#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SMAD4	4089	broad.mit.edu	37	18	48604761	48604764	+	Frame_Shift_Del	DEL	ACTT	ACTT	-			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			ACTT	-	ACTT	ACTT		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr18:48604761_48604764delACTT	ENST00000342988.3	+	12	2121_2124	c.1583_1586delACTT	c.(1582-1587)cacttafs	p.HL528fs	SMAD4_ENST00000398417.2_Frame_Shift_Del_p.HL528fs|SMAD4_ENST00000588745.1_Frame_Shift_Del_p.HL432fs|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	528	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.L529fs*7(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ATTGAAATTCACTTACACCGGGCC	0.495																																						ENST00000342988.3	0.560000	4.200000e-01	0.530000	4.500000e-01	4.900000e-01	0.496197	4.900000e-01	0.490000																										39	Whole gene deletion(36)|Unknown(2)|Deletion - Frameshift(1)	p.0?(36)|p.?(2)|p.L529fs*7(1)	pancreas(27)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1582-1587)cacttafs		SMAD family member 4																																				SO:0001589	frameshift_variant	4089	0	0					g.chr18:48604761_48604764delACTT	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1583_1586delACTT	chr18.hg19:g.48604761_48604764delACTT	ENSP00000341551:p.His528fs	1					SMAD4_ENST00000588745.1_Frame_Shift_Del_p.HL432fs|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.HL528fs	p.HL528fs	NM_005359.5	NP_005350.1	0	1	1	1.494535	Q13485	SMAD4_HUMAN		12	2121_2124	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Frame_Shift_Del	DEL	ENST00000342988.3	1	1	hg19	c.1583_1586delACTT	CCDS11950.1	0																																																																																								0.587302		TCGA-IB-A5SP-01A-11D-A32N-08	0.495	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		25	2	2	0	0	0	1	64	0	64	64	1	1.770000	-9.475697	1	0.740000	NM_005359		0	142	166	0	346	356	0	0	1	1	1	0	0	64	1119	0	1.000000	9.999932e-01	1	14	176	31	300	142	346
SCN7A	6332	broad.mit.edu	37	2	167313539	167313540	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:167313539_167313540insA	ENST00000409855.1	-	10	1256_1257	c.1130_1131insT	c.(1129-1131)gtafs	p.V377fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	377					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ACAAAAAACTTACCACCACAAA	0.347																																						ENST00000409855.1	1.000000	4.200000e-01	0.680000	4.900000e-01	5.700000e-01	0.595394	5.700000e-01	0.570000																										0				44						c.(1129-1131)gtafs		sodium channel, voltage-gated, type VII, alpha subunit	Valproic Acid(DB00313)																																			SO:0001589	frameshift_variant	6332	0	0					g.chr2:167313539_167313540insA	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1131dupT	chr2.hg19:g.167313540_167313540dupA	ENSP00000386796:p.Val377fs	0						p.V377fs	NM_002976.3	NP_002967.2	1	2	3	2.252328	Q01118	SCN7A_HUMAN		10	1256_1257	-				Frame_Shift_Ins	INS	ENST00000409855.1	0	1	hg19	c.1130_1131insT	CCDS46442.1	0																																																																																								0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.347	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1	1	0	1		2	2		0	0	0	0	16	0	16	16	1	1.770000	-20.000000	1	0.740000			0	38	38	0	143	142	0	0	1	0		0	0	16	0	0	1.000000	4.632929e-02		0	0	2	0	38	143
MECOM	2122	broad.mit.edu	37	3	168833756	168833762	+	Frame_Shift_Del	DEL	TTATTAT	TTATTAT	-			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			TTATTAT	-	TTATTAT	TTATTAT		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr3:168833756_168833762delTTATTAT	ENST00000464456.1	-	7	2534_2540	c.1334_1340delATAATAA	c.(1333-1341)aataataagfs	p.NNK445fs	MECOM_ENST00000472280.1_Frame_Shift_Del_p.NNK446fs|MECOM_ENST00000392736.3_Frame_Shift_Del_p.NNK445fs|MECOM_ENST00000460814.1_Frame_Shift_Del_p.NNK445fs|MECOM_ENST00000494292.1_Frame_Shift_Del_p.NNK633fs|MECOM_ENST00000433243.2_Frame_Shift_Del_p.NNK446fs|MECOM_ENST00000264674.3_Frame_Shift_Del_p.NNK510fs|MECOM_ENST00000468789.1_Frame_Shift_Del_p.NNK445fs	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GTATTCTTTCTTATTATTTATTGAAGC	0.348																																						ENST00000464456.1	0.640000	4.400000e-01	0.590000	4.800000e-01	5.300000e-01	0.544772	5.300000e-01	0.540000																										0				85						c.(1333-1341)aataataagfs		MDS1 and EVI1 complex locus																																				SO:0001589	frameshift_variant	2122	0	0					g.chr3:168833756_168833762delTTATTAT	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.1334_1340delATAATAA	chr3.hg19:g.168833756_168833762delTTATTAT	ENSP00000419770:p.Asn445fs	1					MECOM_ENST00000472280.1_Frame_Shift_Del_p.NNK446fs|MECOM_ENST00000392736.3_Frame_Shift_Del_p.NNK445fs|MECOM_ENST00000460814.1_Frame_Shift_Del_p.NNK445fs|MECOM_ENST00000494292.1_Frame_Shift_Del_p.NNK633fs|MECOM_ENST00000433243.2_Frame_Shift_Del_p.NNK446fs|MECOM_ENST00000264674.3_Frame_Shift_Del_p.NNK510fs|MECOM_ENST00000468789.1_Frame_Shift_Del_p.NNK445fs	p.NNK445fs	NM_001164000.1	NP_001157472.1	0	1	1	1.954591	Q13465	MDS1_HUMAN		7	2534_2540	-			Q13466|Q6FH90	Frame_Shift_Del	DEL	ENST00000464456.1	1	1	hg19	c.1334_1340delATAATAA	CCDS54669.1	0																																																																																								0.700046		TCGA-IB-A5SP-01A-11D-A32N-08	0.348	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	1	0	1		42	2		0	0	0	3	54	0	54	57	1	1.770000	-20.000000	1	0.740000	NM_005241, NM_004991		0	87	131	0	289	327	0	0	1	0		0	0	54	0	0	1.000000	9.999962e-01		1	0	62	0	87	289
RREB1	6239	broad.mit.edu	37	6	7230570	7230570	+	Frame_Shift_Del	DEL	C	C	-	rs532055856	byFrequency	TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr6:7230570delC	ENST00000349384.6	+	10	2552	c.2238delC	c.(2236-2238)gacfs	p.D746fs	RREB1_ENST00000379933.3_Frame_Shift_Del_p.D746fs|RREB1_ENST00000334984.6_Frame_Shift_Del_p.D746fs|RREB1_ENST00000379938.2_Frame_Shift_Del_p.D746fs	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	746					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AGCTGGTGGACGCCTTCTGCG	0.662																																						ENST00000349384.6	0.630000	4.700000e-01	0.590000	5.000000e-01	5.400000e-01	0.555287	5.400000e-01	0.550000																										0				58						c.(2236-2238)gacfs		ras responsive element binding protein 1							55.0	51.0	52.0					6																	7230570		2203	4300	6503	SO:0001589	frameshift_variant	6239	0	0					g.chr6:7230570delC	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2238delC	chr6.hg19:g.7230570delC	ENSP00000305560:p.Asp746fs	1					RREB1_ENST00000379938.2_Frame_Shift_Del_p.D746fs|RREB1_ENST00000334984.6_Frame_Shift_Del_p.D746fs|RREB1_ENST00000379933.3_Frame_Shift_Del_p.D746fs	p.D746fs	NM_001003698.3	NP_001003698.1	0	1	1	1.499983	Q92766	RREB1_HUMAN		10	2552	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Frame_Shift_Del	DEL	ENST00000349384.6	1	1	hg19	c.2238delC	CCDS34336.1	0																																																																																								0.592093		TCGA-IB-A5SP-01A-11D-A32N-08	0.662	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	1	0	1		2	2		0	0	0	0	110	0	110	105	1	1.770000	-11.307400	1	0.740000			0	123	122	0	259	255	0	0	1	1		0	0	110	0	0	1.000000	9.902697e-01		8	0	10	0	123	259
GATA3	2625	broad.mit.edu	37	10	8100716	8100716	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr10:8100716C>A	ENST00000346208.3	+	3	1145	c.690C>A	c.(688-690)agC>agA	p.S230R	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Missense_Mutation_p.S230R			P23771	GATA3_HUMAN	GATA binding protein 3	230					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CCGAGTACAGCTCCGGACTCT	0.697			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															ENST00000346208.3	1.000000	4.400000e-01	0.610000	4.800000e-01	5.400000e-01	0.573890	5.400000e-01	0.540000				Rec	yes			Rec	yes		10	10p15	10p15	2625	F, N, S	GATA binding protein 3	yes	yes	HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)	E	E			breast		0				87						c.(688-690)agC>agA		GATA binding protein 3							45.0	44.0	45.0					10																	8100716		2203	4299	6502	SO:0001583	missense	2625	0	0					g.chr10:8100716C>A	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.690C>A	chr10.hg19:g.8100716C>A	ENSP00000341619:p.Ser230Arg	0					GATA3_ENST00000379328.3_Missense_Mutation_p.S230R|GATA3_ENST00000461472.1_3'UTR	p.S230R			2	2	4	2.306636	P23771	GATA3_HUMAN		3	1145	+			Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	1	1	hg19	c.690C>A	CCDS7083.1	0	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846693	0.51164	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96459	-4.02;-4.0	5.55	5.55	0.83447	5.550000	5.550000	0.834470	.	0.098818	0.64402	D	0.000001	D	0.94647	0.8274	L	0.50333	1.59	0.42485	D	0.99287	P;B	0.43826	0.818;0.317	B;B	0.39299	0.296;0.124	D	0.94291	0.7528	10	0.39692	T	0.17	-19.3456	19.5043	0.95108	0.0:1.0:0.0:0.0	.	230;230	P23771;P23771-2	GATA3_HUMAN;.	R	230	ENSP00000368632:S230R;ENSP00000341619:S230R	ENSP00000341619:S230R	S	+	3	2	2	GATA3	8140722	8140722	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.873000	0.56093	2.607000	0.88179	0.561000	0.74099	AGC	0.754532		TCGA-IB-A5SP-01A-11D-A32N-08	0.697	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	0	0	0	2	21	2	2	1	1	1	2	106	106	106	105	1	1.770000	-20.000000	1	0.740000	NM_001002295		0	86	85	0	369	361	1		1	0		1	0	106	0	0	1.000000	9.554913e-02	0	0	0	3	0	86	369
PCDH15	65217	broad.mit.edu	37	10	55912915	55912915	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr10:55912915G>A	ENST00000320301.6	-	14	2123	c.1729C>T	c.(1729-1731)Cgg>Tgg	p.R577W	PCDH15_ENST00000395445.1_Missense_Mutation_p.R584W|PCDH15_ENST00000437009.1_Missense_Mutation_p.R577W|PCDH15_ENST00000395430.1_Missense_Mutation_p.R577W|PCDH15_ENST00000395446.1_Missense_Mutation_p.R577W|PCDH15_ENST00000409834.1_Missense_Mutation_p.R188W|PCDH15_ENST00000395433.1_Missense_Mutation_p.R555W|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Missense_Mutation_p.R555W|PCDH15_ENST00000395432.2_Missense_Mutation_p.R540W|PCDH15_ENST00000395438.1_Missense_Mutation_p.R577W|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.R577W|PCDH15_ENST00000373965.2_Missense_Mutation_p.R584W|PCDH15_ENST00000414778.1_Missense_Mutation_p.R582W|PCDH15_ENST00000373955.1_Missense_Mutation_p.R577W	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	577	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GCGTAAGTCCGCCCGACTATC	0.483										HNSCC(58;0.16)																												ENST00000320301.6	1.000000	9.900000e-01	1.000000	9.900000e-01	9.900000e-01	0.999562	9.900000e-01	1.000000																										0				237						c.(1729-1731)Cgg>Tgg		protocadherin-related 15							137.0	119.0	125.0					10																	55912915		2203	4300	6503	SO:0001583	missense	65217	0	0					g.chr10:55912915G>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1729C>T	chr10.hg19:g.55912915G>A	ENSP00000322604:p.Arg577Trp	1	HNSCC(58;0.16)				PCDH15_ENST00000395433.1_Missense_Mutation_p.R555W|PCDH15_ENST00000373965.2_Missense_Mutation_p.R584W|PCDH15_ENST00000395430.1_Missense_Mutation_p.R577W|PCDH15_ENST00000373957.3_Missense_Mutation_p.R555W|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.R577W|PCDH15_ENST00000409834.1_Missense_Mutation_p.R188W|PCDH15_ENST00000395438.1_Missense_Mutation_p.R577W|PCDH15_ENST00000361849.3_Missense_Mutation_p.R577W|PCDH15_ENST00000437009.1_Missense_Mutation_p.R577W|PCDH15_ENST00000395445.1_Missense_Mutation_p.R584W|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.R540W|PCDH15_ENST00000373955.1_Missense_Mutation_p.R577W|PCDH15_ENST00000414778.1_Missense_Mutation_p.R582W	p.R577W	NM_033056.3	NP_149045.3	2	2	4	2.343436	Q96QU1	PCD15_HUMAN		14	2123	-		Melanoma(3;0.117)|Lung SC(717;0.238)	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	1	1	hg19	c.1729C>T	CCDS7248.1	1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945863	0.34377	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09	5.83	2.87	0.33458	5.830000	2.870000	0.334580	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.76751	0.4031	M	0.88979	2.995	0.09310	N	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;1.0;1.0;1.0;0.997;1.0;1.0;0.994;0.997;0.987;0.997;0.999	D;P;P;P;D;D;D;P;D;D;P;P;P;P;P	0.67725	0.932;0.901;0.901;0.849;0.932;0.932;0.932;0.883;0.953;0.953;0.832;0.832;0.742;0.893;0.901	T	0.66689	-0.5860	9	0.87932	D	0	.	10.5008	0.44804	0.0:0.1241:0.4926:0.3833	.	555;577;577;582;577;540;577;577;584;584;577;582;577;555;577	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	W	584;582;577;577;188;584;577;540;577;555;555;577;577;582;577;577	ENSP00000363076:R584W;ENSP00000410304:R582W;ENSP00000378826:R577W;ENSP00000386693:R188W;ENSP00000378832:R584W;ENSP00000378833:R577W;ENSP00000378820:R540W;ENSP00000354950:R577W;ENSP00000378821:R555W;ENSP00000363068:R555W;ENSP00000322604:R577W;ENSP00000378818:R577W;ENSP00000412628:R577W;ENSP00000363066:R577W	ENSP00000322604:R577W	R	-	1	2	2	PCDH15	55582921	55582921	0.019000	0.18553	0.006000	0.13384	0.053000	0.15095	1.942000	0.40243	0.331000	0.23511	0.650000	0.86243	CGG	0.757914		TCGA-IB-A5SP-01A-11D-A32N-08	0.483	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.770000	-19.870380	1	0.740000	NM_033056		0	149	148	0	227	226	1		1			0	0	39	0	0	1.000000	0	0	0	0	0	0	149	227
P4HA1	5033	broad.mit.edu	37	10	74828652	74828652	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr10:74828652C>A	ENST00000307116.2	-	5	531	c.415G>T	c.(415-417)Gat>Tat	p.D139Y	RP11-344N10.2_ENST00000431293.2_RNA|P4HA1_ENST00000394890.2_Missense_Mutation_p.D139Y|P4HA1_ENST00000440381.1_Missense_Mutation_p.D139Y|P4HA1_ENST00000373008.2_Missense_Mutation_p.D139Y|P4HA1_ENST00000412021.2_Missense_Mutation_p.D139Y|P4HA1_ENST00000263556.3_Missense_Mutation_p.D139Y			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	139					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TTGTAGGTATCCTGGAGACGT	0.398																																					Colon(147;367 2405 2662 52127)	ENST00000307116.2	1.000000	9.900000e-01	1.000000	9.900000e-01	9.900000e-01	0.999891	9.900000e-01	1.000000																										0				15						c.(415-417)Gat>Tat		prolyl 4-hydroxylase, alpha polypeptide I	Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)						180.0	167.0	171.0					10																	74828652		2203	4300	6503	SO:0001583	missense	5033	0	0					g.chr10:74828652C>A		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.415G>T	chr10.hg19:g.74828652C>A	ENSP00000307318:p.Asp139Tyr	1					P4HA1_ENST00000440381.1_Missense_Mutation_p.D139Y|RP11-344N10.2_ENST00000431293.2_RNA|P4HA1_ENST00000373008.2_Missense_Mutation_p.D139Y|P4HA1_ENST00000412021.2_Missense_Mutation_p.D139Y|P4HA1_ENST00000394890.2_Missense_Mutation_p.D139Y|P4HA1_ENST00000263556.3_Missense_Mutation_p.D139Y	p.D139Y			2	2	4	2.343436	P13674	P4HA1_HUMAN		5	531	-	Prostate(51;0.0198)		C9JL12|Q15082|Q15083|Q5VSQ5	Missense_Mutation	SNP	ENST00000307116.2	1	1	hg19	c.415G>T		1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873543	0.91664	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	T;T;T;T;T;T	0.52526	0.68;0.68;0.68;0.68;0.68;0.66	5.61	5.61	0.85477	5.610000	5.610000	0.854770	Prolyl 4-hydroxylase alpha-subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79064	0.4383	H	0.94462	3.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84676	0.0714	10	0.87932	D	0	-29.5049	19.6379	0.95744	0.0:1.0:0.0:0.0	.	139;139;139	C9JL12;Q5VSQ6;P13674	.;.;P4HA1_HUMAN	Y	139	ENSP00000307318:D139Y;ENSP00000362099:D139Y;ENSP00000411688:D139Y;ENSP00000378353:D139Y;ENSP00000263556:D139Y;ENSP00000414464:D139Y	ENSP00000263556:D139Y	D	-	1	0	0	P4HA1	74498658	74498658	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.374000	0.79633	2.657000	0.90304	0.655000	0.94253	GAT	0.757914		TCGA-IB-A5SP-01A-11D-A32N-08	0.398	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	1	0	1	2	2	2	2	0	0	0	0	110	110	110	109	1	1.770000	-20.000000	1	0.740000	NM_000917		0	253	246	0	393	388	1		1	1		0	0	110	0	0	1.000000	9.999999e-01	0	19	0	22	0	253	393
TACC2	10579	broad.mit.edu	37	10	123843041	123843041	+	Silent	SNP	G	G	A	rs201912981	byFrequency	TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr10:123843041G>A	ENST00000369005.1	+	4	1366	c.1026G>A	c.(1024-1026)ccG>ccA	p.P342P	TACC2_ENST00000334433.3_Silent_p.P342P|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Silent_p.P342P|TACC2_ENST00000515603.1_Silent_p.P342P|TACC2_ENST00000453444.2_Silent_p.P342P|TACC2_ENST00000513429.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	342					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CATATCTGCCGCACGCAGAGC	0.632													g|||	2	0.000399361	0.0	0.0	5008	,	,		16808	0.0		0.0	False		,,,				2504	0.002					ENST00000369005.1	1.000000	0	0.060000	1.000000e-02	2.000000e-02	0.112198	2.000000e-02	0.030000																										0				83						c.(1024-1026)ccG>ccA		transforming, acidic coiled-coil containing protein 2							31.0	37.0	35.0					10																	123843041		2199	4297	6496	SO:0001819	synonymous_variant	10579	6	121382	39				g.chr10:123843041G>A	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.1026G>A	chr10.hg19:g.123843041G>A		1					TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515603.1_Silent_p.P342P|TACC2_ENST00000334433.3_Silent_p.P342P|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000453444.2_Silent_p.P342P|TACC2_ENST00000515273.1_Silent_p.P342P	p.P342P	NM_206862.2	NP_996744.2	2	2	4	2.343436	O95359	TACC2_HUMAN		4	1366	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	0	1	hg19	c.1026G>A	CCDS7626.1	0																																																																																								0.757914		TCGA-IB-A5SP-01A-11D-A32N-08	0.632	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	107	1	1.770000	-3.107977	1	0.740000			0	5	5	0	491	487	0		1	0	0	0	0	108	0	0	0.936497	4.439473e-03	0	0	0	8	1	5	491
MRGPRX2	117194	broad.mit.edu	37	11	19077764	19077764	+	Silent	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr11:19077764G>A	ENST00000329773.2	-	2	273	c.186C>T	c.(184-186)aaC>aaT	p.N62N		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	62			N -> S (in dbSNP:rs10833049). {ECO:0000269|PubMed:15862286, ECO:0000269|Ref.5}.		positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						CAGAGAAGGCGTTCCTGCGCA	0.557																																					GBM(198;1966 2199 4849 37227 49954)	ENST00000329773.2	1.000000	3.000000e-01	0.420000	3.300000e-01	3.700000e-01	0.405274	3.700000e-01	0.370000																										0				15						c.(184-186)aaC>aaT		MAS-related GPR, member X2							82.0	90.0	87.0					11																	19077764		2199	4293	6492	SO:0001819	synonymous_variant	117194	0	0					g.chr11:19077764G>A		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.186C>T	chr11.hg19:g.19077764G>A		0						p.N62N	NM_054030.2	NP_473371.1	1	2	3	2.284513	Q96LB1	MRGX2_HUMAN		2	273	-			B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Silent	SNP	ENST00000329773.2	1	1	hg19	c.186C>T	CCDS7847.1	0																																																																																								0.745647		TCGA-IB-A5SP-01A-11D-A32N-08	0.557	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	91	1	1.770000	-20.000000	1	0.740000	NM_054030		0	89	88	0	570	562	1		1			0	0	93	0	0	1.000000	0	0	0	0	0	0	89	570
DDIAS	220042	broad.mit.edu	37	11	82645017	82645017	+	Silent	SNP	A	A	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr11:82645017A>C	ENST00000533655.1	+	6	2849	c.2637A>C	c.(2635-2637)ggA>ggC	p.G879G	C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Silent_p.G879G|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000329143.3_Silent_p.G578G	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		879					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						ATATGCTTGGATTCCAAGGCA	0.408																																						ENST00000533655.1	1.000000	2.400000e-01	0.420000	2.900000e-01	3.400000e-01	0.394753	3.400000e-01	0.340000																										0				33						c.(2635-2637)ggA>ggC									72.0	71.0	71.0					11																	82645017		2203	4300	6503	SO:0001819	synonymous_variant	0	0	0					g.chr11:82645017A>C																												ENST00000533655.1:c.2637A>C	chr11.hg19:g.82645017A>C		0					C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000329143.3_Silent_p.G578G|C11orf82_ENST00000430323.2_Silent_p.G879G	p.G879G	NM_145018.3	NP_659455.3	2	2	4	2.330246	Q8IXT1	DDIAS_HUMAN		6	2849	+			Q96LK6|Q9H856	Silent	SNP	ENST00000533655.1	1	1	hg19	c.2637A>C	CCDS8263.1	0																																																																																								0.756235		TCGA-IB-A5SP-01A-11D-A32N-08	0.408	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	61	1	1.770000	-20.000000	1	0.740000			0	40	39	0	298	295	1		1	0		0	0	63	0	0	1.000000	1.485251e-02	0	0	0	2	0	40	298
TRPV4	59341	broad.mit.edu	37	12	110236628	110236628	+	Missense_Mutation	SNP	G	G	A	rs267607143		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:110236628G>A	ENST00000418703.2	-	5	1037	c.943C>T	c.(943-945)Cgg>Tgg	p.R315W	TRPV4_ENST00000537083.1_Missense_Mutation_p.R315W|TRPV4_ENST00000346520.2_Missense_Mutation_p.R315W|TRPV4_ENST00000541794.1_Missense_Mutation_p.R268W|TRPV4_ENST00000392719.2_Missense_Mutation_p.R268W|TRPV4_ENST00000261740.2_Missense_Mutation_p.R315W|TRPV4_ENST00000536838.1_Missense_Mutation_p.R281W|TRPV4_ENST00000544971.1_Missense_Mutation_p.R268W	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	315			R -> W (in CMT2C). {ECO:0000269|PubMed:20037588, ECO:0000269|PubMed:21115951}.		actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TCCTGGCGCCGCATGTCCGCC	0.612																																						ENST00000418703.2	0.070000	0	0.050000	1.000000e-02	2.000000e-02	0.033265	2.000000e-02	0.030000																										0				35						c.(943-945)Cgg>Tgg		transient receptor potential cation channel, subfamily V, member 4							94.0	76.0	82.0					12																	110236628		2203	4300	6503	SO:0001583	missense	59341	0	0					g.chr12:110236628G>A	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.943C>T	chr12.hg19:g.110236628G>A	ENSP00000406191:p.Arg315Trp	1					TRPV4_ENST00000544971.1_Missense_Mutation_p.R268W|TRPV4_ENST00000392719.2_Missense_Mutation_p.R268W|TRPV4_ENST00000541794.1_Missense_Mutation_p.R268W|TRPV4_ENST00000346520.2_Missense_Mutation_p.R315W|TRPV4_ENST00000536838.1_Missense_Mutation_p.R281W|TRPV4_ENST00000537083.1_Missense_Mutation_p.R315W|TRPV4_ENST00000261740.2_Missense_Mutation_p.R315W	p.R315W	NM_001177431.1	NP_001170902.1	0	1	1	2.113057	Q9HBA0	TRPV4_HUMAN		5	1037	-			B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	0	1	hg19	c.943C>T	CCDS9134.1	0	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751278	0.69533	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	T;T;T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	4.37	2.43	0.29744	4.370000	2.430000	0.297440	Ankyrin repeat-containing domain (3);	0.055968	0.64402	D	0.000001	T	0.79370	0.4434	L	0.59967	1.855	0.33765	D	0.622362	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;1.0	D;P;D;P;P	0.76575	0.988;0.899;0.985;0.827;0.863	D	0.84213	0.0457	10	0.66056	D	0.02	-17.2861	12.0415	0.53456	0.0:0.0:0.6756:0.3244	.	315;315;268;268;281	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	W	315;315;268;315;268;315;268;281	ENSP00000406191:R315W;ENSP00000261740:R315W;ENSP00000376480:R268W;ENSP00000319003:R315W;ENSP00000443611:R268W;ENSP00000442738:R315W;ENSP00000442167:R268W;ENSP00000444336:R281W	ENSP00000261740:R315W	R	-	1	2	2	TRPV4	108721011	108721011	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	4.154000	0.58125	0.525000	0.28522	0.655000	0.94253	CGG	0.723639		TCGA-IB-A5SP-01A-11D-A32N-08	0.612	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	0	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	1.770000	-2.394291	0	0.740000	NM_021625		0	5	5	0	444	439	0		1	0		0	0	135	0	0	0.936015	1.019960e-02	0	0	0	11	0	5	444
SDSL	113675	broad.mit.edu	37	12	113873183	113873183	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:113873183C>T	ENST00000403593.4	+	6	755	c.493C>T	c.(493-495)Cca>Tca	p.P165S	SDSL_ENST00000345635.4_Missense_Mutation_p.P165S			Q96GA7	SDSL_HUMAN	serine dehydratase-like	165					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						GCTGAGGACCCCACCAGGTGC	0.682																																						ENST00000403593.4	0.410000	1.100000e-01	0.330000	1.700000e-01	2.400000e-01	0.253290	2.400000e-01	0.240000																										0				15						c.(493-495)Cca>Tca		serine dehydratase-like							15.0	16.0	16.0					12																	113873183		2197	4293	6490	SO:0001583	missense	113675	0	0					g.chr12:113873183C>T	AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.493C>T	chr12.hg19:g.113873183C>T	ENSP00000385790:p.Pro165Ser	1					SDSL_ENST00000345635.4_Missense_Mutation_p.P165S	p.P165S			0	1	1	2.113057	Q96GA7	SDSL_HUMAN		6	755	+				Missense_Mutation	SNP	ENST00000403593.4	0	1	hg19	c.493C>T	CCDS9170.1	0	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401157	0.25291	.	.	ENSG00000139410	ENST00000403593;ENST00000553248;ENST00000345635	D;D;D	0.96554	-4.05;-4.05;-4.05	4.49	4.49	0.54785	4.490000	4.490000	0.547850	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.187421	0.42682	D	0.000666	D	0.93255	0.7851	L	0.56280	1.765	0.31826	N	0.625354	B	0.17852	0.024	B	0.14023	0.01	D	0.88786	0.3274	10	0.12430	T	0.62	-12.8961	12.3743	0.55271	0.2143:0.7856:0.0:0.0	.	165	Q96GA7	SDSL_HUMAN	S	165;107;165	ENSP00000385790:P165S;ENSP00000448868:P107S;ENSP00000341117:P165S	ENSP00000341117:P165S	P	+	1	0	0	SDSL	112357566	112357566	0.993000	0.37304	0.998000	0.56505	0.402000	0.30811	3.344000	0.52174	2.209000	0.71365	0.462000	0.41574	CCA	0.723639		TCGA-IB-A5SP-01A-11D-A32N-08	0.682	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404782.1	0	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.770000	-14.831980	1	0.740000	NM_138432		0	9	9	0	89	89	0		1	0		0	0	19	0	0	0.994945	8.938730e-01	0	1	0	41	0	9	89
