#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
BRAF	673	broad.mit.edu	37	7	140477837	140477851	+	In_Frame_Del	DEL	TAGGTGCTGTCACAT	TAGGTGCTGTCACAT	-	rs375520366|rs397516893		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr7:140477837_140477851delTAGGTGCTGTCACAT	ENST00000288602.6	-	12	1517_1531	c.1457_1471delATGTGACAGCACCTA	c.(1456-1473)aatgtgacagcacctaca>aca	p.NVTAP486del		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	486	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L485_P490>Y(2)|p.N486_P490del(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TGCTGAGGTGTAGGTGCTGTCACATTCAACATTTT	0.349		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	ENST00000288602.6	1.000000	0.210000	0.620000	0.300000	0.420000	0.479202	0.420000	0.390000		61		Dom	yes			Dom	yes		7	7q34	7q34	673	Mis, T, O	v-raf murine sarcoma viral oncogene homolog B1	yes	yes	Cardio-facio-cutaneous syndrome	E	E	AKAP9, KIAA1549		melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	3	Complex - deletion inframe(2)|Deletion - In frame(1)	p.L485_P490>Y(2)|p.N486_P490del(1)	lung(2)|ovary(1)	27380	GRCh37	CM071573	BRAF	M		c.(1456-1473)aatgtgacagcacctaca>aca		B-Raf proto-oncogene, serine/threonine kinase	Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)																																			SO:0001651	inframe_deletion	673	0	0		Cardiofaciocutaneous syndrome	Familial Cancer Database	CFC, CFCS	g.chr7:140477837_140477851delTAGGTGCTGTCACAT	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1457_1471delATGTGACAGCACCTA	chr7.hg19:g.140477837_140477851delTAGGTGCTGTCACAT	ENSP00000288602:p.Asn486_Pro490del	0						p.NVTAP486del	NM_004333.4	NP_004324.2	1	2	3	2.035490	P15056	BRAF_HUMAN		12	1517_1531	-	Melanoma(164;0.00956)		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	In_Frame_Del	DEL	ENST00000288602.6	0	1	hg19	c.1457_1471delATGTGACAGCACCTA	CCDS5863.1	0																																																																																								0.157582		TCGA-IB-A5SQ-01A-11D-A32N-08	0.349	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	0	0	1		2	2		0	0	0	0	63	0	63	64	1	1.900000	-3.661989	1	0.150000	NM_004333		0	10	16	0	332	338	0	0	1	0	0	0	0	63	0	0	0.997481	6.612028e-02	0	0	0	13	0	10	332
OR5F1	338674	broad.mit.edu	37	11	55761879	55761879	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr11:55761879T>G	ENST00000278409.1	-	1	222	c.223A>C	c.(223-225)Act>Cct	p.T75P		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	75					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GTGATGGTAGTTGAGTTACAA	0.443																																						ENST00000278409.1	1.000000	0.780000	1.000000	0.890000	0.970000	0.955352	0.970000	1.000000																										0				58						c.(223-225)Act>Cct		olfactory receptor, family 5, subfamily F, member 1							64.0	61.0	62.0					11																	55761879		2201	4296	6497	SO:0001583	missense	338674	0	0					g.chr11:55761879T>G	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.223A>C	chr11.hg19:g.55761879T>G	ENSP00000278409:p.Thr75Pro	1						p.T75P	NM_003697.1	NP_003688.1	0	1	1	1.862665	O95221	OR5F1_HUMAN		1	222	-	Esophageal squamous(21;0.00448)		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	1	1	hg19	c.223A>C	CCDS31515.1	1	.	.	.	.	.	.	.	.	.	.	T	9.452	1.090942	0.20471	.	.	ENSG00000149133	ENST00000278409	T	0.00402	7.56	3.03	0.33	0.15929	3.03	0.33	0.15929	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00468	0.0015	M	0.79926	2.475	0.09310	N	1	B	0.34226	0.443	B	0.32465	0.146	T	0.34900	-0.9810	9	0.87932	D	0	.	7.279	0.26300	0.4403:0.0:0.0:0.5596	.	75	O95221	OR5F1_HUMAN	P	75	ENSP00000278409:T75P	ENSP00000278409:T75P	T	-	1	0	0	OR5F1	55518455	55518455	0.006000	0.16342	0.036000	0.18154	0.077000	0.17291	0.070000	0.14573	-0.198000	0.10333	0.247000	0.18012	ACT	0.084791		TCGA-IB-A5SQ-01A-11D-A32N-08	0.443	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	1	0	1		2	2	2	0	0	0	0	67	0	67	67	1	1.900000	-20.000000	1	0.150000	NM_003697		0	34	33	0	294	293	1	0	1			0	0	67	0	0	1.000000	0	0	0	0	0	0	34	294
SLC22A20	440044	broad.mit.edu	37	11	65004295	65004295	+	RNA	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr11:65004295G>A	ENST00000525437.1	+	0	1545							A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)	8						TGGGCTGGCCGTCTGCGTCCT	0.657																																						ENST00000525437.1	0.270000	0.050000	0.210000	0.090000	0.130000	0.152098	0.130000	0.130000																										0				8								solute carrier family 22, member 20							62.0	68.0	66.0					11																	65004295		2082	4210	6292			440044	4	121026	37				g.chr11:65004295G>A	DQ053017		11q13.1	2014-02-20			ENSG00000197847	ENSG00000197847		"""Solute carriers"""	29867	other	unknown		611696				15369770, 16478971	Standard	NM_001004326		Approved	Oat6, FLJ16331	uc021qlh.1	A6NK97	OTTHUMG00000165615		chr11.hg19:g.65004295G>A		1									0	1	1	2.003944	A6NK97	S22AK_HUMAN		0	1545	+			B9EJB2|Q6ZN88	RNA	SNP	ENST00000525437.1	0	1	hg19			0																																																																																								0.081081		TCGA-IB-A5SQ-01A-11D-A32N-08	0.657	SLC22A20-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000385336.1	0	0	1		2	2	2	0	0	0	0	101	0	101	100	1	1.900000	-3.212343	1	0.150000	NM_001004326		0	6	6	0	548	537	0	0	1			0	0	101	0	0	0.962697	0	0	0	0	0	0	6	548
SYTL2	54843	broad.mit.edu	37	11	85468696	85468696	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr11:85468696G>A	ENST00000528231.1	-	1	350	c.73C>T	c.(73-75)Ctg>Ttg	p.L25L	SYTL2_ENST00000524452.1_Silent_p.L25L|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000316356.4_Silent_p.L25L|SYTL2_ENST00000389960.4_Silent_p.L25L	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	25	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GCCCTCTTCAGAGCAGCATCC	0.478																																						ENST00000528231.1	1.000000	0.790000	0.980000	0.850000	0.920000	0.922377	0.920000	0.970000																										0				52						c.(73-75)Ctg>Ttg		synaptotagmin-like 2							240.0	243.0	242.0					11																	85468696		2203	4299	6502	SO:0001819	synonymous_variant	54843	0	0					g.chr11:85468696G>A	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.73C>T	chr11.hg19:g.85468696G>A		1					SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000524452.1_Silent_p.L25L|SYTL2_ENST00000389960.4_Silent_p.L25L|SYTL2_ENST00000316356.4_Silent_p.L25L	p.L25L	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	0	1	1	2.003944	Q9HCH5	SYTL2_HUMAN		1	350	-		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	ENST00000528231.1	1	1	hg19	c.73C>T	CCDS53688.1	1																																																																																								0.081081		TCGA-IB-A5SQ-01A-11D-A32N-08	0.478	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	1	0	1		2	2	2	0	0	0	0	283	0	283	281	1	1.900000	-19.989460	1	0.150000	NM_206927		0	114	112	0	1331	1308	0	0	1	1		0	0	283	0	0	1.000000	1.568600e-01	0	2	0	7	0	114	1331
RDX	5962	broad.mit.edu	37	11	110108327	110108327	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr11:110108327G>A	ENST00000343115.4	-	11	1460	c.1141C>T	c.(1141-1143)Cga>Tga	p.R381*	RDX_ENST00000405097.1_Nonsense_Mutation_p.R381*|RDX_ENST00000530301.1_Intron|RDX_ENST00000528900.1_Nonsense_Mutation_p.R34*|RDX_ENST00000528498.1_Nonsense_Mutation_p.R381*|RDX_ENST00000544551.1_Nonsense_Mutation_p.R245*	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	381	Glu-rich.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		TCTTTTGCTCGTTTTCGTTCT	0.428																																					Esophageal Squamous(55;25 1062 11040 28755 44273)	ENST00000343115.4	0.990000	0.620000	0.950000	0.730000	0.850000	0.847335	0.850000	0.890000																										0				18						c.(1141-1143)Cga>Tga		radixin							181.0	172.0	175.0					11																	110108327		2201	4298	6499	SO:0001587	stop_gained	5962	0	0					g.chr11:110108327G>A	BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.1141C>T	chr11.hg19:g.110108327G>A	ENSP00000342830:p.Arg381*	1					RDX_ENST00000544551.1_Nonsense_Mutation_p.R245*|RDX_ENST00000405097.1_Nonsense_Mutation_p.R381*|RDX_ENST00000528498.1_Nonsense_Mutation_p.R381*|RDX_ENST00000530301.1_Intron|RDX_ENST00000528900.1_Nonsense_Mutation_p.R34*	p.R381*	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	0	1	1	2.003944	P35241	RADI_HUMAN		11	1460	-		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Nonsense_Mutation	SNP	ENST00000343115.4	0	1	hg19	c.1141C>T	CCDS8343.1	1	.	.	.	.	.	.	.	.	.	.	G	41	8.898136	0.98994	.	.	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000343115;ENST00000544551;ENST00000530085	.	.	.	5.78	4.84	0.62591	5.78	4.84	0.62591	.	0.354723	0.25230	N	0.032165	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	14.7001	0.69150	0.0:0.0:0.7205:0.2795	.	.	.	.	X	381;381;34;381;245;51	.	ENSP00000342830:R381X	R	-	1	2	2	RDX	109613537	109613537	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	1.566000	0.36396	1.364000	0.46038	0.650000	0.86243	CGA	0.081081		TCGA-IB-A5SQ-01A-11D-A32N-08	0.428	RDX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390535.2	1	0	1		2	2	2	0	0	0	0	93	0	93	92	1	1.900000	-8.919833	1	0.150000	NM_002906		0	34	34	0	424	418	0	0	1	0		0	0	93	0	0	1.000000	9.951046e-01	0	0	0	104	0	34	424
TAS2R50	259296	broad.mit.edu	37	12	11138881	11138881	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:11138881T>C	ENST00000506868.1	-	1	630	c.579A>G	c.(577-579)atA>atG	p.I193M	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	193					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						TCAGAAAAGATATCAGGGACA	0.408																																						ENST00000506868.1	1.000000	0.580000	1.000000	0.700000	0.850000	0.852566	0.850000	1.000000																										0				17						c.(577-579)atA>atG		taste receptor, type 2, member 50							131.0	120.0	124.0					12																	11138881		2203	4300	6503	SO:0001583	missense	259296	0	0					g.chr12:11138881T>C	AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.579A>G	chr12.hg19:g.11138881T>C	ENSP00000424040:p.Ile193Met	0					TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	p.I193M	NM_176890.2	NP_795371.2	1	2	3	2.042590	P59544	T2R50_HUMAN		1	630	-			P59545|Q2M255|Q645Y0	Missense_Mutation	SNP	ENST00000506868.1	1	1	hg19	c.579A>G	CCDS8638.1	1	.	.	.	.	.	.	.	.	.	.	T	11.88	1.770932	0.31320	.	.	ENSG00000212126	ENST00000506868	T	0.41065	1.01	2.19	-2.61	0.06171	2.19	-2.61	0.06171	.	2.272960	0.03713	U	0.250636	T	0.47432	0.1445	M	0.80028	2.48	0.09310	N	1	P	0.38535	0.635	B	0.42361	0.385	T	0.48980	-0.8986	10	0.72032	D	0.01	.	3.8053	0.08774	0.1852:0.0:0.3371:0.4777	.	193	P59544	T2R50_HUMAN	M	193	ENSP00000424040:I193M	ENSP00000424040:I193M	I	-	3	3	3	TAS2R50	11030148	11030148	0.000000	0.05858	0.000000	0.03702	0.283000	0.27025	-0.609000	0.05635	-0.349000	0.08274	0.260000	0.18958	ATA	0.159456		TCGA-IB-A5SQ-01A-11D-A32N-08	0.408	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370192.2	1	0	1		2	2	2	0	0	0	0	74	0	74	74	1	1.900000	-20.000000	1	0.150000	NM_176890		0	30	30	0	457	453	0	0	1			0	0	74	0	0	1.000000	0	0	0	0	0	0	30	457
CCDC60	160777	broad.mit.edu	37	12	119909828	119909828	+	Missense_Mutation	SNP	G	G	A	rs144740799	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:119909828G>A	ENST00000327554.2	+	3	665	c.200G>A	c.(199-201)cGt>cAt	p.R67H	CCDC60_ENST00000546345.1_3'UTR|RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	67										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AAGATAGGCCGTGGATATTTT	0.468													G|||	4	0.000798722	0.0	0.0	5008	,	,		19701	0.0		0.001	False		,,,				2504	0.0031					ENST00000327554.2	0.890000	0.390000	0.760000	0.490000	0.610000	0.632231	0.610000	0.600000																										0				40						c.(199-201)cGt>cAt		coiled-coil domain containing 60		G	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	98.0	95.0	96.0		200	2.0	0.5	12	dbSNP_134	96	17,8583	12.6+/-44.7	0,17,4283	yes	missense	CCDC60	NM_178499.3	29	0,21,6482	AA,AG,GG		0.1977,0.0908,0.1615	probably-damaging	67/551	119909828	21,12985	2203	4300	6503	SO:0001583	missense	160777	195	121412	55				g.chr12:119909828G>A	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.200G>A	chr12.hg19:g.119909828G>A	ENSP00000333374:p.Arg67His	1					CCDC60_ENST00000546345.1_3'UTR|RP11-768F21.1_ENST00000509470.2_lincRNA	p.R67H	NM_178499.3	NP_848594.2	0	1	1	1.897148	Q8IWA6	CCD60_HUMAN		3	665	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			Missense_Mutation	SNP	ENST00000327554.2	1	0	hg19	c.200G>A	CCDS9190.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.93	1.490322	0.26686	9.08E-4	0.001977	ENSG00000183273	ENST00000327554	T	0.25912	1.77	5.22	2.0	0.26442	5.22	2.0	0.26442	.	0.253027	0.26556	N	0.023712	T	0.39279	0.1072	M	0.68317	2.08	0.39642	D	0.970335	D	0.76494	0.999	D	0.64687	0.928	T	0.20107	-1.0285	9	.	.	.	-12.1971	5.4573	0.16598	0.399:0.0:0.601:0.0	.	67	Q8IWA6	CCD60_HUMAN	H	67	ENSP00000333374:R67H	.	R	+	2	0	0	CCDC60	118394211	118394211	0.438000	0.25602	0.512000	0.27736	0.025000	0.11179	0.906000	0.28517	0.593000	0.29745	-1.175000	0.01729	CGT	0.090666		TCGA-IB-A5SQ-01A-11D-A32N-08	0.468	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	1	0	1		2	2	2	0	0	0	0	84	0	84	84	1	1.900000	-4.790068	1	0.150000	NM_178499		0	21	22	0	400	394	0	0	1			0	0	84	0	0	0.999997	0	0	0	0	0	0	21	400
GPR162	27239	broad.mit.edu	37	12	6933844	6933844	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:6933844G>A	ENST00000311268.3	+	2	1567	c.780G>A	c.(778-780)tcG>tcA	p.S260S	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						TGGATGGCTCGGAGTCTGCCA	0.622																																						ENST00000311268.3	1.000000	0.580000	1.000000	0.720000	0.900000	0.876679	0.900000	1.000000																										0				18						c.(778-780)tcG>tcA		G protein-coupled receptor 162							54.0	55.0	54.0					12																	6933844		2203	4300	6503	SO:0001819	synonymous_variant	27239	1	121410	33				g.chr12:6933844G>A	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.780G>A	chr12.hg19:g.6933844G>A		0					GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	p.S260S	NM_019858.1	NP_062832.1	1	2	3	2.042590	Q16538	GP162_HUMAN		2	1567	+			Q16664|Q59EH5|Q66K56	Silent	SNP	ENST00000311268.3	1	1	hg19	c.780G>A	CCDS8563.1	1																																																																																								0.159456		TCGA-IB-A5SQ-01A-11D-A32N-08	0.622	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	1	0	1		20	2	2	0	0	0	1	59	0	59	57	1	1.900000	-2.774811	1	0.150000	NM_019858		0	24	24	0	348	338	0	0	1	0		0	0	59	0	0	0.749864	7.647126e-02	0	0	0	7	0	24	348
CD163	9332	broad.mit.edu	37	12	7635290	7635290	+	Missense_Mutation	SNP	C	C	A	rs139478533	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:7635290C>A	ENST00000359156.4	-	14	3398	c.3196G>T	c.(3196-3198)Gtc>Ttc	p.V1066F	CD163_ENST00000539632.1_5'Flank|CD163_ENST00000541972.1_Missense_Mutation_p.V1054F|CD163_ENST00000432237.2_Missense_Mutation_p.V1066F|CD163_ENST00000396620.3_Missense_Mutation_p.V1099F	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	1066					acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.V1066I(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	AATAATGCGACGAAAATGGCC	0.423																																						ENST00000359156.4	1.000000	0.810000	1.000000	0.950000	0.990000	0.980894	0.990000	1.000000																										1	Substitution - Missense(1)	p.V1066I(1)	lung(1)	76						c.(3196-3198)Gtc>Ttc		CD163 molecule	WF10(DB05389)						130.0	138.0	135.0					12																	7635290		2203	4300	6503	SO:0001583	missense	9332	0	0					g.chr12:7635290C>A	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.3196G>T	chr12.hg19:g.7635290C>A	ENSP00000352071:p.Val1066Phe	0					CD163_ENST00000541972.1_Missense_Mutation_p.V1054F|CD163_ENST00000396620.3_Missense_Mutation_p.V1099F|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000432237.2_Missense_Mutation_p.V1066F	p.V1066F	NM_004244.5	NP_004235.4	1	2	3	2.042590	Q86VB7	C163A_HUMAN		14	3398	-			C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	1	1	hg19	c.3196G>T	CCDS8578.1	1	.	.	.	.	.	.	.	.	.	.	C	9.345	1.064039	0.20067	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.01446	4.88;4.91;4.91;4.91	4.32	-0.639	0.11497	4.32	-0.639	0.11497	.	1.150940	0.06616	N	0.756554	T	0.01592	0.0051	N	0.08118	0	0.09310	N	1	P;P;P	0.37573	0.532;0.6;0.532	B;B;B	0.41860	0.185;0.368;0.185	T	0.51371	-0.8714	10	0.72032	D	0.01	.	7.6763	0.28488	0.0:0.3086:0.0:0.6914	.	1099;1066;1066	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	F	1066;1054;1099;1066	ENSP00000352071:V1066F;ENSP00000444071:V1054F;ENSP00000379863:V1099F;ENSP00000403885:V1066F	ENSP00000352071:V1066F	V	-	1	0	0	CD163	7526557	7526557	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.734000	0.04893	-0.102000	0.12197	-1.193000	0.01689	GTC	0.159456		TCGA-IB-A5SQ-01A-11D-A32N-08	0.423	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	1	0	1		2	2	2	0	0	0	0	99	0	99	99	1	1.900000	-11.544490	1	0.150000	NM_004244, NM_203416		0	43	44	0	484	477	0	0	1	0		0	0	99	0	0	1.000000	1	0	0	0	313	0	43	484
