#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CELF2	10659	broad.mit.edu	37	10	11363283	11363283	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr10:11363283G>A	ENST00000379261.4	+	11	1281	c.1189G>A	c.(1189-1191)Gcg>Acg	p.A397T	CELF2_ENST00000427450.1_Missense_Mutation_p.A379T|CELF2-AS1_ENST00000379256.3_RNA|CELF2_ENST00000354897.3_Missense_Mutation_p.A391T|CELF2_ENST00000609692.1_Missense_Mutation_p.A377T|CELF2_ENST00000542579.1_Missense_Mutation_p.A410T|CELF2_ENST00000399850.3_Missense_Mutation_p.A379T|CELF2_ENST00000450189.1_Missense_Mutation_p.A410T|CELF2_ENST00000417956.2_Missense_Mutation_p.A377T|CELF2_ENST00000608830.1_Missense_Mutation_p.A377T|CELF2_ENST00000315874.4_Missense_Mutation_p.A379T|CELF2_ENST00000416382.2_Missense_Mutation_p.A397T|CELF2_ENST00000354440.2_Missense_Mutation_p.A379T|CELF2_ENST00000537122.1_Missense_Mutation_p.A292T	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	397	Ala-rich.|Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CGCAGCCGCCGCGCTGCCCAC	0.657																																						ENST00000379261.4	1.000000	4.600000e-01	1	6.500000e-01	0.900000	0.852733	0.900000	1.000000																										0				16						c.(1189-1191)Gcg>Acg		CUGBP, Elav-like family member 2							34.0	38.0	37.0					10																	11363283		2062	4187	6249	SO:0001583	missense	10659	7	120968	39				g.chr10:11363283G>A	U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.1189G>A	chr10.hg19:g.11363283G>A	ENSP00000368563:p.Ala397Thr	0					CELF2_ENST00000537122.1_Missense_Mutation_p.A292T|CELF2_ENST00000608830.1_Missense_Mutation_p.A377T|CELF2-AS1_ENST00000379256.3_RNA|CELF2_ENST00000417956.2_Missense_Mutation_p.A377T|CELF2_ENST00000542579.1_Missense_Mutation_p.A410T|CELF2_ENST00000609692.1_Missense_Mutation_p.A377T|CELF2_ENST00000354440.2_Missense_Mutation_p.A379T|CELF2_ENST00000315874.4_Missense_Mutation_p.A379T|CELF2_ENST00000450189.1_Missense_Mutation_p.A410T|CELF2_ENST00000416382.2_Missense_Mutation_p.A397T|CELF2_ENST00000354897.3_Missense_Mutation_p.A391T|CELF2_ENST00000399850.3_Missense_Mutation_p.A379T|CELF2_ENST00000427450.1_Missense_Mutation_p.A379T	p.A397T	NM_001025077.2	NP_001020248.1	1	2	3	1.940731	O95319	CELF2_HUMAN		11	1281	+			B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	ENST00000379261.4	1	1	hg19	c.1189G>A	CCDS44354.1	1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318107	0.81469	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450;ENST00000537122;ENST00000538632	T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.186321	0.32753	N	0.005686	T	0.79094	0.4388	M	0.62723	1.935	0.80722	D	1	P;P;B;D;P;D	0.76494	0.802;0.802;0.078;0.999;0.898;0.991	P;P;B;D;B;P	0.68621	0.471;0.471;0.029;0.959;0.378;0.776	T	0.73836	-0.3857	10	0.25106	T	0.35	-1.3418	19.2874	0.94084	0.0:0.0:1.0:0.0	.	385;403;398;410;410;397	B4DDE7;B4DS31;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;CELF2_HUMAN	T	397;397;410;410;379;377;379;379;387;379;292;203	ENSP00000368563:A397T;ENSP00000406451:A397T;ENSP00000389951:A410T;ENSP00000443926:A410T;ENSP00000382743:A379T;ENSP00000404834:A377T;ENSP00000315328:A379T;ENSP00000346426:A379T;ENSP00000388530:A379T;ENSP00000438884:A292T	ENSP00000315328:A379T	A	+	1	0	0	CELF2	11403289	11403289	1.000000	0.71417	0.344000	0.25628	0.982000	0.71751	9.591000	0.98241	2.789000	0.95967	0.558000	0.71614	GCG	0.122003		TCGA-IB-8126-01A-11D-2396-08	0.657	CELF2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	3.970000	-11.920220	1	0.090000			0	11	11	0	293	289	0		1	0		0	0	52	0	0	0.998292	1.186448e-01	0	0	0	15	0	11	293
CHAT	1103	broad.mit.edu	37	10	50827783	50827783	+	Silent	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr10:50827783C>T	ENST00000337653.2	+	3	553	c.400C>T	c.(400-402)Ctg>Ttg	p.L134L	CHAT_ENST00000351556.3_Silent_p.L16L|CHAT_ENST00000395559.2_Silent_p.L16L|CHAT_ENST00000460699.1_3'UTR|CHAT_ENST00000395562.2_Silent_p.L52L|CHAT_ENST00000339797.1_Silent_p.L16L|CHAT_ENST00000455728.2_Silent_p.L16L	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	134					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GCTGCCCAAACTGCCCGTGCC	0.577																																						ENST00000337653.2	1.000000	4.300000e-01	1	6.800000e-01	0.990000	0.880847	0.990000	1.000000																										0				56						c.(400-402)Ctg>Ttg		choline O-acetyltransferase	Choline(DB00122)|Nicotine(DB00184)						53.0	42.0	45.0					10																	50827783		2203	4300	6503	SO:0001819	synonymous_variant	1103	0	0					g.chr10:50827783C>T	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.400C>T	chr10.hg19:g.50827783C>T		0					CHAT_ENST00000460699.1_3'UTR|CHAT_ENST00000455728.2_Silent_p.L16L|CHAT_ENST00000395559.2_Silent_p.L16L|CHAT_ENST00000395562.2_Silent_p.L52L|CHAT_ENST00000339797.1_Silent_p.L16L|CHAT_ENST00000351556.3_Silent_p.L16L	p.L134L	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	1	2	3	2.016533	P28329	CLAT_HUMAN		3	553	+		all_neural(218;0.107)	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Silent	SNP	ENST00000337653.2	1	1	hg19	c.400C>T	CCDS7232.1	1																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.577	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	23	1	3.970000	-8.996124	1	0.090000	NM_020549		0	6	6	0	137	137	0		1	0		0	0	24	0	0	0.966001	0	0	0	0	1	0	6	137
KNDC1	85442	broad.mit.edu	37	10	134997481	134997481	+	Missense_Mutation	SNP	G	G	A	rs545007203		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr10:134997481G>A	ENST00000304613.3	+	5	634	c.613G>A	c.(613-615)Gga>Aga	p.G205R	KNDC1_ENST00000368572.2_Missense_Mutation_p.G205R|KNDC1_ENST00000368571.2_Missense_Mutation_p.G140R			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	205	KIND 1. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGAGTCCTTCGGAGCGCTGCA	0.582													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20334	0.0		0.0	False		,,,				2504	0.0					ENST00000304613.3	1.000000	5.400000e-01	1	7.300000e-01	0.960000	0.895549	0.960000	1.000000																										0				60						c.(613-615)Gga>Aga		kinase non-catalytic C-lobe domain (KIND) containing 1							153.0	128.0	137.0					10																	134997481		2203	4300	6503	SO:0001583	missense	85442	3	121378	34				g.chr10:134997481G>A	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.613G>A	chr10.hg19:g.134997481G>A	ENSP00000304437:p.Gly205Arg	0					KNDC1_ENST00000368572.2_Missense_Mutation_p.G205R|KNDC1_ENST00000368571.2_Missense_Mutation_p.G140R	p.G205R			1	2	3	2.008180	Q76NI1	VKIND_HUMAN		5	634	+		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	1	1	hg19	c.613G>A	CCDS7674.1	1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494056	0.64186	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.20598	2.54;2.54;2.06	4.15	4.15	0.48705	4.15	4.15	0.48705	KIND (2);	0.492334	0.17935	U	0.157032	T	0.41766	0.1173	L	0.57536	1.79	0.38641	D	0.951614	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.41520	-0.9504	10	0.87932	D	0	-17.3865	12.7092	0.57080	0.0:0.0:1.0:0.0	.	140;205	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	R	205;205;140	ENSP00000304437:G205R;ENSP00000357561:G205R;ENSP00000357560:G140R	ENSP00000304437:G205R	G	+	1	0	0	KNDC1	134847471	134847471	0.995000	0.38212	0.998000	0.56505	0.682000	0.39822	3.501000	0.53325	2.255000	0.74692	0.450000	0.29827	GGA	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.582	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	3.970000	-3.064027	1	0.090000	NM_152643		0	13	13	0	304	301	0		1	0		0	0	60	0	0	0.999532	5.966550e-03	0	0	0	3	0	13	304
OR5D18	219438	broad.mit.edu	37	11	55587727	55587727	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr11:55587727G>T	ENST00000333976.4	+	1	642	c.622G>T	c.(622-624)Gaa>Taa	p.E208*		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CACCTTTAATGAAATCAGCAC	0.448																																						ENST00000333976.4	1.000000	3.700000e-01	8.400000e-01	4.900000e-01	0.650000	0.667472	0.650000	1.000000																										0				55						c.(622-624)Gaa>Taa		olfactory receptor, family 5, subfamily D, member 18							193.0	162.0	173.0					11																	55587727		2200	4296	6496	SO:0001587	stop_gained	219438	0	0					g.chr11:55587727G>T	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.622G>T	chr11.hg19:g.55587727G>T	ENSP00000335025:p.Glu208*	0						p.E208*	NM_001001952.1	NP_001001952.1	1	2	3	1.968950	Q8NGL1	OR5DI_HUMAN		1	642	+		all_epithelial(135;0.208)	Q6IF67|Q6IFD3|Q96RB3	Nonsense_Mutation	SNP	ENST00000333976.4	0	1	hg19	c.622G>T	CCDS31510.1	0	.	.	.	.	.	.	.	.	.	.	.	10.04	1.242711	0.22796	.	.	ENSG00000186119	ENST00000333976	.	.	.	4.85	3.92	0.45320	4.85	3.92	0.45320	.	1.005710	0.08015	N	0.991100	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	0.2984	7.6562	0.28377	0.0887:0.0:0.7453:0.166	.	.	.	.	X	208	.	ENSP00000335025:E208X	E	+	1	0	0	OR5D18	55344303	55344303	0.000000	0.05858	0.891000	0.34965	0.219000	0.24729	0.634000	0.24614	2.462000	0.83206	0.567000	0.79289	GAA	0.128811		TCGA-IB-8126-01A-11D-2396-08	0.448	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	108	1	3.970000	-12.233260	1	0.090000	NM_001001952		0	14	14	0	496	491	0		1			0	0	108	0	0	0.999742	0	0	0	0	0	0	14	496
DENND5A	23258	broad.mit.edu	37	11	9225319	9225319	+	Silent	SNP	A	A	G			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr11:9225319A>G	ENST00000328194.3	-	4	1157	c.837T>C	c.(835-837)ctT>ctC	p.L279L	DENND5A_ENST00000530044.1_Silent_p.L279L	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	279	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CAAATAGGGGAAGCTCATTGG	0.498																																						ENST00000328194.3	0.460000	7.000000e-02	3.300000e-01	1.300000e-01	0.210000	0.236516	0.210000	0.200000																										0				39						c.(835-837)ctT>ctC		DENN/MADD domain containing 5A							71.0	76.0	75.0					11																	9225319		2201	4296	6497	SO:0001819	synonymous_variant	23258	0	0					g.chr11:9225319A>G	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.837T>C	chr11.hg19:g.9225319A>G		0					DENND5A_ENST00000530044.1_Silent_p.L279L	p.L279L	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	1	2	3	1.968950	Q6IQ26	DEN5A_HUMAN		4	1157	-			B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Silent	SNP	ENST00000328194.3	0	1	hg19	c.837T>C	CCDS31423.1	0																																																																																								0.128811		TCGA-IB-8126-01A-11D-2396-08	0.498	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	0	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	3.970000	-4.554739	1	0.090000	NM_015213		0	5	5	0	575	571	0		1	0		0	0	93	0	0	0.936643	9.677867e-02	0	0	0	49	0	5	575
ARAP1	116985	broad.mit.edu	37	11	72422096	72422096	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr11:72422096G>A	ENST00000393609.3	-	9	1385	c.1183C>T	c.(1183-1185)Cga>Tga	p.R395*	ARAP1_ENST00000393605.3_Nonsense_Mutation_p.R155*|ARAP1_ENST00000359373.5_Nonsense_Mutation_p.R395*|ARAP1_ENST00000426523.1_Nonsense_Mutation_p.R150*|ARAP1_ENST00000455638.2_Nonsense_Mutation_p.R395*|ARAP1_ENST00000334211.8_Nonsense_Mutation_p.R150*|ARAP1_ENST00000429686.1_Nonsense_Mutation_p.R150*	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	395	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GCAAAGGTTCGGTTGTTTGTG	0.547																																					Ovarian(102;1198 1520 13195 17913 37529)	ENST00000393609.3	1.000000	7.600000e-01	1	9.100000e-01	0.990000	0.968826	0.990000	1.000000																										0				27						c.(1183-1185)Cga>Tga		ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1							160.0	128.0	139.0					11																	72422096		2200	4293	6493	SO:0001587	stop_gained	116985	0	0					g.chr11:72422096G>A	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.1183C>T	chr11.hg19:g.72422096G>A	ENSP00000377233:p.Arg395*	0					ARAP1_ENST00000429686.1_Nonsense_Mutation_p.R150*|ARAP1_ENST00000426523.1_Nonsense_Mutation_p.R150*|ARAP1_ENST00000334211.8_Nonsense_Mutation_p.R150*|ARAP1_ENST00000393605.3_Nonsense_Mutation_p.R155*|ARAP1_ENST00000455638.2_Nonsense_Mutation_p.R395*|ARAP1_ENST00000359373.5_Nonsense_Mutation_p.R395*	p.R395*	NM_001040118.2	NP_001035207.1	1	2	3	2.014809	Q96P48	ARAP1_HUMAN		9	1385	-			A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Nonsense_Mutation	SNP	ENST00000393609.3	0	1	hg19	c.1183C>T	CCDS41687.1	1	.	.	.	.	.	.	.	.	.	.	G	45	11.461141	0.99564	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000340247	.	.	.	5.52	4.61	0.57282	5.52	4.61	0.57282	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6244	0.62155	0.0:0.0:0.8439:0.1561	.	.	.	.	X	395;395;155;150;395;150;150;184	.	ENSP00000335506:R150X	R	-	1	2	2	ARAP1	72099744	72099744	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.092000	0.50207	1.343000	0.45638	-0.152000	0.13540	CGA	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.547	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	1	0	1	2	2	2	2	0	0	0	0	98	98	98	98	1	3.970000	-2.607054	1	0.090000	NM_001040118		0	31	31	0	629	622	0		1	0		0	0	98	0	0	1.000000	7.937185e-01	0	0	0	62	0	31	629
