#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
DHX30	22907	broad.mit.edu	37	3	47889357	47889358	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			AT	-	AT	AT		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr3:47889357_47889358delAT	ENST00000445061.1	+	14	2604_2605	c.2197_2198delAT	c.(2197-2199)attfs	p.I733fs	DHX30_ENST00000348968.4_Frame_Shift_Del_p.I705fs|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Frame_Shift_Del_p.I761fs|DHX30_ENST00000446256.2_Frame_Shift_Del_p.I694fs	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	733	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGCCACCAACATTGCTGAGACT	0.535																																						ENST00000445061.1	0.800000	0.330000	0.680000	0.430000	0.540000	0.558479	0.540000	0.530000																										0				37						c.(2197-2199)attfs		DEAH (Asp-Glu-Ala-His) box helicase 30																																				SO:0001589	frameshift_variant	22907	0	0					g.chr3:47889357_47889358delAT	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.2197_2198delAT	chr3.hg19:g.47889357_47889358delAT	ENSP00000405620:p.Ile733fs	1					DHX30_ENST00000446256.2_Frame_Shift_Del_p.I694fs|DHX30_ENST00000348968.4_Frame_Shift_Del_p.I705fs|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Frame_Shift_Del_p.I761fs	p.I733fs	NM_138615.2	NP_619520.1	0	1	1	1.887303	Q7L2E3	DHX30_HUMAN		14	2604_2605	+			A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Frame_Shift_Del	DEL	ENST00000445061.1	0	1	hg19	c.2197_2198delAT	CCDS2759.1	0																																																																																								0.168826		TCGA-IB-A5SO-01A-11D-A32N-08	0.535	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	1	0	1		2	2		0	0	0	0	59	0	59	59	1	1.870000	-19.996020	1	0.230000	NM_138615		0	18	20	0	249	249	0	0	1	1	0	0	0	59	0	0	0.999986	9.925499e-01	0	2	0	110	0	18	249
C10orf2	56652	broad.mit.edu	37	10	102748967	102748967	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr10:102748967C>T	ENST00000311916.2	+	1	1185	c.1000C>T	c.(1000-1002)Cga>Tga	p.R334*	MRPL43_ENST00000370241.3_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank|C10orf2_ENST00000370228.1_Nonsense_Mutation_p.R334*|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000370236.1_5'Flank|MRPL43_ENST00000299179.5_5'Flank	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	334			R -> P (in PEOA3). {ECO:0000269|PubMed:18575922}.|R -> Q (in PEO; sporadic case; the patient also carries the S-848 mutation in the POLG gene suggesting digenic inheritance; dbSNP:rs28937887). {ECO:0000269|PubMed:12707443, ECO:0000269|PubMed:12872260, ECO:0000269|PubMed:20479361}.		cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CTTCTTGGTGCGACCAGGAGA	0.572																																						ENST00000311916.2	1.000000	0.430000	0.870000	0.540000	0.680000	0.703523	0.680000	0.650000																										0				24						c.(1000-1002)Cga>Tga		chromosome 10 open reading frame 2							61.0	59.0	60.0					10																	102748967		2203	4300	6503	SO:0001587	stop_gained	56652	2	121412	38				g.chr10:102748967C>T	AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.1000C>T	chr10.hg19:g.102748967C>T	ENSP00000309595:p.Arg334*	0					MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank|C10orf2_ENST00000370228.1_Nonsense_Mutation_p.R334*|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000370241.3_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|MRPL43_ENST00000370236.1_5'Flank	p.R334*	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	1	2	3	2.064678	Q96RR1	PEO1_HUMAN		1	1185	+		Colorectal(252;0.122)|all_hematologic(284;0.152)	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Nonsense_Mutation	SNP	ENST00000311916.2	0	1	hg19	c.1000C>T	CCDS7506.1	0	.	.	.	.	.	.	.	.	.	.	c	22.3	4.269486	0.80469	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	.	.	.	5.9	2.63	0.31362	5.9	2.63	0.31362	.	0.176895	0.49916	D	0.000131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.1322	10.4927	0.44760	0.2696:0.6067:0.1237:0.0	.	.	.	.	X	334	.	ENSP00000309595:R334X	R	+	1	2	2	C10orf2	102738957	102738957	1.000000	0.71417	1.000000	0.80357	0.332000	0.28634	2.501000	0.45389	1.443000	0.47586	0.457000	0.33378	CGA	0.238754		TCGA-IB-A5SO-01A-11D-A32N-08	0.572	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049886.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.870000	-3.142713	1	0.230000	NM_021830		0	23	23	0	283	280	0		1	1		0	0	65	0	0	0.999999	2.401563e-01	0	2	0	10	0	23	283
EPS8L2	64787	broad.mit.edu	37	11	722406	722406	+	Silent	SNP	C	C	T	rs146372566		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:722406C>T	ENST00000533256.1	+	14	1440	c.1065C>T	c.(1063-1065)gtC>gtT	p.V355V	EPS8L2_ENST00000530636.1_Silent_p.V355V|EPS8L2_ENST00000526198.1_Silent_p.V371V|EPS8L2_ENST00000318562.8_Silent_p.V355V|AP006621.9_ENST00000527021.2_RNA			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	355					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCAGATCGTCAACACCTGCA	0.657																																						ENST00000533256.1	0.950000	0.410000	0.800000	0.520000	0.650000	0.667567	0.650000	0.640000																										0				13						c.(1063-1065)gtC>gtT		EPS8-like 2				1,4405	2.1+/-5.4	0,1,2202	82.0	73.0	76.0		1065	1.0	1.0	11	dbSNP_134	76	0,8600		0,0,4300	no	coding-synonymous	EPS8L2	NM_022772.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		355/716	722406	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64787	0	0					g.chr11:722406C>T	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1065C>T	chr11.hg19:g.722406C>T		0					AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000526198.1_Silent_p.V371V|EPS8L2_ENST00000530636.1_Silent_p.V355V|EPS8L2_ENST00000318562.8_Silent_p.V355V	p.V355V			0	0	0	1.979230	Q9H6S3	ES8L2_HUMAN		14	1440	+		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Silent	SNP	ENST00000533256.1	1	1	hg19	c.1065C>T	CCDS31328.1	0																																																																																								0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.657	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.870000	-19.999970	1	0.230000	NM_022772		0	19	20	0	228	225	0		1	1		0	0	69	0	0	0.999992	9.999998e-01	0	155	0	194	0	19	228
PTPN5	84867	broad.mit.edu	37	11	18754215	18754215	+	Missense_Mutation	SNP	G	G	A	rs367543224		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:18754215G>A	ENST00000358540.2	-	12	1683	c.1253C>T	c.(1252-1254)gCg>gTg	p.A418V	PTPN5_ENST00000396168.1_Missense_Mutation_p.A394V|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396166.3_5'Flank|PTPN5_ENST00000477854.1_Missense_Mutation_p.A222V|PTPN5_ENST00000396171.4_Missense_Mutation_p.A418V|PTPN5_ENST00000396170.1_Missense_Mutation_p.A386V|PTPN5_ENST00000396167.2_Missense_Mutation_p.A386V	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	418	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						ACCGTCGTACGCCACCTGCTC	0.572											OREG0020824	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000358540.2	0.680000	0.310000	0.580000	0.390000	0.480000	0.493100	0.480000	0.480000																										0				27						c.(1252-1254)gCg>gTg		protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)							140.0	126.0	131.0					11																	18754215		2199	4293	6492	SO:0001583	missense	84867	2	121412	38				g.chr11:18754215G>A	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1253C>T	chr11.hg19:g.18754215G>A	ENSP00000351342:p.Ala418Val	0		OREG0020824	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	728	PTPN5_ENST00000396170.1_Missense_Mutation_p.A386V|PTPN5_ENST00000396167.2_Missense_Mutation_p.A386V|PTPN5_ENST00000477854.1_Missense_Mutation_p.A222V|PTPN5_ENST00000396166.3_5'Flank|PTPN5_ENST00000396171.4_Missense_Mutation_p.A418V|PTPN5_ENST00000396168.1_Missense_Mutation_p.A394V|RP11-1081L13.4_ENST00000527285.1_RNA	p.A418V	NM_006906.1	NP_008837.1	0	0	0	1.979230	P54829	PTN5_HUMAN		12	1683	-			B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	1	1	hg19	c.1253C>T	CCDS7845.1	0	.	.	.	.	.	.	.	.	.	.	g	6.138	0.393746	0.11638	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.55	3.19	0.36642	5.55	3.19	0.36642	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.490245	0.20026	N	0.100810	T	0.56819	0.2011	N	0.04746	-0.17	0.21416	N	0.999693	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47446	-0.9117	10	0.02654	T	1	.	4.3729	0.11256	0.6621:0.0:0.1925:0.1454	.	418;386	P54829;B3KXG7	PTN5_HUMAN;.	V	222;418;386;418;386;394	ENSP00000435056:A222V;ENSP00000351342:A418V;ENSP00000379473:A386V;ENSP00000379474:A418V;ENSP00000379470:A386V;ENSP00000379471:A394V	ENSP00000351342:A418V	A	-	2	0	0	PTPN5	18710791	18710791	0.453000	0.25721	0.545000	0.28153	0.995000	0.86356	1.154000	0.31688	0.372000	0.24591	-0.285000	0.09966	GCG	0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.572	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	1.870000	-3.221177	1	0.230000	NM_001039970		0	25	24	0	415	409	0		1	0		0	0	93	0	0	1.000000	9.618080e-02	0	0	0	9	0	25	415
SLC5A12	159963	broad.mit.edu	37	11	26725427	26725427	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:26725427G>A	ENST00000396005.3	-	5	902	c.593C>T	c.(592-594)aCg>aTg	p.T198M	SLC5A12_ENST00000280467.6_Missense_Mutation_p.T198M	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	198					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AATGAGAACCGTTAAGAAGCC	0.403																																						ENST00000396005.3	0.220000	0.040000	0.170000	0.070000	0.110000	0.124844	0.110000	0.110000																										0				35						c.(592-594)aCg>aTg		solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12							235.0	215.0	222.0					11																	26725427		2203	4299	6502	SO:0001583	missense	159963	0	0					g.chr11:26725427G>A	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.593C>T	chr11.hg19:g.26725427G>A	ENSP00000379326:p.Thr198Met	0					SLC5A12_ENST00000280467.6_Missense_Mutation_p.T198M	p.T198M	NM_178498.3	NP_848593.2	0	0	0	1.979230	Q1EHB4	SC5AC_HUMAN		5	902	-			Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	0	1	hg19	c.593C>T	CCDS7860.2	0	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161956	0.78226	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.88046	-2.33;-2.33;-2.33	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.058040	0.64402	D	0.000003	D	0.91212	0.7231	L	0.46670	1.46	0.39532	D	0.968674	D;D	0.69078	0.978;0.997	P;D	0.67725	0.707;0.953	D	0.92534	0.6036	10	0.72032	D	0.01	.	18.6369	0.91382	0.0:0.0:1.0:0.0	.	198;198	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	M	198;198;10	ENSP00000379326:T198M;ENSP00000280467:T198M;ENSP00000435053:T10M	ENSP00000280467:T198M	T	-	2	0	0	SLC5A12	26682003	26682003	1.000000	0.71417	0.936000	0.37596	0.978000	0.69477	7.957000	0.87870	2.412000	0.81896	0.484000	0.47621	ACG	0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.403	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	0	0	1	2	2	2	2	0	0	0	0	141	141	141	141	1	1.870000	-2.139137	0	0.230000	NM_178498		0	7	6	0	529	523	0		1			0	0	141	0	0	0.979798	0	0	0	0	0	0	7	529
FOSL1	8061	broad.mit.edu	37	11	65661489	65661489	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:65661489T>A	ENST00000312562.2	-	3	587	c.401A>T	c.(400-402)cAg>cTg	p.Q134L	FOSL1_ENST00000531493.1_Intron|FOSL1_ENST00000448083.2_Intron|FOSL1_ENST00000532401.1_Silent_p.A132A	NM_005438.3	NP_005429.1	P15407	FOSL1_HUMAN	FOS-like antigen 1	134	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|chemotaxis (GO:0006935)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)|vitellogenesis (GO:0007296)	cytosol (GO:0005829)|neuron projection (GO:0043005)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	10				READ - Rectum adenocarcinoma(159;0.168)		GCTCACCGCCTGCAGGAAGTC	0.657																																						ENST00000312562.2	1.000000	0.200000	1.000000	0.380000	0.660000	0.669880	0.660000	1.000000																										0				10						c.(400-402)cAg>cTg		FOS-like antigen 1							35.0	30.0	31.0					11																	65661489		2200	4295	6495	SO:0001583	missense	8061	0	0					g.chr11:65661489T>A	BC016648	CCDS8121.1, CCDS73324.1	11q13	2013-01-10			ENSG00000175592	ENSG00000175592		"""basic leucine zipper proteins"""	13718	protein-coding gene	gene with protein product		136515				2107490	Standard	XM_005274311		Approved	fra-1	uc001ogg.1	P15407	OTTHUMG00000166715	ENST00000312562.2:c.401A>T	chr11.hg19:g.65661489T>A	ENSP00000310170:p.Gln134Leu	0					FOSL1_ENST00000448083.2_Intron|FOSL1_ENST00000531493.1_Intron|FOSL1_ENST00000532401.1_Silent_p.A132A	p.Q134L	NM_005438.3	NP_005429.1	0	0	0	1.979230	P15407	FOSL1_HUMAN		3	587	-			B4DR11|Q6FG51	Missense_Mutation	SNP	ENST00000312562.2	0	1	hg19	c.401A>T	CCDS8121.1	0	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791078	0.90367	.	.	ENSG00000175592	ENST00000312562	T	0.56444	0.46	4.26	4.26	0.50523	4.26	4.26	0.50523	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.120965	0.56097	D	0.000025	T	0.69278	0.3093	M	0.75777	2.31	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.73512	-0.3959	10	0.87932	D	0	-19.5225	11.6688	0.51389	0.0:0.0:0.0:1.0	.	134	P15407	FOSL1_HUMAN	L	134	ENSP00000310170:Q134L	ENSP00000310170:Q134L	Q	-	2	0	0	FOSL1	65418065	65418065	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.533000	0.81994	1.931000	0.55961	0.528000	0.53228	CAG	0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.657	FOSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391168.2	0	0	0	2	2	2	2	0	0	0	0	10	10	10	10	1	1.870000	-8.245490	1	0.230000	NM_005438		0	3	2	0	38	38	0		1	0		0	0	10	0	0	0.804735	9.791946e-01	0	0	0	110	0	3	38
KLC2	64837	broad.mit.edu	37	11	66029444	66029444	+	Splice_Site	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:66029444G>A	ENST00000417856.1	+	3	702		c.e3+1		KLC2_ENST00000394078.1_Splice_Site|KLC2_ENST00000394066.2_Intron|KLC2_ENST00000421552.1_Intron|KLC2_ENST00000394065.2_Splice_Site|KLC2_ENST00000316924.5_Splice_Site|RP11-755F10.3_ENST00000533576.1_RNA|KLC2_ENST00000394067.2_Splice_Site|RP11-867G23.1_ENST00000530805.1_RNA	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)	p.?(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						CTCCCCTAACGTGAGCTCCTA	0.632																																						ENST00000417856.1	0.570000	0.090000	0.420000	0.160000	0.270000	0.297849	0.270000	0.240000																										1	Unknown(1)	p.?(1)	upper_aerodigestive_tract(1)	24						c.e3+1		kinesin light chain 2							64.0	48.0	53.0					11																	66029444		2200	4295	6495	SO:0001630	splice_region_variant	64837	1	121408	33				g.chr11:66029444G>A	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.459+1G>A	chr11.hg19:g.66029444G>A		0					RP11-867G23.1_ENST00000530805.1_RNA|KLC2_ENST00000316924.5_Splice_Site|KLC2_ENST00000394066.2_Intron|KLC2_ENST00000394065.2_Splice_Site|RP11-755F10.3_ENST00000533576.1_RNA|KLC2_ENST00000394078.1_Splice_Site|KLC2_ENST00000394067.2_Splice_Site|KLC2_ENST00000421552.1_Intron		NM_001134775.1	NP_001128247.1	0	0	0	1.979230	Q9H0B6	KLC2_HUMAN		3	702	+			A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Splice_Site	SNP	ENST00000417856.1	0	1	hg19		CCDS8130.1	0	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461432	0.43736	.	.	ENSG00000174996	ENST00000417856;ENST00000440228;ENST00000394067;ENST00000316924;ENST00000394078;ENST00000475757;ENST00000394065	.	.	.	4.15	3.19	0.36642	4.15	3.19	0.36642	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7987	0.46476	0.0:0.1934:0.8066:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	KLC2	65786020	65786020	0.352000	0.24895	0.715000	0.30552	0.343000	0.28985	2.337000	0.43947	0.897000	0.36392	0.561000	0.74099	.	0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.632	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	0	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.870000	-6.702899	1	0.230000	NM_022822	Intron	0	4	4	0	132	132	0		1	0		0	0	27	0	0	0.891506	1.563966e-03	0	1	0	1	0	4	132
FAT3	120114	broad.mit.edu	37	11	92523233	92523233	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:92523233G>A	ENST00000298047.6	+	7	4477	c.4460G>A	c.(4459-4461)aGa>aAa	p.R1487K	FAT3_ENST00000409404.2_Missense_Mutation_p.R1487K|FAT3_ENST00000525166.1_Missense_Mutation_p.R1337K			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1487	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCCACAGATAGAGATGAGAAG	0.473										TCGA Ovarian(4;0.039)																												ENST00000298047.6	0.990000	0.550000	0.880000	0.650000	0.760000	0.770774	0.760000	0.760000																										0				85						c.(4459-4461)aGa>aAa		FAT atypical cadherin 3							188.0	182.0	184.0					11																	92523233		2084	4228	6312	SO:0001583	missense	120114	0	0					g.chr11:92523233G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4460G>A	chr11.hg19:g.92523233G>A	ENSP00000298047:p.Arg1487Lys	0	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Missense_Mutation_p.R1337K|FAT3_ENST00000409404.2_Missense_Mutation_p.R1487K	p.R1487K			0	0	0	1.979230	Q8TDW7	FAT3_HUMAN		7	4477	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	1	1	hg19	c.4460G>A		0	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991286	0.35131	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01685	4.69;4.69;4.69	6.17	5.27	0.74061	6.17	5.27	0.74061	.	.	.	.	.	T	0.01189	0.0039	N	0.11927	0.2	0.80722	D	1	B	0.21753	0.06	B	0.19666	0.026	T	0.41893	-0.9483	9	0.02654	T	1	.	11.64	0.51227	0.1347:0.0:0.8653:0.0	.	1487	Q8TDW7-3	.	K	1487;1487;1337	ENSP00000298047:R1487K;ENSP00000387040:R1487K;ENSP00000432586:R1337K	ENSP00000298047:R1487K	R	+	2	0	0	FAT3	92162881	92162881	1.000000	0.71417	0.562000	0.28370	0.866000	0.49608	4.904000	0.63279	1.636000	0.50526	0.655000	0.94253	AGA	0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.473	FAT3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	113	113	113	112	1	1.870000	-11.542060	1	0.230000	NM_001008781		0	40	40	0	403	400	0		1			0	0	113	0	0	1.000000	0	0	0	0	0	0	40	403