KRT80	144501	broad.mit.edu	37	12	52566851	52566851	+	Missense_Mutation	SNP	G	G	A	rs183742007	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:52566851G>A	ENST00000394815.2	-	6	1025	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W	KRT80_ENST00000313234.5_Missense_Mutation_p.R310W	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	310	Coil 2.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		ATCTGGGACCGCAGCTTCTGG	0.637													g|||	2	0.000399361	0.0	0.0	5008	,	,		17689	0.002		0.0	False		,,,				2504	0.0				GBM(178;2309 2916 15678 35873)	ENST00000394815.2	1.000000	0.110000	0.470000	0.170000	0.270000	0.364578	0.270000	0.240000																										0				5						c.(928-930)Cgg>Tgg		keratin 80		T	TRP/ARG,TRP/ARG	0,4406		0,0,2203	51.0	50.0	50.0		928,928	1.2	0.3	12		50	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	KRT80	NM_001081492.1,NM_182507.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	310/423,310/453	52566851	1,13005	2203	4300	6503	SO:0001583	missense	144501	34	121412	45				g.chr12:52566851G>A	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.928C>T	chr12.hg19:g.52566851G>A	ENSP00000378292:p.Arg310Trp	0					KRT80_ENST00000313234.5_Missense_Mutation_p.R310W	p.R310W	NM_182507.2	NP_872313.2	1	2	3	2.044214	Q6KB66	K2C80_HUMAN		6	1025	-			Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	ENST00000394815.2	0	1	hg19	c.928C>T	CCDS8821.2	0	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	g	14.10	2.434757	0.43224	0.0	1.16E-4	ENSG00000167767	ENST00000313234;ENST00000394815	D;D	0.89270	-2.49;-2.49	4.39	1.24	0.21308	4.39	1.24	0.21308	Filament (1);	0.000000	0.34725	N	0.003726	D	0.93726	0.7995	M	0.80422	2.495	0.19300	N	0.999974	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.984;0.991;0.998	D	0.88202	0.2884	10	0.87932	D	0	.	14.4952	0.67683	0.0:0.0:0.5428:0.4572	.	310;310;345	Q6KB66-2;Q6KB66;Q6KB66-3	.;K2C80_HUMAN;.	W	310	ENSP00000369361:R310W;ENSP00000378292:R310W	ENSP00000369361:R310W	R	-	1	2	2	KRT80	50853118	50853118	0.000000	0.05858	0.287000	0.24848	0.492000	0.33523	0.185000	0.16958	0.577000	0.29470	-0.217000	0.12591	CGG	0.159456		TCGA-IB-A5SQ-01A-11D-A32N-08	0.637	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	0	0	1		2	2	2	0	0	0	0	55	0	55	55	1	1.900000	-3.694595	1	0.150000	NM_182507		0	6	6	0	325	321	0	0	1	0		0	0	55	0	0	0.964007	2.880270e-01	0	0	0	51	0	6	325
DUSP6	1848	broad.mit.edu	37	12	89745479	89745479	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:89745479G>T	ENST00000279488.7	-	1	1569	c.338C>A	c.(337-339)tCg>tAg	p.S113*	DUSP6_ENST00000308385.6_Nonsense_Mutation_p.S113*|DUSP6_ENST00000547140.1_5'Flank|DUSP6_ENST00000547291.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	113	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						CCCGAGCACCGACTCGCCGCC	0.682																																					Colon(132;3456 5224)	ENST00000279488.7	1.000000	0.210000	0.870000	0.380000	0.600000	0.623294	0.600000	1.000000																										0				16						c.(337-339)tCg>tAg		dual specificity phosphatase 6							10.0	10.0	10.0					12																	89745479		2160	4241	6401	SO:0001587	stop_gained	1848	0	0					g.chr12:89745479G>T	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.338C>A	chr12.hg19:g.89745479G>T	ENSP00000279488:p.Ser113*	1					DUSP6_ENST00000308385.6_Nonsense_Mutation_p.S113*|DUSP6_ENST00000547291.1_5'Flank|DUSP6_ENST00000547140.1_5'Flank	p.S113*	NM_001946.2	NP_001937.2	0	1	1	1.897148	Q16828	DUS6_HUMAN		1	1569	-			O75109|Q53Y75|Q9BSH6	Nonsense_Mutation	SNP	ENST00000279488.7	0	1	hg19	c.338C>A	CCDS9033.1	0	.	.	.	.	.	.	.	.	.	.	G	46	12.912705	0.99705	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000548755	.	.	.	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6644	0.88200	0.0:0.0:1.0:0.0	.	.	.	.	X	113	.	ENSP00000279488:S113X	S	-	2	0	0	DUSP6	88269610	88269610	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	9.616000	0.98359	2.646000	0.89796	0.655000	0.94253	TCG	0.090666		TCGA-IB-A5SQ-01A-11D-A32N-08	0.682	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	1	0	1		2	2	2	0	0	0	0	20	0	20	20	1	1.900000	-8.334806	1	0.150000	NM_001946, NM_022652		0	4	4	0	76	75	0	0	1	1		0	0	20	0	0	0.889180	8.494142e-01	0	5	0	63	0	4	76
GCN1L1	10985	broad.mit.edu	37	12	120602186	120602186	+	Missense_Mutation	SNP	G	G	A	rs375873694		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr12:120602186G>A	ENST00000300648.6	-	18	1814	c.1802C>T	c.(1801-1803)gCg>gTg	p.A601V		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	601					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAGTCCGTGCGCCAGCTTAAA	0.612																																						ENST00000300648.6	0.240000	0.040000	0.180000	0.070000	0.120000	0.132143	0.120000	0.110000																										0				94						c.(1801-1803)gCg>gTg		GCN1 general control of amino-acid synthesis 1-like 1 (yeast)		G	VAL/ALA	0,3930		0,0,1965	87.0	91.0	90.0		1802	5.8	1.0	12		90	1,8319		0,1,4159	no	missense	GCN1L1	NM_006836.1	64	0,1,6124	AA,AG,GG		0.012,0.0,0.0082	benign	601/2672	120602186	1,12249	1965	4160	6125	SO:0001583	missense	10985	7	120908	43				g.chr12:120602186G>A	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1802C>T	chr12.hg19:g.120602186G>A	ENSP00000300648:p.Ala601Val	1						p.A601V	NM_006836.1	NP_006827	0	1	1	1.897148	Q92616	GCN1L_HUMAN		18	1814	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	0	1	hg19	c.1802C>T	CCDS41847.1	0	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713573	0.68730	0.0	1.2E-4	ENSG00000089154	ENST00000300648	T	0.04654	3.58	5.83	5.83	0.93111	5.83	5.83	0.93111	Armadillo-like helical (1);Domain of unknown function DUF3554 (1);Armadillo-type fold (1);	0.052807	0.85682	D	0.000000	T	0.05640	0.0148	L	0.49455	1.56	0.80722	D	1	B	0.29766	0.256	B	0.25291	0.059	T	0.39187	-0.9626	10	0.12103	T	0.63	.	13.3273	0.60467	0.0717:0.0:0.9283:0.0	.	601	Q92616	GCN1L_HUMAN	V	601	ENSP00000300648:A601V	ENSP00000300648:A601V	A	-	2	0	0	GCN1L1	119086569	119086569	1.000000	0.71417	0.965000	0.40720	0.937000	0.57800	7.375000	0.79646	2.769000	0.95229	0.655000	0.94253	GCG	0.090666		TCGA-IB-A5SQ-01A-11D-A32N-08	0.612	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1	0	0	1		2	2	2	0	0	0	0	127	0	127	126	1	1.900000	-2.734613	1	0.150000			0	6	7	0	642	631	0	0	1	0		0	0	127	0	0	0.963372	6.702748e-03	0	0	0	11	0	6	642
ATP12A	479	broad.mit.edu	37	13	25262530	25262530	+	Missense_Mutation	SNP	C	C	A	rs146927457	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr13:25262530C>A	ENST00000381946.3	+	4	469	c.302C>A	c.(301-303)aCg>aAg	p.T101K	ATP12A_ENST00000218548.6_Missense_Mutation_p.T101K			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	101					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CCCAAGCAGACGCCTGAGATC	0.587																																					Pancreas(156;1582 1935 18898 22665 26498)	ENST00000381946.3	1.000000	0.760000	1.000000	0.830000	0.910000	0.915991	0.910000	1.000000																										0				74						c.(301-303)aCg>aAg		ATPase, H+/K+ transporting, nongastric, alpha polypeptide							203.0	212.0	209.0					13																	25262530		2203	4300	6503	SO:0001583	missense	479	0	0					g.chr13:25262530C>A	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.302C>A	chr13.hg19:g.25262530C>A	ENSP00000371372:p.Thr101Lys	0					ATP12A_ENST00000218548.6_Missense_Mutation_p.T101K	p.T101K			0	0	0	1.959332	P54707	AT12A_HUMAN		4	469	+		Lung SC(185;0.0225)|Breast(139;0.077)	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	1	1	hg19	c.302C>A	CCDS31948.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097218	0.76870	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	T;T	0.77489	-1.1;-1.1	5.06	5.06	0.68205	5.06	5.06	0.68205	ATPase, P-type cation-transporter, N-terminal (2);	0.151867	0.45606	D	0.000357	T	0.82226	0.4991	M	0.64404	1.975	0.80722	D	1	D;D	0.55172	0.957;0.97	P;P	0.52758	0.708;0.473	D	0.83710	0.0187	10	0.56958	D	0.05	.	15.9701	0.80008	0.0:1.0:0.0:0.0	.	101;101	P54707-2;P54707	.;AT12A_HUMAN	K	101	ENSP00000218548:T101K;ENSP00000371372:T101K	ENSP00000218548:T101K	T	+	2	0	0	ATP12A	24160530	24160530	1.000000	0.71417	0.801000	0.32222	0.716000	0.41182	5.692000	0.68256	2.624000	0.88883	0.655000	0.94253	ACG	0.122354		TCGA-IB-A5SQ-01A-11D-A32N-08	0.587	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	1	0	1		2	2	2	0	0	0	0	389	0	389	387	1	1.900000	-19.901080	1	0.150000	NM_001676		0	122	122	0	1588	1563	0	0	1			0	0	389	0	0	1.000000	0	0	0	0	0	0	122	1588
TTC9	23508	broad.mit.edu	37	14	71134284	71134284	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr14:71134284G>T	ENST00000256367.2	+	2	753	c.410G>T	c.(409-411)tGc>tTc	p.C137F		NM_015351.1	NP_056166.1	Q92623	TTC9A_HUMAN	tetratricopeptide repeat domain 9	137										skin(1)	1				all cancers(60;0.00545)|BRCA - Breast invasive adenocarcinoma(234;0.00747)|OV - Ovarian serous cystadenocarcinoma(108;0.0538)		TCCATAGCCTGCCTGCTCCAG	0.512																																						ENST00000256367.2	1.000000	0.390000	1.000000	0.550000	0.740000	0.754007	0.740000	1.000000																										0				1						c.(409-411)tGc>tTc		tetratricopeptide repeat domain 9							47.0	47.0	47.0					14																	71134284		1967	4178	6145	SO:0001583	missense	23508	0	0					g.chr14:71134284G>T	D86980	CCDS45132.1	14q24.2	2014-08-12			ENSG00000133985			"""Tetratricopeptide (TTC) repeat domain containing"""	20267	protein-coding gene	gene with protein product		610488					Standard	NM_015351		Approved	KIAA0227, TTC9A	uc001xmi.2	Q92623	OTTHUMG00000172133	ENST00000256367.2:c.410G>T	chr14.hg19:g.71134284G>T	ENSP00000256367:p.Cys137Phe	0						p.C137F	NM_015351.1	NP_056166.1	1	2	3	2.015457	Q92623	TTC9A_HUMAN		2	753	+			Q86WT2	Missense_Mutation	SNP	ENST00000256367.2	1	1	hg19	c.410G>T	CCDS45132.1	0	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400773	0.62177	.	.	ENSG00000133985	ENST00000256367	T	0.17691	2.26	5.02	5.02	0.67125	5.02	5.02	0.67125	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.068925	0.64402	D	0.000014	T	0.51686	0.1689	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62353	-0.6872	10	0.87932	D	0	-15.8465	18.5279	0.90980	0.0:0.0:1.0:0.0	.	137	Q92623	TTC9A_HUMAN	F	137	ENSP00000256367:C137F	ENSP00000256367:C137F	C	+	2	0	0	TTC9	70204037	70204037	1.000000	0.71417	1.000000	0.80357	0.319000	0.28217	9.243000	0.95416	2.596000	0.87737	0.655000	0.94253	TGC	0.153808		TCGA-IB-A5SQ-01A-11D-A32N-08	0.512	TTC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417024.1	1	0	1		2	2	2	0	0	0	0	30	0	30	30	1	1.900000	-14.094270	1	0.150000	XM_027236		0	11	11	0	193	191	0	0	1	1		0	0	30	0	0	0.998386	5.461245e-01	0	15	0	17	0	11	193
FAM181A	90050	broad.mit.edu	37	14	94394668	94394668	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr14:94394668T>G	ENST00000267594.5	+	3	530	c.223T>G	c.(223-225)Ttc>Gtc	p.F75V	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000556222.1_Missense_Mutation_p.F13V|FAM181A_ENST00000557000.2_Missense_Mutation_p.F13V|FAM181A_ENST00000557719.1_Missense_Mutation_p.F13V	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	75										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						GCTGCTGAACTTCGTGAACCT	0.607																																						ENST00000267594.5	1.000000	0.370000	0.830000	0.490000	0.630000	0.659359	0.630000	0.610000																										0				18						c.(223-225)Ttc>Gtc		family with sequence similarity 181, member A							83.0	74.0	77.0					14																	94394668		2203	4300	6503	SO:0001583	missense	90050	0	0					g.chr14:94394668T>G	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.223T>G	chr14.hg19:g.94394668T>G	ENSP00000267594:p.Phe75Val	0					FAM181A_ENST00000557000.2_Missense_Mutation_p.F13V|FAM181A_ENST00000557719.1_Missense_Mutation_p.F13V|FAM181A_ENST00000556222.1_Missense_Mutation_p.F13V|FAM181A-AS1_ENST00000554742.1_RNA	p.F75V	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	1	2	3	2.015457	Q8N9Y4	F181A_HUMAN		3	530	+			B2RD39|Q96GY1	Missense_Mutation	SNP	ENST00000267594.5	1	1	hg19	c.223T>G	CCDS9914.1	0	.	.	.	.	.	.	.	.	.	.	T	24.6	4.550636	0.86127	.	.	ENSG00000140067	ENST00000557719;ENST00000267594;ENST00000556222;ENST00000554404;ENST00000557000	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	4.63	4.63	0.57726	4.63	4.63	0.57726	.	0.000000	0.64402	D	0.000019	T	0.81559	0.4848	M	0.64404	1.975	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.83842	0.0258	10	0.87932	D	0	-15.2697	14.0621	0.64806	0.0:0.0:0.0:1.0	.	75	Q8N9Y4	F181A_HUMAN	V	13;75;13;13;64	ENSP00000451802:F13V;ENSP00000267594:F75V;ENSP00000451678:F13V;ENSP00000452393:F13V	ENSP00000267594:F75V	F	+	1	0	0	FAM181A	93464421	93464421	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	8.018000	0.88722	1.733000	0.51620	0.260000	0.18958	TTC	0.153808		TCGA-IB-A5SQ-01A-11D-A32N-08	0.607	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	1	0	1		2	2	2	0	0	0	0	70	0	70	70	1	1.900000	-17.751810	1	0.150000	NM_138344		0	16	16	0	330	326	0	0	1			0	0	70	0	0	0.999932	0	0	0	0	0	0	16	330
RYR3	6263	broad.mit.edu	37	15	33795853	33795853	+	Missense_Mutation	SNP	G	G	A	rs572913737		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr15:33795853G>A	ENST00000389232.4	+	3	263	c.193G>A	c.(193-195)Gtc>Atc	p.V65I	RYR3_ENST00000415757.3_Missense_Mutation_p.V65I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	65					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGATCTCTGCGTCTGCAATTT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		20468	0.0		0.0	False		,,,				2504	0.001					ENST00000389232.4	1.000000	0.260000	0.990000	0.440000	0.680000	0.694824	0.680000	1.000000																										0				311						c.(193-195)Gtc>Atc		ryanodine receptor 3							56.0	57.0	57.0					15																	33795853		1941	4151	6092	SO:0001583	missense	6263	31	120856	42				g.chr15:33795853G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.193G>A	chr15.hg19:g.33795853G>A	ENSP00000373884:p.Val65Ile	0					RYR3_ENST00000415757.3_Missense_Mutation_p.V65I	p.V65I	NM_001036.3	NP_001027.3	0	1	1	2.007251	Q15413	RYR3_HUMAN		3	263	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	0	1	hg19	c.193G>A	CCDS45210.1	0	.	.	.	.	.	.	.	.	.	.	G	8.783	0.928601	0.18131	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98164	-4.76;-4.76	5.36	3.36	0.38483	5.36	3.36	0.38483	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.069726	0.56097	D	0.000033	D	0.87811	0.6271	N	0.00436	-1.5	0.32828	D	0.503591	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	D	0.85323	0.1085	10	0.22706	T	0.39	.	5.095	0.14729	0.3515:0.0:0.6485:0.0	.	65;65	Q15413-2;Q15413	.;RYR3_HUMAN	I	65	ENSP00000373884:V65I;ENSP00000399610:V65I	ENSP00000354735:V65I	V	+	1	0	0	RYR3	31583145	31583145	0.998000	0.40836	0.994000	0.49952	0.995000	0.86356	2.728000	0.47319	1.479000	0.48272	0.655000	0.94253	GTC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.473	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	0	0	1		2	2	2	0	0	0	0	16	0	16	16	1	1.900000	-4.379368	1	0.150000			0	5	5	0	96	96	0	0	1			0	0	16	0	0	0.939157	0	0	0	0	0	0	5	96
SPRED1	161742	broad.mit.edu	37	15	38643373	38643373	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr15:38643373G>C	ENST00000299084.4	+	7	1703	c.843G>C	c.(841-843)caG>caC	p.Q281H		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	281	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CCAGTATTCAGTTTTCTAAAC	0.398									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)	ENST00000299084.4	1.000000	0.900000	1.000000	0.990000	0.990000	0.994310	0.990000	1.000000																										0				25						c.(841-843)caG>caC		sprouty-related, EVH1 domain containing 1							82.0	82.0	82.0					15																	38643373		2200	4297	6497	SO:0001583	missense	161742	0	0		Legius syndrome	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	g.chr15:38643373G>C	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.843G>C	chr15.hg19:g.38643373G>C	ENSP00000299084:p.Gln281His	0						p.Q281H	NM_152594.2	NP_689807.1	0	1	1	2.007251	Q7Z699	SPRE1_HUMAN		7	1703	+		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	1	1	hg19	c.843G>C	CCDS32193.1	1	.	.	.	.	.	.	.	.	.	.	G	0.672	-0.801388	0.02841	.	.	ENSG00000166068	ENST00000299084	D	0.84298	-1.83	5.97	-0.439	0.12264	5.97	-0.439	0.12264	c-Kit-binding domain (1);	0.734032	0.14484	N	0.316776	T	0.69205	0.3085	N	0.14661	0.345	0.21325	N	0.999728	B	0.02656	0.0	B	0.01281	0.0	T	0.52358	-0.8586	10	0.24483	T	0.36	-18.8552	9.1329	0.36857	0.2898:0.2295:0.4807:0.0	.	281	Q7Z699	SPRE1_HUMAN	H	281	ENSP00000299084:Q281H	ENSP00000299084:Q281H	Q	+	3	2	2	SPRED1	36430665	36430665	0.847000	0.29606	0.971000	0.41717	0.969000	0.65631	0.024000	0.13555	-0.315000	0.08703	-0.153000	0.13522	CAG	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.398	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1	1	0	1		2	2	2	0	0	0	0	57	0	57	57	1	1.900000	-11.738120	1	0.150000			0	32	31	0	297	294	1	0	1	1		0	0	57	0	0	1.000000	9.194709e-01	0	9	0	33	0	32	297