C3AR1	719	broad.mit.edu	37	12	8211546	8211546	+	Silent	SNP	A	A	C			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr12:8211546A>C	ENST00000307637.4	-	2	1439	c.1236T>G	c.(1234-1236)acT>acG	p.T412T		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	412					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AGGACATCAGAGTTTTCCCCA	0.468																																						ENST00000307637.4	1.000000	4.100000e-01	1	5.900000e-01	0.800000	0.797415	0.800000	1.000000																										0				20						c.(1234-1236)acT>acG		complement component 3a receptor 1							87.0	80.0	83.0					12																	8211546		2203	4300	6503	SO:0001819	synonymous_variant	719	0	0					g.chr12:8211546A>C	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.1236T>G	chr12.hg19:g.8211546A>C		0						p.T412T	NM_004054.2	NP_004045.1	1	2	3	2.003616	Q16581	C3AR_HUMAN		2	1439	-			O43771|Q92868	Silent	SNP	ENST00000307637.4	1	1	hg19	c.1236T>G	CCDS8588.1	0																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.468	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	3.970000	-11.397040	1	0.090000			0	10	10	0	285	281	0		1	0		0	0	70	0	0	0.996800	5.366142e-01	0	0	0	50	0	10	285
CAPZA3	93661	broad.mit.edu	37	12	18891852	18891852	+	Missense_Mutation	SNP	A	A	G	rs374397815		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr12:18891852A>G	ENST00000317658.3	+	1	808	c.650A>G	c.(649-651)aAc>aGc	p.N217S	PLCZ1_ENST00000447925.2_5'Flank|PLCZ1_ENST00000266505.7_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000435379.1_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	217					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				GAAATAGTTAACCAAGCTCAA	0.398																																						ENST00000317658.3	1.000000	3.500000e-01	1	5.200000e-01	0.740000	0.747274	0.740000	1.000000																										0				19						c.(649-651)aAc>aGc		capping protein (actin filament) muscle Z-line, alpha 3		A	SER/ASN	0,4406		0,0,2203	64.0	66.0	65.0		650	4.8	1.0	12		65	1,8599	1.2+/-3.3	0,1,4299	no	missense	CAPZA3	NM_033328.2	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	217/300	18891852	1,13005	2203	4300	6503	SO:0001583	missense	93661	1	121406	28				g.chr12:18891852A>G	AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.650A>G	chr12.hg19:g.18891852A>G	ENSP00000326238:p.Asn217Ser	0					PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000435379.1_5'Flank|PLCZ1_ENST00000447925.2_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000266505.7_5'Flank	p.N217S	NM_033328.2	NP_201585.1	1	2	3	2.003616	Q96KX2	CAZA3_HUMAN		1	808	+	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)	Q969J0	Missense_Mutation	SNP	ENST00000317658.3	1	1	hg19	c.650A>G	CCDS8681.1	0	.	.	.	.	.	.	.	.	.	.	A	15.91	2.972165	0.53614	0.0	1.16E-4	ENSG00000177938	ENST00000317658	.	.	.	4.8	4.8	0.61643	4.8	4.8	0.61643	.	0.288858	0.31673	N	0.007253	T	0.61850	0.2380	L	0.41906	1.305	0.37992	D	0.933951	D	0.59767	0.986	P	0.58928	0.848	T	0.65158	-0.6236	9	0.40728	T	0.16	-22.2602	11.8334	0.52309	1.0:0.0:0.0:0.0	.	217	Q96KX2	CAZA3_HUMAN	S	217	.	ENSP00000326238:N217S	N	+	2	0	0	CAPZA3	18783119	18783119	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	5.478000	0.66806	2.021000	0.59480	0.379000	0.24179	AAC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.398	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	3.970000	-9.764521	1	0.090000	NM_033328		0	8	8	0	251	248	0		1	0		0	0	61	0	0	0.989175	0	0	0	0	1	0	8	251
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0	5.500000e-01	4.000000e-02	0.180000	0.287707	0.180000	0.010000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.003616	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4			hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1		0	1					0	0	0	0	25	25	25	25	1	3.970000	-2.752535	1	0.090000	NM_033360		1055	0	0	6830	80	79						0	0	25	365					0	7	15	371	0	80
KRT7	3855	broad.mit.edu	37	12	52639299	52639299	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr12:52639299G>T	ENST00000331817.5	+	7	1271	c.1088G>T	c.(1087-1089)cGg>cTg	p.R363L	RP3-416H24.1_ENST00000546686.1_RNA|KRT7_ENST00000552322.1_3'UTR	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	363	Coil 2.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	GCCCTGCAGCGGGGCAAGCAG	0.647																																						ENST00000331817.5	0.560000	1.000000e-01	4.200000e-01	1.700000e-01	0.270000	0.301673	0.270000	0.250000																										0				14						c.(1087-1089)cGg>cTg		keratin 7	Primaquine(DB01087)						47.0	48.0	48.0					12																	52639299		2203	4300	6503	SO:0001583	missense	3855	0	0					g.chr12:52639299G>T		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.1088G>T	chr12.hg19:g.52639299G>T	ENSP00000329243:p.Arg363Leu	0					RP3-416H24.1_ENST00000546686.1_RNA|KRT7_ENST00000552322.1_3'UTR	p.R363L	NM_005556.3	NP_005547.3	1	2	3	2.001934	P08729	K2C7_HUMAN		7	1271	+			Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	0	1	hg19	c.1088G>T	CCDS8822.1	0	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739868	0.30865	.	.	ENSG00000135480	ENST00000331817;ENST00000422319	D	0.89050	-2.46	4.4	1.11	0.20524	4.4	1.11	0.20524	Filament (1);	1.896280	0.03317	N	0.191374	D	0.86447	0.5935	L	0.47190	1.495	0.29184	N	0.876328	P	0.43701	0.815	B	0.40477	0.33	T	0.75634	-0.3250	10	0.87932	D	0	.	8.4518	0.32875	0.7315:0.0:0.2685:0.0	.	363	P08729	K2C7_HUMAN	L	363;339	ENSP00000329243:R363L	ENSP00000329243:R363L	R	+	2	0	0	KRT7	50925566	50925566	0.867000	0.29959	0.022000	0.16811	0.005000	0.04900	1.090000	0.30902	0.096000	0.17463	-0.258000	0.10820	CGG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.647	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	0	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	3.970000	-4.429121	1	0.090000	NM_005556		0	5	5	0	448	441	0		1	0		0	0	57	0	0	0.935277	8.057674e-01	0	0	0	271	0	5	448
HSP90B1	7184	broad.mit.edu	37	12	104327988	104327988	+	Silent	SNP	C	C	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr12:104327988C>A	ENST00000299767.5	+	5	848	c.666C>A	c.(664-666)atC>atA	p.I222I		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	222					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	CCCAGCACATCTGGGAGTCTG	0.433																																						ENST00000299767.5	1.000000	4.800000e-01	1	6.700000e-01	0.900000	0.859484	0.900000	1.000000																										0				29						c.(664-666)atC>atA		heat shock protein 90kDa beta (Grp94), member 1	Rifabutin(DB00615)						85.0	80.0	82.0					12																	104327988		2203	4300	6503	SO:0001819	synonymous_variant	7184	0	0					g.chr12:104327988C>A	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.666C>A	chr12.hg19:g.104327988C>A		0						p.I222I	NM_003299.2	NP_003290.1	1	2	3	2.001934	P14625	ENPL_HUMAN		5	848	+			Q96A97	Silent	SNP	ENST00000299767.5	1	1	hg19	c.666C>A	CCDS9094.1	1																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.433	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	55	1	3.970000	-12.315890	1	0.090000	NM_003299		0	11	11	0	277	275	0		1	1		0	0	54	0	0	0.998325	9.999966e-01	0	16	0	680	0	11	277
CCDC70	83446	broad.mit.edu	37	13	52439917	52439917	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr13:52439917T>A	ENST00000242819.4	+	2	699	c.403T>A	c.(403-405)Ttc>Atc	p.F135I		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	135						extracellular region (GO:0005576)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		GGATAAGGCCTTCTGGAAAGA	0.478																																						ENST00000242819.4	1.000000	7.800000e-01	1	9.100000e-01	0.990000	0.969733	0.990000	1.000000																										0				15						c.(403-405)Ttc>Atc		coiled-coil domain containing 70							122.0	134.0	130.0					13																	52439917		2203	4300	6503	SO:0001583	missense	83446	0	0					g.chr13:52439917T>A		CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.403T>A	chr13.hg19:g.52439917T>A	ENSP00000242819:p.Phe135Ile	0						p.F135I	NM_031290.2	NP_112580.2	1	2	3	1.946162	Q6NSX1	CCD70_HUMAN		2	699	+		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)	Q8N7A8|Q9H097	Missense_Mutation	SNP	ENST00000242819.4	1	1	hg19	c.403T>A	CCDS9431.1	1	.	.	.	.	.	.	.	.	.	.	T	12.48	1.949934	0.34377	.	.	ENSG00000123171	ENST00000242819	T	0.20738	2.05	5.78	-0.997	0.10215	5.78	-0.997	0.10215	.	0.097664	0.45606	D	0.000357	T	0.30230	0.0758	M	0.70595	2.14	0.09310	N	1	D	0.56287	0.975	P	0.53035	0.716	T	0.17077	-1.0381	10	0.42905	T	0.14	-25.4087	10.0609	0.42275	0.0:0.3629:0.0:0.6371	.	135	Q6NSX1	CCD70_HUMAN	I	135	ENSP00000242819:F135I	ENSP00000242819:F135I	F	+	1	0	0	CCDC70	51337918	51337918	0.963000	0.33076	0.000000	0.03702	0.005000	0.04900	1.723000	0.38053	-0.085000	0.12573	-0.256000	0.11100	TTC	0.123145		TCGA-IB-8126-01A-11D-2396-08	0.478	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045033.2	1	0	1	2	2	2	2	0	0	0	0	118	118	118	117	1	3.970000	-5.262018	1	0.090000	NM_031290		0	45	44	0	947	939	0		1			0	0	118	0	0	1.000000	0	0	0	0	0	0	45	947
TGM5	9333	broad.mit.edu	37	15	43527834	43527834	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr15:43527834G>A	ENST00000220420.5	-	10	1554	c.1547C>T	c.(1546-1548)cCg>cTg	p.P516L	TGM5_ENST00000349114.4_Missense_Mutation_p.P434L	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	516					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CATGTTGGGCGGGTCGAGCAG	0.567																																						ENST00000220420.5	1.000000	5.600000e-01	1	7.700000e-01	0.990000	0.918569	0.990000	1.000000																										0				44						c.(1546-1548)cCg>cTg		transglutaminase 5	L-Glutamine(DB00130)						108.0	90.0	96.0					15																	43527834		2203	4299	6502	SO:0001583	missense	9333	4	121412	33				g.chr15:43527834G>A	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1547C>T	chr15.hg19:g.43527834G>A	ENSP00000220420:p.Pro516Leu	0					TGM5_ENST00000349114.4_Missense_Mutation_p.P434L	p.P516L	NM_201631.3	NP_963925.2	1	2	3	2.011097	O43548	TGM5_HUMAN		10	1554	-		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	ENST00000220420.5	1	1	hg19	c.1547C>T	CCDS32212.1	1	.	.	.	.	.	.	.	.	.	.	G	6.234	0.411308	0.11812	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	T;T	0.68624	-0.34;-0.34	5.58	3.58	0.41010	5.58	3.58	0.41010	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.439796	0.24666	N	0.036588	T	0.54838	0.1883	L	0.47016	1.485	0.09310	N	1	B;B	0.30937	0.136;0.301	B;B	0.24269	0.024;0.052	T	0.49041	-0.8980	10	0.39692	T	0.17	-0.4586	10.2275	0.43233	0.0:0.1477:0.6995:0.1528	.	434;516	O43548-2;O43548	.;TGM5_HUMAN	L	516;434;515	ENSP00000220420:P516L;ENSP00000220419:P434L	ENSP00000220420:P516L	P	-	2	0	0	TGM5	41315126	41315126	0.094000	0.21725	0.008000	0.14137	0.083000	0.17756	2.334000	0.43920	1.351000	0.45789	-0.165000	0.13383	CCG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.567	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	3.970000	-2.901027	1	0.090000	NM_004245		0	11	12	0	238	237	0		1			0	0	36	0	0	0.998441	0	0	0	0	0	0	11	238
IL16	3603	broad.mit.edu	37	15	81592482	81592482	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr15:81592482G>A	ENST00000302987.4	+	13	2815	c.2815G>A	c.(2815-2817)Gac>Aac	p.D939N	IL16_ENST00000394660.2_Missense_Mutation_p.D939N|IL16_ENST00000394652.2_Missense_Mutation_p.D238N			Q14005	IL16_HUMAN	interleukin 16	939					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CCCTGGCCCGGACCCGCTCCT	0.657																																						ENST00000302987.4	0.900000	2.000000e-01	6.900000e-01	3.100000e-01	0.470000	0.508048	0.470000	0.450000																										0				57						c.(2815-2817)Gac>Aac		interleukin 16							28.0	33.0	31.0					15																	81592482		2203	4300	6503	SO:0001583	missense	3603	0	0					g.chr15:81592482G>A	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.2815G>A	chr15.hg19:g.81592482G>A	ENSP00000302935:p.Asp939Asn	0					IL16_ENST00000394660.2_Missense_Mutation_p.D939N|IL16_ENST00000394652.2_Missense_Mutation_p.D238N	p.D939N			1	2	3	2.011097	Q14005	IL16_HUMAN		13	2815	+			A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	0	1	hg19	c.2815G>A	CCDS42069.1	0	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211166	0.79240	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653;ENST00000394652;ENST00000394656	T;T;T	0.11495	2.77;2.78;3.37	4.85	4.85	0.62838	4.85	4.85	0.62838	.	0.267702	0.26731	N	0.022788	T	0.24928	0.0605	L	0.46157	1.445	0.36294	D	0.856591	D;D;D;D;B;D	0.89917	0.997;0.965;1.0;1.0;0.166;0.991	P;P;D;D;B;P	0.83275	0.844;0.703;0.994;0.996;0.017;0.798	T	0.08126	-1.0737	10	0.62326	D	0.03	.	11.7533	0.51862	0.0853:0.0:0.9147:0.0	.	771;432;476;329;939;939	F8W7Z5;Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;.;IL16_HUMAN;.	N	939;771;939;476;329;238;238	ENSP00000378155:D939N;ENSP00000302935:D939N;ENSP00000378147:D238N	ENSP00000302935:D939N	D	+	1	0	0	IL16	79379537	79379537	0.986000	0.35501	0.367000	0.25926	0.037000	0.13140	3.537000	0.53590	2.236000	0.73375	0.655000	0.94253	GAC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.657	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	0	0	1	2	2	2	2	0	0	0	0	61	61	61	59	1	3.970000	-6.807217	1	0.090000	NM_172217		0	6	6	0	304	296	0		1	0		0	0	61	0	0	0.962451	3.659531e-01	0	0	0	58	0	6	304