PITPNM2	57605	broad.mit.edu	37	12	123472784	123472784	+	Silent	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:123472784C>A	ENST00000542749.1	-	18	3057	c.2994G>T	c.(2992-2994)ctG>ctT	p.L998L	PITPNM2_ENST00000320201.4_Silent_p.L998L|PITPNM2_ENST00000392428.1_Silent_p.L719L|PITPNM2_ENST00000280562.5_Silent_p.L992L			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	998					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CCCTCACCCGCAGCTTCACGT	0.627																																						ENST00000542749.1	0.070000	0	0.050000	1.000000e-02	3.000000e-02	0.037872	3.000000e-02	0.040000																										0				39						c.(2992-2994)ctG>ctT		phosphatidylinositol transfer protein, membrane-associated 2							66.0	71.0	70.0					12																	123472784		2203	4300	6503	SO:0001819	synonymous_variant	57605	0	0					g.chr12:123472784C>A	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2994G>T	chr12.hg19:g.123472784C>A		1					PITPNM2_ENST00000280562.5_Silent_p.L992L|PITPNM2_ENST00000320201.4_Silent_p.L998L|PITPNM2_ENST00000392428.1_Silent_p.L719L	p.L998L			0	1	1	2.113057	Q9BZ72	PITM2_HUMAN		18	3057	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		Q9P271	Silent	SNP	ENST00000542749.1	0	1	hg19	c.2994G>T	CCDS9242.1	0																																																																																								0.723639		TCGA-IB-A5SP-01A-11D-A32N-08	0.627	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	0	0	1	2	2	2	2	0	0	0	0	224	224	224	225	1	1.770000	-6.636570	1	0.740000	NM_020845		0	9	9	0	665	656	0		1	0		0	0	224	0	0	0.993895	2.403573e-04	0	0	0	2	0	9	665
CCDC92	80212	broad.mit.edu	37	12	124428832	124428832	+	Silent	SNP	C	C	T	rs148809811		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:124428832C>T	ENST00000238156.3	-	2	375	c.21G>A	c.(19-21)tcG>tcA	p.S7S	CCDC92_ENST00000545135.1_5'UTR|CCDC92_ENST00000544798.1_5'UTR|CCDC92_ENST00000545891.1_Intron	NM_025140.1	NP_079416.1	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	7						centriole (GO:0005814)				large_intestine(5)|lung(2)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		CATCGTAACTCGAGAAATGTG	0.498																																						ENST00000238156.3	1.000000	7.300000e-01	0.940000	7.900000e-01	8.600000e-01	0.869868	8.600000e-01	0.870000																										0				7						c.(19-21)tcG>tcA		coiled-coil domain containing 92		C		0,4406		0,0,2203	88.0	86.0	87.0		21	-1.6	0.0	12	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCDC92	NM_025140.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		7/332	124428832	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80212	4	121412	36				g.chr12:124428832C>T	AK026124	CCDS9256.1	12q24.31	2011-09-02			ENSG00000119242	ENSG00000119242			29563	protein-coding gene	gene with protein product	"""limkain beta 2"""					12477932	Standard	NM_025140		Approved	FLJ22471	uc001ufw.1	Q53HC0	OTTHUMG00000168725	ENST00000238156.3:c.21G>A	chr12.hg19:g.124428832C>T		1					CCDC92_ENST00000545891.1_Intron|CCDC92_ENST00000544798.1_5'UTR|CCDC92_ENST00000545135.1_5'UTR	p.S7S	NM_025140.1	NP_079416.1	0	1	1	2.113057	Q53HC0	CCD92_HUMAN		2	375	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		B3KNQ0|Q9H697	Silent	SNP	ENST00000238156.3	1	1	hg19	c.21G>A	CCDS9256.1	1																																																																																								0.723639		TCGA-IB-A5SP-01A-11D-A32N-08	0.498	CCDC92-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400780.2	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.770000	-11.809940	1	0.740000	NM_025140		0	107	106	0	206	203	1		1	1		0	0	87	0	0	1.000000	9.999879e-01	0	13	0	23	0	107	206
CACNA1C	775	broad.mit.edu	37	12	2716164	2716164	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:2716164C>T	ENST00000347598.4	+	27	3284	c.3284C>T	c.(3283-3285)aCg>aTg	p.T1095M	CACNA1C_ENST00000344100.3_Missense_Mutation_p.T1075M|CACNA1C_ENST00000402845.3_Missense_Mutation_p.T1075M|CACNA1C_ENST00000327702.7_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399634.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399591.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399644.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399601.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399655.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399637.1_Missense_Mutation_p.T1075M|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399641.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399595.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399617.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399603.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000406454.3_Missense_Mutation_p.T1075M|CACNA1C_ENST00000480911.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000335762.5_Missense_Mutation_p.T1100M|CACNA1C_ENST00000399649.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399606.1_Missense_Mutation_p.T1095M|CACNA1C_ENST00000399621.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399638.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399597.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399629.1_Missense_Mutation_p.T1075M	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1095					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AACTACATCACGTACAAAGAC	0.557																																						ENST00000347598.4	0.970000	6.800000e-01	0.910000	7.500000e-01	8.300000e-01	0.835235	8.300000e-01	0.840000																										0				132						c.(3283-3285)aCg>aTg		calcium channel, voltage-dependent, L type, alpha 1C subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						63.0	66.0	65.0					12																	2716164		2072	4233	6305	SO:0001583	missense	775	3	121066	33				g.chr12:2716164C>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3284C>T	chr12.hg19:g.2716164C>T	ENSP00000266376:p.Thr1095Met	1					CACNA1C_ENST00000399637.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399644.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399603.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000480911.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000327702.7_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399641.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399655.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399597.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399617.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000402845.3_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399638.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399591.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399634.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399629.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399606.1_Missense_Mutation_p.T1095M|CACNA1C_ENST00000399621.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000335762.5_Missense_Mutation_p.T1100M|CACNA1C_ENST00000399649.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000344100.3_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399601.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000399595.1_Missense_Mutation_p.T1075M|CACNA1C_ENST00000406454.3_Missense_Mutation_p.T1075M|CACNA1C-AS3_ENST00000543559.1_RNA	p.T1095M	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	0	1	1	1.531743	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	27	3284	+			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	1	1	hg19	c.3284C>T	CCDS44788.1	0	.	.	.	.	.	.	.	.	.	.	c	13.73	2.322899	0.41096	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96685	-4.02;-4.01;-4.05;-4.01;-4.04;-4.01;-4.03;-3.92;-3.97;-4.01;-3.96;-3.94;-4.01;-4.09;-3.96;-3.86;-4.08;-4.02;-4.01;-4.05;-3.96;-4.04;-4.08	4.86	4.86	0.63082	4.860000	4.860000	0.630820	Ion transport (1);	0.202841	0.52532	D	0.000071	D	0.97099	0.9052	L	0.42529	1.33	0.38378	D	0.945041	D;P;B;D;P;P;B;B;B;B;B;B;B;P;P;B;B;P;B;B;P;P;B;B;B	0.89917	1.0;0.466;0.265;1.0;0.719;0.466;0.212;0.224;0.024;0.33;0.239;0.123;0.212;0.469;0.636;0.414;0.4;0.525;0.119;0.239;0.525;0.525;0.286;0.013;0.286	D;B;B;D;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.91635	0.999;0.071;0.041;0.999;0.148;0.071;0.091;0.024;0.024;0.071;0.023;0.04;0.091;0.04;0.284;0.034;0.058;0.049;0.04;0.034;0.071;0.049;0.024;0.011;0.047	D	0.97646	1.0151	10	0.46703	T	0.11	.	18.5389	0.91020	0.0:1.0:0.0:0.0	.	1075;1072;1095;1075;1075;1075;1075;1075;1075;1095;1075;1046;1095;1075;1075;1075;1075;1075;1075;1075;1075;1075;1075;1075;1075	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	M	1100;1075;1075;1075;1075;1075;1075;1075;1075;1075;1095;1095;1075;1075;1075;1075;1075;1075;1075;1075;1075;1075;1075;916	ENSP00000336982:T1100M;ENSP00000382563:T1075M;ENSP00000437936:T1075M;ENSP00000382552:T1075M;ENSP00000382547:T1075M;ENSP00000382506:T1075M;ENSP00000382530:T1075M;ENSP00000382546:T1075M;ENSP00000382500:T1075M;ENSP00000382549:T1075M;ENSP00000266376:T1095M;ENSP00000382515:T1095M;ENSP00000382510:T1075M;ENSP00000341092:T1075M;ENSP00000382537:T1075M;ENSP00000329877:T1075M;ENSP00000382557:T1075M;ENSP00000385724:T1075M;ENSP00000382512:T1075M;ENSP00000382542:T1075M;ENSP00000382526:T1075M;ENSP00000385896:T1075M;ENSP00000382504:T1075M	ENSP00000323129:T916M	T	+	2	0	0	CACNA1C	2586425	2586425	0.139000	0.22563	0.995000	0.50966	0.979000	0.70002	1.089000	0.30890	2.687000	0.91594	0.651000	0.88453	ACG	0.592093		TCGA-IB-A5SP-01A-11D-A32N-08	0.557	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.770000	-16.057770	1	0.740000	NM_000719		0	62	62	0	65	63	1		1	0		0	0	54	0	0	1.000000	4.826940e-01	0	0	0	3	0	62	65
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	7.900000e-01	1.000000	8.700000e-01	9.400000e-01	0.937091	9.400000e-01	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	1	1	1.532613	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.592093		TCGA-IB-A5SP-01A-11D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.770000	-20.000000	1	0.740000	NM_033360		5403	49	49	2618	35	34	1	1	1	1	1	0	0	18	1201	1	1.000000	9.989910e-01	1	11	105	1	109	49	35
TMEM117	84216	broad.mit.edu	37	12	44782362	44782362	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:44782362C>T	ENST00000266534.3	+	8	1579	c.1452C>T	c.(1450-1452)acC>acT	p.T484T	TMEM117_ENST00000551577.1_3'UTR|TMEM117_ENST00000536799.1_Silent_p.T380T|TMEM117_ENST00000546978.1_3'UTR	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	484						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		CCCACCTAACCTCGGAAAACT	0.453																																						ENST00000266534.3	1.000000	8.800000e-01	1.000000	9.300000e-01	9.700000e-01	0.971541	9.700000e-01	1.000000																										0				23						c.(1450-1452)acC>acT		transmembrane protein 117							166.0	159.0	161.0					12																	44782362		2203	4300	6503	SO:0001819	synonymous_variant	84216	1	121412	34				g.chr12:44782362C>T	BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.1452C>T	chr12.hg19:g.44782362C>T		0					TMEM117_ENST00000536799.1_Silent_p.T380T|TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_3'UTR	p.T484T	NM_032256.1	NP_115632.1	0	1	1	2.172560	Q9H0C3	TM117_HUMAN		8	1579	+	Lung SC(27;0.192)			Silent	SNP	ENST00000266534.3	1	1	hg19	c.1452C>T	CCDS8745.1	1																																																																																								0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.453	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403969.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	75	1	1.770000	-20.000000	1	0.740000	NM_032256		0	263	260	0	449	436	1		1	1		0	0	77	0	0	1.000000	9.931152e-01	0	4	0	12	0	263	449
GOLGA3	2802	broad.mit.edu	37	12	133365860	133365860	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr12:133365860T>G	ENST00000450791.2	-	12	2747	c.2564A>C	c.(2563-2565)tAc>tCc	p.Y855S	GOLGA3_ENST00000456883.2_Missense_Mutation_p.Y855S|GOLGA3_ENST00000537452.1_Missense_Mutation_p.Y855S|GOLGA3_ENST00000545875.1_Missense_Mutation_p.Y855S|GOLGA3_ENST00000204726.3_Missense_Mutation_p.Y855S			Q08378	GOGA3_HUMAN	golgin A3	855					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GTCGCGCCGGTAGGCCTCCAC	0.637																																						ENST00000450791.2	0.170000	4.000000e-02	0.130000	6.000000e-02	9.000000e-02	0.102436	9.000000e-02	0.090000																										0				64						c.(2563-2565)tAc>tCc		golgin A3							28.0	25.0	26.0					12																	133365860		2203	4300	6503	SO:0001583	missense	2802	0	0					g.chr12:133365860T>G	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2564A>C	chr12.hg19:g.133365860T>G	ENSP00000410378:p.Tyr855Ser	1					GOLGA3_ENST00000545875.1_Missense_Mutation_p.Y855S|GOLGA3_ENST00000204726.3_Missense_Mutation_p.Y855S|GOLGA3_ENST00000456883.2_Missense_Mutation_p.Y855S|GOLGA3_ENST00000537452.1_Missense_Mutation_p.Y855S	p.Y855S			0	1	1	2.113057	Q08378	GOGA3_HUMAN		12	2747	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	0	1	hg19	c.2564A>C	CCDS9281.1	0	.	.	.	.	.	.	.	.	.	.	T	25.4	4.636969	0.87760	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.37058	1.68;1.68;1.69;1.22;1.22	5.42	5.42	0.78866	5.420000	5.420000	0.788660	.	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.57957	-0.7721	10	0.29301	T	0.29	.	15.4572	0.75325	0.0:0.0:0.0:1.0	.	855;855;855	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	S	855	ENSP00000204726:Y855S;ENSP00000410378:Y855S;ENSP00000409303:Y855S;ENSP00000442143:Y855S;ENSP00000442603:Y855S	ENSP00000204726:Y855S	Y	-	2	0	0	GOLGA3	131875933	131875933	1.000000	0.71417	0.996000	0.52242	0.734000	0.41952	7.959000	0.87885	2.064000	0.61679	0.460000	0.39030	TAC	0.723639		TCGA-IB-A5SP-01A-11D-A32N-08	0.637	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	0	0	1	2	2	2	2	0	0	0	0	75	75	75	73	1	1.770000	-13.468770	1	0.740000	NM_005895		0	8	8	0	213	210	0		1	1		0	0	75	0	0	0.989161	4.312760e-01	0	3	0	34	0	8	213
GPC5	2262	broad.mit.edu	37	13	92380846	92380846	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr13:92380846G>T	ENST00000377067.3	+	4	1453	c.1081G>T	c.(1081-1083)Gat>Tat	p.D361Y	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	361					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTGTTCTTTTGATCAGAGCAA	0.398																																						ENST00000377067.3	0.060000	0	0.040000	1.000000e-02	2.000000e-02	0.030160	2.000000e-02	0.020000																										0				69						c.(1081-1083)Gat>Tat		glypican 5							125.0	130.0	128.0					13																	92380846		2203	4300	6503	SO:0001583	missense	2262	0	0					g.chr13:92380846G>T	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1081G>T	chr13.hg19:g.92380846G>T	ENSP00000366267:p.Asp361Tyr	0					GPC5_ENST00000483422.1_3'UTR	p.D361Y	NM_004466.4	NP_004457.1	0	0	0	2.131965	P78333	GPC5_HUMAN		4	1453	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	0	1	hg19	c.1081G>T	CCDS9468.1	0	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682939	0.68157	.	.	ENSG00000179399	ENST00000377067	T	0.55234	0.53	5.88	5.04	0.67666	5.880000	5.040000	0.676660	.	0.478094	0.24502	N	0.037975	T	0.64091	0.2567	M	0.72894	2.215	0.37269	D	0.907309	P	0.44877	0.845	P	0.52514	0.701	T	0.72221	-0.4356	10	0.72032	D	0.01	2.7075	12.1984	0.54311	0.0779:0.0:0.9221:0.0	.	361	P78333	GPC5_HUMAN	Y	361	ENSP00000366267:D361Y	ENSP00000366267:D361Y	D	+	1	0	0	GPC5	91178847	91178847	1.000000	0.71417	0.986000	0.45419	0.989000	0.77384	3.232000	0.51302	1.499000	0.48617	0.557000	0.71058	GAT	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.398	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	0	0	1	2	2	2	2	0	0	0	0	78	78	78	77	1	1.770000	-2.834094	1	0.740000	NM_004466		0	5	5	0	509	504	0		1			0	0	78	0	0	0.936206	0	0	0	0	0	0	5	509
RASA3	22821	broad.mit.edu	37	13	114773065	114773065	+	Silent	SNP	C	C	T	rs557790275		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr13:114773065C>T	ENST00000334062.7	-	18	1807	c.1686G>A	c.(1684-1686)tcG>tcA	p.S562S	RASA3_ENST00000389544.4_Silent_p.S530S	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	562					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCCCCGAGGACGAAATCAGAT	0.552													c|||	1	0.000199681	0.0	0.0	5008	,	,		21135	0.001		0.0	False		,,,				2504	0.0					ENST00000334062.7	1.000000	8.400000e-01	1.000000	9.200000e-01	9.900000e-01	0.971726	9.900000e-01	1.000000																										0				47						c.(1684-1686)tcG>tcA		RAS p21 protein activator 3							114.0	94.0	101.0					13																	114773065		2201	4298	6499	SO:0001819	synonymous_variant	22821	2	121346	31				g.chr13:114773065C>T		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1686G>A	chr13.hg19:g.114773065C>T		0					RASA3_ENST00000389544.4_Silent_p.S530S	p.S562S	NM_007368.2	NP_031394.2	0	0	0	2.145043	Q14644	RASA3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.128)	18	1807	-	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	A6NL15|F8W6X8|Q8IUY2	Silent	SNP	ENST00000334062.7	1	1	hg19	c.1686G>A	CCDS32016.1	1																																																																																								0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.552	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	1	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	1.770000	-20.000000	1	0.740000	NM_007368		0	84	81	0	137	133	1		1	1		0	0	70	0	0	1.000000	1	0	34	0	30	0	84	137
MAP3K9	4293	broad.mit.edu	37	14	71209085	71209085	+	Missense_Mutation	SNP	C	C	T	rs200816838		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr14:71209085C>T	ENST00000554752.2	-	6	1549	c.1550G>A	c.(1549-1551)cGc>cAc	p.R517H	MAP3K9_ENST00000381250.4_Missense_Mutation_p.R517H|MAP3K9_ENST00000553414.1_Missense_Mutation_p.R211H|MAP3K9_ENST00000555993.2_Missense_Mutation_p.R517H|MAP3K9_ENST00000554146.1_Missense_Mutation_p.R254H	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	517				KLKDGNRISLPSDFQHKFTVQASPT -> AQPVLPFPHGHS RCPGGTGSSWGGQ (in Ref. 4). {ECO:0000305}.	activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GAGGCTGATGCGGTTGCCATC	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		18722	0.001		0.0	False		,,,				2504	0.0				GBM(114;411 1587 13539 28235 50070)	ENST00000554752.2	0.050000	0	0.030000	0	1.000000e-02	0.022249	1.000000e-02	0.020000																										0				46						c.(1549-1551)cGc>cAc		mitogen-activated protein kinase kinase kinase 9							100.0	94.0	96.0					14																	71209085		2203	4300	6503	SO:0001583	missense	4293	8	121412	42				g.chr14:71209085C>T	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1550G>A	chr14.hg19:g.71209085C>T	ENSP00000451612:p.Arg517His	0					MAP3K9_ENST00000553414.1_Missense_Mutation_p.R211H|MAP3K9_ENST00000554146.1_Missense_Mutation_p.R254H|MAP3K9_ENST00000381250.4_Missense_Mutation_p.R517H|MAP3K9_ENST00000555993.2_Missense_Mutation_p.R517H	p.R517H	NM_001284230.1	NP_001271159.1	0	0	0	2.008487	P80192	M3K9_HUMAN		6	1549	-			A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	0	1	hg19	c.1550G>A		0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.47	1.947067	0.34377	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	6.06	5.17	0.71159	6.060000	5.170000	0.711590	Protein kinase-like domain (1);	0.211843	0.49305	D	0.000141	T	0.07413	0.0187	N	0.25245	0.725	0.50171	D	0.999854	B;B;B;B	0.20261	0.001;0.025;0.043;0.005	B;B;B;B	0.20577	0.005;0.009;0.03;0.013	T	0.28332	-1.0047	10	0.35671	T	0.21	.	7.1057	0.25362	0.1401:0.71:0.0:0.1499	.	254;517;517;211	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	H	517;517;211;517;254;245	ENSP00000451612:R517H;ENSP00000451038:R211H;ENSP00000370649:R517H;ENSP00000451921:R254H	ENSP00000005198:R517H	R	-	2	0	0	MAP3K9	70278838	70278838	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	3.617000	0.54181	1.577000	0.49804	-0.150000	0.13652	CGC	0.716961		TCGA-IB-A5SP-01A-11D-A32N-08	0.602	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2	0	0	1	2	16	2	2	1	1	1	1	147	147	147	146	1	1.770000	-2.163597	0	0.740000			0	5	5	0	651	631	0		0	0		1	0	147	0	0	0.010455	2.882276e-04	0	0	0	3	0	5	651
KIF26A	26153	broad.mit.edu	37	14	104642766	104642766	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr14:104642766C>T	ENST00000423312.2	+	12	3641	c.3641C>T	c.(3640-3642)cCg>cTg	p.P1214L	KIF26A_ENST00000315264.7_Missense_Mutation_p.P1075L	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1214					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CCCCGGAAACCGAGGACTGCC	0.721																																						ENST00000423312.2	1.000000	6.700000e-01	0.950000	7.600000e-01	8.500000e-01	0.858834	8.500000e-01	1.000000																										0				21						c.(3640-3642)cCg>cTg		kinesin family member 26A							17.0	22.0	21.0					14																	104642766		1956	4126	6082	SO:0001583	missense	26153	2	119696	34				g.chr14:104642766C>T	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.3641C>T	chr14.hg19:g.104642766C>T	ENSP00000388241:p.Pro1214Leu	0					KIF26A_ENST00000315264.7_Missense_Mutation_p.P1075L	p.P1214L	NM_015656.1	NP_056471.1	0	0	0	2.008487	Q9ULI4	KI26A_HUMAN	Epithelial(46;0.152)	12	3641	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	1	1	hg19	c.3641C>T	CCDS45171.1	1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.580981	0.00879	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.76448	-1.02;-1.02	3.6	0.264	0.15607	3.600000	0.264000	0.156070	.	.	.	.	.	T	0.68146	0.2969	M	0.64404	1.975	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.51601	-0.8685	9	0.21540	T	0.41	.	4.6768	0.12715	0.2952:0.5102:0.0:0.1946	.	1214	Q9ULI4	KI26A_HUMAN	L	1214;1075	ENSP00000388241:P1214L;ENSP00000325452:P1075L	ENSP00000325452:P1075L	P	+	2	0	0	KIF26A	103712519	103712519	0.002000	0.14202	0.002000	0.10522	0.106000	0.19336	0.517000	0.22832	0.199000	0.20427	-1.026000	0.02426	CCG	0.716961		TCGA-IB-A5SP-01A-11D-A32N-08	0.721	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	1.770000	-20.000000	1	0.740000			0	54	54	0	102	100	1		1	0		0	0	63	0	0	1.000000	1.226017e-01	0	0	0	2	0	54	102
PPIP5K1	9677	broad.mit.edu	37	15	43827457	43827457	+	Silent	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr15:43827457G>A	ENST00000396923.3	-	30	3838	c.3717C>T	c.(3715-3717)tcC>tcT	p.S1239S	PPIP5K1_ENST00000360301.4_Silent_p.S1214S|PPIP5K1_ENST00000334933.4_Silent_p.S1214S|PPIP5K1_ENST00000348806.6_Silent_p.S1212S|PPIP5K1_ENST00000381885.1_Silent_p.S1235S|PPIP5K1_ENST00000420765.1_Silent_p.S1239S|PPIP5K1_ENST00000381879.4_Silent_p.S1215S|PPIP5K1_ENST00000360135.4_Silent_p.S1212S			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1239					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						GCACCTGTGGGGACTGATTTG	0.562																																						ENST00000396923.3	0.950000	7.700000e-01	0.910000	8.200000e-01	8.600000e-01	0.869822	8.600000e-01	0.870000																										0				1						c.(3715-3717)tcC>tcT		diphosphoinositol pentakisphosphate kinase 1							91.0	90.0	91.0					15																	43827457		2201	4298	6499	SO:0001819	synonymous_variant	9677	0	0					g.chr15:43827457G>A	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3717C>T	chr15.hg19:g.43827457G>A		1					PPIP5K1_ENST00000360301.4_Silent_p.S1214S|PPIP5K1_ENST00000360135.4_Silent_p.S1212S|PPIP5K1_ENST00000381885.1_Silent_p.S1235S|PPIP5K1_ENST00000420765.1_Silent_p.S1239S|PPIP5K1_ENST00000348806.6_Silent_p.S1212S|PPIP5K1_ENST00000334933.4_Silent_p.S1214S|PPIP5K1_ENST00000381879.4_Silent_p.S1215S	p.S1239S			0	1	1	1.932441	Q6PFW1	VIP1_HUMAN		30	3838	-			O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Silent	SNP	ENST00000396923.3	1	1	hg19	c.3717C>T	CCDS45252.1	1																																																																																								0.692162		TCGA-IB-A5SP-01A-11D-A32N-08	0.562	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	1	0	1	2	2	2	2	0	0	0	0	152	152	152	149	1	1.770000	-20.000000	1	0.740000	NM_014659		0	240	239	0	390	387	1		1	1		0	0	152	0	0	1.000000	9.999997e-01	0	16	0	23	0	240	390
