#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
LRIG3	121227	broad.mit.edu	37	12	59277344	59277344	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			A	-	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr12:59277344delA	ENST00000320743.3	-	11	1560	c.1274delT	c.(1273-1275)ttafs	p.L425fs	LRIG3_ENST00000379141.4_Frame_Shift_Del_p.L365fs	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	425					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			ATTGCCTTGTAAAGACATGAT	0.383			T	ROS1	NSCLC																																	ENST00000320743.3	1.000000	4.900000e-01	0.820000	0.580000	0.680000	0.707925	0.680000	0.670000				Dom	yes			Dom	yes		12	12q14.1	12q14.1	121227	T	leucine-rich repeats and immunoglobulin-like domains 3				E	E	ROS1		NSCLC	LRIG3/ROS1(2)	0				48						c.(1273-1275)ttafs		leucine-rich repeats and immunoglobulin-like domains 3							122.0	116.0	118.0					12																	59277344		2203	4300	6503	SO:0001589	frameshift_variant	121227	0	0					g.chr12:59277344delA	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1274delT	chr12.hg19:g.59277344delA	ENSP00000326759:p.Leu425fs	0					LRIG3_ENST00000379141.4_Frame_Shift_Del_p.L365fs	p.L425fs	NM_153377.4	NP_700356.2	1	2	3	2.141350	Q6UXM1	LRIG3_HUMAN	GBM - Glioblastoma multiforme(1;1.17e-18)	11	1560	-			Q6UXL7|Q8NC72	Frame_Shift_Del	DEL	ENST00000320743.3	1	0	hg19	c.1274delT	CCDS8960.1	0																																																																																								0.469756		TCGA-IB-A5SS-01A-11D-A32N-08	0.383	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	1	0	1		24	2		0	0	0	3	58	0	58	58	1	1.850000	-20.000000	1	0.460000	NM_153377		0	36	37	0	199	196	0	0	1	1		0	0	58	0	0	0.959804	9.983174e-01		6	0	51	0	36	199
SMAD4	4089	broad.mit.edu	37	18	48604697	48604698	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			AA	-	AA	AA		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr18:48604697_48604698delAA	ENST00000342988.3	+	12	2057_2058	c.1519_1520delAA	c.(1519-1521)aaafs	p.K507fs	SMAD4_ENST00000588745.1_Frame_Shift_Del_p.K411fs|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.K507fs	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	507	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.K507Q(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GAGTTTTGTGAAAGGCTGGGGA	0.47																																						ENST00000342988.3	0.740000	4.500000e-01	0.670000	0.510000	0.580000	0.597468	0.580000	0.590000																										40	Whole gene deletion(36)|Substitution - Missense(2)|Unknown(2)	p.0?(36)|p.?(2)|p.K507Q(2)	pancreas(26)|large_intestine(5)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1519-1521)aaafs		SMAD family member 4																																				SO:0001589	frameshift_variant	4089	0	0					g.chr18:48604697_48604698delAA	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1519_1520delAA	chr18.hg19:g.48604697_48604698delAA	ENSP00000341551:p.Lys507fs	1					SMAD4_ENST00000588745.1_Frame_Shift_Del_p.K411fs|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.K507fs	p.K507fs	NM_005359.5	NP_005350.1	0	1	1	1.626997	Q13485	SMAD4_HUMAN		12	2057_2058	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Frame_Shift_Del	DEL	ENST00000342988.3	1	0	hg19	c.1519_1520delAA	CCDS11950.1	0																																																																																								0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.470	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		14	2	2	0	0	0	1	75	0	75	76	1	1.850000	-3.407717	1	0.460000	NM_005359		0	51	53	0	236	229	0	0	1	1	1	0	0	75	1078	0	1.000000	1	1	36	198	128	844	51	236
SLC39A12	221074	broad.mit.edu	37	10	18292111	18292111	+	Missense_Mutation	SNP	G	G	A	rs142064736	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr10:18292111G>A	ENST00000377369.2	+	12	2044	c.1771G>A	c.(1771-1773)Gtg>Atg	p.V591M	SLC39A12_ENST00000377374.4_Missense_Mutation_p.V554M|SLC39A12_ENST00000377371.3_Missense_Mutation_p.V590M|SLC39A12_ENST00000539911.1_Missense_Mutation_p.V457M|SLC39A12-AS1_ENST00000439319.1_RNA|SLC39A12-AS1_ENST00000445287.1_RNA	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	591					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						AGACTTTGCCGTGCTCTTAAG	0.393													G|||	13	0.00259585	0.0083	0.0029	5008	,	,		18943	0.0		0.0	False		,,,				2504	0.0					ENST00000377369.2	0.940000	6.100000e-01	0.860000	0.680000	0.770000	0.778631	0.770000	0.770000																										0				60						c.(1771-1773)Gtg>Atg		solute carrier family 39 (zinc transporter), member 12		G	MET/VAL,MET/VAL	36,4370	41.6+/-74.8	1,34,2168	166.0	164.0	165.0		1771,1660	5.5	1.0	10	dbSNP_134	165	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	SLC39A12	NM_001145195.1,NM_152725.3	21,21	1,36,6466	AA,AG,GG		0.0233,0.8171,0.2922	probably-damaging,probably-damaging	591/692,554/655	18292111	38,12968	2203	4300	6503	SO:0001583	missense	221074	108	121412	55				g.chr10:18292111G>A		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1771G>A	chr10.hg19:g.18292111G>A	ENSP00000366586:p.Val591Met	0					SLC39A12_ENST00000377374.4_Missense_Mutation_p.V554M|SLC39A12-AS1_ENST00000445287.1_RNA|SLC39A12_ENST00000539911.1_Missense_Mutation_p.V457M|SLC39A12-AS1_ENST00000439319.1_RNA|SLC39A12_ENST00000377371.3_Missense_Mutation_p.V590M	p.V591M	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	0	0	0	2.071590	Q504Y0	S39AC_HUMAN		12	2044	+			B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	1	0	hg19	c.1771G>A	CCDS44362.1	0	9	0.004120879120879121	8	0.016260162601626018	1	0.0027624309392265192	0	0.0	0	0.0	G	24.0	4.485154	0.84854	0.008171	2.33E-4	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.52789	0.1756	M	0.64080	1.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;1.0	T	0.62378	-0.6867	10	0.52906	T	0.07	-15.6242	19.7024	0.96060	0.0:0.0:1.0:0.0	.	590;591;554	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	M	591;554;590;457;511	ENSP00000366586:V591M;ENSP00000366591:V554M;ENSP00000366588:V590M;ENSP00000440445:V457M	ENSP00000366586:V591M	V	+	1	0	0	SLC39A12	18332117	18332117	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.972000	0.88022	2.724000	0.93272	0.655000	0.94253	GTG	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.393	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	109	109	109	109	1	1.850000	-3.465666	1	0.460000	NM_152725		0	68	68	0	314	313	1		1			0	0	109	0	0	1.000000	0	0	0	0	0	0	68	314
APBB1IP	54518	broad.mit.edu	37	10	26785284	26785284	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr10:26785284G>C	ENST00000376236.4	+	4	579	c.124G>C	c.(124-126)Gaa>Caa	p.E42Q	APBB1IP_ENST00000356785.4_Missense_Mutation_p.E42Q	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	42					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						ACCCAGAGCTGAATTTAACTA	0.348																																						ENST00000376236.4	0.180000	2.000000e-02	0.130000	0.040000	0.080000	0.092395	0.080000	0.080000																										0				45						c.(124-126)Gaa>Caa		amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein							93.0	96.0	95.0					10																	26785284		2203	4300	6503	SO:0001583	missense	54518	0	0					g.chr10:26785284G>C	AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.124G>C	chr10.hg19:g.26785284G>C	ENSP00000365411:p.Glu42Gln	0					APBB1IP_ENST00000356785.4_Missense_Mutation_p.E42Q	p.E42Q	NM_019043.3	NP_061916.3	0	0	0	2.071590	Q7Z5R6	AB1IP_HUMAN		4	579	+			Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	0	1	hg19	c.124G>C	CCDS31167.1	0	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618637	0.87460	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.35421	1.31	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.086924	0.85682	D	0.000000	T	0.58438	0.2122	L	0.59436	1.845	0.52501	D	0.999951	P;D;D	0.89917	0.822;1.0;1.0	P;D;D	0.74023	0.651;0.946;0.982	T	0.55062	-0.8199	10	0.59425	D	0.04	.	18.7629	0.91860	0.0:0.0:1.0:0.0	.	42;42;42	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	Q	42	ENSP00000365411:E42Q	ENSP00000349237:E42Q	E	+	1	0	0	APBB1IP	26825290	26825290	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	6.107000	0.71517	2.941000	0.99782	0.655000	0.94253	GAA	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.348	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	0	0	0	2	2	2	2	0	0	0	0	58	58	58	57	1	1.850000	-5.210345	1	0.460000	NM_019043		0	4	0	0	228	226	0		0	0		0	0	58	0	0	0.882774	1.752873e-01	0	0	0	35	0	4	228
LRIT1	26103	broad.mit.edu	37	10	85991943	85991943	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr10:85991943C>T	ENST00000372105.3	-	4	1633	c.1612G>A	c.(1612-1614)Gtc>Atc	p.V538I		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	538						integral component of endoplasmic reticulum membrane (GO:0030176)		p.V538I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AGGGCAATGACGATGGCCACA	0.532																																						ENST00000372105.3	1.000000	5.800000e-01	0.980000	0.700000	0.830000	0.835718	0.830000	1.000000																										1	Substitution - Missense(1)	p.V538I(1)	haematopoietic_and_lymphoid_tissue(1)	23						c.(1612-1614)Gtc>Atc		leucine-rich repeat, immunoglobulin-like and transmembrane domains 1							112.0	88.0	96.0					10																	85991943		2203	4300	6503	SO:0001583	missense	26103	2	121412	31				g.chr10:85991943C>T	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1612G>A	chr10.hg19:g.85991943C>T	ENSP00000361177:p.Val538Ile	1						p.V538I	NM_015613.2	NP_056428.1	1	2	3	2.562086	Q9P2V4	LRIT1_HUMAN		4	1633	-			Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	1	1	hg19	c.1612G>A	CCDS7373.1	0	.	.	.	.	.	.	.	.	.	.	C	9.192	1.026386	0.19512	.	.	ENSG00000148602	ENST00000372105	T	0.42513	0.97	5.62	2.5	0.30297	5.62	2.5	0.30297	.	0.565141	0.18543	N	0.138159	T	0.24044	0.0582	L	0.41632	1.29	0.42532	D	0.993043	P	0.36633	0.562	B	0.29862	0.108	T	0.07770	-1.0755	10	0.07030	T	0.85	.	7.4198	0.27065	0.0:0.6491:0.0:0.3509	.	538	Q9P2V4	LRIT1_HUMAN	I	538	ENSP00000361177:V538I	ENSP00000361177:V538I	V	-	1	0	0	LRIT1	85981923	85981923	0.981000	0.34729	0.410000	0.26471	0.092000	0.18411	2.499000	0.45372	0.580000	0.29522	0.563000	0.77884	GTC	0.560976		TCGA-IB-A5SS-01A-11D-A32N-08	0.532	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.850000	-20.000000	1	0.460000	NM_015613		0	30	30	0	163	160	1		1			0	0	44	0	0	1.000000	0	0	0	0	0	0	30	163
SLIT1	6585	broad.mit.edu	37	10	98816094	98816094	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr10:98816094G>A	ENST00000266058.4	-	13	1530	c.1285C>T	c.(1285-1287)Cgg>Tgg	p.R429W	SLIT1_ENST00000371070.4_Missense_Mutation_p.R429W|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	429					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TGGATGGCCCGCAGGGAGGTG	0.622																																						ENST00000266058.4	0.180000	3.000000e-02	0.140000	0.050000	0.090000	0.100985	0.090000	0.090000																										0				78						c.(1285-1287)Cgg>Tgg		slit homolog 1 (Drosophila)							104.0	101.0	102.0					10																	98816094		2203	4300	6503	SO:0001583	missense	6585	2	121410	34				g.chr10:98816094G>A	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1285C>T	chr10.hg19:g.98816094G>A	ENSP00000266058:p.Arg429Trp	1					ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.R429W	p.R429W	NM_003061.2	NP_003052.2	1	2	3	2.587009	O75093	SLIT1_HUMAN		13	1530	-		Colorectal(252;0.162)	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	0	1	hg19	c.1285C>T	CCDS7453.1	0	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056410	0.76074	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	T;T;T	0.58210	1.8;1.8;0.35	4.91	1.86	0.25419	4.91	1.86	0.25419	.	0.059286	0.64402	D	0.000002	T	0.65647	0.2711	L	0.54908	1.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.922	T	0.66791	-0.5834	10	0.87932	D	0	.	13.5661	0.61819	0.0:0.0:0.593:0.407	.	439;429	E7EWQ8;O75093	.;SLIT1_HUMAN	W	429;439;429;422	ENSP00000266058:R429W;ENSP00000360109:R429W;ENSP00000315005:R422W	ENSP00000266058:R429W	R	-	1	2	2	SLIT1	98806084	98806084	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	5.433000	0.66520	0.194000	0.20326	0.561000	0.74099	CGG	0.560976		TCGA-IB-A5SS-01A-11D-A32N-08	0.622	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	0	0	1	2	2	2	2	0	0	0	0	98	98	98	96	1	1.850000	-2.637073	1	0.460000	NM_003061		0	6	6	0	362	359	0		1	0		0	0	98	0	0	0.964396	1.197704e-03	0	0	0	3	0	6	362
PYROXD2	84795	broad.mit.edu	37	10	100155147	100155147	+	Splice_Site	SNP	C	C	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr10:100155147C>A	ENST00000370575.4	-	7	736		c.e7+1		PYROXD2_ENST00000483923.1_Splice_Site|MIR1287_ENST00000408492.1_RNA	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2								oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						GAACCACTCACCTTGGTAATG	0.577																																						ENST00000370575.4	0.090000	0	0.070000	0.010000	0.040000	0.047916	0.040000	0.040000																										0				12						c.e7+1		pyridine nucleotide-disulphide oxidoreductase domain 2							152.0	155.0	154.0					10																	100155147		2203	4300	6503	SO:0001630	splice_region_variant	84795	0	0					g.chr10:100155147C>A	AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.687+1G>T	chr10.hg19:g.100155147C>A		1					PYROXD2_ENST00000483923.1_Splice_Site|MIR1287_ENST00000408492.1_RNA		NM_032709.2	NP_116098.2	1	2	3	2.587009	Q8N2H3	PYRD2_HUMAN		7	736	-			D3DR61|Q5TAA9|Q9BRQ1	Splice_Site	SNP	ENST00000370575.4	0	1	hg19		CCDS7474.1	0	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654104	0.67472	.	.	ENSG00000119943	ENST00000370575	.	.	.	5.14	5.14	0.70334	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4032	0.87466	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	PYROXD2	100145137	100145137	1.000000	0.71417	0.993000	0.49108	0.817000	0.46193	3.922000	0.56462	2.386000	0.81285	0.655000	0.94253	.	0.560976		TCGA-IB-A5SS-01A-11D-A32N-08	0.577	PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	0	0	1	2	2	2	2	0	0	0	0	246	246	246	241	1	1.850000	-3.308682	1	0.460000	NM_032709	Intron	0	7	7	0	858	851	0		1			0	0	246	0	0	0.980057	0	0	0	0	0	0	7	858
KCNC1	3746	broad.mit.edu	37	11	17757790	17757790	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr11:17757790G>A	ENST00000379472.3	+	1	271	c.241G>A	c.(241-243)Gac>Aac	p.D81N	KCNC1_ENST00000265969.6_Missense_Mutation_p.D81N	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	81					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	CTGCCCAGCCGACGTGTGCGG	0.662																																						ENST00000379472.3	0.200000	3.000000e-02	0.150000	0.050000	0.090000	0.105360	0.090000	0.090000																										0				33						c.(241-243)Gac>Aac		potassium voltage-gated channel, Shaw-related subfamily, member 1	Dalfampridine(DB06637)						44.0	43.0	44.0					11																	17757790		2200	4292	6492	SO:0001583	missense	3746	0	0					g.chr11:17757790G>A	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.241G>A	chr11.hg19:g.17757790G>A	ENSP00000368785:p.Asp81Asn	0					KCNC1_ENST00000265969.6_Missense_Mutation_p.D81N	p.D81N	NM_004976.4	NP_004967.1	1	2	3	2.076771	P48547	KCNC1_HUMAN		1	271	+			K4DI87	Missense_Mutation	SNP	ENST00000379472.3	0	1	hg19	c.241G>A	CCDS7827.1	0	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422598	0.62622	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	T;T	0.76060	-0.99;-0.99	5.3	3.44	0.39384	5.3	3.44	0.39384	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.099935	0.64402	N	0.000002	T	0.57873	0.2083	L	0.27975	0.815	0.80722	D	1	B;P	0.42375	0.246;0.778	B;B	0.39503	0.052;0.301	T	0.50898	-0.8773	10	0.11794	T	0.64	.	11.4045	0.49889	0.1469:0.0:0.8531:0.0	.	81;81	Q3KNS8;P48547	.;KCNC1_HUMAN	N	81	ENSP00000265969:D81N;ENSP00000368785:D81N	ENSP00000265969:D81N	D	+	1	0	0	KCNC1	17714366	17714366	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.757000	0.74924	0.629000	0.30376	0.491000	0.48974	GAC	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.662	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	0	0	0	2	2	2	2	0	0	0	0	61	61	61	61	1	1.850000	-6.350677	1	0.460000	NM_004976		0	5	2	0	240	238	0		1			0	0	61	0	0	0.934743	0	0	0	0	0	0	5	240
KIF18A	81930	broad.mit.edu	37	11	28080600	28080600	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr11:28080600C>G	ENST00000263181.6	-	13	2111	c.1821G>C	c.(1819-1821)ttG>ttC	p.L607F	MIR610_ENST00000385139.1_RNA	NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	607					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						TCCTCTCTACCAAATGTTCGA	0.408																																						ENST00000263181.6	0.140000	3.000000e-02	0.110000	0.050000	0.070000	0.081580	0.070000	0.080000																										0				36						c.(1819-1821)ttG>ttC		kinesin family member 18A							177.0	175.0	176.0					11																	28080600		2202	4299	6501	SO:0001583	missense	81930	0	0					g.chr11:28080600C>G	AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.1821G>C	chr11.hg19:g.28080600C>G	ENSP00000263181:p.Leu607Phe	0					MIR610_ENST00000385139.1_RNA	p.L607F	NM_031217.3	NP_112494.3	1	2	3	2.076771	Q8NI77	KI18A_HUMAN		13	2111	-			Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	ENST00000263181.6	0	1	hg19	c.1821G>C	CCDS7867.1	0	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524458	0.44969	.	.	ENSG00000121621	ENST00000263181	T	0.77098	-1.07	5.62	0.802	0.18686	5.62	0.802	0.18686	.	0.070738	0.56097	D	0.000026	D	0.84215	0.5423	M	0.70275	2.135	0.46521	D	0.999083	D	0.89917	1.0	D	0.73380	0.98	T	0.81701	-0.0813	10	0.51188	T	0.08	.	10.6652	0.45726	0.0:0.2739:0.0:0.7261	.	607	Q8NI77	KI18A_HUMAN	F	607	ENSP00000263181:L607F	ENSP00000263181:L607F	L	-	3	2	2	KIF18A	28037176	28037176	0.986000	0.35501	0.989000	0.46669	0.381000	0.30169	0.007000	0.13174	-0.080000	0.12685	-0.229000	0.12294	TTG	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.408	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	0	0	1	2	2	2	2	0	0	0	0	136	136	136	135	1	1.850000	-1.977695	0	0.460000	NM_031217		0	9	9	0	522	513	0		1	0		0	0	136	0	0	0.993828	2.183688e-02	0	0	0	12	0	9	522