SBK1	388228	broad.mit.edu	37	16	28331735	28331735	+	Silent	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr16:28331735G>A	ENST00000341901.4	+	4	1557	c.768G>A	c.(766-768)gcG>gcA	p.A256A		NM_001024401.2	NP_001019572.1	Q52WX2	SBK1_HUMAN	SH3 domain binding kinase 1	256	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(3)|ovary(1)	5						GGGAGGCGGCGTCGGGCGCCG	0.746																																						ENST00000341901.4	1.000000	8.100000e-01	1	9.900000e-01	0.990000	0.988269	0.990000	1.000000																										0				5						c.(766-768)gcG>gcA		SH3 domain binding kinase 1							13.0	21.0	18.0					16																	28331735		2083	4197	6280	SO:0001819	synonymous_variant	388228	0	0					g.chr16:28331735G>A		CCDS32416.1	16p11.2	2013-09-27	2013-09-27			ENSG00000188322			17699	protein-coding gene	gene with protein product			"""SH3-binding domain kinase 1"""				Standard	XM_005255315		Approved	Sbk	uc002dpd.3	Q52WX2		ENST00000341901.4:c.768G>A	chr16.hg19:g.28331735G>A		0						p.A256A	NM_001024401.2	NP_001019572.1	1	2	3	2.017862	Q52WX2	SBK1_HUMAN		4	1557	+				Silent	SNP	ENST00000341901.4	1	1	hg19	c.768G>A	CCDS32416.1	1																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.746	SBK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387677.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	3.970000	-15.370900	1	0.090000	XM_370948		0	11	10	0	160	160	0		1			0	0	44	0	0	0.998456	0	0	0	0	0	0	11	160
HSD17B2	3294	broad.mit.edu	37	16	82131809	82131809	+	Missense_Mutation	SNP	A	A	G	rs529224978		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr16:82131809A>G	ENST00000199936.4	+	5	1125	c.932A>G	c.(931-933)aAc>aGc	p.N311S	RP11-510J16.5_ENST00000567021.1_RNA	NM_002153.2	NP_002144.1	P37059	DHB2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 2	311					in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|response to retinoic acid (GO:0032526)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						CTATTGATCAACTCGTTAGCC	0.542													a|||	1	0.000199681	0.0008	0.0	5008	,	,		17915	0.0		0.0	False		,,,				2504	0.0					ENST00000199936.4	1.000000	5.600000e-01	1	7.100000e-01	0.890000	0.870578	0.890000	1.000000																										0				10						c.(931-933)aAc>aGc		hydroxysteroid (17-beta) dehydrogenase 2							174.0	132.0	146.0					16																	82131809		2201	4300	6501	SO:0001583	missense	3294	1	121412	32				g.chr16:82131809A>G		CCDS10936.1	16q24.1-q24.2	2011-09-14			ENSG00000086696	ENSG00000086696	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5211	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 2"""	109685				7759109, 19027726	Standard	NM_002153		Approved	HSD17, SDR9C2	uc002fgv.3	P37059	OTTHUMG00000137631	ENST00000199936.4:c.932A>G	chr16.hg19:g.82131809A>G	ENSP00000199936:p.Asn311Ser	0					RP11-510J16.5_ENST00000567021.1_RNA	p.N311S	NM_002153.2	NP_002144.1	1	2	3	2.012426	P37059	DHB2_HUMAN		5	1125	+			B2R7T4	Missense_Mutation	SNP	ENST00000199936.4	1	1	hg19	c.932A>G	CCDS10936.1	1	.	.	.	.	.	.	.	.	.	.	a	5.085	0.201396	0.09652	.	.	ENSG00000086696	ENST00000199936	D	0.83419	-1.72	5.57	-9.36	0.00629	5.57	-9.36	0.00629	NAD(P)-binding domain (1);	2.782280	0.00732	N	0.000947	T	0.56645	0.1999	N	0.11064	0.09	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.57740	-0.7759	10	0.08837	T	0.75	.	0.9019	0.01276	0.281:0.2882:0.2436:0.1872	.	311	P37059	DHB2_HUMAN	S	311	ENSP00000199936:N311S	ENSP00000199936:N311S	N	+	2	0	0	HSD17B2	80689310	80689310	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.845000	0.01677	-1.859000	0.01156	0.533000	0.62120	AAC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.542	HSD17B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269057.2	0	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	3.970000	-4.258489	1	0.090000	NM_002153		0	20	20	0	504	499	0		1	1		0	0	110	0	0	0.999995	9.769839e-01	0	10	0	146	0	20	504
GRIN2A	2903	broad.mit.edu	37	16	9862737	9862737	+	Missense_Mutation	SNP	G	G	A	rs201072838	byFrequency	TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr16:9862737G>A	ENST00000396573.2	-	13	2875	c.2566C>T	c.(2566-2568)Cgg>Tgg	p.R856W	GRIN2A_ENST00000562109.1_Missense_Mutation_p.R856W|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R856W|GRIN2A_ENST00000396575.2_Missense_Mutation_p.R856W|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R699W|GRIN2A_ENST00000404927.2_Missense_Mutation_p.R856W	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	856					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AACCCAGGCCGGTCGGAGCAC	0.567																																						ENST00000396573.2	0.720000	2.800000e-01	6.100000e-01	3.700000e-01	0.480000	0.495365	0.480000	0.480000																										0				198						c.(2566-2568)Cgg>Tgg		glutamate receptor, ionotropic, N-methyl D-aspartate 2A	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)						90.0	94.0	93.0					16																	9862737		2197	4300	6497	SO:0001583	missense	2903	1	121412	39				g.chr16:9862737G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2566C>T	chr16.hg19:g.9862737G>A	ENSP00000379818:p.Arg856Trp	0					GRIN2A_ENST00000396575.2_Missense_Mutation_p.R856W|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R856W|GRIN2A_ENST00000404927.2_Missense_Mutation_p.R856W|GRIN2A_ENST00000562109.1_Missense_Mutation_p.R856W|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R699W	p.R856W	NM_000833.3	NP_000824.1	1	2	3	2.004762	Q12879	NMDE1_HUMAN		13	2875	-			O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	1	1	hg19	c.2566C>T	CCDS10539.1	0	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066263	0.76187	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63	4.44	3.33	0.38152	4.44	3.33	0.38152	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.155509	0.56097	D	0.000031	T	0.28928	0.0718	M	0.64997	1.995	0.37896	D	0.930866	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.70016	0.944;0.967;0.913	T	0.04885	-1.0920	9	.	.	.	.	9.4317	0.38615	0.0:0.0:0.5699:0.4301	.	699;856;856	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	W	856;856;699;856;856	ENSP00000379818:R856W;ENSP00000385872:R856W;ENSP00000441572:R699W;ENSP00000332549:R856W;ENSP00000379820:R856W	.	R	-	1	2	2	GRIN2A	9770238	9770238	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.673000	0.61604	2.170000	0.68504	0.563000	0.77884	CGG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.567	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3	0	0	1	2	2	2	2	0	0	0	0	98	98	98	98	1	3.970000	-2.115213	0	0.090000			0	17	17	0	818	809	0		1			0	0	98	0	0	0.999961	0	0	0	0	0	0	17	818
CDT1	81620	broad.mit.edu	37	16	88871873	88871873	+	Missense_Mutation	SNP	C	C	T	rs3218727	byFrequency	TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr16:88871873C>T	ENST00000301019.4	+	4	1133	c.514C>T	c.(514-516)Cgc>Tgc	p.R172C		NM_030928.3	NP_112190.2			chromatin licensing and DNA replication factor 1											central_nervous_system(1)|endometrium(2)|kidney(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CGCCTACCAGCGCTTCCATGC	0.677													C|||	8	0.00159744	0.0061	0.0	5008	,	,		14178	0.0		0.0	False		,,,				2504	0.0				Melanoma(159;511 3380 30971)	ENST00000301019.4	1.000000	2.900000e-01	8.100000e-01	4.200000e-01	0.590000	0.619910	0.590000	1.000000																										0				7						c.(514-516)Cgc>Tgc		chromatin licensing and DNA replication factor 1		C	CYS/ARG	15,4381	22.3+/-47.3	1,13,2184	31.0	37.0	35.0		514	3.7	1.0	16	dbSNP_106	35	0,8590		0,0,4295	yes	missense	CDT1	NM_030928.3	180	1,13,6479	TT,TC,CC		0.0,0.3412,0.1155	probably-damaging	172/547	88871873	15,12971	2198	4295	6493	SO:0001583	missense	81620	43	121224	47				g.chr16:88871873C>T	AF070552	CCDS32510.1	16q24.3	2014-08-12			ENSG00000167513	ENSG00000167513			24576	protein-coding gene	gene with protein product		605525				11896191, 11555648	Standard	NM_030928		Approved	DUP, RIS2	uc002flu.3	Q9H211	OTTHUMG00000173467	ENST00000301019.4:c.514C>T	chr16.hg19:g.88871873C>T	ENSP00000301019:p.Arg172Cys	0						p.R172C	NM_030928.3	NP_112190.2	1	2	3	2.012426				4	1133	+				Missense_Mutation	SNP	ENST00000301019.4	0	1	hg19	c.514C>T	CCDS32510.1	0	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644116	0.87859	0.003412	0.0	ENSG00000167513	ENST00000301019	T	0.28255	1.62	4.68	3.66	0.41972	4.68	3.66	0.41972	.	0.111388	0.64402	D	0.000007	T	0.56217	0.1970	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64089	-0.6489	10	0.87932	D	0	-22.4772	15.3458	0.74337	0.0:0.8602:0.1398:0.0	rs3218727	172	Q9H211	CDT1_HUMAN	C	172	ENSP00000301019:R172C	ENSP00000301019:R172C	R	+	1	0	0	CDT1	87399374	87399374	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	3.838000	0.55828	2.319000	0.78375	0.462000	0.41574	CGC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.677	CDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423215.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	3.970000	-8.880385	1	0.090000	NM_030928		0	9	9	0	354	351	0		1	0		0	0	45	0	0	0.994142	4.727954e-03	0	1	0	3	0	9	354
KIAA0100	9703	broad.mit.edu	37	17	26946933	26946933	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr17:26946933C>T	ENST00000528896.2	-	30	5539	c.5465G>A	c.(5464-5466)cGg>cAg	p.R1822Q	KIAA0100_ENST00000579924.2_5'Flank|SPAG5-AS1_ENST00000424210.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1679Q|KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1679Q|SPAG5-AS1_ENST00000414744.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1822						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CACATGCTGCCGCACAGCCTC	0.493																																						ENST00000528896.2	1.000000	4.800000e-01	1	6.600000e-01	0.910000	0.859339	0.910000	1.000000																										0				68						c.(5464-5466)cGg>cAg		KIAA0100							100.0	91.0	94.0					17																	26946933		2203	4300	6503	SO:0001583	missense	9703	0	0					g.chr17:26946933C>T	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5465G>A	chr17.hg19:g.26946933C>T	ENSP00000436773:p.Arg1822Gln	0					SPAG5-AS1_ENST00000424210.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1679Q|KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1679Q|SPAG5-AS1_ENST00000414744.1_RNA|KIAA0100_ENST00000579924.2_5'Flank	p.R1822Q	NM_014680.3	NP_055495.2	3	3	6	2.078682	Q14667	K0100_HUMAN		30	5539	-	Lung NSC(42;0.00431)		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	1	1	hg19	c.5465G>A	CCDS32595.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.208479	0.95069	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.53423	0.62;0.62	5.53	5.53	0.82687	5.53	5.53	0.82687	FMP27,  C-terminal (1);	0.051185	0.64402	D	0.000001	T	0.71576	0.3356	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69826	-0.5040	10	0.38643	T	0.18	.	19.4358	0.94794	0.0:1.0:0.0:0.0	.	1822	Q14667	K0100_HUMAN	Q	1822;1792;1822;1679	ENSP00000436773:R1822Q;ENSP00000446443:R1679Q	ENSP00000005905:R1822Q	R	-	2	0	0	KIAA0100	23971060	23971060	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.448000	0.66612	2.768000	0.95171	0.655000	0.94253	CGG	0.198238		TCGA-IB-8126-01A-11D-2396-08	0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	0	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	3.970000	-2.516486	1	0.090000	NM_014680		0	13	13	0	385	382	0		1	1		0	0	62	0	0	0.999528	7.877712e-01	0	3	0	85	0	13	385