TLN2	83660	broad.mit.edu	37	15	63032911	63032911	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr15:63032911C>T	ENST00000561311.1	+	31	4198	c.3968C>T	c.(3967-3969)tCt>tTt	p.S1323F	TLN2_ENST00000306829.6_Missense_Mutation_p.S1323F			Q9Y4G6	TLN2_HUMAN	talin 2	1323					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S1323Y(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GCTGCCAAGTCTCTCTCTGTA	0.493																																						ENST00000561311.1	0.650000	4.300000e-01	0.600000	4.800000e-01	5.300000e-01	0.545703	5.300000e-01	0.540000																										1	Substitution - Missense(1)	p.S1323Y(1)	large_intestine(1)	99						c.(3967-3969)tCt>tTt		talin 2							84.0	75.0	78.0					15																	63032911		2203	4300	6503	SO:0001583	missense	83660	0	0					g.chr15:63032911C>T	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3968C>T	chr15.hg19:g.63032911C>T	ENSP00000453508:p.Ser1323Phe	1					TLN2_ENST00000306829.6_Missense_Mutation_p.S1323F	p.S1323F			0	1	1	1.932441	Q9Y4G6	TLN2_HUMAN		31	4198	+			A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	1	1	hg19	c.3968C>T	CCDS32261.1	0	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126628	0.56721	.	.	ENSG00000171914	ENST00000306829	T	0.14893	2.47	5.87	5.87	0.94306	5.870000	5.870000	0.943060	.	0.094038	0.85682	D	0.000000	T	0.20820	0.0501	L	0.49126	1.545	0.80722	D	1	B	0.11235	0.004	B	0.12837	0.008	T	0.04281	-1.0963	10	0.23302	T	0.38	-13.3132	20.5827	0.99408	0.0:1.0:0.0:0.0	.	1323	Q9Y4G6	TLN2_HUMAN	F	1323	ENSP00000303476:S1323F	ENSP00000303476:S1323F	S	+	2	0	0	TLN2	60820203	60820203	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.002000	0.70693	2.941000	0.99782	0.655000	0.94253	TCT	0.692162		TCGA-IB-A5SP-01A-11D-A32N-08	0.493	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.770000	-20.000000	1	0.740000			0	67	67	0	215	210	1		1	1		0	0	43	0	0	1.000000	5.264291e-01	0	2	0	5	0	67	215
ERCC4	2072	broad.mit.edu	37	16	14014215	14014215	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr16:14014215C>T	ENST00000311895.7	+	1	202	c.193C>T	c.(193-195)Cag>Tag	p.Q65*	ERCC4_ENST00000575156.1_Nonsense_Mutation_p.Q65*	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	65	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						GCTCAACACGCAGCCGGCCGA	0.697			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													ENST00000311895.7	1.000000	9.900000e-01	1.000000	9.900000e-01	9.900000e-01	0.998863	9.900000e-01	1.000000			yes	Rec		Xeroderma pigmentosum (F)	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	16p13.3-p13.13	2072	Mis, N, F	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""				E	E		skin basal cell, skin squamous cell, melanoma			0				38						c.(193-195)Cag>Tag	Nucleotide excision repair (NER)	excision repair cross-complementation group 4							10.0	11.0	10.0					16																	14014215		2174	4277	6451	SO:0001587	stop_gained	2072	0	0		Xeroderma Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	g.chr16:14014215C>T	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.193C>T	chr16.hg19:g.14014215C>T	ENSP00000310520:p.Gln65*	0					ERCC4_ENST00000575156.1_Nonsense_Mutation_p.Q65*	p.Q65*	NM_005236.2	NP_005227.1	1	2	3	2.232676	Q92889	XPF_HUMAN		1	202	+			A5PKV6|A8K111|O00140|Q8TD83	Nonsense_Mutation	SNP	ENST00000311895.7	0	1	hg19	c.193C>T	CCDS32390.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.363938	0.97507	.	.	ENSG00000175595	ENST00000311895;ENST00000439007;ENST00000389138	.	.	.	4.98	4.98	0.66077	4.980000	4.980000	0.660770	.	0.436137	0.26696	N	0.022966	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-25.2254	11.0818	0.48064	0.2766:0.7234:0.0:0.0	.	.	.	.	X	65;54;54	.	ENSP00000310520:Q65X	Q	+	1	0	0	ERCC4	13921716	13921716	0.976000	0.34144	1.000000	0.80357	0.937000	0.57800	3.363000	0.52321	2.741000	0.93983	0.655000	0.94253	CAG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.697	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.770000	-20.000000	1	0.740000	NM_005236		0	37	37	0	40	39	1		1	0		0	0	20	0	0	1.000000	4.718823e-01	0	0	0	3	0	37	40
NMRAL1	57407	broad.mit.edu	37	16	4516232	4516232	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr16:4516232G>A	ENST00000574733.1	-	4	1180	c.451C>T	c.(451-453)Cgg>Tgg	p.R151W	NMRAL1_ENST00000572391.1_5'UTR|NMRAL1_ENST00000283429.6_Missense_Mutation_p.R151W|NMRAL1_ENST00000404295.3_Missense_Mutation_p.R151W|NMRAL1_ENST00000574425.1_Missense_Mutation_p.R151W			Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	151						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|prostate(2)|stomach(1)	15						CAGGGCAGCCGCACACTGGTC	0.572																																						ENST00000574733.1	0.090000	0	0.060000	1.000000e-02	3.000000e-02	0.050418	3.000000e-02	0.040000																										0				15						c.(451-453)Cgg>Tgg		NmrA-like family domain containing 1							95.0	89.0	91.0					16																	4516232		2197	4300	6497	SO:0001583	missense	57407	2	121412	33				g.chr16:4516232G>A	AF225419	CCDS10516.1	16p13.3	2013-10-11			ENSG00000153406	ENSG00000153406		"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	24987	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 48A, member 1"""					19027726	Standard	NM_020677		Approved	FLJ25918, HSCARG, SDR48A1	uc002cwo.3	Q9HBL8	OTTHUMG00000129468	ENST00000574733.1:c.451C>T	chr16.hg19:g.4516232G>A	ENSP00000458762:p.Arg151Trp	0					NMRAL1_ENST00000574425.1_Missense_Mutation_p.R151W|NMRAL1_ENST00000572391.1_5'UTR|NMRAL1_ENST00000404295.3_Missense_Mutation_p.R151W|NMRAL1_ENST00000283429.6_Missense_Mutation_p.R151W	p.R151W			1	2	3	2.232676	Q9HBL8	NMRL1_HUMAN		4	1180	-				Missense_Mutation	SNP	ENST00000574733.1	0	1	hg19	c.451C>T	CCDS10516.1	0	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804190	0.70682	.	.	ENSG00000153406	ENST00000283429;ENST00000404295	T;T	0.48836	0.8;0.8	5.84	3.85	0.44370	5.840000	3.850000	0.443700	NAD(P)-binding domain (1);NmrA-like (1);	0.000000	0.64402	D	0.000005	T	0.64316	0.2587	M	0.68952	2.095	0.47862	D	0.999539	D	0.89917	1.0	D	0.97110	1.0	T	0.62034	-0.6939	10	0.35671	T	0.21	-32.0395	12.9284	0.58272	0.0:0.0:0.7042:0.2958	.	151	Q9HBL8	NMRL1_HUMAN	W	151	ENSP00000283429:R151W;ENSP00000383962:R151W	ENSP00000283429:R151W	R	-	1	2	2	NMRAL1	4456233	4456233	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	3.199000	0.51043	0.786000	0.33708	-0.309000	0.09137	CGG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.572	NMRAL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438579.1	0	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.770000	-2.906499	1	0.740000	NM_020677		0	5	5	0	387	384	0		1	0		0	0	74	0	0	0.936655	6.939733e-01	0	0	0	177	0	5	387
IL21R	50615	broad.mit.edu	37	16	27448836	27448836	+	Silent	SNP	C	C	T	rs370550834		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr16:27448836C>T	ENST00000337929.3	+	4	653	c.180C>T	c.(178-180)gaC>gaT	p.D60D	IL21R_ENST00000395755.1_Silent_p.D60D|IL21R_ENST00000564089.1_Silent_p.D60D|IL21R_ENST00000395754.4_Silent_p.D60D	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	60	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						AGCTGAAGGACGAGGCCACCT	0.597			T	BCL6	NHL																																	ENST00000337929.3	0.120000	2.000000e-02	0.090000	3.000000e-02	6.000000e-02	0.076311	6.000000e-02	0.060000				Dom	yes			Dom	yes		16	16p11	16p11	50615	T	interleukin 21 receptor				L	L	BCL6		NHL		0				8						c.(178-180)gaC>gaT		interleukin 21 receptor		C	,,	1,4393	2.1+/-5.4	0,1,2196	100.0	79.0	86.0		180,180,246	-9.3	0.0	16		86	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	IL21R	NM_021798.3,NM_181078.2,NM_181079.4	,,	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	,,	60/539,60/539,82/561	27448836	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	50615	4	121412	37				g.chr16:27448836C>T	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.180C>T	chr16.hg19:g.27448836C>T		0					IL21R_ENST00000395755.1_Silent_p.D60D|IL21R_ENST00000564089.1_Silent_p.D60D|IL21R_ENST00000395754.4_Silent_p.D60D	p.D60D	NM_181078.2	NP_851564.1	1	2	3	2.232676	Q9HBE5	IL21R_HUMAN		4	653	+			A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	ENST00000337929.3	0	1	hg19	c.180C>T	CCDS10630.1	0																																																																																								0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.597	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	0	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	1.770000	-8.496587	1	0.740000	NM_181078		0	9	10	0	394	390	0		1	0		0	0	103	0	0	0.994142	1.967485e-03	0	0	0	3	0	9	394
RRAD	6236	broad.mit.edu	37	16	66956197	66956197	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr16:66956197G>A	ENST00000299759.6	-	5	959	c.709C>T	c.(709-711)Cac>Tac	p.H237Y	RRAD_ENST00000420652.1_Missense_Mutation_p.H237Y			P55042	RAD_HUMAN	Ras-related associated with diabetes	237					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		ACATTGTGGTGCAATGCCGCT	0.602																																						ENST00000299759.6	1.000000	0	0.060000	1.000000e-02	3.000000e-02	0.066394	3.000000e-02	0.040000																										0				17						c.(709-711)Cac>Tac		Ras-related associated with diabetes							78.0	66.0	70.0					16																	66956197		2200	4300	6500	SO:0001583	missense	6236	0	0					g.chr16:66956197G>A	L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.709C>T	chr16.hg19:g.66956197G>A	ENSP00000299759:p.His237Tyr	0					RRAD_ENST00000420652.1_Missense_Mutation_p.H237Y	p.H237Y			1	2	3	2.246134	P55042	RAD_HUMAN		5	959	-		Ovarian(137;0.192)	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	0	1	hg19	c.709C>T	CCDS10824.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142870	0.77888	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.79653	-1.29;-1.29	5.93	5.93	0.95920	5.930000	5.930000	0.959200	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88522	0.6459	M	0.69823	2.125	0.80722	D	1	D	0.62365	0.991	P	0.59546	0.859	D	0.88586	0.3140	10	0.72032	D	0.01	.	20.328	0.98708	0.0:0.0:1.0:0.0	.	237	P55042	RAD_HUMAN	Y	237	ENSP00000388744:H237Y;ENSP00000299759:H237Y	ENSP00000299759:H237Y	H	-	1	0	0	RRAD	65513698	65513698	1.000000	0.71417	0.998000	0.56505	0.449000	0.32228	9.471000	0.97696	2.802000	0.96397	0.561000	0.74099	CAC	0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.602	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	104	1	1.770000	-4.749076	1	0.740000	NM_004165		0	5	5	0	412	407	0		1	0		0	0	108	0	0	0.935903	9.666273e-03	0	0	0	10	0	5	412
TP53	7157	broad.mit.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs28934573		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr17:7577559G>A	ENST00000269305.4	-	7	911	c.722C>T	c.(721-723)tCc>tTc	p.S241F	TP53_ENST00000445888.2_Missense_Mutation_p.S241F|TP53_ENST00000455263.2_Missense_Mutation_p.S241F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000359597.4_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.950000	7.200000e-01	0.900000	7.700000e-01	8.300000e-01	0.841610	8.300000e-01	0.840000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	24185	GRCh37	CM920673	TP53	M	rs28934573	c.(721-723)tCc>tTc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						139.0	108.0	118.0					17																	7577559		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577559G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>T	chr17.hg19:g.7577559G>A	ENSP00000269305:p.Ser241Phe	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.S241F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.S241F|TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000359597.4_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F	p.S241F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.503745	P04637	P53_HUMAN		7	911	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.722C>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404027	0.62288	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	4.620000	3.640000	0.417300	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.53688	A	0.999973	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96525	0.9388	9	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	rs28934573	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241F;ENSP00000352610:S241F;ENSP00000269305:S241F;ENSP00000398846:S241F;ENSP00000391127:S241F;ENSP00000391478:S241F;ENSP00000425104:S109F;ENSP00000423862:S148F	ENSP00000269305:S241F	S	-	2	0	0	TP53	7518284	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC	0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	3	0	0	0	0	91	91	91	91	1	1.770000	-20.000000	1	0.740000	NM_000546		0	107	105	0	110	109	1		1	1	1	0	2	91	2958	0	1.000000	1	1	79	286	14	243	107	110
MYO15A	51168	broad.mit.edu	37	17	18023559	18023559	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr17:18023559G>A	ENST00000205890.5	+	2	1783	c.1445G>A	c.(1444-1446)cGa>cAa	p.R482Q		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	482					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CTCTTCCCGCGACCCCAGGTG	0.632																																						ENST00000205890.5	0.320000	1.600000e-01	0.280000	1.900000e-01	2.300000e-01	0.244999	2.300000e-01	0.240000																										0				99						c.(1444-1446)cGa>cAa		myosin XVA							38.0	45.0	43.0					17																	18023559		2049	4191	6240	SO:0001583	missense	51168	0	0					g.chr17:18023559G>A	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1445G>A	chr17.hg19:g.18023559G>A	ENSP00000205890:p.Arg482Gln	1						p.R482Q	NM_016239.3	NP_057323.3	0	1	1	1.503745	Q9UKN7	MYO15_HUMAN		2	1783	+	all_neural(463;0.228)		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	1	1	hg19	c.1445G>A	CCDS42271.1	0	.	.	.	.	.	.	.	.	.	.	G	21.3	4.131602	0.77662	.	.	ENSG00000091536	ENST00000205890	T	0.51325	0.71	5.1	5.1	0.69264	5.100000	5.100000	0.692640	.	.	.	.	.	T	0.59756	0.2217	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.61978	-0.6951	9	0.54805	T	0.06	.	18.1103	0.89533	0.0:0.0:1.0:0.0	.	482	Q9UKN7	MYO15_HUMAN	Q	482	ENSP00000205890:R482Q	ENSP00000205890:R482Q	R	+	2	0	0	MYO15A	17964284	17964284	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.973000	0.88032	2.374000	0.81015	0.561000	0.74099	CGA	0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.632	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	1	0	1	2	10	2	2	1	1	1	1	89	89	89	88	1	1.770000	-20.000000	1	0.740000	NM_016239		0	31	30	0	190	187	1		1			1	0	89	0	0	0.999850	0	0	0	0	0	0	31	190
ONECUT2	9480	broad.mit.edu	37	18	55103544	55103544	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr18:55103544G>C	ENST00000491143.2	+	1	628	c.596G>C	c.(595-597)cGc>cCc	p.R199P	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	199					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		ACCCTCATGCGCGACGAGCGC	0.677																																						ENST00000491143.2	0.980000	6.700000e-01	0.930000	7.500000e-01	8.400000e-01	0.844473	8.400000e-01	0.850000																										0				15						c.(595-597)cGc>cCc		one cut homeobox 2							28.0	33.0	31.0					18																	55103544		2150	4257	6407	SO:0001583	missense	9480	0	0					g.chr18:55103544G>C	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.596G>C	chr18.hg19:g.55103544G>C	ENSP00000419185:p.Arg199Pro	1					AC090340.1_ENST00000581316.1_RNA	p.R199P	NM_004852.2	NP_004843.2	0	1	1	1.494535	O95948	ONEC2_HUMAN		1	628	+		Colorectal(73;0.234)		Missense_Mutation	SNP	ENST00000491143.2	1	1	hg19	c.596G>C	CCDS42440.1	0	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796477	0.70567	.	.	ENSG00000119547	ENST00000491143;ENST00000262095	.	.	.	4.37	4.37	0.52481	4.370000	4.370000	0.524810	.	0.000000	0.64402	D	0.000001	T	0.78155	0.4239	M	0.76574	2.34	0.53688	D	0.999979	D	0.71674	0.998	D	0.79108	0.992	T	0.80984	-0.1138	9	0.56958	D	0.05	-18.0298	15.663	0.77203	0.0:0.0:1.0:0.0	.	199	O95948	ONEC2_HUMAN	P	180;199	.	ENSP00000262095:R199P	R	+	2	0	0	ONECUT2	53254542	53254542	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	9.544000	0.98092	1.990000	0.58119	0.455000	0.32223	CGC	0.587302		TCGA-IB-A5SP-01A-11D-A32N-08	0.677	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3	1	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	1.770000	-20.000000	1	0.740000			0	44	44	0	43	43	0		1	1		0	0	40	0	0	1.000000	9.998059e-01	0	17	0	1	0	44	43
ZNF441	126068	broad.mit.edu	37	19	11891903	11891903	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:11891903A>G	ENST00000357901.4	+	4	1366	c.1264A>G	c.(1264-1266)Aaa>Gaa	p.K422E	ZNF441_ENST00000454339.2_Missense_Mutation_p.K355E	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATATAAATGTAAACAATGTGG	0.368																																						ENST00000357901.4	1.000000	8.800000e-01	1.000000	9.600000e-01	9.900000e-01	0.986632	9.900000e-01	1.000000																										0				19						c.(1264-1266)Aaa>Gaa		zinc finger protein 441							38.0	39.0	38.0					19																	11891903		2203	4300	6503	SO:0001583	missense	126068	0	0					g.chr19:11891903A>G	AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1264A>G	chr19.hg19:g.11891903A>G	ENSP00000350576:p.Lys422Glu	0					ZNF441_ENST00000454339.2_Missense_Mutation_p.K355E	p.K422E	NM_152355.2	NP_689568.2	0	0	0	2.149781	Q8N8Z8	ZN441_HUMAN		4	1366	+				Missense_Mutation	SNP	ENST00000357901.4	1	1	hg19	c.1264A>G	CCDS12266.2	1	.	.	.	.	.	.	.	.	.	.	-	15.89	2.966344	0.53507	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.08370	3.1;3.1	1.22	0.166	0.14999	1.220000	0.166000	0.149990	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04048	0.0113	N	0.12611	0.24	0.09310	N	0.999999	B	0.28291	0.206	B	0.34418	0.182	T	0.44174	-0.9345	9	0.25751	T	0.34	.	0.0939	0.00042	0.3319:0.241:0.1882:0.239	.	422	Q8N8Z8	ZN441_HUMAN	E	378;422;355	ENSP00000350576:K422E;ENSP00000403738:K355E	ENSP00000350576:K422E	K	+	1	0	0	ZNF441	11752903	11752903	0.000000	0.05858	0.122000	0.21767	0.980000	0.70556	-4.770000	0.00188	-0.007000	0.14345	0.254000	0.18369	AAA	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.368	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335273.3	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.770000	-20.000000	1	0.740000	NM_152355		0	82	82	0	124	122	1		1	1		0	0	20	0	0	1.000000	5.223269e-01	0	3	0	1	0	82	124
MKNK2	2872	broad.mit.edu	37	19	2041073	2041073	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:2041073G>A	ENST00000591601.1	-	11	1111	c.1076C>T	c.(1075-1077)gCc>gTc	p.A359V	MKNK2_ENST00000591588.1_Missense_Mutation_p.A103V|MKNK2_ENST00000250896.3_Missense_Mutation_p.A359V|MKNK2_ENST00000309340.7_Missense_Mutation_p.A359V|MKNK2_ENST00000591142.1_Missense_Mutation_p.A103V|MKNK2_ENST00000541165.1_Missense_Mutation_p.A228V|MKNK2_ENST00000588014.1_Missense_Mutation_p.A103V			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	359	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.A359V(2)		breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTTGGGCGGCACTCAGCCT	0.662																																						ENST00000591601.1	0.060000	0	0.040000	0	2.000000e-02	0.028665	2.000000e-02	0.020000																										2	Substitution - Missense(2)	p.A359V(2)	large_intestine(2)	10						c.(1075-1077)gCc>gTc		MAP kinase interacting serine/threonine kinase 2							125.0	100.0	109.0					19																	2041073		2203	4300	6503	SO:0001583	missense	2872	0	0					g.chr19:2041073G>A	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.1076C>T	chr19.hg19:g.2041073G>A	ENSP00000467811:p.Ala359Val	0					MKNK2_ENST00000541165.1_Missense_Mutation_p.A228V|MKNK2_ENST00000250896.3_Missense_Mutation_p.A359V|MKNK2_ENST00000591142.1_Missense_Mutation_p.A103V|MKNK2_ENST00000309340.7_Missense_Mutation_p.A359V|MKNK2_ENST00000588014.1_Missense_Mutation_p.A103V|MKNK2_ENST00000591588.1_Missense_Mutation_p.A103V	p.A359V			0	0	0	2.149781	Q9HBH9	MKNK2_HUMAN		11	1111	-		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Missense_Mutation	SNP	ENST00000591601.1	0	1	hg19	c.1076C>T	CCDS12080.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140434	0.77775	.	.	ENSG00000099875	ENST00000309340;ENST00000250896;ENST00000541165;ENST00000545627	T;T;T	0.46063	0.88;0.88;0.88	3.94	3.94	0.45596	3.940000	3.940000	0.455960	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.117336	0.56097	D	0.000022	T	0.52933	0.1765	L	0.38531	1.155	0.80722	D	1	D;D;P;P	0.71674	0.988;0.998;0.939;0.868	D;D;P;P	0.71414	0.951;0.973;0.779;0.859	T	0.55848	-0.8076	10	0.52906	T	0.07	-6.964	15.1499	0.72689	0.0:0.0:1.0:0.0	.	164;359;359;261	Q59GN5;Q9HBH9;Q9HBH9-2;Q9NT28	.;MKNK2_HUMAN;.;.	V	359;359;228;299	ENSP00000309485:A359V;ENSP00000250896:A359V;ENSP00000438904:A228V	ENSP00000250896:A359V	A	-	2	0	0	MKNK2	1992073	1992073	1.000000	0.71417	0.540000	0.28089	0.417000	0.31264	9.343000	0.97047	2.046000	0.60703	0.555000	0.69702	GCC	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.662	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449312.1	0	0	1	2	13	10	2	1	1	1	1	169	169	169	168	1	1.770000	-2.739844	1	0.740000	NM_199054		0	5	5	0	535	528	0		0	0		1	0	169	0	0	0.043705	4.522639e-02	0	0	0	387	0	5	535
MAN2B1	4125	broad.mit.edu	37	19	12763078	12763078	+	Silent	SNP	G	G	A	rs34853569	byFrequency	TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:12763078G>A	ENST00000456935.2	-	16	1975	c.1935C>T	c.(1933-1935)aaC>aaT	p.N645N	MAN2B1_ENST00000221363.4_Silent_p.N644N	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	645					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTATACTGGCGTTGTACCTGG	0.592													G|||	48	0.00958466	0.0356	0.0014	5008	,	,		16337	0.0		0.0	False		,,,				2504	0.0					ENST00000456935.2	1.000000	8.700000e-01	1.000000	9.300000e-01	9.900000e-01	0.974689	9.900000e-01	1.000000																										0				33						c.(1933-1935)aaC>aaT		mannosidase, alpha, class 2B, member 1		G	,	162,4244	110.8+/-149.0	4,154,2045	130.0	101.0	111.0		1935,1932	-11.2	0.1	19	dbSNP_126	111	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MAN2B1	NM_000528.3,NM_001173498.1	,	4,155,6344	AA,AG,GG		0.0116,3.6768,1.2533	,	645/1012,644/1011	12763078	163,12843	2203	4300	6503	SO:0001819	synonymous_variant	4125	427	121412	59				g.chr19:12763078G>A		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.1935C>T	chr19.hg19:g.12763078G>A		0					MAN2B1_ENST00000221363.4_Silent_p.N644N	p.N645N	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	0	0	0	2.149781	O00754	MA2B1_HUMAN		16	1975	-			G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	1	0	hg19	c.1935C>T	CCDS32919.1	1	18	0.008241758241758242	16	0.032520325203252036	2	0.0055248618784530384	0	0.0	0	0.0	G	0.018	-1.477523	0.01035	0.036768	1.16E-4	ENSG00000104774	ENST00000433513	.	.	.	5.6	-11.2	0.00127	5.600000	-11.200000	0.001270	.	.	.	.	.	T	0.24431	0.0592	.	.	.	0.45439	D	0.998412	.	.	.	.	.	.	T	0.69343	-0.5170	4	.	.	.	-8.3103	13.3469	0.60578	0.2157:0.0:0.6193:0.165	rs34853569	.	.	.	C	181	.	.	R	-	1	0	0	MAN2B1	12624078	12624078	0.002000	0.14202	0.081000	0.20488	0.002000	0.02628	-1.569000	0.02142	-3.131000	0.00236	-1.105000	0.02106	CGC	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.592	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	100	1	1.770000	-2.204850	0	0.740000			0	166	163	0	277	270	1		1	1		0	0	104	0	0	1.000000	1	0	23	0	69	0	166	277
HIPK4	147746	broad.mit.edu	37	19	40886552	40886552	+	Missense_Mutation	SNP	G	G	A	rs201121603		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:40886552G>A	ENST00000291823.2	-	3	1630	c.1346C>T	c.(1345-1347)gCg>gTg	p.A449V		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	449					histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			GTCGGAGACCGCATTGGTGCA	0.632													g|||	1	0.000199681	0.0008	0.0	5008	,	,		19090	0.0		0.0	False		,,,				2504	0.0					ENST00000291823.2	0.050000	0	0.030000	0	1.000000e-02	0.031990	1.000000e-02	0.020000																										0				20						c.(1345-1347)gCg>gTg		homeodomain interacting protein kinase 4							86.0	90.0	89.0					19																	40886552		2203	4300	6503	SO:0001583	missense	147746	1	121410	37				g.chr19:40886552G>A	BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.1346C>T	chr19.hg19:g.40886552G>A	ENSP00000291823:p.Ala449Val	0						p.A449V	NM_144685.3	NP_653286.2	1	2	3	2.221285	Q8NE63	HIPK4_HUMAN	Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)	3	1630	-			A8K863|Q96M54	Missense_Mutation	SNP	ENST00000291823.2	0	1	hg19	c.1346C>T	CCDS12555.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	g	0.004	-2.287071	0.00248	.	.	ENSG00000160396	ENST00000291823;ENST00000452139	T	0.66099	-0.19	4.84	-4.35	0.03656	4.840000	-4.350000	0.036560	.	1.367440	0.05006	N	0.470122	T	0.31136	0.0787	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39683	-0.9602	10	0.02654	T	1	.	7.7812	0.29066	0.217:0.3469:0.4361:0.0	.	449	Q8NE63	HIPK4_HUMAN	V	449;414	ENSP00000291823:A449V	ENSP00000291823:A449V	A	-	2	0	0	HIPK4	45578392	45578392	0.000000	0.05858	0.012000	0.15200	0.008000	0.06430	-0.930000	0.03972	-0.596000	0.05821	-0.598000	0.04106	GCG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.632	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462593.1	0	0	1	2	14	2	2	1	1	1	1	236	236	236	233	1	1.770000	-2.123610	0	0.740000	NM_144685		0	6	6	0	839	824	0		0			1	0	236	0	0	0.051844	0	0	0	0	0	0	6	839