ADAMTS15	170689	broad.mit.edu	37	11	130319167	130319167	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr11:130319167G>A	ENST00000299164.2	+	1	299	c.299G>A	c.(298-300)cGc>cAc	p.R100H		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	100						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GACCTGCGACGCTGCTTCTAT	0.677																																						ENST00000299164.2	1.000000	0.660000	1.000000	0.760000	0.880000	0.881192	0.880000	1.000000																										0				36						c.(298-300)cGc>cAc		ADAM metallopeptidase with thrombospondin type 1 motif, 15							41.0	49.0	46.0					11																	130319167		2198	4295	6493	SO:0001583	missense	170689	0	0					g.chr11:130319167G>A	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.299G>A	chr11.hg19:g.130319167G>A	ENSP00000299164:p.Arg100His	0						p.R100H	NM_139055.2	NP_620686.1	0	0	0	1.979230	Q8TE58	ATS15_HUMAN		1	299	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	1	1	hg19	c.299G>A	CCDS8488.1	1	.	.	.	.	.	.	.	.	.	.	G	9.717	1.158526	0.21454	.	.	ENSG00000166106	ENST00000299164	T	0.04551	3.6	4.63	3.69	0.42338	4.63	3.69	0.42338	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.02047	0.0064	N	0.03154	-0.405	0.22096	N	0.999367	B	0.19817	0.039	B	0.16722	0.016	T	0.47598	-0.9105	9	0.17369	T	0.5	.	4.0747	0.09899	0.2047:0.2129:0.5824:0.0	.	100	Q8TE58	ATS15_HUMAN	H	100	ENSP00000299164:R100H	ENSP00000299164:R100H	R	+	2	0	0	ADAMTS15	129824377	129824377	0.077000	0.21312	0.717000	0.30585	0.993000	0.82548	0.552000	0.23376	1.245000	0.43885	0.561000	0.74099	CGC	0.208145		TCGA-IB-A5SO-01A-11D-A32N-08	0.677	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	1	0	1	2	2	2	2	0	0	0	0	114	114	114	112	1	1.870000	-15.607740	1	0.230000	NM_139055		0	45	44	0	383	380	0		1			0	0	114	0	0	1.000000	0	0	0	0	0	0	45	383
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.480000	1.000000	0.690000	0.970000	0.880578	0.970000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.077328	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	1.870000	-6.860924	1	0.230000	NM_033360		901	9	9	7113	77	76	0	1	1	1	1	0	0	26	283	1	0.994775	9.356873e-01	1	13	34	31	461	9	77
POU6F1	5463	broad.mit.edu	37	12	51586202	51586202	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr12:51586202G>A	ENST00000389243.4	-	9	1241	c.302C>T	c.(301-303)gCc>gTc	p.A101V	POU6F1_ENST00000550824.1_Missense_Mutation_p.A101V|POU6F1_ENST00000333640.10_Missense_Mutation_p.A101V			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	101	Gln/Pro-rich.				brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						AGCTGGGCTGGCAATGACCAC	0.612																																						ENST00000389243.4	1.000000	0.030000	0.180000	0.060000	0.100000	0.194134	0.100000	0.090000																										0				11						c.(301-303)gCc>gTc		POU class 6 homeobox 1							90.0	88.0	89.0					12																	51586202		2203	4300	6503	SO:0001583	missense	5463	0	0					g.chr12:51586202G>A	AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.302C>T	chr12.hg19:g.51586202G>A	ENSP00000373895:p.Ala101Val	0					POU6F1_ENST00000550824.1_Missense_Mutation_p.A101V|POU6F1_ENST00000333640.10_Missense_Mutation_p.A101V	p.A101V			1	2	3	2.077328	Q14863	PO6F1_HUMAN		9	1241	-			Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	ENST00000389243.4	0	1	hg19	c.302C>T	CCDS31803.1	0	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577348	0.45902	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.86230	-2.09;-2.09;-2.09	5.69	4.75	0.60458	5.69	4.75	0.60458	.	0.553568	0.20789	N	0.085655	T	0.81302	0.4794	L	0.34521	1.04	0.25496	N	0.987598	B	0.14438	0.01	B	0.04013	0.001	T	0.70342	-0.4898	10	0.40728	T	0.16	.	15.0878	0.72167	0.0:0.1424:0.8576:0.0	.	101	Q14863	PO6F1_HUMAN	V	101	ENSP00000373895:A101V;ENSP00000330190:A101V;ENSP00000448389:A101V	ENSP00000330190:A101V	A	-	2	0	0	POU6F1	49872469	49872469	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	3.445000	0.52921	2.695000	0.91970	0.655000	0.94253	GCC	0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.612	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405126.1	0	0	1	2	14	3	2	1	1	1	1	128	128	128	125	1	1.870000	-2.500785	1	0.230000	NM_002702		0	5	5	0	480	472	0		0	0		1	0	128	0	0	0.027485	8.125651e-03	0	0	0	30	0	5	480
ESPL1	9700	broad.mit.edu	37	12	53663505	53663505	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr12:53663505G>A	ENST00000257934.4	+	3	870	c.779G>A	c.(778-780)cGt>cAt	p.R260H	ESPL1_ENST00000552462.1_Missense_Mutation_p.R260H	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	260					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GAACACTGCCGTCGCTTTTGC	0.572																																					Colon(53;1069 1201 2587 5382)	ENST00000257934.4	1.000000	0.050000	0.230000	0.080000	0.140000	0.226845	0.140000	0.130000																										0				70						c.(778-780)cGt>cAt		extra spindle pole bodies homolog 1 (S. cerevisiae)							67.0	67.0	67.0					12																	53663505		2203	4300	6503	SO:0001583	missense	9700	5	121412	38				g.chr12:53663505G>A	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.779G>A	chr12.hg19:g.53663505G>A	ENSP00000257934:p.Arg260His	0					ESPL1_ENST00000552462.1_Missense_Mutation_p.R260H	p.R260H	NM_012291.4	NP_036423.4	1	2	3	2.077328	Q14674	ESPL1_HUMAN		3	870	+				Missense_Mutation	SNP	ENST00000257934.4	0	1	hg19	c.779G>A	CCDS8852.1	0	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429533	0.83776	.	.	ENSG00000135476	ENST00000257934;ENST00000552462	T;T	0.15256	2.44;2.44	5.41	4.5	0.54988	5.41	4.5	0.54988	.	0.131175	0.50627	D	0.000102	T	0.36663	0.0975	M	0.72118	2.19	0.37632	D	0.921717	D	0.89917	1.0	D	0.63283	0.913	T	0.18116	-1.0347	9	.	.	.	.	13.5552	0.61756	0.0776:0.0:0.9224:0.0	.	260	Q14674	ESPL1_HUMAN	H	260	ENSP00000257934:R260H;ENSP00000449831:R260H	.	R	+	2	0	0	ESPL1	51949772	51949772	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	4.064000	0.57506	2.815000	0.96918	0.561000	0.74099	CGT	0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.572	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	0	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	1.870000	-2.885850	1	0.230000	NM_012291		0	6	6	0	417	414	0		1	0		0	0	107	0	0	0.964453	3.093068e-04	0	0	0	2	0	6	417
COL4A1	1282	broad.mit.edu	37	13	110857876	110857876	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr13:110857876C>T	ENST00000375820.4	-	16	989	c.868G>A	c.(868-870)Gga>Aga	p.G290R	COL4A1_ENST00000543140.1_Missense_Mutation_p.G290R	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	290	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCATCTTTTCCGGGTTTGCCC	0.473																																						ENST00000375820.4	1.000000	0.060000	0.300000	0.090000	0.140000	0.280539	0.140000	0.130000																										0				105						c.(868-870)Gga>Aga		collagen, type IV, alpha 1							127.0	147.0	140.0					13																	110857876		2203	4300	6503	SO:0001583	missense	1282	1	121412	31				g.chr13:110857876C>T	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.868G>A	chr13.hg19:g.110857876C>T	ENSP00000364979:p.Gly290Arg	0					COL4A1_ENST00000543140.1_Missense_Mutation_p.G290R	p.G290R	NM_001845.4	NP_001836.2	1	2	3	2.119712	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)	16	989	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	0	1	hg19	c.868G>A	CCDS9511.1	0	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460326	0.43736	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.99353	-5.77;-5.77	4.61	4.61	0.57282	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97186	0.9854	10	0.87932	D	0	.	17.8452	0.88728	0.0:1.0:0.0:0.0	.	290	P02462	CO4A1_HUMAN	R	279;290;290;290	ENSP00000364979:G290R;ENSP00000443348:G290R	ENSP00000364973:G279R	G	-	1	0	0	COL4A1	109655877	109655877	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	6.226000	0.72277	2.280000	0.76307	0.551000	0.68910	GGA	0.248157		TCGA-IB-A5SO-01A-11D-A32N-08	0.473	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3	0	0	1	2	2	2	2	0	0	0	0	148	148	148	148	1	1.870000	-2.185200	0	0.230000			0	9	9	0	596	586	0		1	0		0	0	148	0	0	0.993819	9.952571e-01	0	0	0	629	0	9	596
EFS	10278	broad.mit.edu	37	14	23829227	23829227	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr14:23829227C>T	ENST00000216733.3	-	4	1067	c.460G>A	c.(460-462)Gcc>Acc	p.A154T	EFS_ENST00000429593.2_Missense_Mutation_p.A61T|EFS_ENST00000351354.3_Missense_Mutation_p.A61T	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	154	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		ACCCGGAGGGCGGTGGGGGGC	0.637																																						ENST00000216733.3	0.250000	0.040000	0.190000	0.070000	0.120000	0.134837	0.120000	0.110000																										0				16						c.(460-462)Gcc>Acc		embryonal Fyn-associated substrate							36.0	41.0	39.0					14																	23829227		2200	4295	6495	SO:0001583	missense	10278	0	0					g.chr14:23829227C>T	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.460G>A	chr14.hg19:g.23829227C>T	ENSP00000216733:p.Ala154Thr	1					EFS_ENST00000351354.3_Missense_Mutation_p.A61T|EFS_ENST00000429593.2_Missense_Mutation_p.A61T	p.A154T	NM_005864.2	NP_005855.1	0	1	1	1.891540	O43281	EFS_HUMAN		4	1067	-	all_cancers(95;7.12e-06)		B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	ENST00000216733.3	0	1	hg19	c.460G>A	CCDS9595.1	0	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207479	0.58343	.	.	ENSG00000100842	ENST00000216733;ENST00000351354;ENST00000429593	T;T;T	0.57907	0.37;0.67;0.8	5.32	4.42	0.53409	5.32	4.42	0.53409	.	0.471664	0.23237	N	0.050387	T	0.47377	0.1442	M	0.62723	1.935	0.33255	D	0.558962	P;P;P	0.52577	0.94;0.954;0.923	B;B;B	0.41619	0.259;0.361;0.198	T	0.60449	-0.7261	10	0.26408	T	0.33	-7.6625	10.4055	0.44254	0.0:0.907:0.0:0.093	.	61;61;154	B4DJ56;O43281-2;O43281	.;.;EFS_HUMAN	T	154;61;61	ENSP00000216733:A154T;ENSP00000340607:A61T;ENSP00000416684:A61T	ENSP00000216733:A154T	A	-	1	0	0	EFS	22899067	22899067	0.981000	0.34729	0.903000	0.35520	0.393000	0.30537	1.155000	0.31700	1.450000	0.47717	0.563000	0.77884	GCC	0.165719		TCGA-IB-A5SO-01A-11D-A32N-08	0.637	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2	0	0	1	2	2	2	2	0	0	0	0	102	102	102	101	1	1.870000	-3.035067	1	0.230000			0	5	5	0	345	342	0		1	0		0	0	102	0	0	0.936553	1.256457e-01	0	0	0	35	0	5	345
AKAP6	9472	broad.mit.edu	37	14	33290803	33290803	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr14:33290803G>A	ENST00000280979.4	+	13	3954	c.3784G>A	c.(3784-3786)Gac>Aac	p.D1262N	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1262					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CCCTGGTTATGACGAGGAGGC	0.448																																					Melanoma(49;821 1200 7288 13647 42351)	ENST00000280979.4	0.430000	0.080000	0.320000	0.130000	0.210000	0.235827	0.210000	0.200000																										0				122						c.(3784-3786)Gac>Aac		A kinase (PRKA) anchor protein 6							108.0	93.0	98.0					14																	33290803		2203	4300	6503	SO:0001583	missense	9472	0	0					g.chr14:33290803G>A	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3784G>A	chr14.hg19:g.33290803G>A	ENSP00000280979:p.Asp1262Asn	1					AKAP6_ENST00000557272.1_Intron	p.D1262N	NM_004274.4	NP_004265.3	0	1	1	1.891540	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	13	3954	+	Breast(36;0.0388)|Prostate(35;0.15)		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	0	1	hg19	c.3784G>A	CCDS9644.1	0	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367025	0.41902	.	.	ENSG00000151320	ENST00000280979	T	0.05319	3.46	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.414559	0.26828	N	0.022293	T	0.05273	0.0140	N	0.14661	0.345	0.80722	D	1	B	0.32245	0.361	B	0.21360	0.034	T	0.45026	-0.9289	10	0.66056	D	0.02	-10.2954	18.7374	0.91761	0.0:0.0:1.0:0.0	.	1262	Q13023	AKAP6_HUMAN	N	1262	ENSP00000280979:D1262N	ENSP00000280979:D1262N	D	+	1	0	0	AKAP6	32360554	32360554	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	5.563000	0.67352	2.861000	0.98227	0.655000	0.94253	GAC	0.165719		TCGA-IB-A5SO-01A-11D-A32N-08	0.448	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	0	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	1.870000	-6.859260	1	0.230000	NM_004274		0	5	5	0	192	191	0		1	0		0	0	38	0	0	0.937509	1.055276e-03	0	0	0	2	0	5	192
DYNC1H1	1778	broad.mit.edu	37	14	102493761	102493761	+	Silent	SNP	A	A	G	rs8010870	byFrequency	TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr14:102493761A>G	ENST00000360184.4	+	46	9092	c.8928A>G	c.(8926-8928)ctA>ctG	p.L2976L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2976	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ATGAAGATCTACGGACAGTGT	0.418													A|||	975	0.194688	0.2504	0.1484	5008	,	,		23531	0.248		0.0895	False		,,,				2504	0.2055					ENST00000360184.4	1.000000	0.630000	1.000000	0.770000	0.930000	0.902137	0.930000	1.000000																										0				166						c.(8926-8928)ctA>ctG		dynein, cytoplasmic 1, heavy chain 1		A		976,3430	366.4+/-317.8	117,742,1344	118.0	111.0	113.0		8928	-12.1	0.0	14	dbSNP_116	113	942,7658	206.9+/-248.8	54,834,3412	no	coding-synonymous	DYNC1H1	NM_001376.4		171,1576,4756	GG,GA,AA		10.9535,22.1516,14.747		2976/4647	102493761	1918,11088	2203	4300	6503	SO:0001819	synonymous_variant	1778	16837	121412	76				g.chr14:102493761A>G	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8928A>G	chr14.hg19:g.102493761A>G		0						p.L2976L	NM_001376.4	NP_001367.2	1	2	3	2.063149	Q14204	DYHC1_HUMAN		46	9092	+			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	1	0	hg19	c.8928A>G	CCDS9966.1	1																																																																																								0.237888		TCGA-IB-A5SO-01A-11D-A32N-08	0.418	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	0	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.870000	-2.443248	0	0.230000	NM_001376		0	28	27	0	240	237	1		1	1		0	0	62	0	0	1.000000	9.999934e-01	0	26	0	139	0	28	240
RTF1	23168	broad.mit.edu	37	15	41763442	41763442	+	Silent	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr15:41763442G>A	ENST00000389629.4	+	8	1110	c.1098G>A	c.(1096-1098)cgG>cgA	p.R366R		NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	366	Plus3. {ECO:0000255|PROSITE- ProRule:PRU00693}.				DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)	p.R241R(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		GATTATCACGGCATAAGCTAG	0.458																																						ENST00000389629.4	1.000000	0.030000	0.180000	0.060000	0.100000	0.188290	0.100000	0.090000																										1	Substitution - coding silent(1)	p.R241R(1)	kidney(1)	18						c.(1096-1098)cgG>cgA		Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)							164.0	155.0	158.0					15																	41763442		2203	4300	6503	SO:0001819	synonymous_variant	23168	0	0					g.chr15:41763442G>A	D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.1098G>A	chr15.hg19:g.41763442G>A		0						p.R366R	NM_015138.4	NP_055953.3	1	2	3	2.072761	Q92541	RTF1_HUMAN		8	1110	+		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)	Q96BX6	Silent	SNP	ENST00000389629.4	0	1	hg19	c.1098G>A	CCDS32200.2	0																																																																																								0.239619		TCGA-IB-A5SO-01A-11D-A32N-08	0.458	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258111.1	0	0	1	2	2	2	2	0	0	0	0	117	117	117	116	1	1.870000	-1.625385	0	0.230000	NM_015138		0	5	5	0	474	467	0		1	0		0	0	117	0	0	0.935401	3.054074e-01	0	0	0	90	0	5	474
SEMA6D	80031	broad.mit.edu	37	15	48063190	48063190	+	Silent	SNP	G	G	A	rs144939945	byFrequency	TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr15:48063190G>A	ENST00000316364.5	+	19	2869	c.2430G>A	c.(2428-2430)ccG>ccA	p.P810P	SEMA6D_ENST00000389432.2_Silent_p.P767P|SEMA6D_ENST00000389433.2_Silent_p.P791P|SEMA6D_ENST00000354744.4_Silent_p.P754P|SEMA6D_ENST00000389428.3_Silent_p.P735P|SEMA6D_ENST00000537942.1_Silent_p.P748P|SEMA6D_ENST00000558014.1_Silent_p.P748P|SEMA6D_ENST00000358066.4_Silent_p.P748P|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000536845.2_Silent_p.P810P	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	810					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.P748P(1)|p.P810P(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AGTTTTTTCCGTCTAGTCCGC	0.507																																						ENST00000316364.5	1.000000	0.370000	0.720000	0.450000	0.560000	0.601943	0.560000	0.550000																										2	Substitution - coding silent(2)	p.P748P(1)|p.P810P(1)	endometrium(2)	77						c.(2428-2430)ccG>ccA		sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D		A	,,,,,	1,4395	2.1+/-5.4	0,1,2197	87.0	88.0	88.0		2244,2244,2205,2262,2430,	-2.9	0.9	15	dbSNP_134	88	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,utr-3	SEMA6D	NM_001198999.1,NM_020858.1,NM_153616.1,NM_153617.1,NM_153618.1,NM_153619.1	,,,,,	0,1,6494	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	748/1012,748/1012,735/999,754/1018,810/1074,	48063190	1,12989	2198	4297	6495	SO:0001819	synonymous_variant	80031	5	121412	40				g.chr15:48063190G>A	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2430G>A	chr15.hg19:g.48063190G>A		0					SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000358066.4_Silent_p.P748P|SEMA6D_ENST00000389428.3_Silent_p.P735P|SEMA6D_ENST00000389433.2_Silent_p.P791P|SEMA6D_ENST00000537942.1_Silent_p.P748P|SEMA6D_ENST00000389432.2_Silent_p.P767P|SEMA6D_ENST00000536845.2_Silent_p.P810P|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000558014.1_Silent_p.P748P|SEMA6D_ENST00000354744.4_Silent_p.P754P	p.P810P	NM_153618.1	NP_705871.1	1	2	3	2.072761	Q8NFY4	SEM6D_HUMAN		19	2869	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	1	1	hg19	c.2430G>A	CCDS32225.1	0																																																																																								0.239619		TCGA-IB-A5SO-01A-11D-A32N-08	0.507	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	1	0	1	2	16	2	2	1	1	1	1	98	98	98	94	1	1.870000	-6.657005	1	0.230000	NM_024966		0	26	25	0	391	387	0		1	0		1	0	98	0	0	0.955465	9.123163e-02	0	0	0	8	0	26	391
UNC13C	440279	broad.mit.edu	37	15	54916007	54916007	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr15:54916007G>A	ENST00000260323.11	+	31	6214	c.6214G>A	c.(6214-6216)Gac>Aac	p.D2072N	UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000545554.1_Missense_Mutation_p.D2072N|UNC13C_ENST00000537900.1_Missense_Mutation_p.D2070N	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2072	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGCTATTAATGACCTAAACTG	0.368																																						ENST00000260323.11	1.000000	0.540000	1.000000	0.740000	0.990000	0.904033	0.990000	1.000000																										0				121						c.(6214-6216)Gac>Aac		unc-13 homolog C (C. elegans)							69.0	65.0	67.0					15																	54916007		1835	4084	5919	SO:0001583	missense	440279	0	0					g.chr15:54916007G>A	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6214G>A	chr15.hg19:g.54916007G>A	ENSP00000260323:p.Asp2072Asn	0					UNC13C_ENST00000537900.1_Missense_Mutation_p.D2070N|UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000545554.1_Missense_Mutation_p.D2072N	p.D2072N	NM_001080534.1	NP_001074003.1	1	2	3	2.072761	Q8NB66	UN13C_HUMAN		31	6214	+			Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	1	1	hg19	c.6214G>A	CCDS45264.1	1	.	.	.	.	.	.	.	.	.	.	G	8.260	0.811040	0.16537	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.75367	-0.93;-0.93;-0.93	5.53	4.55	0.56014	5.53	4.55	0.56014	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.344021	0.33419	N	0.004929	T	0.57227	0.2039	N	0.20357	0.565	0.34289	D	0.683087	B	0.06786	0.001	B	0.04013	0.001	T	0.59915	-0.7364	10	0.31617	T	0.26	.	9.1177	0.36769	0.2002:0.0:0.7998:0.0	.	2072	Q8NB66	UN13C_HUMAN	N	2072;2072;2070	ENSP00000260323:D2072N;ENSP00000438156:D2072N;ENSP00000442569:D2070N	ENSP00000260323:D2072N	D	+	1	0	0	UNC13C	52703299	52703299	1.000000	0.71417	0.997000	0.53966	0.333000	0.28666	4.974000	0.63771	1.196000	0.43129	0.563000	0.77884	GAC	0.239619		TCGA-IB-A5SO-01A-11D-A32N-08	0.368	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.870000	-17.842960	1	0.230000	NM_173166		0	11	11	0	89	89	0		1			0	0	36	0	0	0.998651	0	0	0	0	0	0	11	89