NUFIP2	57532	broad.mit.edu	37	17	27613833	27613833	+	Silent	SNP	T	T	C			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr17:27613833T>C	ENST00000225388.4	-	2	1237	c.1179A>G	c.(1177-1179)caA>caG	p.Q393Q	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	393	Ser-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			GACTTGATGATTGGGTCTGAG	0.433																																						ENST00000225388.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				24						c.(1177-1179)caA>caG		nuclear fragile X mental retardation protein interacting protein 2							141.0	142.0	141.0					17																	27613833		2203	4300	6503	SO:0001819	synonymous_variant	57532	0	0					g.chr17:27613833T>C	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1179A>G	chr17.hg19:g.27613833T>C		0					NUFIP2_ENST00000579665.1_Intron	p.Q393Q	NM_020772.2	NP_065823.1	3	3	6	2.078682	Q7Z417	NUFP2_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)	2	1237	-			A1L3A6|Q9P2M5	Silent	SNP	ENST00000225388.4	1	1	hg19	c.1179A>G	CCDS32600.1	1																																																																																								0.198238		TCGA-IB-8126-01A-11D-2396-08	0.433	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	1	0	1	2	2	2	2	0	0	0	0	105	105	105	103	1	3.970000	-10.949910	1	0.090000	NM_020772		0	47	47	0	597	591	0		1	1		0	0	105	0	0	1.000000	9.812358e-01	0	2	0	79	0	47	597
CSH2	1443	broad.mit.edu	37	17	61949520	61949520	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr17:61949520T>A	ENST00000392886.2	-	5	771	c.620A>T	c.(619-621)cAg>cTg	p.Q207L	CSH2_ENST00000336844.5_3'UTR|CSH2_ENST00000345366.7_Missense_Mutation_p.Q112L|CSH2_ENST00000560142.1_Missense_Mutation_p.Q150L	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2	207						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|lung(3)	6						AGAGCGGCACTGCACCATGCG	0.592																																						ENST00000392886.2	1.000000	6.500000e-01	1	8.300000e-01	0.990000	0.940701	0.990000	1.000000																										0				6						c.(619-621)cAg>cTg		chorionic somatomammotropin hormone 2							139.0	116.0	124.0					17																	61949520		2203	4300	6503	SO:0001583	missense	1443	0	0					g.chr17:61949520T>A	V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.620A>T	chr17.hg19:g.61949520T>A	ENSP00000376623:p.Gln207Leu	0					CSH2_ENST00000336844.5_3'UTR|CSH2_ENST00000345366.7_Missense_Mutation_p.Q112L|CSH2_ENST00000560142.1_Missense_Mutation_p.Q150L	p.Q207L	NM_020991.3	NP_066271.1	1	2	3	1.941436	P0DML3	CSH2_HUMAN		5	771	-			P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	ENST00000392886.2	1	1	hg19	c.620A>T	CCDS42369.1	1	.	.	.	.	.	.	.	.	.	.	N	14.32	2.499020	0.44455	.	.	ENSG00000213218	ENST00000345366;ENST00000392886	D;T	0.90676	-2.71;0.93	3.97	2.88	0.33553	3.97	2.88	0.33553	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.587450	0.04964	N	0.462618	D	0.95529	0.8547	M	0.85630	2.765	0.32011	N	0.602031	D;D;P	0.64830	0.994;0.994;0.728	D;D;B	0.74674	0.984;0.984;0.42	D	0.84470	0.0599	10	0.87932	D	0	.	8.0549	0.30600	0.0:0.101:0.0:0.899	.	207;207;112	P01243;A8K6C2;B1A4H9	CSH_HUMAN;.;.	L	112;207	ENSP00000308396:Q112L;ENSP00000376623:Q207L	ENSP00000308396:Q112L	Q	-	2	0	0	CSH2	59303252	59303252	1.000000	0.71417	0.999000	0.59377	0.018000	0.09664	3.847000	0.55895	0.570000	0.29347	0.379000	0.24179	CAG	0.122003		TCGA-IB-8126-01A-11D-2396-08	0.592	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417657.1	0	0	1	2	2	2	2	0	0	0	0	87	87	87	94	1	3.970000	-4.636657	1	0.090000	NM_020991		0	20	20	0	437	402	0		1			0	0	87	0	0	0.999990	0	0	0	0	0	0	20	437
RNF213	57674	broad.mit.edu	37	17	78363984	78363984	+	Missense_Mutation	SNP	G	G	A	rs528073196		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr17:78363984G>A	ENST00000582970.1	+	67	15601	c.15458G>A	c.(15457-15459)cGc>cAc	p.R5153H	CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.R3226H|CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.R5202H|RNF213_ENST00000427003.3_3'UTR	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	5153					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GAGCGCTTCCGCCCTCAGTGG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		17896	0.001		0.0	False		,,,				2504	0.0					ENST00000582970.1	1.000000	6.200000e-01	1	7.700000e-01	0.950000	0.907002	0.950000	1.000000																										0				130						c.(15457-15459)cGc>cAc		ring finger protein 213							57.0	66.0	63.0					17																	78363984		2202	4299	6501	SO:0001583	missense	57674	4	121392	38				g.chr17:78363984G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.15458G>A	chr17.hg19:g.78363984G>A	ENSP00000464087:p.Arg5153His	0					CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.R5202H|CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.R3226H|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000427003.3_3'UTR	p.R5153H	NM_001256071.1	NP_001243000.1	1	2	3	1.941436	Q63HN8	RN213_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)	67	15601	+	all_neural(118;0.0538)		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	1	1	hg19	c.15458G>A	CCDS58606.1	1	.	.	.	.	.	.	.	.	.	.	G	9.024	0.985660	0.18889	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T;T	0.23147	1.95;1.92	5.67	2.26	0.28386	5.67	2.26	0.28386	.	0.954721	0.08773	N	0.896005	T	0.17704	0.0425	L	0.43152	1.355	0.20926	N	0.999826	D;P	0.53619	0.961;0.713	B;B	0.35240	0.198;0.139	T	0.16305	-1.0407	10	0.44086	T	0.13	.	6.2579	0.20884	0.6156:0.1201:0.2643:0.0	.	5153;3226	D6RI12;Q63HN8	.;RN213_HUMAN	H	5153;5202;3226;503	ENSP00000425956:R5153H;ENSP00000338218:R3226H	ENSP00000338218:R3226H	R	+	2	0	0	RNF213	75978579	75978579	0.010000	0.17322	0.026000	0.17262	0.011000	0.07611	0.138000	0.16016	0.092000	0.17331	-0.294000	0.09567	CGC	0.122003		TCGA-IB-8126-01A-11D-2396-08	0.483	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	0	0	1	2	2	2	2	0	0	0	0	90	90	90	87	1	3.970000	-3.010969	1	0.090000	NM_020914		0	27	27	0	655	650	0		1	1	0	0	0	90	40	0	1.000000	9.073145e-01	4.463657e-01	5	1	96	36	27	655
VPS13D	55187	broad.mit.edu	37	1	12423195	12423195	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:12423195G>A	ENST00000358136.3	+	52	10470	c.10340G>A	c.(10339-10341)cGg>cAg	p.R3447Q	VPS13D_ENST00000356315.4_Missense_Mutation_p.R3422Q	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.R3447Q(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CACTGGCCTCGGAATGACTAT	0.453																																						ENST00000358136.3	1.000000	4.900000e-01	1	6.500000e-01	0.850000	0.837303	0.850000	1.000000																										1	Substitution - Missense(1)	p.R3447Q(1)	prostate(1)	130						c.(10339-10341)cGg>cAg		vacuolar protein sorting 13 homolog D (S. cerevisiae)							254.0	221.0	232.0					1																	12423195		2203	4300	6503	SO:0001583	missense	55187	1	121412	35				g.chr1:12423195G>A	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.10340G>A	chr1.hg19:g.12423195G>A	ENSP00000350854:p.Arg3447Gln	0					VPS13D_ENST00000356315.4_Missense_Mutation_p.R3422Q	p.R3447Q	NM_015378.2	NP_056193.2	1	2	3	1.951197				52	10470	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		Missense_Mutation	SNP	ENST00000358136.3	1	1	hg19	c.10340G>A	CCDS30588.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.752959|5.752959	0.96890|0.96890	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|T;T	.|0.33438	.|1.41;1.41	6.06|6.06	6.06|6.06	0.98353|0.98353	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Vacuolar protein sorting-associated protein (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.55561|0.55561	0.1928|0.1928	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.994;1.0	.|D;D	.|0.87578	.|0.956;0.998	T|T	0.35943|0.35943	-0.9768|-0.9768	5|10	.|0.31617	.|T	.|0.26	.|.	20.6208|20.6208	0.99490|0.99490	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|3422;3446	.|Q5THJ4-2;Q5THJ4	.|.;VP13D_HUMAN	R|Q	2269|3422;3447	.|ENSP00000348666:R3422Q;ENSP00000350854:R3447Q	.|ENSP00000348666:R3422Q	G|R	+|+	1|2	0|0	0|0	VPS13D|VPS13D	12345782|12345782	12345782|12345782	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.863000|0.863000	0.49368|0.49368	9.434000|9.434000	0.97515|0.97515	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GGA|CGG	0.124284		TCGA-IB-8126-01A-11D-2396-08	0.453	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	0	0	1	2	2	2	2	0	0	0	0	119	119	119	119	1	3.970000	-2.331684	0	0.090000	NM_015378		0	16	16	0	438	434	0		1	0		0	0	119	0	0	0.999931	1.082953e-01	0	0	0	15	0	16	438
TNN	63923	broad.mit.edu	37	1	175086325	175086325	+	Silent	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:175086325C>T	ENST00000239462.4	+	10	2483	c.2370C>T	c.(2368-2370)gaC>gaT	p.D790D		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	790	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGAAGGCTGACACCAAGGCCC	0.537																																						ENST00000239462.4	1.000000	5.500000e-01	1	7.000000e-01	0.890000	0.867287	0.890000	1.000000																										0				156						c.(2368-2370)gaC>gaT		tenascin N							85.0	85.0	85.0					1																	175086325		2203	4300	6503	SO:0001819	synonymous_variant	63923	0	0					g.chr1:175086325C>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2370C>T	chr1.hg19:g.175086325C>T		0						p.D790D	NM_022093.1	NP_071376.1	1	2	3	2.018194	Q9UQP3	TENN_HUMAN		10	2483	+		Breast(1374;0.000962)	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	1	1	hg19	c.2370C>T	CCDS30943.1	1																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.537	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	0	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	3.970000	-17.804350	1	0.090000	XM_040527		0	19	19	0	481	474	0		1	0		0	0	82	0	0	0.999989	0	0	0	0	1	0	19	481
HMCN1	83872	broad.mit.edu	37	1	185931765	185931765	+	Silent	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:185931765C>T	ENST00000271588.4	+	12	2173	c.1944C>T	c.(1942-1944)aaC>aaT	p.N648N	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Silent_p.N648N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	648	Ig-like C2-type 3.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGACCGTTAACGATATGTTTA	0.413																																						ENST00000271588.4	0.930000	2.600000e-01	7.300000e-01	3.800000e-01	0.540000	0.566283	0.540000	0.510000																										0				308						c.(1942-1944)aaC>aaT		hemicentin 1							207.0	190.0	196.0					1																	185931765		2203	4300	6503	SO:0001819	synonymous_variant	83872	5	121412	41				g.chr1:185931765C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1944C>T	chr1.hg19:g.185931765C>T		0					HMCN1_ENST00000367492.2_Silent_p.N648N|HMCN1_ENST00000485744.1_3'UTR	p.N648N	NM_031935.2	NP_114141.2	1	2	3	2.018194	Q96RW7	HMCN1_HUMAN		12	2173	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	0	1	hg19	c.1944C>T	CCDS30956.1	0																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	0	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	3.970000	-2.758881	1	0.090000	NM_031935		0	9	9	0	391	390	0		1	0		0	0	91	0	0	0.994275	1.996626e-03	0	0	0	2	0	9	391
CAMTA1	23261	broad.mit.edu	37	1	7796575	7796575	+	Silent	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:7796575C>T	ENST00000303635.7	+	13	3445	c.3238C>T	c.(3238-3240)Cta>Tta	p.L1080L	CAMTA1_ENST00000439411.2_Silent_p.L1080L	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1080					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTATGCCACCCTAATCCAGAC	0.607			T	WWTR1	epitheliod hemangioendothelioma																																	ENST00000303635.7	1.000000	6.200000e-01	1	7.800000e-01	0.970000	0.912950	0.970000	1.000000				Dom	yes			Dom	yes		1	1p36.31-p36.23	1p36.31-p36.23	611501	T	calmodulin binding transcription activator 1				M	M	WWTR1		epitheliod hemangioendothelioma		0				85						c.(3238-3240)Cta>Tta		calmodulin binding transcription activator 1							95.0	91.0	92.0					1																	7796575		2203	4300	6503	SO:0001819	synonymous_variant	23261	0	0					g.chr1:7796575C>T	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3238C>T	chr1.hg19:g.7796575C>T		0					CAMTA1_ENST00000439411.2_Silent_p.L1080L	p.L1080L	NM_015215.2	NP_056030.1	1	2	3	1.951197	Q9Y6Y1	CMTA1_HUMAN		13	3445	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	1	1	hg19	c.3238C>T	CCDS30576.1	1																																																																																								0.124284		TCGA-IB-8126-01A-11D-2396-08	0.607	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	0	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	3.970000	-2.771097	1	0.090000	NM_015215		0	24	24	0	568	564	0		1	0		0	0	89	0	0	1.000000	5.350727e-03	0	0	0	3	0	24	568