MUC16	94025	broad.mit.edu	37	19	9011412	9011412	+	Missense_Mutation	SNP	C	C	T	rs114676657	byFrequency	TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:9011412C>T	ENST00000397910.4	-	36	39024	c.38821G>A	c.(38821-38823)Gag>Aag	p.E12941K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12943	SEA 6. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TACAGCTGCTCTCTGTTGAGT	0.572													N|||	66	0.0131789	0.0121	0.0101	5008	,	,		17786	0.0		0.0288	False		,,,				2504	0.0143					ENST00000397910.4	0.970000	8.000000e-01	0.930000	8.400000e-01	8.800000e-01	0.891598	8.800000e-01	0.890000																										0				590						c.(38821-38823)Gag>Aag		mucin 16, cell surface associated		C	LYS/GLU	40,3884		1,38,1923	195.0	173.0	180.0		38821	2.8	0.0	19	dbSNP_132	180	221,8077		6,209,3934	no	missense	MUC16	NM_024690.2	56	7,247,5857	TT,TC,CC		2.6633,1.0194,2.1355	probably-damaging	12941/14508	9011412	261,11961	1962	4149	6111	SO:0001583	missense	94025	2715	120900	71				g.chr19:9011412C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38821G>A	chr19.hg19:g.9011412C>T	ENSP00000381008:p.Glu12941Lys	0						p.E12941K	NM_024690.2	NP_078966.2	0	0	0	2.149781	Q8WXI7	MUC16_HUMAN		36	39024	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	0	hg19	c.38821G>A	CCDS54212.1	1	24	0.01098901098901099	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	20	0.026385224274406333	.	12.85	2.061979	0.36373	0.010194	0.026633	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.63255	-0.03	2.76	2.76	0.32466	2.760000	2.760000	0.324660	.	.	.	.	.	T	0.54854	0.1884	M	0.79258	2.445	.	.	.	D	0.71674	0.998	D	0.80764	0.994	T	0.76903	-0.2787	8	0.87932	D	0	-19.752	9.6026	0.39615	0.0:1.0:0.0:0.0	.	12941	B5ME49	.	K	12941;94	ENSP00000381008:E12941K	ENSP00000381008:E12941K	E	-	1	0	0	MUC16	8872412	8872412	0.001000	0.12720	0.025000	0.17156	0.022000	0.10575	0.101000	0.15251	1.474000	0.48178	0.305000	0.20034	GAG	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	207	207	207	207	1	1.770000	-1.349145	0	0.740000	NM_024690		0	337	331	0	670	657	1		1			0	0	207	0	0	1.000000	0	0	0	0	0	0	337	670
MUC16	94025	broad.mit.edu	37	19	9057140	9057140	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:9057140C>A	ENST00000397910.4	-	3	30509	c.30306G>T	c.(30304-30306)atG>atT	p.M10102I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10104	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTCACTGCCATGCTTGAAG	0.468																																						ENST00000397910.4	0.970000	7.300000e-01	0.920000	7.800000e-01	8.500000e-01	0.857421	8.500000e-01	0.860000																										0				590						c.(30304-30306)atG>atT		mucin 16, cell surface associated							112.0	109.0	110.0					19																	9057140		1955	4160	6115	SO:0001583	missense	94025	0	0					g.chr19:9057140C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30306G>T	chr19.hg19:g.9057140C>A	ENSP00000381008:p.Met10102Ile	0						p.M10102I	NM_024690.2	NP_078966.2	0	0	0	2.149781	Q8WXI7	MUC16_HUMAN		3	30509	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.30306G>T	CCDS54212.1	1	.	.	.	.	.	.	.	.	.	.	c	3.031	-0.199690	0.06219	.	.	ENSG00000181143	ENST00000397910	T	0.20200	2.09	2.6	-5.21	0.02815	2.600000	-5.210000	0.028150	.	.	.	.	.	T	0.07954	0.0199	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.29427	-1.0012	8	0.87932	D	0	.	1.7767	0.03023	0.1437:0.3395:0.3098:0.2071	.	10102	B5ME49	.	I	10102	ENSP00000381008:M10102I	ENSP00000381008:M10102I	M	-	3	0	0	MUC16	8918140	8918140	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-3.069000	0.00619	-1.862000	0.01151	-1.436000	0.01078	ATG	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	1.770000	-11.413900	1	0.740000	NM_024690		0	127	126	0	268	267	1		1			0	0	66	0	0	1.000000	0	0	0	0	0	0	127	268
MUC16	94025	broad.mit.edu	37	19	9089947	9089947	+	Missense_Mutation	SNP	G	G	T	rs576260781		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:9089947G>T	ENST00000397910.4	-	1	2071	c.1868C>A	c.(1867-1869)aCa>aAa	p.T623K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	623	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGGTGGGTTGTGCCCTGGCT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		19156	0.0		0.001	False		,,,				2504	0.0					ENST00000397910.4	1.000000	7.600000e-01	0.960000	8.200000e-01	8.800000e-01	0.894340	8.800000e-01	1.000000																										0				590						c.(1867-1869)aCa>aAa		mucin 16, cell surface associated							93.0	97.0	96.0					19																	9089947		2196	4294	6490	SO:0001583	missense	94025	14	121378	43				g.chr19:9089947G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1868C>A	chr19.hg19:g.9089947G>T	ENSP00000381008:p.Thr623Lys	0						p.T623K	NM_024690.2	NP_078966.2	0	0	0	2.149781	Q8WXI7	MUC16_HUMAN		1	2071	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.1868C>A	CCDS54212.1	1	.	.	.	.	.	.	.	.	.	.	g	3.239	-0.155665	0.06544	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	1.68	-0.919	0.10478	1.680000	-0.919000	0.104780	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.23540	0.087	B	0.15870	0.014	T	0.46247	-0.9205	8	0.87932	D	0	.	2.1688	0.03844	0.2075:0.0:0.4212:0.3713	.	623	B5ME49	.	K	623	ENSP00000381008:T623K	ENSP00000381008:T623K	T	-	2	0	0	MUC16	8950947	8950947	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.135000	0.10420	-0.188000	0.10499	0.205000	0.17691	ACA	0.736094		TCGA-IB-A5SP-01A-11D-A32N-08	0.577	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.770000	-20.000000	1	0.740000	NM_024690		0	130	128	0	257	254	1		1			0	0	76	0	0	1.000000	0	0	0	0	0	0	130	257
SHANK1	50944	broad.mit.edu	37	19	51219616	51219616	+	Silent	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr19:51219616G>A	ENST00000293441.1	-	2	393	c.375C>T	c.(373-375)tcC>tcT	p.S125S	SHANK1_ENST00000359082.3_Silent_p.S125S|SHANK1_ENST00000391814.1_Silent_p.S125S	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	125					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CATCGCGGCCGGAGGTGGCCG	0.637																																						ENST00000293441.1	0.070000	0	0.050000	1.000000e-02	2.000000e-02	0.042377	2.000000e-02	0.030000																										0				64						c.(373-375)tcC>tcT		SH3 and multiple ankyrin repeat domains 1							49.0	52.0	51.0					19																	51219616		2203	4300	6503	SO:0001819	synonymous_variant	50944	0	0					g.chr19:51219616G>A	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.375C>T	chr19.hg19:g.51219616G>A		0					SHANK1_ENST00000391814.1_Silent_p.S125S|SHANK1_ENST00000359082.3_Silent_p.S125S	p.S125S	NM_016148.2	NP_057232.2	1	2	3	2.221285	Q9Y566	SHAN1_HUMAN		2	393	-		all_neural(266;0.057)	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	0	1	hg19	c.375C>T	CCDS12799.1	0																																																																																								0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.637	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	107	1	1.770000	-4.433140	1	0.740000	NM_016148		0	5	5	0	478	475	0		1	0		0	0	108	0	0	0.936816	0	0	0	0	1	0	5	478
PRDM2	7799	broad.mit.edu	37	1	14108213	14108213	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:14108213G>A	ENST00000235372.7	+	8	4779	c.3923G>A	c.(3922-3924)cGt>cAt	p.R1308H	PRDM2_ENST00000311066.5_Missense_Mutation_p.R1308H|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.R1107H|PRDM2_ENST00000413440.1_Missense_Mutation_p.R1107H|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TACCATCACCGTAACCCCATG	0.443																																						ENST00000235372.7	0.050000	0	0.030000	0	1.000000e-02	0.023370	1.000000e-02	0.020000																										0				55						c.(3922-3924)cGt>cAt		PR domain containing 2, with ZNF domain							140.0	139.0	139.0					1																	14108213		2203	4300	6503	SO:0001583	missense	7799	2	121412	36				g.chr1:14108213G>A	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3923G>A	chr1.hg19:g.14108213G>A	ENSP00000235372:p.Arg1308His	1					PRDM2_ENST00000311066.5_Missense_Mutation_p.R1308H|PRDM2_ENST00000343137.4_Missense_Mutation_p.R1107H|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.R1107H	p.R1308H	NM_012231.4	NP_036363.2	0	1	1	2.024600	Q13029	PRDM2_HUMAN	GBM - Glioblastoma multiforme(2;0.00182)	8	4779	+	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	0	1	hg19	c.3923G>A	CCDS150.1	0	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502016	0.64298	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.02050	4.59;4.48;4.48;4.48	6.17	5.27	0.74061	6.170000	5.270000	0.740610	.	0.000000	0.85682	D	0.000000	T	0.06234	0.0161	L	0.29908	0.895	0.47037	D	0.999293	D;B;B	0.89917	1.0;0.167;0.257	D;B;B	0.74023	0.982;0.031;0.042	T	0.38672	-0.9650	10	0.87932	D	0	.	10.4416	0.44469	0.1477:0.0:0.8523:0.0	.	1166;1308;1308	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	H	1308;1308;1308;1107;1107	ENSP00000235372:R1308H;ENSP00000312352:R1308H;ENSP00000411103:R1107H;ENSP00000341621:R1107H	ENSP00000235372:R1308H	R	+	2	0	0	PRDM2	13980800	13980800	1.000000	0.71417	0.999000	0.59377	0.823000	0.46562	6.781000	0.75068	1.635000	0.50512	0.655000	0.94253	CGT	0.708749		TCGA-IB-A5SP-01A-11D-A32N-08	0.443	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	0	0	1	2	17	2	2	1	1	1	1	156	156	156	156	1	1.770000	-2.101181	0	0.740000	NM_012231		0	7	6	0	776	764	0		0	0		1	0	156	0	0	0.027969	1.907308e-02	0	0	0	20	0	7	776
KCNA3	3738	broad.mit.edu	37	1	111216789	111216789	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:111216789C>T	ENST00000369769.2	-	1	866	c.643G>A	c.(643-645)Gac>Aac	p.D215N		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	215					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	CGCTGGAAGTCGCGGCGGGGC	0.682																																						ENST00000369769.2	0.100000	3.000000e-02	0.090000	4.000000e-02	6.000000e-02	0.068001	6.000000e-02	0.070000																										0				38						c.(643-645)Gac>Aac		potassium voltage-gated channel, shaker-related subfamily, member 3	Dalfampridine(DB06637)						36.0	44.0	41.0					1																	111216789		2200	4283	6483	SO:0001583	missense	3738	0	0					g.chr1:111216789C>T	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.643G>A	chr1.hg19:g.111216789C>T	ENSP00000358784:p.Asp215Asn	1						p.D215N	NM_002232.3	NP_002223.3	0	1	1	2.013778	P22001	KCNA3_HUMAN		1	866	-		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	1	1	hg19	c.643G>A	CCDS828.2	0	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180330	0.57800	.	.	ENSG00000177272	ENST00000369769	D	0.96830	-4.14	4.8	3.87	0.44632	4.800000	3.870000	0.446320	.	0.844686	0.10366	U	0.683427	D	0.89332	0.6685	L	0.28192	0.835	0.41461	D	0.988045	P	0.34699	0.464	B	0.28849	0.095	D	0.85442	0.1155	10	0.87932	D	0	.	14.8698	0.70448	0.0:0.8552:0.1448:0.0	.	215	P22001	KCNA3_HUMAN	N	215	ENSP00000358784:D215N	ENSP00000358784:D215N	D	-	1	0	0	KCNA3	111018312	111018312	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.873000	0.63057	0.986000	0.38683	0.561000	0.74099	GAC	0.703839		TCGA-IB-A5SP-01A-11D-A32N-08	0.682	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	0	0	1	2	2	2	2	0	0	0	0	138	138	138	112	1	1.770000	-12.714770	1	0.740000	NM_002232		0	15	14	0	541	475	0		1			0	0	138	0	0	0.999676	0	0	0	0	0	0	15	541
RGL1	23179	broad.mit.edu	37	1	183885789	183885789	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:183885789G>A	ENST00000360851.3	+	16	2136	c.1958G>A	c.(1957-1959)cGc>cAc	p.R653H	RGL1_ENST00000536277.1_Missense_Mutation_p.R651H|RGL1_ENST00000304685.4_Missense_Mutation_p.R688H|RGL1_ENST00000539189.1_Missense_Mutation_p.R624H			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	653	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						TGCATAATCCGCATCAGTGTG	0.498																																						ENST00000360851.3	0.070000	0	0.050000	1.000000e-02	2.000000e-02	0.036194	2.000000e-02	0.030000																										0				51						c.(1957-1959)cGc>cAc		ral guanine nucleotide dissociation stimulator-like 1							123.0	117.0	119.0					1																	183885789		2203	4300	6503	SO:0001583	missense	23179	3	121412	37				g.chr1:183885789G>A	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1958G>A	chr1.hg19:g.183885789G>A	ENSP00000354097:p.Arg653His	1					RGL1_ENST00000539189.1_Missense_Mutation_p.R624H|RGL1_ENST00000304685.4_Missense_Mutation_p.R688H|RGL1_ENST00000536277.1_Missense_Mutation_p.R651H	p.R653H			0	1	1	2.004601	Q9NZL6	RGL1_HUMAN		16	2136	+			Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	0	1	hg19	c.1958G>A		0	.	.	.	.	.	.	.	.	.	.	G	35	5.454279	0.96223	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000360851;ENST00000539189	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.43	5.43	0.79202	5.430000	5.430000	0.792020	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.998	T	0.64567	-0.6377	10	0.87932	D	0	.	18.8583	0.92262	0.0:0.0:1.0:0.0	.	624;651;653;688	F5H6U6;B7Z2W5;Q9NZL6;Q5SXQ6	.;.;RGL1_HUMAN;.	H	688;688;651;653;624	ENSP00000303192:R688H;ENSP00000356501:R688H;ENSP00000438662:R651H;ENSP00000354097:R653H;ENSP00000437355:R624H	ENSP00000303192:R688H	R	+	2	0	0	RGL1	182152412	182152412	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.401000	0.97294	2.555000	0.86185	0.650000	0.86243	CGC	0.703839		TCGA-IB-A5SP-01A-11D-A32N-08	0.498	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.770000	-2.406972	0	0.740000	NM_015149		0	5	5	0	383	376	0		1	0		0	0	85	0	0	0.934902	1.335087e-02	0	0	0	11	0	5	383
HMCN1	83872	broad.mit.edu	37	1	185892601	185892601	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:185892601C>G	ENST00000271588.4	+	8	1330	c.1101C>G	c.(1099-1101)atC>atG	p.I367M	HMCN1_ENST00000367492.2_Missense_Mutation_p.I367M	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	367					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTTTGAGTATCTCAGGAAGTT	0.353																																						ENST00000271588.4	0.150000	3.000000e-02	0.110000	5.000000e-02	7.000000e-02	0.085730	7.000000e-02	0.080000																										0				308						c.(1099-1101)atC>atG		hemicentin 1							90.0	89.0	89.0					1																	185892601		2203	4300	6503	SO:0001583	missense	83872	0	0					g.chr1:185892601C>G	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1101C>G	chr1.hg19:g.185892601C>G	ENSP00000271588:p.Ile367Met	1					HMCN1_ENST00000367492.2_Missense_Mutation_p.I367M	p.I367M	NM_031935.2	NP_114141.2	0	1	1	2.004601	Q96RW7	HMCN1_HUMAN		8	1330	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	1	1	hg19	c.1101C>G	CCDS30956.1	0	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318610	0.60524	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.64438	-0.1;-0.1	5.4	3.43	0.39272	5.400000	3.430000	0.392720	.	0.260319	0.43579	D	0.000544	T	0.53753	0.1816	L	0.47716	1.5	0.33535	D	0.594146	P	0.43169	0.8	B	0.42462	0.388	T	0.61850	-0.6978	10	0.34782	T	0.22	.	8.7355	0.34525	0.2826:0.6415:0.0:0.0759	.	367	Q96RW7	HMCN1_HUMAN	M	367	ENSP00000271588:I367M;ENSP00000356462:I367M	ENSP00000271588:I367M	I	+	3	3	3	HMCN1	184159224	184159224	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.005000	0.49521	0.558000	0.29135	0.655000	0.94253	ATC	0.703839		TCGA-IB-A5SP-01A-11D-A32N-08	0.353	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	0	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.770000	-8.765153	1	0.740000	NM_031935		0	7	7	0	212	212	0		1			0	0	43	0	0	0.980795	0	0	0	0	0	0	7	212
KDM5B	10765	broad.mit.edu	37	1	202702804	202702804	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:202702804C>A	ENST00000367265.3	-	23	4798	c.3634G>T	c.(3634-3636)Ggc>Tgc	p.G1212C	KDM5B_ENST00000367264.2_Missense_Mutation_p.G1248C	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1212					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						ATTCGCAGGCCCTGTGAAATA	0.542																																						ENST00000367265.3	1.000000	9.900000e-01	1.000000	9.900000e-01	9.900000e-01	0.999589	9.900000e-01	1.000000																										0				6						c.(3634-3636)Ggc>Tgc		lysine (K)-specific demethylase 5B							52.0	53.0	53.0					1																	202702804		2203	4300	6503	SO:0001583	missense	10765	0	0					g.chr1:202702804C>A	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3634G>T	chr1.hg19:g.202702804C>A	ENSP00000356234:p.Gly1212Cys	1					KDM5B_ENST00000367264.2_Missense_Mutation_p.G1248C	p.G1212C	NM_006618.3	NP_006609.3	0	1	1	2.004601	Q9UGL1	KDM5B_HUMAN		23	4798	-			O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	1	1	hg19	c.3634G>T	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.391676	0.62066	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.88046	-2.33;-2.33;-2.33	6.09	4.15	0.48705	6.090000	4.150000	0.487050	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.449783	0.28871	N	0.013866	D	0.91036	0.7180	M	0.91140	3.18	0.33999	D	0.650031	P;P	0.49696	0.927;0.814	P;P	0.49276	0.605;0.563	D	0.93343	0.6711	10	0.56958	D	0.05	-5.713	9.9016	0.41351	0.0:0.8245:0.0:0.1755	.	1248;1212	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	C	1212;1054;1248;1054	ENSP00000356234:G1212C;ENSP00000356233:G1248C;ENSP00000235790:G1054C	ENSP00000235790:G1054C	G	-	1	0	0	KDM5B	200969427	200969427	0.432000	0.25554	0.011000	0.14972	0.797000	0.45037	0.847000	0.27696	0.798000	0.33994	0.643000	0.83706	GGC	0.703839		TCGA-IB-A5SP-01A-11D-A32N-08	0.542	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.770000	-20.000000	1	0.740000	NM_006618		0	135	134	0	143	142	1		1	1		0	0	52	0	0	1.000000	1	0	18	0	21	0	135	143
USH2A	7399	broad.mit.edu	37	1	215933091	215933091	+	Silent	SNP	T	T	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:215933091T>C	ENST00000307340.3	-	57	11528	c.11142A>G	c.(11140-11142)caA>caG	p.Q3714Q	USH2A_ENST00000366943.2_Silent_p.Q3714Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3714	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAATTGATATTGAGAAACGA	0.428										HNSCC(13;0.011)																												ENST00000307340.3	0.720000	5.200000e-01	0.670000	5.600000e-01	6.100000e-01	0.625822	6.100000e-01	0.620000																										0				527						c.(11140-11142)caA>caG		Usher syndrome 2A (autosomal recessive, mild)							112.0	107.0	109.0					1																	215933091		2203	4300	6503	SO:0001819	synonymous_variant	7399	0	0					g.chr1:215933091T>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11142A>G	chr1.hg19:g.215933091T>C		1	HNSCC(13;0.011)				USH2A_ENST00000366943.2_Silent_p.Q3714Q	p.Q3714Q	NM_206933.2	NP_996816	0	1	1	2.004601	O75445	USH2A_HUMAN		57	11528	-			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	1	1	hg19	c.11142A>G	CCDS31025.1	0																																																																																								0.703839		TCGA-IB-A5SP-01A-11D-A32N-08	0.428	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.770000	-20.000000	1	0.740000	NM_007123		0	112	111	0	314	310	1		1			0	0	79	0	0	1.000000	0	0	0	0	0	0	112	314
PLD5	200150	broad.mit.edu	37	1	242253380	242253380	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:242253380G>C	ENST00000536534.2	-	10	1628	c.1387C>G	c.(1387-1389)Cag>Gag	p.Q463E	PLD5_ENST00000427495.1_Missense_Mutation_p.Q401E|PLD5_ENST00000442594.2_Missense_Mutation_p.Q371E			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	463						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CCAGCATTCTGAGTGAAATCA	0.398																																						ENST00000536534.2	0.790000	5.800000e-01	0.740000	6.300000e-01	6.800000e-01	0.692794	6.800000e-01	0.690000																										0				55						c.(1387-1389)Cag>Gag		phospholipase D family, member 5							120.0	115.0	117.0					1																	242253380		2203	4300	6503	SO:0001583	missense	200150	0	0					g.chr1:242253380G>C	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1387C>G	chr1.hg19:g.242253380G>C	ENSP00000440896:p.Gln463Glu	1					PLD5_ENST00000427495.1_Missense_Mutation_p.Q401E|PLD5_ENST00000442594.2_Missense_Mutation_p.Q371E	p.Q463E			0	1	1	1.963230	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)	10	1628	-	Melanoma(84;0.242)		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	1	1	hg19	c.1387C>G	CCDS1621.2	0	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.505959	0.00992	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.22134	1.97;1.97;1.97	5.77	5.77	0.91146	5.770000	5.770000	0.911460	.	0.137275	0.53938	D	0.000055	T	0.16599	0.0399	L	0.49126	1.545	0.30380	N	0.782052	B;P;B	0.39250	0.372;0.665;0.372	B;B;B	0.32677	0.15;0.119;0.15	T	0.10870	-1.0611	10	0.08837	T	0.75	-7.7223	13.5982	0.62002	0.0:0.0:0.8451:0.1548	.	371;463;401	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	E	401;371;463	ENSP00000401285:Q401E;ENSP00000414188:Q371E;ENSP00000440896:Q463E	ENSP00000401285:Q401E	Q	-	1	0	0	PLD5	240320003	240320003	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	3.937000	0.56575	2.723000	0.93209	0.655000	0.94253	CAG	0.697463		TCGA-IB-A5SP-01A-11D-A32N-08	0.398	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	1	0	1	2	2	2	2	0	0	0	0	87	87	87	86	1	1.770000	-9.305342	1	0.740000	NM_152666		0	125	125	0	295	292	1		1			0	0	87	0	0	1.000000	0	0	0	0	0	0	125	295
MAP3K6	9064	broad.mit.edu	37	1	27687469	27687469	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:27687469C>T	ENST00000493901.1	-	15	2102	c.1863G>A	c.(1861-1863)acG>acA	p.T621T	MAP3K6_ENST00000374040.3_Silent_p.T613T|MAP3K6_ENST00000357582.2_Silent_p.T621T	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	621					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		AATCCGGGTTCGTCACCCAGG	0.716																																						ENST00000493901.1	1.000000	3.200000e-01	1.000000	4.100000e-01	5.200000e-01	0.593906	5.200000e-01	0.490000																										0				10						c.(1861-1863)acG>acA		mitogen-activated protein kinase kinase kinase 6							11.0	15.0	14.0					1																	27687469		2121	4247	6368	SO:0001819	synonymous_variant	9064	0	0					g.chr1:27687469C>T	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.1863G>A	chr1.hg19:g.27687469C>T		1					MAP3K6_ENST00000374040.3_Silent_p.T613T|MAP3K6_ENST00000357582.2_Silent_p.T621T	p.T621T	NM_004672.3	NP_004663.3	0	2	2	2.056041	O95382	M3K6_HUMAN		15	2102	-		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Silent	SNP	ENST00000493901.1	1	1	hg19	c.1863G>A	CCDS299.1	0	.	.	.	.	.	.	.	.	.	.	C	10.64	1.407554	0.25378	.	.	ENSG00000142733	ENST00000472410	.	.	.	5.2	-0.331	0.12679	5.200000	-0.331000	0.126790	.	.	.	.	.	T	0.20414	0.0491	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.23368	-1.0190	4	.	.	.	.	1.4977	0.02470	0.1414:0.4258:0.1589:0.2739	.	.	.	.	Q	345	.	.	R	-	2	0	0	MAP3K6	27560056	27560056	0.002000	0.14202	0.955000	0.39395	0.932000	0.56968	-1.018000	0.03626	0.198000	0.20407	0.655000	0.94253	CGA	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.716	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.770000	-20.000000	1	0.740000	NM_004672		0	19	18	0	85	84	1		1	1		0	0	29	0	0	0.999994	9.955304e-01	0	3	0	40	0	19	85
MATN1	4146	broad.mit.edu	37	1	31188936	31188936	+	Missense_Mutation	SNP	G	G	A	rs201435688		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:31188936G>A	ENST00000373765.4	-	5	1062	c.1027C>T	c.(1027-1029)Cgg>Tgg	p.R343W	MATN1-AS1_ENST00000454613.1_RNA|MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000414763.1_RNA|MATN1-AS1_ENST00000414532.2_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	343	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		GACATATTCCGCACAGCCGCC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		20286	0.0		0.001	False		,,,				2504	0.0					ENST00000373765.4	1.000000	0	1.000000	1.000000e-02	3.000000e-02	0.206485	3.000000e-02	0.040000																										0				12						c.(1027-1029)Cgg>Tgg		matrilin 1, cartilage matrix protein							106.0	115.0	112.0					1																	31188936		2203	4300	6503	SO:0001583	missense	4146	1	121412	28				g.chr1:31188936G>A	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.1027C>T	chr1.hg19:g.31188936G>A	ENSP00000362870:p.Arg343Trp	1					MATN1-AS1_ENST00000454613.1_RNA|MATN1-AS1_ENST00000414763.1_RNA|MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000414532.2_RNA	p.R343W	NM_002379.3	NP_002370.1	0	2	2	2.056041	P21941	MATN1_HUMAN		5	1062	-		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)	B2R7E3|Q5TBB9	Missense_Mutation	SNP	ENST00000373765.4	0	1	hg19	c.1027C>T	CCDS336.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.4	3.990861	0.74703	.	.	ENSG00000162510	ENST00000373765	T	0.79554	-1.28	5.34	0.615	0.17608	5.340000	0.615000	0.176080	von Willebrand factor, type A (3);	.	.	.	.	D	0.88179	0.6367	M	0.78285	2.405	0.35079	D	0.763242	D;D	0.89917	0.999;1.0	D;D	0.68483	0.958;0.958	D	0.91112	0.4923	9	0.72032	D	0.01	-22.2694	14.8171	0.70041	0.0:0.0:0.2392:0.7608	.	327;343	A3KMG0;P21941	.;MATN1_HUMAN	W	343	ENSP00000362870:R343W	ENSP00000362870:R343W	R	-	1	2	2	MATN1	30961523	30961523	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.748000	0.62148	0.193000	0.20303	0.650000	0.86243	CGG	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.592	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010458.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	130	1	1.770000	-2.116668	0	0.740000	NM_002379		0	7	8	0	541	536	0		1			0	0	131	0	0	0.980210	0	0	0	0	0	0	7	541
SDCCAG8	10806	broad.mit.edu	37	1	243456473	243456473	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr1:243456473C>T	ENST00000366541.3	+	6	745	c.627C>T	c.(625-627)gaC>gaT	p.D209D	SDCCAG8_ENST00000391846.1_Silent_p.D209D|SDCCAG8_ENST00000343783.6_Silent_p.D64D|SDCCAG8_ENST00000496361.1_3'UTR|SDCCAG8_ENST00000355875.4_Intron	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	209					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TTTCCCATGACAATGCAGATT	0.403																																						ENST00000366541.3	0.080000	1.000000e-02	0.060000	2.000000e-02	4.000000e-02	0.046796	4.000000e-02	0.040000																										0				29						c.(625-627)gaC>gaT		serologically defined colon cancer antigen 8							96.0	96.0	96.0					1																	243456473		2203	4300	6503	SO:0001819	synonymous_variant	10806	0	0					g.chr1:243456473C>T	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.627C>T	chr1.hg19:g.243456473C>T		1					SDCCAG8_ENST00000496361.1_3'UTR|SDCCAG8_ENST00000355875.4_Intron|SDCCAG8_ENST00000391846.1_Silent_p.D209D|SDCCAG8_ENST00000343783.6_Silent_p.D64D	p.D209D	NM_006642.3	NP_006633.1	0	1	1	1.963230	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	6	745	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Silent	SNP	ENST00000366541.3	0	1	hg19	c.627C>T	CCDS31075.1	0																																																																																								0.697463		TCGA-IB-A5SP-01A-11D-A32N-08	0.403	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.770000	-6.752073	1	0.740000	NM_006642		0	7	7	0	388	381	0		1	0		0	0	66	0	0	0.979552	7.609216e-02	0	0	0	22	0	7	388