SORL1	6653	broad.mit.edu	37	11	121428026	121428026	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr11:121428026G>A	ENST00000260197.7	+	19	2704	c.2575G>A	c.(2575-2577)Gct>Act	p.A859T		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	859					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TTGTCAGGTAGCTAATCCAGA	0.532																																						ENST00000260197.7	1.000000	8.700000e-01	1.000000	0.960000	0.990000	0.986102	0.990000	1.000000																										0				91						c.(2575-2577)Gct>Act		sortilin-related receptor, L(DLR class) A repeats containing							161.0	146.0	151.0					11																	121428026		2203	4299	6502	SO:0001583	missense	6653	0	0					g.chr11:121428026G>A	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2575G>A	chr11.hg19:g.121428026G>A	ENSP00000260197:p.Ala859Thr	0						p.A859T	NM_003105.5	NP_003096	1	2	3	2.087795	Q92673	SORL_HUMAN		19	2704	+		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	1	1	hg19	c.2575G>A	CCDS8436.1	1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994993	0.54041	.	.	ENSG00000137642	ENST00000260197	D	0.91124	-2.79	5.31	5.31	0.75309	5.31	5.31	0.75309	Six-bladed beta-propeller, TolB-like (1);	0.334487	0.31519	N	0.007520	D	0.91597	0.7345	M	0.74258	2.255	0.80722	D	1	B	0.27910	0.193	B	0.34536	0.185	D	0.89616	0.3845	10	0.41790	T	0.15	.	18.9779	0.92745	0.0:0.0:1.0:0.0	.	859	Q92673	SORL_HUMAN	T	859	ENSP00000260197:A859T	ENSP00000260197:A859T	A	+	1	0	0	SORL1	120933236	120933236	0.998000	0.40836	0.999000	0.59377	0.998000	0.95712	3.282000	0.51693	2.487000	0.83934	0.655000	0.94253	GCT	0.462473		TCGA-IB-A5SS-01A-11D-A32N-08	0.532	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	1	0	1	2	2	2	2	0	0	0	0	113	113	113	110	1	1.850000	-20.000000	1	0.460000	NM_003105		0	76	76	0	233	229	1		1	1		0	0	113	0	0	1.000000	9.999614e-01	0	27	0	22	0	76	233
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	3.800000e-01	0.950000	0.520000	0.700000	0.719443	0.700000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.141350	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.469756		TCGA-IB-A5SS-01A-11D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	1.850000	-9.068718	1	0.460000	NM_033360		1532	11	11	6472	61	60	1	1	1	1	1	0	0	12	353	1	0.998677	9.785979e-01	1	23	71	17	291	11	61
NOS1	4842	broad.mit.edu	37	12	117662845	117662845	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr12:117662845G>A	ENST00000338101.4	-	25	3908	c.3904C>T	c.(3904-3906)Cgg>Tgg	p.R1302W	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.R1268W			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TCAAATTGCCGCTGTTGCCAG	0.612																																					Esophageal Squamous(162;1748 2599 51982 52956)	ENST00000338101.4	1.000000	9.100000e-01	1.000000	0.940000	0.970000	0.976972	0.970000	0.990000																										0				117						c.(3904-3906)Cgg>Tgg		nitric oxide synthase 1 (neuronal)							146.0	159.0	155.0					12																	117662845		1948	4149	6097	SO:0001583	missense	4842	0	0					g.chr12:117662845G>A		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3904C>T	chr12.hg19:g.117662845G>A	ENSP00000337459:p.Arg1302Trp	1					NOS1_ENST00000317775.6_Missense_Mutation_p.R1268W|NOS1_ENST00000344089.3_3'UTR	p.R1302W			0	1	1	1.609290	Q8WY41	NANO1_HUMAN		25	3908	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			Missense_Mutation	SNP	ENST00000338101.4	1	1	hg19	c.3904C>T	CCDS55890.1	1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874204	0.72180	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	D;D	0.85258	-1.96;-1.96	4.93	4.0	0.46444	4.93	4.0	0.46444	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.93680	0.7981	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94520	0.7726	10	0.66056	D	0.02	-31.3949	13.4871	0.61373	0.0:0.0:0.731:0.269	.	1268	P29475	NOS1_HUMAN	W	1163;1268;1302	ENSP00000320758:R1268W;ENSP00000337459:R1302W	ENSP00000320758:R1268W	R	-	1	2	2	NOS1	116147228	116147228	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.995000	0.49441	2.555000	0.86185	0.561000	0.74099	CGG	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.612	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1	1	0	1	2	2	2	2	0	0	0	0	295	295	295	291	1	1.850000	-20.000000	1	0.460000			0	189	186	0	383	379	1		1			0	0	295	0	0	1.000000	0	0	0	0	0	0	189	383
DHRS2	10202	broad.mit.edu	37	14	24114078	24114078	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr14:24114078C>A	ENST00000250383.6	+	8	1194	c.718C>A	c.(718-720)Cat>Aat	p.H240N	DHRS2_ENST00000344777.7_Silent_p.I243I	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	240					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		CAAGGAACATCATCAGCTGCA	0.512																																						ENST00000250383.6	0.970000	5.500000e-01	0.860000	0.640000	0.740000	0.759511	0.740000	0.750000																										0				14						c.(718-720)Cat>Aat		dehydrogenase/reductase (SDR family) member 2							106.0	106.0	106.0					14																	24114078		2203	4300	6503	SO:0001583	missense	10202	0	0					g.chr14:24114078C>A		CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.718C>A	chr14.hg19:g.24114078C>A	ENSP00000250383:p.His240Asn	0					DHRS2_ENST00000344777.7_Silent_p.I243I	p.H240N	NM_005794.3	NP_005785.1	0	1	1	2.065582	Q13268	DHRS2_HUMAN		8	1194	+			D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	ENST00000250383.6	1	1	hg19	c.718C>A	CCDS9604.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.123|8.123	0.781271|0.781271	0.16120|0.16120	.|.	.|.	ENSG00000100867|ENSG00000100867	ENST00000250383;ENST00000553600|ENST00000557535	D;T|.	0.87966|.	-2.32;1.02|.	5.48|5.48	-5.45|-5.45	0.02616|0.02616	5.48|5.48	-5.45|-5.45	0.02616|0.02616	.|.	.|.	.|.	.|.	.|.	T|.	0.18676|.	0.0448|.	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.32010|.	0.351|.	B|.	0.27380|.	0.079|.	T|.	0.27400|.	-1.0075|.	8|.	0.54805|.	T|.	0.06|.	.|.	3.8079|3.8079	0.08785|0.08785	0.1079:0.2756:0.1063:0.5103|0.1079:0.2756:0.1063:0.5103	.|.	240|.	D3DS54|.	.|.	N|X	240;140|139	ENSP00000250383:H240N;ENSP00000451485:H140N|.	ENSP00000250383:H240N|.	H|S	+|+	1|2	0|0	0|0	DHRS2|DHRS2	23183918|23183918	23183918|23183918	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.335000|-1.335000	0.02662|0.02662	-1.100000|-1.100000	0.03030|0.03030	-1.098000|-1.098000	0.02139|0.02139	CAT|TCA	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.512	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000071842.2	1	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.850000	-19.993090	1	0.460000	NM_182908		0	39	39	0	186	184	1		1	1		0	0	85	0	0	1.000000	9.862541e-01	0	9	0	26	0	39	186
ICE2	79664	broad.mit.edu	37	15	60747571	60747571	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr15:60747571A>G	ENST00000261520.4	-	7	971	c.737T>C	c.(736-738)aTa>aCa	p.I246T	NARG2_ENST00000439632.1_Missense_Mutation_p.I109T|NARG2_ENST00000561114.1_Missense_Mutation_p.I246T	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						AATGGTAGCTATATCGTCCTT	0.333																																						ENST00000261520.4	1.000000	8.800000e-01	1.000000	0.970000	0.990000	0.987882	0.990000	1.000000																										0				32						c.(736-738)aTa>aCa									199.0	181.0	187.0					15																	60747571		2202	4300	6502	SO:0001583	missense	0	0	0					g.chr15:60747571A>G																												ENST00000261520.4:c.737T>C	chr15.hg19:g.60747571A>G	ENSP00000261520:p.Ile246Thr	0					NARG2_ENST00000439632.1_Missense_Mutation_p.I109T|NARG2_ENST00000561114.1_Missense_Mutation_p.I246T	p.I246T	NM_024611.4	NP_078887.2	1	2	3	2.092296				7	971	-				Missense_Mutation	SNP	ENST00000261520.4	1	1	hg19	c.737T>C	CCDS10176.1	1	.	.	.	.	.	.	.	.	.	.	A	1.299	-0.605421	0.03717	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	4.68	-1.88	0.07713	4.68	-1.88	0.07713	.	0.620823	0.16985	N	0.191552	T	0.16599	0.0399	N	0.16478	0.41	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.09377	0.0;0.004	T	0.12016	-1.0564	9	0.32370	T	0.25	-0.2145	4.7993	0.13289	0.6043:0.0:0.211:0.1848	.	109;246	G3V0H6;Q659A1	.;NARG2_HUMAN	T	246;109	.	ENSP00000261520:I246T	I	-	2	0	0	NARG2	58534863	58534863	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.076000	0.14712	-0.078000	0.12730	-0.313000	0.08912	ATA	0.462473		TCGA-IB-A5SS-01A-11D-A32N-08	0.333	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.850000	-20.000000	1	0.460000			0	81	80	0	247	246	1		1	1		0	0	99	0	0	1.000000	9.928747e-01	0	6	0	20	0	81	247
ADAMTS17	170691	broad.mit.edu	37	15	100636613	100636613	+	Silent	SNP	G	G	A	rs141443664		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr15:100636613G>A	ENST00000268070.4	-	15	2190	c.2085C>T	c.(2083-2085)gaC>gaT	p.D695D		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	695	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		AGGTCTTGCCGTCCCCGCTGC	0.592																																						ENST00000268070.4	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.055359	0.040000	0.050000																										0				50						c.(2083-2085)gaC>gaT		ADAM metallopeptidase with thrombospondin type 1 motif, 17		G		0,4406		0,0,2203	94.0	101.0	99.0		2085	-3.6	0.9	15	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAMTS17	NM_139057.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		695/1096	100636613	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	170691	3	121412	42				g.chr15:100636613G>A	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2085C>T	chr15.hg19:g.100636613G>A		0						p.D695D	NM_139057.2	NP_620688.2	1	2	3	2.076387	Q8TE56	ATS17_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	15	2190	-	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	0	1	hg19	c.2085C>T	CCDS10383.1	0																																																																																								0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.592	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	0	0	1	2	11	2	2	1	1	1	1	203	203	203	201	1	1.850000	-2.351779	0	0.460000	NM_139057		0	6	7	0	542	534	0		0			1	0	203	0	0	0.156723	0	0	0	0	0	0	6	542
TSC2	7249	broad.mit.edu	37	16	2136297	2136297	+	Missense_Mutation	SNP	C	C	T	rs373635516|rs137854039		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr16:2136297C>T	ENST00000219476.3	+	37	5396	c.4766C>T	c.(4765-4767)cCg>cTg	p.P1589L	TSC2_ENST00000401874.2_Missense_Mutation_p.P1522L|TSC2_ENST00000382538.6_Missense_Mutation_p.P1474L|TSC2_ENST00000353929.4_Missense_Mutation_p.P1546L|TSC2_ENST00000350773.4_Missense_Mutation_p.P1566L|TSC2_ENST00000568454.1_Missense_Mutation_p.P1533L|TSC2_ENST00000439673.2_Missense_Mutation_p.P1486L	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1589	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GACTGCCAGCCGGACAAGGTG	0.617			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													ENST00000219476.3	1.000000	8.600000e-01	1.000000	0.920000	0.970000	0.965478	0.970000	0.990000			yes	Rec		Tuberous sclerosis 2	yes	Rec		Tuberous sclerosis 2	16	16p13.3	16p13.3	7249	D, Mis, N, F, S	tuberous sclerosis 2 gene				"""E, O"""	E, O		hamartoma, renal cell			0				56						c.(4765-4767)cCg>cTg		tuberous sclerosis 2		C	LEU/PRO,LEU/PRO,LEU/PRO	0,4396		0,0,2198	116.0	92.0	100.0		4766,4565,4697	4.5	1.0	16		100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TSC2	NM_000548.3,NM_001077183.1,NM_001114382.1	98,98,98	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	1589/1808,1522/1741,1566/1785	2136297	1,12995	2198	4300	6498	SO:0001583	missense	7249	1	121206	29	Tuberous Sclerosis	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	g.chr16:2136297C>T	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4766C>T	chr16.hg19:g.2136297C>T	ENSP00000219476:p.Pro1589Leu	1					TSC2_ENST00000353929.4_Missense_Mutation_p.P1546L|TSC2_ENST00000439673.2_Missense_Mutation_p.P1486L|TSC2_ENST00000401874.2_Missense_Mutation_p.P1522L|TSC2_ENST00000350773.4_Missense_Mutation_p.P1566L|TSC2_ENST00000382538.6_Missense_Mutation_p.P1474L|TSC2_ENST00000568454.1_Missense_Mutation_p.P1533L	p.P1589L	NM_000548.3	NP_000539.2	0	1	1	1.633385	P49815	TSC2_HUMAN		37	5396	+		Hepatocellular(780;0.0202)	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	1	1	hg19	c.4766C>T	CCDS10458.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683119	0.88542	0.0	1.16E-4	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29;-3.29	4.47	4.47	0.54385	4.47	4.47	0.54385	Rap/ran-GAP (2);	0.062472	0.64402	D	0.000004	D	0.95114	0.8417	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D;D;D;P;D;D;D	0.91635	0.999;0.998;0.999;0.842;0.999;0.999;0.999	D	0.92958	0.6386	10	0.15499	T	0.54	-22.8344	17.3319	0.87267	0.0:1.0:0.0:0.0	.	1474;1486;1566;364;1545;1522;1589	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	L	1589;1523;1546;1486;1474;1566	ENSP00000219476:P1589L;ENSP00000248099:P1546L;ENSP00000399232:P1486L;ENSP00000371978:P1474L;ENSP00000344383:P1566L	ENSP00000219476:P1589L	P	+	2	0	0	TSC2	2076298	2076298	1.000000	0.71417	0.952000	0.39060	0.768000	0.43524	7.588000	0.82629	2.319000	0.78375	0.561000	0.74099	CCG	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.617	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.850000	-20.000000	1	0.460000	NM_000548		0	66	66	0	107	105	1		1	1		0	0	91	0	0	1.000000	1	0	26	0	68	0	66	107
SCNN1G	6340	broad.mit.edu	37	16	23226527	23226527	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr16:23226527C>T	ENST00000300061.2	+	13	1830	c.1687C>T	c.(1687-1689)Cgc>Tgc	p.R563C	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	563					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	TATCATTGCCCGCCGCCAGTG	0.587																																						ENST00000300061.2	1.000000	8.500000e-01	1.000000	0.940000	0.990000	0.981389	0.990000	1.000000																										0				34						c.(1687-1689)Cgc>Tgc		sodium channel, non-voltage-gated 1, gamma subunit	Amiloride(DB00594)|Triamterene(DB00384)						95.0	88.0	90.0					16																	23226527		2197	4300	6497	SO:0001583	missense	6340	0	0					g.chr16:23226527C>T	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1687C>T	chr16.hg19:g.23226527C>T	ENSP00000300061:p.Arg563Cys	0					CTC-391G2.1_ENST00000563471.1_RNA	p.R563C	NM_001039.3	NP_001030.2	0	1	1	2.066887	P51170	SCNNG_HUMAN		13	1830	+			P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	1	1	hg19	c.1687C>T	CCDS10608.1	1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801858	0.50315	.	.	ENSG00000166828	ENST00000300061	T	0.73258	-0.73	5.22	4.26	0.50523	5.22	4.26	0.50523	.	0.000000	0.64402	D	0.000014	T	0.66790	0.2825	N	0.08118	0	0.51482	D	0.999928	D	0.89917	1.0	D	0.85130	0.997	T	0.67601	-0.5629	10	0.38643	T	0.18	-20.3075	9.9973	0.41907	0.1562:0.6932:0.1505:0.0	.	563	P51170	SCNNG_HUMAN	C	563	ENSP00000300061:R563C	ENSP00000300061:R563C	R	+	1	0	0	SCNN1G	23134028	23134028	1.000000	0.71417	0.466000	0.27168	0.654000	0.38779	2.845000	0.48254	1.154000	0.42482	0.561000	0.74099	CGC	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.587	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	1	0	1	2	2	2	2	0	0	0	0	133	133	133	130	1	1.850000	-4.166446	1	0.460000	NM_001039		0	83	83	0	260	260	1		1	0		0	0	133	0	0	1.000000	0	0	0	0	1	0	83	260
ATXN2L	11273	broad.mit.edu	37	16	28844418	28844418	+	Silent	SNP	T	T	C			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr16:28844418T>C	ENST00000336783.4	+	14	1865	c.1698T>C	c.(1696-1698)ccT>ccC	p.P566P	ATXN2L_ENST00000382686.4_Silent_p.P566P|ATXN2L_ENST00000395547.2_Silent_p.P566P|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000570200.1_Silent_p.P566P|ATXN2L_ENST00000325215.6_Silent_p.P566P|ATXN2L_ENST00000340394.8_Silent_p.P566P|ATXN2L_ENST00000564304.1_Silent_p.P572P	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	566					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GCCTGGATCCTTTTCCTCCCC	0.532																																						ENST00000336783.4	0.080000	0	0.060000	0.010000	0.030000	0.043431	0.030000	0.040000																										0				36						c.(1696-1698)ccT>ccC		ataxin 2-like							121.0	126.0	125.0					16																	28844418		2197	4300	6497	SO:0001819	synonymous_variant	11273	0	0					g.chr16:28844418T>C		CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1698T>C	chr16.hg19:g.28844418T>C		0					ATXN2L_ENST00000325215.6_Silent_p.P566P|ATXN2L_ENST00000395547.2_Silent_p.P566P|ATXN2L_ENST00000382686.4_Silent_p.P566P|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000564304.1_Silent_p.P572P|ATXN2L_ENST00000570200.1_Silent_p.P566P|ATXN2L_ENST00000340394.8_Silent_p.P566P	p.P566P	NM_007245.3	NP_009176.2	0	0	0	2.072833	Q8WWM7	ATX2L_HUMAN		14	1865	+			A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Silent	SNP	ENST00000336783.4	0	1	hg19	c.1698T>C	CCDS10641.1	0																																																																																								0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.532	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	0	0	1	2	12	6	2	1	1	1	1	206	206	206	204	1	1.850000	-2.217963	0	0.460000	NM_007245		0	5	5	0	588	576	0		0	0		1	0	206	0	0	0.064273	5.726435e-02	0	0	0	232	0	5	588
