	chr6.hg19:g.39847105C>T	ENSP00000381876:p.Pro566Leu	0					DAAM2_ENST00000274867.4_Missense_Mutation_p.P566L|RP11-61I13.3_ENST00000607675.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.P566L	p.P566L			1	2	3	2.011705	Q86T65	DAAM2_HUMAN		14	1879	+	Ovarian(28;0.0355)|Colorectal(47;0.196)		G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	0	1	hg19	c.1697C>T	CCDS56426.1	0	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918426	0.33908	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	D;D;D	0.92446	-3.04;-3.04;-3.04	4.63	4.63	0.57726	4.630000	4.630000	0.577260	Actin-binding FH2 (1);	0.000000	0.85682	D	0.000000	D	0.90143	0.6920	L	0.47716	1.5	0.80722	D	1	D;D	0.61080	0.989;0.982	P;P	0.51170	0.661;0.459	D	0.89794	0.3970	10	0.42905	T	0.14	.	17.2629	0.87075	0.0:1.0:0.0:0.0	.	566;566	G5EA45;Q86T65	.;DAAM2_HUMAN	L	566	ENSP00000274867:P566L;ENSP00000381876:P566L;ENSP00000437808:P566L	ENSP00000274867:P566L	P	+	2	0	0	DAAM2	39955083	39955083	0.999000	0.42202	0.978000	0.43139	0.008000	0.06430	4.374000	0.59543	2.383000	0.81215	0.650000	0.86243	CCG	0.166005		TCGA-IB-7897-01A-21D-2201-08	0.672	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	31	1	2	-6.605908	1	0.160000			0	4	4	0	138	130	0		1	0		0	0	33	0	0	8.773031e-01	3.325286e-02	0	0	0	8	0	4	138
FOXP2	93986	broad.mit.edu	37	7	114298280	114298280	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr7:114298280C>T	ENST00000393494.2	+	11	1705	c.1426C>T	c.(1426-1428)Cga>Tga	p.R476*	FOXP2_ENST00000403559.4_Nonsense_Mutation_p.R493*|FOXP2_ENST00000393498.2_Nonsense_Mutation_p.R455*|FOXP2_ENST00000408937.3_Nonsense_Mutation_p.R501*|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000350908.4_Nonsense_Mutation_p.R476*|FOXP2_ENST00000393491.3_Intron|FOXP2_ENST00000393489.3_Nonsense_Mutation_p.R384*			O15409	FOXP2_HUMAN	forkhead box P2	476					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						GGGAGCCATACGAAGGCGACA	0.507																																						ENST00000393494.2	1.000000	0.240000	0.570000	0.320000	0.420000	0.468378	0.420000	0.410000																										0				52						c.(1426-1428)Cga>Tga		forkhead box P2							116.0	99.0	105.0					7																	114298280		2203	4300	6503	SO:0001587	stop_gained	93986	0	0					g.chr7:114298280C>T	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1426C>T	chr7.hg19:g.114298280C>T	ENSP00000377132:p.Arg476*	0					FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000393498.2_Nonsense_Mutation_p.R455*|FOXP2_ENST00000350908.4_Nonsense_Mutation_p.R476*|FOXP2_ENST00000393491.3_Intron|FOXP2_ENST00000403559.4_Nonsense_Mutation_p.R493*|FOXP2_ENST00000408937.3_Nonsense_Mutation_p.R501*|FOXP2_ENST00000393489.3_Nonsense_Mutation_p.R384*	p.R476*			1	2	3	2.011317	O15409	FOXP2_HUMAN		11	1705	+			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Nonsense_Mutation	SNP	ENST00000393494.2	0	1	hg19	c.1426C>T	CCDS5760.1	0	.	.	.	.	.	.	.	.	.	.	C	39	7.583133	0.98371	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489	.	.	.	5.71	5.71	0.89125	5.710000	5.710000	0.891250	.	0.113270	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2245	0.98337	0.0:1.0:0.0:0.0	.	.	.	.	X	476;501;493;476;453;384	.	ENSP00000265436:R476X	R	+	1	2	2	FOXP2	114085516	114085516	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.664000	0.54525	2.861000	0.98227	0.650000	0.86243	CGA	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.507	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	0	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	2	-13.937700	1	0.160000	NM_014491		0	15	15	0	444	422	0		1	0		0	0	74	0	0	9.998203e-01	1.187377e-01	0	0	0	17	0	15	444