CCNB2	9133	broad.mit.edu	37	15	59409031	59409031	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr15:59409031G>A	ENST00000288207.2	+	6	931	c.740G>A	c.(739-741)cGa>cAa	p.R247Q	CCNB2_ENST00000559622.1_Missense_Mutation_p.R166Q	NM_004701.3	NP_004692.1	O95067	CCNB2_HUMAN	cyclin B2	247					G2/M transition of mitotic cell cycle (GO:0000086)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				kidney(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9						TCCCAAATCCGAGAAATGGAA	0.413																																						ENST00000288207.2	1.000000	0.050000	0.220000	0.090000	0.130000	0.218748	0.130000	0.130000																										0				9						c.(739-741)cGa>cAa		cyclin B2							117.0	120.0	119.0					15																	59409031		2191	4291	6482	SO:0001583	missense	9133	0	0					g.chr15:59409031G>A	AF002822	CCDS10170.1	15q21.3	2004-01-19			ENSG00000157456	ENSG00000157456			1580	protein-coding gene	gene with protein product		602755					Standard	NM_004701		Approved	HsT17299	uc002afz.3	O95067	OTTHUMG00000132715	ENST00000288207.2:c.740G>A	chr15.hg19:g.59409031G>A	ENSP00000288207:p.Arg247Gln	0					CCNB2_ENST00000559622.1_Missense_Mutation_p.R166Q	p.R247Q	NM_004701.3	NP_004692.1	1	2	3	2.072761	O95067	CCNB2_HUMAN		6	931	+			B3KM93|Q6FI99	Missense_Mutation	SNP	ENST00000288207.2	0	1	hg19	c.740G>A	CCDS10170.1	0	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225727	0.58668	.	.	ENSG00000157456	ENST00000288207	T	0.10960	2.82	5.28	4.35	0.52113	5.28	4.35	0.52113	Cyclin, N-terminal (1);Cyclin-like (3);	0.118236	0.53938	D	0.000046	T	0.16727	0.0402	M	0.70842	2.15	0.52501	D	0.999952	P;P	0.43826	0.812;0.818	B;B	0.40782	0.163;0.34	T	0.02617	-1.1133	10	0.72032	D	0.01	.	14.4633	0.67467	0.0:0.0:0.8518:0.1482	.	247;247	Q53HG9;O95067	.;CCNB2_HUMAN	Q	247	ENSP00000288207:R247Q	ENSP00000288207:R247Q	R	+	2	0	0	CCNB2	57196323	57196323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.381000	0.59587	1.318000	0.45170	0.650000	0.86243	CGA	0.239619		TCGA-IB-A5SO-01A-11D-A32N-08	0.413	CCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256016.1	0	0	1	2	2	2	2	0	0	0	0	110	110	110	109	1	1.870000	-2.196000	0	0.230000	NM_004701		0	7	8	0	482	478	0		1	0		0	0	110	0	0	0.980325	2.790772e-01	0	0	0	64	0	7	482
EFTUD1	79631	broad.mit.edu	37	15	82530841	82530841	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr15:82530841G>A	ENST00000268206.7	-	7	706	c.538C>T	c.(538-540)Ctt>Ttt	p.L180F	EFTUD1_ENST00000359445.3_Missense_Mutation_p.L129F	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	180	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GAAGTAAAAAGAGTCCCTGTG	0.453																																						ENST00000268206.7	1.000000	0.350000	1.000000	0.520000	0.740000	0.748493	0.740000	1.000000																										0				32						c.(538-540)Ctt>Ttt		elongation factor Tu GTP binding domain containing 1							38.0	33.0	35.0					15																	82530841		1820	4071	5891	SO:0001583	missense	79631	0	0					g.chr15:82530841G>A	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.538C>T	chr15.hg19:g.82530841G>A	ENSP00000268206:p.Leu180Phe	0					EFTUD1_ENST00000359445.3_Missense_Mutation_p.L129F	p.L180F	NM_024580.5	NP_078856.4	1	2	3	2.072761	Q7Z2Z2	ETUD1_HUMAN		7	706	-			A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	ENST00000268206.7	0	1	hg19	c.538C>T	CCDS42071.1	0	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320203	0.41096	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.77229	-1.08;-1.08	4.49	4.49	0.54785	4.49	4.49	0.54785	Protein synthesis factor, GTP-binding (1);	0.000000	0.47093	U	0.000251	T	0.81706	0.4879	L	0.38692	1.165	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	T	0.76184	-0.3052	10	0.13470	T	0.59	-0.0792	17.7897	0.88548	0.0:0.0:1.0:0.0	.	129;180	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	F	180;129	ENSP00000268206:L180F;ENSP00000352418:L129F	ENSP00000268206:L180F	L	-	1	0	0	EFTUD1	80317896	80317896	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.644000	0.61397	2.501000	0.84356	0.405000	0.27470	CTT	0.239619		TCGA-IB-A5SO-01A-11D-A32N-08	0.453	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	0	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.870000	-13.375620	1	0.230000	NM_024580		0	8	8	0	93	70	0		1	1		0	0	24	0	0	0.973788	2.189100e-01	0	3	0	7	0	8	93
MAPK8IP3	23162	broad.mit.edu	37	16	1814146	1814146	+	Silent	SNP	C	C	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr16:1814146C>A	ENST00000250894.4	+	18	2210	c.2053C>A	c.(2053-2055)Cgg>Agg	p.R685R	MAPK8IP3_ENST00000356010.5_Silent_p.R679R	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	685					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GGAGGACACGCGGATGAAGAA	0.672																																						ENST00000250894.4	0.430000	0.090000	0.330000	0.140000	0.220000	0.242490	0.220000	0.210000																										0				42						c.(2053-2055)Cgg>Agg		mitogen-activated protein kinase 8 interacting protein 3							34.0	45.0	41.0					16																	1814146		2101	4205	6306	SO:0001819	synonymous_variant	23162	0	0					g.chr16:1814146C>A	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2053C>A	chr16.hg19:g.1814146C>A		0					MAPK8IP3_ENST00000356010.5_Silent_p.R679R	p.R685R	NM_015133.3	NP_055948.2	0	1	1	2.030129	Q9UPT6	JIP3_HUMAN		18	2210	+			A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	ENST00000250894.4	0	1	hg19	c.2053C>A	CCDS10442.2	0																																																																																								0.228225		TCGA-IB-A5SO-01A-11D-A32N-08	0.672	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	0	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.870000	-3.549492	1	0.230000	NM_001040439		0	6	6	0	239	236	0		1	0		0	0	43	0	0	0.964167	7.651603e-01	0	0	0	110	0	6	239
PPL	5493	broad.mit.edu	37	16	4935121	4935121	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr16:4935121G>A	ENST00000345988.2	-	22	3624	c.3535C>T	c.(3535-3537)Cgg>Tgg	p.R1179W	PPL_ENST00000590782.2_Missense_Mutation_p.R1177W	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1179					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GGGTCTGGCCGCACGATCTCC	0.627																																						ENST00000345988.2	0.220000	0.040000	0.170000	0.070000	0.110000	0.125109	0.110000	0.110000																										0				62						c.(3535-3537)Cgg>Tgg		periplakin							107.0	97.0	100.0					16																	4935121		2197	4300	6497	SO:0001583	missense	5493	0	0					g.chr16:4935121G>A	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3535C>T	chr16.hg19:g.4935121G>A	ENSP00000340510:p.Arg1179Trp	0					PPL_ENST00000590782.2_Missense_Mutation_p.R1177W	p.R1179W	NM_002705.4	NP_002696	0	1	1	2.030129	O60437	PEPL_HUMAN		22	3624	-			O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	0	1	hg19	c.3535C>T	CCDS10526.1	0	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222315	0.79464	.	.	ENSG00000118898	ENST00000345988	T	0.56941	0.43	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.74520	0.3727	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76473	-0.2946	10	0.87932	D	0	.	19.7311	0.96182	0.0:0.0:1.0:0.0	.	1179	O60437	PEPL_HUMAN	W	1179	ENSP00000340510:R1179W	ENSP00000340510:R1179W	R	-	1	2	2	PPL	4875122	4875122	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	5.493000	0.66899	2.677000	0.91161	0.561000	0.74099	CGG	0.228225		TCGA-IB-A5SO-01A-11D-A32N-08	0.627	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	0	0	1	2	2	2	2	0	0	0	0	130	130	130	129	1	1.870000	-2.417411	0	0.230000	NM_002705		0	6	6	0	474	469	0		1	0		0	0	130	0	0	0.964034	6.154226e-01	0	0	0	154	0	6	474
NUTF2	10204	broad.mit.edu	37	16	67904796	67904796	+	Missense_Mutation	SNP	G	G	A	rs201657691		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr16:67904796G>A	ENST00000219169.4	+	5	647	c.364G>A	c.(364-366)Gcc>Acc	p.A122T	NUTF2_ENST00000569436.2_Missense_Mutation_p.A122T|NUTF2_ENST00000568396.2_Missense_Mutation_p.A122T|EDC4_ENST00000358933.5_5'Flank	NM_005796.1	NP_005787.1	P61970	NTF2_HUMAN	nuclear transport factor 2	122					protein export from nucleus (GO:0006611)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	transporter activity (GO:0005215)			kidney(1)|lung(2)|upper_aerodigestive_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		GTTCAGGCTCGCCCTGCACAA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		20536	0.0		0.001	False		,,,				2504	0.0					ENST00000219169.4	0.710000	0.250000	0.580000	0.340000	0.450000	0.468146	0.450000	0.430000																										0				4						c.(364-366)Gcc>Acc		nuclear transport factor 2							102.0	86.0	91.0					16																	67904796		2198	4300	6498	SO:0001583	missense	10204	0	0					g.chr16:67904796G>A	U43939	CCDS10848.1	16q22.1	2008-02-05			ENSG00000102898	ENSG00000102898			13722	protein-coding gene	gene with protein product		605813				7744965, 3380696	Standard	NM_005796		Approved	NTF2, PP15	uc002eup.3	P61970	OTTHUMG00000137540	ENST00000219169.4:c.364G>A	chr16.hg19:g.67904796G>A	ENSP00000219169:p.Ala122Thr	0					NUTF2_ENST00000568396.2_Missense_Mutation_p.A122T|NUTF2_ENST00000569436.2_Missense_Mutation_p.A122T|EDC4_ENST00000358933.5_5'Flank	p.A122T	NM_005796.1	NP_005787.1	0	1	1	2.030129	P61970	NTF2_HUMAN		5	647	+		Ovarian(137;0.0563)	B2R4G7|P13662|Q6IB67	Missense_Mutation	SNP	ENST00000219169.4	1	1	hg19	c.364G>A	CCDS10848.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.7	4.031459	0.75504	.	.	ENSG00000102898	ENST00000219169	.	.	.	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.053987	0.64402	D	0.000001	T	0.61751	0.2372	M	0.82323	2.585	0.80722	D	1	B	0.33583	0.418	B	0.18561	0.022	T	0.63712	-0.6575	9	0.14252	T	0.57	-33.3308	18.6568	0.91456	0.0:0.0:1.0:0.0	.	122	P61970	NTF2_HUMAN	T	122	.	ENSP00000219169:A122T	A	+	1	0	0	NUTF2	66462297	66462297	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.263000	0.72521	2.500000	0.84329	0.655000	0.94253	GCC	0.228225		TCGA-IB-A5SO-01A-11D-A32N-08	0.517	NUTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268871.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.870000	-4.479433	1	0.230000			0	13	12	0	241	240	1		1	1		0	0	64	0	0	0.999549	9.999987e-01	0	79	0	449	0	13	241
FOXC2	2303	broad.mit.edu	37	16	86601494	86601494	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr16:86601494G>A	ENST00000320354.4	+	1	638	c.553G>A	c.(553-555)Gag>Aag	p.E185K	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	185					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						CCACCTCAAGGAGCCGCCCCC	0.682									Late-onset Hereditary Lymphedema																													ENST00000320354.4	0.400000	0.070000	0.300000	0.120000	0.190000	0.214705	0.190000	0.180000																										0				15						c.(553-555)Gag>Aag		forkhead box C2 (MFH-1, mesenchyme forkhead 1)							14.0	21.0	18.0					16																	86601494		2060	4113	6173	SO:0001583	missense	2303	1	119448	27	Late-onset Hereditary Lymphedema	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	g.chr16:86601494G>A	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.553G>A	chr16.hg19:g.86601494G>A	ENSP00000326371:p.Glu185Lys	0					RP11-463O9.5_ENST00000563280.1_RNA	p.E185K	NM_005251.2	NP_005242.1	0	1	1	2.030129	Q99958	FOXC2_HUMAN		1	638	+			C6KMR9|Q14DA6	Missense_Mutation	SNP	ENST00000320354.4	0	1	hg19	c.553G>A	CCDS10958.1	0	.	.	.	.	.	.	.	.	.	.	g	15.19	2.758706	0.49468	.	.	ENSG00000176692	ENST00000320354	D	0.95001	-3.58	4.23	4.23	0.50019	4.23	4.23	0.50019	.	1.447760	0.04727	U	0.420400	D	0.91935	0.7446	L	0.39898	1.24	0.48087	D	0.999582	B	0.11235	0.004	B	0.09377	0.004	T	0.70608	-0.4825	10	0.11182	T	0.66	.	15.2735	0.73723	0.0:0.0:1.0:0.0	.	185	Q99958	FOXC2_HUMAN	K	185	ENSP00000326371:E185K	ENSP00000326371:E185K	E	+	1	0	0	FOXC2	85158995	85158995	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	5.154000	0.64894	1.917000	0.55516	0.553000	0.69018	GAG	0.228225		TCGA-IB-A5SO-01A-11D-A32N-08	0.682	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	0	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.870000	-6.701517	1	0.230000	NM_005251		0	5	5	0	232	229	0		1	0		0	0	52	0	0	0.936095	1.005082e-02	0	0	0	6	0	5	232
POLR2A	5430	broad.mit.edu	37	17	7405016	7405016	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr17:7405016G>A	ENST00000322644.6	+	14	2716	c.2317G>A	c.(2317-2319)Gga>Aga	p.G773R		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	773					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GGTCGTGTCCGGAGCTAAAGG	0.483																																						ENST00000322644.6	0.370000	0.050000	0.270000	0.100000	0.170000	0.190999	0.170000	0.160000																										0				50						c.(2317-2319)Gga>Aga		polymerase (RNA) II (DNA directed) polypeptide A, 220kDa							63.0	59.0	61.0					17																	7405016		2203	4300	6503	SO:0001583	missense	5430	0	0					g.chr17:7405016G>A			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2317G>A	chr17.hg19:g.7405016G>A	ENSP00000314949:p.Gly773Arg	1						p.G773R	NM_000937.4	NP_000928	0	1	1	1.883826	P24928	RPB1_HUMAN		14	2716	+		Prostate(122;0.173)	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	0	1	hg19	c.2317G>A	CCDS32548.1	0	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947770	0.92593	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	D	0.97378	-4.36	5.82	5.82	0.92795	5.82	5.82	0.92795	RNA polymerase Rpb1, domain 4 (1);	0.000000	0.85682	D	0.000000	D	0.99275	0.9747	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98602	1.0659	10	0.87932	D	0	-6.8597	18.8608	0.92271	0.0:0.0:1.0:0.0	.	773	P24928	RPB1_HUMAN	R	729;773	ENSP00000314949:G773R	ENSP00000314949:G773R	G	+	1	0	0	SLC35G6	7345740	7345740	1.000000	0.71417	0.904000	0.35570	0.986000	0.74619	9.627000	0.98412	2.761000	0.94854	0.655000	0.94253	GGA	0.162588		TCGA-IB-A5SO-01A-11D-A32N-08	0.483	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	0	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	1.870000	-3.080377	1	0.230000	NM_000937		0	4	4	0	198	196	0		1	0		0	0	47	0	0	0.888876	6.193507e-01	0	0	0	95	0	4	198
MAPT	4137	broad.mit.edu	37	17	44060672	44060672	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr17:44060672C>T	ENST00000571987.1	+	5	502	c.502C>T	c.(502-504)Cgc>Tgc	p.R168C	MAPT_ENST00000420682.2_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.R168C|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.R168C|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.R168C			P10636	TAU_HUMAN	microtubule-associated protein tau	168					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	AGAGGCCACACGCCAACCTTC	0.692																																						ENST00000571987.1	1.000000	0.290000	1.000000	0.470000	0.740000	0.739722	0.740000	1.000000																										0				38						c.(502-504)Cgc>Tgc		microtubule-associated protein tau	Docetaxel(DB01248)|Paclitaxel(DB01229)						13.0	15.0	14.0					17																	44060672		2196	4292	6488	SO:0001583	missense	4137	3	121062	26				g.chr17:44060672C>T	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.502C>T	chr17.hg19:g.44060672C>T	ENSP00000458742:p.Arg168Cys	0					MAPT_ENST00000431008.3_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.R168C|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.R168C|MAPT_ENST00000415613.2_Missense_Mutation_p.R168C	p.R168C			1	2	3	2.061943	P10636	TAU_HUMAN		5	502	+		Melanoma(429;0.216)	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	0	1	hg19	c.502C>T	CCDS11501.1	0	.	.	.	.	.	.	.	.	.	.	C	13.27	2.188535	0.38609	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000415613	T;T;T	0.10382	2.88;2.88;2.88	4.03	-2.5	0.06384	4.03	-2.5	0.06384	.	2.448770	0.01389	N	0.013192	T	0.05777	0.0151	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.0	T	0.37934	-0.9684	10	0.52906	T	0.07	4.9526	4.149	0.10228	0.0:0.3518:0.3326:0.3156	.	168;168	P10636-9;P10636	.;TAU_HUMAN	C	168	ENSP00000340820:R168C;ENSP00000262410:R168C;ENSP00000410838:R168C	ENSP00000262410:R168C	R	+	1	0	0	MAPT	41416509	41416509	0.000000	0.05858	0.000000	0.03702	0.427000	0.31564	-2.823000	0.00748	-0.148000	0.11234	0.561000	0.74099	CGC	0.237888		TCGA-IB-A5SO-01A-11D-A32N-08	0.692	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.870000	-11.928930	1	0.230000	NM_016835		0	5	5	0	59	56	0		1			0	0	16	0	0	0.932078	0	0	0	0	0	0	5	59
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.960000	0.370000	0.800000	0.490000	0.630000	0.653231	0.630000	0.630000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	24185	GRCh37	CM941329	TP53	M		c.(586-588)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	7157	1	121412	40	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578263G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	chr17.hg19:g.7578263G>A	ENSP00000269305:p.Arg196*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*	p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.883826	P04637	P53_HUMAN		6	775	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.586C>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	2	TP53	7518988	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	0.162588		TCGA-IB-A5SO-01A-11D-A32N-08	0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	1.870000	-2.806926	1	0.230000	NM_000546		0	15	15	0	173	172	0		1	1	1	0	0	47	959	0	0.999889	9.642332e-01	1	5	138	62	1197	15	173