NINL	22981	broad.mit.edu	37	20	25462667	25462667	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr20:25462667G>A	ENST00000278886.6	-	14	1820	c.1747C>T	c.(1747-1749)Cgg>Tgg	p.R583W	NINL_ENST00000422516.1_Missense_Mutation_p.R583W	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	583					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GGGCTGTGCCGGTTCTTGGGC	0.692																																						ENST00000278886.6	0.070000	0	0.050000	1.000000e-02	2.000000e-02	0.041081	2.000000e-02	0.030000																										0				57						c.(1747-1749)Cgg>Tgg		ninein-like							42.0	48.0	46.0					20																	25462667		2202	4300	6502	SO:0001583	missense	22981	4	121200	38				g.chr20:25462667G>A		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1747C>T	chr20.hg19:g.25462667G>A	ENSP00000278886:p.Arg583Trp	0					NINL_ENST00000422516.1_Missense_Mutation_p.R583W	p.R583W	NM_025176.4	NP_079452.3	1	2	3	2.231308	Q9Y2I6	NINL_HUMAN		14	1820	-			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	0	1	hg19	c.1747C>T	CCDS33452.1	0	.	.	.	.	.	.	.	.	.	.	G	12.92	2.083873	0.36758	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.34859	1.58;1.34	4.73	-5.11	0.02901	4.730000	-5.110000	0.029010	.	2.414770	0.01809	N	0.033350	T	0.27765	0.0683	L	0.46741	1.465	0.09310	N	1	B;B	0.26147	0.143;0.001	B;B	0.15484	0.013;0.0	T	0.25433	-1.0132	10	0.51188	T	0.08	-6.8188	5.0826	0.14664	0.3951:0.0:0.3319:0.273	.	583;583	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	W	583	ENSP00000278886:R583W;ENSP00000410431:R583W	ENSP00000278886:R583W	R	-	1	2	2	NINL	25410667	25410667	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.540000	0.06106	-0.682000	0.05197	0.555000	0.69702	CGG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.692	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	0	0	1	2	2	2	2	0	0	0	0	166	166	166	166	1	1.770000	-3.201131	1	0.740000	NM_025176		0	6	6	0	577	573	0		1	0		0	0	166	0	0	0.964371	6.775956e-03	0	0	0	10	0	6	577
TOX2	84969	broad.mit.edu	37	20	42694515	42694515	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr20:42694515G>A	ENST00000358131.5	+	6	1278	c.1070G>A	c.(1069-1071)cGg>cAg	p.R357Q	TOX2_ENST00000423191.2_Missense_Mutation_p.R333Q|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000372999.1_Missense_Mutation_p.R333Q|TOX2_ENST00000341197.4_Missense_Mutation_p.R375Q	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	357					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			AGCCTCGCCCGGACGCTGGGC	0.706																																						ENST00000358131.5	1.000000	8.400000e-01	1.000000	9.000000e-01	9.500000e-01	0.954210	9.500000e-01	1.000000																										0				26						c.(1069-1071)cGg>cAg		TOX high mobility group box family member 2							41.0	46.0	44.0					20																	42694515		2203	4298	6501	SO:0001583	missense	84969	9	121170	41				g.chr20:42694515G>A	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1070G>A	chr20.hg19:g.42694515G>A	ENSP00000350849:p.Arg357Gln	0					TOX2_ENST00000372999.1_Missense_Mutation_p.R333Q|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000341197.4_Missense_Mutation_p.R375Q|TOX2_ENST00000423191.2_Missense_Mutation_p.R333Q	p.R357Q	NM_001098798.1	NP_001092268.1	1	2	3	2.231308	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)	6	1278	+		Myeloproliferative disorder(115;0.00452)	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	1	1	hg19	c.1070G>A	CCDS42875.1	1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536841	0.45176	.	.	ENSG00000124191	ENST00000341197;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864	T;T;T;T;T	0.14766	2.72;2.73;2.73;2.57;2.48	5.11	4.16	0.48862	5.110000	4.160000	0.488620	.	0.000000	0.39687	N	0.001299	T	0.22003	0.0530	L	0.37850	1.14	0.45946	D	0.998777	D;D;D;D	0.76494	0.997;0.999;0.999;0.999	D;D;D;D	0.77557	0.968;0.99;0.978;0.978	T	0.03576	-1.1023	10	0.07325	T	0.83	.	12.5979	0.56481	0.0818:0.0:0.9182:0.0	.	253;375;357;333	B4DQV8;G3XAC7;Q96NM4;E1P5X0	.;.;TOX2_HUMAN;.	Q	375;333;333;357;253	ENSP00000344724:R375Q;ENSP00000390278:R333Q;ENSP00000362090:R333Q;ENSP00000350849:R357Q;ENSP00000396777:R253Q	ENSP00000344724:R375Q	R	+	2	0	0	TOX2	42127929	42127929	1.000000	0.71417	0.998000	0.56505	0.161000	0.22273	5.322000	0.65852	1.282000	0.44496	-0.136000	0.14681	CGG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.706	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2	1	0	1	2	2	2	2	0	0	0	0	140	140	140	136	1	1.770000	-19.060080	1	0.740000			0	190	188	0	348	342	1		1	0		0	0	140	0	0	1.000000	0	0	0	0	1	0	190	348
TSHZ2	128553	broad.mit.edu	37	20	51871857	51871857	+	Silent	SNP	C	C	T	rs143642849		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr20:51871857C>T	ENST00000371497.5	+	2	2747	c.1860C>T	c.(1858-1860)caC>caT	p.H620H	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Silent_p.H617H|TSHZ2_ENST00000603338.2_Silent_p.H617H	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	620					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAAGTCCCCACGAAGAGGCCT	0.517																																						ENST00000371497.5	1.000000	8.000000e-01	0.970000	8.500000e-01	9.000000e-01	0.912890	9.000000e-01	0.910000																										0				84						c.(1858-1860)caC>caT		teashirt zinc finger homeobox 2							78.0	81.0	80.0					20																	51871857		2203	4300	6503	SO:0001819	synonymous_variant	128553	2	121412	37				g.chr20:51871857C>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1860C>T	chr20.hg19:g.51871857C>T		0					TSHZ2_ENST00000603338.2_Silent_p.H617H|TSHZ2_ENST00000329613.6_Silent_p.H617H|RP4-678D15.1_ENST00000606932.1_RNA	p.H620H	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	1	2	3	2.231308	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)	2	2747	+			B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	1	1	hg19	c.1860C>T	CCDS33490.1	1																																																																																								0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.517	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	1	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	1.770000	-20.000000	1	0.740000	NM_173485		0	189	185	0	375	369	0		1	1		0	0	95	0	0	1.000000	9.858197e-01	0	5	0	11	0	189	375
COL20A1	57642	broad.mit.edu	37	20	61929336	61929336	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr20:61929336G>A	ENST00000358894.6	+	3	257	c.157G>A	c.(157-159)Ggc>Agc	p.G53S	COL20A1_ENST00000326996.6_Missense_Mutation_p.G53S|COL20A1_ENST00000435874.1_Missense_Mutation_p.G53S|COL20A1_ENST00000422202.1_Missense_Mutation_p.G53S	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	53	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GGAGGGGAGCGGCCTCGGCTA	0.632																																						ENST00000358894.6	0.140000	2.000000e-02	0.100000	4.000000e-02	6.000000e-02	0.080684	6.000000e-02	0.060000																										0				36						c.(157-159)Ggc>Agc		collagen, type XX, alpha 1							41.0	52.0	48.0					20																	61929336		2031	4164	6195	SO:0001583	missense	57642	1	120818	32				g.chr20:61929336G>A	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.157G>A	chr20.hg19:g.61929336G>A	ENSP00000351767:p.Gly53Ser	0					COL20A1_ENST00000422202.1_Missense_Mutation_p.G53S|COL20A1_ENST00000435874.1_Missense_Mutation_p.G53S|COL20A1_ENST00000326996.6_Missense_Mutation_p.G53S	p.G53S	NM_020882.2	NP_065933.2	1	2	3	2.231308	Q9P218	COKA1_HUMAN		3	257	+	all_cancers(38;1.39e-10)		Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	0	1	hg19	c.157G>A	CCDS46628.1	0	.	.	.	.	.	.	.	.	.	.	G	2.312	-0.357702	0.05138	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	3.95	-1.67	0.08238	3.950000	-1.670000	0.082380	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.543240	0.18383	N	0.142918	T	0.27933	0.0688	N	0.14661	0.345	0.09310	N	1	B	0.21309	0.054	B	0.15484	0.013	T	0.17137	-1.0379	10	0.21014	T	0.42	.	8.946	0.35758	0.8054:0.0:0.1946:0.0	.	53	Q9P218	COKA1_HUMAN	S	53	ENSP00000351767:G53S;ENSP00000323077:G53S;ENSP00000408690:G53S;ENSP00000414753:G53S	ENSP00000323077:G53S	G	+	1	0	0	COL20A1	61399781	61399781	0.000000	0.05858	0.057000	0.19452	0.005000	0.04900	0.036000	0.13819	-0.160000	0.11002	-0.229000	0.12294	GGC	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.632	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	0	0	1	2	2	2	2	0	0	0	0	115	115	115	113	1	1.770000	-3.730716	1	0.740000	NM_020882		0	7	6	0	295	290	0		1			0	0	115	0	0	0.979507	0	0	0	0	0	0	7	295
TPTE	7179	broad.mit.edu	37	21	10969096	10969096	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr21:10969096C>T	ENST00000361285.4	-	7	481	c.152G>A	c.(151-153)cGg>cAg	p.R51Q	TPTE_ENST00000342420.5_Intron|TPTE_ENST00000415664.2_Intron|TPTE_ENST00000298232.7_Intron	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	51					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGGTGACACCCGGGCTGCTCC	0.453																																						ENST00000361285.4	1.000000	5.300000e-01	0.680000	5.700000e-01	6.100000e-01	0.660918	6.100000e-01	0.610000																										0				130						c.(151-153)cGg>cAg		transmembrane phosphatase with tensin homology							234.0	220.0	225.0					21																	10969096		2203	4300	6503	SO:0001583	missense	7179	22	121412	43				g.chr21:10969096C>T	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.152G>A	chr21.hg19:g.10969096C>T	ENSP00000355208:p.Arg51Gln	0					TPTE_ENST00000298232.7_Intron|TPTE_ENST00000342420.5_Intron|TPTE_ENST00000415664.2_Intron	p.R51Q	NM_199261.2	NP_954870	0	2	2	1.924057	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	7	481	-			B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	1	1	hg19	c.152G>A	CCDS13560.2	0	.	.	.	.	.	.	.	.	.	.	A	4.078	0.012302	0.07912	.	.	ENSG00000166157	ENST00000361285;ENST00000328758	D	0.94687	-3.49	0.558	-1.12	0.09808	0.558000	-1.120000	0.098080	.	0.602094	0.13783	U	0.363084	T	0.81880	0.4916	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.63484	-0.6627	9	0.21540	T	0.41	5.8346	.	.	.	.	51	P56180	TPTE_HUMAN	Q	51;33	ENSP00000355208:R51Q	ENSP00000399471:R33Q	R	-	2	0	0	TPTE	9990967	9990967	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.181000	0.01257	-2.672000	0.00413	-2.396000	0.00226	CGG	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.453	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1	1	0	1	2	2	2	2	0	0	0	0	163	163	163	163	1	1.770000	-4.869643	1	0.740000			0	195	186	0	668	551	1		1			0	0	163	0	0	1.000000	0	0	0	0	0	0	195	668
DYRK1A	1859	broad.mit.edu	37	21	38877757	38877757	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr21:38877757T>A	ENST00000398960.2	+	9	1486	c.1411T>A	c.(1411-1413)Tat>Aat	p.Y471N	DYRK1A_ENST00000455387.2_Missense_Mutation_p.Y243N|DYRK1A_ENST00000398956.2_Missense_Mutation_p.Y471N|DYRK1A_ENST00000321219.8_Missense_Mutation_p.Y471N|DYRK1A_ENST00000338785.3_Missense_Mutation_p.Y471N|DYRK1A_ENST00000451934.1_Missense_Mutation_p.Y471N|DYRK1A_ENST00000339659.4_Missense_Mutation_p.Y462N	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AATTCAACCTTATTATGCTCT	0.438																																					Melanoma(114;464 1602 31203 43785 45765)	ENST00000398960.2	0.050000	0	0.030000	0	1.000000e-02	0.024238	1.000000e-02	0.020000																										0				42						c.(1411-1413)Tat>Aat		dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A							111.0	111.0	111.0					21																	38877757		2203	4300	6503	SO:0001583	missense	1859	0	0					g.chr21:38877757T>A	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1411T>A	chr21.hg19:g.38877757T>A	ENSP00000381932:p.Tyr471Asn	1					DYRK1A_ENST00000339659.4_Missense_Mutation_p.Y462N|DYRK1A_ENST00000398956.2_Missense_Mutation_p.Y471N|DYRK1A_ENST00000455387.2_Missense_Mutation_p.Y243N|DYRK1A_ENST00000338785.3_Missense_Mutation_p.Y471N|DYRK1A_ENST00000451934.1_Missense_Mutation_p.Y471N|DYRK1A_ENST00000321219.8_Missense_Mutation_p.Y471N	p.Y471N	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	0	1	1	1.505428	Q13627	DYR1A_HUMAN		9	1486	+			O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	0	1	hg19	c.1411T>A	CCDS42925.1	0	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024460	0.54683	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.83	5.83	0.93111	5.830000	5.830000	0.931110	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.120768	0.64402	D	0.000014	T	0.42899	0.1223	N	0.02685	-0.53	0.80722	D	1	B;B;B;B;B	0.26845	0.005;0.005;0.161;0.133;0.005	B;B;B;B;B	0.30179	0.035;0.035;0.112;0.068;0.035	T	0.49163	-0.8968	10	0.66056	D	0.02	.	16.1946	0.82018	0.0:0.0:0.0:1.0	.	471;471;471;462;471	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	N	471;462;471;471;471;471;243	ENSP00000342690:Y471N;ENSP00000340373:Y462N;ENSP00000319032:Y471N;ENSP00000416089:Y471N;ENSP00000381932:Y471N;ENSP00000381929:Y471N;ENSP00000407854:Y243N	ENSP00000319032:Y471N	Y	+	1	0	0	DYRK1A	37799627	37799627	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	7.977000	0.88081	2.228000	0.72767	0.528000	0.53228	TAT	0.592093		TCGA-IB-A5SP-01A-11D-A32N-08	0.438	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	0	0	0	2	2	2	2	0	0	0	0	110	110	110	108	1	1.770000	-5.377386	1	0.740000	NM_001396		0	5	4	0	417	417	0		1	0		0	0	110	0	0	0.937502	2.084297e-02	0	0	0	15	0	5	417
SLC19A1	6573	broad.mit.edu	37	21	46951654	46951654	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr21:46951654C>T	ENST00000311124.4	-	3	750	c.598G>A	c.(598-600)Gcc>Acc	p.A200T	SLC19A1_ENST00000380010.4_Missense_Mutation_p.A200T|SLC19A1_ENST00000485649.2_Missense_Mutation_p.A160T|SLC19A1_ENST00000567670.1_Missense_Mutation_p.A200T	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	200					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	AGGAAGAGGGCGAGGACCACG	0.647																																						ENST00000311124.4	1.000000	7.500000e-01	0.970000	8.200000e-01	9.000000e-01	0.901602	9.000000e-01	0.930000																										0				10						c.(598-600)Gcc>Acc		solute carrier family 19 (folate transporter), member 1	Methotrexate(DB00563)|Pralatrexate(DB06813)						57.0	48.0	51.0					21																	46951654		2200	4299	6499	SO:0001583	missense	6573	2	121298	23				g.chr21:46951654C>T	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.598G>A	chr21.hg19:g.46951654C>T	ENSP00000308895:p.Ala200Thr	1					SLC19A1_ENST00000567670.1_Missense_Mutation_p.A200T|SLC19A1_ENST00000485649.2_Missense_Mutation_p.A160T|SLC19A1_ENST00000380010.4_Missense_Mutation_p.A200T	p.A200T	NM_194255.2	NP_919231.1	0	1	1	1.452635	P41440	S19A1_HUMAN		3	750	-			B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000311124.4	1	1	hg19	c.598G>A	CCDS13725.1	1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.510194	0.44660	.	.	ENSG00000173638	ENST00000311124;ENST00000380010;ENST00000485649	T;T;T	0.81330	-1.48;-1.48;-1.48	4.62	-5.28	0.02755	4.620000	-5.280000	0.027550	Major facilitator superfamily domain, general substrate transporter (1);	0.404697	0.27544	N	0.018889	T	0.60830	0.2299	L	0.35288	1.05	0.25111	N	0.990718	P;P;B;P	0.35481	0.504;0.504;0.262;0.504	B;B;B;B	0.33960	0.173;0.058;0.019;0.032	T	0.55029	-0.8204	10	0.33940	T	0.23	-15.7351	5.7407	0.18092	0.2584:0.1321:0.0:0.6095	.	160;222;200;200	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	T	200;200;160	ENSP00000308895:A200T;ENSP00000369347:A200T;ENSP00000441772:A160T	ENSP00000308895:A200T	A	-	1	0	0	SLC19A1	45776082	45776082	0.012000	0.17670	0.172000	0.22920	0.879000	0.50718	-0.237000	0.08990	-0.965000	0.03591	0.306000	0.20318	GCC	0.587302		TCGA-IB-A5SP-01A-11D-A32N-08	0.647	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	1.770000	-20.000000	1	0.740000			0	54	53	0	44	44	0		1	1		0	0	47	0	0	1.000000	8.628921e-01	0	4	0	1	0	54	44
HIRA	7290	broad.mit.edu	37	22	19365576	19365576	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr22:19365576C>T	ENST00000263208.5	-	14	1685	c.1429G>A	c.(1429-1431)Gca>Aca	p.A477T	HIRA_ENST00000546308.1_Missense_Mutation_p.A433T|HIRA_ENST00000340170.4_Missense_Mutation_p.A477T|HIRA_ENST00000541063.1_Missense_Mutation_p.A433T	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	477	Interaction with ASF1A.|Interaction with CCNA1.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					TTAAAGAATGCCGTGGAGAAG	0.488																																						ENST00000263208.5	0.060000	0	0.040000	1.000000e-02	2.000000e-02	0.030412	2.000000e-02	0.030000																										0				37						c.(1429-1431)Gca>Aca		histone cell cycle regulator							80.0	92.0	88.0					22																	19365576		2203	4300	6503	SO:0001583	missense	7290	0	0					g.chr22:19365576C>T	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1429G>A	chr22.hg19:g.19365576C>T	ENSP00000263208:p.Ala477Thr	1					HIRA_ENST00000340170.4_Missense_Mutation_p.A477T|HIRA_ENST00000541063.1_Missense_Mutation_p.A433T|HIRA_ENST00000546308.1_Missense_Mutation_p.A433T	p.A477T	NM_003325.3	NP_003316.3	0	1	1	1.494306	P54198	HIRA_HUMAN		14	1685	-	Colorectal(54;0.0993)		Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	0	1	hg19	c.1429G>A	CCDS13759.1	0	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030001	0.93575	.	.	ENSG00000100084	ENST00000340170;ENST00000263208;ENST00000541063;ENST00000546308	T;T;T;T	0.72282	-0.4;-0.64;-0.48;-0.46	5.28	5.28	0.74379	5.280000	5.280000	0.743790	.	0.000000	0.85682	D	0.000000	T	0.75845	0.3905	L	0.29908	0.895	0.80722	D	1	D;D;P	0.67145	0.974;0.996;0.956	P;D;P	0.79784	0.647;0.993;0.549	T	0.69228	-0.5200	10	0.16896	T	0.51	-16.2298	19.1181	0.93350	0.0:1.0:0.0:0.0	.	433;477;477	F5H4M2;P54198-2;P54198	.;.;HIRA_HUMAN	T	477;477;433;433	ENSP00000345350:A477T;ENSP00000263208:A477T;ENSP00000446073:A433T;ENSP00000441870:A433T	ENSP00000263208:A477T	A	-	1	0	0	HIRA	17745576	17745576	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.297000	0.72757	2.756000	0.94617	0.655000	0.94253	GCA	0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.488	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	1.770000	-2.013891	0	0.740000	NM_003325		0	5	5	0	330	327	0		1	0		0	0	115	0	0	0.936510	1.890112e-01	0	0	0	44	0	5	330
MED15	51586	broad.mit.edu	37	22	20929453	20929453	+	Silent	SNP	G	G	A	rs201830458		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr22:20929453G>A	ENST00000263205.7	+	9	1275	c.1206G>A	c.(1204-1206)ccG>ccA	p.P402P	MED15_ENST00000478831.1_Intron|MED15_ENST00000292733.7_Intron|MED15_ENST00000541476.1_Intron|MED15_ENST00000425759.2_Intron|MED15_ENST00000382974.2_Intron|MED15_ENST00000406969.1_Intron|MED15_ENST00000542773.1_Intron	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	402	Pro-rich.				gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CCCGGTTCCCGCCTACCACCG	0.597																																						ENST00000263205.7	0.060000	0	0.040000	1.000000e-02	2.000000e-02	0.031425	2.000000e-02	0.030000																										0				25						c.(1204-1206)ccG>ccA		mediator complex subunit 15							115.0	100.0	105.0					22																	20929453		2203	4300	6503	SO:0001819	synonymous_variant	51586	0	0					g.chr22:20929453G>A	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1206G>A	chr22.hg19:g.20929453G>A		1					MED15_ENST00000382974.2_Intron|MED15_ENST00000542773.1_Intron|MED15_ENST00000406969.1_Intron|MED15_ENST00000292733.7_Intron|MED15_ENST00000478831.1_Intron|MED15_ENST00000425759.2_Intron|MED15_ENST00000541476.1_Intron	p.P402P	NM_001003891.1	NP_001003891.1	0	1	1	1.494306	Q96RN5	MED15_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)	9	1275	+	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Silent	SNP	ENST00000263205.7	0	1	hg19	c.1206G>A	CCDS33602.1	0																																																																																								0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.597	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	0	0	1	2	2	2	2	0	0	0	0	131	131	131	131	1	1.770000	-2.466742	0	0.740000	NM_015889		0	6	6	0	373	372	0		1	0		0	0	131	0	0	0.964991	1.100247e-01	0	0	0	30	0	6	373
MGAT5	4249	broad.mit.edu	37	2	135012053	135012053	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:135012053A>G	ENST00000409645.1	+	2	331	c.79A>G	c.(79-81)Atg>Gtg	p.M27V	MGAT5_ENST00000281923.2_Missense_Mutation_p.M27V|MGAT5_ENST00000468758.1_3'UTR			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	27					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CATTTGGGGTATGATGCTTCT	0.522																																						ENST00000409645.1	1.000000	8.000000e-01	1.000000	8.900000e-01	9.800000e-01	0.957723	9.800000e-01	1.000000																										0				36						c.(79-81)Atg>Gtg		mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase							130.0	111.0	118.0					2																	135012053		2203	4300	6503	SO:0001583	missense	4249	0	0					g.chr2:135012053A>G	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.79A>G	chr2.hg19:g.135012053A>G	ENSP00000386377:p.Met27Val	0					MGAT5_ENST00000468758.1_3'UTR|MGAT5_ENST00000281923.2_Missense_Mutation_p.M27V	p.M27V			1	2	3	2.252328	Q09328	MGT5A_HUMAN		2	331	+			D3DP70	Missense_Mutation	SNP	ENST00000409645.1	1	1	hg19	c.79A>G	CCDS2171.1	1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.435716	0.62955	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	4.88	4.88	0.63580	4.880000	4.880000	0.635800	.	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	L	0.38531	1.155	0.80722	D	1	P	0.43578	0.811	P	0.60789	0.879	T	0.56541	-0.7962	9	0.16420	T	0.52	-29.1494	14.9292	0.70903	1.0:0.0:0.0:0.0	.	27	Q09328	MGT5A_HUMAN	V	27	.	ENSP00000281923:M27V	M	+	1	0	0	MGAT5	134728523	134728523	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	9.087000	0.94110	2.162000	0.67917	0.528000	0.53228	ATG	0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.522	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.770000	-20.000000	1	0.740000	NM_002410		0	75	74	0	134	134	1		1	1		0	0	29	0	0	1.000000	9.998141e-01	0	12	0	15	0	75	134
SCN2A	6326	broad.mit.edu	37	2	166171996	166171996	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:166171996G>A	ENST00000375437.2	+	11	1689	c.1399G>A	c.(1399-1401)Gca>Aca	p.A467T	SCN2A_ENST00000375427.2_Missense_Mutation_p.A467T|SCN2A_ENST00000283256.6_Missense_Mutation_p.A467T|SCN2A_ENST00000357398.3_Missense_Mutation_p.A467T	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	467					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCTGCAGCCGCATCTGCTGA	0.408																																						ENST00000375437.2	1.000000	2.000000e-02	0.100000	4.000000e-02	6.000000e-02	0.102194	6.000000e-02	0.070000																										0				118						c.(1399-1401)Gca>Aca		sodium channel, voltage-gated, type II, alpha subunit	Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)						59.0	66.0	64.0					2																	166171996		2203	4299	6502	SO:0001583	missense	6326	4	121412	39				g.chr2:166171996G>A	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1399G>A	chr2.hg19:g.166171996G>A	ENSP00000364586:p.Ala467Thr	0					SCN2A_ENST00000357398.3_Missense_Mutation_p.A467T|SCN2A_ENST00000375427.2_Missense_Mutation_p.A467T|SCN2A_ENST00000283256.6_Missense_Mutation_p.A467T	p.A467T	NM_001040142.1	NP_001035232.1	1	2	3	2.252328	Q99250	SCN2A_HUMAN		11	1689	+			A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	0	1	hg19	c.1399G>A	CCDS33314.1	0	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650394	0.29336	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.96427	-4.01;-3.95;-3.95;-3.95;-3.95	5.9	5.02	0.67125	5.900000	5.020000	0.671250	.	0.539045	0.18025	N	0.154104	D	0.93360	0.7883	L	0.40543	1.245	0.49483	D	0.999793	B;B	0.21520	0.055;0.057	B;B	0.19666	0.026;0.013	D	0.90222	0.4272	10	0.21540	T	0.41	.	15.0639	0.71977	0.0677:0.0:0.9323:0.0	.	467;467	Q99250-2;Q99250	.;SCN2A_HUMAN	T	467	ENSP00000406454:A467T;ENSP00000364586:A467T;ENSP00000349973:A467T;ENSP00000283256:A467T;ENSP00000364576:A467T	ENSP00000283256:A467T	A	+	1	0	0	SCN2A	165880242	165880242	0.994000	0.37717	0.746000	0.31095	0.313000	0.28021	3.124000	0.50461	1.496000	0.48567	0.650000	0.86243	GCA	0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.408	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	0	0	1	2	27	2	2	1	1	1	1	45	45	45	45	1	1.770000	-2.871021	1	0.740000	NM_021007		0	11	11	0	422	417	0		0			1	0	45	0	0	0.005237	0	0	0	0	0	0	11	422