LRP12	29967	broad.mit.edu	37	8	105502937	105502937	+	Silent	SNP	G	G	A	rs532435409		TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr8:105502937G>A	ENST00000276654.5	-	7	2652	c.2544C>T	c.(2542-2544)aaC>aaT	p.N848N	LRP12_ENST00000424843.2_Silent_p.N829N|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	848					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CACTCGTTTCGTTTTTCAGTG	0.418																																						ENST00000276654.5	1.000000	0.140000	0.370000	0.200000	0.260000	0.320979	0.260000	0.260000																										0				48						c.(2542-2544)aaC>aaT		low density lipoprotein receptor-related protein 12							143.0	130.0	134.0					8																	105502937		2203	4300	6503	SO:0001819	synonymous_variant	29967	8	121410	41				g.chr8:105502937G>A	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2544C>T	chr8.hg19:g.105502937G>A		0					LRP12_ENST00000424843.2_Silent_p.N829N|LRP12_ENST00000518375.1_5'UTR	p.N848N	NM_013437.4	NP_038465.1	1	2	3	2.011482	Q9Y561	LRP12_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)	7	2652	-			A8K137|B4DRQ2	Silent	SNP	ENST00000276654.5	0	1	hg19	c.2544C>T	CCDS6303.1	0																																																																																								0.165342		TCGA-IB-7897-01A-21D-2201-08	0.418	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	0	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	2	-2.786688	1	0.160000	NM_013437		0	13	13	0	622	606	0		1	0		0	0	81	0	0	9.994466e-01	4.874092e-01	0	1	0	75	0	13	622
PLEC	5339	broad.mit.edu	37	8	145006714	145006714	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr8:145006714G>A	ENST00000322810.4	-	16	2411	c.2242C>T	c.(2242-2244)Cgc>Tgc	p.R748C	PLEC_ENST00000357649.2_Missense_Mutation_p.R615C|PLEC_ENST00000356346.3_Missense_Mutation_p.R597C|PLEC_ENST00000436759.2_Missense_Mutation_p.R638C|PLEC_ENST00000398774.2_Missense_Mutation_p.R579C|PLEC_ENST00000354589.3_Missense_Mutation_p.R611C|PLEC_ENST00000527096.1_Missense_Mutation_p.R634C|PLEC_ENST00000345136.3_Missense_Mutation_p.R611C|PLEC_ENST00000354958.2_Missense_Mutation_p.R589C	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	748	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.R611C(1)|p.R748C(1)|p.R638C(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GACCTGAGGCGGGCCTTGGAG	0.657																																						ENST00000322810.4	1.000000	0.110000	0.310000	0.150000	0.220000	0.276392	0.220000	0.210000																										3	Substitution - Missense(3)	p.R611C(1)|p.R748C(1)|p.R638C(1)	lung(3)	137						c.(2242-2244)Cgc>Tgc		plectin							45.0	52.0	50.0					8																	145006714		1981	4143	6124	SO:0001583	missense	5339	2	120706	33				g.chr8:145006714G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.2242C>T	chr8.hg19:g.145006714G>A	ENSP00000323856:p.Arg748Cys	0					PLEC_ENST00000436759.2_Missense_Mutation_p.R638C|PLEC_ENST00000354589.3_Missense_Mutation_p.R611C|PLEC_ENST00000527096.1_Missense_Mutation_p.R634C|PLEC_ENST00000357649.2_Missense_Mutation_p.R615C|PLEC_ENST00000354958.2_Missense_Mutation_p.R589C|PLEC_ENST00000345136.3_Missense_Mutation_p.R611C|PLEC_ENST00000356346.3_Missense_Mutation_p.R597C|PLEC_ENST00000398774.2_Missense_Mutation_p.R579C	