EPB41	2035	broad.mit.edu	37	1	29314163	29314163	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:29314163C>T	ENST00000343067.4	+	2	341	c.214C>T	c.(214-216)Cgg>Tgg	p.R72W	EPB41_ENST00000356093.2_Missense_Mutation_p.R72W|EPB41_ENST00000398863.2_Missense_Mutation_p.R72W|EPB41_ENST00000373798.1_Missense_Mutation_p.R72W|EPB41_ENST00000347529.3_Missense_Mutation_p.R72W|EPB41_ENST00000373797.1_Missense_Mutation_p.R72W|EPB41_ENST00000373800.3_5'UTR|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000349460.4_5'UTR	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	72					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GAACAAGGAGCGGACATCAGA	0.453																																						ENST00000343067.4	1.000000	6.000000e-02	3.000000e-01	1.000000e-01	0.160000	0.276944	0.160000	0.140000																										0				14						c.(214-216)Cgg>Tgg		erythrocyte membrane protein band 4.1							166.0	159.0	161.0					1																	29314163		2203	4300	6503	SO:0001583	missense	2035	2	121412	37				g.chr1:29314163C>T	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.214C>T	chr1.hg19:g.29314163C>T	ENSP00000345259:p.Arg72Trp	0					EPB41_ENST00000398863.2_Missense_Mutation_p.R72W|EPB41_ENST00000373797.1_Missense_Mutation_p.R72W|EPB41_ENST00000349460.4_5'UTR|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000356093.2_Missense_Mutation_p.R72W|EPB41_ENST00000347529.3_Missense_Mutation_p.R72W|EPB41_ENST00000373798.1_Missense_Mutation_p.R72W|EPB41_ENST00000373800.3_5'UTR	p.R72W	NM_001166005.1	NP_001159477.1	1	2	3	1.944733	P11171	41_HUMAN		2	341	+		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	0	1	hg19	c.214C>T	CCDS53288.1	0	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179746	0.78564	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D	0.85258	-1.96;-1.95;-1.78;-1.69;-1.96;-1.94	5.6	5.6	0.85130	5.6	5.6	0.85130	.	0.070962	0.56097	D	0.000035	D	0.89150	0.6633	L	0.32530	0.975	0.44500	D	0.997445	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.988;0.999;1.0;0.999	D	0.90061	0.4156	10	0.72032	D	0.01	.	18.6548	0.91448	0.0:1.0:0.0:0.0	.	72;72;72;72;72	C9JTS2;P11171;P11171-2;P11171-7;P11171-5	.;41_HUMAN;.;.;.	W	89;72;72;72;72;72;72;72;72	ENSP00000345259:R72W;ENSP00000348397:R72W;ENSP00000381839:R72W;ENSP00000290100:R72W;ENSP00000362904:R72W;ENSP00000362903:R72W	ENSP00000345259:R72W	R	+	1	2	2	EPB41	29186750	29186750	0.998000	0.40836	0.978000	0.43139	0.926000	0.56050	3.068000	0.50018	2.633000	0.89246	0.650000	0.86243	CGG	0.122765		TCGA-IB-8126-01A-11D-2396-08	0.453	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	0	0	1	2	2	2	2	0	0	0	0	134	134	134	134	1	3.970000	-2.077858	0	0.090000	NM_203342		0	6	6	0	954	944	0		1	0		0	0	134	0	0	0.963858	1.695685e-02	0	0	0	26	0	6	954
PPT1	5538	broad.mit.edu	37	1	40539758	40539758	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:40539758G>A	ENST00000433473.3	-	9	1360	c.896C>T	c.(895-897)gCc>gTc	p.A299V	PPT1_ENST00000372775.2_5'UTR|PPT1_ENST00000449045.2_Missense_Mutation_p.A196V|PPT1_ENST00000530076.1_Missense_Mutation_p.A80V	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1	299					adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TATGATGTGGGCATAAAACCA	0.483																																						ENST00000433473.3	1.000000	7.000000e-02	3.500000e-01	1.200000e-01	0.190000	0.299513	0.190000	0.170000																										0				11						c.(895-897)gCc>gTc		palmitoyl-protein thioesterase 1							189.0	181.0	183.0					1																	40539758		2203	4300	6503	SO:0001583	missense	5538	1	121412	32				g.chr1:40539758G>A	U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495	ENST00000433473.3:c.896C>T	chr1.hg19:g.40539758G>A	ENSP00000394863:p.Ala299Val	0					PPT1_ENST00000372775.2_5'UTR|PPT1_ENST00000449045.2_Missense_Mutation_p.A196V|PPT1_ENST00000530076.1_Missense_Mutation_p.A80V	p.A299V	NM_000310.3	NP_000301.1	1	2	3	1.944733	P50897	PPT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)	9	1360	-	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	B4DY24|Q6FGQ4	Missense_Mutation	SNP	ENST00000433473.3	0	1	hg19	c.896C>T	CCDS447.1	0	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636756	0.29068	.	.	ENSG00000131238	ENST00000433473;ENST00000449045;ENST00000439754;ENST00000530076	D;D;D;D	0.97404	-4.37;-4.37;-3.51;-4.37	5.78	3.84	0.44239	5.78	3.84	0.44239	.	0.619388	0.16981	N	0.191714	D	0.95541	0.8551	L	0.59436	1.845	0.20196	N	0.999925	B;B;B	0.29571	0.249;0.119;0.01	B;B;B	0.32583	0.024;0.148;0.007	D	0.89878	0.4028	10	0.51188	T	0.08	-0.8945	12.7764	0.57451	0.0:0.0:0.5698:0.4302	.	196;225;299	P50897-2;B4DWU3;P50897	.;.;PPT1_HUMAN	V	299;196;170;80	ENSP00000394863:A299V;ENSP00000392293:A196V;ENSP00000403207:A170V;ENSP00000434007:A80V	ENSP00000394863:A299V	A	-	2	0	0	PPT1	40312345	40312345	0.795000	0.28851	1.000000	0.80357	0.476000	0.33039	1.039000	0.30266	0.720000	0.32209	-0.182000	0.12963	GCC	0.122765		TCGA-IB-8126-01A-11D-2396-08	0.483	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	0	0	1	2	2	2	2	0	0	0	0	155	155	155	155	1	3.970000	-2.111416	0	0.090000	NM_000310		0	6	8	0	823	816	0		1	0		0	0	155	0	0	0.964245	4.526501e-01	0	0	0	189	0	6	823
SNAP47	116841	broad.mit.edu	37	1	227968309	227968309	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr1:227968309G>A	ENST00000366759.4	+	5	1744	c.1330G>A	c.(1330-1332)Gca>Aca	p.A444T	SNAP47_ENST00000366760.1_Missense_Mutation_p.A202T	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	444	t-SNARE coiled-coil homology 2. {ECO:0000255|PROSITE-ProRule:PRU00202}.				long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TGGCGTTGCAGCAGCTGTGGA	0.597																																						ENST00000366759.4	0.730000	1.400000e-01	5.500000e-01	2.300000e-01	0.360000	0.396879	0.360000	0.330000																										0				17						c.(1330-1332)Gca>Aca		synaptosomal-associated protein, 47kDa							147.0	115.0	126.0					1																	227968309		2203	4300	6503	SO:0001583	missense	116841	0	0					g.chr1:227968309G>A	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.1330G>A	chr1.hg19:g.227968309G>A	ENSP00000355721:p.Ala444Thr	0					SNAP47_ENST00000366760.1_Missense_Mutation_p.A202T	p.A444T	NM_053052.3	NP_444280.2	1	2	3	2.013594	Q5SQN1	SNP47_HUMAN		5	1744	+			B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	0	1	hg19	c.1330G>A	CCDS1562.1	0	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.565409	0.00903	.	.	ENSG00000143740	ENST00000366760;ENST00000366759	T;T	0.42513	0.97;2.28	4.67	-2.54	0.06307	4.67	-2.54	0.06307	Target SNARE coiled-coil domain (1);	0.884135	0.10124	N	0.713045	T	0.17109	0.0411	N	0.11560	0.145	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.28681	-1.0036	10	0.10636	T	0.68	-15.287	4.493	0.11822	0.3799:0.0:0.2016:0.4185	.	444	Q5SQN1	SNP47_HUMAN	T	202;444	ENSP00000355722:A202T;ENSP00000355721:A444T	ENSP00000355721:A444T	A	+	1	0	0	SNAP47	226034932	226034932	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.403000	0.07214	-0.674000	0.05253	-0.258000	0.10820	GCA	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.597	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	3.970000	-4.407505	1	0.090000	NM_053052		0	5	5	0	337	334	0		1	0		0	0	54	0	0	0.936531	1.774911e-01	0	0	0	43	0	5	337
RPRD1B	58490	broad.mit.edu	37	20	36694636	36694636	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr20:36694636C>T	ENST00000373433.4	+	6	1211	c.809C>T	c.(808-810)tCg>tTg	p.S270L		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	270					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						GATGTTTTGTCGGAGAAGGAG	0.502																																						ENST00000373433.4	0.930000	3.100000e-01	7.600000e-01	4.300000e-01	0.570000	0.598965	0.570000	0.570000																										0				12						c.(808-810)tCg>tTg		regulation of nuclear pre-mRNA domain containing 1B							75.0	86.0	82.0					20																	36694636		2203	4300	6503	SO:0001583	missense	58490	0	0					g.chr20:36694636C>T	AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.809C>T	chr20.hg19:g.36694636C>T	ENSP00000362532:p.Ser270Leu	0						p.S270L	NM_021215.3	NP_067038.1	1	2	3	1.991956	Q9NQG5	RPR1B_HUMAN		6	1211	+			Q1WDE7|Q6PKF4	Missense_Mutation	SNP	ENST00000373433.4	1	1	hg19	c.809C>T	CCDS13301.1	0	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538823	0.45176	.	.	ENSG00000101413	ENST00000373433;ENST00000449186	.	.	.	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.313199	0.35207	N	0.003367	T	0.45377	0.1339	L	0.27053	0.805	0.41599	D	0.988848	B	0.13594	0.008	B	0.10450	0.005	T	0.30208	-0.9986	9	0.39692	T	0.17	-5.9908	14.2206	0.65823	0.0:0.851:0.149:0.0	.	270	Q9NQG5	RPR1B_HUMAN	L	270;152	.	ENSP00000362532:S270L	S	+	2	0	0	RPRD1B	36128050	36128050	0.996000	0.38824	1.000000	0.80357	0.966000	0.64601	0.953000	0.29162	2.941000	0.99782	0.655000	0.94253	TCG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.502	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079142.2	0	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	3.970000	-2.823549	1	0.090000	NM_021215		0	12	12	0	482	476	0		1	0		0	0	80	0	0	0.999067	3.733316e-01	0	0	0	50	0	12	482
TIAM1	7074	broad.mit.edu	37	21	32493078	32493078	+	Missense_Mutation	SNP	C	C	T	rs200252911		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr21:32493078C>T	ENST00000286827.3	-	29	4855	c.4384G>A	c.(4384-4386)Gtc>Atc	p.V1462I	TIAM1_ENST00000541036.1_Missense_Mutation_p.V1402I	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1462					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTTGCGGAGACGGCATCAGAA	0.562																																						ENST00000286827.3	1.000000	4.600000e-01	1	6.200000e-01	0.810000	0.808561	0.810000	1.000000																										0				115						c.(4384-4386)Gtc>Atc		T-cell lymphoma invasion and metastasis 1		C	ILE/VAL	0,4406		0,0,2203	43.0	46.0	45.0		4384	2.2	0.7	21		45	1,8599	1.2+/-3.3	0,1,4299	no	missense	TIAM1	NM_003253.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1462/1592	32493078	1,13005	2203	4300	6503	SO:0001583	missense	7074	14	121410	45				g.chr21:32493078C>T		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4384G>A	chr21.hg19:g.32493078C>T	ENSP00000286827:p.Val1462Ile	0					TIAM1_ENST00000541036.1_Missense_Mutation_p.V1402I	p.V1462I	NM_003253.2	NP_003244.2	1	2	3	2.002735	Q13009	TIAM1_HUMAN		29	4855	-			B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	1	1	hg19	c.4384G>A	CCDS13609.1	0	.	.	.	.	.	.	.	.	.	.	C	9.128	1.010725	0.19277	0.0	1.16E-4	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.39056	1.1;1.11	5.14	2.2	0.27929	5.14	2.2	0.27929	.	0.290368	0.32147	N	0.006505	T	0.20981	0.0505	N	0.13235	0.315	0.27602	N	0.948927	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.17471	-1.0368	10	0.20046	T	0.44	.	6.7271	0.23363	0.0:0.5879:0.0:0.4121	.	1402;1462	F5GZ53;Q13009	.;TIAM1_HUMAN	I	1462;1402	ENSP00000286827:V1462I;ENSP00000441570:V1402I	ENSP00000286827:V1462I	V	-	1	0	0	TIAM1	31414949	31414949	0.308000	0.24509	0.735000	0.30896	0.916000	0.54674	0.220000	0.17660	0.129000	0.18514	-0.140000	0.14226	GTC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.562	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	3.970000	-13.580230	1	0.090000	NM_003253		0	14	14	0	392	387	0		1	0		0	0	84	0	0	0.999743	8.310043e-02	0	0	0	13	0	14	392
MFSD9	84804	broad.mit.edu	37	2	103335481	103335481	+	Missense_Mutation	SNP	G	G	A	rs144200432	byFrequency	TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr2:103335481G>A	ENST00000258436.5	-	6	866	c.823C>T	c.(823-825)Cgg>Tgg	p.R275W	MFSD9_ENST00000496253.1_5'Flank	NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	275					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						TTCATGTTCCGCAAGGCCAAC	0.557													G|||	5	0.000998403	0.0008	0.0	5008	,	,		20033	0.004		0.0	False		,,,				2504	0.0					ENST00000258436.5	0.710000	1.700000e-01	5.500000e-01	2.600000e-01	0.380000	0.411070	0.380000	0.360000																										0				20						c.(823-825)Cgg>Tgg		major facilitator superfamily domain containing 9							99.0	79.0	86.0					2																	103335481		2203	4300	6503	SO:0001583	missense	84804	8	121412	40				g.chr2:103335481G>A		CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.823C>T	chr2.hg19:g.103335481G>A	ENSP00000258436:p.Arg275Trp	0					MFSD9_ENST00000496253.1_5'Flank	p.R275W	NM_032718.3	NP_116107.3	1	2	3	2.009564	Q8NBP5	MFSD9_HUMAN		6	866	-			Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Missense_Mutation	SNP	ENST00000258436.5	0	1	hg19	c.823C>T	CCDS2063.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	13.25	2.181450	0.38511	.	.	ENSG00000135953	ENST00000258436	D	0.83250	-1.7	4.97	1.47	0.22746	4.97	1.47	0.22746	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.665977	0.15409	N	0.263908	T	0.71745	0.3376	L	0.34521	1.04	0.09310	N	1	B	0.18013	0.025	B	0.17098	0.017	T	0.62062	-0.6933	10	0.52906	T	0.07	-5.4226	7.0595	0.25117	0.0938:0.0:0.3214:0.5847	.	275	Q8NBP5	MFSD9_HUMAN	W	275	ENSP00000258436:R275W	ENSP00000258436:R275W	R	-	1	2	2	MFSD9	102701913	102701913	0.437000	0.25593	0.068000	0.19968	0.045000	0.14185	1.372000	0.34261	0.571000	0.29365	0.644000	0.83932	CGG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.557	MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253295.2	0	0	1	2	16	3	2	1	1	1	1	93	93	93	93	1	3.970000	-2.414887	0	0.090000	NM_032718		0	7	7	0	436	430	0		0	0		1	0	93	0	0	0.040460	1.118152e-02	0	0	0	24	0	7	436