NHLRC4	283948	broad.mit.edu	37	16	618370	618370	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr16:618370C>A	ENST00000424439.2	+	2	980	c.323C>A	c.(322-324)gCc>gAc	p.A108D	NHLRC4_ENST00000540585.1_Missense_Mutation_p.A108D|PIGQ_ENST00000470411.2_5'Flank|PIGQ_ENST00000026218.5_5'Flank|PIGQ_ENST00000321878.5_5'Flank|PIGQ_ENST00000409527.2_Intron			P0CG21	NHLC4_HUMAN	NHL repeat containing 4	108																	GTGGCTGATGCCAAGGACAAC	0.667																																						ENST00000424439.2	0.300000	4.000000e-02	0.220000	0.080000	0.140000	0.155814	0.140000	0.130000																										0										c.(322-324)gCc>gAc		NHL repeat containing 4							16.0	18.0	17.0					16																	618370		1941	4097	6038	SO:0001583	missense	283948	0	0					g.chr16:618370C>A		CCDS45366.1	16p13.3	2013-03-28			ENSG00000257108	ENSG00000257108			26700	protein-coding gene	gene with protein product						12477932	Standard	NM_001301159		Approved		uc002chl.3	P0CG21	OTTHUMG00000047857	ENST00000424439.2:c.323C>A	chr16.hg19:g.618370C>A	ENSP00000410858:p.Ala108Asp	1					PIGQ_ENST00000470411.2_5'Flank|PIGQ_ENST00000026218.5_5'Flank|PIGQ_ENST00000321878.5_5'Flank|NHLRC4_ENST00000540585.1_Missense_Mutation_p.A108D|PIGQ_ENST00000409527.2_Intron	p.A108D			0	1	1	1.633385	P0CG21	NHLC4_HUMAN		2	980	+			B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000424439.2	0	1	hg19	c.323C>A	CCDS45366.1	0	.	.	.	.	.	.	.	.	.	.	C	5.854	0.341804	0.11069	.	.	ENSG00000257108	ENST00000424439;ENST00000540585	T;T	0.72282	-0.64;-0.64	4.16	1.95	0.26073	4.16	1.95	0.26073	Six-bladed beta-propeller, TolB-like (1);	0.422812	0.16956	U	0.192698	T	0.65585	0.2705	L	0.46741	1.465	0.09310	N	1	P	0.51351	0.944	P	0.48524	0.58	T	0.55636	-0.8110	9	.	.	.	.	8.147	0.31117	0.1711:0.7326:0.0:0.0963	.	108	P0CG21	NHLC4_HUMAN	D	108	ENSP00000410858:A108D;ENSP00000442223:A108D	.	A	+	2	0	0	NHLRC4	558371	558371	0.001000	0.12720	0.030000	0.17652	0.024000	0.10985	1.330000	0.33781	1.906000	0.55180	0.585000	0.79938	GCC	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.667	NHLRC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397724.1	0	0	0	2	2	2	2	0	0	0	0	45	45	45	44	1	1.850000	-7.527087	1	0.460000	NM_176677		0	4	0	0	99	97	0		0	0		0	0	45	0	0	0.877122	1.480101e-02	0	0	0	4	0	4	99
SEPHS2	22928	broad.mit.edu	37	16	30456111	30456111	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr16:30456111G>A	ENST00000478753.2	-	1	1391	c.938C>T	c.(937-939)gCg>gTg	p.A313V	SEPHS2_ENST00000500504.2_Missense_Mutation_p.A313V|SEPHS2_ENST00000542752.1_Missense_Mutation_p.A256V			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	313					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						ATCTGTGGCCGCATGGGCATT	0.448																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)	ENST00000478753.2	0.130000	1.000000e-02	0.100000	0.030000	0.060000	0.071213	0.060000	0.060000																										0				10						c.(937-939)gCg>gTg		selenophosphate synthetase 2							98.0	91.0	93.0					16																	30456111		1944	4143	6087	SO:0001583	missense	22928	0	0					g.chr16:30456111G>A	BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.938C>T	chr16.hg19:g.30456111G>A	ENSP00000418669:p.Ala313Val	0					SEPHS2_ENST00000500504.2_Missense_Mutation_p.A313V|SEPHS2_ENST00000542752.1_Missense_Mutation_p.A256V	p.A313V			0	0	0	2.072833	Q99611	SPS2_HUMAN		1	1391	-			Q9BUQ2	Missense_Mutation	SNP	ENST00000478753.2	0	1	hg19	c.938C>T		0	.	.	.	.	.	.	.	.	.	.	G	17.53	3.413384	0.62511	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.64991	-0.13;-0.13;-0.13	5.28	5.28	0.74379	5.28	5.28	0.74379	AIR synthase-related protein, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.76709	0.4025	H	0.94620	3.56	0.80722	D	1	P;P	0.49090	0.919;0.906	P;B	0.45343	0.477;0.2	D	0.84632	0.0690	10	0.87932	D	0	-10.0941	16.7892	0.85583	0.0:0.0:1.0:0.0	.	313;256	Q99611;F5H8F9	SPS2_HUMAN;.	V	313;256;264;313	ENSP00000418669:A313V;ENSP00000443601:A256V;ENSP00000426234:A313V	ENSP00000390233:A264V	A	-	2	0	0	SEPHS2	30363612	30363612	1.000000	0.71417	0.991000	0.47740	0.267000	0.26476	9.772000	0.98984	2.652000	0.90054	0.655000	0.94253	GCG	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.448	SEPHS2-001	KNOWN	basic|seleno	protein_coding	protein_coding	OTTHUMT00000109640.11	0	0	1	2	2	2	10	0	0	0	0	132	132	132	131	1	1.850000	-2.199730	0	0.460000	NM_012248		0	5	5	0	358	354	0		1	0	0	0	3	132	586	0	0.936124	7.514636e-01	5.147378e-01	0	0	188	633	5	358
HAP1	9001	broad.mit.edu	37	17	39881075	39881075	+	Missense_Mutation	SNP	C	C	T	rs537536210		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr17:39881075C>T	ENST00000310778.5	-	12	1903	c.1894G>A	c.(1894-1896)Gcc>Acc	p.A632T	JUP_ENST00000540235.1_Intron|HAP1_ENST00000393939.2_Missense_Mutation_p.A555T|HAP1_ENST00000347901.4_Missense_Mutation_p.A580T|HAP1_ENST00000341193.5_Missense_Mutation_p.A563T			P54257	HAP1_HUMAN	huntingtin-associated protein 1	632					anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TGCCAGTTGGCCAGCTGCTGG	0.627													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15235	0.0		0.0	False		,,,				2504	0.0					ENST00000310778.5	1.000000	1.000000e-02	0.080000	0.030000	0.040000	0.099051	0.040000	0.050000																										0				21						c.(1894-1896)Gcc>Acc		huntingtin-associated protein 1							122.0	123.0	122.0					17																	39881075		2203	4300	6503	SO:0001583	missense	9001	1	121412	31				g.chr17:39881075C>T	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1894G>A	chr17.hg19:g.39881075C>T	ENSP00000309392:p.Ala632Thr	0					JUP_ENST00000540235.1_Intron|HAP1_ENST00000393939.2_Missense_Mutation_p.A555T|HAP1_ENST00000347901.4_Missense_Mutation_p.A580T|HAP1_ENST00000341193.5_Missense_Mutation_p.A563T	p.A632T			1	2	3	2.123027	P54257	HAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)	12	1903	-		Breast(137;0.000162)	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	0	1	hg19	c.1894G>A		0	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117571	0.37339	.	.	ENSG00000173805	ENST00000458656;ENST00000442364;ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T;T;T	0.44881	1.32;0.91;3.15;3.41;3.27;3.16	4.14	2.06	0.26882	4.14	2.06	0.26882	.	0.560677	0.15052	N	0.283242	T	0.36138	0.0956	L	0.27053	0.805	0.09310	N	0.99999	P;D;D;D	0.56968	0.872;0.965;0.974;0.978	P;P;P;P	0.54270	0.578;0.546;0.747;0.563	T	0.10064	-1.0646	10	0.32370	T	0.25	-11.1038	4.8636	0.13596	0.219:0.6683:0.0:0.1127	.	555;563;580;632	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	T	87;49;555;632;580;563	ENSP00000404640:A87T;ENSP00000388981:A49T;ENSP00000377513:A555T;ENSP00000309392:A632T;ENSP00000334002:A580T;ENSP00000343170:A563T	ENSP00000309392:A632T	A	-	1	0	0	HAP1	37134601	37134601	0.215000	0.23574	0.948000	0.38648	0.014000	0.08584	-0.225000	0.09151	0.459000	0.27016	-0.350000	0.07774	GCC	0.467351		TCGA-IB-A5SS-01A-11D-A32N-08	0.627	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	0	0	1	2	2	2	2	0	0	0	0	243	243	243	239	1	1.850000	-1.981559	0	0.460000	NM_003949		0	7	7	0	636	625	0		1	0		0	0	243	0	0	0.979453	5.130543e-04	0	0	0	3	0	7	636
CCR10	2826	broad.mit.edu	37	17	40832279	40832279	+	Silent	SNP	G	G	C			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr17:40832279G>C	ENST00000332438.4	-	2	400	c.381C>G	c.(379-381)ggC>ggG	p.G127G	CTD-3193K9.4_ENST00000593139.1_RNA|CNTNAP1_ENST00000264638.4_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA|CCR10_ENST00000591765.1_5'UTR	NM_016602.2	NP_057686.2	P46092	CCR10_HUMAN	chemokine (C-C motif) receptor 10	127					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			lung(1)|ovary(1)|skin(1)	3		Breast(137;0.000153)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GGAAGAGGAAGCCGGCGTGGA	0.706																																						ENST00000332438.4	1.000000	3.500000e-01	1.000000	0.560000	0.860000	0.808826	0.860000	1.000000																										0				3						c.(379-381)ggC>ggG		chemokine (C-C motif) receptor 10							10.0	14.0	13.0					17																	40832279		2147	4236	6383	SO:0001819	synonymous_variant	2826	0	0					g.chr17:40832279G>C	AF215981	CCDS11435.1	17q21.1-q21.3	2012-08-08	2004-11-12	2004-11-12	ENSG00000184451	ENSG00000184451		"""GPCR / Class A : Chemokine receptors : C-C motif"""	4474	protein-coding gene	gene with protein product		600240	"""G protein-coupled receptor 2"""	GPR2		7851889	Standard	NM_016602		Approved		uc002iax.4	P46092	OTTHUMG00000132301	ENST00000332438.4:c.381C>G	chr17.hg19:g.40832279G>C		0					CCR10_ENST00000591765.1_5'UTR|CTD-3193K9.3_ENST00000592440.1_RNA|CTD-3193K9.4_ENST00000593139.1_RNA|CNTNAP1_ENST00000264638.4_5'Flank	p.G127G	NM_016602.2	NP_057686.2	1	2	3	2.123027	P46092	CCR10_HUMAN		2	400	-		Breast(137;0.000153)	Q4V749|Q6T7X2|Q9NZG2	Silent	SNP	ENST00000332438.4	0	1	hg19	c.381C>G	CCDS11435.1	1																																																																																								0.467351		TCGA-IB-A5SS-01A-11D-A32N-08	0.706	CCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255406.1	0	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	1.850000	-12.799970	1	0.460000	NM_016602		0	5	5	0	22	22	0		1	0		0	0	13	0	0	0.944039	2.005006e-01	0	0	0	4	0	5	22
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	7.900000e-01	0.990000	0.870000	0.940000	0.936562	0.940000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	24185	GRCh37	CM056413|CM920678	TP53	M	rs28934574	c.(844-846)Cgg>Tgg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	SO:0001583	missense	7157	2	121412	36	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577094G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	chr17.hg19:g.7577094G>A	ENSP00000269305:p.Arg282Trp	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron	p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.638444	P04637	P53_HUMAN		8	1033	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.844C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	2	TP53	7517819	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	53	1	1.850000	-7.257383	1	0.460000	NM_000546		0	44	44	0	84	82	1		1	1	1	0	0	55	1237	0	1.000000	1	1	47	227	64	625	44	84
KDM6B	23135	broad.mit.edu	37	17	7752044	7752044	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr17:7752044G>A	ENST00000448097.2	+	11	2769	c.2438G>A	c.(2437-2439)gGa>gAa	p.G813E	KDM6B_ENST00000254846.5_Missense_Mutation_p.G813E			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	813	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						GTGCTGGAGGGACAAAAGTAC	0.647																																						ENST00000448097.2	1.000000	8.100000e-01	0.980000	0.870000	0.930000	0.933991	0.930000	0.990000																										0				37						c.(2437-2439)gGa>gAa		lysine (K)-specific demethylase 6B							52.0	57.0	56.0					17																	7752044		2202	4300	6502	SO:0001583	missense	23135	0	0					g.chr17:7752044G>A	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2438G>A	chr17.hg19:g.7752044G>A	ENSP00000412513:p.Gly813Glu	1					KDM6B_ENST00000254846.5_Missense_Mutation_p.G813E	p.G813E			0	1	1	1.638444	O15054	KDM6B_HUMAN		11	2769	+			C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	1	1	hg19	c.2438G>A		1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958268	0.34565	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.16897	2.31;2.31	4.54	4.54	0.55810	4.54	4.54	0.55810	.	0.242138	0.31092	N	0.008272	T	0.22244	0.0536	N	0.19112	0.55	0.38701	D	0.952991	P;D	0.58268	0.816;0.982	B;P	0.55087	0.311;0.768	T	0.08229	-1.0732	10	0.87932	D	0	-5.6434	16.5716	0.84613	0.0:0.0:1.0:0.0	.	813;813	O15054;O15054-1	KDM6B_HUMAN;.	E	813	ENSP00000254846:G813E;ENSP00000412513:G813E	ENSP00000254846:G813E	G	+	2	0	0	KDM6B	7692769	7692769	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.418000	0.59828	2.526000	0.85167	0.462000	0.41574	GGA	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.647	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	132	1	1.850000	-20.000000	1	0.460000	XM_043272		0	102	101	0	242	239	0		1	1		0	0	132	0	0	1.000000	9.701730e-01	0	6	0	10	0	102	242
ARMC7	79637	broad.mit.edu	37	17	73125037	73125037	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr17:73125037C>A	ENST00000245543.1	+	3	803	c.501C>A	c.(499-501)ttC>ttA	p.F167L	ARMC7_ENST00000581078.1_3'UTR|ARMC7_ENST00000579096.1_3'UTR|NT5C_ENST00000579082.1_5'Flank	NM_024585.2	NP_078861.1	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	167						cytoplasm (GO:0005737)		p.F167F(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|pancreas(3)	9	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			TGGAGGACTTCTGCTCCCCCC	0.701																																						ENST00000245543.1	1.000000	5.300000e-01	1.000000	0.670000	0.840000	0.833307	0.840000	1.000000																										1	Substitution - coding silent(1)	p.F167F(1)	lung(1)	9						c.(499-501)ttC>ttA		armadillo repeat containing 7							16.0	16.0	16.0					17																	73125037		2203	4298	6501	SO:0001583	missense	79637	0	0					g.chr17:73125037C>A	AK025813	CCDS11714.1	17q25	2013-02-14				ENSG00000125449		"""Armadillo repeat containing"""	26168	protein-coding gene	gene with protein product						12477932	Standard	NM_024585		Approved	FLJ22160	uc002jmw.1	Q9H6L4		ENST00000245543.1:c.501C>A	chr17.hg19:g.73125037C>A	ENSP00000245543:p.Phe167Leu	0					NT5C_ENST00000579082.1_5'Flank|ARMC7_ENST00000581078.1_3'UTR|ARMC7_ENST00000579096.1_3'UTR	p.F167L	NM_024585.2	NP_078861.1	1	2	3	2.123027	Q9H6L4	ARMC7_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)	3	803	+	all_lung(278;0.14)|Lung NSC(278;0.168)		B4DVA4	Missense_Mutation	SNP	ENST00000245543.1	1	1	hg19	c.501C>A	CCDS11714.1	0	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969018	0.34754	.	.	ENSG00000125449	ENST00000245543	T	0.32272	1.46	5.18	4.22	0.49857	5.18	4.22	0.49857	Armadillo-like helical (1);Armadillo-type fold (1);	0.478366	0.24633	N	0.036863	T	0.18923	0.0454	N	0.16478	0.41	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04017	-1.0984	10	0.35671	T	0.21	.	10.8273	0.46640	0.0:0.7987:0.0:0.2013	.	167	Q9H6L4	ARMC7_HUMAN	L	167	ENSP00000245543:F167L	ENSP00000245543:F167L	F	+	3	2	2	ARMC7	70636632	70636632	1.000000	0.71417	0.968000	0.41197	0.367000	0.29736	2.074000	0.41529	1.338000	0.45544	-0.137000	0.14449	TTC	0.467351		TCGA-IB-A5SS-01A-11D-A32N-08	0.701	ARMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445846.1	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	1.850000	-20.000000	1	0.460000	NM_024585		0	18	18	0	78	75	1		1	1		0	0	23	0	0	0.999988	9.911319e-01	0	10	0	27	0	18	78
MC5R	4161	broad.mit.edu	37	18	13826098	13826098	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr18:13826098C>T	ENST00000324750.3	+	1	556	c.334C>T	c.(334-336)Cgc>Tgc	p.R112C	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	112					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						CGCCTTTGTGCGCCACATTGA	0.522																																						ENST00000324750.3	1.000000	8.300000e-01	0.990000	0.900000	0.950000	0.952839	0.950000	0.990000																										0				41						c.(334-336)Cgc>Tgc		melanocortin 5 receptor							152.0	124.0	133.0					18																	13826098		2203	4300	6503	SO:0001583	missense	4161	2	121412	31				g.chr18:13826098C>T	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.334C>T	chr18.hg19:g.13826098C>T	ENSP00000318077:p.Arg112Cys	1					AP001525.1_ENST00000390194.2_RNA	p.R112C	NM_005913.2	NP_005904.1	0	1	1	1.626997	P33032	MC5R_HUMAN		1	556	+			B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	1	1	hg19	c.334C>T	CCDS11868.1	1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704257	0.48412	.	.	ENSG00000176136	ENST00000324750	T	0.20738	2.05	4.9	3.1	0.35709	4.9	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	0.103679	0.64402	D	0.000005	T	0.33789	0.0875	L	0.39898	1.24	0.58432	D	0.999999	D	0.89917	1.0	D	0.70716	0.97	T	0.02909	-1.1095	10	0.87932	D	0	.	10.9647	0.47406	0.1464:0.7129:0.1407:0.0	.	112	P33032	MC5R_HUMAN	C	112	ENSP00000318077:R112C	ENSP00000318077:R112C	R	+	1	0	0	MC5R	13816098	13816098	1.000000	0.71417	0.932000	0.37286	0.749000	0.42624	2.825000	0.48096	0.467000	0.27218	-0.384000	0.06662	CGC	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.522	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	1	0	1	2	9	2	2	1	1	1	1	95	95	95	94	1	1.850000	-9.132377	1	0.460000	NM_005913		0	65	65	0	124	123	1		1			1	0	95	0	0	1.000000	0	0	0	0	0	0	65	124
LSR	51599	broad.mit.edu	37	19	35753550	35753550	+	Missense_Mutation	SNP	G	G	A	rs540686530		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:35753550G>A	ENST00000361790.3	+	5	1036	c.877G>A	c.(877-879)Gtc>Atc	p.V293I	LSR_ENST00000427250.1_Intron|AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000597933.1_3'UTR|LSR_ENST00000360798.3_Intron|LSR_ENST00000347609.4_Missense_Mutation_p.V256I|LSR_ENST00000354900.3_Missense_Mutation_p.V274I|LSR_ENST00000602122.1_Missense_Mutation_p.V274I	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	293	Cys-rich.				embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTGCTGCTACGTCAGGTGCCC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17474	0.0		0.001	False		,,,				2504	0.0					ENST00000361790.3	1.000000	7.600000e-01	1.000000	0.850000	0.950000	0.937296	0.950000	1.000000																										0				13						c.(877-879)Gtc>Atc		lipolysis stimulated lipoprotein receptor							100.0	80.0	87.0					19																	35753550		2203	4300	6503	SO:0001583	missense	51599	4	121412	41				g.chr19:35753550G>A	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.877G>A	chr19.hg19:g.35753550G>A	ENSP00000354575:p.Val293Ile	1					AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000347609.4_Missense_Mutation_p.V256I|LSR_ENST00000602122.1_Missense_Mutation_p.V274I|LSR_ENST00000597933.1_3'UTR|LSR_ENST00000427250.1_Intron|LSR_ENST00000354900.3_Missense_Mutation_p.V274I|LSR_ENST00000360798.3_Intron	p.V293I	NM_205834.3	NP_991403.1	1	2	3	2.485102	Q86X29	LSR_HUMAN	Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)	5	1036	+	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	ENST00000361790.3	1	1	hg19	c.877G>A	CCDS12450.1	1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862120	0.71949	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000347609	T;T;T	0.57107	0.42;0.42;0.42	4.74	4.74	0.60224	4.74	4.74	0.60224	LISCH7 (1);	0.065915	0.64402	D	0.000014	T	0.57286	0.2043	L	0.34521	1.04	0.80722	D	1	D;D;D;P	0.76494	0.999;0.977;0.982;0.84	P;P;P;B	0.61070	0.883;0.525;0.562;0.344	T	0.52155	-0.8613	10	0.27785	T	0.31	-37.3992	15.256	0.73585	0.0:0.0:1.0:0.0	.	256;274;274;293	Q86X29-2;Q86X29-3;E9PHD4;Q86X29	.;.;.;LSR_HUMAN	I	293;274;256	ENSP00000354575:V293I;ENSP00000346976:V274I;ENSP00000262627:V256I	ENSP00000262627:V256I	V	+	1	0	0	LSR	40445390	40445390	1.000000	0.71417	0.946000	0.38457	0.967000	0.64934	4.937000	0.63513	2.448000	0.82819	0.591000	0.81541	GTC	0.560976		TCGA-IB-A5SS-01A-11D-A32N-08	0.627	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	1	0	1	2	2	2	2	0	0	0	0	106	106	106	105	1	1.850000	-20.000000	1	0.460000	NM_015925		0	75	73	0	345	342	1		1	1		0	0	106	0	0	1.000000	1	0	195	0	446	0	75	345