PRPSAP1	5635	broad.mit.edu	37	17	74309083	74309083	+	Silent	SNP	G	G	A	rs148092431		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr17:74309083G>A	ENST00000446526.3	-	9	1312	c.867C>T	c.(865-867)gaC>gaT	p.D289D	PRPSAP1_ENST00000324684.4_Silent_p.D186D|PRPSAP1_ENST00000588364.1_5'UTR	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	260					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						TCTCCACATCGTCAATAATGT	0.512																																						ENST00000446526.3	1.000000	0.630000	1.000000	0.740000	0.870000	0.871956	0.870000	1.000000																										0				17						c.(865-867)gaC>gaT		phosphoribosyl pyrophosphate synthetase-associated protein 1		G		2,4404	4.2+/-10.8	0,2,2201	100.0	98.0	99.0		867	-7.9	0.0	17	dbSNP_134	99	0,8600		0,0,4300	no	coding-synonymous	PRPSAP1	NM_002766.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		289/386	74309083	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	5635	26	121412	47				g.chr17:74309083G>A	D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.867C>T	chr17.hg19:g.74309083G>A		0					PRPSAP1_ENST00000588364.1_5'UTR|PRPSAP1_ENST00000324684.4_Silent_p.D186D	p.D289D	NM_002766.2	NP_002757.2	1	2	3	2.061943	Q14558	KPRA_HUMAN		9	1312	-			B2R6M4|Q96H06	Silent	SNP	ENST00000446526.3	1	1	hg19	c.867C>T	CCDS11743.2	1																																																																																								0.237888		TCGA-IB-A5SO-01A-11D-A32N-08	0.512	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342480.2	1	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	1.870000	-12.917470	1	0.230000	NM_002766		0	38	37	0	348	344	0		1	1		0	0	99	0	0	1.000000	9.999305e-01	0	31	0	102	0	38	348
DNAH17	8632	broad.mit.edu	37	17	76455199	76455199	+	Missense_Mutation	SNP	C	C	T	rs139080560	byFrequency	TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr17:76455199C>T	ENST00000585328.1	-	61	9854	c.9730G>A	c.(9730-9732)Gtc>Atc	p.V3244I	DNAH17_ENST00000389840.5_Missense_Mutation_p.V3235I|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3235	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TAGAAGCGGACGATGTTGATG	0.637													C|||	12	0.00239617	0.0091	0.0	5008	,	,		18349	0.0		0.0	False		,,,				2504	0.0					ENST00000585328.1	1.000000	0.580000	0.850000	0.650000	0.730000	0.757204	0.730000	0.730000																										0				116						c.(9730-9732)Gtc>Atc		dynein, axonemal, heavy chain 17		C	ILE/VAL	52,4354	54.2+/-90.2	1,50,2152	171.0	177.0	175.0		9745	5.3	1.0	17	dbSNP_134	175	0,8600		0,0,4300	yes	missense	DNAH17	NM_173628.3	29	1,50,6452	TT,TC,CC		0.0,1.1802,0.3998	benign	3249/4463	76455199	52,12954	2203	4300	6503	SO:0001583	missense	8632	130	121406	58				g.chr17:76455199C>T	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9730G>A	chr17.hg19:g.76455199C>T	ENSP00000465516:p.Val3244Ile	0					DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.V3235I	p.V3244I	NM_173628.3	NP_775899.3	1	2	3	2.061943	Q9UFH2	DYH17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)	61	9854	-			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	1	1	hg19	c.9730G>A		0	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	C	14.20	2.464303	0.43736	0.011802	0.0	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.79141	-1.24	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000022	T	0.58452	0.2123	L	0.35487	1.065	0.33727	D	0.617749	P	0.35481	0.504	B	0.29716	0.106	T	0.67601	-0.5629	10	0.09590	T	0.72	.	18.6873	0.91570	0.0:1.0:0.0:0.0	.	3244	E7EUM8	.	I	3244;3235	ENSP00000374490:V3235I	ENSP00000300671:V3244I	V	-	1	0	0	DNAH17	73966794	73966794	0.998000	0.40836	0.991000	0.47740	0.991000	0.79684	3.678000	0.54627	2.491000	0.84063	0.655000	0.94253	GTC	0.237888		TCGA-IB-A5SO-01A-11D-A32N-08	0.637	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	0	0	0	2	14	2	2	1	1	1	1	257	257	257	252	1	1.870000	-17.904050	1	0.230000	NM_173628		0	78	78	0	857	847	0		1	0		1	0	257	0	0	1.000000	0	0	0	0	1	0	78	857
FCGBP	8857	broad.mit.edu	37	19	40433869	40433869	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr19:40433869G>A	ENST00000221347.6	-	2	407	c.400C>T	c.(400-402)Cgg>Tgg	p.R134W		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	134	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGATGGGCCGCAGCAGTGTC	0.597																																						ENST00000221347.6	1.000000	0.060000	0.400000	0.120000	0.210000	0.307651	0.210000	0.180000																										0				165						c.(400-402)Cgg>Tgg		Fc fragment of IgG binding protein							64.0	54.0	57.0					19																	40433869		2203	4300	6503	SO:0001583	missense	8857	12	121412	40				g.chr19:40433869G>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.400C>T	chr19.hg19:g.40433869G>A	ENSP00000221347:p.Arg134Trp	0						p.R134W	NM_003890.2	NP_003881.2	1	2	3	2.086413	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)	2	407	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		O95784	Missense_Mutation	SNP	ENST00000221347.6	0	1	hg19	c.400C>T	CCDS12546.1	0	.	.	.	.	.	.	.	.	.	.	G	6.404	0.442631	0.12164	.	.	ENSG00000090920	ENST00000221347	T	0.18338	2.22	4.13	-8.27	0.01017	4.13	-8.27	0.01017	.	0.899723	0.09194	N	0.835531	T	0.04137	0.0115	N	0.00926	-1.1	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.45991	-0.9223	10	0.37606	T	0.19	.	8.3971	0.32564	0.6469:0.0:0.1439:0.2092	.	134	Q9Y6R7	FCGBP_HUMAN	W	134	ENSP00000221347:R134W	ENSP00000221347:R134W	R	-	1	2	2	FCGBP	45125709	45125709	0.000000	0.05858	0.000000	0.03702	0.294000	0.27393	-0.060000	0.11712	-1.660000	0.01486	0.655000	0.94253	CGG	0.242201		TCGA-IB-A5SO-01A-11D-A32N-08	0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	0	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	1.870000	-3.486999	1	0.230000	NM_003890		0	4	4	0	191	189	0		1	0		0	0	60	0	0	0.888803	0	0	0	0	1	0	4	191
PSG7	5676	broad.mit.edu	37	19	43441294	43441294	+	RNA	SNP	C	C	T	rs374924950		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr19:43441294C>T	ENST00000406070.2	-	0	31				PSG7_ENST00000446844.3_RNA|PSG7_ENST00000471557.1_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TTCCTGAGCACGGCTGTCAGC	0.617																																						ENST00000406070.2	1.000000	0.730000	1.000000	0.890000	0.990000	0.963390	0.990000	1.000000																										0												pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)		C	,	2,1382		1,0,691	41.0	43.0	43.0		,	-0.2	0.0	19		43	1,3181		0,1,1590	no	utr-5,utr-5	PSG7	NM_001206650.1,NM_002783.2	,	1,1,2281	TT,TC,CC		0.0314,0.1445,0.0657	,	,	43441294	3,4563	692	1591	2283			5676	0	0					g.chr19:43441294C>T			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		chr19.hg19:g.43441294C>T		0					PSG7_ENST00000471557.1_RNA|PSG7_ENST00000446844.3_RNA		NM_002783.2	NP_002774.2	1	2	3	2.086413	Q13046	PSG7_HUMAN		0	31	-		Prostate(69;0.00682)	Q15232	RNA	SNP	ENST00000406070.2	0	1	hg19			1																																																																																								0.242201		TCGA-IB-A5SO-01A-11D-A32N-08	0.617	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	0	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.870000	-6.057421	1	0.230000	NM_001206650		0	25	25	0	181	179	0		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	25	181
TMEM143	55260	broad.mit.edu	37	19	48837419	48837419	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr19:48837419C>G	ENST00000293261.3	-	7	1327	c.1011G>C	c.(1009-1011)gaG>gaC	p.E337D	TMEM143_ENST00000377431.2_Missense_Mutation_p.E237D|TMEM143_ENST00000436660.2_Missense_Mutation_p.E272D|TMEM143_ENST00000435956.3_Missense_Mutation_p.E302D|TMEM143_ENST00000541566.1_Missense_Mutation_p.E227D	NM_018273.2	NP_060743.2	Q96AN5	TM143_HUMAN	transmembrane protein 143	337					hematopoietic progenitor cell differentiation (GO:0002244)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	14		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		TGTGCGCCAGCTCCAACGCCT	0.701											OREG0025605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000293261.3	1.000000	0.510000	1.000000	0.760000	0.990000	0.914492	0.990000	1.000000																										0				14						c.(1009-1011)gaG>gaC		transmembrane protein 143							15.0	15.0	15.0					19																	48837419		2191	4286	6477	SO:0001583	missense	55260	0	0					g.chr19:48837419C>G	AK129801	CCDS12716.1	19q13.32	2008-02-05				ENSG00000161558			25603	protein-coding gene	gene with protein product						12975309	Standard	NM_018273		Approved	FLJ10922	uc002pix.1	Q96AN5		ENST00000293261.3:c.1011G>C	chr19.hg19:g.48837419C>G	ENSP00000293261:p.Glu337Asp	0		OREG0025605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	957	TMEM143_ENST00000541566.1_Missense_Mutation_p.E227D|TMEM143_ENST00000436660.2_Missense_Mutation_p.E272D|TMEM143_ENST00000377431.2_Missense_Mutation_p.E237D|TMEM143_ENST00000435956.3_Missense_Mutation_p.E302D	p.E337D	NM_018273.2	NP_060743.2	1	2	3	2.086413	Q96AN5	TM143_HUMAN		7	1327	-		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)	A8K656|Q6UXY4|Q9NV49	Missense_Mutation	SNP	ENST00000293261.3	0	1	hg19	c.1011G>C	CCDS12716.1	1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.571313	0.28003	.	.	ENSG00000161558	ENST00000293261;ENST00000377431;ENST00000435956;ENST00000436660;ENST00000541566	T;T;T	0.50548	0.74;0.76;0.75	4.02	1.82	0.25136	4.02	1.82	0.25136	.	0.104192	0.39274	N	0.001413	T	0.33294	0.0858	L	0.47716	1.5	0.27686	N	0.946273	B;B;B;B	0.15930	0.015;0.0;0.004;0.001	B;B;B;B	0.17979	0.02;0.002;0.015;0.004	T	0.17745	-1.0359	10	0.18710	T	0.47	-14.1542	5.1988	0.15252	0.0:0.6356:0.1716:0.1929	.	272;237;302;337	B4DPF8;Q96AN5-2;B4DMT0;Q96AN5	.;.;.;TM143_HUMAN	D	337;237;302;272;227	ENSP00000293261:E337D;ENSP00000397038:E302D;ENSP00000444275:E227D	ENSP00000293261:E337D	E	-	3	2	2	TMEM143	53529231	53529231	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	0.755000	0.26405	0.299000	0.22661	0.313000	0.20887	GAG	0.242201		TCGA-IB-A5SO-01A-11D-A32N-08	0.701	TMEM143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465622.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.870000	-14.738920	1	0.230000	NM_018273		0	8	8	0	61	60	1		1	1		0	0	17	0	0	0.990252	6.245019e-01	0	5	0	12	0	8	61
CSMD2	114784	broad.mit.edu	37	1	34011733	34011733	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr1:34011733G>A	ENST00000373381.4	-	57	9180	c.9004C>T	c.(9004-9006)Cgc>Tgc	p.R3002C		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2975	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAGCTGAAGCGCATCACAGTG	0.612																																						ENST00000373381.4	1.000000	0.540000	1.000000	0.670000	0.830000	0.833104	0.830000	1.000000																										0				246						c.(9004-9006)Cgc>Tgc		CUB and Sushi multiple domains 2							75.0	66.0	69.0					1																	34011733		2203	4300	6503	SO:0001583	missense	114784	0	0					g.chr1:34011733G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9004C>T	chr1.hg19:g.34011733G>A	ENSP00000362479:p.Arg3002Cys	0						p.R3002C	NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	0	0	0	1.989740	Q7Z408	CSMD2_HUMAN		57	9180	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	1	1	hg19	c.9004C>T		0	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854909	0.71719	.	.	ENSG00000121904	ENST00000373381	T	0.66815	-0.23	4.97	4.97	0.65823	4.97	4.97	0.65823	Complement control module (2);Sushi/SCR/CCP (3);	0.213233	0.38217	N	0.001762	D	0.84005	0.5377	M	0.93678	3.445	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.70487	0.832;0.969	D	0.85887	0.1426	10	0.48119	T	0.1	.	10.9638	0.47399	0.0:0.0:0.7096:0.2904	.	2858;3002	Q7Z408;E7EUA6	CSMD2_HUMAN;.	C	3002	ENSP00000362479:R3002C	ENSP00000241312:R2858C	R	-	1	0	0	CSMD2	33784320	33784320	1.000000	0.71417	0.995000	0.50966	0.865000	0.49528	3.711000	0.54868	2.591000	0.87537	0.650000	0.86243	CGC	0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.612	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.870000	-3.318813	1	0.230000	NM_052896		0	21	21	0	192	189	0		1	1		0	0	64	0	0	0.999998	1.210693e-01	0	2	0	4	0	21	192
SSBP3	23648	broad.mit.edu	37	1	54708959	54708959	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr1:54708959C>T	ENST00000371320.3	-	10	1075	c.665G>A	c.(664-666)gGc>gAc	p.G222D	SSBP3_ENST00000417664.2_Missense_Mutation_p.G112D|SSBP3_ENST00000357475.4_Missense_Mutation_p.G202D|SSBP3_ENST00000371319.3_Missense_Mutation_p.G195D|SSBP3_ENST00000326956.7_5'UTR	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	222	Gly-rich.|Pro-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						TGGTCTCATGCCGCTGCCGTA	0.562																																						ENST00000371320.3	0.130000	0.020000	0.100000	0.040000	0.060000	0.072092	0.060000	0.070000																										0				11						c.(664-666)gGc>gAc		single stranded DNA binding protein 3							145.0	153.0	150.0					1																	54708959		2203	4300	6503	SO:0001583	missense	23648	0	0					g.chr1:54708959C>T		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.665G>A	chr1.hg19:g.54708959C>T	ENSP00000360371:p.Gly222Asp	0					SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000357475.4_Missense_Mutation_p.G202D|SSBP3_ENST00000371319.3_Missense_Mutation_p.G195D|SSBP3_ENST00000417664.2_Missense_Mutation_p.G112D	p.G222D	NM_145716.2	NP_663768.1	0	0	0	1.989740	Q9BWW4	SSBP3_HUMAN		10	1075	-			A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	0	1	hg19	c.665G>A	CCDS591.1	0	.	.	.	.	.	.	.	.	.	.	c	25.8	4.676502	0.88445	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475;ENST00000444533;ENST00000525990	.	.	.	3.94	3.94	0.45596	3.94	3.94	0.45596	.	0.000000	0.85682	U	0.000000	T	0.78717	0.4327	M	0.75085	2.285	0.80722	D	1	D;P;P	0.89917	1.0;0.951;0.866	D;P;P	0.97110	1.0;0.743;0.686	T	0.81534	-0.0889	9	0.59425	D	0.04	-1.6526	17.3039	0.87189	0.0:1.0:0.0:0.0	.	195;202;222	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	D	112;222;195;202;53;85	.	ENSP00000350067:G202D	G	-	2	0	0	SSBP3	54481547	54481547	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.969000	0.76092	2.493000	0.84123	0.479000	0.44913	GGC	0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.562	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	0	0	1	2	2	2	2	0	0	0	0	315	315	315	311	1	1.870000	-1.721604	0	0.230000	NM_018070		0	7	7	0	930	915	0		1	0		0	0	315	0	0	0.979464	5.130608e-01	0	0	0	211	0	7	930
WLS	79971	broad.mit.edu	37	1	68615942	68615942	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr1:68615942C>T	ENST00000262348.4	-	6	1154	c.901G>A	c.(901-903)Gac>Aac	p.D301N	WLS_ENST00000540432.1_Missense_Mutation_p.D301N|WLS_ENST00000354777.2_Missense_Mutation_p.D299N|GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000491811.1_5'UTR|WLS_ENST00000370976.3_Missense_Mutation_p.D210N	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	301					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						TGTCGGATGTCACCAAACAGC	0.512																																						ENST00000262348.4	1.000000	0.690000	1.000000	0.800000	0.920000	0.910024	0.920000	1.000000																										0				20						c.(901-903)Gac>Aac		wntless Wnt ligand secretion mediator							146.0	131.0	136.0					1																	68615942		2203	4300	6503	SO:0001583	missense	79971	0	0					g.chr1:68615942C>T	BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.901G>A	chr1.hg19:g.68615942C>T	ENSP00000262348:p.Asp301Asn	0					GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000370976.3_Missense_Mutation_p.D210N|WLS_ENST00000354777.2_Missense_Mutation_p.D299N|WLS_ENST00000491811.1_5'UTR|GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000540432.1_Missense_Mutation_p.D301N	p.D301N	NM_024911.6	NP_079187.3	0	0	0	1.989740	Q5T9L3	WLS_HUMAN		6	1154	-			B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	ENST00000262348.4	1	1	hg19	c.901G>A	CCDS642.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.309247	0.95629	.	.	ENSG00000116729	ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	4.85	4.85	0.62838	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.64627	0.2615	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.68032	-0.5516	10	0.51188	T	0.08	-33.6655	18.0034	0.89203	0.0:1.0:0.0:0.0	.	301;210;301;299	F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2	.;.;WLS_HUMAN;.	N	301;299;301;210	ENSP00000446112:D301N;ENSP00000346829:D299N;ENSP00000262348:D301N;ENSP00000360015:D210N	ENSP00000262348:D301N	D	-	1	0	0	WLS	68388530	68388530	1.000000	0.71417	0.953000	0.39169	0.943000	0.58893	7.298000	0.78815	2.248000	0.74166	0.563000	0.77884	GAC	0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.512	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025368.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	104	1	1.870000	-16.639770	1	0.230000	NM_024911		0	47	47	0	383	376	1		1	1		0	0	107	0	0	1.000000	1	0	31	0	188	0	47	383
PSMB4	5692	broad.mit.edu	37	1	151372521	151372521	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr1:151372521G>A	ENST00000290541.6	+	2	259	c.205G>A	c.(205-207)Gca>Aca	p.A69T		NM_002796.2	NP_002787.2	P28070	PSB4_HUMAN	proteasome (prosome, macropain) subunit, beta type, 4	69					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	lipopolysaccharide binding (GO:0001530)|threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|lung(9)|ovary(2)|prostate(1)|skin(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGTGATTGCCGCAGACATGCT	0.582																																						ENST00000290541.6	0.170000	0.020000	0.130000	0.050000	0.080000	0.094100	0.080000	0.080000																										0				14						c.(205-207)Gca>Aca		proteasome (prosome, macropain) subunit, beta type, 4							124.0	124.0	124.0					1																	151372521		2203	4300	6503	SO:0001583	missense	5692	0	0					g.chr1:151372521G>A	D26600	CCDS996.1	1q21	2008-02-05			ENSG00000159377	ENSG00000159377		"""Proteasome (prosome, macropain) subunits"""	9541	protein-coding gene	gene with protein product		602177				7918633	Standard	NM_002796		Approved	HN3, PROS26	uc001eyc.1	P28070	OTTHUMG00000012494	ENST00000290541.6:c.205G>A	chr1.hg19:g.151372521G>A	ENSP00000290541:p.Ala69Thr	0						p.A69T	NM_002796.2	NP_002787.2	0	0	0	1.976688	P28070	PSB4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)	2	259	+	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		B2R9L3|P31148|Q5SZS5|Q6IBI4|Q969L6	Missense_Mutation	SNP	ENST00000290541.6	0	1	hg19	c.205G>A	CCDS996.1	0	.	.	.	.	.	.	.	.	.	.	G	37	6.114497	0.97296	.	.	ENSG00000159377	ENST00000290541	T	0.41758	0.99	5.34	5.34	0.76211	5.34	5.34	0.76211	Proteasome, beta-type subunit, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.56630	0.1998	M	0.66378	2.025	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.70487	0.969;0.846	T	0.59899	-0.7367	10	0.66056	D	0.02	-10.9451	17.6208	0.88080	0.0:0.0:1.0:0.0	.	69;69	B4DFL3;P28070	.;PSB4_HUMAN	T	69	ENSP00000290541:A69T	ENSP00000290541:A69T	A	+	1	0	0	PSMB4	149639145	149639145	1.000000	0.71417	0.881000	0.34555	0.995000	0.86356	9.355000	0.97087	2.502000	0.84385	0.561000	0.74099	GCA	0.206267		TCGA-IB-A5SO-01A-11D-A32N-08	0.582	PSMB4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034885.1	0	0	1	2	2	2	2	0	0	0	0	120	120	120	120	1	1.870000	-2.160619	0	0.230000	NM_002796		0	5	5	0	527	523	0		1	0		0	0	120	0	0	0.936566	9.928319e-01	0	0	0	1049	0	5	527