FIGN	55137	broad.mit.edu	37	2	164466495	164466495	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr2:164466495A>G	ENST00000333129.3	-	3	2161	c.1847T>C	c.(1846-1848)gTa>gCa	p.V616A	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	616					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CGAAGTTAGTACAGTGTCCAG	0.423																																						ENST00000333129.3	1.000000	3.800000e-01	8.600000e-01	5.100000e-01	0.660000	0.686332	0.660000	1.000000																										0				47						c.(1846-1848)gTa>gCa		fidgetin							116.0	110.0	112.0					2																	164466495		1958	4157	6115	SO:0001583	missense	55137	0	0					g.chr2:164466495A>G	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1847T>C	chr2.hg19:g.164466495A>G	ENSP00000333836:p.Val616Ala	0					FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	p.V616A	NM_018086.2	NP_060556.2	1	2	3	2.009564	Q5HY92	FIGN_HUMAN		3	2161	-			B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	1	1	hg19	c.1847T>C	CCDS2221.2	0	.	.	.	.	.	.	.	.	.	.	A	4.122	0.020814	0.08006	.	.	ENSG00000182263	ENST00000333129	D	0.94897	-3.55	5.77	5.77	0.91146	5.77	5.77	0.91146	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.062004	0.64402	D	0.000004	D	0.93324	0.7872	L	0.27975	0.815	0.58432	D	0.999999	P	0.41366	0.747	P	0.55161	0.77	D	0.90675	0.4601	10	0.08837	T	0.75	-17.6067	16.0953	0.81117	1.0:0.0:0.0:0.0	.	616	Q5HY92	FIGN_HUMAN	A	616	ENSP00000333836:V616A	ENSP00000333836:V616A	V	-	2	0	0	FIGN	164174741	164174741	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.116000	0.71571	2.204000	0.70986	0.383000	0.25322	GTA	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.423	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	0	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	3.970000	-12.729920	1	0.090000	NM_018086		0	14	13	0	481	478	0		1	0		0	0	97	0	0	0.999743	9.619238e-04	0	0	0	2	0	14	481
ALK	238	broad.mit.edu	37	2	30143012	30143012	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr2:30143012C>T	ENST00000389048.3	-	1	1420	c.514G>A	c.(514-516)Gag>Aag	p.E172K	ALK_ENST00000431873.1_Missense_Mutation_p.E172K	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	172					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CTGAACAGCTCGCTGAGATTG	0.647			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													ENST00000389048.3	1.000000	2.400000e-01	8.300000e-01	3.800000e-01	0.580000	0.609013	0.580000	1.000000			yes	Dom	yes	Familial neuroblastoma	yes	Dom	yes	Familial neuroblastoma	2	2p23	2p23	238	T, Mis, A	anaplastic lymphoma kinase (Ki-1)				"""L, E, M"""	L, E, M	NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22	neuroblastoma	ALCL, NSCLC, Neuroblastoma	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	0				340						c.(514-516)Gag>Aag		anaplastic lymphoma receptor tyrosine kinase	Adenosine triphosphate(DB00171)|Crizotinib(DB08865)						26.0	32.0	30.0					2																	30143012		2203	4300	6503	SO:0001583	missense	238	0	0		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	g.chr2:30143012C>T	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.514G>A	chr2.hg19:g.30143012C>T	ENSP00000373700:p.Glu172Lys	0					ALK_ENST00000431873.1_Missense_Mutation_p.E172K	p.E172K	NM_004304.4	NP_004295.2	1	2	3	2.009564	Q9UM73	ALK_HUMAN		1	1420	-	Acute lymphoblastic leukemia(172;0.155)		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	0	1	hg19	c.514G>A	CCDS33172.1	0	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585036	0.66105	.	.	ENSG00000171094	ENST00000389048;ENST00000431873	T;T	0.80033	-1.33;2.7	5.33	5.33	0.75918	5.33	5.33	0.75918	.	.	.	.	.	T	0.69886	0.3161	N	0.24115	0.695	0.32250	N	0.571579	B	0.28258	0.205	B	0.19666	0.026	T	0.68503	-0.5391	8	.	.	.	.	17.9759	0.89127	0.0:1.0:0.0:0.0	.	172	Q9UM73	ALK_HUMAN	K	172	ENSP00000373700:E172K;ENSP00000414027:E172K	.	E	-	1	0	0	ALK	29996516	29996516	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.012000	0.40932	2.652000	0.90054	0.655000	0.94253	GAG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.647	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	0	0	1	2	18	2	2	1	1	1	1	44	44	44	44	1	3.970000	-3.329602	1	0.090000	NM_004304		0	6	6	0	248	248	0		0			1	0	44	0	0	0.009554	0	0	0	0	0	0	6	248
WDFY1	57590	broad.mit.edu	37	2	224758990	224758990	+	Silent	SNP	G	G	A	rs374953968		TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr2:224758990G>A	ENST00000233055.4	-	8	894	c.792C>T	c.(790-792)ggC>ggT	p.G264G		NM_020830.3	NP_065881.1	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	264						cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)	18		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		CTGCAATTCCGCCGTCCGAGG	0.557																																						ENST00000233055.4	1.000000	2.900000e-01	8.500000e-01	4.300000e-01	0.610000	0.639248	0.610000	1.000000																										0				18						c.(790-792)ggC>ggT		WD repeat and FYVE domain containing 1		G		1,4405	2.1+/-5.4	0,1,2202	174.0	129.0	145.0		792	-5.0	0.9	2		145	0,8600		0,0,4300	no	coding-synonymous	WDFY1	NM_020830.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		264/411	224758990	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57590	6	121412	36				g.chr2:224758990G>A	AB037856	CCDS33387.1	2q36.2	2013-01-09	2003-03-13		ENSG00000085449	ENSG00000085449		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20451	protein-coding gene	gene with protein product			"""WD40 and FYVE domain containing 1"""			11739631	Standard	NM_020830		Approved	KIAA1435, FENS-1, WDF1, ZFYVE17	uc002vnq.3	Q8IWB7	OTTHUMG00000153370	ENST00000233055.4:c.792C>T	chr2.hg19:g.224758990G>A		0						p.G264G	NM_020830.3	NP_065881.1	1	2	3	2.009564	Q8IWB7	WDFY1_HUMAN		8	894	-		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)	Q53S17|Q9H9D5|Q9P2B3	Silent	SNP	ENST00000233055.4	0	1	hg19	c.792C>T	CCDS33387.1	0																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.557	WDFY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330908.1	0	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	3.970000	-2.887808	1	0.090000	NM_020830		0	8	8	0	306	301	0		1	0		0	0	53	0	0	0.988900	3.522196e-01	0	1	0	43	0	8	306
ATG3	64422	broad.mit.edu	37	3	112267472	112267472	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr3:112267472C>T	ENST00000283290.5	-	5	685	c.251G>A	c.(250-252)cGg>cAg	p.R84Q	ATG3_ENST00000495756.1_5'UTR|ATG3_ENST00000402314.2_Missense_Mutation_p.R84Q	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	84					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						CTGTTTGCACCGCTTATAGCA	0.378																																						ENST00000283290.5	1.000000	3.500000e-01	1	5.300000e-01	0.770000	0.766263	0.770000	1.000000																										0				9						c.(250-252)cGg>cAg		autophagy related 3							129.0	115.0	119.0					3																	112267472		2203	4299	6502	SO:0001583	missense	64422	2	121406	30				g.chr3:112267472C>T		CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.251G>A	chr3.hg19:g.112267472C>T	ENSP00000283290:p.Arg84Gln	0					ATG3_ENST00000495756.1_5'UTR|ATG3_ENST00000402314.2_Missense_Mutation_p.R84Q	p.R84Q	NM_022488.3	NP_071933.2	1	2	3	2.028119	Q9NT62	ATG3_HUMAN		5	685	-			Q6PKC5|Q9H6L9	Missense_Mutation	SNP	ENST00000283290.5	0	1	hg19	c.251G>A	CCDS2966.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.539479	0.96474	.	.	ENSG00000144848	ENST00000283290;ENST00000402314	.	.	.	5.32	5.32	0.75619	5.32	5.32	0.75619	Autophagy-related protein 3, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86690	0.5993	M	0.93638	3.44	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.74023	0.982;0.974	D	0.90176	0.4239	9	0.87932	D	0	0.0444	18.5844	0.91183	0.0:1.0:0.0:0.0	.	84;84	Q9NT62;Q9NT62-2	ATG3_HUMAN;.	Q	84	.	ENSP00000283290:R84Q	R	-	2	0	0	ATG3	113750162	113750162	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.416000	0.66417	2.482000	0.83794	0.591000	0.81541	CGG	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.378	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354147.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	3.970000	-2.925876	1	0.090000	NM_022488		0	7	7	0	212	210	0		1	1		0	0	45	0	0	0.980474	9.255595e-01	0	5	0	137	0	7	212
ARHGAP31	57514	broad.mit.edu	37	3	119128441	119128441	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr3:119128441G>A	ENST00000264245.4	+	11	2276	c.1744G>A	c.(1744-1746)Gcc>Acc	p.A582T		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	582					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGAGCCAGGCGCCCACCTGGA	0.542																																					Pancreas(7;176 297 5394 51128 51241)	ENST00000264245.4	1.000000	5.500000e-01	1	8.100000e-01	0.990000	0.935818	0.990000	1.000000																										0				67						c.(1744-1746)Gcc>Acc		Rho GTPase activating protein 31							33.0	36.0	35.0					3																	119128441		1883	4107	5990	SO:0001583	missense	57514	4	120840	34				g.chr3:119128441G>A		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1744G>A	chr3.hg19:g.119128441G>A	ENSP00000264245:p.Ala582Thr	0						p.A582T	NM_020754.2	NP_065805.2	1	2	3	2.028119	Q2M1Z3	RHG31_HUMAN		11	2276	+			Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	0	1	hg19	c.1744G>A	CCDS43135.1	1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.477473	0.01035	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.05925	3.37	5.27	-10.5	0.00291	5.27	-10.5	0.00291	.	1.661360	0.03193	N	0.173588	T	0.02083	0.0065	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32348	-0.9910	10	0.02654	T	1	.	5.8933	0.18925	0.5415:0.2715:0.1077:0.0793	.	582	Q2M1Z3	RHG31_HUMAN	T	582	ENSP00000264245:A582T	ENSP00000264245:A582T	A	+	1	0	0	ARHGAP31	120611131	120611131	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.506000	0.00448	-3.278000	0.00198	-1.594000	0.00841	GCC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.542	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	3.970000	-10.989630	1	0.090000			0	8	7	0	156	153	0		1	0		0	0	21	0	0	0.988848	3.883010e-01	0	0	0	25	0	8	156
COL6A6	131873	broad.mit.edu	37	3	130284081	130284081	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr3:130284081G>A	ENST00000358511.6	+	3	936	c.905G>A	c.(904-906)cGa>cAa	p.R302Q	COL6A6_ENST00000453409.2_Missense_Mutation_p.R302Q	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	302	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTTTCTCCCCGAACTGGGAAG	0.478																																						ENST00000358511.6	0.970000	3.100000e-01	7.900000e-01	4.400000e-01	0.590000	0.616869	0.590000	1.000000																										0				134						c.(904-906)cGa>cAa		collagen, type VI, alpha 6							68.0	71.0	70.0					3																	130284081		1860	4096	5956	SO:0001583	missense	131873	4	120804	39				g.chr3:130284081G>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.905G>A	chr3.hg19:g.130284081G>A	ENSP00000351310:p.Arg302Gln	0					COL6A6_ENST00000453409.2_Missense_Mutation_p.R302Q	p.R302Q	NM_001102608.1	NP_001096078.1	1	2	3	2.028119	A6NMZ7	CO6A6_HUMAN		3	936	+			A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	0	1	hg19	c.905G>A	CCDS46911.1	0	.	.	.	.	.	.	.	.	.	.	G	0.090	-1.169073	0.01660	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78364	-1.17;-1.17	5.01	-2.32	0.06745	5.01	-2.32	0.06745	von Willebrand factor, type A (3);	1.188040	0.06089	N	0.663415	T	0.57036	0.2026	N	0.04387	-0.21	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.38178	-0.9673	10	0.26408	T	0.33	.	12.8264	0.57723	0.4013:0.0:0.5987:0.0	.	302	A6NMZ7	CO6A6_HUMAN	Q	302	ENSP00000351310:R302Q;ENSP00000399236:R302Q	ENSP00000351310:R302Q	R	+	2	0	0	COL6A6	131766771	131766771	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.959000	0.03853	-0.497000	0.06641	-0.459000	0.05422	CGA	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.478	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	0	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	3.970000	-1.996802	0	0.090000	NM_001102608		0	11	11	0	430	428	0		1	0		0	0	96	0	0	0.998335	2.329450e-03	0	0	0	3	0	11	430