ZNF585A	199704	broad.mit.edu	37	19	37643142	37643142	+	Silent	SNP	G	G	A	rs113590010	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:37643142G>A	ENST00000356958.4	-	5	1917	c.1659C>T	c.(1657-1659)caC>caT	p.H553H	ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000292841.5_Silent_p.H498H|ZNF585A_ENST00000392157.2_Silent_p.H498H|ZNF585A_ENST00000588723.1_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	553					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCCCACATTCGTGGCATTCAT	0.403													G|||	3	0.000599042	0.0	0.0043	5008	,	,		20513	0.0		0.0	False		,,,				2504	0.0					ENST00000356958.4	1.000000	9.000000e-01	1.000000	0.990000	0.990000	0.992826	0.990000	1.000000																										0				42						c.(1657-1659)caC>caT		zinc finger protein 585A		G	,	6,4400	11.4+/-27.6	0,6,2197	63.0	63.0	63.0		1494,1494	-5.7	0.0	19	dbSNP_132	63	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous	ZNF585A	NM_152655.2,NM_199126.1	,	0,6,6495	AA,AG,GG		0.0,0.1362,0.0461	,	498/715,498/715	37643142	6,12996	2203	4298	6501	SO:0001819	synonymous_variant	199704	21	121412	47				g.chr19:37643142G>A	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1659C>T	chr19.hg19:g.37643142G>A		1					ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000292841.5_Silent_p.H498H|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Silent_p.H498H	p.H553H			1	2	3	2.485102	Q6P3V2	Z585A_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	1917	-			Q8TE95|Q96MV3	Silent	SNP	ENST00000356958.4	1	0	hg19	c.1659C>T		1																																																																																								0.560976		TCGA-IB-A5SS-01A-11D-A32N-08	0.403	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	1	0	1	2	2	2	2	0	0	0	0	64	64	64	117	1	1.850000	-20.000000	1	0.460000	NM_152655		0	63	63	0	233	227	0		1			0	0	64	0	0	1.000000	0	0	0	0	0	0	63	233
LTBP4	8425	broad.mit.edu	37	19	41123123	41123123	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:41123123C>G	ENST00000308370.7	+	25	3261	c.3261C>G	c.(3259-3261)caC>caG	p.H1087Q	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000396819.3_Missense_Mutation_p.H1020Q|LTBP4_ENST00000545697.1_Intron|LTBP4_ENST00000204005.9_Missense_Mutation_p.H1050Q|LTBP4_ENST00000243562.9_Missense_Mutation_p.H141Q	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1088	Cys-rich.|EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ATGGGCGTCACTGCGTGGGTA	0.622																																						ENST00000308370.7	1.000000	5.900000e-01	1.000000	0.730000	0.900000	0.880398	0.900000	1.000000																										0				1						c.(3259-3261)caC>caG		latent transforming growth factor beta binding protein 4							26.0	27.0	27.0					19																	41123123		1980	4153	6133	SO:0001583	missense	8425	0	0					g.chr19:41123123C>G	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3261C>G	chr19.hg19:g.41123123C>G	ENSP00000311905:p.His1087Gln	1					LTBP4_ENST00000545697.1_Intron|LTBP4_ENST00000204005.9_Missense_Mutation_p.H1050Q|LTBP4_ENST00000396819.3_Missense_Mutation_p.H1020Q|LTBP4_ENST00000243562.9_Missense_Mutation_p.H141Q|LTBP4_ENST00000602240.1_3'UTR	p.H1087Q	NM_001042544.1	NP_001036009.1	1	4	5	3.505587	Q8N2S1	LTBP4_HUMAN	Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)	25	3261	+			O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	1	1	hg19	c.3261C>G		1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999789	0.54147	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819;ENST00000243562	D;D;D;D	0.91631	-2.19;-2.88;-2.19;-2.88	4.19	4.19	0.49359	4.19	4.19	0.49359	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.42420	D	0.000715	D	0.94138	0.8120	.	.	.	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.87578	0.993;0.998;0.998	D	0.91644	0.5329	9	0.13470	T	0.59	.	15.8101	0.78552	0.0:1.0:0.0:0.0	.	1020;1088;1050	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	Q	1050;1087;1020;141	ENSP00000204005:H1050Q;ENSP00000311905:H1087Q;ENSP00000380031:H1020Q;ENSP00000243562:H141Q	ENSP00000204005:H1050Q	H	+	3	2	2	LTBP4	45814963	45814963	0.611000	0.26992	1.000000	0.80357	0.994000	0.84299	-0.142000	0.10311	2.330000	0.79161	0.563000	0.77884	CAC	0.680473		TCGA-IB-A5SS-01A-11D-A32N-08	0.622	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.850000	-20.000000	1	0.460000	NM_003573		0	22	22	0	159	159	1		1	1		0	0	43	0	0	0.999999	1	0	22	0	267	0	22	159
CCDC9	26093	broad.mit.edu	37	19	47774764	47774764	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:47774764G>T	ENST00000221922.6	+	12	1647	c.1425G>T	c.(1423-1425)gaG>gaT	p.E475D		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	475							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		GTCCGGAGGAGCCCCTGCTGG	0.677																																						ENST00000221922.6	0.100000	1.000000e-02	0.080000	0.020000	0.040000	0.054819	0.040000	0.050000																										0				12						c.(1423-1425)gaG>gaT		coiled-coil domain containing 9							54.0	65.0	61.0					19																	47774764		2203	4300	6503	SO:0001583	missense	26093	0	0					g.chr19:47774764G>T	AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.1425G>T	chr19.hg19:g.47774764G>T	ENSP00000221922:p.Glu475Asp	1						p.E475D	NM_015603.2	NP_056418.1	0	1	1	1.646124	Q9Y3X0	CCDC9_HUMAN		12	1647	+		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		Missense_Mutation	SNP	ENST00000221922.6	0	1	hg19	c.1425G>T	CCDS12698.1	0	.	.	.	.	.	.	.	.	.	.	.	15.91	2.971115	0.53614	.	.	ENSG00000105321	ENST00000221922;ENST00000504556	T	0.25749	1.78	4.25	0.667	0.17907	4.25	0.667	0.17907	.	0.951510	0.08620	N	0.918598	T	0.17577	0.0422	L	0.33485	1.01	0.31583	N	0.654852	B	0.06786	0.001	B	0.08055	0.003	T	0.28744	-1.0034	10	0.36615	T	0.2	-8.8316	5.4815	0.16727	0.1917:0.1632:0.6451:0.0	.	475	Q9Y3X0	CCDC9_HUMAN	D	475;457	ENSP00000221922:E475D	ENSP00000221922:E475D	E	+	3	2	2	CCDC9	52466604	52466604	0.998000	0.40836	0.009000	0.14445	0.138000	0.21146	2.748000	0.47483	0.445000	0.26639	0.281000	0.19383	GAG	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.677	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466917.1	0	0	0	2	2	2	2	0	0	0	0	152	152	152	151	1	1.850000	-5.302741	1	0.460000	NM_015603		0	5	5	0	357	355	0		1	0		0	0	152	0	0	0.937045	3.643418e-01	0	0	0	79	0	5	357
NUP62	23636	broad.mit.edu	37	19	50412865	50412865	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:50412865G>A	ENST00000596217.1	-	2	2087	c.200C>T	c.(199-201)cCg>cTg	p.P67L	NUP62_ENST00000352066.3_Missense_Mutation_p.P67L|NUP62_ENST00000422090.2_Missense_Mutation_p.P67L|NUP62_ENST00000413454.1_Missense_Mutation_p.P67L|IL4I1_ENST00000341114.3_Intron|CTC-326K19.6_ENST00000451973.1_3'UTR|NUP62_ENST00000597029.1_Missense_Mutation_p.P67L|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000597723.1_Missense_Mutation_p.P67L|IL4I1_ENST00000595948.1_Intron			P37198	NUP62_HUMAN	nucleoporin 62kDa	67	15 X 9 AA approximate repeats.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CTGTGTGGCCGGAGTCTGGGT	0.552																																						ENST00000596217.1	0.070000	0	0.050000	0.010000	0.030000	0.037593	0.030000	0.030000																										0				19						c.(199-201)cCg>cTg		nucleoporin 62kDa							150.0	154.0	153.0					19																	50412865		2203	4300	6503	SO:0001583	missense	23636	0	0					g.chr19:50412865G>A	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.200C>T	chr19.hg19:g.50412865G>A	ENSP00000471191:p.Pro67Leu	1					NUP62_ENST00000597723.1_Missense_Mutation_p.P67L|IL4I1_ENST00000341114.3_Intron|CTC-326K19.6_ENST00000451973.1_3'UTR|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000413454.1_Missense_Mutation_p.P67L|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_Missense_Mutation_p.P67L|NUP62_ENST00000597029.1_Missense_Mutation_p.P67L|NUP62_ENST00000422090.2_Missense_Mutation_p.P67L	p.P67L			0	1	1	1.646124	P37198	NUP62_HUMAN		2	2087	-		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	ENST00000596217.1	0	1	hg19	c.200C>T	CCDS12788.1	0	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755489	0.31046	.	.	ENSG00000213024	ENST00000319225;ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.38722	1.12;1.12;1.12	4.16	3.12	0.35913	4.16	3.12	0.35913	Nucleoporin, NSP1-like, C-terminal (1);	0.403038	0.21678	U	0.070777	T	0.29716	0.0742	L	0.38531	1.155	0.42109	D	0.991379	P;P	0.47545	0.89;0.897	B;B	0.39419	0.299;0.157	T	0.13683	-1.0500	10	0.72032	D	0.01	-4.6212	7.9938	0.30256	0.1097:0.0:0.8903:0.0	.	67;67	Q8WYU3;P37198	.;NUP62_HUMAN	L	67	ENSP00000305503:P67L;ENSP00000407331:P67L;ENSP00000387991:P67L	ENSP00000321866:P67L	P	-	2	0	0	NUP62	55104677	55104677	0.914000	0.31030	0.018000	0.16275	0.019000	0.09904	6.760000	0.74939	1.339000	0.45563	0.655000	0.94253	CCG	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.552	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	0	0	1	2	10	2	2	0	0	0	1	259	259	259	258	1	1.850000	-1.734053	0	0.460000	NM_153719		0	6	6	0	613	601	0		0	0		0	0	259	0	0	0.212976	3.634614e-01	0	0	0	115	0	6	613
KLK13	26085	broad.mit.edu	37	19	51561826	51561826	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:51561826C>T	ENST00000595793.1	-	4	656	c.614G>A	c.(613-615)gGc>gAc	p.G205D	KLK13_ENST00000595547.1_Missense_Mutation_p.G132D|KLK13_ENST00000335422.3_Missense_Mutation_p.G53D	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13	205	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		CTCTTTTGTGCCGGCACACAA	0.527																																						ENST00000595793.1	0.080000	1.000000e-02	0.060000	0.020000	0.030000	0.046736	0.030000	0.040000																										0				16						c.(613-615)gGc>gAc		kallikrein-related peptidase 13							206.0	186.0	193.0					19																	51561826		2203	4300	6503	SO:0001583	missense	26085	0	0					g.chr19:51561826C>T		CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.614G>A	chr19.hg19:g.51561826C>T	ENSP00000470555:p.Gly205Asp	1					KLK13_ENST00000595547.1_Missense_Mutation_p.G132D|KLK13_ENST00000335422.3_Missense_Mutation_p.G53D	p.G205D	NM_015596.1	NP_056411.1	0	1	1	1.646124	Q9UKR3	KLK13_HUMAN		4	656	-		all_neural(266;0.026)	A7UNK6|Q86VI8|Q9Y433	Missense_Mutation	SNP	ENST00000595793.1	0	1	hg19	c.614G>A	CCDS12822.1	0	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130091	0.56721	.	.	ENSG00000167759	ENST00000156476;ENST00000335422	D	0.90133	-2.62	4.67	4.67	0.58626	4.67	4.67	0.58626	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.136174	0.33732	N	0.004605	D	0.95971	0.8688	M	0.90595	3.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.983;0.999;0.999	D	0.96571	0.9423	10	0.87932	D	0	.	15.4416	0.75187	0.0:1.0:0.0:0.0	.	53;132;205	Q86VI8;Q86VI7;Q9UKR3	.;.;KLK13_HUMAN	D	205;53	ENSP00000334079:G53D	ENSP00000156476:G205D	G	-	2	0	0	KLK13	56253638	56253638	0.998000	0.40836	0.858000	0.33744	0.171000	0.22731	6.159000	0.71856	2.588000	0.87417	0.561000	0.74099	GGC	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.527	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464298.2	0	0	1	2	2	2	2	0	0	0	0	221	221	221	218	1	1.850000	-1.719904	0	0.460000	NM_015596		0	6	6	0	491	487	0		1	0		0	0	221	0	0	0.964288	0	0	0	0	1	0	6	491
OR2Z1	284383	broad.mit.edu	37	19	8841649	8841649	+	Missense_Mutation	SNP	C	C	T	rs199861220	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:8841649C>T	ENST00000324060.2	+	1	334	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						AGACTTTCTGCGGGGAGAAGG	0.552													C|||	2	0.000399361	0.0	0.0014	5008	,	,		20989	0.001		0.0	False		,,,				2504	0.0					ENST00000324060.2	0.160000	1.000000e-02	0.120000	0.030000	0.060000	0.078659	0.060000	0.050000																										0				18						c.(259-261)Cgg>Tgg		olfactory receptor, family 2, subfamily Z, member 1		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	108.0	95.0	100.0		259	3.0	0.0	19		100	0,8600		0,0,4300	no	missense	OR2Z1	NM_001004699.1	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	87/315	8841649	1,13005	2203	4300	6503	SO:0001583	missense	284383	2	121412	37				g.chr19:8841649C>T	AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.259C>T	chr19.hg19:g.8841649C>T	ENSP00000316284:p.Arg87Trp	1						p.R87W	NM_001004699.1	NP_001004699.1	1	4	5	3.572793	Q8NG97	OR2Z1_HUMAN		1	334	+			B9EH50|Q6IFK0|Q96R25	Missense_Mutation	SNP	ENST00000324060.2	0	1	hg19	c.259C>T	CCDS32895.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	2.412	-0.335123	0.05278	2.27E-4	0.0	ENSG00000181733	ENST00000324060	T	0.00406	7.55	4.33	3.05	0.35203	4.33	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	2.610920	0.01162	N	0.006663	T	0.00384	0.0012	L	0.39514	1.22	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.49606	-0.8922	10	0.38643	T	0.18	.	7.9281	0.29887	0.0:0.8369:0.0:0.1631	.	87	Q8NG97	OR2Z1_HUMAN	W	87	ENSP00000316284:R87W	ENSP00000316284:R87W	R	+	1	2	2	OR2Z1	8702649	8702649	0.000000	0.05858	0.009000	0.14445	0.011000	0.07611	-0.537000	0.06128	2.182000	0.69389	0.543000	0.68304	CGG	0.680473		TCGA-IB-A5SS-01A-11D-A32N-08	0.552	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459954.1	0	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	1.850000	-2.330848	0	0.460000			0	5	5	0	539	536	0		1			0	0	95	0	0	0.936893	0	0	0	0	0	0	5	539
KIR3DL1	3811	broad.mit.edu	37	19	55333120	55333120	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr19:55333120G>A	ENST00000391728.4	+	5	789	c.756G>A	c.(754-756)atG>atA	p.M252I	KIR3DL1_ENST00000541392.1_Missense_Mutation_p.M252I|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.M157I|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.M252I|KIR3DL1_ENST00000538269.1_Missense_Mutation_p.M252I|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.M252I	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	252	Ig-like C2-type 3.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CCTATGACATGTACCATCTAT	0.587																																						ENST00000391728.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999982	0.990000	1.000000																										0				11						c.(754-756)atG>atA		killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1							16.0	17.0	16.0					19																	55333120		2087	4000	6087	SO:0001583	missense	3811	0	0					g.chr19:55333120G>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.756G>A	chr19.hg19:g.55333120G>A	ENSP00000375608:p.Met252Ile	0					KIR3DL1_ENST00000541392.1_Missense_Mutation_p.M252I|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.M252I|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.M252I|KIR3DL1_ENST00000538269.1_Missense_Mutation_p.M252I|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.M157I	p.M252I	NM_013289.2	NP_037421.2	0	1	1	2.044852	P43629	KI3L1_HUMAN		5	789	+			O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000391728.4	0	1	hg19	c.756G>A	CCDS42621.1	1	.	.	.	.	.	.	.	.	.	.	-	0.425	-0.906123	0.02453	.	.	ENSG00000167633	ENST00000402254;ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14	1.47	-2.94	0.05581	1.47	-2.94	0.05581	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	3.298930	0.01900	N	0.039137	T	0.12390	0.0301	N	0.17594	0.5	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.13407	0.009;0.004;0.001;0.009	T	0.25572	-1.0128	10	0.19147	T	0.46	.	5.1298	0.14903	0.0:0.1775:0.4406:0.3819	.	252;157;252;252	Q15702;Q14946;F6QF33;P43629	.;.;.;KI3L1_HUMAN	I	252;252;252;230;252;252;157	ENSP00000384528:M252I;ENSP00000443350:M252I;ENSP00000442355:M252I;ENSP00000375608:M252I;ENSP00000326868:M252I;ENSP00000350901:M157I	ENSP00000326868:M252I	M	+	3	0	0	KIR3DL1	60024932	60024932	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.385000	0.20685	-3.201000	0.00217	-3.594000	0.00028	ATG	0.451164		TCGA-IB-A5SS-01A-11D-A32N-08	0.587	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	0	0	1	2	2	2	2	0	0	0	0	71	71	71	122	1	1.850000	-20.000000	1	0.460000	NM_013289		0	55	29	0	102	63	0		1			0	0	71	0	0	1.000000	0	0	0	0	0	0	55	102
ATP13A2	23400	broad.mit.edu	37	1	17322564	17322564	+	Silent	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr1:17322564G>A	ENST00000326735.8	-	15	1482	c.1449C>T	c.(1447-1449)taC>taT	p.Y483Y	ATP13A2_ENST00000502860.1_5'UTR|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000452699.1_Silent_p.Y478Y|ATP13A2_ENST00000341676.5_Silent_p.Y478Y			Q9NQ11	AT132_HUMAN	ATPase type 13A2	483					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		GGCTCTGGGCGTAGAGCGTGC	0.622																																						ENST00000326735.8	1.000000	0	0.080000	0.020000	0.040000	0.111962	0.040000	0.040000																										0				32						c.(1447-1449)taC>taT		ATPase type 13A2							97.0	102.0	100.0					1																	17322564		2203	4300	6503	SO:0001819	synonymous_variant	23400	14	121412	46				g.chr1:17322564G>A	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1449C>T	chr1.hg19:g.17322564G>A		0					ATP13A2_ENST00000502860.1_5'UTR|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Silent_p.Y478Y|ATP13A2_ENST00000452699.1_Silent_p.Y478Y	p.Y483Y			1	2	3	2.142064	Q9NQ11	AT132_HUMAN		15	1482	-		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Silent	SNP	ENST00000326735.8	0	1	hg19	c.1449C>T	CCDS175.1	0																																																																																								0.469756		TCGA-IB-A5SS-01A-11D-A32N-08	0.622	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	0	0	1	2	2	2	2	0	0	0	0	197	197	197	197	1	1.850000	-2.360717	0	0.460000	NM_022089		0	5	5	0	512	507	0		1	0		0	0	197	0	0	0.936213	4.554295e-01	0	0	0	139	0	5	512