KIAA0430	9665	broad.mit.edu	37	16	15729930	15729930	+	Silent	SNP	C	C	T	rs369662480		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr16:15729930C>T	ENST00000396368.3	-	3	620	c.414G>A	c.(412-414)tcG>tcA	p.S138S	KIAA0430_ENST00000602337.1_Silent_p.S138S|KIAA0430_ENST00000540441.2_Silent_p.S138S|KIAA0430_ENST00000344181.3_5'UTR|KIAA0430_ENST00000551742.1_Silent_p.S138S|KIAA0430_ENST00000548025.1_Silent_p.S138S	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	138					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGGTGCTTTGCGAGTCTAACA	0.547																																						ENST00000396368.3	1.000000	0.050000	0.210000	0.080000	0.130000	0.195668	0.130000	0.130000																										0				40						c.(412-414)tcG>tcA		KIAA0430		C	,,	1,4165		0,1,2082	170.0	170.0	170.0		414,414,414	-6.8	0.8	16		170	0,8422		0,0,4211	no	coding-synonymous,coding-synonymous,coding-synonymous	KIAA0430	NM_001184998.1,NM_001184999.1,NM_014647.3	,,	0,1,6293	TT,TC,CC		0.0,0.024,0.0079	,,	138/1743,138/1740,138/1743	15729930	1,12587	2083	4211	6294	SO:0001819	synonymous_variant	9665	16	121032	47				g.chr16:15729930C>T	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.414G>A	chr16.hg19:g.15729930C>T		0					KIAA0430_ENST00000602337.1_Silent_p.S138S|KIAA0430_ENST00000344181.3_5'UTR|KIAA0430_ENST00000540441.2_Silent_p.S138S|KIAA0430_ENST00000548025.1_Silent_p.S138S|KIAA0430_ENST00000551742.1_Silent_p.S138S	p.S138S	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	1	2	3	2.021185	Q9Y4F3	MARF1_HUMAN		3	620	-			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	ENST00000396368.3	0	1	hg19	c.414G>A	CCDS10562.2	0																																																																																								0.155070		TCGA-IB-A5SQ-01A-11D-A32N-08	0.547	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	0	0	1		18	2	2	1	0	1	1	141	0	141	139	1	1.900000	-1.980703	0	0.150000	NM_014647		0	7	7	0	750	737	0	0	0	0		1	0	141	0	0	0.018554	2.029803e-02	0	0	0	20	0	7	750
ARHGAP17	55114	broad.mit.edu	37	16	24942323	24942323	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr16:24942323A>G	ENST00000289968.6	-	19	2366	c.2297T>C	c.(2296-2298)cTa>cCa	p.L766P	ARHGAP17_ENST00000303665.5_Missense_Mutation_p.L688P|ARHGAP17_ENST00000441763.2_3'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	766	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CTGTTTTCCTAGGGGCGGAGT	0.617																																						ENST00000289968.6	1.000000	0.960000	1.000000	0.990000	0.990000	0.997926	0.990000	1.000000																										0				30						c.(2296-2298)cTa>cCa		Rho GTPase activating protein 17							70.0	85.0	80.0					16																	24942323		2197	4300	6497	SO:0001583	missense	55114	0	0					g.chr16:24942323A>G	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.2297T>C	chr16.hg19:g.24942323A>G	ENSP00000289968:p.Leu766Pro	0					ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.L688P	p.L766P	NM_001006634.1	NP_001006635.1	0	1	1	2.006314	Q68EM7	RHG17_HUMAN		19	2366	-			A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	1	1	hg19	c.2297T>C	CCDS32409.1	1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.466931	0.26335	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.20738	2.05;2.08	5.39	4.27	0.50696	5.39	4.27	0.50696	.	0.234011	0.21868	N	0.067922	T	0.34454	0.0898	L	0.41356	1.27	0.31123	N	0.708582	B;B;D;B;B	0.89917	0.004;0.003;1.0;0.137;0.215	B;B;D;B;B	0.91635	0.011;0.005;0.999;0.066;0.139	T	0.28138	-1.0053	10	0.54805	T	0.06	.	9.6939	0.40145	0.9158:0.0:0.0842:0.0	.	688;766;299;599;327	Q68EM7-2;Q68EM7;Q68EM7-7;B4DWE9;B4DVF3	.;RHG17_HUMAN;.;.;.	P	766;688;766	ENSP00000289968:L766P;ENSP00000303130:L688P	ENSP00000289968:L766P	L	-	2	0	0	ARHGAP17	24849824	24849824	0.862000	0.29867	0.018000	0.16275	0.069000	0.16628	3.540000	0.53611	0.829000	0.34733	0.454000	0.30748	CTA	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.617	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	1	0	1		2	2	2	0	0	0	0	165	0	165	163	1	1.900000	-19.482530	1	0.150000	NM_018054		0	72	71	0	710	704	1	0	1	1		0	0	165	0	0	1.000000	9.988698e-01	0	19	0	80	0	72	710
ZACN	353174	broad.mit.edu	37	17	74077738	74077738	+	Missense_Mutation	SNP	G	G	A	rs201259366		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr17:74077738G>A	ENST00000334586.5	+	7	865	c.782G>A	c.(781-783)cGc>cAc	p.R261H	EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000607838.1_3'UTR|EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000591724.1_Intron	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	261	Leu-rich.				ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						GCCATTGAGCGCATAGGCTAC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		18545	0.0		0.001	False		,,,				2504	0.0					ENST00000334586.5	0.240000	0.040000	0.180000	0.070000	0.120000	0.132377	0.120000	0.120000																										0				11						c.(781-783)cGc>cAc		zinc activated ligand-gated ion channel							123.0	114.0	117.0					17																	74077738		2203	4300	6503	SO:0001583	missense	353174	1	121412	33				g.chr17:74077738G>A	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.782G>A	chr17.hg19:g.74077738G>A	ENSP00000334854:p.Arg261His	0					EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000591724.1_Intron|EXOC7_ENST00000607838.1_3'UTR	p.R261H	NM_180990.3	NP_851321.2	0	1	1	2.012279	Q401N2	ZACN_HUMAN		7	865	+			Q2TB29|Q6ZWK3|Q86YW4	Missense_Mutation	SNP	ENST00000334586.5	0	1	hg19	c.782G>A	CCDS11740.2	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	9.702	1.154853	0.21371	.	.	ENSG00000186919	ENST00000334586	D	0.88431	-2.38	4.64	2.61	0.31194	4.64	2.61	0.31194	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.154450	0.43110	N	0.000602	D	0.83755	0.5323	M	0.78285	2.405	0.20196	N	0.999922	P	0.42518	0.782	B	0.28232	0.087	T	0.77517	-0.2558	10	0.87932	D	0	-15.7124	6.8633	0.24079	0.0924:0.0:0.7344:0.1732	.	261	Q401N2	ZACN_HUMAN	H	261	ENSP00000334854:R261H	ENSP00000334854:R261H	R	+	2	0	0	ZACN	71589333	71589333	0.751000	0.28327	0.017000	0.16124	0.217000	0.24651	1.805000	0.38883	0.557000	0.29117	0.505000	0.49811	CGC	0.146158		TCGA-IB-A5SQ-01A-11D-A32N-08	0.622	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	0	0	1		2	2	2	0	0	0	0	136	0	136	134	1	1.900000	-1.756895	0	0.150000	NM_180990		0	6	4	0	688	678	0	0	1	0		0	0	136	0	0	0.963140	5.713662e-01	0	0	0	203	0	6	688
SMARCA4	6597	broad.mit.edu	37	19	11143994	11143994	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr19:11143994G>A	ENST00000429416.3	+	27	3856	c.3575G>A	c.(3574-3576)cGc>cAc	p.R1192H	SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1192H|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1192H|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1192H	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1192	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CGAGCCCACCGCATCGGGCAG	0.612			"""F, N, Mis"""		NSCLC																																	ENST00000429416.3	0.910000	0.370000	0.760000	0.480000	0.610000	0.628884	0.610000	0.590000				Rec	yes			Rec	yes		19	19p13.2	19p13.2	6597	F, N, Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""				E	E			NSCLC		1	Unknown(1)	p.?(1)	lung(1)	163						c.(3574-3576)cGc>cAc		SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4							63.0	62.0	62.0					19																	11143994		2203	4300	6503	SO:0001583	missense	6597	0	0					g.chr19:11143994G>A	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3575G>A	chr19.hg19:g.11143994G>A	ENSP00000395654:p.Arg1192His	0					SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1192H|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1192H|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1192H|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1192H	p.R1192H	NM_001128844.1	NP_001122316.1	0	1	1	2.007438	P51532	SMCA4_HUMAN		27	3856	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	1	1	hg19	c.3575G>A	CCDS12253.1	0	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769759	0.90020	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57;-4.57;-4.57	4.74	4.74	0.60224	4.74	4.74	0.60224	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.99863	4.86	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97804	1.0246	10	0.87932	D	0	-34.1151	16.7067	0.85374	0.0:0.0:1.0:0.0	.	1192;1192;1192;1192;1192;412;1192	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	H	1192;1192;1256;1192;1192;1192;1192;1192	ENSP00000395654:R1192H;ENSP00000350720:R1192H;ENSP00000343896:R1192H;ENSP00000445036:R1192H;ENSP00000392837:R1192H;ENSP00000397783:R1192H;ENSP00000414727:R1192H	ENSP00000343896:R1192H	R	+	2	0	0	SMARCA4	11004994	11004994	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.319000	0.96338	2.488000	0.83962	0.558000	0.71614	CGC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.612	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	1	0	1		2	2	8	0	0	0	0	73	0	73	73	1	1.900000	-4.595885	1	0.150000	NM_003072		0	18	18	0	374	366	1	0	1	1	1	0	1	73	573	0	0.999980	9.647176e-01	9.999961e-01	16	55	100	895	18	374
SHD	56961	broad.mit.edu	37	19	4283173	4283173	+	Missense_Mutation	SNP	C	C	T	rs200550741	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr19:4283173C>T	ENST00000543264.2	+	3	1989	c.526C>T	c.(526-528)Cgg>Tgg	p.R176W	SHD_ENST00000599689.1_Missense_Mutation_p.R176W	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	176										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGATGAACGGCCAGCAGA	0.567													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		18620	0.0		0.0	False		,,,				2504	0.0					ENST00000543264.2	1.000000	0.530000	1.000000	0.660000	0.820000	0.826884	0.820000	1.000000																										0				14						c.(526-528)Cgg>Tgg		Src homology 2 domain containing transforming protein D							59.0	57.0	58.0					19																	4283173		2203	4300	6503	SO:0001583	missense	56961	6	121412	40				g.chr19:4283173C>T	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.526C>T	chr19.hg19:g.4283173C>T	ENSP00000446058:p.Arg176Trp	0					SHD_ENST00000599689.1_Missense_Mutation_p.R176W	p.R176W	NM_020209.3	NP_064594.3	0	1	1	2.007438	Q96IW2	SHD_HUMAN		3	1989	+			Q96NC2	Missense_Mutation	SNP	ENST00000543264.2	1	1	hg19	c.526C>T	CCDS12125.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	21.6	4.175397	0.78564	.	.	ENSG00000105251	ENST00000543264;ENST00000221852	T	0.35973	1.28	5.47	3.27	0.37495	5.47	3.27	0.37495	.	0.000000	0.85682	D	0.000000	T	0.59362	0.2188	M	0.80332	2.49	0.42300	D	0.992177	D	0.89917	1.0	D	0.76071	0.987	T	0.63346	-0.6658	10	0.87932	D	0	-10.4695	11.5411	0.50667	0.4875:0.5125:0.0:0.0	.	176	Q96IW2	SHD_HUMAN	W	176;91	ENSP00000446058:R176W	ENSP00000221852:R91W	R	+	1	2	2	SHD	4234173	4234173	0.997000	0.39634	0.968000	0.41197	0.970000	0.65996	0.914000	0.28624	0.607000	0.29982	0.448000	0.29417	CGG	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.567	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	1	0	1		2	2	2	0	0	0	0	48	0	48	48	1	1.900000	-3.222166	1	0.150000	NM_020209		0	21	21	0	315	311	0	0	1			0	0	48	0	0	0.999998	0	0	0	0	0	0	21	315
PKN1	5585	broad.mit.edu	37	19	14581660	14581660	+	Silent	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr19:14581660C>T	ENST00000242783.6	+	21	2787	c.2622C>T	c.(2620-2622)ttC>ttT	p.F874F	PKN1_ENST00000342216.4_Silent_p.F880F	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	874	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						AGCCCTTCTTCAGGGTGAGAT	0.607																																					NSCLC(185;2539 2965 10733 52867)	ENST00000242783.6	1.000000	0.620000	1.000000	0.760000	0.920000	0.899389	0.920000	1.000000																										0				31						c.(2620-2622)ttC>ttT		protein kinase N1							84.0	100.0	95.0					19																	14581660		2024	4174	6198	SO:0001819	synonymous_variant	5585	0	0					g.chr19:14581660C>T	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2622C>T	chr19.hg19:g.14581660C>T		0					PKN1_ENST00000342216.4_Silent_p.F880F	p.F874F	NM_002741.3	NP_002732.3	0	1	1	2.007438	Q16512	PKN1_HUMAN		21	2787	+			A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Silent	SNP	ENST00000242783.6	1	1	hg19	c.2622C>T	CCDS42513.1	1																																																																																								0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.607	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	1	0	1		2	2	2	0	0	0	0	57	0	57	57	1	1.900000	-3.318806	1	0.150000	NM_002741, NM_213560		0	26	26	0	344	336	0	0	1	1		0	0	57	0	0	1.000000	9.999999e-01	0	41	0	318	0	26	344
GIPR	2696	broad.mit.edu	37	19	46178073	46178073	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr19:46178073C>G	ENST00000590918.1	+	7	721	c.622C>G	c.(622-624)Ctg>Gtg	p.L208V	GIPR_ENST00000304207.8_Missense_Mutation_p.L172V|GIPR_ENST00000263281.3_Missense_Mutation_p.L208V|MIR642A_ENST00000385039.1_RNA	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	208					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		GGCCCTTGCGCTGTGGAACCA	0.577																																						ENST00000590918.1	0.490000	0.070000	0.360000	0.130000	0.230000	0.252861	0.230000	0.210000																										0				12						c.(622-624)Ctg>Gtg		gastric inhibitory polypeptide receptor							67.0	58.0	61.0					19																	46178073		2203	4300	6503	SO:0001583	missense	2696	0	0					g.chr19:46178073C>G		CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.622C>G	chr19.hg19:g.46178073C>G	ENSP00000467494:p.Leu208Val	0					GIPR_ENST00000304207.8_Missense_Mutation_p.L172V|MIR642A_ENST00000385039.1_RNA|GIPR_ENST00000263281.3_Missense_Mutation_p.L208V	p.L208V	NM_000164.2	NP_000155.1	0	1	1	2.008035	P48546	GIPR_HUMAN		7	721	+		Ovarian(192;0.051)|all_neural(266;0.112)	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Missense_Mutation	SNP	ENST00000590918.1	0	1	hg19	c.622C>G	CCDS12671.1	0	.	.	.	.	.	.	.	.	.	.	C	0.067	-1.209882	0.01555	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	T;T	0.57907	0.37;1.21	4.29	2.14	0.27477	4.29	2.14	0.27477	GPCR, family 2-like (1);	0.694941	0.12035	N	0.505605	T	0.29749	0.0743	N	0.04959	-0.14	0.09310	N	1	B;P;B	0.40000	0.187;0.698;0.17	B;B;B	0.40825	0.145;0.341;0.2	T	0.09100	-1.0690	10	0.29301	T	0.29	.	6.6579	0.22998	0.0:0.7816:0.0:0.2184	.	172;208;208	B7WP14;P48546;P48546-2	.;GIPR_HUMAN;.	V	208;172	ENSP00000263281:L208V;ENSP00000305321:L172V	ENSP00000263281:L208V	L	+	1	2	2	GIPR	50869913	50869913	0.163000	0.22920	0.137000	0.22149	0.030000	0.12068	0.778000	0.26732	0.565000	0.29255	-0.258000	0.10820	CTG	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.577	GIPR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459640.1	0	0	0		2	2	2	0	0	0	0	44	0	44	44	1	1.900000	-5.778242	1	0.150000			0	4	0	0	250	246	0	0	0	0		0	0	44	0	0	0.883417	8.748650e-03	0	0	0	7	0	4	250
KLK11	11012	broad.mit.edu	37	19	51527499	51527499	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr19:51527499C>T	ENST00000594768.1	-	4	546	c.361G>A	c.(361-363)Gcc>Acc	p.A121T	KLK11_ENST00000319720.7_Missense_Mutation_p.A89T|KLK11_ENST00000600362.1_Intron|KLK11_ENST00000594458.1_5'UTR|KLK11_ENST00000391804.3_Missense_Mutation_p.A114T|KLK11_ENST00000453757.3_Missense_Mutation_p.A89T	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	121	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		GACTCAGTGGCTGTCCGGGTC	0.582																																						ENST00000594768.1	0.830000	0.380000	0.710000	0.480000	0.580000	0.602366	0.580000	0.590000																										0				7						c.(361-363)Gcc>Acc		kallikrein-related peptidase 11							105.0	98.0	101.0					19																	51527499		2203	4300	6503	SO:0001583	missense	11012	0	0					g.chr19:51527499C>T	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.361G>A	chr19.hg19:g.51527499C>T	ENSP00000473047:p.Ala121Thr	0					KLK11_ENST00000600362.1_Intron|KLK11_ENST00000319720.7_Missense_Mutation_p.A89T|KLK11_ENST00000594458.1_5'UTR|KLK11_ENST00000453757.3_Missense_Mutation_p.A89T|KLK11_ENST00000391804.3_Missense_Mutation_p.A114T	p.A121T	NM_144947.1	NP_659196.1	0	1	1	2.008035	Q9UBX7	KLK11_HUMAN		4	546	-		all_neural(266;0.026)	O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	1	1	hg19	c.361G>A	CCDS12818.1	0	.	.	.	.	.	.	.	.	.	.	c	13.83	2.354005	0.41700	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	D;D;D	0.92965	-3.14;-3.14;-3.14	4.32	3.25	0.37280	4.32	3.25	0.37280	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37906	U	0.001893	D	0.86531	0.5955	L	0.37897	1.145	0.30572	N	0.763413	B;B	0.29341	0.242;0.242	B;B	0.32393	0.145;0.145	D	0.83710	0.0187	10	0.72032	D	0.01	.	7.0907	0.25282	0.1979:0.6103:0.1918:0.0	.	121;114	Q9UBX7;Q8IXD7	KLK11_HUMAN;.	T	114;89;89;121	ENSP00000375680:A114T;ENSP00000324269:A89T;ENSP00000413958:A89T	ENSP00000324269:A89T	A	-	1	0	0	KLK11	56219311	56219311	0.152000	0.22762	0.709000	0.30452	0.782000	0.44232	0.785000	0.26830	0.977000	0.38444	0.462000	0.41574	GCC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.582	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464314.2	1	0	1		2	2	2	0	0	0	0	108	0	108	104	1	1.900000	-4.825924	1	0.150000	NM_006853		0	24	24	0	518	509	1	0	1	1		0	0	108	0	0	1.000000	8.559714e-01	0	40	0	37	0	24	518
