#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PDCD4	27250	broad.mit.edu	37	10	112641004	112641004	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr10:112641004A>T	ENST00000280154.7	+	3	331	c.57A>T	c.(55-57)ttA>ttT	p.L19F	PDCD4_ENST00000393104.2_Missense_Mutation_p.L8F	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	19					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTGATAACTTAAGTGACTCTC	0.308																																					Ovarian(115;1498 1603 9363 40056 40885)	ENST00000280154.7	1.000000	0.150000	0.650000	0.250000	0.390000	0.460762	0.390000	0.330000																										0				13						c.(55-57)ttA>ttT		programmed cell death 4 (neoplastic transformation inhibitor)							61.0	71.0	68.0					10																	112641004		2203	4300	6503	SO:0001583	missense	27250	0	0					g.chr10:112641004A>T	U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.57A>T	chr10.hg19:g.112641004A>T	ENSP00000280154:p.Leu19Phe	0					PDCD4_ENST00000393104.2_Missense_Mutation_p.L8F	p.L19F	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	1	2	3	1.998000	Q53EL6	PDCD4_HUMAN		3	331	+		Breast(234;0.0848)|Lung NSC(174;0.238)	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	ENST00000280154.7	0	1	hg19	c.57A>T	CCDS7567.1	0	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153586	0.57259	.	.	ENSG00000150593	ENST00000280154;ENST00000393104	T;T	0.40756	1.02;1.12	5.42	4.29	0.51040	5.42	4.29	0.51040	.	0.071705	0.56097	D	0.000024	T	0.35422	0.0931	N	0.20685	0.6	0.51233	D	0.999912	D;P	0.65815	0.995;0.845	P;B	0.56278	0.795;0.261	T	0.13415	-1.0510	10	0.10377	T	0.69	-8.0641	8.1263	0.31001	0.7861:0.0:0.2139:0.0	.	19;8	Q53EL6;B5ME91	PDCD4_HUMAN;.	F	19;8	ENSP00000280154:L19F;ENSP00000376816:L8F	ENSP00000280154:L19F	L	+	3	2	2	PDCD4	112630994	112630994	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	1.052000	0.30429	1.002000	0.39104	-0.334000	0.08254	TTA	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.308	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	2.040000	-6.340241	1	0.100000	NM_014456		0	6	6	0	342	335	0		1	1		0	0	50	0	0	0.963058	8.238542e-01	0	21	0	162	0	6	342
ACSL5	51703	broad.mit.edu	37	10	114185121	114185121	+	Missense_Mutation	SNP	G	G	A	rs201183294		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr10:114185121G>A	ENST00000393081.1	+	18	1926	c.1619G>A	c.(1618-1620)cGt>cAt	p.R540H	ACSL5_ENST00000433418.1_Missense_Mutation_p.R540H|ACSL5_ENST00000369410.3_Missense_Mutation_p.R322H|ACSL5_ENST00000354273.4_Missense_Mutation_p.R540H|ACSL5_ENST00000354655.4_Missense_Mutation_p.R540H|ACSL5_ENST00000356116.1_Missense_Mutation_p.R596H	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	540					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		ATCATCGACCGTAAAAAGAAC	0.388																																						ENST00000393081.1	1.000000	0.170000	0.730000	0.280000	0.440000	0.503113	0.440000	0.380000																										0				21						c.(1618-1620)cGt>cAt		acyl-CoA synthetase long-chain family member 5							103.0	96.0	99.0					10																	114185121		2203	4300	6503	SO:0001583	missense	51703	4	121412	37				g.chr10:114185121G>A	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.1619G>A	chr10.hg19:g.114185121G>A	ENSP00000376796:p.Arg540His	0					ACSL5_ENST00000369410.3_Missense_Mutation_p.R322H|ACSL5_ENST00000354655.4_Missense_Mutation_p.R540H|ACSL5_ENST00000356116.1_Missense_Mutation_p.R596H|ACSL5_ENST00000354273.4_Missense_Mutation_p.R540H|ACSL5_ENST00000433418.1_Missense_Mutation_p.R540H	p.R540H	NM_203380.1	NP_976314.1	1	2	3	1.998000	Q9ULC5	ACSL5_HUMAN		18	1926	+		Colorectal(252;0.117)|Breast(234;0.222)	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Missense_Mutation	SNP	ENST00000393081.1	0	1	hg19	c.1619G>A	CCDS7573.