ASTN1	460	broad.mit.edu	37	1	176926840	176926840	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr1:176926840G>A	ENST00000367654.3	-	11	2096	c.1885C>T	c.(1885-1887)Cgc>Tgc	p.R629C	ASTN1_ENST00000424564.2_Missense_Mutation_p.R621C|ASTN1_ENST00000367657.3_Missense_Mutation_p.R621C|ASTN1_ENST00000361833.2_Missense_Mutation_p.R621C|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	629	EGF-like 2.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCCAGCTTGCGATCTGAAATA	0.537																																						ENST00000367654.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.998943	0.990000	1.000000																										0				153						c.(1885-1887)Cgc>Tgc		astrotactin 1							85.0	81.0	83.0					1																	176926840		2203	4300	6503	SO:0001583	missense	460	3	121412	36				g.chr1:176926840G>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1885C>T	chr1.hg19:g.176926840G>A	ENSP00000356626:p.Arg629Cys	0					ASTN1_ENST00000367657.3_Missense_Mutation_p.R621C|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Missense_Mutation_p.R621C|ASTN1_ENST00000424564.2_Missense_Mutation_p.R621C	p.R629C	NM_004319.1	NP_004310.1	1	2	3	2.095873	O14525	ASTN1_HUMAN		11	2096	-			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	1	1	hg19	c.1885C>T		1	.	.	.	.	.	.	.	.	.	.	G	32	5.191818	0.94923	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;T;D	0.87571	-2.27;-2.27;2.64;-2.27	5.58	5.58	0.84498	5.58	5.58	0.84498	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.90363	0.6984	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.992	D	0.91468	0.5194	10	0.87932	D	0	-28.5238	19.1684	0.93567	0.0:0.0:1.0:0.0	.	629;621;621	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	C	621;621;629;621;621	ENSP00000356629:R621C;ENSP00000354536:R621C;ENSP00000356626:R629C;ENSP00000395041:R621C	ENSP00000354536:R621C	R	-	1	0	0	ASTN1	175193463	175193463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.296000	0.96104	2.618000	0.88619	0.563000	0.77884	CGC	0.462473		TCGA-IB-A5SS-01A-11D-A32N-08	0.537	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	82	82	82	80	1	1.850000	-6.215812	1	0.460000	NM_004319		0	68	66	0	172	171	1		1			0	0	82	0	0	1.000000	0	0	0	0	0	0	68	172
HLX	3142	broad.mit.edu	37	1	221057751	221057751	+	Missense_Mutation	SNP	C	C	T	rs199521070		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr1:221057751C>T	ENST00000366903.6	+	4	2673	c.1172C>T	c.(1171-1173)aCg>aTg	p.T391M	HLX_ENST00000549319.1_Missense_Mutation_p.T177M	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	391	Ser-rich.				cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CCCAGCGACACGGAGCGGACT	0.642																																						ENST00000366903.6	1.000000	9.000000e-01	1.000000	0.990000	0.990000	0.993210	0.990000	1.000000																										0				32						c.(1171-1173)aCg>aTg		H2.0-like homeobox							59.0	52.0	55.0					1																	221057751		2203	4300	6503	SO:0001583	missense	3142	0	0					g.chr1:221057751C>T	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.1172C>T	chr1.hg19:g.221057751C>T	ENSP00000355870:p.Thr391Met	0					HLX_ENST00000549319.1_Missense_Mutation_p.T177M	p.T391M	NM_021958.3	NP_068777.1	1	2	3	2.095873	Q14774	HLX_HUMAN		4	2673	+			B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	1	1	hg19	c.1172C>T	CCDS1527.1	1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952214	0.53293	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;T;T	0.90385	-2.66;0.51;3.29	5.03	4.09	0.47781	5.03	4.09	0.47781	.	0.247697	0.27811	N	0.017749	D	0.84174	0.5414	N	0.24115	0.695	0.09310	N	1	P	0.48640	0.913	B	0.43809	0.432	T	0.77587	-0.2532	10	0.66056	D	0.02	-14.4125	9.6566	0.39930	0.1598:0.6859:0.1543:0.0	.	391	Q14774	HLX_HUMAN	M	391;124;177	ENSP00000355870:T391M;ENSP00000408248:T124M;ENSP00000449882:T177M	ENSP00000355870:T391M	T	+	2	0	0	HLX	219124374	219124374	0.977000	0.34250	0.038000	0.18304	0.737000	0.42083	2.102000	0.41796	1.207000	0.43291	0.561000	0.74099	ACG	0.462473		TCGA-IB-A5SS-01A-11D-A32N-08	0.642	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	1	0	1	2	2	2	2	0	0	0	0	58	58	58	56	1	1.850000	-20.000000	1	0.460000	NM_021958		0	59	59	0	166	160	1		1	0		0	0	58	0	0	1.000000	1	0	0	0	114	0	59	166
LPAR3	23566	broad.mit.edu	37	1	85279562	85279562	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr1:85279562G>C	ENST00000440886.1	-	2	1067	c.1029C>G	c.(1027-1029)agC>agG	p.S343R	LPAR3_ENST00000491034.1_5'Flank|LPAR3_ENST00000370611.3_Missense_Mutation_p.S343R			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	343					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						CTGCACCTTGGCTAATACTAT	0.532																																						ENST00000440886.1	0.250000	3.000000e-02	0.180000	0.060000	0.110000	0.128349	0.110000	0.100000																										0				24						c.(1027-1029)agC>agG		lysophosphatidic acid receptor 3							100.0	91.0	94.0					1																	85279562		2203	4300	6503	SO:0001583	missense	23566	0	0					g.chr1:85279562G>C	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.1029C>G	chr1.hg19:g.85279562G>C	ENSP00000395389:p.Ser343Arg	1					LPAR3_ENST00000370611.3_Missense_Mutation_p.S343R|LPAR3_ENST00000491034.1_5'Flank	p.S343R			0	1	1	1.642911	Q9UBY5	LPAR3_HUMAN		2	1067	-			A0AVA3	Missense_Mutation	SNP	ENST00000440886.1	0	1	hg19	c.1029C>G	CCDS700.1	0	.	.	.	.	.	.	.	.	.	.	G	10.85	1.465648	0.26335	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.74421	-0.84;-0.84	5.85	3.99	0.46301	5.85	3.99	0.46301	.	0.513877	0.21711	N	0.070278	T	0.35422	0.0931	N	0.14661	0.345	0.36935	D	0.892083	B	0.19583	0.037	B	0.14023	0.01	T	0.10451	-1.0629	10	0.21540	T	0.41	.	9.1901	0.37193	0.2425:0.0:0.7575:0.0	.	343	Q9UBY5	LPAR3_HUMAN	R	343	ENSP00000395389:S343R;ENSP00000359643:S343R	ENSP00000359643:S343R	S	-	3	2	2	LPAR3	85052150	85052150	1.000000	0.71417	0.087000	0.20705	0.257000	0.26127	1.974000	0.40559	0.824000	0.34613	0.650000	0.86243	AGC	0.298701		TCGA-IB-A5SS-01A-11D-A32N-08	0.532	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	0	0	0	2	2	2	2	0	0	0	0	65	65	65	64	1	1.850000	-6.755027	1	0.460000	NM_012152		0	4	0	0	122	122	0		0	0		0	0	65	0	0	0.883847	0	0	0	0	1	0	4	122
OR2G6	391211	broad.mit.edu	37	1	248685733	248685733	+	Silent	SNP	G	G	A	rs531426431	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr1:248685733G>A	ENST00000343414.4	+	1	818	c.786G>A	c.(784-786)ccG>ccA	p.P262P		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTTCAACCGGCCAATAGGA	0.448																																						ENST00000343414.4	0.190000	2.000000e-02	0.130000	0.040000	0.080000	0.098920	0.080000	0.080000																										0				61						c.(784-786)ccG>ccA		olfactory receptor, family 2, subfamily G, member 6							109.0	111.0	110.0					1																	248685733		2203	4300	6503	SO:0001819	synonymous_variant	391211	5	121412	44				g.chr1:248685733G>A		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.786G>A	chr1.hg19:g.248685733G>A		0						p.P262P	NM_001013355.1	NP_001013373.1	1	2	3	2.095873	Q5TZ20	OR2G6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)	1	818	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	B2RP33	Silent	SNP	ENST00000343414.4	0	1	hg19	c.786G>A	CCDS31119.1	0																																																																																								0.462473		TCGA-IB-A5SS-01A-11D-A32N-08	0.448	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	1.850000	-2.694931	1	0.460000	XM_372842		0	5	5	0	283	281	0		1			0	0	88	0	0	0.936928	0	0	0	0	0	0	5	283
PTPRT	11122	broad.mit.edu	37	20	40827934	40827934	+	Missense_Mutation	SNP	C	C	T	rs61749502	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr20:40827934C>T	ENST00000373187.1	-	16	2436	c.2437G>A	c.(2437-2439)Gcc>Acc	p.A813T	PTPRT_ENST00000373198.4_Missense_Mutation_p.A832T|PTPRT_ENST00000373193.3_Missense_Mutation_p.A816T|PTPRT_ENST00000373201.1_Missense_Mutation_p.A803T|PTPRT_ENST00000356100.2_Missense_Mutation_p.A822T|PTPRT_ENST00000373190.1_Missense_Mutation_p.A813T|PTPRT_ENST00000373184.1_Missense_Mutation_p.A803T			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	813					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTGCGGCTGGCGCTGAGCTTG	0.577													C|||	130	0.0259585	0.0923	0.0072	5008	,	,		18513	0.0		0.0	False		,,,				2504	0.0031					ENST00000373187.1	1.000000	8.400000e-01	1.000000	0.900000	0.970000	0.961421	0.970000	1.000000																										0				176						c.(2437-2439)Gcc>Acc		protein tyrosine phosphatase, receptor type, T		C	THR/ALA,THR/ALA	310,3796		12,286,1755	229.0	238.0	235.0		2494,2437	-12.1	0.0	20	dbSNP_129	235	1,8403		0,1,4201	yes	missense,missense	PTPRT	NM_133170.3,NM_007050.5	58,58	12,287,5956	TT,TC,CC		0.0119,7.5499,2.486	benign,benign	832/1461,813/1442	40827934	311,12199	2053	4202	6255	SO:0001583	missense	11122	899	120968	66				g.chr20:40827934C>T	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2437G>A	chr20.hg19:g.40827934C>T	ENSP00000362283:p.Ala813Thr	0					PTPRT_ENST00000373198.4_Missense_Mutation_p.A832T|PTPRT_ENST00000356100.2_Missense_Mutation_p.A822T|PTPRT_ENST00000373184.1_Missense_Mutation_p.A803T|PTPRT_ENST00000373201.1_Missense_Mutation_p.A803T|PTPRT_ENST00000373190.1_Missense_Mutation_p.A813T|PTPRT_ENST00000373193.3_Missense_Mutation_p.A816T	p.A813T			0	0	0	2.047877	O14522	PTPRT_HUMAN		16	2436	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	1	0	hg19	c.2437G>A	CCDS42874.1	1	51	0.023351648351648352	46	0.09349593495934959	5	0.013812154696132596	0	0.0	0	0.0	C	5.956	0.360303	0.11296	0.075499	1.19E-4	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.32988	1.46;1.46;1.46;1.46;1.45;1.44;1.43	6.03	-12.1	0.00011	6.03	-12.1	0.00011	.	0.964896	0.08646	N	0.914735	T	0.00300	0.0009	N	0.02225	-0.63	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.22661	-1.0210	10	0.02654	T	1	.	12.1518	0.54053	0.2949:0.6078:0.0:0.0973	.	835;813	O14522-1;O14522	.;PTPRT_HUMAN	T	813;813;816;822;835;803;803	ENSP00000362286:A813T;ENSP00000362283:A813T;ENSP00000362289:A816T;ENSP00000348408:A822T;ENSP00000362294:A835T;ENSP00000362280:A803T;ENSP00000362297:A803T	ENSP00000348408:A822T	A	-	1	0	0	PTPRT	40261348	40261348	0.920000	0.31207	0.000000	0.03702	0.902000	0.53008	-0.011000	0.12721	-2.596000	0.00453	-0.140000	0.14226	GCC	0.454986		TCGA-IB-A5SS-01A-11D-A32N-08	0.577	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1	0	0	1	2	2	2	2	0	0	0	0	308	308	308	305	1	1.850000	-1.843438	0	0.460000			0	177	175	0	604	591	1		1			0	0	308	0	0	1.000000	0	0	0	0	0	0	177	604
CDH26	60437	broad.mit.edu	37	20	58574705	58574705	+	Missense_Mutation	SNP	C	C	T	rs367650551		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr20:58574705C>T	ENST00000244047.5	+	14	2395	c.2084C>T	c.(2083-2085)aCg>aTg	p.T695M	CDH26_ENST00000348616.4_Missense_Mutation_p.T695M|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000350849.6_Missense_Mutation_p.T28M|CDH26_ENST00000244049.3_Missense_Mutation_p.T28M			Q8IXH8	CAD26_HUMAN	cadherin 26	695					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GCAGGACCCACGCAGGGAGTT	0.522																																						ENST00000244047.5	0.980000	6.000000e-01	0.890000	0.680000	0.780000	0.790043	0.780000	0.780000																										0				44						c.(2083-2085)aCg>aTg		cadherin 26		C	MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	84.0	81.0	82.0		83,2084	-5.8	0.0	20		82	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CDH26	NM_021810.4,NM_177980.2	81,81	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging,possibly-damaging	28/166,695/833	58574705	3,13003	2203	4300	6503	SO:0001583	missense	60437	8	121412	40				g.chr20:58574705C>T	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2084C>T	chr20.hg19:g.58574705C>T	ENSP00000244047:p.Thr695Met	0					CDH26_ENST00000244049.3_Missense_Mutation_p.T28M|CDH26_ENST00000348616.4_Missense_Mutation_p.T695M|CDH26_ENST00000350849.6_Missense_Mutation_p.T28M|CDH26_ENST00000497614.1_3'UTR	p.T695M			0	0	0	2.047877	Q8IXH8	CAD26_HUMAN	BRCA - Breast invasive adenocarcinoma(7;5.58e-09)	14	2395	+	all_lung(29;0.00963)		A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	1	1	hg19	c.2084C>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.687|2.687	-0.274118|-0.274118	0.05679|0.05679	4.54E-4|4.54E-4	1.16E-4|1.16E-4	ENSG00000124215|ENSG00000124215	ENST00000370991|ENST00000244047;ENST00000348616;ENST00000244049;ENST00000350849;ENST00000456106	.|T;T;T	.|0.59638	.|0.25;0.54;0.54	2.88|2.88	-5.76|-5.76	0.02376|0.02376	2.88|2.88	-5.76|-5.76	0.02376|0.02376	.|.	.|.	.|.	.|.	.|.	T|T	0.22704|0.22704	0.0548|0.0548	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P;P;P;B	.|0.43024	.|0.798;0.798;0.474;0.434	.|B;B;B;B	.|0.32465	.|0.094;0.146;0.032;0.07	T|T	0.20940|0.20940	-1.0260|-1.0260	5|9	.|0.34782	.|T	.|0.22	.|.	2.0821|2.0821	0.03637|0.03637	0.2073:0.422:0.0986:0.2721|0.2073:0.422:0.0986:0.2721	.|.	.|28;28;695;695	.|Q8IXH8-5;Q8IXH8-2;Q8IXH8;Q8IXH8-4	.|.;.;CAD26_HUMAN;.	C|M	287|695;695;28;28;28	.|ENSP00000244047:T695M;ENSP00000339390:T695M;ENSP00000310845:T28M	.|ENSP00000244047:T695M	R|T	+|+	1|2	0|0	0|0	CDH26|CDH26	58008100|58008100	58008100|58008100	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.002000|-2.002000	0.01464|0.01464	-1.744000|-1.744000	0.01338|0.01338	-3.845000|-3.845000	0.00018|0.00018	CGC|ACG	0.454986		TCGA-IB-A5SS-01A-11D-A32N-08	0.522	CDH26-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	1.850000	-20.000000	1	0.460000	NM_177980		0	51	48	0	229	228	1		1	0		0	0	84	0	0	1.000000	6.726205e-01	0	1	0	11	0	51	229
RFPL1	5988	broad.mit.edu	37	22	29835118	29835118	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr22:29835118T>A	ENST00000354373.2	+	1	547	c.338T>A	c.(337-339)aTt>aAt	p.I113N	RFPL1S_ENST00000539579.1_RNA|RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	113	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						CTGAAGAAGATTCTGCAGATG	0.512																																						ENST00000354373.2	1.000000	2.000000e-02	0.100000	0.030000	0.060000	0.120641	0.060000	0.060000																										0				16						c.(337-339)aTt>aAt		ret finger protein-like 1							127.0	121.0	123.0					22																	29835118		2203	4300	6503	SO:0001583	missense	5988	0	0					g.chr22:29835118T>A	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.338T>A	chr22.hg19:g.29835118T>A	ENSP00000346342:p.Ile113Asn	0					RFPL1S_ENST00000461286.3_RNA|RFPL1S_ENST00000539579.1_RNA	p.I113N	NM_021026.2	NP_066306.2	1	2	3	2.134110	O75677	RFPL1_HUMAN		1	547	+			Q6IC06|Q9UJ97	Missense_Mutation	SNP	ENST00000354373.2	0	1	hg19	c.338T>A	CCDS13857.2	0	.	.	.	.	.	.	.	.	.	.	-	12.72	2.023419	0.35701	.	.	ENSG00000128250	ENST00000354373	T	0.30448	1.53	1.66	-1.88	0.07713	1.66	-1.88	0.07713	RDM domain, Ret finger protein-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.37705	0.1013	L	0.52573	1.65	0.09310	N	1	D	0.59767	0.986	D	0.69307	0.963	T	0.24333	-1.0163	9	0.37606	T	0.19	.	2.2276	0.03988	0.0:0.235:0.315:0.45	.	113	O75677	RFPL1_HUMAN	N	113	ENSP00000346342:I113N	ENSP00000346342:I113N	I	+	2	0	0	RFPL1	28165118	28165118	0.004000	0.15560	0.004000	0.12327	0.209000	0.24338	-0.522000	0.06237	-0.097000	0.12307	0.342000	0.21767	ATT	0.468556		TCGA-IB-A5SS-01A-11D-A32N-08	0.512	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318719.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	132	1	1.850000	-6.096757	1	0.460000	NM_021026		0	6	6	0	441	434	0		1	0		0	0	131	0	0	0.963464	0	0	0	0	1	0	6	441
CACNA1I	8911	broad.mit.edu	37	22	40042649	40042649	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr22:40042649C>T	ENST00000402142.3	+	8	1225	c.1225C>T	c.(1225-1227)Cac>Tac	p.H409Y	CACNA1I_ENST00000401624.1_Missense_Mutation_p.H409Y|CACNA1I_ENST00000407673.1_Missense_Mutation_p.H409Y|CACNA1I_ENST00000404898.1_Missense_Mutation_p.H409Y|CACNA1I_ENST00000400164.3_Missense_Mutation_p.H409Y|CACNA1I_ENST00000336649.4_Missense_Mutation_p.H409Y	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	409					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GCAACGGGAGCACCGGCTGAT	0.607																																						ENST00000402142.3	1.000000	4.300000e-01	1.000000	0.670000	0.980000	0.873955	0.980000	1.000000																										0				60						c.(1225-1227)Cac>Tac		calcium channel, voltage-dependent, T type, alpha 1I subunit	Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)						13.0	15.0	14.0					22																	40042649		2102	4229	6331	SO:0001583	missense	8911	0	0					g.chr22:40042649C>T	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.1225C>T	chr22.hg19:g.40042649C>T	ENSP00000385019:p.His409Tyr	0					CACNA1I_ENST00000400164.3_Missense_Mutation_p.H409Y|CACNA1I_ENST00000404898.1_Missense_Mutation_p.H409Y|CACNA1I_ENST00000401624.1_Missense_Mutation_p.H409Y|CACNA1I_ENST00000336649.4_Missense_Mutation_p.H409Y|CACNA1I_ENST00000407673.1_Missense_Mutation_p.H409Y	p.H409Y	NM_021096.3	NP_066919.2	1	2	3	2.134110	Q9P0X4	CAC1I_HUMAN		8	1225	+	Melanoma(58;0.0749)		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	0	1	hg19	c.1225C>T	CCDS46710.1	1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144395	0.37825	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.96885	-4.14;-4.09;-4.13;-4.09;-4.16;-4.06	3.49	3.49	0.39957	3.49	3.49	0.39957	.	0.300797	0.30151	U	0.010282	D	0.96725	0.8931	M	0.63843	1.955	0.50813	D	0.999896	P;D;P;D	0.63880	0.919;0.969;0.919;0.993	B;P;B;D	0.72982	0.441;0.792;0.441;0.979	D	0.95148	0.8270	10	0.02654	T	1	.	15.8737	0.79145	0.0:1.0:0.0:0.0	.	409;409;409;409	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	Y	409	ENSP00000385019:H409Y;ENSP00000384093:H409Y;ENSP00000383887:H409Y;ENSP00000385680:H409Y;ENSP00000337829:H409Y;ENSP00000383028:H409Y	ENSP00000337829:H409Y	H	+	1	0	0	CACNA1I	38372595	38372595	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.658000	0.37376	1.899000	0.54978	0.305000	0.20034	CAC	0.468556		TCGA-IB-A5SS-01A-11D-A32N-08	0.607	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.850000	-14.565670	1	0.460000	NM_001003406		0	6	6	0	22	22	1		1			0	0	10	0	0	0.970955	0	0	0	0	0	0	6	22