DCST1	149095	broad.mit.edu	37	1	155014235	155014235	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr1:155014235G>A	ENST00000295542.1	+	8	890	c.794G>A	c.(793-795)cGc>cAc	p.R265H	DCST1_ENST00000368419.2_Missense_Mutation_p.R265H|DCST1_ENST00000392480.1_Missense_Mutation_p.R265H|DCST1_ENST00000423025.2_Missense_Mutation_p.R240H	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	265						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TGGTTTGACCGCAAGCATGAA	0.537																																						ENST00000295542.1	1.000000	0.080000	0.300000	0.130000	0.190000	0.261969	0.190000	0.190000																										0				27						c.(793-795)cGc>cAc		DC-STAMP domain containing 1							175.0	132.0	147.0					1																	155014235		2203	4300	6503	SO:0001583	missense	149095	1	121412	37				g.chr1:155014235G>A	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.794G>A	chr1.hg19:g.155014235G>A	ENSP00000295542:p.Arg265His	1					DCST1_ENST00000392480.1_Missense_Mutation_p.R265H|DCST1_ENST00000368419.2_Missense_Mutation_p.R265H|DCST1_ENST00000423025.2_Missense_Mutation_p.R240H	p.R265H	NM_152494.3	NP_689707.2	1	3	4	2.281435	Q5T197	DCST1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.000434)	8	890	+	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	ENST00000295542.1	0	1	hg19	c.794G>A	CCDS1083.1	0	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935876	0.34189	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	4.73	-6.0	0.02206	4.73	-6.0	0.02206	.	2.011450	0.02298	N	0.070951	T	0.11024	0.0269	N	0.00926	-1.1	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.13872	-1.0493	10	0.41790	T	0.15	0.7543	13.3586	0.60642	0.386:0.0:0.614:0.0	.	240;290;265	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	H	265;265;240;265	ENSP00000295542:R265H;ENSP00000376271:R265H;ENSP00000387369:R240H;ENSP00000357404:R265H	ENSP00000295542:R265H	R	+	2	0	0	DCST1	153280859	153280859	0.000000	0.05858	0.001000	0.08648	0.559000	0.35586	-1.570000	0.02140	-1.129000	0.02918	-1.332000	0.01269	CGC	0.252090		TCGA-IB-A5SQ-01A-11D-A32N-08	0.537	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	0	0	1		2	2	2	0	0	0	0	90	0	90	90	1	1.900000	-1.962440	0	0.150000	NM_152494		0	7	7	0	582	579	0	0	1			0	0	90	0	0	0.980349	0	0	0	0	0	0	7	582
LAMB3	3914	broad.mit.edu	37	1	209800758	209800758	+	Silent	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr1:209800758C>T	ENST00000356082.4	-	12	1589	c.1455G>A	c.(1453-1455)ccG>ccA	p.P485P	LAMB3_ENST00000391911.1_Silent_p.P485P|LAMB3_ENST00000367030.3_Silent_p.P485P	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	485	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GGGAGTTGTGCGGGTCGCAGG	0.647											OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000356082.4	0.560000	0.100000	0.420000	0.170000	0.280000	0.304593	0.280000	0.260000																										0				45						c.(1453-1455)ccG>ccA		laminin, beta 3							56.0	47.0	50.0					1																	209800758		2203	4300	6503	SO:0001819	synonymous_variant	3914	0	0					g.chr1:209800758C>T	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1455G>A	chr1.hg19:g.209800758C>T		0		OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2185	LAMB3_ENST00000391911.1_Silent_p.P485P|LAMB3_ENST00000367030.3_Silent_p.P485P	p.P485P	NM_000228.2	NP_000219.2	0	1	1	2.008661	Q13751	LAMB3_HUMAN		12	1589	-			D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Silent	SNP	ENST00000356082.4	0	1	hg19	c.1455G>A	CCDS1487.1	0																																																																																								0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.647	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	0	0	1		2	2	2	0	0	0	0	44	0	44	44	1	1.900000	-2.532101	1	0.150000	NM_000228		0	5	5	0	248	248	0	0	1	0		0	0	44	0	0	0.938151	9.668803e-01	0	0	0	316	0	5	248
MACF1	23499	broad.mit.edu	37	1	39833893	39833893	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr1:39833893C>T	ENST00000372915.3	+	49	12947	c.12860C>T	c.(12859-12861)tCt>tTt	p.S4287F	MACF1_ENST00000317713.7_Missense_Mutation_p.S2220F|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Missense_Mutation_p.S2220F|MACF1_ENST00000539005.1_Missense_Mutation_p.S2220F|MACF1_ENST00000545844.1_Missense_Mutation_p.S2220F|MACF1_ENST00000567887.1_Missense_Mutation_p.S4319F|MACF1_ENST00000564288.1_Missense_Mutation_p.S4282F|MACF1_ENST00000289893.4_Missense_Mutation_p.S2722F			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4287					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAACTGAGCTCTTGTGGCTTT	0.448																																						ENST00000372915.3	1.000000	0.650000	1.000000	0.810000	0.990000	0.933194	0.990000	1.000000																										0				203						c.(12859-12861)tCt>tTt		microtubule-actin crosslinking factor 1							121.0	115.0	117.0					1																	39833893		2203	4300	6503	SO:0001583	missense	23499	0	0					g.chr1:39833893C>T	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12860C>T	chr1.hg19:g.39833893C>T	ENSP00000362006:p.Ser4287Phe	1					MACF1_ENST00000564288.1_Missense_Mutation_p.S4282F|MACF1_ENST00000289893.4_Missense_Mutation_p.S2722F|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Missense_Mutation_p.S2220F|MACF1_ENST00000539005.1_Missense_Mutation_p.S2220F|MACF1_ENST00000567887.1_Missense_Mutation_p.S4319F|MACF1_ENST00000317713.7_Missense_Mutation_p.S2220F|MACF1_ENST00000545844.1_Missense_Mutation_p.S2220F	p.S4287F			2	2	4	2.125106	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)	49	12947	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	1	1	hg19	c.12860C>T		1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340087	0.81911	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.65178	-0.11;1.23;-0.11;-0.14;0.03;1.0	5.85	3.83	0.44106	5.85	3.83	0.44106	.	0.499782	0.18532	N	0.138463	T	0.72993	0.3530	L	0.53249	1.67	0.80722	D	1	D;B;P;B	0.76494	0.999;0.089;0.942;0.033	D;B;P;B	0.72982	0.979;0.052;0.708;0.03	T	0.73418	-0.3989	10	0.52906	T	0.07	.	12.4341	0.55590	0.1331:0.7388:0.1281:0.0	.	4287;2220;2220;2185	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3	MACF1_HUMAN;.;.;.	F	2220;4287;2220;2220;2220;2722	ENSP00000439537:S2220F;ENSP00000362006:S4287F;ENSP00000354573:S2220F;ENSP00000313438:S2220F;ENSP00000444364:S2220F;ENSP00000289893:S2722F	ENSP00000289893:S2722F	S	+	2	0	0	MACF1	39606480	39606480	0.979000	0.34478	0.995000	0.50966	0.977000	0.68977	1.987000	0.40687	1.418000	0.47098	0.467000	0.42956	TCT	0.196977		TCGA-IB-A5SQ-01A-11D-A32N-08	0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	1	0	1		2	2	2	0	0	0	0	72	0	72	70	1	1.900000	-3.017775	1	0.150000	NM_033044		0	25	25	0	345	342	0	0	1	0	1	0	0	72	385	0	1.000000	1.048907e-01	1	1	35	7	594	25	345
WNT3A	89780	broad.mit.edu	37	1	228210456	228210456	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr1:228210456C>T	ENST00000284523.1	+	2	238	c.160C>T	c.(160-162)Cgc>Tgc	p.R54C	WNT3A_ENST00000366753.2_Missense_Mutation_p.R54C	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	54					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				CAAGCAGCTCCGCTTCTGCAG	0.652																																						ENST00000284523.1	1.000000	0.850000	1.000000	0.990000	0.990000	0.989552	0.990000	1.000000																										0				12						c.(160-162)Cgc>Tgc		wingless-type MMTV integration site family, member 3A							53.0	51.0	52.0					1																	228210456		2203	4300	6503	SO:0001583	missense	89780	0	0					g.chr1:228210456C>T	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.160C>T	chr1.hg19:g.228210456C>T	ENSP00000284523:p.Arg54Cys	0					WNT3A_ENST00000366753.2_Missense_Mutation_p.R54C	p.R54C	NM_033131.3	NP_149122.1	0	1	1	2.008661	P56704	WNT3A_HUMAN		2	238	+		Prostate(94;0.0405)	Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	1	1	hg19	c.160C>T	CCDS1564.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803864	0.90623	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.77489	-1.1;-1.1	4.47	4.47	0.54385	4.47	4.47	0.54385	.	0.068061	0.64402	D	0.000010	D	0.90573	0.7045	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.99	D	0.93130	0.6532	10	0.87932	D	0	.	16.9039	0.86120	0.0:1.0:0.0:0.0	.	54;54	P56704;Q3SY79	WNT3A_HUMAN;.	C	54	ENSP00000284523:R54C;ENSP00000355715:R54C	ENSP00000284523:R54C	R	+	1	0	0	WNT3A	226277079	226277079	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.534000	0.82004	2.311000	0.77944	0.586000	0.80456	CGC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.652	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	1	0	1		2	2	2	0	0	0	0	63	0	63	63	1	1.900000	-3.017764	1	0.150000	NM_033131		0	29	29	0	281	275	0	0	1			0	0	63	0	0	1.000000	0	0	0	0	0	0	29	281
YTHDF1	54915	broad.mit.edu	37	20	61834082	61834082	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr20:61834082G>A	ENST00000370339.3	-	4	1551	c.1210C>T	c.(1210-1212)Cgc>Tgc	p.R404C	YTHDF1_ENST00000370333.4_Missense_Mutation_p.R354C|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	404	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.						N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						TTAATGGAGCGGTGGATGTCG	0.552																																						ENST00000370339.3	1.000000	0.610000	1.000000	0.720000	0.850000	0.857691	0.850000	1.000000																										0				24						c.(1210-1212)Cgc>Tgc		YTH domain family, member 1							97.0	85.0	89.0					20																	61834082		2203	4300	6503	SO:0001583	missense	54915	0	0					g.chr20:61834082G>A	AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.1210C>T	chr20.hg19:g.61834082G>A	ENSP00000359364:p.Arg404Cys	0					YTHDF1_ENST00000370334.4_Intron|YTHDF1_ENST00000370333.4_Missense_Mutation_p.R354C	p.R404C	NM_017798.3	NP_060268.2	0	1	1	2.006475	Q9BYJ9	YTHD1_HUMAN		4	1551	-			Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	1	1	hg19	c.1210C>T	CCDS13511.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105768	0.77096	.	.	ENSG00000149658	ENST00000370339;ENST00000370333	T;T	0.31769	1.48;1.48	4.72	4.72	0.59763	4.72	4.72	0.59763	YTH domain (2);	0.047653	0.85682	N	0.000000	T	0.64438	0.2598	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.74179	-0.3749	10	0.87932	D	0	-12.6731	18.0486	0.89341	0.0:0.0:1.0:0.0	.	404	Q9BYJ9	YTHD1_HUMAN	C	404;354	ENSP00000359364:R404C;ENSP00000359358:R354C	ENSP00000359358:R354C	R	-	1	0	0	YTHDF1	61304527	61304527	1.000000	0.71417	0.999000	0.59377	0.762000	0.43233	9.669000	0.98622	2.339000	0.79563	0.591000	0.81541	CGC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.552	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	1	0	1		2	2	2	0	0	0	0	93	0	93	92	1	1.900000	-2.540643	1	0.150000	NM_017798		0	36	37	0	518	507	1	0	1	1		0	0	93	0	0	1.000000	9.526933e-01	0	19	0	55	0	36	518
SLC5A3	6526	broad.mit.edu	37	21	35468701	35468701	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr21:35468701G>A	ENST00000381151.3	+	2	1716	c.1204G>A	c.(1204-1206)Gca>Aca	p.A402T	MRPS6_ENST00000399312.2_Intron|SLC5A3_ENST00000608209.1_Missense_Mutation_p.A402T|AP000320.7_ENST00000362077.4_RNA			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	402					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						CCGCAAGAGCGCAAGCTCCCG	0.478																																						ENST00000381151.3	0.390000	0.070000	0.290000	0.120000	0.190000	0.211274	0.190000	0.180000																										0				20						c.(1204-1206)Gca>Aca		solute carrier family 5 (sodium/myo-inositol cotransporter), member 3							89.0	81.0	84.0					21																	35468701		2203	4300	6503	SO:0001583	missense	6526	0	0					g.chr21:35468701G>A		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1204G>A	chr21.hg19:g.35468701G>A	ENSP00000370543:p.Ala402Thr	0					MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.A402T	p.A402T			0	1	1	2.014866	P53794	SC5A3_HUMAN		2	1716	+			O43489	Missense_Mutation	SNP	ENST00000381151.3	0	1	hg19	c.1204G>A	CCDS33549.1	0	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122917	0.77436	.	.	ENSG00000198743	ENST00000381151	D	0.89196	-2.48	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.94301	0.8169	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.94516	0.7723	10	0.87932	D	0	.	18.5913	0.91214	0.0:0.0:1.0:0.0	.	402	P53794	SC5A3_HUMAN	T	402	ENSP00000370543:A402T	ENSP00000370543:A402T	A	+	1	0	0	SLC5A3	34390571	34390571	1.000000	0.71417	0.584000	0.28653	0.979000	0.70002	7.792000	0.85828	2.677000	0.91161	0.655000	0.94253	GCA	0.146158		TCGA-IB-A5SQ-01A-11D-A32N-08	0.478	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1	0	0	1		2	2	2	0	0	0	0	48	0	48	47	1	1.900000	-2.648972	1	0.150000			0	5	5	0	364	360	0	0	1	0		0	0	48	0	0	0.936150	2.021933e-02	0	0	0	13	0	5	364
MKL1	57591	broad.mit.edu	37	22	40807886	40807886	+	Silent	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr22:40807886C>T	ENST00000355630.3	-	15	2894	c.2304G>A	c.(2302-2304)ccG>ccA	p.P768P	MKL1_ENST00000407029.1_Silent_p.P768P|MKL1_ENST00000396617.3_Missense_Mutation_p.A772T|MKL1_ENST00000402042.1_Silent_p.P718P	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	768	Pro-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCAGGGATGGCGGCTCCTTGA	0.532			T	RBM15	acute megakaryocytic leukemia																																	ENST00000355630.3	0.200000	0.030000	0.150000	0.060000	0.100000	0.114246	0.100000	0.090000				Dom	yes			Dom	yes		22	22q13	22q13	57591	T	megakaryoblastic leukemia (translocation) 1				L	L	RBM15		acute megakaryocytic leukemia		0				30						c.(2302-2304)ccG>ccA		megakaryoblastic leukemia (translocation) 1							97.0	107.0	103.0					22																	40807886		2157	4183	6340	SO:0001819	synonymous_variant	57591	30	119246	48				g.chr22:40807886C>T	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.2304G>A	chr22.hg19:g.40807886C>T		1					MKL1_ENST00000407029.1_Silent_p.P768P|MKL1_ENST00000396617.3_Missense_Mutation_p.A772T|MKL1_ENST00000402042.1_Silent_p.P718P	p.P768P	NM_020831.3	NP_065882.1	1	2	3	2.016816	Q969V6	MKL1_HUMAN		15	2894	-			Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Silent	SNP	ENST00000355630.3	0	1	hg19	c.2304G>A	CCDS14003.1	0	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235131	0.39498	.	.	ENSG00000196588	ENST00000396617	T	0.46451	0.87	4.92	-7.52	0.01341	4.92	-7.52	0.01341	.	.	.	.	.	T	0.21022	0.0506	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29912	-0.9996	8	0.54805	T	0.06	-2.7668	1.9139	0.03293	0.1882:0.3859:0.1944:0.2315	.	772	E7ER32	.	T	772	ENSP00000379861:A772T	ENSP00000379861:A772T	A	-	1	0	0	MKL1	39137832	39137832	0.000000	0.05858	0.090000	0.20809	0.761000	0.43186	-0.214000	0.09292	-0.755000	0.04709	-1.744000	0.00683	GCC	0.209302		TCGA-IB-A5SQ-01A-11D-A32N-08	0.532	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	0	0	1		2	2	2	0	0	0	0	151	0	151	150	1	1.900000	-1.952097	0	0.150000	NM_020831		0	7	7	0	991	974	0	0	1	0		0	0	151	0	0	0.979377	1.857196e-01	0	0	0	97	0	7	991
TTLL1	25809	broad.mit.edu	37	22	43459909	43459909	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr22:43459909G>A	ENST00000266254.7	-	7	897	c.657C>T	c.(655-657)tgC>tgT	p.C219C	TTLL1_ENST00000331018.7_Silent_p.C219C	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	219	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TGCAGAACCGGCAAAACCCAA	0.458																																						ENST00000266254.7	0.300000	0.050000	0.230000	0.100000	0.150000	0.168113	0.150000	0.150000																										0				23						c.(655-657)tgC>tgT		tubulin tyrosine ligase-like family, member 1							197.0	185.0	189.0					22																	43459909		2203	4300	6503	SO:0001819	synonymous_variant	25809	1	121412	32				g.chr22:43459909G>A	AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.657C>T	chr22.hg19:g.43459909G>A		1					TTLL1_ENST00000331018.7_Silent_p.C219C	p.C219C	NM_012263.4	NP_036395.1	1	2	3	2.016816	O95922	TTLL1_HUMAN		7	897	-		Ovarian(80;0.0694)	B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Silent	SNP	ENST00000266254.7	0	1	hg19	c.657C>T	CCDS14043.1	0	.	.	.	.	.	.	.	.	.	.	G	9.861	1.196399	0.22037	.	.	ENSG00000100271	ENST00000495814	.	.	.	5.98	1.04	0.20106	5.98	1.04	0.20106	.	.	.	.	.	T	0.50752	0.1634	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38023	-0.9680	4	.	.	.	.	4.5385	0.12045	0.3534:0.0:0.4944:0.1523	.	.	.	.	V	145	.	.	A	-	2	0	0	TTLL1	41789853	41789853	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	2.311000	0.43717	0.359000	0.24239	0.591000	0.81541	GCC	0.209302		TCGA-IB-A5SQ-01A-11D-A32N-08	0.458	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319659.1	0	0	1		2	2	2	0	0	0	0	104	0	104	103	1	1.900000	-1.866508	0	0.150000	NM_012263		0	6	6	0	585	575	0	0	1	0		0	0	104	0	0	0.963229	5.549977e-02	0	0	0	31	0	6	585