TTN	7273	broad.mit.edu	37	2	179436286	179436286	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:179436286A>T	ENST00000591111.1	-	276	69874	c.69650T>A	c.(69649-69651)aTt>aAt	p.I23217N	TTN_ENST00000589042.1_Missense_Mutation_p.I24858N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I22290N|TTN_ENST00000342175.6_Missense_Mutation_p.I15985N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I15918N|TTN_ENST00000460472.2_Missense_Mutation_p.I15793N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23217	Fibronectin type-III 68. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTGATACAATTTGCCAGGT	0.418																																						ENST00000591111.1	1.000000	6.900000e-01	0.990000	7.800000e-01	8.800000e-01	0.882675	8.800000e-01	1.000000																										0				1448						c.(69649-69651)aTt>aAt		titin							86.0	75.0	79.0					2																	179436286		1877	4115	5992	SO:0001583	missense	7273	0	0					g.chr2:179436286A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.69650T>A	chr2.hg19:g.179436286A>T	ENSP00000465570:p.Ile23217Asn	0					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I22290N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I15793N|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I24858N|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I15985N|TTN_ENST00000359218.5_Missense_Mutation_p.I15918N|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.I23217N			1	2	3	2.252328	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	69874	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.69650T>A		1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.674275	0.29693	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	5.93	5.93	0.95920	5.930000	5.930000	0.959200	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53786	0.1818	N	0.14661	0.345	0.51482	D	0.999922	D;D;D;D	0.58970	0.984;0.984;0.984;0.97	P;P;P;P	0.58331	0.837;0.837;0.837;0.828	T	0.61535	-0.7043	9	0.87932	D	0	.	16.3709	0.83357	1.0:0.0:0.0:0.0	.	15793;15918;15985;23217	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	22290;15793;15985;15918;15791	ENSP00000343764:I22290N;ENSP00000434586:I15793N;ENSP00000340554:I15985N;ENSP00000352154:I15918N	ENSP00000340554:I15985N	I	-	2	0	0	TTN	179144532	179144532	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.251000	0.78297	2.261000	0.74972	0.528000	0.53228	ATT	0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.770000	-20.000000	1	0.740000	NM_133378		0	54	54	0	114	113	1		1			0	0	19	0	0	1.000000	0	0	0	0	0	0	54	114
POMC	5443	broad.mit.edu	37	2	25387630	25387630	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:25387630C>T	ENST00000405623.1	-	2	467	c.12G>A	c.(10-12)tcG>tcA	p.S4S	POMC_ENST00000380794.1_Silent_p.S4S|POMC_ENST00000395826.2_Silent_p.S4S|POMC_ENST00000264708.3_Silent_p.S4S			P01189	COLI_HUMAN	proopiomelanocortin	4					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	GGCTGCAGCACGATCTCGGCA	0.607																																					Colon(110;1515 1566 8452 10082 43216)	ENST00000405623.1	1.000000	0	0.080000	2.000000e-02	4.000000e-02	0.087339	4.000000e-02	0.040000																										0				12						c.(10-12)tcG>tcA		proopiomelanocortin	Loperamide(DB00836)						37.0	40.0	39.0					2																	25387630		2201	4299	6500	SO:0001819	synonymous_variant	5443	1	121412	30				g.chr2:25387630C>T		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.12G>A	chr2.hg19:g.25387630C>T		0					POMC_ENST00000264708.3_Silent_p.S4S|POMC_ENST00000395826.2_Silent_p.S4S|POMC_ENST00000380794.1_Silent_p.S4S	p.S4S			1	2	3	2.261196	P01189	COLI_HUMAN		2	467	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		P78442|Q53T23|Q9UD39|Q9UD40	Silent	SNP	ENST00000405623.1	0	1	hg19	c.12G>A	CCDS1717.1	0																																																																																								0.744723		TCGA-IB-A5SP-01A-11D-A32N-08	0.607	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	1.770000	-6.192198	1	0.740000	NM_001035256		0	6	6	0	367	363	0		1	0		0	0	73	0	0	0.964100	0	0	0	0	1	0	6	367
DPYSL5	56896	broad.mit.edu	37	2	27121503	27121503	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:27121503G>A	ENST00000288699.6	+	2	294	c.136G>A	c.(136-138)Ggc>Agc	p.G46S	DPYSL5_ENST00000401478.1_Missense_Mutation_p.G46S	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	46					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGATCCCTGGCGGGGCCAA	0.587																																						ENST00000288699.6	1.000000	0	0.070000	1.000000e-02	3.000000e-02	0.078814	3.000000e-02	0.040000																										0				27						c.(136-138)Ggc>Agc		dihydropyrimidinase-like 5							99.0	84.0	89.0					2																	27121503		2203	4300	6503	SO:0001583	missense	56896	0	0					g.chr2:27121503G>A	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.136G>A	chr2.hg19:g.27121503G>A	ENSP00000288699:p.Gly46Ser	0					DPYSL5_ENST00000401478.1_Missense_Mutation_p.G46S	p.G46S	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	1	2	3	2.261196	Q9BPU6	DPYL5_HUMAN		2	294	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	0	1	hg19	c.136G>A	CCDS1730.1	0	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728087	0.89390	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	T;D;D;T;T	0.85258	-1.06;-1.96;-1.96;-1.06;-1.06	4.85	4.85	0.62838	4.850000	4.850000	0.628380	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	T	0.79003	0.4373	L	0.33485	1.01	0.58432	D	0.999992	B	0.30937	0.301	B	0.28139	0.086	T	0.77253	-0.2656	10	0.37606	T	0.19	-13.6077	17.1086	0.86669	0.0:0.0:1.0:0.0	.	46	Q9BPU6	DPYL5_HUMAN	S	46	ENSP00000407174:G46S;ENSP00000288699:G46S;ENSP00000385549:G46S;ENSP00000399581:G46S;ENSP00000413075:G46S	ENSP00000288699:G46S	G	+	1	0	0	DPYSL5	26975007	26975007	1.000000	0.71417	0.504000	0.27639	0.986000	0.74619	9.333000	0.96459	2.403000	0.81681	0.561000	0.74099	GGC	0.744723		TCGA-IB-A5SP-01A-11D-A32N-08	0.587	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	0	0	1	2	2	2	2	0	0	0	0	63	63	63	62	1	1.770000	-4.889804	1	0.740000	NM_020134		0	4	4	0	315	311	0		1			0	0	63	0	0	0.888013	0	0	0	0	0	0	4	315
ASB18	401036	broad.mit.edu	37	2	237103689	237103689	+	Silent	SNP	C	C	T	rs201896139		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr2:237103689C>T	ENST00000409749.3	-	6	1226	c.1227G>A	c.(1225-1227)ccG>ccA	p.P409P	AC079135.1_ENST00000483218.1_RNA|AC079135.1_ENST00000415226.1_RNA|ASB18_ENST00000330842.6_Silent_p.P380P	NM_212556.2	NP_997721.2	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box containing 18	409	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					large_intestine(1)|lung(3)|ovary(1)|prostate(1)	6		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		ACTGGTAGAACGGCTTGTGCA	0.542																																						ENST00000409749.3	1.000000	7.700000e-01	1.000000	8.700000e-01	9.700000e-01	0.948228	9.700000e-01	1.000000																										0				6						c.(1225-1227)ccG>ccA		ankyrin repeat and SOCS box containing 18		C		0,4234		0,0,2117	59.0	73.0	68.0		1227	-6.2	0.1	2		68	3,8487		0,3,4242	yes	coding-synonymous	ASB18	NM_212556.2		0,3,6359	TT,TC,CC		0.0353,0.0,0.0236		409/467	237103689	3,12721	2117	4245	6362	SO:0001819	synonymous_variant	401036	1	121092	38				g.chr2:237103689C>T	AK123854	CCDS46548.1	2q37.2	2013-01-10	2011-01-25		ENSG00000182177	ENSG00000182177		"""Ankyrin repeat domain containing"""	19770	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 18"""			12076535	Standard	NM_212556		Approved		uc010znh.2	Q6ZVZ8	OTTHUMG00000153086	ENST00000409749.3:c.1227G>A	chr2.hg19:g.237103689C>T		0					ASB18_ENST00000330842.6_Silent_p.P380P|AC079135.1_ENST00000415226.1_RNA|AC079135.1_ENST00000483218.1_RNA	p.P409P	NM_212556.2	NP_997721.2	1	2	3	2.221947	Q6ZVZ8	ASB18_HUMAN		6	1226	-		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)	B6ZDL7	Silent	SNP	ENST00000409749.3	1	1	hg19	c.1227G>A	CCDS46548.1	1																																																																																								0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.542	ASB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329436.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	1.770000	-20.000000	1	0.740000	NM_212556		0	56	55	0	100	99	1		1			0	0	34	0	0	1.000000	0	0	0	0	0	0	56	100
MCF2L2	23101	broad.mit.edu	37	3	183027561	183027561	+	Silent	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr3:183027561G>A	ENST00000328913.3	-	10	1353	c.1056C>T	c.(1054-1056)agC>agT	p.S352S	MCF2L2_ENST00000447025.2_Silent_p.S352S|MCF2L2_ENST00000473233.1_Silent_p.S352S|MCF2L2_ENST00000414362.2_Silent_p.S352S	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	352							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CGTGCATCACGCTGTCTCCAA	0.448																																						ENST00000328913.3	0.110000	2.000000e-02	0.090000	4.000000e-02	6.000000e-02	0.067680	6.000000e-02	0.060000																										0				72						c.(1054-1056)agC>agT		MCF.2 cell line derived transforming sequence-like 2							140.0	129.0	133.0					3																	183027561		2203	4300	6503	SO:0001819	synonymous_variant	23101	3	121412	36				g.chr3:183027561G>A	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1056C>T	chr3.hg19:g.183027561G>A		1					MCF2L2_ENST00000473233.1_Silent_p.S352S|MCF2L2_ENST00000414362.2_Silent_p.S352S|MCF2L2_ENST00000447025.2_Silent_p.S352S	p.S352S	NM_015078.2	NP_055893	0	1	1	1.954591	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)	10	1353	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent	SNP	ENST00000328913.3	1	1	hg19	c.1056C>T	CCDS3243.1	0																																																																																								0.700046		TCGA-IB-A5SP-01A-11D-A32N-08	0.448	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	1.770000	-2.872809	1	0.740000	NM_015078		0	11	11	0	402	400	0		1	0		0	0	84	0	0	0.998337	2.650169e-03	0	0	0	3	0	11	402
OSBPL10	114884	broad.mit.edu	37	3	31789494	31789494	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr3:31789494G>A	ENST00000396556.2	-	5	970	c.848C>T	c.(847-849)gCt>gTt	p.A283V	OSBPL10_ENST00000438237.2_Missense_Mutation_p.A219V|OSBPL10_ENST00000467647.1_5'UTR	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	283					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GAGGGTGGCAGCAGAGGTAGC	0.637																																						ENST00000396556.2	0.050000	0	0.040000	0	2.000000e-02	0.026381	2.000000e-02	0.020000																										0				34						c.(847-849)gCt>gTt		oxysterol binding protein-like 10							77.0	72.0	74.0					3																	31789494		2203	4300	6503	SO:0001583	missense	114884	0	0					g.chr3:31789494G>A	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.848C>T	chr3.hg19:g.31789494G>A	ENSP00000379804:p.Ala283Val	1					OSBPL10_ENST00000438237.2_Missense_Mutation_p.A219V|OSBPL10_ENST00000467647.1_5'UTR	p.A283V	NM_017784.4	NP_060254.2	0	1	1	1.952909	Q9BXB5	OSB10_HUMAN		5	970	-			B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	0	1	hg19	c.848C>T	CCDS2651.1	0	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000746	0.74818	.	.	ENSG00000144645	ENST00000396556;ENST00000438237;ENST00000428241	T;T;T	0.45276	0.9;0.9;0.9	5.61	4.74	0.60224	5.610000	4.740000	0.602240	.	0.047989	0.85682	D	0.000000	T	0.62962	0.2471	M	0.74881	2.28	0.50171	D	0.999853	D;P;P	0.89917	1.0;0.949;0.901	D;P;P	0.87578	0.998;0.642;0.49	T	0.62320	-0.6879	10	0.30078	T	0.28	-12.5971	14.4653	0.67480	0.0704:0.0:0.9296:0.0	.	219;283;51	B4E212;Q9BXB5;Q59ED9	.;OSB10_HUMAN;.	V	283;219;91	ENSP00000379804:A283V;ENSP00000406124:A219V;ENSP00000399200:A91V	ENSP00000379804:A283V	A	-	2	0	0	OSBPL10	31764498	31764498	1.000000	0.71417	0.295000	0.24960	0.993000	0.82548	9.459000	0.97638	1.367000	0.46095	0.549000	0.68633	GCT	0.697463		TCGA-IB-A5SP-01A-11D-A32N-08	0.637	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2	0	0	1	2	15	2	2	0	0	0	1	122	122	122	121	1	1.770000	-2.680701	1	0.740000			0	5	5	0	509	504	0		0	0		0	0	122	0	0	0.018499	4.021961e-02	0	0	0	26	0	5	509
RNF123	63891	broad.mit.edu	37	3	49738081	49738081	+	Missense_Mutation	SNP	C	C	T	rs369371695		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr3:49738081C>T	ENST00000327697.6	+	15	1360	c.1216C>T	c.(1216-1218)Cgg>Tgg	p.R406W	RNF123_ENST00000432042.1_Missense_Mutation_p.R260W	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	406					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CCATTACCTGCGGCTCACTAT	0.607																																						ENST00000327697.6	0.050000	0	0.040000	0	1.000000e-02	0.024732	1.000000e-02	0.020000																										0				38						c.(1216-1218)Cgg>Tgg		ring finger protein 123		C	TRP/ARG	0,4406		0,0,2203	114.0	103.0	107.0		1216	3.4	1.0	3		107	1,8599	1.2+/-3.3	0,1,4299	no	missense	RNF123	NM_022064.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	406/1315	49738081	1,13005	2203	4300	6503	SO:0001583	missense	63891	2	121412	38				g.chr3:49738081C>T	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1216C>T	chr3.hg19:g.49738081C>T	ENSP00000328287:p.Arg406Trp	1					RNF123_ENST00000432042.1_Missense_Mutation_p.R260W	p.R406W	NM_022064.3	NP_071347.2	0	1	1	1.952909	Q5XPI4	RN123_HUMAN		15	1360	+			A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	0	1	hg19	c.1216C>T	CCDS33758.1	0	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373157	0.82573	0.0	1.16E-4	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.76060	-0.7;-0.99	5.26	3.38	0.38709	5.260000	3.380000	0.387090	.	0.575264	0.18160	N	0.149820	T	0.68081	0.2962	N	0.19112	0.55	0.80722	D	1	D;D	0.65815	0.995;0.988	P;P	0.50231	0.635;0.513	T	0.68629	-0.5358	10	0.56958	D	0.05	-11.9117	13.28	0.60208	0.2744:0.7256:0.0:0.0	.	260;406	C9J266;Q5XPI4	.;RN123_HUMAN	W	406;406;260	ENSP00000328287:R406W;ENSP00000392443:R260W	ENSP00000328287:R406W	R	+	1	2	2	RNF123	49713085	49713085	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	3.753000	0.55180	0.541000	0.28827	0.561000	0.74099	CGG	0.697463		TCGA-IB-A5SP-01A-11D-A32N-08	0.607	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	0	0	1	2	2	2	2	0	0	0	0	169	169	169	165	1	1.770000	-2.683539	1	0.740000	NM_022064		0	6	6	0	628	616	0		1	0		0	0	169	0	0	0.962973	4.653204e-02	0	0	0	30	0	6	628
PCYT1A	5130	broad.mit.edu	37	3	195965646	195965646	+	Silent	SNP	G	G	A	rs372804569		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr3:195965646G>A	ENST00000292823.2	-	10	1189	c.1017C>T	c.(1015-1017)tcC>tcT	p.S339S	PCYT1A_ENST00000419333.1_Silent_p.S339S|PCYT1A_ENST00000431016.1_Silent_p.S339S	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	339	3 X repeats.				CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	AAGTCTTGCCGGAGAAGGGCC	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		16657	0.0		0.0	False		,,,				2504	0.001					ENST00000292823.2	0.070000	0	0.050000	1.000000e-02	3.000000e-02	0.038766	3.000000e-02	0.030000																										0				18						c.(1015-1017)tcC>tcT		phosphate cytidylyltransferase 1, choline, alpha	Choline(DB00122)|Lamivudine(DB00709)	G		1,4405	2.1+/-5.4	0,1,2202	71.0	73.0	72.0		1017	-1.6	1.0	3		72	0,8600		0,0,4300	no	coding-synonymous	PCYT1A	NM_005017.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		339/368	195965646	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5130	15	121406	43				g.chr3:195965646G>A	L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.1017C>T	chr3.hg19:g.195965646G>A		1					PCYT1A_ENST00000419333.1_Silent_p.S339S|PCYT1A_ENST00000431016.1_Silent_p.S339S	p.S339S	NM_005017.2	NP_005008.2	0	1	1	1.964826	P49585	PCY1A_HUMAN	Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	10	1189	-	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		A9LYK9|D3DXB1|Q86Y88	Silent	SNP	ENST00000292823.2	0	1	hg19	c.1017C>T	CCDS3315.1	0																																																																																								0.701321		TCGA-IB-A5SP-01A-11D-A32N-08	0.607	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	0	0	1	2	15	6	2	1	1	1	1	89	89	89	86	1	1.770000	-2.727133	1	0.740000	NM_005017		0	5	6	0	355	347	0		0	0		1	0	89	0	0	0.017052	9.179977e-03	0	0	0	87	0	5	355
GK2	2712	broad.mit.edu	37	4	80328648	80328648	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr4:80328648G>C	ENST00000358842.3	-	1	724	c.707C>G	c.(706-708)tCt>tGt	p.S236C		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	423					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						GATCTCAGAAGAACTGAAGAC	0.413																																						ENST00000358842.3	0.210000	1.000000e-01	0.190000	1.200000e-01	1.500000e-01	0.158739	1.500000e-01	0.150000																										0				39						c.(706-708)tCt>tGt		glycerol kinase 2							66.0	70.0	69.0					4																	80328648		2203	4300	6503	SO:0001583	missense	2712	0	0					g.chr4:80328648G>C	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.707C>G	chr4.hg19:g.80328648G>C	ENSP00000351706:p.Ser236Cys	1						p.S236C	NM_033214.2	NP_149991.2	0	1	1	1.671928	Q01415	GALK2_HUMAN		1	724	-			Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	1	1	hg19	c.707C>G	CCDS3585.1	0	.	.	.	.	.	.	.	.	.	.	G	5.559	0.287923	0.10513	.	.	ENSG00000196475	ENST00000358842	T	0.58060	0.36	4.57	2.8	0.32819	4.570000	2.800000	0.328190	Carbohydrate kinase, FGGY, N-terminal (1);	0.115441	0.64402	N	0.000010	T	0.53206	0.1782	M	0.71581	2.175	0.58432	D	0.999998	B	0.31290	0.318	B	0.34093	0.175	T	0.57860	-0.7738	10	0.72032	D	0.01	-10.4064	13.132	0.59389	0.0:0.3081:0.6919:0.0	.	236	Q14410	GLPK2_HUMAN	C	236	ENSP00000351706:S236C	ENSP00000351706:S236C	S	-	2	0	0	GK2	80547672	80547672	1.000000	0.71417	0.999000	0.59377	0.136000	0.21042	3.061000	0.49963	0.612000	0.30071	-0.203000	0.12734	TCT	0.630682		TCGA-IB-A5SP-01A-11D-A32N-08	0.413	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	1.770000	-9.428238	1	0.740000	NM_033214		0	29	26	0	328	326	0		1			0	0	73	0	0	1.000000	0	0	0	0	0	0	29	328
C4orf17	84103	broad.mit.edu	37	4	100460491	100460491	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr4:100460491T>C	ENST00000326581.4	+	7	1162	c.800T>C	c.(799-801)gTg>gCg	p.V267A	C4orf17_ENST00000514652.1_Missense_Mutation_p.V267A	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	267										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		AAATCAAAAGTGCTGACCAGA	0.458																																						ENST00000326581.4	0.200000	8.000000e-02	0.170000	1.000000e-01	1.300000e-01	0.140660	1.300000e-01	0.140000																										0				18						c.(799-801)gTg>gCg		chromosome 4 open reading frame 17							85.0	88.0	87.0					4																	100460491		2203	4300	6503	SO:0001583	missense	84103	0	0					g.chr4:100460491T>C	AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.800T>C	chr4.hg19:g.100460491T>C	ENSP00000322582:p.Val267Ala	1					C4orf17_ENST00000514652.1_Missense_Mutation_p.V267A	p.V267A	NM_032149.2	NP_115525.2	0	1	1	1.671928	Q53FE4	CD017_HUMAN		7	1162	+			Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	ENST00000326581.4	1	1	hg19	c.800T>C	CCDS3649.1	0	.	.	.	.	.	.	.	.	.	.	T	10.36	1.329614	0.24167	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.18810	2.21;2.19	5.03	-0.46	0.12175	5.030000	-0.460000	0.121750	.	0.437967	0.19567	N	0.111193	T	0.13841	0.0335	L	0.39898	1.24	0.09310	N	1	B	0.20052	0.041	B	0.19666	0.026	T	0.29731	-1.0002	10	0.20519	T	0.43	-0.8055	7.9028	0.29744	0.0:0.5021:0.0:0.4979	.	267	Q53FE4	CD017_HUMAN	A	267	ENSP00000322582:V267A;ENSP00000427663:V267A	ENSP00000322582:V267A	V	+	2	0	0	C4orf17	100679514	100679514	0.140000	0.22579	0.068000	0.19968	0.002000	0.02628	0.035000	0.13797	0.052000	0.16007	-0.290000	0.09829	GTG	0.630682		TCGA-IB-A5SP-01A-11D-A32N-08	0.458	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	0	0	1	2	16	2	2	1	1	1	1	61	61	61	61	1	1.770000	-7.039774	1	0.740000	NM_032149		0	21	21	0	274	274	0		1			1	0	61	0	0	0.843303	0	0	0	0	0	0	21	274
ADAMTS19	171019	broad.mit.edu	37	5	128983486	128983486	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr5:128983486G>A	ENST00000274487.4	+	12	2028	c.1883G>A	c.(1882-1884)aGg>aAg	p.R628K	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	628	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGTACCAGCAGGACCTCAGCA	0.507																																						ENST00000274487.4	1.000000	9.400000e-01	1.000000	9.900000e-01	9.900000e-01	0.995450	9.900000e-01	1.000000																										0				91						c.(1882-1884)aGg>aAg		ADAM metallopeptidase with thrombospondin type 1 motif, 19							142.0	140.0	141.0					5																	128983486		2203	4300	6503	SO:0001583	missense	171019	0	0					g.chr5:128983486G>A	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1883G>A	chr5.hg19:g.128983486G>A	ENSP00000274487:p.Arg628Lys	0					CTC-575N7.1_ENST00000503616.1_RNA	p.R628K	NM_133638.3	NP_598377.3	2	2	4	2.296524	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	12	2028	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)		Missense_Mutation	SNP	ENST00000274487.4	1	1	hg19	c.1883G>A	CCDS4146.1	1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835992	0.32421	.	.	ENSG00000145808	ENST00000274487	T	0.62232	0.04	4.71	3.84	0.44239	4.710000	3.840000	0.442390	.	0.133374	0.47852	N	0.000212	T	0.32645	0.0836	N	0.04245	-0.25	0.33562	D	0.59748	B	0.06786	0.001	B	0.04013	0.001	T	0.32348	-0.9910	9	.	.	.	.	6.0807	0.19940	0.1582:0.0:0.6875:0.1543	.	628	Q8TE59	ATS19_HUMAN	K	628	ENSP00000274487:R628K	.	R	+	2	0	0	ADAMTS19	129011385	129011385	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.233000	0.43027	1.586000	0.49944	0.650000	0.86243	AGG	0.752805		TCGA-IB-A5SP-01A-11D-A32N-08	0.507	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	1	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.770000	-20.000000	1	0.740000	NM_133638		0	255	255	0	436	433	1		1			0	0	70	0	0	1.000000	0	0	0	0	0	0	255	436
PCDHA1	56147	broad.mit.edu	37	5	140166589	140166589	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr5:140166589C>T	ENST00000504120.2	+	1	714	c.714C>T	c.(712-714)aaC>aaT	p.N238N	PCDHA1_ENST00000378133.3_Silent_p.N238N|PCDHA1_ENST00000394633.3_Silent_p.N238N	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	238	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTAATGATAACGCCCCACTGT	0.488																																						ENST00000504120.2	1.000000	9.500000e-01	1.000000	9.900000e-01	9.900000e-01	0.997039	9.900000e-01	1.000000																										0				70						c.(712-714)aaC>aaT		protocadherin alpha 1							98.0	96.0	96.0					5																	140166589		2203	4300	6503	SO:0001819	synonymous_variant	56147	1	121412	30				g.chr5:140166589C>T	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.714C>T	chr5.hg19:g.140166589C>T		0					PCDHA1_ENST00000378133.3_Silent_p.N238N|PCDHA1_ENST00000394633.3_Silent_p.N238N	p.N238N	NM_018900.2	NP_061723.1	2	2	4	2.296524	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	714	+			O75288|Q9NRT7	Silent	SNP	ENST00000504120.2	1	1	hg19	c.714C>T	CCDS54913.1	1																																																																																								0.752805		TCGA-IB-A5SP-01A-11D-A32N-08	0.488	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	1	0	1	2	2	2	2	0	0	0	0	101	101	101	101	1	1.770000	-20.000000	1	0.740000	NM_018900		0	173	170	0	282	279	1		1	0		0	0	101	0	0	1.000000	0	0	0	0	1	0	173	282
ADAM19	8728	broad.mit.edu	37	5	156915309	156915309	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr5:156915309C>T	ENST00000517905.1	-	21	2558	c.2514G>A	c.(2512-2514)cgG>cgA	p.R838R	ADAM19_ENST00000394020.1_Silent_p.R840R|ADAM19_ENST00000430702.2_Silent_p.R571R|ADAM19_ENST00000257527.4_Silent_p.R838R			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	838					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGGAATTGGCCGGCTTGGAG	0.567																																						ENST00000517905.1	1.000000	0	0.030000	0	1.000000e-02	0.076948	1.000000e-02	0.020000																										0				53						c.(2512-2514)cgG>cgA		ADAM metallopeptidase domain 19							92.0	98.0	96.0					5																	156915309		2203	4300	6503	SO:0001819	synonymous_variant	8728	0	0					g.chr5:156915309C>T	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2514G>A	chr5.hg19:g.156915309C>T		0					ADAM19_ENST00000430702.2_Silent_p.R571R|ADAM19_ENST00000394020.1_Silent_p.R840R|ADAM19_ENST00000257527.4_Silent_p.R838R	p.R838R			2	2	4	2.296524	Q9H013	ADA19_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	21	2558	-	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Q9BZL5|Q9UHP2	Silent	SNP	ENST00000517905.1	0	1	hg19	c.2514G>A		0	.	.	.	.	.	.	.	.	.	.	C	4.950	0.176471	0.09443	.	.	ENSG00000135074	ENST00000517374	.	.	.	5.69	2.92	0.33932	5.690000	2.920000	0.339320	.	.	.	.	.	T	0.59059	0.2166	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54077	-0.8347	4	.	.	.	.	9.7224	0.40311	0.0:0.7816:0.0:0.2184	.	.	.	.	D	409	.	.	G	-	2	0	0	ADAM19	156847887	156847887	0.988000	0.35896	0.998000	0.56505	0.351000	0.29236	0.032000	0.13732	0.738000	0.32606	0.491000	0.48974	GGC	0.752805		TCGA-IB-A5SP-01A-11D-A32N-08	0.567	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	0	0	1	2	2	2	2	0	0	0	0	206	206	206	204	1	1.770000	-1.850776	0	0.740000	NM_033274		0	7	7	0	1027	1018	0		1	0		0	0	206	0	0	0.979986	6.676050e-05	0	0	0	2	0	7	1027