SBF1	6305	broad.mit.edu	37	22	50900742	50900742	+	Missense_Mutation	SNP	C	C	T	rs200624784		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr22:50900742C>T	ENST00000390679.3	-	19	2472	c.2288G>A	c.(2287-2289)cGc>cAc	p.R763H	SBF1_ENST00000380817.3_Missense_Mutation_p.R763H|SBF1_ENST00000348911.6_Missense_Mutation_p.R764H			O95248	MTMR5_HUMAN	SET binding factor 1	763					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GTAGCTCATGCGGTTGGCATA	0.647																																						ENST00000390679.3	1.000000	1.000000e-02	0.110000	0.030000	0.060000	0.124098	0.060000	0.060000																										0				43						c.(2287-2289)cGc>cAc		SET binding factor 1		C	HIS/ARG	0,4308		0,0,2154	58.0	65.0	63.0		2288	4.5	1.0	22		63	1,8493		0,1,4246	yes	missense	SBF1	NM_002972.2	29	0,1,6400	TT,TC,CC		0.0118,0.0,0.0078	probably-damaging	763/1894	50900742	1,12801	2154	4247	6401	SO:0001583	missense	6305	29	121210	46				g.chr22:50900742C>T	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.2288G>A	chr22.hg19:g.50900742C>T	ENSP00000375097:p.Arg763His	0					SBF1_ENST00000348911.6_Missense_Mutation_p.R764H|SBF1_ENST00000380817.3_Missense_Mutation_p.R763H	p.R763H			1	2	3	2.129916	O95248	MTMR5_HUMAN		19	2472	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	0	1	hg19	c.2288G>A		0	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503927	0.85176	0.0	1.18E-4	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	T;T;T	0.49432	0.78;0.78;0.78	4.52	4.52	0.55395	4.52	4.52	0.55395	.	0.933584	0.09027	N	0.859341	T	0.69593	0.3128	M	0.72118	2.19	0.58432	D	0.999999	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.66716	0.946;0.938;0.938	T	0.66516	-0.5904	10	0.59425	D	0.04	.	17.0388	0.86483	0.0:1.0:0.0:0.0	.	763;764;763	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	H	763;764;774;773;763	ENSP00000370196:R763H;ENSP00000252027:R764H;ENSP00000375097:R763H	ENSP00000336522:R773H	R	-	2	0	0	SBF1	49247608	49247608	0.984000	0.35163	1.000000	0.80357	0.965000	0.64279	1.018000	0.30002	2.366000	0.80165	0.655000	0.94253	CGC	0.468556		TCGA-IB-A5SS-01A-11D-A32N-08	0.647	SBF1-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	158	158	158	157	1	1.850000	-2.844892	1	0.460000			0	5	5	0	358	355	0		1	0		0	0	158	0	0	0.936587	4.975705e-01	0	0	0	107	0	5	358
VWA3B	200403	broad.mit.edu	37	2	98914394	98914394	+	Missense_Mutation	SNP	G	G	A	rs146321928		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr2:98914394G>A	ENST00000477737.1	+	24	3386	c.3182G>A	c.(3181-3183)cGc>cAc	p.R1061H	AC092675.1_ENST00000401293.1_RNA|VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1061										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGTGTGAGCCGCACCCAAGCA	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		19816	0.0		0.001	False		,,,				2504	0.0					ENST00000477737.1	0.200000	3.000000e-02	0.150000	0.050000	0.090000	0.105905	0.090000	0.090000																										0				70						c.(3181-3183)cGc>cAc		von Willebrand factor A domain containing 3B							86.0	90.0	88.0					2																	98914394		2014	4166	6180	SO:0001583	missense	200403	8	120908	41				g.chr2:98914394G>A	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3182G>A	chr2.hg19:g.98914394G>A	ENSP00000417955:p.Arg1061His	0					AC092675.1_ENST00000401293.1_RNA|VWA3B_ENST00000490947.2_3'UTR	p.R1061H	NM_144992.4	NP_659429.4	0	0	0	2.054531	Q502W6	VWA3B_HUMAN		24	3386	+			B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	0	1	hg19	c.3182G>A	CCDS42718.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	7.890	0.732062	0.15507	.	.	ENSG00000168658	ENST00000477737;ENST00000358269	T	0.23147	1.92	4.93	-0.398	0.12418	4.93	-0.398	0.12418	.	750.824000	0.00166	N	0.000000	T	0.15782	0.0380	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.32455	-0.9906	10	0.56958	D	0.05	.	8.6816	0.34212	0.2741:0.4468:0.279:0.0	.	453;1061	Q502W6-5;Q502W6	.;VWA3B_HUMAN	H	1061;183	ENSP00000417955:R1061H	ENSP00000351009:R183H	R	+	2	0	0	VWA3B	98280826	98280826	0.000000	0.05858	0.093000	0.20910	0.314000	0.28054	0.066000	0.14489	0.036000	0.15547	-0.151000	0.13558	CGC	0.457505		TCGA-IB-A5SS-01A-11D-A32N-08	0.532	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.850000	-2.576463	1	0.460000	NM_144992		0	5	5	0	237	233	0		1	0		0	0	85	0	0	0.935420	7.025761e-04	0	0	0	2	0	5	237
CXCR2	3579	broad.mit.edu	37	2	219000390	219000390	+	Missense_Mutation	SNP	G	G	A	rs186640530		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr2:219000390G>A	ENST00000318507.2	+	3	1293	c.866G>A	c.(865-867)cGc>cAc	p.R289H		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	289					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						TGTGAGCGCCGCAATCACATC	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		19234	0.001		0.0	False		,,,				2504	0.0					ENST00000318507.2	0.150000	2.000000e-02	0.120000	0.040000	0.070000	0.083445	0.070000	0.070000																										0				22						c.(865-867)cGc>cAc		chemokine (C-X-C motif) receptor 2							83.0	78.0	79.0					2																	219000390		2203	4300	6503	SO:0001583	missense	3579	6	121412	40				g.chr2:219000390G>A	U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.866G>A	chr2.hg19:g.219000390G>A	ENSP00000319635:p.Arg289His	0						p.R289H	NM_001557.3	NP_001548.1	0	0	0	2.054531	P25025	CXCR2_HUMAN		3	1293	+			Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	ENST00000318507.2	0	1	hg19	c.866G>A	CCDS2408.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.03	2.114961	0.37339	.	.	ENSG00000180871	ENST00000318507	T	0.37411	1.2	5.36	4.47	0.54385	5.36	4.47	0.54385	GPCR, rhodopsin-like superfamily (1);	0.057955	0.64402	D	0.000006	T	0.48502	0.1503	M	0.70108	2.13	0.09310	N	0.999998	P	0.38767	0.646	P	0.50231	0.635	T	0.40440	-0.9563	9	.	.	.	.	9.7981	0.40748	0.1635:0.0:0.8365:0.0	.	289	P25025	CXCR2_HUMAN	H	289	ENSP00000319635:R289H	.	R	+	2	0	0	CXCR2	218708635	218708635	0.930000	0.31532	0.358000	0.25811	0.045000	0.14185	3.615000	0.54167	1.243000	0.43853	0.456000	0.33151	CGC	0.457505		TCGA-IB-A5SS-01A-11D-A32N-08	0.597	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	0	0	1	2	2	2	2	0	0	0	0	108	108	108	108	1	1.850000	-2.437072	0	0.460000	NM_001557		0	5	5	0	303	300	0		1			0	0	108	0	0	0.936422	0	0	0	0	0	0	5	303
SLC6A1	6529	broad.mit.edu	37	3	11059035	11059035	+	Silent	SNP	G	G	A	rs183069336	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr3:11059035G>A	ENST00000287766.4	+	3	559	c.138G>A	c.(136-138)acG>acA	p.T46T	SLC6A1-AS1_ENST00000414969.2_RNA|SLC6A1_ENST00000462473.1_Intron|SLC6A1_ENST00000536032.1_Intron	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	46					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	ACCGGGACACGTGGAAGGGCC	0.617													G|||	31	0.0061901	0.0023	0.0317	5008	,	,		15529	0.006		0.0	False		,,,				2504	0.0					ENST00000287766.4	1.000000	8.200000e-01	1.000000	0.900000	0.990000	0.966777	0.990000	1.000000																										0				26						c.(136-138)acG>acA		solute carrier family 6 (neurotransmitter transporter), member 1	Clobazam(DB00349)|Tiagabine(DB00906)	G		1,4405	4.2+/-10.8	0,1,2202	80.0	82.0	81.0		138	-3.8	1.0	3		81	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	SLC6A1	NM_003042.3		0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308		46/600	11059035	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	6529	780	121412	62				g.chr3:11059035G>A		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.138G>A	chr3.hg19:g.11059035G>A		0					SLC6A1_ENST00000536032.1_Intron|SLC6A1-AS1_ENST00000414969.2_RNA|SLC6A1_ENST00000462473.1_Intron	p.T46T	NM_003042.3	NP_003033.3	0	0	0	2.058891	P30531	SC6A1_HUMAN		3	559	+		Ovarian(110;0.0392)	Q8N4K8	Silent	SNP	ENST00000287766.4	1	0	hg19	c.138G>A	CCDS2603.1	1																																																																																								0.457505		TCGA-IB-A5SS-01A-11D-A32N-08	0.617	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	0	0	1	2	2	2	2	0	0	0	0	114	114	114	112	1	1.850000	-2.496433	0	0.460000	NM_003042		0	80	80	0	263	259	1		1	0		0	0	114	0	0	1.000000	5.564212e-02	0	0	0	2	0	80	263
CPNE4	131034	broad.mit.edu	37	3	131261421	131261421	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr3:131261421G>A	ENST00000512055.1	-	19	3645	c.1519C>T	c.(1519-1521)Ccc>Tcc	p.P507S	CPNE4_ENST00000502818.1_Missense_Mutation_p.P525S|CPNE4_ENST00000511604.1_Missense_Mutation_p.P507S|CPNE4_ENST00000512332.1_Missense_Mutation_p.P525S|CPNE4_ENST00000429747.1_Missense_Mutation_p.P507S			Q96A23	CPNE4_HUMAN	copine IV	507	VWFA.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TTCCTGAAGGGCACGAACTGG	0.502																																						ENST00000512055.1	0.210000	3.000000e-02	0.160000	0.060000	0.100000	0.112824	0.100000	0.100000																										0				39						c.(1519-1521)Ccc>Tcc		copine IV							128.0	117.0	121.0					3																	131261421		2203	4300	6503	SO:0001583	missense	131034	0	0					g.chr3:131261421G>A	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1519C>T	chr3.hg19:g.131261421G>A	ENSP00000421705:p.Pro507Ser	0					CPNE4_ENST00000512332.1_Missense_Mutation_p.P525S|CPNE4_ENST00000429747.1_Missense_Mutation_p.P507S|CPNE4_ENST00000502818.1_Missense_Mutation_p.P525S|CPNE4_ENST00000511604.1_Missense_Mutation_p.P507S	p.P507S			0	0	0	2.072413	Q96A23	CPNE4_HUMAN		19	3645	-			D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	0	1	hg19	c.1519C>T	CCDS3072.1	0	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496921	0.85069	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.56103	0.49;0.49;0.48;0.49;0.48	5.48	5.48	0.80851	5.48	5.48	0.80851	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	T	0.76779	0.4035	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.991;0.992	T	0.79342	-0.1843	10	0.56958	D	0.05	-17.478	19.3471	0.94367	0.0:0.0:1.0:0.0	.	525;507	Q96A23-2;Q96A23	.;CPNE4_HUMAN	S	507;507;525;507;525	ENSP00000421705:P507S;ENSP00000411904:P507S;ENSP00000424853:P525S;ENSP00000423811:P507S;ENSP00000421646:P525S	ENSP00000411904:P507S	P	-	1	0	0	CPNE4	132744111	132744111	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	9.624000	0.98398	2.566000	0.86566	0.655000	0.94253	CCC	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.502	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.850000	-3.255014	1	0.460000	NM_130808		0	5	5	0	223	222	0		1	0		0	0	69	0	0	0.937506	4.811178e-02	0	0	0	13	0	5	223
PIK3CB	5291	broad.mit.edu	37	3	138382857	138382857	+	Missense_Mutation	SNP	C	C	T	rs142933486	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr3:138382857C>T	ENST00000477593.1	-	20	2760	c.2687G>A	c.(2686-2688)cGa>cAa	p.R896Q	PIK3CB_ENST00000289153.2_Missense_Mutation_p.R896Q|PIK3CB_ENST00000544716.1_Missense_Mutation_p.R347Q			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	896	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	CTCAATGGCTCGGTCCAGGTC	0.448																																						ENST00000477593.1	1.000000	6.700000e-01	1.000000	0.800000	0.950000	0.919559	0.950000	1.000000																										0				41						c.(2686-2688)cGa>cAa		phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	Caffeine(DB00201)						80.0	71.0	74.0					3																	138382857		2203	4300	6503	SO:0001583	missense	5291	0	0					g.chr3:138382857C>T		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2687G>A	chr3.hg19:g.138382857C>T	ENSP00000418143:p.Arg896Gln	0					PIK3CB_ENST00000289153.2_Missense_Mutation_p.R896Q|PIK3CB_ENST00000544716.1_Missense_Mutation_p.R347Q	p.R896Q			0	0	0	2.072413	P42338	PK3CB_HUMAN		20	2760	-			D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	1	1	hg19	c.2687G>A	CCDS3104.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.04|17.04	3.286996|3.286996	0.59867|0.59867	.|.	.|.	ENSG00000051382|ENSG00000051382	ENST00000493568|ENST00000477593;ENST00000544716;ENST00000289153	.|T;T;T	.|0.76060	.|-0.99;-0.99;-0.99	5.63|5.63	5.63|5.63	0.86233|0.86233	5.63|5.63	5.63|5.63	0.86233|0.86233	.|Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63640|0.63640	0.2528|0.2528	L|L	0.31207|0.31207	0.915|0.915	0.58432|0.58432	D|D	0.999998|0.999998	.|B;B;B	.|0.33379	.|0.269;0.178;0.41	.|B;B;B	.|0.24541	.|0.041;0.044;0.054	T|T	0.60662|0.60662	-0.7219|-0.7219	5|10	.|0.28530	.|T	.|0.3	-11.8261|-11.8261	20.0442|20.0442	0.97604|0.97604	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|896;483;347	.|P42338;B4DZI3;Q68DL0	.|PK3CB_HUMAN;.;.	K|Q	528|896;347;896	.|ENSP00000418143:R896Q;ENSP00000438259:R347Q;ENSP00000289153:R896Q	.|ENSP00000289153:R896Q	E|R	-|-	1|2	0|0	0|0	PIK3CB|PIK3CB	139865547|139865547	139865547|139865547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.138000|3.138000	0.50570|0.50570	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GAG|CGA	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.448	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1	1	0	0	2	2	2	2	0	0	0	0	35	35	35	35	1	1.850000	-3.470118	1	0.460000			0	28	27	0	99	99	1		1	1		0	0	35	0	0	1.000000	9.999955e-01	0	33	0	44	0	28	99
GADL1	339896	broad.mit.edu	37	3	30875345	30875345	+	Splice_Site	SNP	A	A	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr3:30875345A>T	ENST00000282538.5	-	11	1200	c.1050T>A	c.(1048-1050)tcT>tcA	p.S350S	GADL1_ENST00000454381.3_Splice_Site_p.S350S	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	350					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						GAAAACTTACAGATTTGTCTT	0.502																																						ENST00000282538.5	1.000000	6.300000e-01	1.000000	0.750000	0.880000	0.876483	0.880000	1.000000																										0				25						c.(1048-1050)tcT>tcA		glutamate decarboxylase-like 1							72.0	68.0	70.0					3																	30875345		2203	4300	6503	SO:0001630	splice_region_variant	339896	0	0					g.chr3:30875345A>T	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1050+1T>A	chr3.hg19:g.30875345A>T		0					GADL1_ENST00000454381.3_Splice_Site_p.S350S	p.S350S	NM_207359.2	NP_997242.2	0	0	0	2.072413	Q6ZQY3	GADL1_HUMAN		11	1200	-				Splice_Site	SNP	ENST00000282538.5	1	0	hg19	c.1050T>A	CCDS2649.2	1																																																																																								0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.502	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.850000	-20.000000	1	0.460000	NM_207359	Silent	0	32	32	0	125	124	1		1			0	0	58	0	0	1.000000	0	0	0	0	0	0	32	125
CNTN3	5067	broad.mit.edu	37	3	74351867	74351868	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr3:74351867_74351868GA>TT	ENST00000263665.6	-	13	1786_1787	c.1759_1760TC>AA	c.(1759-1761)TCa>AAa	p.S587K		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	587	Ig-like C2-type 6.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AGCAGCAGATGAAACACTGTCC	0.416																																						ENST00000263665.6	1.000000	7.300000e-01	1.000000	0.890000|0.880000	0.990000	0.961195|0.958196	0.990000	1.000000																										0				83						c.(1759-1761)tCa>tAa|c.(1759-1761)Tca>Aca		contactin 3 (plasmacytoma associated)																																				SO:0001583	missense	5067	0	0					g.chr3:74351867G>T|g.chr3:74351868A>T	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1759_1760delinsTT	chr3.hg19:g.74351867_74351868delinsTT	ENSP00000263665:p.Ser587Lys	0						p.S587*|p.S587T	NM_020872.1	NP_065923.1	0	0	0	2.072413	Q9P232	CNTN3_HUMAN		13	1787|1786	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	B9EK50|Q9H039	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000263665.6	0|1	1	hg19	c.1760C>A|c.1759T>A	CCDS33790.1	1																									5.08	5.08	0.68730																																												0			74434557|74434558														0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.416	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	1	0	1	2	2	2	2	0	0	0	0	36	36|37	36|37	37	1	1.850000	-4.274286|-19.583500	1	0.460000	NM_020872		0	26	26	0	80|81	79|80	1		1	0		0	0	36|37	0	0	1.000000	0	0	1	0	0	0	26	80
DVL3	1857	broad.mit.edu	37	3	183884692	183884692	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr3:183884692G>A	ENST00000313143.3	+	11	1375	c.1127G>A	c.(1126-1128)gGc>gAc	p.G376D	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Missense_Mutation_p.G359D	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	376					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CCTGCATACGGCATGAGCCCC	0.647																																						ENST00000313143.3	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.064597	0.050000	0.060000																										0				35						c.(1126-1128)gGc>gAc		dishevelled segment polarity protein 3							127.0	119.0	122.0					3																	183884692		2203	4300	6503	SO:0001583	missense	1857	0	0					g.chr3:183884692G>A	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.1127G>A	chr3.hg19:g.183884692G>A	ENSP00000316054:p.Gly376Asp	0					DVL3_ENST00000431765.1_Missense_Mutation_p.G359D|EIF2B5_ENST00000444495.1_Intron	p.G376D	NM_004423.3	NP_004414.3	0	0	0	2.072413	Q92997	DVL3_HUMAN	Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)	11	1375	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	ENST00000313143.3	0	1	hg19	c.1127G>A	CCDS3253.1	0	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398229	0.83120	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765	T;T	0.04156	3.71;3.69	5.97	5.97	0.96955	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.16557	0.0398	M	0.68593	2.085	0.80722	D	1	P;P;B;D	0.57257	0.94;0.94;0.232;0.979	P;P;B;P	0.55222	0.694;0.76;0.113;0.771	T	0.00172	-1.1958	10	0.33141	T	0.24	-34.8595	20.4387	0.99107	0.0:0.0:1.0:0.0	.	359;208;376;376	B4E3E5;Q9UG07;F5GWR8;Q92997	.;.;.;DVL3_HUMAN	D	376;376;359	ENSP00000316054:G376D;ENSP00000405885:G359D	ENSP00000316054:G376D	G	+	2	0	0	DVL3	185367386	185367386	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.008000	0.88588	2.836000	0.97738	0.655000	0.94253	GGC	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.647	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	0	0	1	2	2	2	2	0	0	0	0	171	171	171	169	1	1.850000	-2.154265	0	0.460000	NM_004423		0	6	5	0	462	456	0		1	0		0	0	171	0	0	0.963527	7.584087e-01	0	0	0	207	0	6	462