GLI2	2736	broad.mit.edu	37	2	121736059	121736059	+	Missense_Mutation	SNP	G	G	A	rs150170739		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:121736059G>A	ENST00000452319.1	+	10	1478	c.1418G>A	c.(1417-1419)cGc>cAc	p.R473H	GLI2_ENST00000314490.11_Missense_Mutation_p.R145H|GLI2_ENST00000361492.4_Missense_Mutation_p.R473H|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TTTGTGTGCCGCTGGCAGGCC	0.632																																						ENST00000452319.1	0.230000	0.050000	0.180000	0.080000	0.120000	0.136482	0.120000	0.120000																										0				64						c.(1417-1419)cGc>cAc		GLI family zinc finger 2		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	138.0	131.0	133.0		1418	4.0	1.0	2	dbSNP_134	133	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GLI2	NM_005270.4	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	473/1587	121736059	2,13004	2203	4300	6503	SO:0001583	missense	2736	10	121410	51				g.chr2:121736059G>A		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1418G>A	chr2.hg19:g.121736059G>A	ENSP00000390436:p.Arg473His	0					GLI2_ENST00000361492.4_Missense_Mutation_p.R473H|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Missense_Mutation_p.R145H	p.R473H			0	1	1	2.007248				10	1478	+	Renal(3;0.0496)	Prostate(154;0.0623)		Missense_Mutation	SNP	ENST00000452319.1	0	1	hg19	c.1418G>A	CCDS33283.1	0	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234684	0.58886	2.27E-4	1.16E-4	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;D	0.91792	-2.91;-2.91;-2.91	4.03	4.03	0.46877	4.03	4.03	0.46877	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.115971	0.64402	D	0.000011	D	0.92463	0.7607	N	0.25890	0.77	0.80722	D	1	B;D;D;B;B	0.89917	0.188;1.0;0.983;0.301;0.054	B;D;P;B;B	0.80764	0.035;0.994;0.599;0.052;0.04	D	0.91007	0.4847	10	0.26408	T	0.33	.	16.6998	0.85346	0.0:0.0:1.0:0.0	.	473;456;128;128;145	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	H	473;473;145	ENSP00000390436:R473H;ENSP00000354586:R473H;ENSP00000312694:R145H	ENSP00000312694:R145H	R	+	2	0	0	GLI2	121452529	121452529	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.714000	0.84703	2.249000	0.74217	0.491000	0.48974	CGC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.632	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	0	0	1		2	2	2	0	0	0	0	174	0	174	172	1	1.900000	-1.924937	0	0.150000	NM_005270		0	8	11	0	858	848	0	0	1	0		0	0	174	0	0	0.988974	6.071157e-03	0	0	0	11	0	8	858
KCTD18	130535	broad.mit.edu	37	2	201354855	201354855	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:201354855G>A	ENST00000359878.3	-	7	1759	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	KCTD18_ENST00000409157.1_Missense_Mutation_p.R417W	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	417					protein homooligomerization (GO:0051260)					endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						TTCTCAGTCCGCACTCCCAAG	0.592																																						ENST00000359878.3	0.560000	0.080000	0.410000	0.160000	0.260000	0.290519	0.260000	0.240000																										0				15						c.(1249-1251)Cgg>Tgg		potassium channel tetramerization domain containing 18							49.0	53.0	52.0					2																	201354855		2203	4300	6503	SO:0001583	missense	130535	0	0					g.chr2:201354855G>A	AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.1249C>T	chr2.hg19:g.201354855G>A	ENSP00000352941:p.Arg417Trp	0					KCTD18_ENST00000409157.1_Missense_Mutation_p.R417W	p.R417W	NM_152387.2	NP_689600.2	0	1	1	2.007248	Q6PI47	KCD18_HUMAN		7	1759	-			Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	ENST00000359878.3	0	1	hg19	c.1249C>T	CCDS2330.1	0	.	.	.	.	.	.	.	.	.	.	G	9.574	1.121811	0.20877	.	.	ENSG00000155729	ENST00000359878;ENST00000409157	T;T	0.35789	1.29;1.29	5.04	2.02	0.26589	5.04	2.02	0.26589	.	1.373990	0.04721	N	0.419262	T	0.17492	0.0420	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17868	-1.0355	10	0.41790	T	0.15	2.0253	4.1114	0.10060	0.2142:0.1959:0.5899:0.0	.	417	Q6PI47	KCD18_HUMAN	W	417	ENSP00000352941:R417W;ENSP00000386751:R417W	ENSP00000352941:R417W	R	-	1	2	2	KCTD18	201063100	201063100	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.283000	0.08433	0.715000	0.32103	0.650000	0.86243	CGG	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.592	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256188.1	0	0	1		2	2	2	0	0	0	0	44	0	44	44	1	1.900000	-3.481862	1	0.150000	NM_152387		0	4	4	0	216	214	0	0	1	0		0	0	44	0	0	0.889012	2.068375e-01	0	0	0	37	0	4	216
GLB1L	79411	broad.mit.edu	37	2	220104663	220104663	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:220104663T>G	ENST00000295759.7	-	7	1013	c.700A>C	c.(700-702)Acc>Ccc	p.T234P	GLB1L_ENST00000497855.1_Intron|GLB1L_ENST00000356283.3_Intron|GLB1L_ENST00000409640.1_Intron|GLB1L_ENST00000392089.2_Missense_Mutation_p.T234P			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	234					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTACAGTGGTATAGAGTCCC	0.527																																						ENST00000295759.7	1.000000	0.700000	1.000000	0.790000	0.900000	0.900549	0.900000	1.000000																										0				22						c.(700-702)Acc>Ccc		galactosidase, beta 1-like							104.0	114.0	110.0					2																	220104663		2203	4300	6503	SO:0001583	missense	79411	0	0					g.chr2:220104663T>G		CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.700A>C	chr2.hg19:g.220104663T>G	ENSP00000295759:p.Thr234Pro	0					GLB1L_ENST00000356283.3_Intron|GLB1L_ENST00000409640.1_Intron|GLB1L_ENST00000392089.2_Missense_Mutation_p.T234P|GLB1L_ENST00000497855.1_Intron	p.T234P			0	1	1	2.007248	Q6UWU2	GLB1L_HUMAN		7	1013	-		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)	Q96DR0	Missense_Mutation	SNP	ENST00000295759.7	1	1	hg19	c.700A>C	CCDS2437.1	1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.304575	0.60305	.	.	ENSG00000163521	ENST00000295759;ENST00000392089	D;D	0.97924	-4.61;-4.61	5.37	1.38	0.22167	5.37	1.38	0.22167	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.331520	0.36034	N	0.002831	D	0.92169	0.7517	N	0.15975	0.35	0.80722	D	1	B	0.23185	0.081	B	0.28991	0.097	D	0.84745	0.0753	10	0.33940	T	0.23	-4.5903	5.7925	0.18369	0.127:0.2293:0.0:0.6437	.	234	Q6UWU2	GLB1L_HUMAN	P	234	ENSP00000295759:T234P;ENSP00000375939:T234P	ENSP00000295759:T234P	T	-	1	0	0	GLB1L	219812907	219812907	0.814000	0.29104	0.987000	0.45799	0.988000	0.76386	1.378000	0.34328	0.461000	0.27071	0.528000	0.53228	ACC	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.527	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	1	0	1		2	2	2	0	0	0	0	118	0	118	117	1	1.900000	-20.000000	1	0.150000	NM_024506		0	60	58	0	814	801	0	0	1	0		0	0	118	0	0	1.000000	6.045220e-02	0	1	0	5	0	60	814
SF3B6	51639	broad.mit.edu	37	2	24297040	24297040	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:24297040G>A	ENST00000233468.4	-	2	268	c.55C>T	c.(55-57)Cgg>Tgg	p.R19W		NM_016047.3	NP_057131.1														NS(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACAATATCCGATTTACTTCA	0.294																																						ENST00000233468.4	1.000000	0.810000	1.000000	0.990000	0.990000	0.986971	0.990000	1.000000																										0				4						c.(55-57)Cgg>Tgg									91.0	89.0	90.0					2																	24297040		2203	4298	6501	SO:0001583	missense	0	3	121400	37				g.chr2:24297040G>A																												ENST00000233468.4:c.55C>T	chr2.hg19:g.24297040G>A	ENSP00000233468:p.Arg19Trp	0						p.R19W	NM_016047.3	NP_057131.1	0	1	1	2.008170				2	268	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			Missense_Mutation	SNP	ENST00000233468.4	0	1	hg19	c.55C>T	CCDS1707.1	1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901228	0.72754	.	.	ENSG00000115128	ENST00000233468	T	0.36157	1.27	4.32	4.32	0.51571	4.32	4.32	0.51571	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.70962	0.3284	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80708	-0.1262	10	0.87932	D	0	-7.637	12.7778	0.57459	0.0:0.0:0.8358:0.1642	.	19	Q9Y3B4	PM14_HUMAN	W	19	ENSP00000233468:R19W	ENSP00000233468:R19W	R	-	1	2	2	AC008073.5	24150544	24150544	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.084000	0.50143	2.351000	0.79841	0.467000	0.42956	CGG	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.294	SF3B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246826.1	0	0	1		2	2	2	0	0	0	0	24	0	24	23	1	1.900000	-19.999590	1	0.150000			0	16	16	0	140	139	0	0	1	1		0	0	24	0	0	0.999946	1	0	85	0	339	0	16	140
ANTXR1	84168	broad.mit.edu	37	2	69409729	69409729	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:69409729G>A	ENST00000303714.4	+	16	1612	c.1290G>A	c.(1288-1290)ccG>ccA	p.P430P	RNU6-1216P_ENST00000362590.2_RNA|RNA5SP96_ENST00000516041.1_RNA	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	430					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						TCCCTGAGCCGCGAAATCTCA	0.473									Familial Infantile Hemangioma																													ENST00000303714.4	0.310000	0.050000	0.230000	0.090000	0.150000	0.169916	0.150000	0.140000																										0				29						c.(1288-1290)ccG>ccA		anthrax toxin receptor 1							135.0	129.0	131.0					2																	69409729		2203	4300	6503	SO:0001819	synonymous_variant	84168	1	121412	32	Familial Infantile Hemangioma	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	g.chr2:69409729G>A	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1290G>A	chr2.hg19:g.69409729G>A		0					RNA5SP96_ENST00000516041.1_RNA|RNU6-1216P_ENST00000362590.2_RNA	p.P430P	NM_032208.2	NP_115584.1	0	1	1	2.008170	Q9H6X2	ANTR1_HUMAN		16	1612	+			A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Silent	SNP	ENST00000303714.4	0	1	hg19	c.1290G>A	CCDS1892.1	0																																																																																								0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.473	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	0	0	1		19	11	2	1	0	1	1	82	0	82	82	1	1.900000	-2.426824	0	0.150000	NM_032208		0	5	5	0	455	454	0	0	0	0		1	0	82	0	0	0.002879	3.709449e-03	0	0	0	231	0	5	455
TET3	200424	broad.mit.edu	37	2	74317154	74317154	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:74317154G>A	ENST00000409262.3	+	5	2614	c.2614G>A	c.(2614-2616)Gca>Aca	p.A872T		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	872					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTTCCGCCTCGCAGGGGACAA	0.592																																						ENST00000409262.3	1.000000	0.790000	1.000000	0.910000	0.990000	0.968882	0.990000	1.000000																										0				34						c.(2614-2616)Gca>Aca		tet methylcytosine dioxygenase 3							84.0	92.0	89.0					2																	74317154		2056	4202	6258	SO:0001583	missense	200424	1	121016	34				g.chr2:74317154G>A		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2614G>A	chr2.hg19:g.74317154G>A	ENSP00000386869:p.Ala872Thr	0						p.A872T	NM_144993.1	NP_659430.1	0	1	1	2.008170	O43151	TET3_HUMAN		5	2614	+			A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	1	1	hg19	c.2614G>A	CCDS46339.1	1	.	.	.	.	.	.	.	.	.	.	G	7.764	0.705976	0.15172	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.11821	2.74	5.3	1.27	0.21489	5.3	1.27	0.21489	TET cysteine-rich domain (1);	0.536026	0.21571	N	0.072420	T	0.04182	0.0116	N	0.04508	-0.205	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.43163	-0.9408	10	0.06891	T	0.86	.	5.0566	0.14537	0.4494:0.1493:0.4013:0.0	.	872	O43151	TET3_HUMAN	T	872	ENSP00000386869:A872T	ENSP00000233310:A872T	A	+	1	0	0	TET3	74170662	74170662	0.023000	0.18921	0.016000	0.15963	0.975000	0.68041	0.734000	0.26101	0.331000	0.23511	0.655000	0.94253	GCA	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.592	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4	1	0	1		2	2	2	0	0	0	0	102	0	102	99	1	1.900000	-12.458530	1	0.150000			0	51	51	0	593	579	0	0	1	1	0	0	0	102	0	0	1.000000	7.892983e-02	0	3	0	3	1	51	593
MRPS5	64969	broad.mit.edu	37	2	95767442	95767442	+	Missense_Mutation	SNP	G	G	A	rs376111435		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:95767442G>A	ENST00000272418.2	-	8	998	c.790C>T	c.(790-792)Cgg>Tgg	p.R264W		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	264	S5 DRBM. {ECO:0000255|PROSITE- ProRule:PRU00268}.				translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						GCATCCATCCGATCAGTAGCT	0.338																																						ENST00000272418.2	1.000000	0.440000	1.000000	0.650000	0.920000	0.856846	0.920000	1.000000																										0				20						c.(790-792)Cgg>Tgg		mitochondrial ribosomal protein S5		G	TRP/ARG	0,4404		0,0,2202	50.0	48.0	49.0		790	4.4	0.3	2		49	1,8599		0,1,4299	no	missense	MRPS5	NM_031902.3	101	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	264/431	95767442	1,13003	2202	4300	6502	SO:0001583	missense	64969	5	121404	32				g.chr2:95767442G>A	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.790C>T	chr2.hg19:g.95767442G>A	ENSP00000272418:p.Arg264Trp	0						p.R264W	NM_031902.3	NP_114108.1	0	1	1	2.008170	P82675	RT05_HUMAN		8	998	-			Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Missense_Mutation	SNP	ENST00000272418.2	0	1	hg19	c.790C>T	CCDS2010.1	1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159629	0.38119	0.0	1.16E-4	ENSG00000144029	ENST00000272418	.	.	.	5.32	4.44	0.53790	5.32	4.44	0.53790	Ribosomal protein S5, N-terminal, conserved site (1);Ribosomal protein S5, N-terminal (2);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	T	0.69314	0.3097	M	0.75447	2.3	0.58432	D	0.999997	D	0.67145	0.996	P	0.58970	0.849	T	0.69665	-0.5084	9	0.37606	T	0.19	-20.9735	11.6662	0.51374	0.0:0.0:0.8223:0.1777	.	264	P82675	RT05_HUMAN	W	264	.	ENSP00000272418:R264W	R	-	1	2	2	MRPS5	95131169	95131169	0.970000	0.33590	0.256000	0.24389	0.096000	0.18686	1.357000	0.34090	1.350000	0.45770	0.591000	0.81541	CGG	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.338	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	1	0	1		2	2	2	0	0	0	0	18	0	18	18	1	1.900000	-3.307364	1	0.150000	NM_031902		0	8	8	0	108	105	0	0	1	1		0	0	18	0	0	0.989080	9.873774e-01	0	11	0	99	0	8	108
DOCK10	55619	broad.mit.edu	37	2	225659771	225659771	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr2:225659771C>T	ENST00000258390.7	-	45	5046	c.4979G>A	c.(4978-4980)cGt>cAt	p.R1660H	DOCK10_ENST00000409592.3_Missense_Mutation_p.R1654H	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1660					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1658H(1)|p.R198H(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGTCCTTATACGCTTAGTCAG	0.478																																						ENST00000258390.7	1.000000	0.760000	1.000000	0.890000	0.990000	0.960975	0.990000	1.000000																										2	Substitution - Missense(2)	p.R1658H(1)|p.R198H(1)	large_intestine(2)	87						c.(4978-4980)cGt>cAt		dedicator of cytokinesis 10							142.0	143.0	143.0					2																	225659771		2005	4185	6190	SO:0001583	missense	55619	0	0					g.chr2:225659771C>T	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4979G>A	chr2.hg19:g.225659771C>T	ENSP00000258390:p.Arg1660His	0					DOCK10_ENST00000409592.3_Missense_Mutation_p.R1654H	p.R1660H	NM_014689.2	NP_055504.2	0	1	1	2.007248	Q96BY6	DOC10_HUMAN		45	5046	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	1	1	hg19	c.4979G>A	CCDS46528.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.577896	0.96565	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.65178	4.66;-0.14	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.83603	0.5290	M	0.91090	3.175	0.58432	D	0.999999	D;P;D;D	0.76494	0.972;0.95;0.984;0.999	B;B;P;D	0.64410	0.444;0.439;0.74;0.925	D	0.86564	0.1843	10	0.87932	D	0	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	1660;514;1654;322	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	H	1654;1660;198	ENSP00000386694:R1654H;ENSP00000258390:R1660H	ENSP00000258390:R1660H	R	-	2	0	0	DOCK10	225368015	225368015	1.000000	0.71417	0.985000	0.45067	0.992000	0.81027	7.487000	0.81328	2.751000	0.94390	0.650000	0.86243	CGT	0.144869		TCGA-IB-A5SQ-01A-11D-A32N-08	0.478	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1	1	0	1		2	2	2	0	0	0	0	104	0	104	103	1	1.900000	-11.280890	1	0.150000			0	47	46	0	557	550	0	0	1	0		0	0	104	0	0	1.000000	6.739727e-01	0	0	0	29	0	47	557
NUP210	23225	broad.mit.edu	37	3	13377062	13377062	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr3:13377062G>A	ENST00000254508.5	-	28	3817	c.3735C>T	c.(3733-3735)ggC>ggT	p.G1245G	NUP210_ENST00000485755.1_5'Flank	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1245					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					CTTTTACCCGGCCGAGCACGT	0.607																																						ENST00000254508.5	1.000000	0.730000	0.980000	0.830000	0.920000	0.915394	0.920000	0.990000																										0				66						c.(3733-3735)ggC>ggT		nucleoporin 210kDa							80.0	76.0	78.0					3																	13377062		2203	4300	6503	SO:0001819	synonymous_variant	23225	0	0					g.chr3:13377062G>A	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3735C>T	chr3.hg19:g.13377062G>A		0					NUP210_ENST00000485755.1_5'Flank	p.G1245G	NM_024923.2	NP_079199.2	0	1	1	1.911861	Q8TEM1	PO210_HUMAN		28	3817	-	all_neural(104;0.187)		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	ENST00000254508.5	1	1	hg19	c.3735C>T	CCDS33704.1	1																																																																																								0.081081		TCGA-IB-A5SQ-01A-11D-A32N-08	0.607	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	1	0	1		2	2	2	0	0	0	0	49	0	49	48	1	1.900000	-20.000000	1	0.150000	NM_024923		0	32	32	0	295	292	0	0	1	1		0	0	49	0	0	1.000000	5.149085e-01	0	5	0	12	0	32	295