CEP72	55722	broad.mit.edu	37	5	633946	633946	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr5:633946C>T	ENST00000264935.5	+	5	665	c.575C>T	c.(574-576)gCg>gTg	p.A192V	CEP72_ENST00000444221.1_Intron	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	192					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GTCATGGATGCGGATGACGAG	0.612																																						ENST00000264935.5	1.000000	0	0.030000	0	1.000000e-02	0.076940	1.000000e-02	0.020000																										0				20						c.(574-576)gCg>gTg		centrosomal protein 72kDa							132.0	133.0	133.0					5																	633946		2203	4300	6503	SO:0001583	missense	55722	2	121412	39				g.chr5:633946C>T	BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.575C>T	chr5.hg19:g.633946C>T	ENSP00000264935:p.Ala192Val	0					CEP72_ENST00000444221.1_Intron	p.A192V	NM_018140.3	NP_060610.2	2	2	4	2.296524	Q9P209	CEP72_HUMAN	Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)	5	665	+			B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	ENST00000264935.5	0	1	hg19	c.575C>T	CCDS34126.1	0	.	.	.	.	.	.	.	.	.	.	C	8.455	0.854063	0.17106	.	.	ENSG00000112877	ENST00000264935	T	0.09911	2.93	5.14	2.14	0.27477	5.140000	2.140000	0.274770	.	0.406531	0.25458	N	0.030523	T	0.11410	0.0278	M	0.65975	2.015	0.29054	N	0.884302	B	0.15473	0.013	B	0.12837	0.008	T	0.09662	-1.0664	10	0.40728	T	0.16	-11.1821	6.2359	0.20762	0.4236:0.4884:0.0:0.088	.	192	Q9P209	CEP72_HUMAN	V	192	ENSP00000264935:A192V	ENSP00000264935:A192V	A	+	2	0	0	CEP72	686946	686946	0.023000	0.18921	0.021000	0.16686	0.247000	0.25773	0.787000	0.26858	0.650000	0.30769	-0.355000	0.07637	GCG	0.752805		TCGA-IB-A5SP-01A-11D-A32N-08	0.612	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365967.3	0	0	1	2	2	2	2	0	0	0	0	312	312	312	309	1	1.770000	-1.810166	0	0.740000	NM_018140		0	7	7	0	1028	1015	0		1	0		0	0	312	0	0	0.979492	2.890763e-02	0	0	0	33	0	7	1028
C5orf38	153571	broad.mit.edu	37	5	2752818	2752818	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr5:2752818G>A	ENST00000334000.3	+	2	400	c.283G>A	c.(283-285)Gag>Aag	p.E95K	IRX2_ENST00000382611.6_5'Flank|IRX2_ENST00000302057.5_5'Flank|C5orf38_ENST00000515640.1_Missense_Mutation_p.E95K|C5orf38_ENST00000457752.2_Intron|C5orf38_ENST00000505778.1_Missense_Mutation_p.E95K|IRX2_ENST00000502957.1_5'UTR|C5orf38_ENST00000397835.4_Missense_Mutation_p.E95K	NM_178569.2	NP_848664.1	Q86SI9	CEI_HUMAN	chromosome 5 open reading frame 38	95						extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(1)	4				GBM - Glioblastoma multiforme(108;0.205)		CAGTCACGTCGAGAACGGGCA	0.602																																						ENST00000334000.3	1.000000	0	0.050000	1.000000e-02	2.000000e-02	0.086038	2.000000e-02	0.030000																										0				4						c.(283-285)Gag>Aag		chromosome 5 open reading frame 38							57.0	64.0	62.0					5																	2752818		2203	4300	6503	SO:0001583	missense	153571	2	121412	33				g.chr5:2752818G>A	AY249324	CCDS34131.1	5p15.33	2014-06-02			ENSG00000186493	ENSG00000186493			24226	protein-coding gene	gene with protein product	"""coordinated expression to IRX2"", ""IRX2 neighbor"""	610522				16515847, 16750006	Standard	XM_005248256		Approved	CEI, IRX2NB	uc003jdc.3	Q86SI9	OTTHUMG00000161741	ENST00000334000.3:c.283G>A	chr5.hg19:g.2752818G>A	ENSP00000334267:p.Glu95Lys	0					C5orf38_ENST00000505778.1_Missense_Mutation_p.E95K|IRX2_ENST00000302057.5_5'Flank|C5orf38_ENST00000457752.2_Intron|IRX2_ENST00000382611.6_5'Flank|C5orf38_ENST00000397835.4_Missense_Mutation_p.E95K|IRX2_ENST00000502957.1_5'UTR|C5orf38_ENST00000515640.1_Missense_Mutation_p.E95K	p.E95K	NM_178569.2	NP_848664.1	2	2	4	2.296524	Q86SI9	CEI_HUMAN		2	400	+				Missense_Mutation	SNP	ENST00000334000.3	0	1	hg19	c.283G>A	CCDS34131.1	0	.	.	.	.	.	.	.	.	.	.	G	7.522	0.656835	0.14580	.	.	ENSG00000186493	ENST00000397835;ENST00000334000;ENST00000505778;ENST00000515640	.	.	.	2.47	-4.95	0.03048	2.470000	-4.950000	0.030480	.	.	.	.	.	T	0.14098	0.0341	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16837	-1.0389	8	0.87932	D	0	.	1.2249	0.01932	0.4102:0.2803:0.1664:0.143	.	95	Q86SI9	CEI_HUMAN	K	95	.	ENSP00000334267:E95K	E	+	1	0	0	C5orf38	2805818	2805818	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-2.638000	0.00866	-1.913000	0.01079	0.313000	0.20887	GAG	0.752805		TCGA-IB-A5SP-01A-11D-A32N-08	0.602	C5orf38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365956.2	0	0	1	2	2	2	2	0	0	0	0	166	166	166	163	1	1.770000	-3.070793	1	0.740000	NM_178569		0	7	7	0	673	667	0		1			0	0	166	0	0	0.980049	0	0	0	0	0	0	7	673
COL23A1	91522	broad.mit.edu	37	5	177688748	177688748	+	Splice_Site	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr5:177688748C>A	ENST00000390654.3	-	11	1034	c.677G>T	c.(676-678)gGc>gTc	p.G226V	COL23A1_ENST00000407622.1_Splice_Site_p.G190V	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	226	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TCCCTTTGGGCCCTGGAACAA	0.562																																						ENST00000390654.3	1.000000	9.600000e-01	1.000000	9.900000e-01	9.900000e-01	0.997942	9.900000e-01	1.000000																										0				19						c.(676-678)gGc>gTc		collagen, type XXIII, alpha 1							56.0	61.0	60.0					5																	177688748		1913	4113	6026	SO:0001630	splice_region_variant	91522	0	0					g.chr5:177688748C>A	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.676-1G>T	chr5.hg19:g.177688748C>A		0					COL23A1_ENST00000407622.1_Splice_Site_p.G190V	p.G226V	NM_173465.3	NP_775736.2	2	2	4	2.296524	Q86Y22	CONA1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	11	1034	-	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Q8IVR4|Q9NT93	Splice_Site	SNP	ENST00000390654.3	1	0	hg19	c.677G>T	CCDS4436.1	1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606433	0.46527	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	D;D	0.99637	-6.29;-6.29	5.29	5.29	0.74685	5.290000	5.290000	0.746850	.	0.150367	0.42548	D	0.000684	D	0.99802	0.9915	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96894	0.9655	10	0.87932	D	0	-8.2243	14.438	0.67296	0.0:1.0:0.0:0.0	.	226	Q86Y22	CONA1_HUMAN	V	226;190	ENSP00000375069:G226V;ENSP00000385092:G190V	ENSP00000375069:G226V	G	-	2	0	0	COL23A1	177621354	177621354	1.000000	0.71417	1.000000	0.80357	0.222000	0.24845	3.891000	0.56227	2.469000	0.83416	0.491000	0.48974	GGC	0.752805		TCGA-IB-A5SP-01A-11D-A32N-08	0.562	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	1	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	1.770000	-19.621590	1	0.740000	NM_173465	Missense_Mutation	0	146	144	0	230	227	1		1	0		0	0	85	0	0	1.000000	3.364934e-01	0	0	0	3	0	146	230
GRM1	2911	broad.mit.edu	37	6	146755420	146755420	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr6:146755420C>G	ENST00000282753.1	+	8	3308	c.3073C>G	c.(3073-3075)Cca>Gca	p.P1025A	GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000361719.2_Missense_Mutation_p.P1025A|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000355289.4_3'UTR			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1025	Gln/Pro-rich.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCAACCCCCTCCACAGCAGAA	0.662																																						ENST00000282753.1	0.500000	3.600000e-01	0.470000	3.900000e-01	4.300000e-01	0.437982	4.300000e-01	0.440000																										0				126						c.(3073-3075)Cca>Gca		glutamate receptor, metabotropic 1							50.0	58.0	55.0					6																	146755420		2202	4299	6501	SO:0001583	missense	2911	0	0					g.chr6:146755420C>G	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3073C>G	chr6.hg19:g.146755420C>G	ENSP00000282753:p.Pro1025Ala	1					GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000361719.2_Missense_Mutation_p.P1025A|GRM1_ENST00000392299.2_3'UTR	p.P1025A			0	1	1	1.502892	Q13255	GRM1_HUMAN		8	3308	+		Ovarian(120;0.0387)	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	1	1	hg19	c.3073C>G	CCDS5209.1	0	.	.	.	.	.	.	.	.	.	.	C	5.758	0.324185	0.10900	.	.	ENSG00000152822	ENST00000361719;ENST00000282753	D;D	0.87179	-2.22;-2.22	2.79	0.452	0.16634	2.790000	0.452000	0.166340	.	1.033610	0.07658	N	0.933160	T	0.43211	0.1237	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43861	-0.9365	10	0.05833	T	0.94	.	3.4837	0.07611	0.0:0.5533:0.2518:0.1949	.	1025	Q13255	GRM1_HUMAN	A	1025	ENSP00000354896:P1025A;ENSP00000282753:P1025A	ENSP00000282753:P1025A	P	+	1	0	0	GRM1	146797113	146797113	0.010000	0.17322	0.052000	0.19188	0.885000	0.51271	2.510000	0.45468	0.066000	0.16515	0.306000	0.20318	CCA	0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.662	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	1	0	0	2	2	2	2	0	0	0	0	148	148	148	145	1	1.770000	-5.752105	1	0.740000	NM_000838		0	114	115	0	333	325	1		1			0	0	148	0	0	1.000000	0	0	0	0	0	0	114	333
HIST1H2AC	8334	broad.mit.edu	37	6	26124800	26124800	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr6:26124800G>T	ENST00000602637.1	+	1	370	c.340G>T	c.(340-342)Gcc>Tcc	p.A114S	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2AC_ENST00000377791.2_Missense_Mutation_p.A114S|HIST1H2BC_ENST00000396984.1_5'Flank			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	114						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						TAACATCCAGGCCGTGCTTCT	0.582																																						ENST00000602637.1	0.230000	1.100000e-01	0.200000	1.300000e-01	1.600000e-01	0.173650	1.600000e-01	0.170000																										0				12						c.(340-342)Gcc>Tcc		histone cluster 1, H2ac							85.0	85.0	85.0					6																	26124800		2203	4300	6503	SO:0001583	missense	8334	0	0					g.chr6:26124800G>T	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.340G>T	chr6.hg19:g.26124800G>T	ENSP00000473534:p.Ala114Ser	1					HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2AC_ENST00000377791.2_Missense_Mutation_p.A114S	p.A114S			0	1	1	1.499983	Q93077	H2A1C_HUMAN		1	370	+			B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Missense_Mutation	SNP	ENST00000602637.1	1	1	hg19	c.340G>T	CCDS4585.1	0	.	.	.	.	.	.	.	.	.	.	.	13.94	2.385900	0.42308	.	.	ENSG00000180573	ENST00000377791;ENST00000314088	T;T	0.40756	1.02;1.02	5.5	5.5	0.81552	5.500000	5.500000	0.815520	Histone-fold (2);Histone H2A (2);	0.000000	0.44285	D	0.000478	T	0.20047	0.0482	L	0.31845	0.965	0.41553	D	0.988589	B	0.10296	0.003	B	0.12156	0.007	T	0.02728	-1.1118	10	0.37606	T	0.19	.	13.6874	0.62524	0.0:0.0:0.8458:0.1542	.	114	Q93077	H2A1C_HUMAN	S	114	ENSP00000367022:A114S;ENSP00000321389:A114S	ENSP00000321389:A114S	A	+	1	0	0	HIST1H2AC	26232779	26232779	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	7.712000	0.84684	2.750000	0.94351	0.467000	0.42956	GCC	0.592093		TCGA-IB-A5SP-01A-11D-A32N-08	0.582	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	1	0	1	2	2	2	2	0	0	0	0	89	89	89	89	1	1.770000	-20.000000	1	0.740000	NM_003512		0	28	26	0	257	256	0		1	1		0	0	89	0	0	1.000000	9.996881e-01	0	14	0	103	0	28	257
CUL9	23113	broad.mit.edu	37	6	43155033	43155033	+	Silent	SNP	G	G	A	rs148427416		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr6:43155033G>A	ENST00000252050.4	+	6	1521	c.1437G>A	c.(1435-1437)ccG>ccA	p.P479P	CUL9_ENST00000372647.2_Silent_p.P479P|CUL9_ENST00000354495.3_Intron	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	479					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ACCCTTTGCCGTACCTCCAGC	0.532																																						ENST00000252050.4	0.040000	0	0.030000	0	1.000000e-02	0.018051	1.000000e-02	0.020000																										0				92						c.(1435-1437)ccG>ccA		cullin 9		G		0,4406		0,0,2203	163.0	155.0	157.0		1437	-2.6	1.0	6	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CUL9	NM_015089.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		479/2518	43155033	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23113	2	121412	30				g.chr6:43155033G>A	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1437G>A	chr6.hg19:g.43155033G>A		1					CUL9_ENST00000354495.3_Intron|CUL9_ENST00000372647.2_Silent_p.P479P	p.P479P	NM_015089.2	NP_055904.1	0	1	1	1.502892	Q8IWT3	CUL9_HUMAN		6	1521	+			O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	0	1	hg19	c.1437G>A	CCDS4890.1	0																																																																																								0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.532	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	0	0	1	2	2	2	2	0	0	0	0	191	191	191	188	1	1.770000	-2.078869	0	0.740000	NM_015089		0	5	6	0	552	545	0		1	0		0	0	191	0	0	0.936007	1.336898e-04	0	0	0	2	0	5	552
RCAN2	10231	broad.mit.edu	37	6	46214487	46214487	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr6:46214487G>A	ENST00000330430.6	-	3	619	c.431C>T	c.(430-432)cCa>cTa	p.P144L	RCAN2_ENST00000306764.7_Missense_Mutation_p.P190L|RCAN2_ENST00000405162.1_Missense_Mutation_p.P190L|RCAN2_ENST00000371374.1_Missense_Mutation_p.P190L	NM_005822.3	NP_005813.2	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	144					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						AAGCTTACCTGGTCCTAGTTT	0.488																																						ENST00000330430.6	0.110000	1.000000e-02	0.090000	3.000000e-02	5.000000e-02	0.062396	5.000000e-02	0.050000																										0				8						c.(430-432)cCa>cTa		regulator of calcineurin 2							47.0	49.0	48.0					6																	46214487		1931	4137	6068	SO:0001583	missense	10231	0	0					g.chr6:46214487G>A	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000330430.6:c.431C>T	chr6.hg19:g.46214487G>A	ENSP00000329454:p.Pro144Leu	1					RCAN2_ENST00000371374.1_Missense_Mutation_p.P190L|RCAN2_ENST00000405162.1_Missense_Mutation_p.P190L|RCAN2_ENST00000306764.7_Missense_Mutation_p.P190L	p.P144L	NM_005822.3	NP_005813.2	0	1	1	1.502892	Q14206	RCAN2_HUMAN		3	619	-			A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Missense_Mutation	SNP	ENST00000330430.6	0	1	hg19	c.431C>T	CCDS43469.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.100723	0.94245	.	.	ENSG00000172348	ENST00000330430;ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.7	5.7	0.88788	5.700000	5.700000	0.887880	.	0.000000	0.85682	D	0.000000	T	0.72020	0.3409	M	0.73217	2.22	0.80722	D	1	P;P	0.50710	0.938;0.775	P;B	0.58130	0.833;0.396	T	0.74609	-0.3608	9	0.87932	D	0	-9.8695	18.8222	0.92102	0.0:0.0:1.0:0.0	.	190;144	Q14206-2;Q14206	.;RCAN2_HUMAN	L	144;190;190;190	.	ENSP00000305223:P190L	P	-	2	0	0	RCAN2	46322446	46322446	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.378000	0.97191	2.703000	0.92315	0.585000	0.79938	CCA	0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.488	RCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040782.1	0	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.770000	-3.339483	1	0.740000			0	5	5	0	157	153	0		1	0		0	0	31	0	0	0.934359	9.718456e-02	0	0	0	14	0	5	157
TIAM2	26230	broad.mit.edu	37	6	155458639	155458639	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr6:155458639G>A	ENST00000461783.3	+	7	2796	c.1523G>A	c.(1522-1524)cGg>cAg	p.R508Q	TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000360366.4_Missense_Mutation_p.R508Q|TIAM2_ENST00000529824.2_Missense_Mutation_p.R508Q|TIAM2_ENST00000318981.5_Missense_Mutation_p.R508Q|TIAM2_ENST00000456144.1_Missense_Mutation_p.R508Q			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	508	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGGGTGGTCCGGAAGGCCGGG	0.542																																						ENST00000461783.3	0.060000	0	0.050000	1.000000e-02	2.000000e-02	0.033500	2.000000e-02	0.030000																										0				65						c.(1522-1524)cGg>cAg		T-cell lymphoma invasion and metastasis 2							65.0	70.0	68.0					6																	155458639		2203	4300	6503	SO:0001583	missense	26230	5	121412	39				g.chr6:155458639G>A		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1523G>A	chr6.hg19:g.155458639G>A	ENSP00000437188:p.Arg508Gln	1					TIAM2_ENST00000360366.4_Missense_Mutation_p.R508Q|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000318981.5_Missense_Mutation_p.R508Q|TIAM2_ENST00000456144.1_Missense_Mutation_p.R508Q|TIAM2_ENST00000529824.2_Missense_Mutation_p.R508Q	p.R508Q			0	1	1	1.502892	Q8IVF5	TIAM2_HUMAN		7	2796	+		Ovarian(120;0.196)	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	0	1	hg19	c.1523G>A	CCDS34558.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.737056	0.96865	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	6.08	6.08	0.98989	6.080000	6.080000	0.989890	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.85155	0.5632	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.84890	0.0836	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	508;508	Q8IVF5-2;Q8IVF5	.;TIAM2_HUMAN	Q	508;754;508;508;508;508;508	ENSP00000437188:R508Q;ENSP00000434901:R508Q;ENSP00000407746:R508Q;ENSP00000327315:R508Q;ENSP00000353528:R508Q;ENSP00000433348:R508Q	ENSP00000327315:R508Q	R	+	2	0	0	TIAM2	155500331	155500331	1.000000	0.71417	0.993000	0.49108	0.972000	0.66771	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	CGG	0.589711		TCGA-IB-A5SP-01A-11D-A32N-08	0.542	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	0	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.770000	-3.042169	1	0.740000	NM_012454		0	5	5	0	299	298	0		1	0		0	0	99	0	0	0.937504	4.243622e-03	0	0	0	5	0	5	299
HDAC9	9734	broad.mit.edu	37	7	18668998	18668998	+	Silent	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr7:18668998G>A	ENST00000432645.2	+	6	681	c.681G>A	c.(679-681)cgG>cgA	p.R227R	HDAC9_ENST00000456174.2_Silent_p.R199R|HDAC9_ENST00000401921.1_Intron|HDAC9_ENST00000406072.1_Intron|HDAC9_ENST00000405010.3_Silent_p.R227R|HDAC9_ENST00000417496.2_Intron|HDAC9_ENST00000406451.4_Silent_p.R227R|HDAC9_ENST00000524023.1_Intron|HDAC9_ENST00000441542.2_Silent_p.R230R|HDAC9_ENST00000428307.2_Intron	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	227	Interaction with ETV6.|Interaction with MAPK10. {ECO:0000250}.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	TGAAGGTGCGGTCCAGGTTAA	0.408																																						ENST00000432645.2	1.000000	7.200000e-01	1.000000	8.400000e-01	9.800000e-01	0.940855	9.800000e-01	1.000000																										0				82						c.(679-681)cgG>cgA		histone deacetylase 9	Valproic Acid(DB00313)						54.0	51.0	52.0					7																	18668998		1895	4113	6008	SO:0001819	synonymous_variant	9734	1	120746	30				g.chr7:18668998G>A	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.681G>A	chr7.hg19:g.18668998G>A		1					HDAC9_ENST00000406072.1_Intron|HDAC9_ENST00000524023.1_Intron|HDAC9_ENST00000441542.2_Silent_p.R230R|HDAC9_ENST00000456174.2_Silent_p.R199R|HDAC9_ENST00000405010.3_Silent_p.R227R|HDAC9_ENST00000401921.1_Intron|HDAC9_ENST00000406451.4_Silent_p.R227R|HDAC9_ENST00000428307.2_Intron|HDAC9_ENST00000417496.2_Intron	p.R227R	NM_058176.2	NP_478056.1	2	2	4	2.366928	Q9UKV0	HDAC9_HUMAN		6	681	+	all_lung(11;0.187)		A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	0	1	hg19	c.681G>A	CCDS47555.1	1																																																																																								0.759571		TCGA-IB-A5SP-01A-11D-A32N-08	0.408	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1	1	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.770000	-20.000000	1	0.740000			0	33	33	0	66	66	0		1	0		0	0	8	0	0	1.000000	5.423152e-01	0	0	0	5	0	33	66
ELN	2006	broad.mit.edu	37	7	73474290	73474290	+	Missense_Mutation	SNP	T	T	G	rs201894730	byFrequency	TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr7:73474290T>G	ENST00000252034.7	+	23	1888	c.1489T>G	c.(1489-1491)Ttg>Gtg	p.L497V	ELN_ENST00000380562.4_Missense_Mutation_p.L503V|ELN_ENST00000445912.1_Missense_Mutation_p.L497V|ELN_ENST00000380553.4_Missense_Mutation_p.L361V|ELN_ENST00000320399.6_Missense_Mutation_p.L497V|ELN_ENST00000358929.4_Missense_Mutation_p.L532V|ELN_ENST00000357036.5_Missense_Mutation_p.L502V|ELN_ENST00000414324.1_Missense_Mutation_p.L473V|ELN_ENST00000380584.4_Missense_Mutation_p.L464V|ELN_ENST00000380575.4_Missense_Mutation_p.L468V|ELN_ENST00000380576.5_Missense_Mutation_p.L478V|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000429192.1_Missense_Mutation_p.L483V|ELN_ENST00000458204.1_Missense_Mutation_p.L487V|ELN_ENST00000320492.7_Missense_Mutation_p.L416V	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TGGAGTTGGCTTGGCTCCTGG	0.607			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""						G|||	3	0.000599042	0.0008	0.0	5008	,	,		12452	0.0		0.001	False		,,,				2504	0.001					ENST00000252034.7	0.750000	6.100000e-01	0.720000	6.400000e-01	6.700000e-01	0.684213	6.700000e-01	0.680000				Dom	yes			Dom	yes		7	7q11.23	7q11.23	2006	T	elastin	yes	yes	Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome	L	L	PAX5		B-ALL		0				32						c.(1489-1491)Ttg>Gtg		elastin							195.0	180.0	186.0					7																	73474290		2203	4300	6503	SO:0001583	missense	2006	0	0					g.chr7:73474290T>G		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1489T>G	chr7.hg19:g.73474290T>G	ENSP00000252034:p.Leu497Val	0					CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000458204.1_Missense_Mutation_p.L487V|ELN_ENST00000380584.4_Missense_Mutation_p.L464V|ELN_ENST00000414324.1_Missense_Mutation_p.L473V|ELN_ENST00000445912.1_Missense_Mutation_p.L497V|ELN_ENST00000380576.5_Missense_Mutation_p.L478V|ELN_ENST00000380575.4_Missense_Mutation_p.L468V|ELN_ENST00000357036.5_Missense_Mutation_p.L502V|ELN_ENST00000380553.4_Missense_Mutation_p.L361V|ELN_ENST00000320399.6_Missense_Mutation_p.L497V|ELN_ENST00000429192.1_Missense_Mutation_p.L483V|ELN_ENST00000380562.4_Missense_Mutation_p.L503V|ELN_ENST00000320492.7_Missense_Mutation_p.L416V|ELN_ENST00000358929.4_Missense_Mutation_p.L532V	p.L497V	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	0	0	0	2.012507	P15502	ELN_HUMAN		23	1888	+		Lung NSC(55;0.159)	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	1	0	hg19	c.1489T>G	CCDS5562.2	0	.	.	.	.	.	.	.	.	.	.	G	9.976	1.226933	0.22542	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.30981	1.55;1.56;1.53;1.52;1.52;1.51;1.55;1.56;1.54;1.54;1.53;1.55;1.55;1.54	3.57	0.521	0.17046	3.570000	0.521000	0.170460	.	.	.	.	.	T	0.11750	0.0286	.	.	.	0.09310	N	0.999999	B;B;B;B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.001;0.0;0.0;0.0	T	0.34378	-0.9831	8	0.08837	T	0.75	.	3.2149	0.06695	0.0914:0.1471:0.4594:0.3021	.	497;416;473;487;503;468;483;502;478;361;408;464;497	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	V	497;497;532;416;473;503;468;464;487;502;483;361;478;497	ENSP00000389857:L497V;ENSP00000252034:L497V;ENSP00000351807:L532V;ENSP00000315607:L416V;ENSP00000392575:L473V;ENSP00000369936:L503V;ENSP00000369949:L468V;ENSP00000369958:L464V;ENSP00000403162:L487V;ENSP00000349540:L502V;ENSP00000391129:L483V;ENSP00000369926:L361V;ENSP00000369950:L478V;ENSP00000313565:L497V	ENSP00000252034:L497V	L	+	1	2	2	ELN	73112226	73112226	0.469000	0.25846	0.000000	0.03702	0.028000	0.11728	0.540000	0.23191	-0.267000	0.09325	-0.126000	0.14955	TTG	0.716961		TCGA-IB-A5SP-01A-11D-A32N-08	0.607	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	1	0	0	2	2	2	2	0	0	0	0	359	359	359	303	1	1.770000	-11.204800	1	0.740000	NM_000501		0	286	0	0	753	654	1		0	1		0	0	359	1	0	1.000000	1	0	3	0	70	0	286	753
NRF1	4899	broad.mit.edu	37	7	129349051	129349051	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr7:129349051G>A	ENST00000393232.1	+	6	860	c.743G>A	c.(742-744)cGc>cAc	p.R248H	NRF1_ENST00000539636.1_Missense_Mutation_p.R87H|NRF1_ENST00000223190.4_Missense_Mutation_p.R248H|NRF1_ENST00000353868.4_Missense_Mutation_p.R248H|NRF1_ENST00000311967.2_Missense_Mutation_p.R248H|NRF1_ENST00000393231.3_Missense_Mutation_p.R248H|NRF1_ENST00000393230.2_Missense_Mutation_p.R248H	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	248					cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R248L(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						AGTGATGTCCGCACAGAAGAG	0.493																																						ENST00000393232.1	0.060000	0	0.050000	1.000000e-02	2.000000e-02	0.035111	2.000000e-02	0.040000																										1	Substitution - Missense(1)	p.R248L(1)	prostate(1)	24						c.(742-744)cGc>cAc		nuclear respiratory factor 1							122.0	124.0	124.0					7																	129349051		2203	4300	6503	SO:0001583	missense	4899	0	0					g.chr7:129349051G>A	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.743G>A	chr7.hg19:g.129349051G>A	ENSP00000376924:p.Arg248His	0					NRF1_ENST00000393230.2_Missense_Mutation_p.R248H|NRF1_ENST00000353868.4_Missense_Mutation_p.R248H|NRF1_ENST00000393231.3_Missense_Mutation_p.R248H|NRF1_ENST00000311967.2_Missense_Mutation_p.R248H|NRF1_ENST00000223190.4_Missense_Mutation_p.R248H|NRF1_ENST00000539636.1_Missense_Mutation_p.R87H	p.R248H	NM_005011.3	NP_005002.3	0	1	1	2.009032	Q16656	NRF1_HUMAN		6	860	+			A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	ENST00000393232.1	0	1	hg19	c.743G>A	CCDS5813.2	0	.	.	.	.	.	.	.	.	.	.	G	35	5.582880	0.96578	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000539636;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	D;D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57;-2.57	5.85	5.85	0.93711	5.850000	5.850000	0.937110	Nuclear respiratory factor 1, NLS/DNA-binding, dimerisation domain (1);	0.000000	0.85682	D	0.000000	D	0.94804	0.8322	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94125	0.7383	9	.	.	.	-9.5325	19.1648	0.93551	0.0:0.0:1.0:0.0	.	248;248	Q96AN2;Q16656	.;NRF1_HUMAN	H	248;248;87;248;248;248;248	ENSP00000376924:R248H;ENSP00000440455:R87H;ENSP00000223190:R248H;ENSP00000309826:R248H;ENSP00000376922:R248H;ENSP00000376923:R248H	.	R	+	2	0	0	NRF1	129136287	129136287	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.499000	0.97975	2.772000	0.95346	0.655000	0.94253	CGC	0.718096		TCGA-IB-A5SP-01A-11D-A32N-08	0.493	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	129	1	1.770000	-1.829393	0	0.740000	NM_001040110		0	7	5	0	556	551	0		1	0		0	0	131	0	0	0.979702	4.811622e-02	0	0	0	24	0	7	556