TBC1D1	23216	broad.mit.edu	37	4	38022213	38022213	+	Splice_Site	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr4:38022213G>A	ENST00000261439.4	+	5	1329	c.974G>A	c.(973-975)gGc>gAc	p.G325D	TBC1D1_ENST00000508802.1_Splice_Site_p.G325D	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	325	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CTTTGGCAGGGCATCAGACAC	0.458																																						ENST00000261439.4	0.090000	0	0.060000	0.010000	0.030000	0.052283	0.030000	0.040000																										0				36						c.(973-975)gGc>gAc		TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1							270.0	259.0	263.0					4																	38022213		2203	4300	6503	SO:0001630	splice_region_variant	23216	0	0					g.chr4:38022213G>A	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.973-1G>A	chr4.hg19:g.38022213G>A		0					TBC1D1_ENST00000508802.1_Splice_Site_p.G325D	p.G325D	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	1	2	3	2.095274	Q86TI0	TBCD1_HUMAN		5	1329	+			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Splice_Site	SNP	ENST00000261439.4	0	1	hg19	c.974G>A	CCDS33972.1	0	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905016	0.92035	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803	T;T;T	0.14266	2.52;2.52;2.52	5.48	5.48	0.80851	5.48	5.48	0.80851	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.51477	D	0.000095	T	0.36054	0.0953	L	0.54908	1.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.03555	-1.1025	10	0.87932	D	0	-20.7573	19.3503	0.94381	0.0:0.0:1.0:0.0	.	325;325;325	B9A6J6;E9PGH8;Q86TI0	.;.;TBCD1_HUMAN	D	325;325;196	ENSP00000423651:G325D;ENSP00000261439:G325D;ENSP00000396877:G196D	ENSP00000261439:G325D	G	+	2	0	0	TBC1D1	37698608	37698608	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	9.730000	0.98797	2.576000	0.86940	0.467000	0.42956	GGC	0.462473		TCGA-IB-A5SS-01A-11D-A32N-08	0.458	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	0	0	1	2	2	2	2	0	0	0	0	258	258	258	258	1	1.850000	-1.704822	0	0.460000	NM_015173	Missense_Mutation	0	6	6	0	700	691	0		1	0		0	0	258	0	0	0.963657	2.153403e-01	0	0	0	87	0	6	700
PCDHA4	56144	broad.mit.edu	37	5	140188813	140188813	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr5:140188813C>T	ENST00000530339.1	+	1	2041	c.2041C>T	c.(2041-2043)Cgg>Tgg	p.R681W	PCDHA4_ENST00000356878.4_Missense_Mutation_p.R681W|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.R681W	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	681					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCTCCTCACGGGCGTTGGT	0.632																																						ENST00000530339.1	1.000000	7.000000e-01	1.000000	0.790000	0.890000	0.893490	0.890000	1.000000																										0				78						c.(2041-2043)Cgg>Tgg		protocadherin alpha 4							57.0	57.0	57.0					5																	140188813		2203	4300	6503	SO:0001583	missense	56144	0	0					g.chr5:140188813C>T	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.2041C>T	chr5.hg19:g.140188813C>T	ENSP00000435300:p.Arg681Trp	0					PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.R681W|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.R681W|PCDHA1_ENST00000394633.3_Intron	p.R681W	NM_018907.2	NP_061730.1	1	2	3	2.084628	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2041	+			O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	1	1	hg19	c.2041C>T	CCDS54916.1	1	.	.	.	.	.	.	.	.	.	.	c	11.80	1.746491	0.30955	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.54071	0.63;0.59;0.6	3.93	-0.744	0.11101	3.93	-0.744	0.11101	.	0.210729	0.23351	U	0.049123	T	0.51466	0.1676	M	0.89601	3.045	0.09310	N	1	B;B;B	0.32717	0.381;0.082;0.137	B;B;B	0.32289	0.143;0.022;0.022	T	0.52366	-0.8585	10	0.66056	D	0.02	.	4.0101	0.09619	0.4068:0.383:0.1322:0.078	.	681;681;681	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	W	681	ENSP00000423470:R681W;ENSP00000349344:R681W;ENSP00000435300:R681W	ENSP00000349344:R681W	R	+	1	2	2	PCDHA4	140168997	140168997	0.171000	0.23029	0.001000	0.08648	0.014000	0.08584	0.000000	0.12993	-0.051000	0.13334	-0.516000	0.04426	CGG	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.632	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	1.850000	-20.000000	1	0.460000	NM_018907		0	59	59	0	227	224	1		1	0		0	0	93	0	0	1.000000	0	0	0	0	1	0	59	227
PCDHGA12	26025	broad.mit.edu	37	5	140810888	140810888	+	Missense_Mutation	SNP	G	G	A	rs112186927	byFrequency	TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr5:140810888G>A	ENST00000252085.3	+	1	704	c.562G>A	c.(562-564)Ggt>Agt	p.G188S	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	188	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGAGCCGACGGTAGTAAGTA	0.607																																						ENST00000252085.3	1.000000	7.100000e-01	0.930000	0.780000	0.850000	0.857698	0.850000	0.850000																										0				58						c.(562-564)Ggt>Agt		protocadherin gamma subfamily A, 12							92.0	99.0	96.0					5																	140810888		2203	4300	6503	SO:0001583	missense	26025	0	0					g.chr5:140810888G>A	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.562G>A	chr5.hg19:g.140810888G>A	ENSP00000252085:p.Gly188Ser	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Intron	p.G188S	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	1	2	3	2.084628	O60330	PCDGC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	704	+			O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	1	0	hg19	c.562G>A	CCDS4260.1	1	.	.	.	.	.	.	.	.	.	.	g	15.60	2.882516	0.51908	.	.	ENSG00000253159	ENST00000252085	T	0.20332	2.08	5.8	5.8	0.92144	5.8	5.8	0.92144	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.57080	0.2029	M	0.93375	3.41	0.30472	N	0.773188	D;D	0.65815	0.993;0.995	P;P	0.60473	0.766;0.875	T	0.65899	-0.6056	9	0.59425	D	0.04	.	19.6649	0.95889	0.0:0.0:1.0:0.0	.	188;188	O60330-2;O60330	.;PCDGC_HUMAN	S	188	ENSP00000252085:G188S	ENSP00000252085:G188S	G	+	1	0	0	PCDHGA12	140791072	140791072	1.000000	0.71417	0.311000	0.25182	0.004000	0.04260	2.963000	0.49184	2.748000	0.94277	0.655000	0.94253	GGT	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.607	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	1	0	1	2	2	2	2	0	0	0	0	161	161	161	159	1	1.850000	-2.793535	1	0.460000	NM_003735		0	108	107	0	442	437	1		1	0		0	0	161	0	0	1.000000	5.545100e-01	0	0	0	9	0	108	442
PCDH1	5097	broad.mit.edu	37	5	141243880	141243880	+	Silent	SNP	G	G	A	rs149691852		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr5:141243880G>A	ENST00000394536.3	-	3	2155	c.2016C>T	c.(2014-2016)agC>agT	p.S672S	PCDH1_ENST00000536585.1_Silent_p.S650S|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Silent_p.S660S|PCDH1_ENST00000287008.3_Silent_p.S672S|PCDH1_ENST00000511044.1_5'UTR	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	672	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CTCGATCAAAGCTCAGGCTGG	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		22002	0.0		0.001	False		,,,				2504	0.0				Ovarian(132;1609 1739 4190 14731 45037)	ENST00000394536.3	1.000000	8.300000e-01	1.000000	0.930000	0.990000	0.977066	0.990000	1.000000																										0				51						c.(2014-2016)agC>agT		protocadherin 1							130.0	127.0	128.0					5																	141243880		2203	4300	6503	SO:0001819	synonymous_variant	5097	2	121412	35				g.chr5:141243880G>A	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2016C>T	chr5.hg19:g.141243880G>A		0					PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000456271.1_Silent_p.S660S|PCDH1_ENST00000287008.3_Silent_p.S672S|PCDH1_ENST00000536585.1_Silent_p.S650S	p.S672S	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	1	2	3	2.084628	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	3	2155	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	Q8IUP2	Silent	SNP	ENST00000394536.3	1	1	hg19	c.2016C>T	CCDS43375.1	1																																																																																								0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.552	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.850000	-20.000000	1	0.460000	NM_032420		0	70	70	0	222	219	1		1	1		0	0	96	0	0	1.000000	1	0	246	0	279	0	70	222
SLC45A2	51151	broad.mit.edu	37	5	33984521	33984521	+	Silent	SNP	C	C	G			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr5:33984521C>G	ENST00000296589.4	-	1	314	c.168G>C	c.(166-168)gtG>gtC	p.V56V	SLC45A2_ENST00000509381.1_Silent_p.V56V|SLC45A2_ENST00000342059.3_Silent_p.V56V|SLC45A2_ENST00000382102.3_Silent_p.V56V|SLC45A2_ENST00000345083.5_Silent_p.V56V	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	56					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						GGACTGGGGTCACATACGCTG	0.592																																					Ovarian(31;380 859 8490 22203 49048)	ENST00000296589.4	1.000000	6.400000e-01	1.000000	0.810000	0.990000	0.932565	0.990000	1.000000																										0				48						c.(166-168)gtG>gtC		solute carrier family 45, member 2							63.0	52.0	56.0					5																	33984521		2203	4300	6503	SO:0001819	synonymous_variant	51151	0	0					g.chr5:33984521C>G	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.168G>C	chr5.hg19:g.33984521C>G		0					SLC45A2_ENST00000509381.1_Silent_p.V56V|SLC45A2_ENST00000342059.3_Silent_p.V56V|SLC45A2_ENST00000345083.5_Silent_p.V56V|SLC45A2_ENST00000382102.3_Silent_p.V56V	p.V56V	NM_016180.3	NP_057264	1	2	3	2.084628	Q9UMX9	S45A2_HUMAN		1	314	-			Q6P2P0|Q9BTM3	Silent	SNP	ENST00000296589.4	1	1	hg19	c.168G>C	CCDS3901.1	1																																																																																								0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.592	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.850000	-20.000000	1	0.460000	NM_016180		0	16	16	0	52	52	1		1			0	0	29	0	0	0.999970	0	0	0	0	0	0	16	52
TMEM161B	153396	broad.mit.edu	37	5	87502295	87502295	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr5:87502295C>A	ENST00000296595.6	-	7	744	c.620G>T	c.(619-621)aGt>aTt	p.S207I	TMEM161B_ENST00000509387.1_Missense_Mutation_p.S80I|TMEM161B_ENST00000506536.1_Missense_Mutation_p.S25I|TMEM161B_ENST00000512429.1_Missense_Mutation_p.S196I|TMEM161B_ENST00000511218.1_Missense_Mutation_p.S25I|TMEM161B_ENST00000514135.1_Missense_Mutation_p.S207I	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	207						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		CTGCATCGCACTGTCTGAAAA	0.279																																						ENST00000296595.6	0.990000	2.500000e-01	0.770000	0.380000	0.550000	0.576708	0.550000	1.000000																										0				20						c.(619-621)aGt>aTt		transmembrane protein 161B							13.0	15.0	14.0					5																	87502295		2174	4261	6435	SO:0001583	missense	153396	0	0					g.chr5:87502295C>A	BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.620G>T	chr5.hg19:g.87502295C>A	ENSP00000296595:p.Ser207Ile	0					TMEM161B_ENST00000512429.1_Missense_Mutation_p.S196I|TMEM161B_ENST00000514135.1_Missense_Mutation_p.S207I|TMEM161B_ENST00000506536.1_Missense_Mutation_p.S25I|TMEM161B_ENST00000511218.1_Missense_Mutation_p.S25I|TMEM161B_ENST00000509387.1_Missense_Mutation_p.S80I	p.S207I	NM_153354.3	NP_699185.1	1	2	3	2.084628	Q8NDZ6	T161B_HUMAN		7	744	-		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)	Q5CZH7|Q6UWQ6	Missense_Mutation	SNP	ENST00000296595.6	0	1	hg19	c.620G>T	CCDS4065.1	0	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891151	0.52014	.	.	ENSG00000164180	ENST00000514135;ENST00000296595;ENST00000506536;ENST00000511218;ENST00000512429;ENST00000443393;ENST00000509387	.	.	.	5.51	3.71	0.42584	5.51	3.71	0.42584	.	0.186558	0.64402	D	0.000002	T	0.67382	0.2887	M	0.67397	2.05	0.80722	D	1	B;B	0.33044	0.083;0.395	P;B	0.44860	0.462;0.164	T	0.70550	-0.4841	9	0.72032	D	0.01	-7.8376	10.9255	0.47189	0.0:0.7979:0.1312:0.0709	.	25;207	B7Z6A5;Q8NDZ6	.;T161B_HUMAN	I	207;207;25;25;196;207;80	.	ENSP00000296595:S207I	S	-	2	0	0	TMEM161B	87538051	87538051	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.025000	0.57225	1.304000	0.44892	0.467000	0.42956	AGT	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.279	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254094.1	1	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	1.850000	-13.623610	1	0.460000	NM_153354		0	7	7	0	50	50	1		1	1		0	0	13	0	0	0.982949	7.526785e-01	0	7	0	14	0	7	50
RASGEF1C	255426	broad.mit.edu	37	5	179538479	179538479	+	Silent	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr5:179538479G>A	ENST00000393371.2	-	11	1577	c.1281C>T	c.(1279-1281)acC>acT	p.T427T	RASGEF1C_ENST00000522500.1_Silent_p.T276T|RASGEF1C_ENST00000361132.4_Silent_p.T427T			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	427	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGATGGGGGCGGTGTACAGGT	0.592																																						ENST00000393371.2	1.000000	7.400000e-01	1.000000	0.860000	0.980000	0.945306	0.980000	1.000000																										0				12						c.(1279-1281)acC>acT		RasGEF domain family, member 1C							136.0	93.0	108.0					5																	179538479		2203	4300	6503	SO:0001819	synonymous_variant	255426	2	121412	34				g.chr5:179538479G>A	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.1281C>T	chr5.hg19:g.179538479G>A		0					RASGEF1C_ENST00000522500.1_Silent_p.T276T|RASGEF1C_ENST00000361132.4_Silent_p.T427T	p.T427T			1	2	3	2.084628	Q8N431	RGF1C_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	11	1577	-	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	D3DWQ7|Q7Z4T0|Q8NA49	Silent	SNP	ENST00000393371.2	1	1	hg19	c.1281C>T	CCDS4452.1	1																																																																																								0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.592	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	1.850000	-4.108868	1	0.460000	NM_175062		0	44	44	0	150	150	1		1			0	0	73	0	0	1.000000	0	0	0	0	0	0	44	150
DNAH11	8701	broad.mit.edu	37	7	21657266	21657266	+	Silent	SNP	C	C	A	rs570983771		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr7:21657266C>A	ENST00000409508.3	+	23	4156	c.4125C>A	c.(4123-4125)cgC>cgA	p.R1375R	DNAH11_ENST00000328843.6_Silent_p.R1380R	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1380	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AGGAAGTCCGCGTCTGGGATG	0.483									Kartagener syndrome																													ENST00000409508.3	1.000000	5.900000e-01	1.000000	0.730000	0.880000	0.871895	0.880000	1.000000																										0				230						c.(4123-4125)cgC>cgA		dynein, axonemal, heavy chain 11							54.0	54.0	54.0					7																	21657266		1882	4106	5988	SO:0001819	synonymous_variant	8701	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21657266C>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4125C>A	chr7.hg19:g.21657266C>A		0					DNAH11_ENST00000328843.6_Silent_p.R1380R	p.R1375R	NM_001277115.1	NP_001264044.1	1	2	3	2.085237	Q96DT5	DYH11_HUMAN		23	4156	+			Q9UJ82	Silent	SNP	ENST00000409508.3	1	1	hg19	c.4125C>A		1																																																																																								0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.483	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1	2	2	2	2	0	0	0	0	28	28	28	27	1	1.850000	-20.000000	1	0.460000	NM_003777		0	23	23	0	90	89	1		1	0		0	0	28	0	0	1.000000	0	0	0	0	1	0	23	90
NEUROD6	63974	broad.mit.edu	37	7	31377972	31377972	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr7:31377972G>A	ENST00000297142.3	-	2	1233	c.911C>T	c.(910-912)gCc>gTc	p.A304V		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	304					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						CCTGAACATGGCACCCTGCCC	0.468																																						ENST00000297142.3	0.210000	3.000000e-02	0.150000	0.050000	0.090000	0.107526	0.090000	0.090000																										0				32						c.(910-912)gCc>gTc		neuronal differentiation 6							90.0	89.0	90.0					7																	31377972		2203	4300	6503	SO:0001583	missense	63974	0	0					g.chr7:31377972G>A	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.911C>T	chr7.hg19:g.31377972G>A	ENSP00000297142:p.Ala304Val	0						p.A304V	NM_022728.2	NP_073565.2	1	2	3	2.085237	Q96NK8	NDF6_HUMAN		2	1233	-			Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	0	1	hg19	c.911C>T	CCDS5434.1	0	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629527	0.46944	.	.	ENSG00000164600	ENST00000297142	D	0.95238	-3.65	5.13	5.13	0.70059	5.13	5.13	0.70059	.	0.108251	0.64402	D	0.000004	D	0.89181	0.6642	L	0.27053	0.805	0.50813	D	0.999898	B	0.16396	0.017	B	0.18263	0.021	D	0.84308	0.0509	10	0.02654	T	1	-19.6987	18.5931	0.91222	0.0:0.0:1.0:0.0	.	304	Q96NK8	NDF6_HUMAN	V	304	ENSP00000297142:A304V	ENSP00000297142:A304V	A	-	2	0	0	NEUROD6	31344497	31344497	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.414000	0.97362	2.386000	0.81285	0.650000	0.86243	GCC	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.468	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.850000	-2.802347	1	0.460000	NM_022728		0	5	5	0	235	232	0		1			0	0	68	0	0	0.936113	0	0	0	0	0	0	5	235
ASL	435	broad.mit.edu	37	7	65557066	65557066	+	Missense_Mutation	SNP	G	G	A	rs200853731		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr7:65557066G>A	ENST00000304874.9	+	15	1238	c.1136G>A	c.(1135-1137)cGc>cAc	p.R379H	ASL_ENST00000395331.3_Missense_Mutation_p.R359H|ASL_ENST00000380839.4_Missense_Mutation_p.R353H|AC068533.7_ENST00000450043.1_Silent_p.P147P|ASL_ENST00000464970.1_3'UTR|ASL_ENST00000395332.3_Missense_Mutation_p.R379H	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	379			R -> C (in ARGINSA; dbSNP:rs28940287). {ECO:0000269|PubMed:12408190}.		arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)	p.R379L(1)		breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TACCTGGTCCGCAAAGGGGTA	0.637																																						ENST00000304874.9	0.110000	0	0.080000	0.020000	0.040000	0.054248	0.040000	0.040000																										1	Substitution - Missense(1)	p.R379L(1)	lung(1)	18						c.(1135-1137)cGc>cAc		argininosuccinate lyase	L-Arginine(DB00125)						95.0	92.0	93.0					7																	65557066		2203	4300	6503	SO:0001583	missense	435	3	121412	37				g.chr7:65557066G>A		CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.1136G>A	chr7.hg19:g.65557066G>A	ENSP00000307188:p.Arg379His	0					ASL_ENST00000395332.3_Missense_Mutation_p.R379H|ASL_ENST00000380839.4_Missense_Mutation_p.R353H|AC068533.7_ENST00000450043.1_Silent_p.P147P|ASL_ENST00000464970.1_3'UTR|ASL_ENST00000395331.3_Missense_Mutation_p.R359H	p.R379H	NM_000048.3	NP_000039.2	1	2	3	2.085237	P04424	ARLY_HUMAN		15	1238	+			E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	ENST00000304874.9	0	1	hg19	c.1136G>A	CCDS5531.1	0	.	.	.	.	.	.	.	.	.	.	g	27.0	4.786704	0.90367	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000395331	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85	5.5	4.63	0.57726	5.5	4.63	0.57726	L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.92909	0.7744	M	0.89601	3.045	0.58432	D	0.999999	P;P;B	0.42871	0.792;0.6;0.445	B;B;B	0.43838	0.433;0.077;0.102	D	0.93527	0.6866	10	0.87932	D	0	.	13.5557	0.61757	0.0753:0.0:0.9247:0.0	.	353;359;379	E9PE48;E7EMI0;P04424	.;.;ARLY_HUMAN	H	379;353;379;359	ENSP00000307188:R379H;ENSP00000370219:R353H;ENSP00000378741:R379H;ENSP00000378740:R359H	ENSP00000307188:R379H	R	+	2	0	0	ASL	65194501	65194501	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.997000	0.63921	1.327000	0.45338	0.491000	0.48974	CGC	0.461239		TCGA-IB-A5SS-01A-11D-A32N-08	0.637	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251695.2	0	0	1	2	12	7	2	1	1	1	1	162	162	162	161	1	1.850000	-1.793686	0	0.460000	NM_000048		0	5	5	0	473	464	0		0	0		1	0	162	0	0	0.064224	6.574152e-02	0	0	0	241	0	5	473