KCNH8	131096	broad.mit.edu	37	3	19436644	19436644	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr3:19436644C>T	ENST00000328405.2	+	7	1284	c.1018C>T	c.(1018-1020)Cgt>Tgt	p.R340C	KCNH8_ENST00000537696.1_5'UTR|KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	340					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R340C(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GCGTCTTTTGCGTCTGCTGCA	0.488																																					NSCLC(124;1625 1765 8018 24930 42026)	ENST00000328405.2	0.250000	0.040000	0.180000	0.070000	0.120000	0.133906	0.120000	0.110000																										1	Substitution - Missense(1)	p.R340C(1)	lung(1)	77						c.(1018-1020)Cgt>Tgt		potassium voltage-gated channel, subfamily H (eag-related), member 8							196.0	162.0	174.0					3																	19436644		2203	4300	6503	SO:0001583	missense	131096	0	0					g.chr3:19436644C>T	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1018C>T	chr3.hg19:g.19436644C>T	ENSP00000328813:p.Arg340Cys	0					KCNH8_ENST00000475063.1_3'UTR|KCNH8_ENST00000537696.1_5'UTR	p.R340C	NM_144633.2	NP_653234.2	0	1	1	1.911861	Q96L42	KCNH8_HUMAN		7	1284	+			B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	0	1	hg19	c.1018C>T	CCDS2632.1	0	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672024	0.88348	.	.	ENSG00000183960	ENST00000328405	D	0.99523	-6.08	5.78	5.78	0.91487	5.78	5.78	0.91487	Ion transport (1);	0.000000	0.32416	U	0.006131	D	0.99722	0.9892	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97601	1.0123	9	.	.	.	.	20.0118	0.97458	0.0:1.0:0.0:0.0	.	340;340	B7Z398;Q96L42	.;KCNH8_HUMAN	C	340	ENSP00000328813:R340C	.	R	+	1	0	0	KCNH8	19411648	19411648	1.000000	0.71417	0.999000	0.59377	0.789000	0.44602	4.787000	0.62432	2.742000	0.94016	0.650000	0.86243	CGT	0.081081		TCGA-IB-A5SQ-01A-11D-A32N-08	0.488	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	0	0	1		2	2	2	0	0	0	0	107	0	107	107	1	1.900000	-1.963016	0	0.150000	NM_144633		0	5	5	0	534	527	0	0	1	0		0	0	107	0	0	0.935642	0	0	0	0	1	0	5	534
STXBP5L	9515	broad.mit.edu	37	3	121097633	121097633	+	Silent	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr3:121097633C>T	ENST00000273666.6	+	22	2590	c.2319C>T	c.(2317-2319)gcC>gcT	p.A773A	STXBP5L_ENST00000497029.1_Intron|STXBP5L_ENST00000492541.1_Silent_p.A773A|STXBP5L_ENST00000472879.1_Silent_p.A749A|STXBP5L_ENST00000471454.1_Silent_p.A749A	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	773					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TTTCTAGTGCCGATGTTTCAA	0.473																																						ENST00000273666.6	1.000000	0.280000	0.880000	0.420000	0.610000	0.641799	0.610000	1.000000																										0				68						c.(2317-2319)gcC>gcT		syntaxin binding protein 5-like							60.0	56.0	57.0					3																	121097633		1870	4105	5975	SO:0001819	synonymous_variant	9515	2	120778	36				g.chr3:121097633C>T	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2319C>T	chr3.hg19:g.121097633C>T		0					STXBP5L_ENST00000497029.1_Intron|STXBP5L_ENST00000492541.1_Silent_p.A773A|STXBP5L_ENST00000471454.1_Silent_p.A749A|STXBP5L_ENST00000472879.1_Silent_p.A749A	p.A773A	NM_014980.2	NP_055795.1	1	2	3	2.020118	Q9Y2K9	STB5L_HUMAN		22	2590	+			Q4G1B4|Q6PIC3	Silent	SNP	ENST00000273666.6	1	1	hg19	c.2319C>T	CCDS43137.1	0																																																																																								0.154439		TCGA-IB-A5SQ-01A-11D-A32N-08	0.473	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3	1	0	1		2	2	2	0	0	0	0	38	0	38	38	1	1.900000	-2.950312	1	0.150000			0	8	8	0	177	174	0	0	1			0	0	38	0	0	0.989143	0	0	0	0	0	0	8	177
QDPR	5860	broad.mit.edu	37	4	17488811	17488811	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr4:17488811G>A	ENST00000281243.5	-	7	857	c.678C>T	c.(676-678)agC>agT	p.S226S	QDPR_ENST00000428702.2_Silent_p.S195S|QDPR_ENST00000513615.1_3'UTR|QDPR_ENST00000508623.1_Missense_Mutation_p.A162V	NM_000320.2	NP_000311.2	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	226					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|dihydrobiopterin metabolic process (GO:0051066)|L-phenylalanine catabolic process (GO:0006559)|liver development (GO:0001889)|response to aluminum ion (GO:0010044)|response to glucagon (GO:0033762)|response to lead ion (GO:0010288)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	6,7-dihydropteridine reductase activity (GO:0004155)|electron carrier activity (GO:0009055)|NADH binding (GO:0070404)|NADPH binding (GO:0070402)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	13						CCTGGATTAGGCTTCCTGAGC	0.453																																						ENST00000281243.5	1.000000	0.630000	1.000000	0.770000	0.940000	0.907192	0.940000	1.000000																										0				13						c.(676-678)agC>agT		quinoid dihydropteridine reductase							161.0	141.0	148.0					4																	17488811		2203	4300	6503	SO:0001819	synonymous_variant	5860	0	0					g.chr4:17488811G>A	AB053170	CCDS3421.1	4p15.31	2014-04-01			ENSG00000151552	ENSG00000151552	1.5.1.34	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	9752	protein-coding gene	gene with protein product	"""6,7-dihydropteridine reductase"", ""short chain dehydrogenase/reductase family 33C, member 1"""	612676				19027726	Standard	NM_000320		Approved	DHPR, PKU2, SDR33C1	uc003gpd.3	P09417	OTTHUMG00000128537	ENST00000281243.5:c.678C>T	chr4.hg19:g.17488811G>A		0					QDPR_ENST00000428702.2_Silent_p.S195S|QDPR_ENST00000513615.1_3'UTR|QDPR_ENST00000508623.1_Missense_Mutation_p.A162V	p.S226S	NM_000320.2	NP_000311.2	1	2	3	2.018787	P09417	DHPR_HUMAN		7	857	-			A8K158|B3KW71|Q53F52|Q9H3M5	Silent	SNP	ENST00000281243.5	1	1	hg19	c.678C>T	CCDS3421.1	1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196879	0.38806	.	.	ENSG00000151552	ENST00000508623	D	0.92699	-3.09	5.29	3.56	0.40772	5.29	3.56	0.40772	.	.	.	.	.	D	0.90648	0.7067	.	.	.	0.23260	N	0.998021	.	.	.	.	.	.	D	0.84350	0.0532	6	0.87932	D	0	-26.8617	5.9529	0.19257	0.3459:0.0:0.6541:0.0	.	.	.	.	V	162	ENSP00000426377:A162V	ENSP00000426377:A162V	A	-	2	0	0	QDPR	17097909	17097909	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.824000	0.27379	1.237000	0.43756	0.650000	0.86243	GCC	0.154439		TCGA-IB-A5SQ-01A-11D-A32N-08	0.453	QDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250372.1	0	0	1		2	2	2	0	0	0	0	88	0	88	87	1	1.900000	-7.449956	1	0.150000	NM_000320		0	27	27	0	361	356	0	0	1	1		0	0	88	0	0	1.000000	1	0	22	0	369	0	27	361
KIAA1211	57482	broad.mit.edu	37	4	57180336	57180336	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr4:57180336G>A	ENST00000504228.1	+	6	773	c.668G>A	c.(667-669)cGc>cAc	p.R223H	KIAA1211_ENST00000264229.6_Missense_Mutation_p.R223H|KIAA1211_ENST00000541073.1_Missense_Mutation_p.R216H			Q6ZU35	K1211_HUMAN	KIAA1211	223	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GAGAGAAGACGCCAAGAAGAC	0.612																																						ENST00000504228.1	1.000000	0.350000	1.000000	0.550000	0.830000	0.793932	0.830000	1.000000																										0				65						c.(667-669)cGc>cAc		KIAA1211							35.0	45.0	42.0					4																	57180336		2035	4190	6225	SO:0001583	missense	57482	0	0					g.chr4:57180336G>A	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.668G>A	chr4.hg19:g.57180336G>A	ENSP00000423366:p.Arg223His	0					KIAA1211_ENST00000264229.6_Missense_Mutation_p.R223H|KIAA1211_ENST00000541073.1_Missense_Mutation_p.R216H	p.R223H			1	2	3	2.018787	Q6ZU35	K1211_HUMAN		6	773	+	Glioma(25;0.08)|all_neural(26;0.101)		Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	0	1	hg19	c.668G>A	CCDS43230.1	0	.	.	.	.	.	.	.	.	.	.	G	9.671	1.146801	0.21288	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.12255	2.7;2.7;2.7	5.07	-0.161	0.13371	5.07	-0.161	0.13371	.	.	.	.	.	T	0.07683	0.0193	L	0.44542	1.39	0.09310	N	1	B;B;B	0.29612	0.251;0.022;0.022	B;B;B	0.20767	0.031;0.007;0.007	T	0.36553	-0.9743	9	0.17369	T	0.5	-5.3546	0.3015	0.00274	0.2693:0.1396:0.2867:0.3044	.	216;216;223	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	H	223;223;216;133	ENSP00000264229:R223H;ENSP00000423366:R223H;ENSP00000444006:R216H	ENSP00000264229:R223H	R	+	2	0	0	KIAA1211	56875093	56875093	0.000000	0.05858	0.160000	0.22671	0.856000	0.48823	0.263000	0.18478	0.225000	0.20959	0.561000	0.74099	CGC	0.154439		TCGA-IB-A5SQ-01A-11D-A32N-08	0.612	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	0	0	1		2	2	2	0	0	0	0	17	0	17	17	1	1.900000	-4.745202	1	0.150000	NM_020722		0	6	6	0	97	95	0	0	1	1		0	0	17	0	0	0.964328	3.801046e-01	0	3	0	17	0	6	97
TMPRSS11F	389208	broad.mit.edu	37	4	68995528	68995528	+	Splice_Site	SNP	G	G	A	rs142296401	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr4:68995528G>A	ENST00000356291.2	-	1	70	c.11C>T	c.(10-12)gCa>gTa	p.A4V		NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	4			A -> T (in dbSNP:rs10030708).			extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						GAATACTTACGCGTACATCAT	0.448																																						ENST00000356291.2	1.000000	0.660000	1.000000	0.820000	0.990000	0.934857	0.990000	1.000000																										0				39						c.(10-12)gCa>gTa		transmembrane protease, serine 11F		G	VAL/ALA	7,4399	12.9+/-30.5	0,7,2196	129.0	111.0	117.0		11	3.5	0.9	4	dbSNP_134	117	0,8600		0,0,4300	yes	missense-near-splice	TMPRSS11F	NM_207407.2	64	0,7,6496	AA,AG,GG		0.0,0.1589,0.0538	benign	4/439	68995528	7,12999	2203	4300	6503	SO:0001630	splice_region_variant	389208	25	121412	46				g.chr4:68995528G>A	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.11+1C>T	chr4.hg19:g.68995528G>A		0						p.A4V	NM_207407.2	NP_997290.2	1	2	3	2.018787	Q6ZWK6	TM11F_HUMAN		1	70	-			A8MXX2	Splice_Site	SNP	ENST00000356291.2	1	0	hg19	c.11C>T	CCDS3520.1	1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759073	0.31137	0.001589	0.0	ENSG00000198092	ENST00000356291	D	0.88509	-2.39	5.24	3.48	0.39840	5.24	3.48	0.39840	.	1.880980	0.02227	N	0.064593	T	0.78748	0.4332	N	0.08118	0	0.34127	D	0.6648	P	0.48089	0.905	B	0.35770	0.21	T	0.70174	-0.4944	9	.	.	.	.	11.8719	0.52525	0.0:0.3399:0.6601:0.0	.	4	Q6ZWK6	TM11F_HUMAN	V	4	ENSP00000348639:A4V	.	A	-	2	0	0	TMPRSS11F	68678123	68678123	0.951000	0.32395	0.948000	0.38648	0.344000	0.29017	0.715000	0.25822	0.756000	0.33013	0.650000	0.86243	GCA	0.154439		TCGA-IB-A5SQ-01A-11D-A32N-08	0.448	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	1	0	1		2	2	2	0	0	0	0	55	0	55	53	1	1.900000	-3.221880	1	0.150000	NM_207407	Missense_Mutation	0	24	24	0	298	294	0	0	1			0	0	55	0	0	1.000000	0	0	0	0	0	0	24	298
ARHGAP10	79658	broad.mit.edu	37	4	148944528	148944528	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr4:148944528G>A	ENST00000336498.3	+	19	2070	c.1831G>A	c.(1831-1833)Gtg>Atg	p.V611M	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.V260M	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CAAGAGGCCCGTGGCCGTCTA	0.502																																						ENST00000336498.3	1.000000	0.680000	1.000000	0.810000	0.980000	0.929418	0.980000	1.000000																										0				33						c.(1831-1833)Gtg>Atg		Rho GTPase activating protein 10							96.0	99.0	98.0					4																	148944528		2203	4300	6503	SO:0001583	missense	79658	4	121412	40				g.chr4:148944528G>A	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.1831G>A	chr4.hg19:g.148944528G>A	ENSP00000336923:p.Val611Met	0					ARHGAP10_ENST00000414545.2_Missense_Mutation_p.V260M	p.V611M	NM_024605.3	NP_078881.3	1	2	3	2.018787	Q5T5U3	RHG21_HUMAN		19	2070	+	all_hematologic(180;0.151)	Renal(17;0.0166)	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	1	1	hg19	c.1831G>A	CCDS34075.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.18|15.18	2.755723|2.755723	0.49362|0.49362	.|.	.|.	ENSG00000071205|ENSG00000071205	ENST00000507661|ENST00000336498;ENST00000414545	.|T;T	.|0.11930	.|3.04;2.73	5.72|5.72	3.96|3.96	0.45880|0.45880	5.72|5.72	3.96|3.96	0.45880|0.45880	.|.	.|0.543718	.|0.18919	.|N	.|0.127533	T|T	0.25754|0.25754	0.0627|0.0627	L|L	0.40543|0.40543	1.245|1.245	0.36518|0.36518	D|D	0.869994|0.869994	.|D;D;D;D	.|0.89917	.|1.0;0.983;0.993;0.987	.|D;P;P;P	.|0.85130	.|0.997;0.507;0.475;0.475	T|T	0.07385|0.07385	-1.0775|-1.0775	5|10	.|0.46703	.|T	.|0.11	.|.	9.5873|9.5873	0.39524|0.39524	0.0749:0.2861:0.639:0.0|0.0749:0.2861:0.639:0.0	.|.	.|44;192;260;611	.|Q9H7G7;Q86T21;E7EUW5;A1A4S6	.|.;.;.;RHG10_HUMAN	H|M	288|611;260	.|ENSP00000336923:V611M;ENSP00000406624:V260M	.|ENSP00000336923:V611M	R|V	+|+	2|1	0|0	0|0	ARHGAP10|ARHGAP10	149163978|149163978	149163978|149163978	0.951000|0.951000	0.32395|0.32395	0.938000|0.938000	0.37757|0.37757	0.989000|0.989000	0.77384|0.77384	1.511000|1.511000	0.35801|0.35801	0.732000|0.732000	0.32470|0.32470	0.655000|0.655000	0.94253|0.94253	CGT|GTG	0.154439		TCGA-IB-A5SQ-01A-11D-A32N-08	0.502	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	1	0	1		2	2	2	0	0	0	0	79	0	79	78	1	1.900000	-8.500285	1	0.150000	NM_024605		0	31	31	0	397	389	0	0	1	1		0	0	79	0	0	1.000000	7.471434e-01	0	5	0	31	0	31	397
NSD1	64324	broad.mit.edu	37	5	176562809	176562809	+	Silent	SNP	A	A	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr5:176562809A>G	ENST00000439151.2	+	2	750	c.705A>G	c.(703-705)acA>acG	p.T235T	NSD1_ENST00000347982.4_Intron|NSD1_ENST00000511258.1_Intron|NSD1_ENST00000354179.4_Intron|NSD1_ENST00000361032.4_Silent_p.T235T	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	235					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGACTGAAACACAGAAAAATA	0.458			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												ENST00000439151.2	1.000000	0.730000	1.000000	0.890000	0.990000	0.962778	0.990000	1.000000				Dom	yes			Dom	yes		5	5q35	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	yes	Sotos Syndrome	L	L	NUP98		AML		0				96						c.(703-705)acA>acG		nuclear receptor binding SET domain protein 1							87.0	85.0	86.0					5																	176562809		2203	4300	6503	SO:0001819	synonymous_variant	64324	0	0		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	g.chr5:176562809A>G	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.705A>G	chr5.hg19:g.176562809A>G		0	HNSCC(47;0.14)				NSD1_ENST00000361032.4_Silent_p.T235T|NSD1_ENST00000347982.4_Intron|NSD1_ENST00000354179.4_Intron|NSD1_ENST00000511258.1_Intron	p.T235T	NM_022455.4	NP_071900.2	1	2	3	2.015147	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	2	750	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	1	1	hg19	c.705A>G	CCDS4412.1	1																																																																																								0.153176		TCGA-IB-A5SQ-01A-11D-A32N-08	0.458	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	1	0	1		2	2	2	0	0	0	0	45	0	45	45	1	1.900000	-20.000000	1	0.150000	NM_172349		0	25	25	0	283	281	0	0	1	0		0	0	45	0	0	1.000000	6.062986e-02	0	0	0	5	0	25	283
DDX41	51428	broad.mit.edu	37	5	176941738	176941738	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr5:176941738C>T	ENST00000507955.1	-	9	1422	c.899G>A	c.(898-900)gGc>gAc	p.G300D	DDX41_ENST00000506965.1_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	300	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CACGGACATGCCCCCAATGCA	0.637																																						ENST00000507955.1	1.000000	0.040000	0.170000	0.070000	0.100000	0.150595	0.100000	0.100000																										0										c.(898-900)gGc>gAc		DEAD (Asp-Glu-Ala-Asp) box polypeptide 41							86.0	94.0	91.0					5																	176941738		2202	4298	6500	SO:0001583	missense	51428	0	0					g.chr5:176941738C>T	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.899G>A	chr5.hg19:g.176941738C>T	ENSP00000422753:p.Gly300Asp	0					DDX41_ENST00000506965.1_5'Flank	p.G300D	NM_016222.2	NP_057306.2	1	2	3	2.015147	Q9UJV9	DDX41_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)	9	1422	-	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	0	1	hg19	c.899G>A	CCDS4427.1	0	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795543	0.90453	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.50548	0.74;0.74	5.74	4.85	0.62838	5.74	4.85	0.62838	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.056454	0.64402	N	0.000001	T	0.76026	0.3930	M	0.92880	3.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83210	-0.0074	10	0.87932	D	0	-27.0527	15.8993	0.79359	0.1364:0.8636:0.0:0.0	.	174;300	B3KRK2;Q9UJV9	.;DDX41_HUMAN	D	318;300	ENSP00000330349:G318D;ENSP00000422753:G300D	ENSP00000330349:G318D	G	-	2	0	0	DDX41	176874344	176874344	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.351000	0.79395	1.378000	0.46305	0.655000	0.94253	GGC	0.153176		TCGA-IB-A5SQ-01A-11D-A32N-08	0.637	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	0	0	1		17	4	2	1	0	1	1	194	0	194	190	1	1.900000	-1.680598	0	0.150000	NM_016222		0	7	7	0	900	891	0	0	0	0		1	0	194	0	0	0.029225	2.665377e-02	0	0	0	114	0	7	900