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.397637	0.96009	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273;ENST00000369410	T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18	5.76	5.76	0.90799	5.76	5.76	0.90799	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.89230	0.6656	H	0.99944	5.01	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.998;0.999;0.999	D	0.94232	0.7477	10	0.87932	D	0	-12.4887	19.9576	0.97228	0.0:0.0:1.0:0.0	.	322;540;596;540	B4DX30;A6GV77;Q9ULC5-3;Q9ULC5	.;.;.;ACSL5_HUMAN	H	540;540;596;540;540;322	ENSP00000346680:R540H;ENSP00000376796:R540H;ENSP00000348429:R596H;ENSP00000403647:R540H;ENSP00000346223:R540H;ENSP00000358418:R322H	ENSP00000346223:R540H	R	+	2	0	0	ACSL5	114175111	114175111	1.000000	0.71417	0.964000	0.40570	0.869000	0.49853	9.869000	0.99810	2.736000	0.93811	0.655000	0.94253	CGT	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.388	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	2.040000	-2.715055	1	0.100000	NM_016234		0	6	6	0	303	300	0		1	0		0	0	54	0	0	0.964308	8.775035e-01	0	0	0	193	0	6	303
ITIH5	80760	broad.mit.edu	37	10	7679231	7679231	+	Silent	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr10:7679231C>T	ENST00000256861.6	-	5	690	c.612G>A	c.(610-612)ccG>ccA	p.P204P	ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397145.2_Silent_p.P204P|ITIH5_ENST00000397146.2_Silent_p.P204P|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	204					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGTTGTGAAGCGGCAGCACCT	0.647																																						ENST00000256861.6	0.920000	0.420000	0.790000	0.520000	0.640000	0.662074	0.640000	0.650000																										0				75						c.(610-612)ccG>ccA		inter-alpha-trypsin inhibitor heavy chain family, member 5							83.0	87.0	86.0					10																	7679231		2203	4300	6503	SO:0001819	synonymous_variant	80760	0	0					g.chr10:7679231C>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.612G>A	chr10.hg19:g.7679231C>T		0					ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397145.2_Silent_p.P204P|ITIH5_ENST00000397146.2_Silent_p.P204P	p.P204P	NM_030569.6	NP_085046.5	0	1	1	1.991996	Q86UX2	ITIH5_HUMAN		5	690	-			Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	1	1	hg19	c.612G>A		0																																																																																								0.093199		TCGA-IB-A5ST-01A-11D-A32N-08	0.647	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	0	0	1	2	2	2	2	0	0	0	0	158	158	158	156	1	2.040000	-3.193416	1	0.100000	NM_030569		0	24	23	0	713	701	0		1	0		0	0	158	0	0	1.000000	2.197519e-01	0	0	0	26	0	24	713
RRP12	23223	broad.mit.edu	37	10	99118343	99118343	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr10:99118343G>A	ENST00000370992.4	-	33	3853	c.3742C>T	c.(3742-3744)Ccg>Tcg	p.P1248S	RRP12_ENST00000315563.6_Missense_Mutation_p.P1148S|RRP12_ENST00000414986.1_Missense_Mutation_p.P1187S|RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000536831.1_Missense_Mutation_p.P966S	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1248						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TAGGGATCCGGCCGGCCTTTC	0.582																																						ENST00000370992.4	1.000000	0.050000	0.210000	0.080000	0.120000	0.228219	0.120000	0.110000																										0				37						c.(3742-3744)Ccg>Tcg		ribosomal RNA processing 12 homolog (S. cerevisiae)							226.0	227.0	227.0					10																	99118343		2203	4300	6503	SO:0001583	missense	23223	0	0					g.chr10:99118343G>A		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3742C>T	chr10.hg19:g.99118343G>A	ENSP00000360031:p.Pro1248Ser	0					RRP12_ENST00000536831.1_Missense_Mutation_p.P966S|RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000315563.6_Missense_Mutation_p.P1148S|RRP12_ENST00000414986.1_Missense_Mutation_p.P1187S	p.P1248S	NM_015179.3	NP_055994.2	1	2	3	1.998000	Q5JTH9	RRP12_HUMAN		33	3853	-		Colorectal(252;0.162)	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	ENST00000370992.4	0	1	hg19	c.3742C>T	CCDS7457.1	0	.	.	.	.	.	.	.	.	.	.	G	6.599	0.478849	0.12581	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.31510	1.49;1.49;1.5;1.49	5.74	4.83	0.62350	5.74	4.83	0.62350	.	