THRB	7068	broad.mit.edu	37	3	24231773	24231773	+	Silent	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr3:24231773G>A	ENST00000356447.4	-	4	359	c.75C>T	c.(73-75)caC>caT	p.H25H	THRB_ENST00000416420.1_Silent_p.H25H|THRB_ENST00000396671.2_Silent_p.H25H	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	25	Modulating.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GCTTCCAGTCGTGTTCTCGGT	0.493																																					Melanoma(21;896 1043 15021 37958)	ENST00000356447.4	1.000000	1.100000e-01	6.700000e-01	2.000000e-01	0.330000	0.427044	0.330000	0.280000																										0				19						c.(73-75)caC>caT		thyroid hormone receptor, beta	Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)						177.0	159.0	165.0					3																	24231773		2203	4300	6503	SO:0001819	synonymous_variant	7068	3	121412	37				g.chr3:24231773G>A		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.75C>T	chr3.hg19:g.24231773G>A		0					THRB_ENST00000396671.2_Silent_p.H25H|THRB_ENST00000416420.1_Silent_p.H25H	p.H25H	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	1	2	3	1.940226	P10828	THB_HUMAN		4	359	-			B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Silent	SNP	ENST00000356447.4	0	1	hg19	c.75C>T	CCDS2641.1	0	.	.	.	.	.	.	.	.	.	.	G	7.584	0.669381	0.14776	.	.	ENSG00000151090	ENST00000416811	.	.	.	5.93	2.09	0.27110	5.93	2.09	0.27110	.	.	.	.	.	T	0.63414	0.2509	.	.	.	0.38566	D	0.949829	.	.	.	.	.	.	T	0.64236	-0.6455	5	0.87932	D	0	.	8.5522	0.33458	0.0713:0.5866:0.2416:0.1005	.	.	.	.	M	25	.	ENSP00000414401:T25M	T	-	2	0	0	THRB	24206777	24206777	0.992000	0.36948	0.664000	0.29753	0.990000	0.78478	0.216000	0.17585	0.095000	0.17434	-0.175000	0.13238	ACG	0.122003		TCGA-IB-8126-01A-11D-2396-08	0.493	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	0	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	3.970000	-2.881296	1	0.090000	NM_000461		0	5	5	0	405	400	0		1	0		0	0	107	0	0	0.935872	3.516292e-03	0	0	0	6	0	5	405
LRRIQ4	344657	broad.mit.edu	37	3	169539979	169539979	+	Silent	SNP	G	G	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr3:169539979G>T	ENST00000340806.6	+	1	270	c.270G>T	c.(268-270)ctG>ctT	p.L90L		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	90										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						GCCCGGCGCTGGGGCTGCTGA	0.567																																						ENST00000340806.6	0.630000	1.800000e-01	5.000000e-01	2.600000e-01	0.370000	0.390689	0.370000	0.360000																										0				30						c.(268-270)ctG>ctT		leucine-rich repeats and IQ motif containing 4							68.0	74.0	72.0					3																	169539979		1945	4130	6075	SO:0001819	synonymous_variant	344657	0	0					g.chr3:169539979G>T		CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.270G>T	chr3.hg19:g.169539979G>T		0						p.L90L	NM_001080460.1	NP_001073929.1	1	2	3	2.028119	A6NIV6	LRIQ4_HUMAN		1	270	+				Silent	SNP	ENST00000340806.6	0	1	hg19	c.270G>T	CCDS46951.1	0																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.567	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	118	1	3.970000	-2.272507	0	0.090000	NM_001080460		0	10	9	0	635	629	0		1			0	0	119	0	0	0.996737	0	0	0	0	0	0	10	635
SHROOM3	57619	broad.mit.edu	37	4	77661903	77661903	+	Silent	SNP	C	C	G			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr4:77661903C>G	ENST00000296043.6	+	5	3530	c.2577C>G	c.(2575-2577)tcC>tcG	p.S859S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	859					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			AAGAGGCTTCCCGGCAGCCCT	0.632																																						ENST00000296043.6	1.000000	4.500000e-01	1	6.100000e-01	0.800000	0.800599	0.800000	1.000000																										0				60						c.(2575-2577)tcC>tcG		shroom family member 3							31.0	36.0	35.0					4																	77661903		2201	4295	6496	SO:0001819	synonymous_variant	57619	0	0					g.chr4:77661903C>G	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2577C>G	chr4.hg19:g.77661903C>G		0						p.S859S	NM_020859.3	NP_065910.3	1	2	3	2.015993	Q8TF72	SHRM3_HUMAN	Lung(101;0.0903)	5	3530	+			Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	0	1	hg19	c.2577C>G	CCDS3579.2	0																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.632	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	0	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	3.970000	-3.150672	1	0.090000	NM_020859		0	13	13	0	369	364	0		1	1		0	0	52	0	0	0.999512	1.797514e-01	0	2	0	19	0	13	369
TET2	54790	broad.mit.edu	37	4	106157130	106157130	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr4:106157130T>A	ENST00000540549.1	+	3	2891	c.2031T>A	c.(2029-2031)tgT>tgA	p.C677*	TET2_ENST00000394764.1_Nonsense_Mutation_p.C677*|TET2_ENST00000413648.2_Nonsense_Mutation_p.C677*|TET2_ENST00000513237.1_Nonsense_Mutation_p.C698*|TET2_ENST00000380013.4_Nonsense_Mutation_p.C677*|TET2_ENST00000305737.2_Nonsense_Mutation_p.C677*|TET2_ENST00000545826.1_Nonsense_Mutation_p.C677*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	677	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGTCACTGTGTGGCACTAGAT	0.438			"""Mis N, F"""		MDS																																	ENST00000540549.1	0.620000	1.100000e-01	4.700000e-01	1.900000e-01	0.310000	0.338266	0.310000	0.280000				Rec	yes			Rec	yes		4	4q24	4q24	54790	Mis N, F	tet oncogene family member 2				L	L			MDS		0				1314						c.(2029-2031)tgT>tgA		tet methylcytosine dioxygenase 2							109.0	107.0	108.0					4																	106157130		2203	4300	6503	SO:0001587	stop_gained	54790	0	0					g.chr4:106157130T>A	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2031T>A	chr4.hg19:g.106157130T>A	ENSP00000442788:p.Cys677*	0					TET2_ENST00000380013.4_Nonsense_Mutation_p.C677*|TET2_ENST00000413648.2_Nonsense_Mutation_p.C677*|TET2_ENST00000305737.2_Nonsense_Mutation_p.C677*|TET2_ENST00000513237.1_Nonsense_Mutation_p.C698*|TET2_ENST00000394764.1_Nonsense_Mutation_p.C677*|TET2_ENST00000545826.1_Nonsense_Mutation_p.C677*	p.C677*			1	2	3	2.015993	Q6N021	TET2_HUMAN		3	2891	+		Myeloproliferative disorder(5;0.0393)	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	ENST00000540549.1	0	1	hg19	c.2031T>A	CCDS47120.1	0	.	.	.	.	.	.	.	.	.	.	T	29.6	5.020328	0.93462	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	.	.	.	5.6	-6.08	0.02151	5.6	-6.08	0.02151	.	0.621347	0.15973	N	0.235671	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	10.1181	0.42603	0.0:0.5241:0.1056:0.3704	.	.	.	.	X	677;677;677;698;677;677;677	.	ENSP00000265149:C677X	C	+	3	2	2	TET2	106376579	106376579	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.340000	0.07821	-0.678000	0.05224	0.533000	0.62120	TGT	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.438	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	0	0	1	2	18	2	2	1	1	1	1	76	76	76	76	1	3.970000	-2.971831	1	0.090000	NM_017628		0	5	5	0	398	395	0		0	0		1	0	76	0	0	0.004463	1.249650e-02	0	0	0	11	0	5	398
SYNE1	23345	broad.mit.edu	37	6	152777116	152777116	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr6:152777116T>G	ENST00000367255.5	-	23	3233	c.2632A>C	c.(2632-2634)Agt>Cgt	p.S878R	SYNE1_ENST00000495090.2_Missense_Mutation_p.S445R|SYNE1_ENST00000413186.2_Missense_Mutation_p.S878R|SYNE1_ENST00000448038.1_Missense_Mutation_p.S885R|SYNE1_ENST00000341594.5_Missense_Mutation_p.S930R|SYNE1_ENST00000367248.3_Missense_Mutation_p.S868R|SYNE1_ENST00000265368.4_Missense_Mutation_p.S878R|SYNE1_ENST00000423061.1_Missense_Mutation_p.S885R|SYNE1_ENST00000367253.4_Missense_Mutation_p.S878R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	878					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTTGAACACTTTGACTGCCT	0.363										HNSCC(10;0.0054)																												ENST00000367255.5	0.730000	1.500000e-01	5.600000e-01	2.500000e-01	0.380000	0.411515	0.380000	0.360000																										0				524						c.(2632-2634)Agt>Cgt		spectrin repeat containing, nuclear envelope 1							144.0	132.0	136.0					6																	152777116		2203	4300	6503	SO:0001583	missense	23345	0	0					g.chr6:152777116T>G	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.2632A>C	chr6.hg19:g.152777116T>G	ENSP00000356224:p.Ser878Arg	0	HNSCC(10;0.0054)				SYNE1_ENST00000341594.5_Missense_Mutation_p.S930R|SYNE1_ENST00000495090.2_Missense_Mutation_p.S445R|SYNE1_ENST00000265368.4_Missense_Mutation_p.S878R|SYNE1_ENST00000448038.1_Missense_Mutation_p.S885R|SYNE1_ENST00000367253.4_Missense_Mutation_p.S878R|SYNE1_ENST00000413186.2_Missense_Mutation_p.S878R|SYNE1_ENST00000367248.3_Missense_Mutation_p.S868R|SYNE1_ENST00000423061.1_Missense_Mutation_p.S885R	p.S878R	NM_182961.3	NP_892006.3	1	2	3	2.005936	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	23	3233	-		Ovarian(120;0.0955)	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	0	1	hg19	c.2632A>C	CCDS5236.2	0	.	.	.	.	.	.	.	.	.	.	T	15.54	2.865046	0.51482	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000495090	T;T;T;T;T;T;T;T;T	0.52983	1.44;1.44;1.44;1.44;0.64;1.44;1.44;1.44;1.44	5.25	4.09	0.47781	5.25	4.09	0.47781	.	0.427135	0.21974	N	0.066416	T	0.20861	0.0502	L	0.34521	1.04	0.80722	D	1	B;B;B;P;B;B;B	0.35077	0.112;0.215;0.404;0.483;0.321;0.215;0.21	B;B;B;B;B;B;B	0.36244	0.074;0.063;0.22;0.203;0.146;0.063;0.146	T	0.05937	-1.0855	10	0.52906	T	0.07	.	8.2238	0.31558	0.0:0.1536:0.0:0.8464	.	861;878;445;868;878;878;885	B3W695;Q8NF91;F5H422;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.;.	R	878;885;878;885;930;878;868;878;445	ENSP00000356224:S878R;ENSP00000396024:S885R;ENSP00000265368:S878R;ENSP00000390975:S885R;ENSP00000341887:S930R;ENSP00000356222:S878R;ENSP00000356217:S868R;ENSP00000414510:S878R;ENSP00000438508:S445R	ENSP00000265368:S878R	S	-	1	0	0	SYNE1	152818809	152818809	0.025000	0.19082	0.998000	0.56505	0.967000	0.64934	1.554000	0.36266	0.845000	0.35118	0.533000	0.62120	AGT	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.363	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	0	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	3.970000	-3.099545	1	0.090000	NM_182961		0	6	6	0	380	379	0		1	0		0	0	92	0	0	0.964987	3.691253e-04	0	0	0	2	0	6	380
SEPT14	346288	broad.mit.edu	37	7	55872990	55872990	+	Silent	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr7:55872990G>A	ENST00000388975.3	-	9	1196	c.1080C>T	c.(1078-1080)gtC>gtT	p.V360V		NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	360					cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTTTCTCCTTGACTCGCTGCA	0.343																																						ENST00000388975.3	1.000000	3.000000e-01	1	4.700000e-01	0.710000	0.717387	0.710000	1.000000																										0				23						c.(1078-1080)gtC>gtT		septin 14							117.0	115.0	115.0					7																	55872990		2202	4297	6499	SO:0001819	synonymous_variant	346288	0	0					g.chr7:55872990G>A	AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.1080C>T	chr7.hg19:g.55872990G>A		0						p.V360V	NM_207366.2	NP_997249.2	1	2	3	2.016128	Q6ZU15	SEP14_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)	9	1196	-	Breast(14;0.214)		A6NCC2|B4DXD6	Silent	SNP	ENST00000388975.3	0	1	hg19	c.1080C>T	CCDS5519.2	0																																																																																								0.129187		TCGA-IB-8126-01A-11D-2396-08	0.343	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251489.2	0	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	3.970000	-3.682513	1	0.090000	NM_207366		0	6	6	0	201	200	0		1			0	0	37	0	0	0.965117	0	0	0	0	0	0	6	201
XKR4	114786	broad.mit.edu	37	8	56436505	56436505	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr8:56436505G>A	ENST00000327381.6	+	3	1772	c.1672G>A	c.(1672-1674)Gac>Aac	p.D558N	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	558						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TGTTGTCAGCGACCGCGATCA	0.587																																						ENST00000327381.6	0.740000	1.400000e-01	5.600000e-01	2.300000e-01	0.370000	0.403739	0.370000	0.330000																										0				34						c.(1672-1674)Gac>Aac		XK, Kell blood group complex subunit-related family, member 4							68.0	70.0	69.0					8																	56436505		2203	4300	6503	SO:0001583	missense	114786	0	0					g.chr8:56436505G>A	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1672G>A	chr8.hg19:g.56436505G>A	ENSP00000328326:p.Asp558Asn	0					RP11-628E19.2_ENST00000522918.1_RNA	p.D558N	NM_052898.1	NP_443130.1	1	2	3	2.017890	Q5GH76	XKR4_HUMAN	Epithelial(17;0.000117)|all cancers(17;0.000836)	3	1772	+			Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	0	1	hg19	c.1672G>A	CCDS34893.1	0	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413709	0.42817	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.82984	-1.67	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.453459	0.26616	N	0.023398	T	0.77665	0.4164	L	0.43152	1.355	0.50813	D	0.99989	B	0.33748	0.423	B	0.26094	0.066	T	0.73445	-0.3980	10	0.21014	T	0.42	-4.3001	20.3931	0.98965	0.0:0.0:1.0:0.0	.	558	Q5GH76	XKR4_HUMAN	N	558	ENSP00000328326:D558N	ENSP00000328326:D558N	D	+	1	0	0	XKR4	56599059	56599059	1.000000	0.71417	0.862000	0.33874	0.008000	0.06430	7.863000	0.87023	2.824000	0.97209	0.655000	0.94253	GAC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.587	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	0	0	0	2	2	2	2	0	0	0	0	66	66	66	66	1	3.970000	-5.345967	1	0.090000	NM_052898		0	5	4	0	331	330	0		1	0		0	0	66	0	0	0.936516	0	0	0	0	1	0	5	331