p.R748C	NM_201380.2	NP_958782.1	1	2	3	2.011482	Q15149	PLEC_HUMAN		16	2411	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	0	1	hg19	c.2242C>T	CCDS43772.1	0	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930956	0.34096	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096;ENST00000528025	T;T;T;T;T;T;T;T;T;D	0.96334	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-3.98	4.6	3.71	0.42584	4.600000	3.710000	0.425840	.	0.000000	0.64402	U	0.000005	D	0.97838	0.9290	M	0.84773	2.715	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.85130	0.997;0.997;0.997;0.994;0.997;0.997;0.997;0.997	D	0.97902	1.0303	10	0.87932	D	0	.	11.3503	0.49583	0.0925:0.0:0.9075:0.0	.	638;597;589;748;579;611;615;611	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	C	611;615;611;579;748;589;597;638;634;655	ENSP00000344848:R611C;ENSP00000350277:R615C;ENSP00000346602:R611C;ENSP00000381756:R579C;ENSP00000323856:R748C;ENSP00000347044:R589C;ENSP00000348702:R597C;ENSP00000388180:R638C;ENSP00000434583:R634C;ENSP00000437303:R655C	ENSP00000323856:R748C	R	-	1	0	0	PLEC	145078702	145078702	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	6.203000	0.72137	2.271000	0.75665	0.453000	0.30009	CGC	0.165342		TCGA-IB-7897-01A-21D-2201-08	0.657	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	0	0	1	2	2	2	2	0	0	0	0	110	110	110	106	1	2	-2.968742	1	0.160000	NM_000445		0	11	11	0	648	623	0		1	1		0	0	110	0	0	9.979377e-01	7.092220e-01	0	13	0	132	0	11	648
ROR2	4920	broad.mit.edu	37	9	94486741	94486741	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr9:94486741C>T	ENST00000375708.3	-	9	2233	c.2035G>A	c.(2035-2037)Ggt>Agt	p.G679S	ROR2_ENST00000375715.1_Missense_Mutation_p.G539S|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	679	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						AGGACCACACCGTAGGACCAG	0.607																																						ENST00000375708.3	0.590000	0.120000	0.450000	0.200000	0.310000	0.331185	0.310000	0.280000																										0				71						c.(2035-2037)Ggt>Agt		receptor tyrosine kinase-like orphan receptor 2							75.0	61.0	65.0					9																	94486741		2203	4300	6503	SO:0001583	missense	4920	0	0					g.chr9:94486741C>T	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2035G>A	chr9.hg19:g.94486741C>T	ENSP00000364860:p.Gly679Ser	0					ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.G539S	p.G679S	NM_004560.3	NP_004551.2	0	0	0	1.962861	Q01974	ROR2_HUMAN		9	2233	-			Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	0	1	hg19	c.2035G>A	CCDS6691.1	0	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427881	0.62733	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.99150	-5.49;-5.49	4.86	4.86	0.63082	4.860000	4.860000	0.630820	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42420	D	0.000712	D	0.99471	0.9812	M	0.93638	3.44	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.75020	0.797;0.985	D	0.98372	1.0554	10	0.87932	D	0	.	18.2087	0.89863	0.0:1.0:0.0:0.0	.	679;539	Q01974;B1APY4	ROR2_HUMAN;.	S	539;679	ENSP00000364867:G539S;ENSP00000364860:G679S	ENSP00000364860:G679S	G	-	1	0	0	ROR2	93526562	93526562	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	5.842000	0.69417	2.526000	0.85167	0.561000	0.74099	GGT	0.140753		TCGA-IB-7897-01A-21D-2201-08	0.607	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1	0	0	1	2	2	2	2	0	0	0	0	47	47	47	44	1	2	-7.143834	1	0.160000			0	6	5	0	244	236	0		1	0		0	0	47	0	0	9.613594e-01	2.740425e-01	0	0	0	37	0	6	244