TGM6	343641	broad.mit.edu	37	20	2397961	2397961	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr20:2397961C>T	ENST00000202625.2	+	10	1481	c.1420C>T	c.(1420-1422)Cgc>Tgc	p.R474C	TGM6_ENST00000381423.1_Missense_Mutation_p.R474C	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	474					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	AATCTGGATCCGCAGGGCTGG	0.622																																						ENST00000202625.2	1.000000	0.250000	0.850000	0.400000	0.600000	0.623929	0.600000	1.000000																										0				52						c.(1420-1422)Cgc>Tgc		transglutaminase 6	L-Glutamine(DB00130)						40.0	33.0	35.0					20																	2397961		2203	4300	6503	SO:0001583	missense	343641	3	121412	27				g.chr20:2397961C>T	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1420C>T	chr20.hg19:g.2397961C>T	ENSP00000202625:p.Arg474Cys	0					TGM6_ENST00000381423.1_Missense_Mutation_p.R474C	p.R474C	NM_198994.2	NP_945345.2	0	0	0	1.986965	O95932	TGM3L_HUMAN		10	1481	+			Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	0	1	hg19	c.1420C>T	CCDS13025.1	0	.	.	.	.	.	.	.	.	.	.	C	14.46	2.542366	0.45280	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	T;T	0.80909	-1.27;-1.43	4.54	4.54	0.55810	4.54	4.54	0.55810	.	0.768164	0.11873	N	0.521286	D	0.82527	0.5056	L	0.47716	1.5	0.31804	N	0.62801	D;D	0.69078	0.997;0.991	P;B	0.53861	0.736;0.332	T	0.82133	-0.0608	10	0.56958	D	0.05	-9.2741	12.6614	0.56815	0.0:1.0:0.0:0.0	.	474;474	O95932-2;O95932	.;TGM3L_HUMAN	C	474	ENSP00000202625:R474C;ENSP00000370831:R474C	ENSP00000202625:R474C	R	+	1	0	0	TGM6	2345961	2345961	0.187000	0.23238	0.123000	0.21794	0.315000	0.28087	4.094000	0.57721	2.368000	0.80403	0.563000	0.77884	CGC	0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.622	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	1.870000	-10.554140	1	0.230000	NM_198994		0	6	6	0	82	81	0		1			0	0	23	0	0	0.965514	0	0	0	0	0	0	6	82
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000464624.2_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371085.3	0.420000	0.070000	0.320000	0.130000	0.210000	0.230858	0.210000	0.200000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		88	Substitution - Missense(88)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)	441						c.(601-603)cGt>cAt		GNAS complex locus							80.0	78.0	79.0					20																	57484421		2203	4300	6503	SO:0001583	missense	2778	10	121412	32				g.chr20:57484421G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	chr20.hg19:g.57484421G>A	ENSP00000360126:p.Arg201His	0	TSP Lung(22;0.16)				GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H	p.R201H	NM_000516.4	NP_000507.1	0	0	0	1.986965	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	8	1026	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	1	1	hg19	c.602G>A	CCDS13472.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	5.53	5.53	0.82687	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	0	GNAS	56917816	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT	0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	0	0	1	2	2	2	8	0	0	0	0	47	47	47	47	1	1.870000	-2.856930	1	0.230000	NM_000516		0	5	5	0	210	209	0		1	1	1	0	1	47	387	0	0.937507	1	9.209650e-01	88	14	4606	633	5	210
OPRL1	4987	broad.mit.edu	37	20	62729805	62729805	+	Silent	SNP	C	C	A	rs376128527		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr20:62729805C>A	ENST00000349451.3	+	6	1178	c.766C>A	c.(766-768)Cgg>Agg	p.R256R	OPRL1_ENST00000336866.2_Silent_p.R256R|OPRL1_ENST00000355631.4_Silent_p.R256R	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	256					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					AGAGAAGGACCGGAACCTGCG	0.657																																						ENST00000349451.3	0.350000	0.090000	0.270000	0.140000	0.190000	0.211459	0.190000	0.190000																										0				19						c.(766-768)Cgg>Agg		opiate receptor-like 1							121.0	107.0	112.0					20																	62729805		2203	4299	6502	SO:0001819	synonymous_variant	4987	0	0					g.chr20:62729805C>A		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.766C>A	chr20.hg19:g.62729805C>A		0					OPRL1_ENST00000355631.4_Silent_p.R256R|OPRL1_ENST00000336866.2_Silent_p.R256R	p.R256R	NM_001200019.1	NP_001186948.1	0	0	0	1.986965	P41146	OPRX_HUMAN		6	1178	+	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)		Q8TD34|Q8WYH9|Q9H4K4	Silent	SNP	ENST00000349451.3	1	1	hg19	c.766C>A	CCDS13556.1	0																																																																																								0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.657	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	0	0	1	2	2	2	2	0	0	0	0	100	100	100	92	1	1.870000	-2.942797	1	0.230000	NM_182647		0	9	9	0	387	374	0		1	0		0	0	100	0	0	0.993412	9.588831e-03	0	0	0	6	0	9	387
HLCS	3141	broad.mit.edu	37	21	38269180	38269180	+	Silent	SNP	T	T	C			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr21:38269180T>C	ENST00000399120.1	-	7	2661	c.1431A>G	c.(1429-1431)acA>acG	p.T477T	HLCS_ENST00000336648.4_Silent_p.T477T|HLCS_ENST00000482273.1_5'UTR	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	477	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	GACGCATCGTTGTGGGGGTCA	0.493																																						ENST00000399120.1	1.000000	0.410000	0.920000	0.540000	0.700000	0.721233	0.700000	1.000000																										0				24						c.(1429-1431)acA>acG		holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	Biotin(DB00121)						88.0	79.0	82.0					21																	38269180		2203	4300	6503	SO:0001819	synonymous_variant	3141	0	0					g.chr21:38269180T>C		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1431A>G	chr21.hg19:g.38269180T>C		0					HLCS_ENST00000482273.1_5'UTR|HLCS_ENST00000336648.4_Silent_p.T477T	p.T477T	NM_001242784.1	NP_001229713.1	1	2	3	2.057065	P50747	BPL1_HUMAN		7	2661	-		Myeloproliferative disorder(46;0.0422)	B2RAH1|D3DSG6|Q99451	Silent	SNP	ENST00000399120.1	1	1	hg19	c.1431A>G	CCDS13647.1	0																																																																																								0.237019		TCGA-IB-A5SO-01A-11D-A32N-08	0.493	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.870000	-19.986980	1	0.230000			0	16	16	0	190	189	0		1	1		0	0	41	0	0	0.999942	7.552221e-01	0	8	0	26	0	16	190
POFUT2	23275	broad.mit.edu	37	21	46705777	46705777	+	Silent	SNP	G	G	A	rs377468764		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr21:46705777G>A	ENST00000349485.5	-	2	224	c.198C>T	c.(196-198)atC>atT	p.I66I	POFUT2_ENST00000471540.1_5'Flank|POFUT2_ENST00000331343.7_Silent_p.I66I|BX322557.10_ENST00000454115.2_RNA	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	66					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		GGAGAGAGGCGATTCGGATAT	0.572																																						ENST00000349485.5	1.000000	0.020000	0.150000	0.050000	0.090000	0.158133	0.090000	0.080000																										0				20						c.(196-198)atC>atT		protein O-fucosyltransferase 2		G	,	0,4406		0,0,2203	86.0	93.0	91.0		198,198	-9.3	0.0	21		91	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	POFUT2	NM_015227.4,NM_133635.4	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	66/425,66/430	46705777	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	23275	6	121412	40				g.chr21:46705777G>A	AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.198C>T	chr21.hg19:g.46705777G>A		0					BX322557.10_ENST00000454115.2_RNA|POFUT2_ENST00000471540.1_5'Flank|POFUT2_ENST00000331343.7_Silent_p.I66I	p.I66I	NM_133635.4	NP_598368.2	1	2	3	2.057065	Q9Y2G5	OFUT2_HUMAN		2	224	-			Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Silent	SNP	ENST00000349485.5	0	1	hg19	c.198C>T	CCDS13719.1	0																																																																																								0.237019		TCGA-IB-A5SO-01A-11D-A32N-08	0.572	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192573.2	0	0	1	2	2	2	2	0	0	0	0	114	114	114	113	1	1.870000	-2.865559	1	0.230000	NM_015227		0	5	5	0	515	503	0		1	0		0	0	114	0	0	0.933907	1.805907e-01	0	0	0	66	0	5	515
RFTN2	130132	broad.mit.edu	37	2	198498522	198498522	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr2:198498522T>C	ENST00000295049.4	-	4	1174	c.638A>G	c.(637-639)gAa>gGa	p.E213G		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	213					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						ATGAAGTTCTTCCTCAATTCC	0.408																																						ENST00000295049.4	0.920000	0.450000	0.800000	0.550000	0.660000	0.679870	0.660000	0.660000																										0				30						c.(637-639)gAa>gGa		raftlin family member 2							236.0	211.0	220.0					2																	198498522		2203	4300	6503	SO:0001583	missense	130132	1	121410	32				g.chr2:198498522T>C	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.638A>G	chr2.hg19:g.198498522T>C	ENSP00000295049:p.Glu213Gly	0						p.E213G	NM_144629.2	NP_653230.2	0	0	0	1.986160	Q52LD8	RFTN2_HUMAN		4	1174	-			Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	1	1	hg19	c.638A>G	CCDS2323.1	0	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387682	0.61956	.	.	ENSG00000162944	ENST00000295049	T	0.33865	1.39	5.27	2.9	0.33743	5.27	2.9	0.33743	.	2.309500	0.01453	N	0.015562	T	0.39462	0.1079	L	0.57536	1.79	0.34698	D	0.72643	B	0.17268	0.021	B	0.15484	0.013	T	0.33548	-0.9864	10	0.48119	T	0.1	-12.8873	8.1485	0.31126	0.0:0.1588:0.0:0.8412	.	213	Q52LD8	RFTN2_HUMAN	G	213	ENSP00000295049:E213G	ENSP00000295049:E213G	E	-	2	0	0	RFTN2	198206767	198206767	1.000000	0.71417	0.431000	0.26735	0.956000	0.61745	2.615000	0.46368	0.945000	0.37605	0.533000	0.62120	GAA	0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.408	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	1	0	1	2	2	2	2	0	0	0	0	119	119	119	119	1	1.870000	-8.915772	1	0.230000	NM_144629		0	27	26	0	316	313	0		1	0		0	0	119	0	0	1.000000	2.536066e-01	0	1	0	11	0	27	316
CLK1	1195	broad.mit.edu	37	2	201724929	201724929	+	Silent	SNP	G	G	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr2:201724929G>T	ENST00000321356.4	-	4	535	c.400C>A	c.(400-402)Cga>Aga	p.R134R	CLK1_ENST00000492793.1_5'Flank|CLK1_ENST00000409769.2_5'Flank|Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000434813.2_Silent_p.R176R	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	134					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CTTTTCCTTCGGTGACTCTTC	0.463																																						ENST00000321356.4	0.270000	0.040000	0.200000	0.080000	0.130000	0.148776	0.130000	0.130000																										0				33						c.(400-402)Cga>Aga		CDC-like kinase 1							175.0	147.0	156.0					2																	201724929		2203	4300	6503	SO:0001819	synonymous_variant	1195	0	0					g.chr2:201724929G>T	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.400C>A	chr2.hg19:g.201724929G>T		0					CLK1_ENST00000409769.2_5'Flank|CLK1_ENST00000434813.2_Silent_p.R176R|CLK1_ENST00000492793.1_5'Flank|Y_RNA_ENST00000516950.1_RNA	p.R134R	NM_004071.3	NP_004062.2	0	0	0	1.986160	P49759	CLK1_HUMAN		4	535	-			B4DFW7|Q0P694|Q8N5V8	Silent	SNP	ENST00000321356.4	0	1	hg19	c.400C>A	CCDS2331.1	0																																																																																								0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.463	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.870000	-2.072577	0	0.230000			0	5	5	0	331	329	0		1	1		0	0	87	0	0	0.937010	9.518986e-01	0	8	0	360	0	5	331
DNMT3A	1788	broad.mit.edu	37	2	25505560	25505560	+	Silent	SNP	T	T	C			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr2:25505560T>C	ENST00000264709.3	-	4	535	c.198A>G	c.(196-198)ccA>ccG	p.P66P	DNMT3A_ENST00000321117.5_Silent_p.P66P|DNMT3A_ENST00000406659.3_Silent_p.P66P	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	66					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGTCCTTTGGCGTGTCAC	0.542			"""Mis, F, N, S"""		AML																																	ENST00000264709.3	0.620000	0.220000	0.510000	0.300000	0.390000	0.411677	0.390000	0.390000				Rec	yes			Rec	yes		2	2p23	2p23	1788	Mis, F, N, S	DNA (cytosine-5-)-methyltransferase 3 alpha				L	L			AML		0				1021						c.(196-198)ccA>ccG		DNA (cytosine-5-)-methyltransferase 3 alpha							48.0	58.0	55.0					2																	25505560		2202	4297	6499	SO:0001819	synonymous_variant	1788	0	0					g.chr2:25505560T>C		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.198A>G	chr2.hg19:g.25505560T>C		0					DNMT3A_ENST00000406659.3_Silent_p.P66P|DNMT3A_ENST00000321117.5_Silent_p.P66P	p.P66P	NM_175629.2	NP_783328.1	0	0	0	1.986160	Q9Y6K1	DNM3A_HUMAN		4	535	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	1	1	hg19	c.198A>G	CCDS33157.1	0																																																																																								0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.542	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	1	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	1.870000	-15.864010	1	0.230000	NM_022552		0	14	14	0	289	287	0		1	0		0	0	85	0	0	0.999761	2.046271e-01	0	0	0	17	0	14	289
ABCA12	26154	broad.mit.edu	37	2	215807679	215807679	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr2:215807679C>T	ENST00000272895.7	-	50	7625	c.7406G>A	c.(7405-7407)tGt>tAt	p.C2469Y	ABCA12_ENST00000389661.4_Missense_Mutation_p.C2151Y|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2469	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGATCCAATACATTGAAACTT	0.393																																					Ovarian(66;664 1488 5121 34295)	ENST00000272895.7	0.490000	0.070000	0.360000	0.140000	0.230000	0.255481	0.230000	0.210000																										0				139						c.(7405-7407)tGt>tAt		ATP-binding cassette, sub-family A (ABC1), member 12							132.0	115.0	121.0					2																	215807679		2203	4300	6503	SO:0001583	missense	26154	1	121390	26				g.chr2:215807679C>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7406G>A	chr2.hg19:g.215807679C>T	ENSP00000272895:p.Cys2469Tyr	0					AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.C2151Y	p.C2469Y	NM_173076.2	NP_775099.2	0	0	0	1.986160	Q86UK0	ABCAC_HUMAN		50	7625	-		Renal(323;0.127)	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	0	1	hg19	c.7406G>A	CCDS33372.1	0	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711011	0.89112	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.97870	-4.58;-4.58	5.65	5.65	0.86999	5.65	5.65	0.86999	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.98406	0.9470	L	0.58969	1.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.99529	1.0960	10	0.87932	D	0	.	19.6795	0.95957	0.0:1.0:0.0:0.0	.	2469;2151	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	Y	2469;2151	ENSP00000272895:C2469Y;ENSP00000374312:C2151Y	ENSP00000272895:C2469Y	C	-	2	0	0	ABCA12	215515924	215515924	1.000000	0.71417	0.987000	0.45799	0.971000	0.66376	7.521000	0.81832	2.821000	0.97095	0.650000	0.86243	TGT	0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.870000	-6.383204	1	0.230000	NM_173076		0	4	4	0	156	154	0		1	0		0	0	39	0	0	0.888400	4.084699e-02	0	0	0	10	0	4	156
SLC6A1	6529	broad.mit.edu	37	3	11067472	11067472	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr3:11067472C>T	ENST00000287766.4	+	9	1284	c.863C>T	c.(862-864)gCg>gTg	p.A288V	SLC6A1_ENST00000536032.1_Missense_Mutation_p.A110V	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	288					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TGGCTGGATGCGGCAACCCAG	0.517																																						ENST00000287766.4	0.180000	0.030000	0.140000	0.050000	0.080000	0.099865	0.080000	0.080000																										0				26						c.(862-864)gCg>gTg		solute carrier family 6 (neurotransmitter transporter), member 1	Clobazam(DB00349)|Tiagabine(DB00906)						105.0	106.0	106.0					3																	11067472		2203	4300	6503	SO:0001583	missense	6529	0	0					g.chr3:11067472C>T		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.863C>T	chr3.hg19:g.11067472C>T	ENSP00000287766:p.Ala288Val	1					SLC6A1_ENST00000536032.1_Missense_Mutation_p.A110V	p.A288V	NM_003042.3	NP_003033.3	0	1	1	1.887303	P30531	SC6A1_HUMAN		9	1284	+		Ovarian(110;0.0392)	Q8N4K8	Missense_Mutation	SNP	ENST00000287766.4	0	1	hg19	c.863C>T	CCDS2603.1	0	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030610	0.93575	.	.	ENSG00000157103	ENST00000287766;ENST00000536032	D;D	0.91124	-2.79;-2.79	4.98	4.98	0.66077	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000004	D	0.97461	0.9169	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99016	1.0816	10	0.87932	D	0	.	18.4501	0.90700	0.0:1.0:0.0:0.0	.	288	P30531	SC6A1_HUMAN	V	288;110	ENSP00000287766:A288V;ENSP00000445171:A110V	ENSP00000287766:A288V	A	+	2	0	0	SLC6A1	11042472	11042472	1.000000	0.71417	0.984000	0.44739	0.797000	0.45037	7.449000	0.80643	2.595000	0.87683	0.561000	0.74099	GCG	0.168826		TCGA-IB-A5SO-01A-11D-A32N-08	0.517	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	0	0	1	2	14	2	2	1	1	1	1	132	132	132	132	1	1.870000	-1.941839	0	0.230000	NM_003042		0	5	5	0	472	467	0		0	0		1	0	132	0	0	0.028615	3.629301e-03	0	0	0	7	0	5	472
TGFBR2	7048	broad.mit.edu	37	3	30715708	30715708	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr3:30715708G>T	ENST00000295754.5	+	5	1748	c.1366G>T	c.(1366-1368)Gaa>Taa	p.E456*	TGFBR2_ENST00000359013.4_Nonsense_Mutation_p.E481*	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	456	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						GGTGCTCTGGGAAATGACATC	0.458																																						ENST00000295754.5	0.930000	0.420000	0.800000	0.530000	0.650000	0.672867	0.650000	0.650000																										0				53						c.(1366-1368)Gaa>Taa		transforming growth factor, beta receptor II (70/80kDa)							154.0	131.0	138.0					3																	30715708		2203	4300	6503	SO:0001587	stop_gained	7048	0	0					g.chr3:30715708G>T		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1366G>T	chr3.hg19:g.30715708G>T	ENSP00000295754:p.Glu456*	1					TGFBR2_ENST00000359013.4_Nonsense_Mutation_p.E481*	p.E456*	NM_003242.5	NP_003233.4	0	1	1	1.887303	P37173	TGFR2_HUMAN		5	1748	+			B4DTV5|Q15580|Q6DKT6|Q99474	Nonsense_Mutation	SNP	ENST00000295754.5	0	1	hg19	c.1366G>T	CCDS2648.1	0	.	.	.	.	.	.	.	.	.	.	G	43	9.989757	0.99312	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	.	.	.	5.75	5.75	0.90469	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9662	0.97271	0.0:0.0:1.0:0.0	.	.	.	.	X	456;481;286	.	ENSP00000295754:E456X	E	+	1	0	0	TGFBR2	30690712	30690712	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.701000	0.92244	0.650000	0.86243	GAA	0.168826		TCGA-IB-A5SO-01A-11D-A32N-08	0.458	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2	0	0	1	2	14	15	2	1	1	1	1	68	68	68	68	1	1.870000	-8.033695	1	0.230000			0	22	22	0	246	242	0		1	0	1	1	0	68	689	0	0.931598	9.451447e-01	1	9	95	282	825	22	246