BAI1	575	broad.mit.edu	37	8	143603440	143603440	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr8:143603440C>T	ENST00000517894.1	+	21	4033	c.3139C>T	c.(3139-3141)Cgc>Tgc	p.R1047C	BAI1_ENST00000323289.5_Missense_Mutation_p.R1047C			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1047					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCTCCGGAACCGCCTCATCCG	0.657																																						ENST00000517894.1	1.000000	5.800000e-01	1	8.100000e-01	0.990000	0.932854	0.990000	1.000000																										0				57						c.(3139-3141)Cgc>Tgc		brain-specific angiogenesis inhibitor 1							31.0	41.0	38.0					8																	143603440		2198	4299	6497	SO:0001583	missense	575	2	121348	33				g.chr8:143603440C>T	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3139C>T	chr8.hg19:g.143603440C>T	ENSP00000430945:p.Arg1047Cys	0					BAI1_ENST00000323289.5_Missense_Mutation_p.R1047C	p.R1047C			1	2	3	2.017890	O14514	BAI1_HUMAN		21	4033	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)			Missense_Mutation	SNP	ENST00000517894.1	1	1	hg19	c.3139C>T		1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619636	0.46736	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.50813	0.73;0.73	3.78	2.89	0.33648	3.78	2.89	0.33648	.	0.162599	0.41938	U	0.000782	T	0.49762	0.1576	M	0.83603	2.65	0.58432	D	0.999992	B	0.16802	0.019	B	0.17433	0.018	T	0.51593	-0.8686	10	0.72032	D	0.01	.	9.8607	0.41112	0.0:0.897:0.0:0.103	.	1047	E9PBK0	.	C	1047	ENSP00000430945:R1047C;ENSP00000313046:R1047C	ENSP00000313046:R1047C	R	+	1	0	0	BAI1	143600442	143600442	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.563000	0.60823	0.558000	0.29135	0.305000	0.20034	CGC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.657	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	0	0	1	2	2	2	2	0	0	0	0	32	32	32	31	1	3.970000	-2.992802	1	0.090000	NM_001702		0	11	11	0	227	200	0		1	0		0	0	32	0	0	0.997009	0	0	0	0	1	0	11	227
KIAA1045	23349	broad.mit.edu	37	9	34971580	34971580	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr9:34971580G>T	ENST00000242315.3	+	2	367	c.285G>T	c.(283-285)agG>agT	p.R95S	KIAA1045_ENST00000544237.1_Missense_Mutation_p.R95S|KIAA1045_ENST00000476115.2_Intron	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	95							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			AGTTTGACAGGACAAGTCGAT	0.622																																						ENST00000242315.3			0	0																														0				19						c.(283-285)agG>agT		KIAA1045							105.0	121.0	116.0					9																	34971580		2011	4162	6173	SO:0001583	missense	23349	0	0					g.chr9:34971580G>T	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.285G>T	chr9.hg19:g.34971580G>T	ENSP00000242315:p.Arg95Ser						KIAA1045_ENST00000544237.1_Missense_Mutation_p.R95S|KIAA1045_ENST00000476115.2_Intron	p.R95S	NM_015297.1	NP_056112.1					Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)	2	367	+			B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	0	1	hg19	c.285G>T	CCDS43796.1		.	.	.	.	.	.	.	.	.	.	g	11.00	1.510166	0.27036	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	6.03	2.92	0.33932	6.03	2.92	0.33932	.	0.366196	0.29046	N	0.013305	T	0.28134	0.0694	L	0.36672	1.1	0.21220	N	0.99976	B	0.19200	0.034	B	0.18561	0.022	T	0.13683	-1.0500	8	.	.	.	-9.928	6.5955	0.22669	0.2802:0.0:0.5903:0.1295	.	95	Q9UPV7	K1045_HUMAN	S	95	.	.	R	+	3	2	2	KIAA1045	34961580	34961580	0.710000	0.27896	0.619000	0.29118	0.132000	0.20833	-0.067000	0.11579	0.885000	0.36088	0.655000	0.94253	AGG			TCGA-IB-8126-01A-11D-2396-08	0.622	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	0	0	1	2	2	2	2	0	0	0	0	167	167	167	163	1	3.970000	-2.804656	1	0.090000	XM_048592		0	12	11	0	1763	1748	0		1			0	0	167	0	0	0.999048	0	0	0	0	0	0	12	1763
TRPM3	80036	broad.mit.edu	37	9	73151119	73151119	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chr9:73151119T>C	ENST00000377110.3	-	25	5117	c.4874A>G	c.(4873-4875)aAc>aGc	p.N1625S	TRPM3_ENST00000423814.3_Missense_Mutation_p.N1652S|TRPM3_ENST00000408909.2_Missense_Mutation_p.N1484S|TRPM3_ENST00000377105.1_Missense_Mutation_p.N1484S|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000377106.1_Missense_Mutation_p.N1497S|TRPM3_ENST00000358082.3_Missense_Mutation_p.N1487S|TRPM3_ENST00000396292.4_Missense_Mutation_p.N1497S|TRPM3_ENST00000357533.2_Missense_Mutation_p.N1629S|TRPM3_ENST00000396280.5_Missense_Mutation_p.N1474S|TRPM3_ENST00000396285.1_Missense_Mutation_p.N1484S|TRPM3_ENST00000360823.2_Missense_Mutation_p.N1487S			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1650					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGTGATGTTGTTGGACAGGGT	0.552																																						ENST00000377110.3	1.000000	7.800000e-01	1	8.700000e-01	0.960000	0.947562	0.960000	1.000000																										0				95						c.(4873-4875)aAc>aGc		transient receptor potential cation channel, subfamily M, member 3							398.0	385.0	389.0					9																	73151119		2203	4300	6503	SO:0001583	missense	80036	0	0					g.chr9:73151119T>C	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4874A>G	chr9.hg19:g.73151119T>C	ENSP00000366314:p.Asn1625Ser	0					TRPM3_ENST00000360823.2_Missense_Mutation_p.N1487S|TRPM3_ENST00000396285.1_Missense_Mutation_p.N1484S|TRPM3_ENST00000423814.3_Missense_Mutation_p.N1652S|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396292.4_Missense_Mutation_p.N1497S|TRPM3_ENST00000377105.1_Missense_Mutation_p.N1484S|TRPM3_ENST00000358082.3_Missense_Mutation_p.N1487S|TRPM3_ENST00000408909.2_Missense_Mutation_p.N1484S|TRPM3_ENST00000396280.5_Missense_Mutation_p.N1474S|TRPM3_ENST00000377106.1_Missense_Mutation_p.N1497S|TRPM3_ENST00000357533.2_Missense_Mutation_p.N1629S	p.N1625S			1	2	3	2.012233	Q9HCF6	TRPM3_HUMAN		25	5117	-			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	1	1	hg19	c.4874A>G	CCDS43835.1	1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534120	0.27475	.	.	ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T	0.53640	0.66;0.64;0.64;0.61;0.66;0.61;0.64;0.64;0.64;0.65	5.77	4.62	0.57501	5.77	4.62	0.57501	.	0.290243	0.39083	N	0.001479	T	0.51126	0.1656	N	0.24115	0.695	0.32672	N	0.516704	B;B;B;B;P;D;B	0.56035	0.318;0.318;0.213;0.378;0.73;0.974;0.213	B;B;B;B;B;D;B	0.67725	0.099;0.141;0.046;0.047;0.281;0.953;0.031	T	0.58194	-0.7679	10	0.25751	T	0.34	-32.5811	13.0652	0.59030	0.0:0.0:0.1343:0.8657	.	1625;1615;1629;1487;1484;1597;1484	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.	S	1625;1497;1487;1484;1629;1484;1484;1497;1487;1652	ENSP00000366314:N1625S;ENSP00000366310:N1497S;ENSP00000354066:N1487S;ENSP00000366309:N1484S;ENSP00000350140:N1629S;ENSP00000386127:N1484S;ENSP00000379581:N1484S;ENSP00000379587:N1497S;ENSP00000350791:N1487S;ENSP00000389542:N1652S	ENSP00000350140:N1629S	N	-	2	0	0	TRPM3	72340939	72340939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.505000	0.66981	0.985000	0.38656	0.533000	0.62120	AAC	0.129187		TCGA-IB-8126-01A-11D-2396-08	0.552	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	0	0	1	2	19	2	2	1	1	1	1	440	440	440	438	1	3.970000	-6.187704	1	0.090000	NM_206945		0	97	97	0	2227	2203	0		1			1	0	440	0	0	1.000000	0	0	0	0	0	0	97	2227
P2RY8	286530	broad.mit.edu	37	X	1584602	1584602	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chrX:1584602G>T	ENST00000381297.4	-	2	1060	c.850C>A	c.(850-852)Ctc>Atc	p.L284I	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGTTGTTGAGGCAGCTGAGA	0.587			T	CRLF2	"""B-ALL, Downs associated ALL"""																																	ENST00000381297.4	1.000000	5.200000e-01	1	6.500000e-01	0.810000	0.817780	0.810000	1.000000				Dom	yes			Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	Xp22.3; Yp11.3	286530	T	"""purinergic receptor P2Y, G-protein coupled, 8"""				L	L	CRLF2		B-ALL, Downs associated ALL		0				23						c.(850-852)Ctc>Atc		purinergic receptor P2Y, G-protein coupled, 8							119.0	117.0	118.0					X																	1584602		2203	4296	6499	SO:0001583	missense	286530	0	0					g.chrX:1584602G>T	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.850C>A	chrX.hg19:g.1584602G>T	ENSP00000370697:p.Leu284Ile						P2RY8_ENST00000460672.1_5'Flank	p.L284I	NM_178129.4	NP_835230.1	0	1	1		Q86VZ1	P2RY8_HUMAN		2	1060	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)		Missense_Mutation	SNP	ENST00000381297.4	1	1	hg19	c.850C>A	CCDS14115.1	0	.	.	.	.	.	.	.	.	.	.	g	11.73	1.724334	0.30593	.	.	ENSG00000182162	ENST00000381297	T	0.20598	2.06	2.73	2.73	0.32206	2.73	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.191682	0.34110	U	0.004251	T	0.18551	0.0445	L	0.52759	1.655	0.09310	N	1	B	0.33494	0.414	B	0.38327	0.271	T	0.11275	-1.0594	10	0.23891	T	0.37	.	6.3011	0.21113	0.3491:0.0:0.6509:0.0	.	284	Q86VZ1	P2RY8_HUMAN	I	284	ENSP00000370697:L284I	ENSP00000370697:L284I	L	-	1	0	0	P2RY8	1544602	1544602	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	0.594000	0.24014	1.007000	0.39238	0.279000	0.19357	CTC	0.090000		TCGA-IB-8126-01A-11D-2396-08	0.587	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	0	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	3.970000	-3.580398	1	0.090000	NM_178129		0	21	20	0	551	544	0		1	0		0	0	97	0	0	0.999997	6.576327e-02	0	0	0	11	0	21	551
AKAP4	8852	broad.mit.edu	37	X	49957303	49957303	+	Silent	SNP	A	A	G			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chrX:49957303A>G	ENST00000376056.2	-	5	2184	c.2034T>C	c.(2032-2034)agT>agC	p.S678S	AKAP4_ENST00000376064.3_Silent_p.S678S|AKAP4_ENST00000358526.2_Silent_p.S687S|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Silent_p.S304S					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GCTTCATCCCACTGGTACAGT	0.478																																						ENST00000376056.2	1.000000	3.500000e-01	9.400000e-01	5.000000e-01	0.700000	0.714435	0.700000	1.000000																										0				41						c.(2032-2034)agT>agC		A kinase (PRKA) anchor protein 4							126.0	92.0	104.0					X																	49957303		2203	4300	6503	SO:0001819	synonymous_variant	8852	0	0					g.chrX:49957303A>G	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2034T>C	chrX.hg19:g.49957303A>G							AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Silent_p.S304S|AKAP4_ENST00000358526.2_Silent_p.S687S|AKAP4_ENST00000376064.3_Silent_p.S678S	p.S678S			0	1	1					5	2184	-	Ovarian(276;0.236)			Silent	SNP	ENST00000376056.2	1	1	hg19	c.2034T>C	CCDS14330.1	0																																																																																								0.090000		TCGA-IB-8126-01A-11D-2396-08	0.478	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	0	0	1	2	13	2	2	1	1	1	1	84	84	84	84	1	3.970000	-10.280390	1	0.090000	NM_003886		0	9	9	0	282	281	0		0			1	0	84	0	0	0.252370	0	0	0	0	0	0	9	282
SLC7A3	84889	broad.mit.edu	37	X	70146816	70146816	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-8126-01A-11D-2396-08	TCGA-IB-8126-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39fccb1b-b1fb-4a1f-bb83-beaefa163ff1	6e08a2fc-e7b8-4811-a7c5-e676767d0e8a	g.chrX:70146816C>A	ENST00000374299.3	-	9	1506	c.1362G>T	c.(1360-1362)gaG>gaT	p.E454D	SLC7A3_ENST00000298085.4_Missense_Mutation_p.E454D			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	454					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GGGTCAACTTCTCTGATTCAG	0.468																																						ENST00000374299.3	1.000000	6.900000e-01	1	8.900000e-01	0.990000	0.961782	0.990000	1.000000																										0				31						c.(1360-1362)gaG>gaT		solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						124.0	116.0	119.0					X																	70146816		2203	4300	6503	SO:0001583	missense	84889	0	0					g.chrX:70146816C>A	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1362G>T	chrX.hg19:g.70146816C>A	ENSP00000363417:p.Glu454Asp						SLC7A3_ENST00000298085.4_Missense_Mutation_p.E454D	p.E454D			0	1	1		Q8WY07	CTR3_HUMAN		9	1506	-	Renal(35;0.156)		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	1	1	hg19	c.1362G>T	CCDS14404.1	1	.	.	.	.	.	.	.	.	.	.	C	9.547	1.114898	0.20795	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88664	-2.41;-2.41	5.31	2.39	0.29439	5.31	2.39	0.29439	.	0.537794	0.13865	U	0.357372	D	0.86301	0.5900	L	0.46157	1.445	0.09310	N	0.999999	B	0.23650	0.089	B	0.35727	0.209	T	0.76189	-0.3050	10	0.44086	T	0.13	.	9.0769	0.36527	0.0:0.7342:0.0:0.2658	.	454	Q8WY07	CTR3_HUMAN	D	454	ENSP00000363417:E454D;ENSP00000298085:E454D	ENSP00000298085:E454D	E	-	3	2	2	SLC7A3	70063541	70063541	0.579000	0.26725	0.881000	0.34555	0.226000	0.24999	0.230000	0.17852	0.158000	0.19367	0.529000	0.55759	GAG	0.090000		TCGA-IB-8126-01A-11D-2396-08	0.468	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	3.970000	-18.789010	1	0.090000	NM_032803		0	17	17	0	313	310	0		1	0		0	0	68	0	0	0.999966	0	0	0	0	1	0	17	313