FLT4	2324	broad.mit.edu	37	5	180056983	180056983	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr5:180056983G>T	ENST00000261937.6	-	5	714	c.636C>A	c.(634-636)gaC>gaA	p.D212E	FLT4_ENST00000393347.3_Missense_Mutation_p.D212E|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.D212E	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	212	Ig-like C2-type 2.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGAAGTCCTGGTCTCCCCAGG	0.637																																					Colon(97;1075 1466 27033 27547 35871)	ENST00000261937.6	1.000000	0.090000	0.390000	0.150000	0.250000	0.295774	0.250000	0.230000																										0				71						c.(634-636)gaC>gaA		fms-related tyrosine kinase 4	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)						92.0	79.0	83.0					5																	180056983		2201	4297	6498	SO:0001583	missense	2324	0	0					g.chr5:180056983G>T	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.636C>A	chr5.hg19:g.180056983G>T	ENSP00000261937:p.Asp212Glu	0					FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.D212E|FLT4_ENST00000393347.3_Missense_Mutation_p.D212E	p.D212E	NM_182925.4	NP_891555.2	1	2	3	2.015147	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	5	714	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	0	1	hg19	c.636C>A	CCDS4457.1	0	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047952	0.36085	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.04654	3.58;3.58;3.58	5.06	4.17	0.49024	5.06	4.17	0.49024	Tyrosine-protein kinase, vascular endothelial growth factor receptor 3 (VEGFR3), N-terminal (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03783	0.0107	L	0.34521	1.04	0.28658	N	0.906316	B;P;B;B	0.35033	0.349;0.481;0.003;0.003	B;B;B;B	0.33454	0.05;0.164;0.004;0.004	T	0.27262	-1.0079	9	0.30078	T	0.28	.	3.8203	0.08833	0.09:0.1755:0.576:0.1585	.	212;212;212;212	B5A927;P35916-3;E9PD35;P35916	.;.;.;VGFR3_HUMAN	E	212;212;212;22	ENSP00000261937:D212E;ENSP00000377016:D212E;ENSP00000426057:D212E	ENSP00000261937:D212E	D	-	3	2	2	FLT4	179989589	179989589	1.000000	0.71417	0.996000	0.52242	0.848000	0.48234	2.115000	0.41921	2.517000	0.84864	0.561000	0.74099	GAC	0.153176		TCGA-IB-A5SQ-01A-11D-A32N-08	0.637	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4	0	0	0		2	2	2	0	0	0	0	62	0	62	62	1	1.900000	-6.328591	1	0.150000			0	5	1	0	287	285	0	0	0	0		0	0	62	0	0	0.934606	1.537802e-02	0	0	0	9	0	5	287
OR10C1	442194	broad.mit.edu	37	6	29408019	29408019	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr6:29408019C>T	ENST00000444197.2	+	1	937	c.227C>T	c.(226-228)aCg>aTg	p.T76M	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ACGTCTGTCACGGTCCCCCTG	0.577																																						ENST00000444197.2	1.000000	0.640000	1.000000	0.760000	0.890000	0.886146	0.890000	1.000000																										0				27						c.(226-228)aCg>aTg		olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)							161.0	143.0	150.0					6																	29408019		1511	2709	4220	SO:0001583	missense	442194	0	0					g.chr6:29408019C>T		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.227C>T	chr6.hg19:g.29408019C>T	ENSP00000419119:p.Thr76Met	0					OR11A1_ENST00000377149.1_Intron	p.T76M	NM_013941.3	NP_039229.3	0	0	0	1.988739	Q96KK4	O10C1_HUMAN		1	937	+			Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	1	1	hg19	c.227C>T	CCDS34364.1	1	.	.	.	.	.	.	.	.	.	.	C	7.874	0.728727	0.15507	.	.	ENSG00000206474	ENST00000444197	T	0.00882	5.58	3.32	3.32	0.38043	3.32	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40302	N	0.001132	T	0.01940	0.0061	M	0.88570	2.965	0.09310	N	0.999996	D	0.69078	0.997	P	0.61722	0.893	T	0.38090	-0.9677	10	0.52906	T	0.07	.	6.6195	0.22796	0.0:0.8667:0.0:0.1333	.	76	Q96KK4	O10C1_HUMAN	M	76	ENSP00000419119:T76M	ENSP00000419119:T76M	T	+	2	0	0	OR10C1	29515998	29515998	0.000000	0.05858	0.287000	0.24848	0.043000	0.13939	-0.103000	0.10940	1.858000	0.53909	0.196000	0.17591	ACG	0.135740		TCGA-IB-A5SQ-01A-11D-A32N-08	0.577	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2	1	0	1		2	2	2	0	0	0	0	114	0	114	112	1	1.900000	-8.383347	1	0.150000			0	38	38	0	516	512	0	0	1			0	0	114	0	0	1.000000	0	0	0	0	0	0	38	516
MAS1L	116511	broad.mit.edu	37	6	29454889	29454889	+	Missense_Mutation	SNP	G	G	A	rs145448286	byFrequency	TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr6:29454889G>A	ENST00000377127.3	-	1	849	c.791C>T	c.(790-792)gCg>gTg	p.A264V		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	264					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						CTGCACCACCGCATAGACCCT	0.522																																					NSCLC(153;755 1987 3859 11251 32945)	ENST00000377127.3	0.550000	0.080000	0.400000	0.150000	0.260000	0.286831	0.260000	0.230000																										0				28						c.(790-792)gCg>gTg		MAS1 proto-oncogene like, G protein-coupled receptor		G	VAL/ALA	5,4401	9.9+/-24.2	0,5,2198	37.0	39.0	38.0		791	-3.7	0.0	6	dbSNP_134	38	0,8600		0,0,4300	yes	missense	MAS1L	NM_052967.1	64	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	benign	264/379	29454889	5,13001	2203	4300	6503	SO:0001583	missense	116511	14	121410	40				g.chr6:29454889G>A	S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.791C>T	chr6.hg19:g.29454889G>A	ENSP00000366331:p.Ala264Val	0						p.A264V	NM_052967.1	NP_443199.1	0	0	0	1.988739	P35410	MAS1L_HUMAN		1	849	-			Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	0	1	hg19	c.791C>T	CCDS4661.1	0	.	.	.	.	.	.	.	.	.	.	G	2.332	-0.353156	0.05173	0.001135	0.0	ENSG00000204687	ENST00000377127	T	0.36340	1.26	2.23	-3.69	0.04450	2.23	-3.69	0.04450	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01592	0.0051	N	0.00510	-1.415	0.09310	N	1	B	0.25390	0.125	B	0.25291	0.059	T	0.32561	-0.9902	9	0.02654	T	1	.	3.4815	0.07603	0.5201:0.2028:0.2771:0.0	.	264	P35410	MAS1L_HUMAN	V	264	ENSP00000366331:A264V	ENSP00000366331:A264V	A	-	2	0	0	MAS1L	29562868	29562868	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.366000	0.01078	-0.792000	0.04480	-0.451000	0.05528	GCG	0.135740		TCGA-IB-A5SQ-01A-11D-A32N-08	0.522	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	0	0	1		2	2	2	0	0	0	0	33	0	33	33	1	1.900000	-3.480473	1	0.150000	NM_052967		0	4	4	0	216	215	0	0	1	0		0	0	33	0	0	0.890095	0	0	0	0	1	0	4	216
PRPH2	5961	broad.mit.edu	37	6	42689575	42689575	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr6:42689575G>A	ENST00000230381.5	-	1	737	c.498C>T	c.(496-498)tgC>tgT	p.C166C		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	166					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			CGTTGTTGCCGCAGCATTTGA	0.507																																						ENST00000230381.5	0.280000	0.050000	0.210000	0.090000	0.140000	0.156568	0.140000	0.130000																										0				18						c.(496-498)tgC>tgT		peripherin 2 (retinal degeneration, slow)							149.0	136.0	140.0					6																	42689575		2203	4300	6503	SO:0001819	synonymous_variant	5961	9	121412	44				g.chr6:42689575G>A		CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.498C>T	chr6.hg19:g.42689575G>A		0						p.C166C	NM_000322.4	NP_000313.2	0	0	0	1.973124	P23942	PRPH2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)	1	737	-	Colorectal(47;0.196)		Q5TFH5|Q6DK65	Silent	SNP	ENST00000230381.5	0	1	hg19	c.498C>T	CCDS4871.1	0																																																																																								0.127758		TCGA-IB-A5SQ-01A-11D-A32N-08	0.507	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	0	0	1		2	2	2	0	0	0	0	102	0	102	102	1	1.900000	-1.878624	0	0.150000	NM_000322		0	6	6	0	566	559	0	0	1	0		0	0	102	0	0	0.963771	0	0	0	0	1	0	6	566
CAPN11	11131	broad.mit.edu	37	6	44144381	44144381	+	Silent	SNP	C	C	T	rs370482641		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr6:44144381C>T	ENST00000398776.1	+	10	1103	c.1065C>T	c.(1063-1065)gaC>gaT	p.D355D	CAPN11_ENST00000542245.1_Silent_p.D355D	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	355	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGACGGAGGACGGGGAGTTCT	0.627																																						ENST00000398776.1	1.000000	0.700000	1.000000	0.850000	0.990000	0.949246	0.990000	1.000000																										0				36						c.(1063-1065)gaC>gaT		calpain 11		C		0,4192		0,0,2096	94.0	110.0	104.0		1065	-5.4	0.6	6		104	1,8459		0,1,4229	no	coding-synonymous	CAPN11	NM_007058.3		0,1,6325	TT,TC,CC		0.0118,0.0,0.0079		355/740	44144381	1,12651	2096	4230	6326	SO:0001819	synonymous_variant	11131	7	121066	40				g.chr6:44144381C>T	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1065C>T	chr6.hg19:g.44144381C>T		0					CAPN11_ENST00000542245.1_Silent_p.D355D	p.D355D	NM_007058.3	NP_008989.2	0	0	0	1.973124	Q9UMQ6	CAN11_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)	10	1103	+	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		B2RA64|Q5T3G1|Q8N4R5	Silent	SNP	ENST00000398776.1	1	1	hg19	c.1065C>T	CCDS47436.1	1																																																																																								0.127758		TCGA-IB-A5SQ-01A-11D-A32N-08	0.627	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3	1	0	1		2	2	2	0	0	0	0	57	0	57	56	1	1.900000	-9.122323	1	0.150000			0	28	28	0	322	315	0	0	1	0		0	0	57	0	0	1.000000	0	0	0	0	1	0	28	322
TNFRSF21	27242	broad.mit.edu	37	6	47253929	47253929	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr6:47253929G>A	ENST00000296861.2	-	2	892	c.499C>T	c.(499-501)Cgg>Tgg	p.R167W		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	167					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TGCTTACACCGCACATCCTCA	0.542																																						ENST00000296861.2	0.310000	0.070000	0.240000	0.110000	0.170000	0.182175	0.170000	0.160000																										0				21						c.(499-501)Cgg>Tgg		tumor necrosis factor receptor superfamily, member 21							313.0	226.0	255.0					6																	47253929		2203	4300	6503	SO:0001583	missense	27242	5	121412	40				g.chr6:47253929G>A	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.499C>T	chr6.hg19:g.47253929G>A	ENSP00000296861:p.Arg167Trp	0						p.R167W	NM_014452.3	NP_055267.1	0	0	0	1.973124	O75509	TNR21_HUMAN	Lung(136;0.189)	2	892	-			B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	0	1	hg19	c.499C>T	CCDS4921.1	0	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668949	0.67814	.	.	ENSG00000146072	ENST00000296861	T	0.61742	0.08	5.54	4.61	0.57282	5.54	4.61	0.57282	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.164121	0.49305	D	0.000156	T	0.65154	0.2664	M	0.72894	2.215	0.47214	D	0.999353	D	0.89917	1.0	P	0.62649	0.905	T	0.68108	-0.5496	10	0.72032	D	0.01	.	12.0809	0.53669	0.0:0.0:0.6729:0.327	.	167	O75509	TNR21_HUMAN	W	167	ENSP00000296861:R167W	ENSP00000296861:R167W	R	-	1	2	2	TNFRSF21	47361888	47361888	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	2.334000	0.43920	2.767000	0.95098	0.591000	0.81541	CGG	0.127758		TCGA-IB-A5SQ-01A-11D-A32N-08	0.542	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	0	0	1		2	2	2	0	0	0	0	146	0	146	144	1	1.900000	-1.909332	0	0.150000	NM_014452		0	8	8	0	625	618	0	0	1	0		0	0	146	0	0	0.988868	9.546107e-01	0	0	0	424	0	8	625
BCLAF1	9774	broad.mit.edu	37	6	136589449	136589449	+	Nonsense_Mutation	SNP	G	G	A	rs147719127		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr6:136589449G>A	ENST00000531224.1	-	10	2500	c.2248C>T	c.(2248-2250)Cga>Tga	p.R750*	BCLAF1_ENST00000031135.9_5'UTR|BCLAF1_ENST00000353331.4_Nonsense_Mutation_p.R748*|BCLAF1_ENST00000527759.1_Nonsense_Mutation_p.R748*|BCLAF1_ENST00000527536.1_Nonsense_Mutation_p.R750*|BCLAF1_ENST00000392348.2_Nonsense_Mutation_p.R748*|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000530767.1_Nonsense_Mutation_p.R577*	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	750	Poly-Ser.				apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R750G(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GATGAAGATCGAGAATGATCT	0.338																																					Colon(142;1534 1789 5427 7063 28491)	ENST00000531224.1	0.850000	0.260000	0.680000	0.370000	0.500000	0.530818	0.500000	0.500000																										1	Substitution - Missense(1)	p.R750G(1)	urinary_tract(1)	9						c.(2248-2250)Cga>Tga		BCL2-associated transcription factor 1		G	stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	101.0	87.0	92.0		2242,1729,2248	4.1	1.0	6	dbSNP_134	92	5,8595	2.2+/-6.3	0,5,4295	yes	stop-gained,stop-gained,stop-gained	BCLAF1	NM_001077440.1,NM_001077441.1,NM_014739.2	,,	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	,,	748/870,577/748,750/921	136589449	5,13001	2203	4300	6503	SO:0001587	stop_gained	9774	112	121386	46				g.chr6:136589449G>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2248C>T	chr6.hg19:g.136589449G>A	ENSP00000435210:p.Arg750*	0					BCLAF1_ENST00000527536.1_Nonsense_Mutation_p.R750*|BCLAF1_ENST00000353331.4_Nonsense_Mutation_p.R748*|BCLAF1_ENST00000527759.1_Nonsense_Mutation_p.R748*|BCLAF1_ENST00000530767.1_Nonsense_Mutation_p.R577*|BCLAF1_ENST00000392348.2_Nonsense_Mutation_p.R748*|BCLAF1_ENST00000031135.9_5'UTR|BCLAF1_ENST00000529917.1_5'UTR	p.R750*	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	0	0	0	1.973124	Q9NYF8	BCLF1_HUMAN		10	2500	-	Colorectal(23;0.24)		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Nonsense_Mutation	SNP	ENST00000531224.1	0	1	hg19	c.2248C>T	CCDS5177.1	0	.	.	.	.	.	.	.	.	.	.	G	42	9.204499	0.99099	0.0	5.81E-4	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348	.	.	.	4.97	4.07	0.47477	4.97	4.07	0.47477	.	0.000000	0.47852	D	0.000213	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7893	12.524	0.56075	0.0:0.0:0.612:0.388	.	.	.	.	X	750;748;750;577;748;748	.	ENSP00000229446:R748X	R	-	1	2	2	BCLAF1	136631142	136631142	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.833000	0.39161	1.190000	0.43042	0.484000	0.47621	CGA	0.127758		TCGA-IB-A5SQ-01A-11D-A32N-08	0.338	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	0	0	1		2	2	2	0	0	0	0	47	0	47	47	1	1.900000	-2.548925	1	0.150000	NM_014739		0	10	8	0	250	227	0	0	1	0		0	0	47	0	0	0.995104	7.215952e-01	0	0	0	64	0	10	250
DNAH11	8701	broad.mit.edu	37	7	21882220	21882220	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr7:21882220C>G	ENST00000409508.3	+	66	10781	c.10750C>G	c.(10750-10752)Cac>Gac	p.H3584D	DNAH11_ENST00000328843.6_Missense_Mutation_p.H3591D	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3591	AAA 5. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CCTTATCCTTCACACAAAATT	0.413									Kartagener syndrome																													ENST00000409508.3	1.000000	0.460000	1.000000	0.620000	0.830000	0.817277	0.830000	1.000000																										0				230						c.(10750-10752)Cac>Gac		dynein, axonemal, heavy chain 11							109.0	103.0	105.0					7																	21882220		1890	4113	6003	SO:0001583	missense	8701	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21882220C>G	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.10750C>G	chr7.hg19:g.21882220C>G	ENSP00000475939:p.His3584Asp	0					DNAH11_ENST00000328843.6_Missense_Mutation_p.H3591D	p.H3584D	NM_001277115.1	NP_001264044.1	0	1	1	2.010727	Q96DT5	DYH11_HUMAN		66	10781	+			Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	1	1	hg19	c.10750C>G		0	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490687	0.64074	.	.	ENSG00000105877	ENST00000328843	T	0.23348	1.91	5.36	5.36	0.76844	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.53061	0.1773	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53634	-0.8411	9	0.52906	T	0.07	.	17.8716	0.88813	0.0:1.0:0.0:0.0	.	3591	Q96DT5	DYH11_HUMAN	D	3591	ENSP00000330671:H3591D	ENSP00000330671:H3591D	H	+	1	0	0	DNAH11	21848745	21848745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.811000	0.86092	2.514000	0.84764	0.655000	0.94253	CAC	0.145514		TCGA-IB-A5SQ-01A-11D-A32N-08	0.413	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1		2	2	2	0	0	0	0	28	0	28	28	1	1.900000	-3.145372	1	0.150000	NM_003777		0	12	12	0	181	178	0	0	1			0	0	28	0	0	0.999129	0	0	0	0	0	0	12	181
EPHA1	2041	broad.mit.edu	37	7	143096794	143096794	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr7:143096794C>T	ENST00000275815.3	-	4	871	c.785G>A	c.(784-786)tGc>tAc	p.C262Y		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	262	Cys-rich.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CTCACAGTGGCACCGTCCTAC	0.652																																						ENST00000275815.3	1.000000	0.840000	1.000000	0.990000	0.990000	0.987438	0.990000	1.000000																										0				51						c.(784-786)tGc>tAc		EPH receptor A1							41.0	45.0	44.0					7																	143096794		2203	4300	6503	SO:0001583	missense	2041	0	0					g.chr7:143096794C>T	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.785G>A	chr7.hg19:g.143096794C>T	ENSP00000275815:p.Cys262Tyr	1						p.C262Y	NM_005232.4	NP_005223.4	2	2	4	2.158698	P21709	EPHA1_HUMAN		4	871	-	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	1	1	hg19	c.785G>A	CCDS5884.1	1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.877639	0.72294	.	.	ENSG00000146904	ENST00000275815	D	0.86627	-2.15	5.22	4.33	0.51752	5.22	4.33	0.51752	Tyrosine-protein kinase, receptor class V, conserved site (1);Growth factor, receptor (1);	0.000000	0.64402	D	0.000003	D	0.92652	0.7665	M	0.93978	3.48	0.49213	D	0.999766	D	0.58970	0.984	P	0.51550	0.673	D	0.94170	0.7422	10	0.87932	D	0	.	13.6352	0.62219	0.0:0.926:0.0:0.074	.	262	P21709	EPHA1_HUMAN	Y	262	ENSP00000275815:C262Y	ENSP00000275815:C262Y	C	-	2	0	0	EPHA1	142806916	142806916	1.000000	0.71417	0.986000	0.45419	0.907000	0.53573	7.518000	0.81795	1.409000	0.46915	0.655000	0.94253	TGC	0.210404		TCGA-IB-A5SQ-01A-11D-A32N-08	0.652	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1	1	0	1		2	2	2	0	0	0	0	74	0	74	70	1	1.900000	-3.221884	1	0.150000			0	35	34	0	402	397	0	0	1	1		0	0	74	0	0	1.000000	1.083411e-01	0	4	0	3	0	35	402