SGCZ	137868	broad.mit.edu	37	8	13947958	13947958	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr8:13947958C>T	ENST00000382080.1	-	8	1648	c.933G>A	c.(931-933)tgG>tgA	p.W311*	SGCZ_ENST00000421524.2_Nonsense_Mutation_p.W264*	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	298					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CACTTCAGCTCCACAGGCAGA	0.498																																						ENST00000382080.1	1.000000	6.800000e-01	0.940000	0.750000	0.840000	0.849543	0.840000	1.000000																										0				47						c.(931-933)tgG>tgA		sarcoglycan, zeta							176.0	164.0	168.0					8																	13947958		2203	4300	6503	SO:0001587	stop_gained	137868	0	0					g.chr8:13947958C>T	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.933G>A	chr8.hg19:g.13947958C>T	ENSP00000371512:p.Trp311*	0					SGCZ_ENST00000421524.2_Nonsense_Mutation_p.W264*	p.W311*	NM_139167.2	NP_631906.2	0	0	0	2.074056	Q96LD1	SGCZ_HUMAN		8	1648	-			Q6REU0	Nonsense_Mutation	SNP	ENST00000382080.1	0	1	hg19	c.933G>A	CCDS5992.2	0	.	.	.	.	.	.	.	.	.	.	C	41	8.963007	0.99018	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	.	.	.	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.39948	D	0.974498	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7556	0.91832	0.0:1.0:0.0:0.0	.	.	.	.	X	311;264	.	ENSP00000371512:W311X	W	-	3	0	0	SGCZ	13992329	13992329	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.760000	0.94817	0.655000	0.94253	TGG	0.460000		TCGA-IB-A5SS-01A-11D-A32N-08	0.498	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	1	0	1	2	2	2	2	0	0	0	0	136	136	136	133	1	1.850000	-3.555108	1	0.460000	NM_139167		0	76	76	0	314	312	0		1			0	0	136	0	0	1.000000	0	0	0	0	0	0	76	314
HSPA5	3309	broad.mit.edu	37	9	128000914	128000914	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:128000914C>T	ENST00000324460.6	-	6	1392	c.1189G>A	c.(1189-1191)Ggt>Agt	p.G397S		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	397					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	ACAGCAGCACCATACGCTACA	0.478										Prostate(1;0.17)																												ENST00000324460.6	1.000000	8.000000e-01	1.000000	0.900000	0.990000	0.966002	0.990000	1.000000																										0				23						c.(1189-1191)Ggt>Agt		heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)						105.0	89.0	94.0					9																	128000914		2203	4300	6503	SO:0001583	missense	3309	0	0					g.chr9:128000914C>T		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1189G>A	chr9.hg19:g.128000914C>T	ENSP00000324173:p.Gly397Ser	0	Prostate(1;0.17)					p.G397S	NM_005347.4	NP_005338.1	0	1	1	2.067028	P11021	GRP78_HUMAN		6	1392	-			B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	1	1	hg19	c.1189G>A	CCDS6863.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.269740	0.95429	.	.	ENSG00000044574	ENST00000324460	T	0.74526	-0.85	4.61	4.61	0.57282	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.93167	0.7824	H	0.99937	4.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96722	0.9533	10	0.87932	D	0	-2.7014	16.4549	0.84009	0.0:1.0:0.0:0.0	.	397	P11021	GRP78_HUMAN	S	397	ENSP00000324173:G397S	ENSP00000324173:G397S	G	-	1	0	0	HSPA5	127040735	127040735	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.818000	0.86416	2.097000	0.63578	0.563000	0.77884	GGT	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.478	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1	1	0	1	2	2	2	2	0	0	0	0	86	86	86	86	1	1.850000	-3.784387	1	0.460000			0	58	58	0	188	183	1		1	1		0	0	86	0	0	1.000000	1	0	819	0	2245	0	58	188
C9orf106	414318	broad.mit.edu	37	9	132084600	132084600	+	RNA	SNP	C	C	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:132084600C>A	ENST00000316786.1	+	0	561							Q8NAJ2	CI106_HUMAN	chromosome 9 open reading frame 106											large_intestine(1)|lung(1)|ovary(1)|skin(1)	4		Ovarian(14;0.00556)|Medulloblastoma(224;0.235)				TGGCTCTGCCCTCAGAGCACT	0.612																																						ENST00000316786.1	1.000000	7.800000e-01	1.000000	0.890000	0.990000	0.964240	0.990000	1.000000																										0				4								chromosome 9 open reading frame 106							42.0	45.0	44.0					9																	132084600		1995	4166	6161			414318	0	0					g.chr9:132084600C>A	AK092588		9q34.11	2013-12-05	2013-12-05	2013-12-05	ENSG00000179082	ENSG00000179082			31370	other	unknown							Standard	NM_001012715		Approved	bA65J3.5	uc004bxs.2	Q8NAJ2	OTTHUMG00000020781		chr9.hg19:g.132084600C>A		0									0	1	1	2.067028	Q8NAJ2	CI106_HUMAN		0	561	+		Ovarian(14;0.00556)|Medulloblastoma(224;0.235)		RNA	SNP	ENST00000316786.1	1	1	hg19			1																																																																																								0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.612	C9orf106-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000054576.2	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.850000	-4.126252	1	0.460000			0	45	46	0	144	142	0		1	0		0	0	69	0	0	1.000000	0	0	0	0	1	0	45	144
LCN9	392399	broad.mit.edu	37	9	138557549	138557549	+	Silent	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:138557549C>T	ENST00000277526.3	+	5	426	c.426C>T	c.(424-426)tgC>tgT	p.C142C	LCN9_ENST00000430290.2_3'UTR	NM_001001676.1	NP_001001676.1	Q8WX39	LCN9_HUMAN	lipocalin 9	142						extracellular region (GO:0005576)	pheromone binding (GO:0005550)|transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	6		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		AAGAAACCTGCGAAAAGTACG	0.572																																						ENST00000277526.3	1.000000	5.600000e-01	1.000000	0.710000	0.900000	0.873432	0.900000	1.000000																										0				6						c.(424-426)tgC>tgT		lipocalin 9							44.0	44.0	44.0					9																	138557549		1925	4121	6046	SO:0001819	synonymous_variant	392399	1	120860	30				g.chr9:138557549C>T	AY301270	CCDS56593.1	9q34	2011-11-14			ENSG00000148386	ENSG00000148386		"""Lipocalins"""	17442	protein-coding gene	gene with protein product	"""MUP-like lipocalin"", ""epididymal-specific lipocalin-9"""	612903				15363845	Standard	NM_001001676		Approved		uc004cgk.2	Q8WX39	OTTHUMG00000020916	ENST00000277526.3:c.426C>T	chr9.hg19:g.138557549C>T		0					LCN9_ENST00000430290.2_3'UTR	p.C142C	NM_001001676.1	NP_001001676.1	0	1	1	2.067028	Q8WX39	LCN9_HUMAN		5	426	+		Myeloproliferative disorder(178;0.0821)	C9J5F0|Q6JVE7	Silent	SNP	ENST00000277526.3	1	1	hg19	c.426C>T	CCDS56593.1	1																																																																																								0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.572	LCN9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410711.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.850000	-20.000000	1	0.460000	NM_001001676		0	16	15	0	61	61	1		1			0	0	34	0	0	0.999962	0	0	0	0	0	0	16	61
CDKN2A	1029	broad.mit.edu	37	9	21971186	21971186	+	Nonsense_Mutation	SNP	G	G	A	rs121913387		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:21971186G>A	ENST00000304494.5	-	2	442	c.172C>T	c.(172-174)Cga>Tga	p.R58*	CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P113L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P72L|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R7*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P72L|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R58*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	58			R -> Q (in dbSNP:rs36204273).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R58*(78)|p.?(45)|p.M53_R58del(3)|p.P113L(3)|p.R58fs*59(2)|p.M54fs*61(2)|p.R58fs*88(2)|p.0(1)|p.V28_V51del(1)|p.A57_R58>V*(1)|p.P113fs*>61(1)|p.R58fs*62(1)|p.R58fs*61(1)|p.G55fs*86(1)|p.R58R(1)|p.A57fs*85(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TCCGCCACTCGGGCGCTGCCC	0.677		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	6.500000e-01	1.000000	0.810000	0.990000	0.932111	0.990000	1.000000		17																								1459	Whole gene deletion(1316)|Substitution - Nonsense(78)|Unknown(45)|Deletion - Frameshift(10)|Deletion - In frame(4)|Substitution - Missense(3)|Insertion - Frameshift(1)|Substitution - coding silent(1)|Complex - compound substitution(1)	p.0?(1315)|p.R58*(78)|p.?(45)|p.M53_R58del(3)|p.P113L(3)|p.R58fs*59(2)|p.M54fs*61(2)|p.R58fs*88(2)|p.0(1)|p.V28_V51del(1)|p.A57_R58>V*(1)|p.P113fs*>61(1)|p.R58fs*62(1)|p.R58fs*61(1)|p.G55fs*86(1)|p.R58R(1)|p.A57fs*85(1)	haematopoietic_and_lymphoid_tissue(284)|skin(201)|central_nervous_system(167)|lung(154)|urinary_tract(94)|upper_aerodigestive_tract(78)|bone(74)|oesophagus(65)|soft_tissue(58)|pleura(51)|ovary(38)|pancreas(37)|kidney(32)|breast(32)|stomach(14)|thyroid(13)|NS(12)|biliary_tract(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(4)|thymus(4)|endometrium(3)|vulva(2)|prostate(2)|cervix(1)	4199	GRCh37	CM940227	CDKN2A	M	rs121913387	c.(172-174)Cga>Tga		cyclin-dependent kinase inhibitor 2A							7.0	9.0	8.0					9																	21971186		2034	4092	6126	SO:0001587	stop_gained	1029	0	0					g.chr9:21971186G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.172C>T	chr9.hg19:g.21971186G>A	ENSP00000307101:p.Arg58*	0	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.P72L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P72L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R58*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P113L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R7*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R58*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R7*	p.R58*	NM_000077.4	NP_000068.1	0	1	1	2.067028	P42771	CD2A1_HUMAN		2	442	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.172C>T	CCDS6510.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.1|28.1	4.893482|4.893482	0.91889|0.91889	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|.	0.75367|.	-0.93;-0.89|.	5.79|5.79	2.71|2.71	0.32032|0.32032	5.79|5.79	2.71|2.71	0.32032|0.32032	.|.	0.409080|.	0.18162|.	N|.	0.149742|.	T|.	0.29288|.	0.0729|.	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	P|.	0.44006|.	0.824|.	B|.	0.33121|.	0.158|.	T|.	0.21381|.	-1.0247|.	10|.	0.72032|0.13470	D|T	0.01|0.59	-3.0019|-3.0019	9.6681|9.6681	0.39996|0.39996	0.0:0.1288:0.474:0.3972|0.0:0.1288:0.474:0.3972	.|.	113|.	Q8N726|.	CD2A2_HUMAN|.	L|X	113;72|58	ENSP00000355153:P113L;ENSP00000432664:P72L|.	ENSP00000355153:P113L|ENSP00000307101:R58X	P|R	-|-	2|1	0|2	0|2	CDKN2A|CDKN2A	21961186|21961186	21961186|21961186	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.277000|0.277000	0.26821|0.26821	0.096000|0.096000	0.15147|0.15147	0.738000|0.738000	0.32606|0.32606	0.555000|0.555000	0.69702|0.69702	CCG|CGA	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.677	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.850000	-3.658803	1	0.460000	NM_000077		0	18	18	0	59	57	0		1	1	1	0	0	28	31	0	0.999991	9.999927e-01	9.987984e-01	68	10	9	31	18	59
RUSC2	9853	broad.mit.edu	37	9	35555589	35555589	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:35555589T>A	ENST00000455600.1	+	3	3116	c.2547T>A	c.(2545-2547)caT>caA	p.H849Q		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	849						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			ACCGGCTCCATGGAACAGGAA	0.647																																						ENST00000455600.1	1.000000	8.900000e-01	1.000000	0.980000	0.990000	0.990686	0.990000	1.000000																										0				32						c.(2545-2547)caT>caA		RUN and SH3 domain containing 2							46.0	45.0	46.0					9																	35555589		2203	4300	6503	SO:0001583	missense	9853	0	0					g.chr9:35555589T>A	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.2547T>A	chr9.hg19:g.35555589T>A	ENSP00000393922:p.His849Gln	0						p.H849Q	NM_001135999.1	NP_001129471	0	1	1	2.067028	Q8N2Y8	RUSC2_HUMAN	Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)	3	3116	+			A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	1	1	hg19	c.2547T>A	CCDS35008.1	1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.328553	0.60743	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.23348	1.91;1.91	4.15	4.15	0.48705	4.15	4.15	0.48705	.	0.295723	0.38272	N	0.001756	T	0.25306	0.0615	L	0.29908	0.895	0.39729	D	0.971581	D	0.61697	0.99	P	0.50537	0.643	T	0.02901	-1.1096	10	0.37606	T	0.19	-8.6196	11.4069	0.49902	0.0:0.0:0.0:1.0	.	849	Q8N2Y8	RUSC2_HUMAN	Q	849	ENSP00000355177:H849Q;ENSP00000393922:H849Q	ENSP00000355177:H849Q	H	+	3	2	2	RUSC2	35545589	35545589	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.372000	0.44257	1.863000	0.54032	0.533000	0.62120	CAT	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.647	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.850000	-20.000000	1	0.460000	XM_048462		0	82	82	0	243	242	1		1	1		0	0	107	0	0	1.000000	9.999999e-01	0	18	0	58	0	82	243
ZCCHC7	84186	broad.mit.edu	37	9	37349387	37349387	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:37349387C>T	ENST00000336755.5	+	7	1127	c.1021C>T	c.(1021-1023)Cct>Tct	p.P341S	ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_Missense_Mutation_p.P51S	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	341						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		GCCGAAGACCCCTTCAAGACC	0.418																																						ENST00000336755.5	1.000000	7.400000e-01	1.000000	0.840000	0.950000	0.932823	0.950000	1.000000																										0				30						c.(1021-1023)Cct>Tct		zinc finger, CCHC domain containing 7							159.0	136.0	144.0					9																	37349387		2203	4300	6503	SO:0001583	missense	84186	2	121412	33				g.chr9:37349387C>T	AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.1021C>T	chr9.hg19:g.37349387C>T	ENSP00000337839:p.Pro341Ser	0					ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_Missense_Mutation_p.P51S	p.P341S	NM_032226.2	NP_115602.2	0	1	1	2.067028	Q8N3Z6	ZCHC7_HUMAN		7	1127	+			B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Missense_Mutation	SNP	ENST00000336755.5	1	1	hg19	c.1021C>T	CCDS6608.2	1	.	.	.	.	.	.	.	.	.	.	C	9.590	1.125878	0.20959	.	.	ENSG00000147905	ENST00000336755;ENST00000534928	T;T	0.75938	-0.98;-0.98	5.7	3.63	0.41609	5.7	3.63	0.41609	Zinc finger, CCHC retroviral-type (1);	0.593530	0.19292	N	0.117876	T	0.57344	0.2047	L	0.40543	1.245	0.32348	N	0.558818	B	0.20052	0.041	B	0.20767	0.031	T	0.51865	-0.8651	10	0.07813	T	0.8	-13.1561	4.7253	0.12938	0.188:0.6049:0.0:0.2071	.	341	Q8N3Z6	ZCHC7_HUMAN	S	341;51	ENSP00000337839:P341S;ENSP00000443113:P51S	ENSP00000337839:P341S	P	+	1	0	0	ZCCHC7	37339387	37339387	0.952000	0.32445	1.000000	0.80357	0.896000	0.52359	1.796000	0.38794	1.413000	0.46997	-0.289000	0.09944	CCT	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.418	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052453.2	1	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	1.850000	-3.307612	1	0.460000	NM_032226		0	53	53	0	187	184	1		1	1		0	0	84	0	0	1.000000	9.998260e-01	0	16	0	33	0	53	187
SNAPC4	6621	broad.mit.edu	37	9	139272186	139272186	+	Missense_Mutation	SNP	G	G	A	rs372472067		TCGA-IB-A5SS-01A-11D-A32N-08	TCGA-IB-A5SS-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4edf9fdf-c3aa-45be-a8eb-593e5e51c1bf	735bd846-c248-4ee8-a1bb-08a3f8738776	g.chr9:139272186G>A	ENST00000298532.2	-	21	4461	c.4093C>T	c.(4093-4095)Cgg>Tgg	p.R1365W		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		AACCGCGCCCGCAACAGGAGG	0.726																																						ENST00000298532.2	0.320000	4.000000e-02	0.230000	0.090000	0.150000	0.166582	0.150000	0.140000																										0				33						c.(4093-4095)Cgg>Tgg		small nuclear RNA activating complex, polypeptide 4, 190kDa			TRP/ARG	0,4390		0,0,2195	21.0	23.0	23.0		4093	1.7	0.0	9		23	2,8586		0,2,4292	no	missense	SNAPC4	NM_003086.2	101	0,2,6487	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	1365/1470	139272186	2,12976	2195	4294	6489	SO:0001583	missense	6621	3	120812	32				g.chr9:139272186G>A	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.4093C>T	chr9.hg19:g.139272186G>A	ENSP00000298532:p.Arg1365Trp	0						p.R1365W	NM_003086.2	NP_003077.2	0	1	1	2.067028				21	4461	-		Myeloproliferative disorder(178;0.0511)		Missense_Mutation	SNP	ENST00000298532.2	0	1	hg19	c.4093C>T	CCDS6998.1	0	.	.	.	.	.	.	.	.	.	.	g	11.34	1.610741	0.28712	0.0	2.33E-4	ENSG00000165684	ENST00000298532	T	0.24908	1.83	4.06	1.66	0.24008	4.06	1.66	0.24008	.	0.196559	0.34507	N	0.003920	T	0.19167	0.0460	L	0.40543	1.245	0.09310	N	1	B	0.26081	0.141	B	0.14023	0.01	T	0.15694	-1.0428	10	0.87932	D	0	-13.5129	10.0768	0.42366	0.0:0.0:0.3652:0.6348	.	1365	Q5SXM2	SNPC4_HUMAN	W	1365	ENSP00000298532:R1365W	ENSP00000298532:R1365W	R	-	1	2	2	SNAPC4	138392007	138392007	0.983000	0.35010	0.012000	0.15200	0.005000	0.04900	1.417000	0.34770	0.044000	0.15775	-0.408000	0.06270	CGG	0.458755		TCGA-IB-A5SS-01A-11D-A32N-08	0.726	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.850000	-6.565011	1	0.460000	NM_003086		0	4	4	0	123	122	0		1	0		0	0	50	0	0	0.889710	3.064773e-01	0	0	0	29	0	4	123