CELSR3	1951	broad.mit.edu	37	3	48677390	48677390	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr3:48677390G>A	ENST00000164024.4	-	34	9908	c.9628C>T	c.(9628-9630)Cgg>Tgg	p.R3210W	CELSR3_ENST00000544264.1_Missense_Mutation_p.R3215W	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	3210					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GAGGGGTGCCGGCTAGGCACC	0.657																																						ENST00000164024.4	1.000000	0.630000	1.000000	0.750000	0.890000	0.879673	0.890000	1.000000																										0				83						c.(9628-9630)Cgg>Tgg		cadherin, EGF LAG seven-pass G-type receptor 3							48.0	58.0	55.0					3																	48677390		2202	4300	6502	SO:0001583	missense	1951	2	120994	32				g.chr3:48677390G>A	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.9628C>T	chr3.hg19:g.48677390G>A	ENSP00000164024:p.Arg3210Trp	1					CELSR3_ENST00000544264.1_Missense_Mutation_p.R3215W	p.R3210W	NM_001407.2	NP_001398.2	0	1	1	1.887303	Q9NYQ7	CELR3_HUMAN		34	9908	-			O75092	Missense_Mutation	SNP	ENST00000164024.4	1	1	hg19	c.9628C>T	CCDS2775.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946434	0.73672	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.73047	-0.71;-0.71	4.92	1.72	0.24424	4.92	1.72	0.24424	.	.	.	.	.	T	0.68952	0.3057	L	0.34521	1.04	0.32023	N	0.600519	D;D;D	0.71674	0.99;0.995;0.998	P;P;P	0.53490	0.727;0.661;0.661	T	0.74377	-0.3685	9	0.72032	D	0.01	.	12.4996	0.55948	0.0:0.0:0.4274:0.5726	.	3215;3210;3308	Q9NYQ7-2;Q9NYQ7;Q5Y190	.;CELR3_HUMAN;.	W	3210;3215	ENSP00000164024:R3210W;ENSP00000445694:R3215W	ENSP00000164024:R3210W	R	-	1	2	2	CELSR3	48652394	48652394	0.999000	0.42202	0.996000	0.52242	0.912000	0.54170	2.199000	0.42715	1.035000	0.39972	0.561000	0.74099	CGG	0.168826		TCGA-IB-A5SO-01A-11D-A32N-08	0.657	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.870000	-2.920871	1	0.230000	NM_001407		0	32	32	0	255	251	1		1	1	1	0	0	87	418	0	1.000000	2.310148e-01	1	3	76	5	676	32	255
RBM6	10180	broad.mit.edu	37	3	50085685	50085685	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr3:50085685T>G	ENST00000266022.4	+	7	1824	c.1565T>G	c.(1564-1566)cTa>cGa	p.L522R	RBM6_ENST00000539992.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.L390R|RBM6_ENST00000442092.1_5'UTR|RBM6_ENST00000422955.1_5'UTR|RBM6_ENST00000441115.1_3'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	522	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CAGGGAACTCTAATGATCCAG	0.433																																						ENST00000266022.4	1.000000	0.580000	1.000000	0.750000	0.950000	0.901392	0.950000	1.000000																										0				33						c.(1564-1566)cTa>cGa		RNA binding motif protein 6							93.0	91.0	92.0					3																	50085685		2203	4300	6503	SO:0001583	missense	10180	0	0					g.chr3:50085685T>G	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1565T>G	chr3.hg19:g.50085685T>G	ENSP00000266022:p.Leu522Arg	1					RBM6_ENST00000442092.1_5'UTR|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000422955.1_5'UTR|RBM6_ENST00000443081.1_Missense_Mutation_p.L390R	p.L522R	NM_005777.2	NP_005768.1	0	1	1	1.887303	P78332	RBM6_HUMAN		7	1824	+			O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	1	1	hg19	c.1565T>G	CCDS2809.1	1	.	.	.	.	.	.	.	.	.	.	T	18.37	3.608302	0.66558	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.10192	2.9;2.9	5.62	5.62	0.85841	5.62	5.62	0.85841	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.208568	0.30859	N	0.008727	T	0.29423	0.0733	M	0.71206	2.165	0.80722	D	1	D;D	0.55800	0.973;0.973	D;P	0.64144	0.922;0.898	T	0.00998	-1.1486	9	.	.	.	-3.54	13.227	0.59921	0.0:0.0:0.0:1.0	.	390;522	E9PGM9;P78332	.;RBM6_HUMAN	R	522;390	ENSP00000266022:L522R;ENSP00000396466:L390R	.	L	+	2	0	0	RBM6	50060689	50060689	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.266000	0.58871	2.141000	0.66446	0.528000	0.53228	CTA	0.168826		TCGA-IB-A5SO-01A-11D-A32N-08	0.433	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.870000	-9.156553	1	0.230000	NM_005777		0	15	15	0	107	106	1		1	1		0	0	30	0	0	0.999902	9.999134e-01	0	27	0	96	0	15	107
GPR128	84873	broad.mit.edu	37	3	100365497	100365497	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr3:100365497C>T	ENST00000273352.3	+	10	1463	c.1195C>T	c.(1195-1197)Caa>Taa	p.Q399*	SNORA31_ENST00000517180.1_RNA|GPR128_ENST00000475887.1_Nonsense_Mutation_p.Q104*	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	399	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						ATATGGCTGTCAAAAAGACAA	0.398																																					Pancreas(87;185 1975 7223 18722)	ENST00000273352.3	1.000000	0.590000	1.000000	0.720000	0.880000	0.871718	0.880000	1.000000																										0				56						c.(1195-1197)Caa>Taa		G protein-coupled receptor 128							107.0	107.0	107.0					3																	100365497		2203	4300	6503	SO:0001587	stop_gained	84873	0	0					g.chr3:100365497C>T	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1195C>T	chr3.hg19:g.100365497C>T	ENSP00000273352:p.Gln399*	0					SNORA31_ENST00000517180.1_RNA|GPR128_ENST00000475887.1_Nonsense_Mutation_p.Q104*	p.Q399*	NM_032787.2	NP_116176.2	1	2	3	2.038053	Q96K78	GP128_HUMAN		10	1463	+			Q14D94|Q86SQ2	Nonsense_Mutation	SNP	ENST00000273352.3	0	1	hg19	c.1195C>T	CCDS2938.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.120168	0.94385	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	.	.	.	5.32	-5.99	0.02213	5.32	-5.99	0.02213	.	1.572660	0.03413	N	0.205109	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.2344	0.00184	0.3615:0.1523:0.1933:0.293	.	.	.	.	X	399;104	.	ENSP00000273352:Q399X	Q	+	1	0	0	GPR128	101848187	101848187	0.000000	0.05858	0.003000	0.11579	0.199000	0.23934	-1.251000	0.02882	-0.824000	0.04295	-0.176000	0.13171	CAA	0.233526		TCGA-IB-A5SO-01A-11D-A32N-08	0.398	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	1.870000	-3.318801	1	0.230000			0	25	23	0	223	221	0		1	0		0	0	59	0	0	1.000000	2.386741e-01	0	1	0	8	0	25	223
PPP3CA	5530	broad.mit.edu	37	4	101947138	101947138	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr4:101947138G>A	ENST00000394854.3	-	14	2133	c.1450C>T	c.(1450-1452)Ccg>Tcg	p.P484S	PPP3CA_ENST00000512215.1_Missense_Mutation_p.P252S|PPP3CA_ENST00000323055.6_Missense_Mutation_p.P432S|PPP3CA_ENST00000507176.1_Missense_Mutation_p.P386S|PPP3CA_ENST00000394853.4_Missense_Mutation_p.P474S|PPP3CA_ENST00000523694.2_Missense_Mutation_p.P417S	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	484	Inhibitory domain.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		CTGCGAGGCGGCATCCTCTCA	0.468																																						ENST00000394854.3	0.190000	0.030000	0.140000	0.050000	0.090000	0.104761	0.090000	0.090000																										0				20						c.(1450-1452)Ccg>Tcg		protein phosphatase 3, catalytic subunit, alpha isozyme							208.0	197.0	201.0					4																	101947138		2203	4300	6503	SO:0001583	missense	5530	0	0					g.chr4:101947138G>A		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1450C>T	chr4.hg19:g.101947138G>A	ENSP00000378323:p.Pro484Ser	0					PPP3CA_ENST00000507176.1_Missense_Mutation_p.P386S|PPP3CA_ENST00000323055.6_Missense_Mutation_p.P432S|PPP3CA_ENST00000523694.2_Missense_Mutation_p.P417S|PPP3CA_ENST00000512215.1_Missense_Mutation_p.P252S|PPP3CA_ENST00000394853.4_Missense_Mutation_p.P474S	p.P484S	NM_000944.4	NP_000935.1	0	0	0	1.992893	Q08209	PP2BA_HUMAN		14	2133	-			A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	0	1	hg19	c.1450C>T	CCDS34037.1	0	.	.	.	.	.	.	.	.	.	.	G	19.90	3.913627	0.72983	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T;T	0.05319	3.46;3.46;3.46;3.46;3.46;3.46	5.79	5.79	0.91817	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.35248	0.0925	M	0.89904	3.07	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;1.0;1.0	T	0.28650	-1.0037	10	0.87932	D	0	-9.9218	20.0473	0.97613	0.0:0.0:1.0:0.0	.	484;252;432;474;386;417	Q08209;A8W6Z8;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.;.	S	252;484;432;474;386;417	ENSP00000422781:P252S;ENSP00000378323:P484S;ENSP00000320580:P432S;ENSP00000378322:P474S;ENSP00000422990:P386S;ENSP00000429350:P417S	ENSP00000320580:P432S	P	-	1	0	0	PPP3CA	102166161	102166161	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.502000	0.97981	2.722000	0.93159	0.655000	0.94253	CCG	0.213724		TCGA-IB-A5SO-01A-11D-A32N-08	0.468	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	0	0	1	2	2	2	2	0	0	0	0	115	115	115	114	1	1.870000	-1.796728	0	0.230000	NM_000944		0	5	6	0	477	466	0		1	0		0	0	115	0	0	0.934340	5.228945e-01	0	0	0	150	0	5	477
ANK2	287	broad.mit.edu	37	4	114179218	114179218	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr4:114179218C>T	ENST00000357077.4	+	12	1254	c.1201C>T	c.(1201-1203)Cca>Tca	p.P401S	ANK2_ENST00000264366.6_Missense_Mutation_p.P401S|ANK2_ENST00000506722.1_Missense_Mutation_p.P380S|ANK2_ENST00000394537.3_Missense_Mutation_p.P401S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	401					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGGTTTTACTCCACTGCACAT	0.398																																						ENST00000357077.4	0.580000	0.140000	0.450000	0.210000	0.320000	0.339321	0.320000	0.300000																										0				248						c.(1201-1203)Cca>Tca		ankyrin 2, neuronal							105.0	99.0	101.0					4																	114179218		2203	4300	6503	SO:0001583	missense	287	0	0					g.chr4:114179218C>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1201C>T	chr4.hg19:g.114179218C>T	ENSP00000349588:p.Pro401Ser	0					ANK2_ENST00000264366.6_Missense_Mutation_p.P401S|ANK2_ENST00000394537.3_Missense_Mutation_p.P401S|ANK2_ENST00000506722.1_Missense_Mutation_p.P380S	p.P401S	NM_001148.4	NP_001139.3	0	0	0	1.992893	Q01484	ANK2_HUMAN		12	1254	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	0	1	hg19	c.1201C>T	CCDS3702.1	0	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969555	0.92855	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.78003	-1.14;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.95	5.95	0.96441	5.95	5.95	0.96441	Ankyrin repeat-containing domain (3);	0.000000	0.53938	D	0.000051	D	0.88768	0.6526	M	0.75884	2.315	0.80722	D	1	D;P;P;P;D	0.89917	1.0;0.63;0.911;0.635;0.998	D;P;P;B;D	0.87578	0.998;0.495;0.755;0.396;0.997	D	0.88615	0.3159	10	0.72032	D	0.01	.	20.3748	0.98911	0.0:1.0:0.0:0.0	.	401;401;401;380;380	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	S	380;380;380;416;401;401;401;380	ENSP00000423799:P380S;ENSP00000421011:P380S;ENSP00000421067:P380S;ENSP00000424722:P416S;ENSP00000378044:P401S;ENSP00000349588:P401S;ENSP00000264366:P401S	ENSP00000264366:P401S	P	+	1	0	0	ANK2	114398667	114398667	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.817000	0.96982	0.563000	0.77884	CCA	0.213724		TCGA-IB-A5SO-01A-11D-A32N-08	0.398	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	0	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.870000	-2.846626	1	0.230000	NM_001148		0	7	7	0	188	187	0		1	0		0	0	42	0	0	0.980837	1.034847e-02	0	0	0	4	0	7	188
NAF1	92345	broad.mit.edu	37	4	164050411	164050411	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr4:164050411G>A	ENST00000274054.2	-	8	1316	c.1123C>T	c.(1123-1125)Cga>Tga	p.R375*	NAF1_ENST00000509434.1_Intron|NAF1_ENST00000422287.2_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	375					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				GAAAATCCTCGTGTGAATTCT	0.448																																						ENST00000274054.2	0.490000	0.120000	0.380000	0.190000	0.270000	0.292805	0.270000	0.260000																										0				21						c.(1123-1125)Cga>Tga		nuclear assembly factor 1 ribonucleoprotein							105.0	111.0	109.0					4																	164050411		2203	4300	6503	SO:0001587	stop_gained	92345	0	0					g.chr4:164050411G>A		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1123C>T	chr4.hg19:g.164050411G>A	ENSP00000274054:p.Arg375*	0					NAF1_ENST00000422287.2_Intron|NAF1_ENST00000509434.1_Intron	p.R375*	NM_138386.2	NP_612395.2	0	0	0	1.992893	Q96HR8	NAF1_HUMAN		8	1316	-	all_hematologic(180;0.166)	Prostate(90;0.109)	D3DP28|E9PAZ2	Nonsense_Mutation	SNP	ENST00000274054.2	0	1	hg19	c.1123C>T	CCDS3803.1	0	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808836	0.50421	.	.	ENSG00000145414	ENST00000274054	.	.	.	4.71	-1.19	0.09585	4.71	-1.19	0.09585	.	0.519016	0.17234	N	0.181810	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-2.034	3.5873	0.07975	0.0796:0.3444:0.2622:0.3139	.	.	.	.	X	375	.	ENSP00000274054:R375X	R	-	1	2	2	NAF1	164269861	164269861	0.005000	0.15991	0.001000	0.08648	0.006000	0.05464	0.134000	0.15932	-0.399000	0.07668	-0.218000	0.12543	CGA	0.213724		TCGA-IB-A5SO-01A-11D-A32N-08	0.448	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	0	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	1.870000	-3.657908	1	0.230000	NM_138386		0	8	8	0	248	245	0		1	0		0	0	76	0	0	0.989174	2.313585e-01	0	1	0	25	0	8	248
SORCS2	57537	broad.mit.edu	37	4	7716916	7716916	+	Silent	SNP	C	C	T	rs376351462		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr4:7716916C>T	ENST00000507866.2	+	17	2239	c.2130C>T	c.(2128-2130)taC>taT	p.Y710Y	SORCS2_ENST00000329016.9_Silent_p.Y538Y	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	710					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						CCAGCGACTACGGATTTGAGC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		12097	0.001		0.0	False		,,,				2504	0.0					ENST00000507866.2	0.960000	0.550000	0.860000	0.640000	0.740000	0.755469	0.740000	0.740000																										0				42						c.(2128-2130)taC>taT		sortilin-related VPS10 domain containing receptor 2		C		2,4028		0,2,2013	149.0	155.0	153.0		2130	0.4	1.0	4		153	0,8326		0,0,4163	no	coding-synonymous	SORCS2	NM_020777.2		0,2,6176	TT,TC,CC		0.0,0.0496,0.0162		710/1160	7716916	2,12354	2015	4163	6178	SO:0001819	synonymous_variant	57537	10	120932	44				g.chr4:7716916C>T	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2130C>T	chr4.hg19:g.7716916C>T		0					SORCS2_ENST00000329016.9_Silent_p.Y538Y	p.Y710Y	NM_020777.2	NP_065828.2	0	0	0	1.992893	Q96PQ0	SORC2_HUMAN		17	2239	+			Q9P2L7	Silent	SNP	ENST00000507866.2	1	1	hg19	c.2130C>T	CCDS47008.1	0																																																																																								0.213724		TCGA-IB-A5SO-01A-11D-A32N-08	0.597	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	1	0	1	2	2	2	2	0	0	0	0	129	129	129	129	1	1.870000	-12.488550	1	0.230000	NM_020777		0	44	42	0	457	449	0		1	0		0	0	129	0	0	1.000000	1.902927e-01	0	0	0	9	0	44	457
CCDC110	256309	broad.mit.edu	37	4	186379493	186379493	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr4:186379493C>T	ENST00000307588.3	-	6	2323	c.2248G>A	c.(2248-2250)Gta>Ata	p.V750I	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.V713I|CCDC110_ENST00000510617.1_Missense_Mutation_p.V750I	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	750						nucleus (GO:0005634)		p.V750I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		ATGCTTCTTACGTAATTTTCT	0.284																																						ENST00000307588.3	0.980000	0.160000	0.730000	0.290000	0.480000	0.515705	0.480000	1.000000																										1	Substitution - Missense(1)	p.V750I(1)	large_intestine(1)	30						c.(2248-2250)Gta>Ata		coiled-coil domain containing 110							59.0	58.0	58.0					4																	186379493		2203	4297	6500	SO:0001583	missense	256309	6	121348	33				g.chr4:186379493C>T	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.2248G>A	chr4.hg19:g.186379493C>T	ENSP00000306776:p.Val750Ile	0					CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.V713I|CCDC110_ENST00000510617.1_Missense_Mutation_p.V750I	p.V750I	NM_152775.3	NP_689988.1	0	0	0	1.992893	Q8TBZ0	CC110_HUMAN		6	2323	-		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)	Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	0	1	hg19	c.2248G>A	CCDS3843.1	0	.	.	.	.	.	.	.	.	.	.	C	11.85	1.763163	0.31228	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.28895	1.59;1.59;1.59	5.54	3.55	0.40652	5.54	3.55	0.40652	.	0.441395	0.19156	N	0.121335	T	0.30386	0.0763	M	0.63428	1.95	0.09310	N	1	D;D;D	0.60575	0.988;0.988;0.988	P;P;P	0.50934	0.654;0.654;0.654	T	0.18871	-1.0323	10	0.14252	T	0.57	-6.4794	1.659	0.02787	0.2086:0.4783:0.1387:0.1745	.	750;713;750	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	I	713;750;750	ENSP00000377172:V713I;ENSP00000306776:V750I;ENSP00000427246:V750I	ENSP00000306776:V750I	V	-	1	0	0	CCDC110	186616487	186616487	0.025000	0.19082	0.931000	0.37212	0.983000	0.72400	0.893000	0.28336	1.471000	0.48121	0.650000	0.86243	GTA	0.213724		TCGA-IB-A5SO-01A-11D-A32N-08	0.284	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.870000	-3.928482	1	0.230000	NM_152775		0	4	4	0	72	72	0		1			0	0	17	0	0	0.892229	0	0	0	0	0	0	4	72
UGT3A1	133688	broad.mit.edu	37	5	35954469	35954469	+	Silent	SNP	C	C	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr5:35954469C>T	ENST00000274278.3	-	7	1764	c.1407G>A	c.(1405-1407)acG>acA	p.T469T	UGT3A1_ENST00000513233.1_5'Flank	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	469						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCTTGAGGTGCGTCGCTCCCC	0.602																																						ENST00000274278.3	0.560000	0.100000	0.420000	0.180000	0.280000	0.307381	0.280000	0.260000																										0				46						c.(1405-1407)acG>acA		UDP glycosyltransferase 3 family, polypeptide A1							101.0	77.0	85.0					5																	35954469		2203	4300	6503	SO:0001819	synonymous_variant	133688	0	0					g.chr5:35954469C>T		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.1407G>A	chr5.hg19:g.35954469C>T		0					UGT3A1_ENST00000513233.1_5'Flank	p.T469T	NM_152404.3	NP_689617.3	0	0	0	1.987370	Q6NUS8	UD3A1_HUMAN	Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	7	1764	-	all_lung(31;0.000197)		G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	ENST00000274278.3	1	1	hg19	c.1407G>A	CCDS3913.1	0																																																																																								0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.602	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.870000	-3.673073	1	0.230000	NM_152404		0	5	5	0	155	153	0		1			0	0	49	0	0	0.936468	0	0	0	0	0	0	5	155
FAM71B	153745	broad.mit.edu	37	5	156590199	156590199	+	Silent	SNP	C	C	T	rs369213663		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr5:156590199C>T	ENST00000302938.4	-	2	1172	c.1077G>A	c.(1075-1077)tcG>tcA	p.S359S		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	359						nucleus (GO:0005634)		p.S359S(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCCCCGCCATCGAGGTGGAAG	0.572																																						ENST00000302938.4	1.000000	0.560000	1.000000	0.700000	0.860000	0.853580	0.860000	1.000000																										1	Substitution - coding silent(1)	p.S359S(1)	large_intestine(1)	68						c.(1075-1077)tcG>tcA		family with sequence similarity 71, member B		C		0,4406		0,0,2203	35.0	38.0	37.0		1077	-4.0	0.0	5		37	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FAM71B	NM_130899.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		359/606	156590199	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	153745	2	121410	35				g.chr5:156590199C>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1077G>A	chr5.hg19:g.156590199C>T		0						p.S359S	NM_130899.2	NP_570969.2	0	0	0	1.987370	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	2	1172	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	1	1	hg19	c.1077G>A	CCDS4335.1	1																																																																																								0.211873		TCGA-IB-A5SO-01A-11D-A32N-08	0.572	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	1.870000	-9.351058	1	0.230000	NM_130899		0	21	21	0	185	183	1		1			0	0	61	0	0	0.999998	0	0	0	0	0	0	21	185