PTGS1	5742	broad.mit.edu	37	9	125148756	125148756	+	Silent	SNP	C	C	T	rs201795484		TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chr9:125148756C>T	ENST00000362012.2	+	9	1046	c.1041C>T	c.(1039-1041)taC>taT	p.Y347Y	PTGS1_ENST00000223423.4_Silent_p.Y347Y|PTGS1_ENST00000540753.1_Silent_p.Y322Y|PTGS1_ENST00000373698.5_Silent_p.Y238Y|AL162424.1_ENST00000600713.1_Intron	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	347					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCGAGGAGTACGTGCAGCAGC	0.527																																						ENST00000362012.2	0.360000	0.150000	0.310000	0.200000	0.240000	0.258803	0.240000	0.250000																										0				8						c.(1039-1041)taC>taT		prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)						147.0	149.0	148.0					9																	125148756		2203	4300	6503	SO:0001819	synonymous_variant	5742	2	121412	39				g.chr9:125148756C>T	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1041C>T	chr9.hg19:g.125148756C>T		0					PTGS1_ENST00000223423.4_Silent_p.Y347Y|PTGS1_ENST00000540753.1_Silent_p.Y322Y|PTGS1_ENST00000373698.5_Silent_p.Y238Y|AL162424.1_ENST00000600713.1_Intron	p.Y347Y	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	0	0	0	1.960649	P23219	PGH1_HUMAN		9	1046	+			A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Silent	SNP	ENST00000362012.2	1	1	hg19	c.1041C>T	CCDS6842.1	0																																																																																								0.139344		TCGA-IB-7897-01A-21D-2201-08	0.527	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1	0	0	1	2	2	2	2	0	0	0	0	137	137	137	136	1	2	-2.856811	1	0.160000			0	22	22	0	1054	1035	0		1	1		0	0	137	0	0	9.999983e-01	2.107155e-01	0	2	0	38	0	22	1054
MAGEA3	4102	broad.mit.edu	37	X	151935609	151935609	+	Silent	SNP	G	G	A			TCGA-IB-7897-01A-21D-2201-08	TCGA-IB-7897-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c284154-c3c3-4cd9-be15-7299b375fc83	e9687af7-9276-4f39-9f3d-5a96e305026f	g.chrX:151935609G>A	ENST00000393902.3	-	3	1125	c.558C>T	c.(556-558)taC>taT	p.Y186Y	MAGEA3_ENST00000370278.3_Silent_p.Y186Y			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	186	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GCAGGCCATCGTAGGAGAGGC	0.572																																						ENST00000393902.3	0.400000	0.190000	0.350000	0.230000	0.280000	0.295026	0.280000	0.280000																										0				15						c.(556-558)taC>taT		melanoma antigen family A, 3							103.0	102.0	102.0					X																	151935609		2202	4294	6496	SO:0001819	synonymous_variant	4102	12	121180	43				g.chrX:151935609G>A		CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.558C>T	chrX.hg19:g.151935609G>A							MAGEA3_ENST00000370278.3_Silent_p.Y186Y	p.Y186Y			0	1	1		P43357	MAGA3_HUMAN		3	1125	-	Acute lymphoblastic leukemia(192;6.56e-05)		Q6FHI6	Silent	SNP	ENST00000393902.3	1	1	hg19	c.558C>T	CCDS14715.1	0																																																																																								0.160000		TCGA-IB-7897-01A-21D-2201-08	0.572	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	0	0	1	2	2	2	2	0	0	0	0	223	223	223	223	1	2	-2.813178	1	0.160000	NM_005362		0	27	27	0	1152	1125	0		1			0	0	223	0	0	9.999999e-01	0	0	0	0	0	0	27	1152