RRS1	23212	broad.mit.edu	37	8	67341954	67341954	+	Silent	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr8:67341954G>A	ENST00000320270.2	+	1	692	c.588G>A	c.(586-588)gcG>gcA	p.A196A	ADHFE1_ENST00000379385.4_5'Flank|RP11-346I3.4_ENST00000499642.1_lincRNA|ADHFE1_ENST00000396623.3_5'Flank|ADHFE1_ENST00000415254.1_5'Flank	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	196					hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			TGGCCCGCGCGCACAAGATGC	0.652																																						ENST00000320270.2	1.000000	0	0.080000	2.000000e-02	4.000000e-02	0.082815	4.000000e-02	0.050000																										0				4						c.(586-588)gcG>gcA		RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)							19.0	22.0	21.0					8																	67341954		2176	4264	6440	SO:0001819	synonymous_variant	23212	0	0					g.chr8:67341954G>A	BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.588G>A	chr8.hg19:g.67341954G>A		0					RP11-346I3.4_ENST00000499642.1_lincRNA|ADHFE1_ENST00000415254.1_5'Flank|ADHFE1_ENST00000379385.4_5'Flank|ADHFE1_ENST00000396623.3_5'Flank	p.A196A	NM_015169.3	NP_055984.1	1	2	3	2.250343	Q15050	RRS1_HUMAN	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)	1	692	+		Lung NSC(129;0.197)	Q9BUX8	Silent	SNP	ENST00000320270.2	0	1	hg19	c.588G>A	CCDS6189.1	0																																																																																								0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.652	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380126.1	0	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	1.770000	-4.112707	1	0.740000	NM_015169		0	5	5	0	288	284	0		1	0		0	0	55	0	0	0.935789	4.791068e-01	0	0	0	83	0	5	288
CYP11B1	1584	broad.mit.edu	37	8	143958154	143958154	+	Missense_Mutation	SNP	G	G	A	rs34620645	byFrequency	TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr8:143958154G>A	ENST00000292427.4	-	4	775	c.743C>T	c.(742-744)aCc>aTc	p.T248I	CYP11B1_ENST00000377675.3_Missense_Mutation_p.T319I|CYP11B1_ENST00000517471.1_Missense_Mutation_p.T248I	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	248			T -> I (in dbSNP:rs34620645).		aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CTTGGGGCTGGTCCAGCGAGA	0.602									Familial Hyperaldosteronism type I																													ENST00000292427.4	1.000000	6.000000e-02	0.200000	9.000000e-02	1.300000e-01	0.167886	1.300000e-01	0.130000																										0				67						c.(742-744)aCc>aTc		cytochrome P450, family 11, subfamily B, polypeptide 1	Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)						52.0	47.0	48.0					8																	143958154		2203	4300	6503	SO:0001583	missense	1584	128	121410	41	Familial Hyperaldosteronism type I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	g.chr8:143958154G>A	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.743C>T	chr8.hg19:g.143958154G>A	ENSP00000292427:p.Thr248Ile	0					CYP11B1_ENST00000377675.3_Missense_Mutation_p.T319I|CYP11B1_ENST00000517471.1_Missense_Mutation_p.T248I	p.T248I	NM_000497.3	NP_000488.3	1	2	3	2.250343	P15538	C11B1_HUMAN		4	775	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	0	1	hg19	c.743C>T	CCDS6392.1	0	.	.	.	.	.	.	.	.	.	.	.	0.042	-1.281373	0.01398	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.66815	-0.23;-0.23;-0.23	3.64	0.81	0.18732	3.640000	0.810000	0.187320	.	1.139050	0.06616	N	0.756477	T	0.44644	0.1303	N	0.17312	0.475	0.09310	N	1	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.17979	0.006;0.013;0.02	T	0.28744	-1.0034	10	0.02654	T	1	.	7.2978	0.26403	0.3297:0.0:0.6703:0.0	rs34620645	319;248;248	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	I	248;248;319	ENSP00000292427:T248I;ENSP00000428043:T248I;ENSP00000366903:T319I	ENSP00000292427:T248I	T	-	2	0	0	CYP11B1	143955156	143955156	0.000000	0.05858	0.320000	0.25306	0.198000	0.23893	0.272000	0.18644	0.339000	0.23719	-0.226000	0.12346	ACC	0.743792		TCGA-IB-A5SP-01A-11D-A32N-08	0.602	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2	0	0	1	2	15	2	2	0	0	0	1	38	38	38	38	1	1.770000	-1.842696	0	0.740000			0	8	8	0	162	160	0		0			0	0	38	0	0	0.089708	0	0	0	0	0	0	8	162
ABCA1	19	broad.mit.edu	37	9	107556682	107556682	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr9:107556682G>A	ENST00000374736.3	-	40	5886	c.5492C>T	c.(5491-5493)gCc>gTc	p.A1831V		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1831					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CCTTTCCAGGGCATCAGCCAT	0.468																																						ENST00000374736.3	0.060000	0	0.040000	0	2.000000e-02	0.036696	2.000000e-02	0.020000																										0				115						c.(5491-5493)gCc>gTc		ATP-binding cassette, sub-family A (ABC1), member 1	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)						159.0	146.0	151.0					9																	107556682		2203	4300	6503	SO:0001583	missense	19	15	121412	46				g.chr9:107556682G>A	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5492C>T	chr9.hg19:g.107556682G>A	ENSP00000363868:p.Ala1831Val	0						p.A1831V	NM_005502.3	NP_005493.2	1	2	3	2.224612	O95477	ABCA1_HUMAN		40	5886	-			Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	0	1	hg19	c.5492C>T	CCDS6762.1	0	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460143	0.43736	.	.	ENSG00000165029	ENST00000374736	D	0.88664	-2.41	5.62	5.62	0.85841	5.620000	5.620000	0.858410	.	0.000000	0.85682	D	0.000000	D	0.85256	0.5655	L	0.33189	0.99	0.80722	D	1	B	0.27450	0.179	B	0.33960	0.173	T	0.80339	-0.1424	10	0.12430	T	0.62	.	19.6523	0.95822	0.0:0.0:1.0:0.0	.	1831	O95477	ABCA1_HUMAN	V	1831	ENSP00000363868:A1831V	ENSP00000363868:A1831V	A	-	2	0	0	ABCA1	106596503	106596503	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.864000	0.99589	2.641000	0.89580	0.650000	0.86243	GCC	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.468	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	103	1	1.770000	-2.345855	0	0.740000	NM_005502		0	6	6	0	664	653	0		1	0		0	0	104	0	0	0.963250	1.205534e-03	0	0	0	5	0	6	664
PRPF4	9128	broad.mit.edu	37	9	116049072	116049072	+	Missense_Mutation	SNP	C	C	T	rs575911571		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr9:116049072C>T	ENST00000374198.4	+	9	1001	c.899C>T	c.(898-900)gCg>gTg	p.A300V	PRPF4_ENST00000374199.4_Missense_Mutation_p.A299V	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	300					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						GCCTCTTGTGCGGCTGATGGC	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		18454	0.0		0.001	False		,,,				2504	0.0					ENST00000374198.4	0.040000	0	0.030000	0	1.000000e-02	0.029858	1.000000e-02	0.020000																										0				23						c.(898-900)gCg>gTg		pre-mRNA processing factor 4							353.0	352.0	353.0					9																	116049072		2203	4300	6503	SO:0001583	missense	9128	4	121412	43				g.chr9:116049072C>T	AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.899C>T	chr9.hg19:g.116049072C>T	ENSP00000363313:p.Ala300Val	0					PRPF4_ENST00000374199.4_Missense_Mutation_p.A299V	p.A300V	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	1	2	3	2.224612	O43172	PRP4_HUMAN		9	1001	+			O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	ENST00000374198.4	0	1	hg19	c.899C>T	CCDS6791.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.163644	0.94727	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.61040	0.14;0.14	5.82	5.82	0.92795	5.820000	5.820000	0.927950	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.155793	0.56097	D	0.000025	T	0.72244	0.3436	L	0.56340	1.77	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.65140	0.932;0.849	T	0.73040	-0.4108	10	0.72032	D	0.01	.	19.0872	0.93209	0.0:1.0:0.0:0.0	.	315;300	Q59EL4;O43172	.;PRP4_HUMAN	V	299;300	ENSP00000363315:A299V;ENSP00000363313:A300V	ENSP00000363313:A300V	A	+	2	0	0	PRPF4	115088893	115088893	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.378000	0.79679	2.752000	0.94435	0.655000	0.94253	GCG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.468	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	0	0	1	2	2	2	2	0	0	0	0	418	418	418	413	1	1.770000	-2.137060	0	0.740000	NM_004697		0	11	11	0	1795	1775	0		1	0		0	0	418	0	0	0.998204	7.429186e-02	0	0	0	66	0	11	1795
GCNT1	2650	broad.mit.edu	37	9	79118080	79118080	+	Silent	SNP	C	C	T	rs372561524		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr9:79118080C>T	ENST00000376730.4	+	4	1266	c.783C>T	c.(781-783)gtC>gtT	p.V261V	GCNT1_ENST00000444201.2_Silent_p.V261V|GCNT1_ENST00000536223.1_Silent_p.V261V|GCNT1_ENST00000442371.1_Silent_p.V261V	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	Q02742	GCNT1_HUMAN	glucosaminyl (N-acetyl) transferase 1, core 2	261	Catalytic. {ECO:0000250}.				cell adhesion molecule production (GO:0060352)|cellular protein metabolic process (GO:0044267)|glycoprotein biosynthetic process (GO:0009101)|kidney morphogenesis (GO:0060993)|leukocyte tethering or rolling (GO:0050901)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to insulin (GO:0032868)|tissue morphogenesis (GO:0048729)	extracellular space (GO:0005615)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(11)|prostate(2)|urinary_tract(1)	30						GGTATGAGGTCGTTAATGGAA	0.463																																						ENST00000376730.4	0.940000	6.800000e-01	0.870000	7.400000e-01	8.000000e-01	0.810295	8.000000e-01	0.810000																										0				30						c.(781-783)gtC>gtT		glucosaminyl (N-acetyl) transferase 1, core 2							104.0	83.0	90.0					9																	79118080		2203	4300	6503	SO:0001819	synonymous_variant	2650	0	0					g.chr9:79118080C>T	L41415	CCDS6653.1	9q13	2013-02-25	2010-03-16		ENSG00000187210	ENSG00000187210	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4203	protein-coding gene	gene with protein product	"""core 2 beta1,6 N-acetylglucosaminyltransferase-I"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N--acetylglucosaminyltransferase"""	600391	"""glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""	NACGT2		8449405, 9915862	Standard	NM_001490		Approved	C2GNT, NAGCT2	uc004akf.4	Q02742	OTTHUMG00000020044	ENST00000376730.4:c.783C>T	chr9.hg19:g.79118080C>T		0					GCNT1_ENST00000444201.2_Silent_p.V261V|GCNT1_ENST00000442371.1_Silent_p.V261V|GCNT1_ENST00000536223.1_Silent_p.V261V	p.V261V	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	1	2	3	2.224612	Q02742	GCNT1_HUMAN		4	1266	+			Q6DJZ4	Silent	SNP	ENST00000376730.4	1	1	hg19	c.783C>T	CCDS6653.1	0																																																																																								0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.463	GCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052725.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	71	1	1.770000	-9.284615	1	0.740000	NM_001097634		0	125	124	0	297	296	1		1	1		0	0	72	0	0	1.000000	9.999925e-01	0	18	0	26	0	125	297
PRUNE2	158471	broad.mit.edu	37	9	79323756	79323756	+	Missense_Mutation	SNP	G	G	A	rs546948015		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr9:79323756G>A	ENST00000376718.3	-	8	3557	c.3434C>T	c.(3433-3435)gCg>gTg	p.A1145V	PRUNE2_ENST00000428286.1_Missense_Mutation_p.A786V	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1145					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GGGGATTGCCGCACCCCCACT	0.522													A|||	1	0.000199681	0.0	0.0	5008	,	,		20449	0.0		0.001	False		,,,				2504	0.0					ENST00000376718.3	0.070000	0	0.050000	1.000000e-02	2.000000e-02	0.043113	2.000000e-02	0.030000																										0				16						c.(3433-3435)gCg>gTg		prune homolog 2 (Drosophila)							121.0	111.0	114.0					9																	79323756		1568	3582	5150	SO:0001583	missense	158471	4	120486	37				g.chr9:79323756G>A	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3434C>T	chr9.hg19:g.79323756G>A	ENSP00000365908:p.Ala1145Val	0					PRUNE2_ENST00000428286.1_Missense_Mutation_p.A786V	p.A1145V	NM_015225.2	NP_056040.2	1	2	3	2.224612	Q8WUY3	PRUN2_HUMAN		8	3557	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	0	1	hg19	c.3434C>T	CCDS47982.1	0	.	.	.	.	.	.	.	.	.	.	A	2.851	-0.238399	0.05944	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.38401	1.15;1.14	6.08	6.08	0.98989	6.080000	6.080000	0.989890	.	0.121361	0.37577	N	0.002034	T	0.12603	0.0306	N	0.01576	-0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16748	-1.0392	10	0.02654	T	1	-10.7943	11.0795	0.48051	0.9304:0.0:0.0696:0.0	.	1145	Q8WUY3	PRUN2_HUMAN	V	1145;786;1144	ENSP00000365908:A1145V;ENSP00000397425:A786V	ENSP00000365908:A1145V	A	-	2	0	0	PRUNE2	78513576	78513576	0.218000	0.23608	0.794000	0.32065	0.308000	0.27856	0.910000	0.28571	1.126000	0.42016	-0.254000	0.11334	GCG	0.741910		TCGA-IB-A5SP-01A-11D-A32N-08	0.522	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	0	0	1	2	17	2	2	1	1	1	1	112	112	112	112	1	1.770000	-1.924413	0	0.740000	NM_138818		0	6	6	0	545	539	0		0	0		1	0	112	0	0	0.015201	5.424425e-04	0	0	0	3	0	6	545
TNC	3371	broad.mit.edu	37	9	117791722	117791722	+	Missense_Mutation	SNP	C	C	T	rs549023811		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chr9:117791722C>T	ENST00000350763.4	-	25	6497	c.6086G>A	c.(6085-6087)cGc>cAc	p.R2029H	TNC_ENST00000423613.2_Missense_Mutation_p.R1756H|TNC_ENST00000345230.3_Missense_Mutation_p.R1392H|TNC_ENST00000346706.3_Missense_Mutation_p.R1483H|TNC_ENST00000341037.4_Missense_Mutation_p.R1847H|TNC_ENST00000340094.3_Missense_Mutation_p.R1665H|TNC_ENST00000537320.1_Missense_Mutation_p.R1392H|TNC_ENST00000535648.1_Missense_Mutation_p.R1574H|TNC_ENST00000542877.1_Missense_Mutation_p.R1666H	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	2029	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TCCGTTTTTGCGTCTCAGGAA	0.488																																						ENST00000350763.4	0.070000	0	0.050000	1.000000e-02	2.000000e-02	0.032992	2.000000e-02	0.030000																										0				120						c.(6085-6087)cGc>cAc		tenascin C							167.0	150.0	156.0					9																	117791722		2203	4300	6503	SO:0001583	missense	3371	0	0					g.chr9:117791722C>T		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.6086G>A	chr9.hg19:g.117791722C>T	ENSP00000265131:p.Arg2029His	0					TNC_ENST00000535648.1_Missense_Mutation_p.R1574H|TNC_ENST00000346706.3_Missense_Mutation_p.R1483H|TNC_ENST00000345230.3_Missense_Mutation_p.R1392H|TNC_ENST00000423613.2_Missense_Mutation_p.R1756H|TNC_ENST00000340094.3_Missense_Mutation_p.R1665H|TNC_ENST00000341037.4_Missense_Mutation_p.R1847H|TNC_ENST00000542877.1_Missense_Mutation_p.R1666H|TNC_ENST00000537320.1_Missense_Mutation_p.R1392H	p.R2029H	NM_002160.3	NP_002151.2	1	2	3	2.201964	P24821	TENA_HUMAN		25	6497	-			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	0	1	hg19	c.6086G>A	CCDS6811.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.217894	0.95104	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	D;D;D;D;D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06	5.48	5.48	0.80851	5.480000	5.480000	0.808510	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.96068	0.8719	H	0.98936	4.375	0.44275	D	0.99713	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97749	1.0213	10	0.87932	D	0	.	19.3449	0.94359	0.0:1.0:0.0:0.0	.	1756;2029	E9PC84;P24821	.;TENA_HUMAN	H	1665;1574;1483;1392;2029;1847;1756;1392;1666	ENSP00000344400:R1665H;ENSP00000438152:R1574H;ENSP00000344555:R1483H;ENSP00000345861:R1392H;ENSP00000265131:R2029H;ENSP00000339553:R1847H;ENSP00000411406:R1756H;ENSP00000443478:R1392H;ENSP00000442242:R1666H	ENSP00000344400:R1665H	R	-	2	0	0	TNC	116831543	116831543	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.363000	0.79516	2.587000	0.87381	0.655000	0.94253	CGC	0.740958		TCGA-IB-A5SP-01A-11D-A32N-08	0.488	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	0	0	1	2	2	2	7	0	0	0	0	87	87	87	86	1	1.770000	-1.887151	0	0.740000	NM_002160		0	6	7	0	553	541	0		1	0	0	0	6	87	2260	0	0.962922	3.329349e-02	8.132015e-01	0	1	22	908	6	553
WWC3	55841	broad.mit.edu	37	X	10090747	10090747	+	Silent	SNP	C	C	T			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chrX:10090747C>T	ENST00000380861.4	+	12	2110	c.1719C>T	c.(1717-1719)agC>agT	p.S573S	WWC3_ENST00000454666.1_Silent_p.S573S	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	573					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CGCTAGCCAGCGACAGTGGGG	0.498																																						ENST00000380861.4	0.020000	0	0.020000	0	0	0.011531	0	0.010000																										0				52						c.(1717-1719)agC>agT		WWC family member 3							256.0	235.0	242.0					X																	10090747		2203	4300	6503	SO:0001819	synonymous_variant	55841	2	121412	43				g.chrX:10090747C>T	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1719C>T	chrX.hg19:g.10090747C>T							WWC3_ENST00000454666.1_Silent_p.S573S	p.S573S	NM_015691.3	NP_056506.2	0	1	1		Q9ULE0	WWC3_HUMAN		12	2110	+			A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	0	1	hg19	c.1719C>T	CCDS14136.1	0	.	.	.	.	.	.	.	.	.	.	C	3.220	-0.159648	0.06544	.	.	ENSG00000047644	ENST00000398613	.	.	.	4.72	-3.99	0.04069	4.720000	-3.990000	0.040690	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.7804	15.226	0.73352	0.0:0.1046:0.0:0.8954	.	.	.	.	X	578	.	.	R	+	1	2	2	WWC3	10050747	10050747	0.915000	0.31059	0.002000	0.10522	0.277000	0.26821	-0.063000	0.11655	-0.854000	0.04131	-0.198000	0.12761	CGA	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.498	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	0	0	1	2	2	2	2	0	0	0	0	227	227	227	226	1	1.770000	-2.538101	1	0.740000	NM_015691		0	7	8	0	882	872	0		1	0		0	0	227	0	0	0.979906	6.497841e-03	0	0	0	13	0	7	882
ZMAT1	84460	broad.mit.edu	37	X	101138639	101138639	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chrX:101138639T>C	ENST00000372782.3	-	7	1807	c.1760A>G	c.(1759-1761)aAg>aGg	p.K587R	ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Missense_Mutation_p.K416R|ZMAT1_ENST00000540921.1_Missense_Mutation_p.K587R	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	587						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TGAACTGACCTTGACTCTATC	0.378																																						ENST00000372782.3	0.060000	0	0.050000	1.000000e-02	2.000000e-02	0.033543	2.000000e-02	0.030000																										0				22						c.(1759-1761)aAg>aGg		zinc finger, matrin-type 1							230.0	193.0	206.0					X																	101138639		2203	4300	6503	SO:0001583	missense	84460	0	0					g.chrX:101138639T>C	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1760A>G	chrX.hg19:g.101138639T>C	ENSP00000361868:p.Lys587Arg						ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000540921.1_Missense_Mutation_p.K587R|ZMAT1_ENST00000458570.1_Missense_Mutation_p.K416R	p.K587R	NM_001011657.3	NP_001011657	0	1	1		Q5H9K5	ZMAT1_HUMAN		7	1807	-			Q8NDS3|Q96JN6	Missense_Mutation	SNP	ENST00000372782.3	1	1	hg19	c.1760A>G	CCDS35348.1	0	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.914913	0.00503	.	.	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	T;T;T	0.23552	2.48;2.48;1.9	3.75	1.02	0.19986	3.750000	1.020000	0.199860	.	1.153020	0.06414	N	0.721174	T	0.06917	0.0176	N	0.00729	-1.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32534	-0.9903	10	0.06099	T	0.92	2.4748	7.3368	0.26615	0.0:0.6725:0.0:0.3275	.	587	Q5H9K5	ZMAT1_HUMAN	R	587;587;416	ENSP00000361868:K587R;ENSP00000437529:K587R;ENSP00000413044:K416R	ENSP00000361868:K587R	K	-	2	0	0	ZMAT1	101025295	101025295	0.000000	0.05858	0.000000	0.03702	0.299000	0.27559	0.140000	0.16056	0.077000	0.16863	-0.296000	0.09543	AAG	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.378	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.770000	-7.676197	1	0.740000			0	7	7	0	313	311	0		1	0		0	0	30	0	0	0.980471	9.561274e-03	0	0	0	6	0	7	313
PTCHD1	139411	broad.mit.edu	37	X	23410819	23410819	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chrX:23410819A>G	ENST00000379361.4	+	3	2044	c.1184A>G	c.(1183-1185)aAc>aGc	p.N395S		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	395	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CCTTTCACGAACATTGAGGCA	0.483																																						ENST00000379361.4	0.060000	0	0.040000	1.000000e-02	2.000000e-02	0.029849	2.000000e-02	0.030000																										0				42						c.(1183-1185)aAc>aGc		patched domain containing 1							127.0	108.0	114.0					X																	23410819		2203	4300	6503	SO:0001583	missense	139411	0	0					g.chrX:23410819A>G	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1184A>G	chrX.hg19:g.23410819A>G	ENSP00000368666:p.Asn395Ser							p.N395S	NM_173495.2	NP_775766.2	0	1	1		Q96NR3	PTHD1_HUMAN		3	2044	+			B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	0	1	hg19	c.1184A>G	CCDS35215.2	0	.	.	.	.	.	.	.	.	.	.	A	10.40	1.340499	0.24339	.	.	ENSG00000165186	ENST00000379361	D	0.85088	-1.94	5.32	5.32	0.75619	5.320000	5.320000	0.756190	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	T	0.77605	0.4155	L	0.31752	0.955	0.50632	D	0.999886	B	0.11235	0.004	B	0.31290	0.127	T	0.68981	-0.5266	10	0.05436	T	0.98	.	14.5355	0.67958	1.0:0.0:0.0:0.0	.	395	Q96NR3	PTHD1_HUMAN	S	395	ENSP00000368666:N395S	ENSP00000368666:N395S	N	+	2	0	0	PTCHD1	23320740	23320740	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.910000	0.92685	1.881000	0.54492	0.486000	0.48141	AAC	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.483	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	0	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	1.770000	-3.306761	1	0.740000	NM_173495		0	5	5	0	264	260	0		1			0	0	35	0	0	0.935633	0	0	0	0	0	0	5	264
FAM47A	158724	broad.mit.edu	37	X	34150174	34150174	+	Silent	SNP	G	G	A	rs373597275		TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chrX:34150174G>A	ENST00000346193.3	-	1	273	c.222C>T	c.(220-222)gaC>gaT	p.D74D		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	74								p.D74D(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GTAAAAACTCGTCACGGCGAC	0.532																																						ENST00000346193.3	0.990000	8.700000e-01	0.970000	9.000000e-01	9.300000e-01	0.939188	9.300000e-01	0.940000																										2	Substitution - coding silent(2)	p.D74D(2)	lung(1)|kidney(1)	97						c.(220-222)gaC>gaT		family with sequence similarity 47, member A							91.0	86.0	88.0					X																	34150174		2202	4300	6502	SO:0001819	synonymous_variant	158724	0	0					g.chrX:34150174G>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.222C>T	chrX.hg19:g.34150174G>A								p.D74D	NM_203408.3	NP_981953.2	0	1	1		Q5JRC9	FA47A_HUMAN		1	273	-			A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	1	1	hg19	c.222C>T	CCDS43926.1	1																																																																																								0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.532	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	1	0	1	2	2	2	2	0	0	0	0	78	78	78	77	1	1.770000	-20.000000	1	0.740000	NM_203408		0	248	243	0	107	106	1		1			0	0	78	0	0	1.000000	0	0	0	0	0	0	248	107
AFF2	2334	broad.mit.edu	37	X	147744171	147744171	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-A5SP-01A-11D-A32N-08	TCGA-IB-A5SP-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd4faec8-6fae-4ef2-95e0-7bbaea030219	c87e1799-db25-4e22-a193-f020949f79ac	g.chrX:147744171C>A	ENST00000370460.2	+	3	1402	c.923C>A	c.(922-924)tCa>tAa	p.S308*	AFF2_ENST00000370457.5_Nonsense_Mutation_p.S304*|AFF2_ENST00000342251.3_Nonsense_Mutation_p.S304*|AFF2_ENST00000370458.1_Nonsense_Mutation_p.S304*	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	308					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTGAAACCTTCAATTGAATTT	0.478																																						ENST00000370460.2	0.050000	0	0.040000	1.000000e-02	2.000000e-02	0.030384	2.000000e-02	0.030000																										0				109						c.(922-924)tCa>tAa		AF4/FMR2 family, member 2							87.0	79.0	82.0					X																	147744171		2203	4300	6503	SO:0001587	stop_gained	2334	0	0					g.chrX:147744171C>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.923C>A	chrX.hg19:g.147744171C>A	ENSP00000359489:p.Ser308*						AFF2_ENST00000370458.1_Nonsense_Mutation_p.S304*|AFF2_ENST00000370457.5_Nonsense_Mutation_p.S304*|AFF2_ENST00000342251.3_Nonsense_Mutation_p.S304*	p.S308*	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	0	1	1		P51816	AFF2_HUMAN		3	1402	+	Acute lymphoblastic leukemia(192;6.56e-05)		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Nonsense_Mutation	SNP	ENST00000370460.2	0	1	hg19	c.923C>A	CCDS14684.1	0	.	.	.	.	.	.	.	.	.	.	C	41	8.941224	0.99010	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	.	.	.	5.92	4.89	0.63831	5.920000	4.890000	0.638310	.	0.113933	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8604	0.70376	0.0:0.9173:0.0:0.0827	.	.	.	.	X	308;304;304;304	.	ENSP00000345459:S304X	S	+	2	0	0	AFF2	147551863	147551863	0.999000	0.42202	0.959000	0.39883	0.949000	0.60115	4.247000	0.58750	2.492000	0.84095	0.600000	0.82982	TCA	0.740000		TCGA-IB-A5SP-01A-11D-A32N-08	0.478	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	0	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.770000	-2.925983	1	0.740000	NM_002025		0	6	6	0	303	301	0		1			0	0	52	0	0	0.964668	0	0	0	0	0	0	6	303