FAM135B	51059	broad.mit.edu	37	8	139165382	139165382	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr8:139165382C>T	ENST00000395297.1	-	13	1506	c.1336G>A	c.(1336-1338)Gat>Aat	p.D446N		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	446										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATACAGTTATCTTCCTTGTCT	0.328										HNSCC(54;0.14)																												ENST00000395297.1	1.000000	0.790000	1.000000	0.990000	0.990000	0.983884	0.990000	1.000000																										0				238						c.(1336-1338)Gat>Aat		family with sequence similarity 135, member B							58.0	56.0	57.0					8																	139165382		1853	4090	5943	SO:0001583	missense	51059	0	0					g.chr8:139165382C>T	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1336G>A	chr8.hg19:g.139165382C>T	ENSP00000378710:p.Asp446Asn	1	HNSCC(54;0.14)					p.D446N	NM_015912.3	NP_056996.2	2	2	4	2.322096	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)	13	1506	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	1	1	hg19	c.1336G>A	CCDS6375.2	1	.	.	.	.	.	.	.	.	.	.	C	2.542	-0.306135	0.05458	.	.	ENSG00000147724	ENST00000395297	T	0.13778	2.56	5.6	3.44	0.39384	5.6	3.44	0.39384	.	2.006110	0.01697	N	0.026948	T	0.10895	0.0266	N	0.19112	0.55	0.09310	N	1	B;B;B	0.29805	0.257;0.157;0.094	B;B;B	0.26864	0.074;0.051;0.023	T	0.28427	-1.0044	10	0.17369	T	0.5	-5.0172	10.0861	0.42419	0.0:0.8112:0.0:0.1888	.	446;446;446	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	N	446	ENSP00000378710:D446N	ENSP00000276737:D446N	D	-	1	0	0	FAM135B	139234564	139234564	0.831000	0.29352	0.867000	0.34043	0.006000	0.05464	2.266000	0.43320	1.348000	0.45733	0.655000	0.94253	GAT	0.260870		TCGA-IB-A5SQ-01A-11D-A32N-08	0.328	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	1	0	1		2	2	2	0	0	0	0	31	0	31	31	1	1.900000	-7.942450	1	0.150000	NM_015912		0	20	20	0	227	227	0	0	1	0		0	0	31	0	0	0.999996	2.090491e-02	0	0	0	3	0	20	227
DCAF4L2	138009	broad.mit.edu	37	8	88885063	88885063	+	Silent	SNP	T	T	C			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr8:88885063T>C	ENST00000319675.3	-	1	1233	c.1137A>G	c.(1135-1137)ccA>ccG	p.P379P		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	379										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TGAGCAGCCCTGGTGCTCCTC	0.562																																						ENST00000319675.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				83						c.(1135-1137)ccA>ccG		DDB1 and CUL4 associated factor 4-like 2							49.0	55.0	53.0					8																	88885063		2203	4300	6503	SO:0001819	synonymous_variant	138009	0	0					g.chr8:88885063T>C	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1137A>G	chr8.hg19:g.88885063T>C		0						p.P379P	NM_152418.3	NP_689631.1	1	2	3	2.038737	Q8NA75	DC4L2_HUMAN		1	1233	-				Silent	SNP	ENST00000319675.3	1	1	hg19	c.1137A>G	CCDS6245.1	1																																																																																								0.184261		TCGA-IB-A5SQ-01A-11D-A32N-08	0.562	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	1	0	1		2	2	2	0	0	0	0	50	0	50	50	1	1.900000	-20.000000	1	0.150000	NM_152418		0	50	48	0	323	320	1	0	1			0	0	50	0	0	1.000000	0	0	0	0	0	0	50	323
PLEC	5339	broad.mit.edu	37	8	144996470	144996470	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr8:144996470G>A	ENST00000322810.4	-	32	8099	c.7930C>T	c.(7930-7932)Cgc>Tgc	p.R2644C	PLEC_ENST00000436759.2_Missense_Mutation_p.R2534C|PLEC_ENST00000345136.3_Missense_Mutation_p.R2507C|PLEC_ENST00000527096.1_Missense_Mutation_p.R2530C|PLEC_ENST00000354589.3_Missense_Mutation_p.R2507C|PLEC_ENST00000357649.2_Missense_Mutation_p.R2511C|PLEC_ENST00000398774.2_Missense_Mutation_p.R2475C|PLEC_ENST00000356346.3_Missense_Mutation_p.R2493C|PLEC_ENST00000354958.2_Missense_Mutation_p.R2485C	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2644	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCGATGAAGCGCTCCCGCTGT	0.627																																						ENST00000322810.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999388	0.990000	1.000000																										0				137						c.(7930-7932)Cgc>Tgc		plectin							20.0	22.0	21.0					8																	144996470		2164	4254	6418	SO:0001583	missense	5339	3	121096	30				g.chr8:144996470G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7930C>T	chr8.hg19:g.144996470G>A	ENSP00000323856:p.Arg2644Cys	1					PLEC_ENST00000436759.2_Missense_Mutation_p.R2534C|PLEC_ENST00000354589.3_Missense_Mutation_p.R2507C|PLEC_ENST00000527096.1_Missense_Mutation_p.R2530C|PLEC_ENST00000357649.2_Missense_Mutation_p.R2511C|PLEC_ENST00000354958.2_Missense_Mutation_p.R2485C|PLEC_ENST00000345136.3_Missense_Mutation_p.R2507C|PLEC_ENST00000356346.3_Missense_Mutation_p.R2493C|PLEC_ENST00000398774.2_Missense_Mutation_p.R2475C	p.R2644C	NM_201380.2	NP_958782.1	2	2	4	2.322096	Q15149	PLEC_HUMAN		32	8099	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	1	1	hg19	c.7930C>T	CCDS43772.1	1	.	.	.	.	.	.	.	.	.	.	g	10.43	1.349012	0.24426	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.78595	-1.16;-1.16;-1.19;-1.19;-1.17;-1.16;-1.15;-1.16;-1.16	4.38	4.38	0.52667	4.38	4.38	0.52667	.	0.100263	0.38720	U	0.001592	T	0.68979	0.3060	L	0.40543	1.245	0.50039	D	0.999843	D;D;D;D;D;D;D;D	0.60160	0.987;0.987;0.987;0.978;0.987;0.987;0.987;0.987	B;B;B;B;B;B;B;B	0.42882	0.401;0.401;0.401;0.226;0.401;0.401;0.401;0.401	T	0.73697	-0.3901	10	0.87932	D	0	.	10.1728	0.42920	0.0:0.0:0.6587:0.3413	.	2534;2493;2485;2644;2475;2507;2511;2507	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	C	2507;2511;2507;2475;2644;2485;2493;2534;2530	ENSP00000344848:R2507C;ENSP00000350277:R2511C;ENSP00000346602:R2507C;ENSP00000381756:R2475C;ENSP00000323856:R2644C;ENSP00000347044:R2485C;ENSP00000348702:R2493C;ENSP00000388180:R2534C;ENSP00000434583:R2530C	ENSP00000323856:R2644C	R	-	1	0	0	PLEC	145068458	145068458	0.964000	0.33143	0.950000	0.38849	0.712000	0.41017	2.523000	0.45580	2.289000	0.77006	0.443000	0.29094	CGC	0.260870		TCGA-IB-A5SQ-01A-11D-A32N-08	0.627	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	1	0	1		2	2	2	0	0	0	0	27	0	27	27	1	1.900000	-20.000000	1	0.150000	NM_000445		0	23	23	0	190	187	1	0	1	1		0	0	27	0	0	1.000000	9.999991e-01	0	69	0	130	0	23	190
DBH	1621	broad.mit.edu	37	9	136508639	136508639	+	Silent	SNP	C	C	T	rs78200745		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr9:136508639C>T	ENST00000393056.2	+	4	861	c.849C>T	c.(847-849)tgC>tgT	p.C283C		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	283					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GCGGGCCCTGCGACTCCAAGA	0.662																																						ENST00000393056.2	1.000000	0.050000	0.360000	0.090000	0.160000	0.291276	0.160000	0.130000																										0				36						c.(847-849)tgC>tgT		dopamine beta-hydroxylase (dopamine beta-monooxygenase)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	C		0,4406		0,0,2203	63.0	64.0	64.0		849	-4.6	0.9	9	dbSNP_131	64	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	DBH	NM_000787.3		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		283/618	136508639	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	1621	39	121408	47				g.chr9:136508639C>T	X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.849C>T	chr9.hg19:g.136508639C>T		0						p.C283C	NM_000787.3	NP_000778.3	1	2	3	2.057426	P09172	DOPO_HUMAN		4	861	+			Q5T381|Q96AG2	Silent	SNP	ENST00000393056.2	0	1	hg19	c.849C>T	CCDS6977.2	0																																																																																								0.162562		TCGA-IB-A5SQ-01A-11D-A32N-08	0.662	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	0	0	1		2	2	2	0	0	0	0	78	0	78	78	1	1.900000	-2.758927	1	0.150000	NM_000787		0	5	5	0	481	474	0	0	1			0	0	78	0	0	0.935431	0	0	0	0	0	0	5	481
SEC16A	9919	broad.mit.edu	37	9	139360502	139360502	+	Silent	SNP	G	G	A	rs368855876		TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr9:139360502G>A	ENST00000371706.3	-	6	3714	c.3681C>T	c.(3679-3681)taC>taT	p.Y1227Y	SEC16A_ENST00000313050.7_Silent_p.Y1405Y|SEC16A_ENST00000431893.2_Silent_p.Y1227Y|SEC16A_ENST00000290037.6_Silent_p.Y1227Y			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1227	Required for endoplasmic reticulum localization.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTAGGTGCCGTAGGCAAAAT	0.577																																						ENST00000371706.3	1.000000	0.040000	0.310000	0.080000	0.140000	0.272206	0.140000	0.120000																										0				51						c.(3679-3681)taC>taT		SEC16 homolog A (S. cerevisiae)		G		0,4064		0,0,2032	53.0	65.0	61.0		4215	-0.3	0.1	9		61	2,8408		0,2,4203	no	coding-synonymous	SEC16A	NM_014866.1		0,2,6235	AA,AG,GG		0.0238,0.0,0.016		1405/2358	139360502	2,12472	2032	4205	6237	SO:0001819	synonymous_variant	9919	47	120944	49				g.chr9:139360502G>A	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.3681C>T	chr9.hg19:g.139360502G>A		0					SEC16A_ENST00000431893.2_Silent_p.Y1227Y|SEC16A_ENST00000290037.6_Silent_p.Y1227Y|SEC16A_ENST00000313050.7_Silent_p.Y1405Y	p.Y1227Y			1	2	3	2.057426	O15027	SC16A_HUMAN		6	3714	-		Myeloproliferative disorder(178;0.0511)	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	0	1	hg19	c.3681C>T		0	.	.	.	.	.	.	.	.	.	.	G	0.575	-0.839346	0.02692	0.0	2.38E-4	ENSG00000148396	ENST00000433860	.	.	.	5.76	-0.351	0.12602	5.76	-0.351	0.12602	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51028	-0.8757	4	.	.	.	-24.8088	9.9193	0.41455	0.5084:0.0:0.4916:0.0	.	.	.	.	W	102	.	.	R	-	1	2	2	SEC16A	138480323	138480323	0.021000	0.18746	0.099000	0.21106	0.012000	0.07955	-0.799000	0.04560	0.080000	0.16959	-0.136000	0.14681	CGG	0.162562		TCGA-IB-A5SQ-01A-11D-A32N-08	0.577	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	0	0	1		2	2	2	0	0	0	0	114	0	114	113	1	1.900000	-2.450970	0	0.150000	XM_088459		0	5	5	0	559	544	0	0	1	0		0	0	114	0	0	0.933261	6.645505e-02	0	0	0	38	0	5	559
TRO	7216	broad.mit.edu	37	X	54957327	54957327	+	Silent	SNP	G	G	A			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chrX:54957327G>A	ENST00000173898.7	+	12	4282	c.4170G>A	c.(4168-4170)ccG>ccA	p.P1390P	TRO_ENST00000375022.4_Intron|TRO_ENST00000319167.8_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000420798.2_Silent_p.P921P|TRO_ENST00000375041.2_Silent_p.P993P	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1390	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GCGGTGGACCGAGCACAGGAG	0.602																																						ENST00000173898.7	0.900000	0.440000	0.780000	0.530000	0.650000	0.663226	0.650000	0.640000																										0				37						c.(4168-4170)ccG>ccA		trophinin							61.0	63.0	62.0					X																	54957327		2044	4183	6227	SO:0001819	synonymous_variant	7216	1	121060	31				g.chrX:54957327G>A	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.4170G>A	chrX.hg19:g.54957327G>A							TRO_ENST00000420798.2_Silent_p.P921P|TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Silent_p.P993P|TRO_ENST00000319167.8_Intron	p.P1390P	NM_001039705.2	NP_001034794.1	0	1	1		Q12816	TROP_HUMAN		12	4282	+			B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	1	1	hg19	c.4170G>A	CCDS43959.1	0																																																																																								0.150000		TCGA-IB-A5SQ-01A-11D-A32N-08	0.602	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	0	0	1		2	3	2	1	0	1	0	111	0	111	109	1	1.900000	-2.774557	1	0.150000	NM_016157		0	28	28	0	547	537	0	0	1	0		1	0	111	0	0	1.000000	3.264240e-01	0	0	0	38	0	28	547
AR	367	broad.mit.edu	37	X	66765211	66765211	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chrX:66765211C>G	ENST00000374690.3	+	1	747	c.223C>G	c.(223-225)Cag>Gag	p.Q75E	AR_ENST00000504326.1_Missense_Mutation_p.Q75E|AR_ENST00000396044.3_Missense_Mutation_p.Q75E|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	75	Gln-rich.|Modulating.|Poly-Gln.		Missing.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gcagcagcagcagcagcagca	0.667									Androgen Insensitivity Syndrome																													ENST00000374690.3	1.000000	0.460000	1.000000	0.700000	0.990000	0.888165	0.990000	1.000000																										0				67						c.(223-225)Cag>Gag		androgen receptor	Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)						6.0	7.0	6.0					X																	66765211		2035	3926	5961	SO:0001583	missense	367	0	0		Androgen Insensitivity Syndrome	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	g.chrX:66765211C>G	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.223C>G	chrX.hg19:g.66765211C>G	ENSP00000363822:p.Gln75Glu						AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q75E|AR_ENST00000504326.1_Missense_Mutation_p.Q75E	p.Q75E	NM_000044.3	NP_000035.2	0	1	1		P10275	ANDR_HUMAN		1	747	+	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	1	0	hg19	c.223C>G	CCDS14387.1	1	.	.	.	.	.	.	.	.	.	.	N	11.10	1.538273	0.27475	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044	T;T;T	0.78924	-1.22;-1.22;-1.22	3.02	3.02	0.34903	3.02	3.02	0.34903	.	.	.	.	.	D	0.87549	0.6205	M	0.88640	2.97	0.18873	N	0.999986	D;P;P	0.59357	0.985;0.843;0.529	D;P;B	0.73708	0.981;0.848;0.363	T	0.75988	-0.3123	9	0.35671	T	0.21	.	8.7659	0.34702	0.0:1.0:0.0:0.0	.	75;75;73	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	E	75	ENSP00000363822:Q75E;ENSP00000421155:Q75E;ENSP00000379359:Q75E	ENSP00000363822:Q75E	Q	+	1	0	0	AR	66681936	66681936	0.990000	0.36364	0.979000	0.43373	0.394000	0.30568	1.643000	0.37217	1.385000	0.46445	0.495000	0.49567	CAG	0.150000		TCGA-IB-A5SQ-01A-11D-A32N-08	0.667	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	1	0	0		2	2	2	0	0	0	0	28	0	28	18	1	1.900000	-12.155730	1	0.150000	NM_000044		0	7	0	0	86	49	0	0	0	0		0	0	28	0	0	0.877700	7.894737e-03	0	0	0	2	0	7	86
DACH2	117154	broad.mit.edu	37	X	85969723	85969723	+	Splice_Site	SNP	G	G	T			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chrX:85969723G>T	ENST00000373125.4	+	6	1104	c.1104G>T	c.(1102-1104)aaG>aaT	p.K368N	DACH2_ENST00000510272.1_Splice_Site_p.K149N|DACH2_ENST00000373131.1_Splice_Site_p.K355N|DACH2_ENST00000508860.1_Splice_Site_p.K201N	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	368					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTGTTATAAAGGTAAGAATCG	0.393																																						ENST00000373125.4	1.000000	0.820000	1.000000	0.970000	0.990000	0.983155	0.990000	1.000000																										0				71						c.(1102-1104)aaG>aaT		dachshund family transcription factor 2							68.0	59.0	62.0					X																	85969723		2203	4300	6503	SO:0001630	splice_region_variant	117154	0	0					g.chrX:85969723G>T	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1104+1G>T	chrX.hg19:g.85969723G>T							DACH2_ENST00000373131.1_Splice_Site_p.K355N|DACH2_ENST00000508860.1_Splice_Site_p.K201N|DACH2_ENST00000510272.1_Splice_Site_p.K149N	p.K368N	NM_053281.3	NP_444511.1	0	1	1		Q96NX9	DACH2_HUMAN		6	1104	+			B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Splice_Site	SNP	ENST00000373125.4	1	0	hg19	c.1104G>T	CCDS14455.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984771	0.74474	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.85556	-2.0;-2.0	4.89	4.89	0.63831	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000003	D	0.90841	0.7123	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.71674	0.996;0.998;0.998;0.993	P;P;D;D	0.71184	0.893;0.883;0.972;0.909	D	0.91059	0.4884	10	0.48119	T	0.1	.	17.3486	0.87316	0.0:0.0:1.0:0.0	.	234;368;355;368	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	N	368;355;368;201;149;201;23	ENSP00000362223:K355N;ENSP00000362217:K368N	ENSP00000345134:K368N	K	+	3	2	2	DACH2	85856379	85856379	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	8.894000	0.92506	2.021000	0.59480	0.422000	0.28245	AAG	0.150000		TCGA-IB-A5SQ-01A-11D-A32N-08	0.393	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	1	0	1		2	2	2	0	0	0	0	66	0	66	64	1	1.900000	-3.075755	1	0.150000	NM_053281	Missense_Mutation	0	34	33	0	358	354	0	0	1	0		0	0	66	0	0	1.000000	8.096125e-03	0	0	0	2	0	34	358
SAMSN1	64092	broad.mit.edu	37	21	15882757	15882757	+	Silent	SNP	A	A	G			TCGA-IB-A5SQ-01A-11D-A32N-08	TCGA-IB-A5SQ-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be12fc83-9cc8-46c6-a210-1fd4e3410bb4	c2c7839f-87cb-4d5f-8089-7b0174efccd9	g.chr21:15882757A>G	ENST00000400566.1	-	5	516	c.435T>C	c.(433-435)ggT>ggC	p.G145G	SAMSN1_ENST00000285670.2_Silent_p.G213G|SAMSN1_ENST00000400564.1_Intron	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	145					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GGTTACTTGTACCATCTGAAC	0.473																																						ENST00000400566.1	1.000000	0.740000	1.000000	0.900000	0.990000	0.964433	0.990000	1.000000																										0				24						c.(433-435)ggT>ggC		SAM domain, SH3 domain and nuclear localization signals 1							103.0	98.0	100.0					21																	15882757		2075	4224	6299	SO:0001819	synonymous_variant	64092	0	0					g.chr21:15882757A>G	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.435T>C	chr21.hg19:g.15882757A>G		0					SAMSN1_ENST00000400564.1_Intron|SAMSN1_ENST00000285670.2_Silent_p.G213G	p.G145G	NM_022136.4	NP_071419.3	0	0	0	1.960603	Q9NSI8	SAMN1_HUMAN		5	516	-			B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	ENST00000400566.1			hg19	c.435T>C	CCDS42906.1	1																																																																																								0.122354		TCGA-IB-A5SQ-01A-11D-A32N-08	0.473	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1		0	1		2	2	2	0	0	0	0	59	0	59	59	1	1.900000	-20.000000	1	0.150000			0	29	28	0	315	314		0	1	0		0	0	59	0	0	1.000000	5.963782e-01	0	0	0	23	0	29	315