GRIK2	2898	broad.mit.edu	37	6	102337618	102337618	+	Missense_Mutation	SNP	G	G	A	rs141189363		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr6:102337618G>A	ENST00000421544.1	+	11	2118	c.1628G>A	c.(1627-1629)cGc>cAc	p.R543H	GRIK2_ENST00000369137.3_Missense_Mutation_p.R543H|GRIK2_ENST00000318991.6_Missense_Mutation_p.R543H|GRIK2_ENST00000413795.1_Missense_Mutation_p.R543H|GRIK2_ENST00000369138.1_Missense_Mutation_p.R543H|GRIK2_ENST00000369134.4_Missense_Mutation_p.R494H	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	543					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ATTTTGTACCGCAAGCCCAAT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14787	0.0		0.0	False		,,,				2504	0.0					ENST00000421544.1	0.230000	0.050000	0.180000	0.080000	0.120000	0.134322	0.120000	0.120000																										0				83						c.(1627-1629)cGc>cAc		glutamate receptor, ionotropic, kainate 2	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	G	HIS/ARG,HIS/ARG,HIS/ARG	3,4403	6.2+/-15.9	0,3,2200	179.0	174.0	176.0		1628,1628,1628	5.6	1.0	6	dbSNP_134	176	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	GRIK2	NM_001166247.1,NM_021956.4,NM_175768.3	29,29,29	0,5,6498	AA,AG,GG		0.0233,0.0681,0.0384	possibly-damaging,possibly-damaging,possibly-damaging	543/893,543/909,543/870	102337618	5,13001	2203	4300	6503	SO:0001583	missense	2898	16	121412	47				g.chr6:102337618G>A		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1628G>A	chr6.hg19:g.102337618G>A	ENSP00000397026:p.Arg543His	0					GRIK2_ENST00000369138.1_Missense_Mutation_p.R543H|GRIK2_ENST00000413795.1_Missense_Mutation_p.R543H|GRIK2_ENST00000318991.6_Missense_Mutation_p.R543H|GRIK2_ENST00000369137.3_Missense_Mutation_p.R543H|GRIK2_ENST00000369134.4_Missense_Mutation_p.R494H	p.R543H	NM_021956.4	NP_068775.1	0	0	0	1.985308	Q13002	GRIK2_HUMAN		11	2118	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	0	1	hg19	c.1628G>A	CCDS5048.1	0	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374924	0.82573	6.81E-4	2.33E-4	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000436862	T;T;T;T;T;T;T	0.54071	2.55;2.55;2.55;0.59;2.55;2.55;2.55	5.6	5.6	0.85130	5.6	5.6	0.85130	Ionotropic glutamate receptor (1);	0.104915	0.64402	D	0.000002	T	0.45617	0.1351	M	0.69463	2.115	0.80722	D	1	P;P;P	0.40875	0.731;0.611;0.731	B;B;B	0.37888	0.26;0.133;0.26	T	0.56025	-0.8047	10	0.66056	D	0.02	.	19.6182	0.95643	0.0:0.0:1.0:0.0	.	543;543;543	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	H	543;543;543;543;543;543;494;142	ENSP00000397026:R543H;ENSP00000405596:R543H;ENSP00000358134:R543H;ENSP00000358133:R543H;ENSP00000313276:R543H;ENSP00000358130:R494H;ENSP00000407140:R142H	ENSP00000313276:R543H	R	+	2	0	0	GRIK2	102444311	102444311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.626000	0.88956	0.650000	0.86243	CGC	0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.468	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1	0	0	1	2	2	2	2	0	0	0	0	153	153	153	153	1	1.870000	-1.775606	0	0.230000			0	7	6	0	492	485	0		1	0		0	0	153	0	0	0.979601	0	0	0	0	1	0	7	492
PTPRK	5796	broad.mit.edu	37	6	128306921	128306921	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr6:128306921G>A	ENST00000368215.3	-	22	3192	c.3193C>T	c.(3193-3195)Cgg>Tgg	p.R1065W	PTPRK_ENST00000368226.4_Missense_Mutation_p.R1066W|PTPRK_ENST00000368213.5_Missense_Mutation_p.R1072W|PTPRK_ENST00000368227.3_Missense_Mutation_p.R1083W|PTPRK_ENST00000368210.3_Missense_Mutation_p.R1084W|PTPRK_ENST00000532331.1_Missense_Mutation_p.R1088W|PTPRK_ENST00000368207.3_Missense_Mutation_p.R1098W			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1065	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTGACTCGCCGGATAAAGGAA	0.498																																						ENST00000368215.3	0.470000	0.070000	0.350000	0.130000	0.220000	0.246569	0.220000	0.200000																									PTPRK/RSPO3(10)	0				72						c.(3193-3195)Cgg>Tgg		protein tyrosine phosphatase, receptor type, K							164.0	150.0	154.0					6																	128306921		2203	4300	6503	SO:0001583	missense	5796	1	121412	28				g.chr6:128306921G>A	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3193C>T	chr6.hg19:g.128306921G>A	ENSP00000357198:p.Arg1065Trp	0					PTPRK_ENST00000368227.3_Missense_Mutation_p.R1083W|PTPRK_ENST00000368226.4_Missense_Mutation_p.R1066W|PTPRK_ENST00000532331.1_Missense_Mutation_p.R1088W|PTPRK_ENST00000368213.5_Missense_Mutation_p.R1072W|PTPRK_ENST00000368207.3_Missense_Mutation_p.R1098W|PTPRK_ENST00000368210.3_Missense_Mutation_p.R1084W	p.R1065W			0	0	0	1.985308	Q15262	PTPRK_HUMAN		22	3192	-			B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	0	1	hg19	c.3193C>T		0	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580797	0.86748	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	D;D;D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9	5.82	5.82	0.92795	5.82	5.82	0.92795	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.94716	0.8295	H	0.94925	3.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.991;0.985	D	0.95321	0.8420	10	0.87932	D	0	.	20.0864	0.97801	0.0:0.0:1.0:0.0	.	1088;1072;1065;1066	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	W	1066;1083;1088;1072;1084;1065;1098	ENSP00000357209:R1066W;ENSP00000357210:R1083W;ENSP00000432973:R1088W;ENSP00000357196:R1072W;ENSP00000357193:R1084W;ENSP00000357198:R1065W;ENSP00000357190:R1098W	ENSP00000357190:R1098W	R	-	1	2	2	PTPRK	128348614	128348614	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.548000	0.67255	2.753000	0.94483	0.650000	0.86243	CGG	0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.498	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1	0	0	1	2	2	2	2	0	0	0	0	37	37	37	36	1	1.870000	-2.481789	0	0.230000			0	4	4	0	162	160	0		1	0		0	0	37	0	0	0.888481	8.941209e-01	0	0	0	168	0	4	162
MOXD1	26002	broad.mit.edu	37	6	132649632	132649632	+	Silent	SNP	G	G	A	rs145443994		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr6:132649632G>A	ENST00000367963.3	-	5	883	c.765C>T	c.(763-765)caC>caT	p.H255H	MOXD1_ENST00000336749.3_Silent_p.H187H	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	255						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		GATAGCACTCGTGGCCGGACT	0.517																																						ENST00000367963.3	0.590000	0.180000	0.480000	0.250000	0.350000	0.373173	0.350000	0.340000																										0				37						c.(763-765)caC>caT		monooxygenase, DBH-like 1		G		1,4405	2.1+/-5.4	0,1,2202	169.0	143.0	152.0		765	-5.9	0.5	6	dbSNP_134	152	0,8600		0,0,4300	no	coding-synonymous	MOXD1	NM_015529.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		255/614	132649632	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26002	5	121412	40				g.chr6:132649632G>A	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.765C>T	chr6.hg19:g.132649632G>A		0					MOXD1_ENST00000336749.3_Silent_p.H187H	p.H255H	NM_015529.2	NP_056344.2	0	0	0	1.985308	Q6UVY6	MOXD1_HUMAN		5	883	-	Breast(56;0.0495)		Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Silent	SNP	ENST00000367963.3	1	1	hg19	c.765C>T	CCDS5152.2	0																																																																																								0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.517	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	61	1	1.870000	-4.232748	1	0.230000	NM_015529		0	10	10	0	234	232	0		1	0		0	0	64	0	0	0.996927	9.965837e-01	0	0	0	237	0	10	234
SASH1	23328	broad.mit.edu	37	6	148853965	148853965	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr6:148853965A>G	ENST00000367467.3	+	14	2072	c.1597A>G	c.(1597-1599)Acc>Gcc	p.T533A		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	533					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TGATTCCTCAACCAGCAACCG	0.557																																						ENST00000367467.3	0.430000	0.120000	0.340000	0.170000	0.240000	0.263367	0.240000	0.240000																										0				52						c.(1597-1599)Acc>Gcc		SAM and SH3 domain containing 1							98.0	99.0	99.0					6																	148853965		2203	4300	6503	SO:0001583	missense	23328	1	121412	30				g.chr6:148853965A>G	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1597A>G	chr6.hg19:g.148853965A>G	ENSP00000356437:p.Thr533Ala	0						p.T533A	NM_015278.3	NP_056093.3	0	0	0	1.985308	O94885	SASH1_HUMAN		14	2072	+		Ovarian(120;0.0169)	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	1	1	hg19	c.1597A>G	CCDS5212.1	0	.	.	.	.	.	.	.	.	.	.	A	6.118	0.389937	0.11581	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.42131	0.98	5.27	2.89	0.33648	5.27	2.89	0.33648	.	0.166954	0.56097	N	0.000035	T	0.07683	0.0193	N	0.11427	0.14	0.29013	N	0.886778	B;B	0.21309	0.054;0.004	B;B	0.20955	0.032;0.017	T	0.38735	-0.9647	10	0.17369	T	0.5	-14.7724	9.7654	0.40557	0.7217:0.0:0.2783:0.0	.	514;533	Q6P4R9;O94885	.;SASH1_HUMAN	A	533;294	ENSP00000356437:T533A	ENSP00000356437:T533A	T	+	1	0	0	SASH1	148895658	148895658	0.976000	0.34144	0.893000	0.35052	0.867000	0.49689	1.935000	0.40173	0.039000	0.15632	-1.139000	0.01908	ACC	0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.557	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	1.870000	-9.822795	1	0.230000	NM_015278		0	9	9	0	307	304	0		1	0		0	0	70	0	0	0.994142	1.333870e-01	0	1	0	19	0	9	307
SYNE1	23345	broad.mit.edu	37	6	152457816	152457816	+	Silent	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr6:152457816G>A	ENST00000367255.5	-	141	26197	c.25596C>T	c.(25594-25596)gaC>gaT	p.D8532D	SYNE1_ENST00000356820.4_Silent_p.D3056D|SYNE1_ENST00000448038.1_Silent_p.D8484D|SYNE1_ENST00000354674.4_Silent_p.D710D|SYNE1_ENST00000423061.1_Silent_p.D8484D|SYNE1_ENST00000539504.1_Silent_p.D687D|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000341594.5_Silent_p.D8144D|SYNE1_ENST00000265368.4_Silent_p.D8532D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8532					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGCACACTCGGTCCCAGCGCC	0.612										HNSCC(10;0.0054)																												ENST00000367255.5	0.310000	0.050000	0.230000	0.090000	0.150000	0.170752	0.150000	0.140000																										0				524						c.(25594-25596)gaC>gaT		spectrin repeat containing, nuclear envelope 1							68.0	63.0	65.0					6																	152457816		2203	4300	6503	SO:0001819	synonymous_variant	23345	0	0					g.chr6:152457816G>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.25596C>T	chr6.hg19:g.152457816G>A		0	HNSCC(10;0.0054)				SYNE1_ENST00000341594.5_Silent_p.D8144D|SYNE1_ENST00000265368.4_Silent_p.D8532D|SYNE1_ENST00000354674.4_Silent_p.D710D|SYNE1_ENST00000539504.1_Silent_p.D687D|SYNE1_ENST00000448038.1_Silent_p.D8484D|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000356820.4_Silent_p.D3056D|SYNE1_ENST00000423061.1_Silent_p.D8484D	p.D8532D	NM_182961.3	NP_892006.3	0	0	0	1.985308	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	141	26197	-		Ovarian(120;0.0955)	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	0	1	hg19	c.25596C>T	CCDS5236.2	0																																																																																								0.210013		TCGA-IB-A5SO-01A-11D-A32N-08	0.612	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	0	0	1	2	2	2	2	0	0	0	0	90	90	90	81	1	1.870000	-3.316814	1	0.230000	NM_182961		0	5	5	0	287	266	0		1	0		0	0	90	0	0	0.924948	5.078251e-01	0	0	0	88	0	5	287
COG5	10466	broad.mit.edu	37	7	107002815	107002815	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr7:107002815G>A	ENST00000347053.3	-	9	1029	c.979C>T	c.(979-981)Cgt>Tgt	p.R327C	COG5_ENST00000393603.2_Missense_Mutation_p.R327C|COG5_ENST00000297135.3_Missense_Mutation_p.R327C	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	327					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						AATGAGGCACGCAAAGCTGCA	0.398																																						ENST00000347053.3	0.440000	0.060000	0.320000	0.120000	0.200000	0.227102	0.200000	0.190000																										0				40						c.(979-981)Cgt>Tgt		component of oligomeric golgi complex 5							83.0	81.0	82.0					7																	107002815		2203	4300	6503	SO:0001583	missense	10466	0	0					g.chr7:107002815G>A	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.979C>T	chr7.hg19:g.107002815G>A	ENSP00000334703:p.Arg327Cys	1					COG5_ENST00000393603.2_Missense_Mutation_p.R327C|COG5_ENST00000297135.3_Missense_Mutation_p.R327C	p.R327C	NM_181733.2	NP_859422.2	0	1	1	1.898206	Q9UP83	COG5_HUMAN		9	1029	-			A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	0	1	hg19	c.979C>T	CCDS5743.1	0	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682211	0.68042	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.32988	1.43;1.43;1.43	5.69	4.81	0.61882	5.69	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.57242	0.2040	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.62923	-0.6751	10	0.87932	D	0	-12.3955	8.6738	0.34167	0.0696:0.0:0.6723:0.258	.	327;327	Q9UP83;Q9UP83-2	COG5_HUMAN;.	C	327	ENSP00000334703:R327C;ENSP00000297135:R327C;ENSP00000377228:R327C	ENSP00000297135:R327C	R	-	1	0	0	COG5	106790051	106790051	1.000000	0.71417	0.990000	0.47175	0.616000	0.37450	5.822000	0.69265	1.540000	0.49301	0.655000	0.94253	CGT	0.167792		TCGA-IB-A5SO-01A-11D-A32N-08	0.398	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.870000	-2.800004	1	0.230000			0	4	4	0	166	166	0		1	0		0	0	39	0	0	0.891327	2.897549e-01	0	0	0	37	0	4	166
MIOS	54468	broad.mit.edu	37	7	7625382	7625382	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr7:7625382G>C	ENST00000340080.4	+	7	2185	c.1764G>C	c.(1762-1764)ttG>ttC	p.L588F	MIOS_ENST00000405785.1_Missense_Mutation_p.L588F	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	588						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACCCGTATTTGTGTGTCATGT	0.383																																						ENST00000340080.4	1.000000	0.050000	0.230000	0.090000	0.140000	0.217516	0.140000	0.130000																										0				32						c.(1762-1764)ttG>ttC		missing oocyte, meiosis regulator, homolog (Drosophila)							162.0	155.0	157.0					7																	7625382		1876	4107	5983	SO:0001583	missense	54468	0	0					g.chr7:7625382G>C		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1764G>C	chr7.hg19:g.7625382G>C	ENSP00000339881:p.Leu588Phe	0					MIOS_ENST00000405785.1_Missense_Mutation_p.L588F	p.L588F	NM_019005.3	NP_061878.3	1	2	3	2.067945	Q9NXC5	MIO_HUMAN		7	2185	+			B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	ENST00000340080.4	0	1	hg19	c.1764G>C	CCDS43554.1	0	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445831	0.43429	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.58210	0.35;0.35	5.46	-5.98	0.02220	5.46	-5.98	0.02220	.	0.000000	0.85682	D	0.000000	T	0.52370	0.1730	L	0.55834	1.745	0.49687	D	0.999814	D	0.54964	0.969	P	0.61592	0.891	T	0.59284	-0.7483	10	0.66056	D	0.02	-7.714	4.7574	0.13092	0.2284:0.4582:0.2193:0.0941	.	588	Q9NXC5	MIO_HUMAN	F	588	ENSP00000339881:L588F;ENSP00000384088:L588F	ENSP00000339881:L588F	L	+	3	2	2	MIOS	7591907	7591907	0.393000	0.25237	0.113000	0.21522	0.612000	0.37316	-0.341000	0.07811	-1.651000	0.01504	-0.229000	0.12294	TTG	0.238754		TCGA-IB-A5SO-01A-11D-A32N-08	0.383	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	1.870000	-3.090841	1	0.230000	NM_019005		0	6	6	0	403	400	0		1	1		0	0	85	0	0	0.964440	2.242233e-01	0	4	0	48	0	6	403
STK31	56164	broad.mit.edu	37	7	23792437	23792437	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr7:23792437A>G	ENST00000355870.3	+	9	1238	c.1119A>G	c.(1117-1119)atA>atG	p.I373M	STK31_ENST00000433467.2_Missense_Mutation_p.I373M|STK31_ENST00000428484.1_Missense_Mutation_p.I350M|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Missense_Mutation_p.I350M	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	373						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AGATGGAAATACTGAAAGAAA	0.333																																						ENST00000355870.3	1.000000	0.500000	1.000000	0.660000	0.850000	0.839022	0.850000	1.000000																										0				67						c.(1117-1119)atA>atG		serine/threonine kinase 31							67.0	67.0	67.0					7																	23792437		2203	4300	6503	SO:0001583	missense	56164	0	0					g.chr7:23792437A>G	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1119A>G	chr7.hg19:g.23792437A>G	ENSP00000348132:p.Ile373Met	0					STK31_ENST00000354639.3_Missense_Mutation_p.I350M|STK31_ENST00000428484.1_Missense_Mutation_p.I350M|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.I373M	p.I373M	NM_031414.4	NP_113602.2	1	2	3	2.067945	Q9BXU1	STK31_HUMAN		9	1238	+			B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	1	1	hg19	c.1119A>G	CCDS5386.1	1	.	.	.	.	.	.	.	.	.	.	A	1.604	-0.525678	0.04141	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	4.94	-4.71	0.03279	4.94	-4.71	0.03279	.	0.667143	0.15196	N	0.275271	T	0.05731	0.0150	N	0.20685	0.6	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.09377	0.004;0.004	T	0.36841	-0.9731	10	0.19147	T	0.46	1.7106	5.3799	0.16186	0.3532:0.2924:0.3544:0.0	.	373;373	B4DZ06;Q9BXU1	.;STK31_HUMAN	M	373;373;350;350	ENSP00000348132:I373M;ENSP00000411852:I373M;ENSP00000346660:I350M;ENSP00000406146:I350M	ENSP00000346660:I350M	I	+	3	3	3	STK31	23758962	23758962	0.000000	0.05858	0.002000	0.10522	0.209000	0.24338	-1.076000	0.03420	-0.604000	0.05760	-0.376000	0.06991	ATA	0.238754		TCGA-IB-A5SO-01A-11D-A32N-08	0.333	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	1	0	1	2	2	2	2	0	0	0	0	29	29	29	28	1	1.870000	-19.999460	1	0.230000	NM_031414		0	16	16	0	154	153	1		1	0		0	0	29	0	0	0.999945	2.860507e-02	0	0	0	3	0	16	154
AUTS2	26053	broad.mit.edu	37	7	69583117	69583117	+	Splice_Site	SNP	G	G	C			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr7:69583117G>C	ENST00000342771.4	+	3	843		c.e3-1		AUTS2_ENST00000406775.2_Splice_Site|AUTS2_ENST00000403018.2_Splice_Site	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2											breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TTTGCCTTTAGCTCAAGCCAG	0.498																																						ENST00000342771.4	1.000000	0.050000	0.320000	0.100000	0.180000	0.257217	0.180000	0.150000																										0				50						c.e3-1		autism susceptibility candidate 2							49.0	51.0	51.0					7																	69583117		2203	4300	6503	SO:0001630	splice_region_variant	26053	0	0					g.chr7:69583117G>C	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.523-1G>C	chr7.hg19:g.69583117G>C		0					AUTS2_ENST00000403018.2_Splice_Site|AUTS2_ENST00000406775.2_Splice_Site		NM_015570.2	NP_056385.1	1	2	3	2.067945	Q8WXX7	AUTS2_HUMAN		3	843	+		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Splice_Site	SNP	ENST00000342771.4	0	1	hg19		CCDS5539.1	0	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512937	0.85389	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	.	.	.	5.34	5.34	0.76211	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2224	0.93803	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	AUTS2	69221053	69221053	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.302000	0.89953	2.765000	0.95021	0.655000	0.94253	.	0.238754		TCGA-IB-A5SO-01A-11D-A32N-08	0.498	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2	0	0	0	2	2	2	2	0	0	0	0	49	49	49	49	1	1.870000	-5.493321	1	0.230000		Intron	0	4	4	0	220	205	0		1			0	0	49	0	0	0.874074	0	0	0	0	0	0	4	220
CPA5	93979	broad.mit.edu	37	7	130008354	130008354	+	Silent	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr7:130008354G>A	ENST00000485477.1	+	12	2356	c.1227G>A	c.(1225-1227)ccG>ccA	p.P409P	CPA5_ENST00000466363.2_Silent_p.P409P|CPA5_ENST00000393213.3_Silent_p.P409P|CPA5_ENST00000474905.1_Silent_p.P409P|CPA5_ENST00000431780.2_Missense_Mutation_p.R381Q|CPA5_ENST00000355388.3_Silent_p.P409P|CPA5_ENST00000461828.1_Silent_p.P409P			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	409						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					TCCTGCTGCCGGCCACACAGA	0.612																																						ENST00000485477.1	0.230000	0.040000	0.180000	0.070000	0.110000	0.129761	0.110000	0.110000																										0				23						c.(1225-1227)ccG>ccA		carboxypeptidase A5							133.0	112.0	119.0					7																	130008354		2203	4300	6503	SO:0001819	synonymous_variant	93979	2	121412	37				g.chr7:130008354G>A	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.1227G>A	chr7.hg19:g.130008354G>A		1					CPA5_ENST00000461828.1_Silent_p.P409P|CPA5_ENST00000355388.3_Silent_p.P409P|CPA5_ENST00000474905.1_Silent_p.P409P|CPA5_ENST00000466363.2_Silent_p.P409P|CPA5_ENST00000431780.2_Missense_Mutation_p.R381Q|CPA5_ENST00000393213.3_Silent_p.P409P	p.P409P			0	1	1	1.898206	Q8WXQ8	CBPA5_HUMAN		12	2356	+	Melanoma(18;0.0435)		G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Silent	SNP	ENST00000485477.1	0	1	hg19	c.1227G>A	CCDS5819.1	0	.	.	.	.	.	.	.	.	.	.	G	0.705	-0.789176	0.02884	.	.	ENSG00000158525	ENST00000431780;ENST00000479492	T	0.12774	2.65	5.85	-11.7	0.00046	5.85	-11.7	0.00046	.	.	.	.	.	T	0.05777	0.0151	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31420	-0.9944	7	.	.	.	.	8.197	0.31402	0.6118:0.1479:0.1748:0.0655	.	381	G3V0G8	.	Q	381;58	ENSP00000393045:R381Q	.	R	+	2	0	0	CPA5	129795590	129795590	0.000000	0.05858	0.046000	0.18839	0.006000	0.05464	-3.373000	0.00493	-3.150000	0.00231	-4.470000	0.00005	CGG	0.167792		TCGA-IB-A5SO-01A-11D-A32N-08	0.612	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	0	0	1	2	2	2	2	0	0	0	0	136	136	136	133	1	1.870000	-2.603785	1	0.230000	NM_001127441		0	6	6	0	421	414	0		1	0		0	0	136	0	0	0.963398	4.306536e-03	0	0	0	6	0	6	421
RP1	6101	broad.mit.edu	37	8	55539165	55539165	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr8:55539165C>G	ENST00000220676.1	+	4	2871	c.2723C>G	c.(2722-2724)gCt>gGt	p.A908G		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	908					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GAGGCTATTGCTCATCATTCA	0.328																																					Colon(91;1014 1389 7634 14542 40420)	ENST00000220676.1	1.000000	0.470000	1.000000	0.620000	0.830000	0.819491	0.830000	1.000000																										0				169						c.(2722-2724)gCt>gGt		retinitis pigmentosa 1 (autosomal dominant)							30.0	32.0	31.0					8																	55539165		2199	4295	6494	SO:0001583	missense	6101	0	0					g.chr8:55539165C>G	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2723C>G	chr8.hg19:g.55539165C>G	ENSP00000220676:p.Ala908Gly	0						p.A908G	NM_006269.1	NP_006260.1	1	2	3	2.088967	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)	4	2871	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)		Missense_Mutation	SNP	ENST00000220676.1	1	1	hg19	c.2723C>G	CCDS6160.1	0	.	.	.	.	.	.	.	.	.	.	C	12.11	1.838250	0.32513	.	.	ENSG00000104237	ENST00000220676	T	0.47869	0.83	5.65	4.76	0.60689	5.65	4.76	0.60689	.	0.812455	0.10842	N	0.628097	T	0.35189	0.0923	L	0.29908	0.895	0.09310	N	0.999998	P	0.39282	0.666	B	0.33339	0.162	T	0.20273	-1.0280	10	0.72032	D	0.01	.	10.4038	0.44246	0.0:0.7852:0.137:0.0778	.	908	P56715	RP1_HUMAN	G	908	ENSP00000220676:A908G	ENSP00000220676:A908G	A	+	2	0	0	RP1	55701718	55701718	0.936000	0.31750	0.399000	0.26333	0.958000	0.62258	1.179000	0.31993	1.357000	0.45904	0.655000	0.94253	GCT	0.243057		TCGA-IB-A5SO-01A-11D-A32N-08	0.328	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.870000	-19.549700	1	0.230000	NM_006269		0	14	13	0	143	143	0		1			0	0	41	0	0	0.999790	0	0	0	0	0	0	14	143
VPS13B	157680	broad.mit.edu	37	8	100833605	100833605	+	Silent	SNP	A	A	T			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr8:100833605A>T	ENST00000358544.2	+	50	9264	c.9153A>T	c.(9151-9153)acA>acT	p.T3051T	VPS13B_ENST00000357162.2_Silent_p.T3026T|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3051					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATAACCTGACATCTCCAAAGT	0.398																																					Colon(161;2205 2542 7338 31318)	ENST00000358544.2	1.000000	0.040000	0.260000	0.080000	0.140000	0.246512	0.140000	0.120000																										0				193						c.(9151-9153)acA>acT		vacuolar protein sorting 13 homolog B (yeast)							212.0	200.0	204.0					8																	100833605		2203	4300	6503	SO:0001819	synonymous_variant	157680	0	0					g.chr8:100833605A>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9153A>T	chr8.hg19:g.100833605A>T		0					VPS13B_ENST00000357162.2_Silent_p.T3026T|VPS13B_ENST00000395996.1_3'UTR	p.T3051T	NM_017890.4	NP_060360.3	1	2	3	2.088967	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)	50	9264	+	Breast(36;3.73e-07)		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	0	1	hg19	c.9153A>T	CCDS6280.1	0																																																																																								0.243057		TCGA-IB-A5SO-01A-11D-A32N-08	0.398	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	0	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	1.870000	-5.769193	1	0.230000	NM_184042		0	5	5	0	356	355	0		1	1		0	0	72	0	0	0.937503	2.768465e-02	0	3	0	12	0	5	356
TGFBR1	7046	broad.mit.edu	37	9	101900330	101900330	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr9:101900330G>A	ENST00000374994.4	+	4	881	c.764G>A	c.(763-765)cGt>cAt	p.R255H	TGFBR1_ENST00000550253.1_Missense_Mutation_p.R186H|TGFBR1_ENST00000552516.1_Missense_Mutation_p.R259H|TGFBR1_ENST00000374990.2_Missense_Mutation_p.R178H	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	255	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.R255L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				GTAATGTTACGTCATGAAAAC	0.378																																						ENST00000374994.4	1.000000	0.070000	0.320000	0.120000	0.190000	0.275784	0.190000	0.170000																										1	Substitution - Missense(1)	p.R255L(1)	prostate(1)	27						c.(763-765)cGt>cAt		transforming growth factor, beta receptor 1							138.0	136.0	137.0					9																	101900330		2203	4300	6503	SO:0001583	missense	7046	0	0					g.chr9:101900330G>A		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.764G>A	chr9.hg19:g.101900330G>A	ENSP00000364133:p.Arg255His	0					TGFBR1_ENST00000552516.1_Missense_Mutation_p.R259H|TGFBR1_ENST00000374990.2_Missense_Mutation_p.R178H|TGFBR1_ENST00000550253.1_Missense_Mutation_p.R186H	p.R255H	NM_004612.2	NP_004603.1	1	2	3	2.076687	P36897	TGFR1_HUMAN		4	881	+		Acute lymphoblastic leukemia(62;0.0559)	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	0	1	hg19	c.764G>A	CCDS6738.1	0	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510468	0.85389	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000549021;ENST00000550253	D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32	5.36	5.36	0.76844	5.36	5.36	0.76844	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95993	0.8695	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.95388	0.8479	9	.	.	.	.	17.8646	0.88792	0.0:0.0:1.0:0.0	.	178;255	P36897-3;P36897	.;TGFR1_HUMAN	H	255;255;178;259;109;186	ENSP00000364133:R255H;ENSP00000364129:R178H;ENSP00000447297:R259H;ENSP00000449028:R109H;ENSP00000450052:R186H	.	R	+	2	0	0	TGFBR1	100940151	100940151	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	9.810000	0.99221	2.530000	0.85305	0.655000	0.94253	CGT	0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.378	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3	0	0	1	2	2	2	20	0	0	0	0	61	61	61	61	1	1.870000	-3.054871	1	0.230000			0	6	6	0	300	300	0		1	0	0	0	6	61	384	0	0.965382	6.602985e-01	2.338840e-01	0	6	108	657	6	300
ACTL7B	10880	broad.mit.edu	37	9	111617095	111617095	+	Silent	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr9:111617095G>A	ENST00000374667.3	-	1	2144	c.1116C>T	c.(1114-1116)gcC>gcT	p.A372A		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	372						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TCTCAGGAGCGGCAGCCACTG	0.647																																						ENST00000374667.3	1.000000	0.050000	0.290000	0.090000	0.160000	0.250266	0.160000	0.130000																										0				20						c.(1114-1116)gcC>gcT		actin-like 7B							26.0	33.0	31.0					9																	111617095		2151	4208	6359	SO:0001819	synonymous_variant	10880	1	121220	31				g.chr9:111617095G>A	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.1116C>T	chr9.hg19:g.111617095G>A		0						p.A372A	NM_006686.3	NP_006677.1	1	2	3	2.076687	Q9Y614	ACL7B_HUMAN		1	2144	-			B2R9Q2|Q5JSV1	Silent	SNP	ENST00000374667.3	0	1	hg19	c.1116C>T	CCDS6771.1	0																																																																																								0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.647	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053571.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	1.870000	-3.923896	1	0.230000	NM_006686		0	4	4	0	250	235	0		1			0	0	75	0	0	0.876181	0	0	0	0	0	0	4	250
FBXW5	54461	broad.mit.edu	37	9	139835466	139835466	+	Missense_Mutation	SNP	G	G	A	rs368494470		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr9:139835466G>A	ENST00000325285.3	-	9	1694	c.1615C>T	c.(1615-1617)Cgc>Tgc	p.R539C	FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	539					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)	p.R539C(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		CGTGGGGAGCGCCAGGCTTTG	0.672																																						ENST00000325285.3	1.000000	0.450000	1.000000	0.840000	0.990000	0.934444	0.990000	1.000000																										1	Substitution - Missense(1)	p.R539C(1)	endometrium(1)	12						c.(1615-1617)Cgc>Tgc		F-box and WD repeat domain containing 5		G	CYS/ARG	0,4292		0,0,2146	69.0	61.0	64.0		1615	4.6	1.0	9		64	1,8449		0,1,4224	no	missense	FBXW5	NM_018998.2	180	0,1,6370	AA,AG,GG		0.0118,0.0,0.0078	probably-damaging	539/567	139835466	1,12741	2146	4225	6371	SO:0001583	missense	54461	0	0					g.chr9:139835466G>A	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.1615C>T	chr9.hg19:g.139835466G>A	ENSP00000313034:p.Arg539Cys	0					FBXW5_ENST00000483559.1_5'UTR	p.R539C	NM_018998.3	NP_061871.1	1	2	3	2.074935	Q969U6	FBXW5_HUMAN	STAD - Stomach adenocarcinoma(284;0.19)	9	1694	-	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	ENST00000325285.3	0	1	hg19	c.1615C>T	CCDS7014.1	1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674100	0.88445	0.0	1.18E-4	ENSG00000159069	ENST00000325285	T	0.67345	-0.26	4.61	4.61	0.57282	4.61	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.063203	0.64402	D	0.000004	T	0.80808	0.4694	M	0.71296	2.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.981	D	0.83522	0.0086	10	0.72032	D	0.01	-0.5139	16.0315	0.80582	0.0:0.0:1.0:0.0	.	404;539	Q59ET5;Q969U6	.;FBXW5_HUMAN	C	539	ENSP00000313034:R539C	ENSP00000313034:R539C	R	-	1	0	0	FBXW5	138955287	138955287	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.184000	0.77705	2.126000	0.65437	0.561000	0.74099	CGC	0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.672	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	0	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.870000	-9.064747	1	0.230000	NM_018998		0	3	3	0	15	15	1		1	1		0	0	10	1	0	0.813268	9.999967e-01	0	103	0	490	0	3	15
OSTF1	26578	broad.mit.edu	37	9	77752511	77752511	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr9:77752511G>A	ENST00000346234.6	+	8	616	c.466G>A	c.(466-468)Gtc>Atc	p.V156I		NM_012383.4	NP_036515.4	Q92882	OSTF1_HUMAN	osteoclast stimulating factor 1	156					ossification (GO:0001503)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)				endometrium(1)|skin(1)	2						TGCAGATATCGTCCAGTTGCT	0.398																																						ENST00000346234.6	1.000000	0.550000	1.000000	0.690000	0.860000	0.853697	0.860000	1.000000																										0				2						c.(466-468)Gtc>Atc		osteoclast stimulating factor 1							176.0	150.0	159.0					9																	77752511		2203	4300	6503	SO:0001583	missense	26578	3	121410	31				g.chr9:77752511G>A	U63717	CCDS6651.1	9q13-q21.2	2013-01-10			ENSG00000134996	ENSG00000134996		"""Ankyrin repeat domain containing"""	8510	protein-coding gene	gene with protein product		610180				10092216	Standard	NM_012383		Approved	SH3P2, OSF, bA235O14.1	uc004ajv.4	Q92882	OTTHUMG00000020033	ENST00000346234.6:c.466G>A	chr9.hg19:g.77752511G>A	ENSP00000340836:p.Val156Ile	0						p.V156I	NM_012383.4	NP_036515.4	1	2	3	2.076687	Q92882	OSTF1_HUMAN		8	616	+			Q5W126|Q96IJ4	Missense_Mutation	SNP	ENST00000346234.6	1	1	hg19	c.466G>A	CCDS6651.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878070	0.91664	.	.	ENSG00000134996	ENST00000346234	T	0.71698	-0.59	5.51	5.51	0.81932	5.51	5.51	0.81932	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	L	0.31752	0.955	0.80722	D	1	D;D	0.89917	1.0;0.959	D;P	0.78314	0.991;0.893	T	0.77313	-0.2634	10	0.45353	T	0.12	-17.9865	18.188	0.89798	0.0:0.0:1.0:0.0	.	156;156	A8K646;Q92882	.;OSTF1_HUMAN	I	156	ENSP00000340836:V156I	ENSP00000340836:V156I	V	+	1	0	0	OSTF1	76942331	76942331	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.757000	0.91657	2.585000	0.87301	0.563000	0.77884	GTC	0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.398	OSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052704.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.870000	-8.913195	1	0.230000	NM_012383		0	21	19	0	199	197	1		1	1		0	0	44	0	0	0.999998	1	0	67	0	282	0	21	199
ABCA2	20	broad.mit.edu	37	9	139908435	139908435	+	Silent	SNP	G	G	A	rs377594797		TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chr9:139908435G>A	ENST00000371605.3	-	27	4440	c.4293C>T	c.(4291-4293)ggC>ggT	p.G1431G	ABCA2_ENST00000341511.6_Silent_p.G1432G|ABCA2_ENST00000265662.5_Silent_p.G1432G			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1431					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TCAGCCACCCGCCGTCCAGCT	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12959	0.0		0.0	False		,,,				2504	0.0					ENST00000371605.3	1.000000	0.180000	0.570000	0.260000	0.380000	0.442569	0.380000	0.350000																										0				41						c.(4291-4293)ggC>ggT		ATP-binding cassette, sub-family A (ABC1), member 2		G	,	2,4166		0,2,2082	32.0	41.0	38.0		4296,4386	4.7	1.0	9		38	0,8396		0,0,4198	no	coding-synonymous,coding-synonymous	ABCA2	NM_001606.4,NM_212533.2	,	0,2,6280	AA,AG,GG		0.0,0.048,0.0159	,	1432/2437,1462/2467	139908435	2,12562	2084	4198	6282	SO:0001819	synonymous_variant	20	11	120222	40				g.chr9:139908435G>A	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4293C>T	chr9.hg19:g.139908435G>A		0					ABCA2_ENST00000265662.5_Silent_p.G1432G|ABCA2_ENST00000341511.6_Silent_p.G1432G	p.G1431G			1	2	3	2.074935	Q9BZC7	ABCA2_HUMAN	STAD - Stomach adenocarcinoma(284;0.123)	27	4440	-	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	1	1	hg19	c.4293C>T		0																																																																																								0.240481		TCGA-IB-A5SO-01A-11D-A32N-08	0.657	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	37	37	37	36	1	1.870000	-10.803910	1	0.230000	NM_001606		0	9	9	0	216	211	0		1	0		0	0	37	0	0	0.993896	6.703683e-01	0	1	0	54	0	9	216
SPANXD	64648	broad.mit.edu	37	X	140785682	140785682	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SO-01A-11D-A32N-08	TCGA-IB-A5SO-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f21270ad-5de6-4066-9e11-f25ed1d27377	72019813-f98e-42f7-a8ca-798553f65d04	g.chrX:140785682G>C	ENST00000370515.3	-	2	567	c.234C>G	c.(232-234)aaC>aaG	p.N78K		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	78						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					TTTGGAGGGGGTTGATTCTGT	0.448																																						ENST00000370515.3	0.550000	0.320000	0.490000	0.370000	0.420000	0.437029	0.420000	0.430000																										0				9						c.(232-234)aaC>aaG		SPANX family, member D							194.0	171.0	179.0					X																	140785682		2199	4273	6472	SO:0001583	missense	64648	0	0					g.chrX:140785682G>C	AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.234C>G	chrX.hg19:g.140785682G>C	ENSP00000359546:p.Asn78Lys							p.N78K	NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	0	1	1		Q9BXN6	SPNXD_HUMAN		2	567	-	Acute lymphoblastic leukemia(192;7.65e-05)		Q5JWI1	Missense_Mutation	SNP	ENST00000370515.3	1	1	hg19	c.234C>G	CCDS14675.1	0	.	.	.	.	.	.	.	.	.	.	N	8.302	0.820191	0.16678	.	.	ENSG00000196406	ENST00000370515	T	0.09445	2.98	.	.	.	.	.	.	.	.	.	.	.	T	0.25457	0.0619	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.81914	0.995	T	0.06789	-1.0807	6	0.72032	D	0.01	.	.	.	.	.	78	Q9BXN6	SPNXD_HUMAN	K	78	ENSP00000359546:N78K	ENSP00000359546:N78K	N	-	3	2	2	SPANXD	140613348	140613348	0.055000	0.20627	0.048000	0.18961	0.048000	0.14542	0.075000	0.14686	0.068000	0.16574	0.068000	0.15388	AAC	0.230000		TCGA-IB-A5SO-01A-11D-A32N-08	0.448	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058598.1	0	0	1	2	2	2	2	0	0	0	0	147	147	147	159	1	1.870000	-16.283330	1	0.230000			0	50	46	0	452	393	0		1			0	0	147	0	0	1.000000	0	0	0	0	0	0	50	452