0.779601	0.12532	N	0.460711	T	0.31888	0.0811	M	0.62723	1.935	0.09310	N	1	B;B;P;B	0.35456	0.357;0.284;0.502;0.07	B;B;B;B	0.31751	0.039;0.054;0.135;0.039	T	0.12528	-1.0544	10	0.27082	T	0.32	-0.6992	13.8073	0.63240	0.0:0.0:0.7211:0.2789	.	1187;1148;966;1248	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	S	1248;1148;1187;966	ENSP00000360031:P1248S;ENSP00000324315:P1148S;ENSP00000414863:P1187S;ENSP00000446184:P966S	ENSP00000324315:P1148S	P	-	1	0	0	RRP12	99108333	99108333	0.535000	0.26370	0.048000	0.18961	0.005000	0.04900	3.810000	0.55613	1.409000	0.46915	-0.314000	0.08810	CCG	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.582	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	0	0	1	2	16	3	2	1	1	1	2	412	412	412	404	1	2.040000	-2.311208	0	0.100000	NM_015179		0	7	8	0	1210	1190	0		0	0		1	0	412	0	0	0.042085	7.847696e-02	0	0	0	143	0	7	1210
HTRA1	5654	broad.mit.edu	37	10	124273731	124273731	+	Silent	SNP	C	C	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr10:124273731C>A	ENST00000368984.3	+	9	1427	c.1299C>A	c.(1297-1299)gtC>gtA	p.V433V		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	433	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				AAAACGACGTCATAATCAGCA	0.493																																						ENST00000368984.3	1.000000	0.270000	0.600000	0.350000	0.440000	0.505828	0.440000	0.420000																										0				17						c.(1297-1299)gtC>gtA		HtrA serine peptidase 1							336.0	302.0	314.0					10																	124273731		2203	4300	6503	SO:0001819	synonymous_variant	5654	0	0					g.chr10:124273731C>A	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1299C>A	chr10.hg19:g.124273731C>A		0						p.V433V	NM_002775.4	NP_002766.1	1	2	3	1.998000	Q92743	HTRA1_HUMAN		9	1427	+		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)	D3DRE4|Q9UNS5	Silent	SNP	ENST00000368984.3	0	1	hg19	c.1299C>A	CCDS7630.1	0																																																																																								0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.493	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	0	0	1	2	2	2	2	0	0	0	0	288	288	288	284	1	2.040000	-2.645926	1	0.100000	NM_002775		0	21	22	0	967	950	0		1	1		0	0	288	0	0	0.999997	9.999993e-01	0	4	0	1116	0	21	967
LAYN	143903	broad.mit.edu	37	11	111428363	111428363	+	Silent	SNP	A	A	G			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:111428363A>G	ENST00000375615.3	+	7	965	c.780A>G	c.(778-780)agA>agG	p.R260R	LAYN_ENST00000525126.1_Silent_p.R260R|LAYN_ENST00000533265.1_Silent_p.R252R|LAYN_ENST00000528924.1_3'UTR|LAYN_ENST00000436913.2_Silent_p.R107R|LAYN_ENST00000375614.2_Silent_p.R252R	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	260						cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	GGATCTGTAGAAAAAGGCAAG	0.443																																					Ovarian(17;551 586 12136 22082 22900)	ENST00000375615.3	0.760000	0.440000	0.680000	0.510000	0.590000	0.605718	0.590000	0.600000																										0				14						c.(778-780)agA>agG		layilin	Hyaluronan(DB08818)						465.0	451.0	456.0					11																	111428363		2201	4297	6498	SO:0001819	synonymous_variant	143903	0	0					g.chr11:111428363A>G		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.780A>G	chr11.hg19:g.111428363A>G		0					LAYN_ENST00000436913.2_Silent_p.R107R|LAYN_ENST00000525126.1_Silent_p.R260R|LAYN_ENST00000375614.2_Silent_p.R252R|LAYN_ENST00000528924.1_3'UTR|LAYN_ENST00000533265.1_Silent_p.R252R	p.R260R	NM_001258390.1	NP_001245319.1	0	1	1	1.992939	Q6UX15	LAYN_HUMAN		7	965	+		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Silent	SNP	ENST00000375615.3	1	1	hg19	c.780A>G	CCDS58178.1	0																																																																																								0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.443	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391187.1	0	0	1	2	2	2	2	0	0	0	0	518	518	518	510	1	2.040000	-3.663127	1	0.100000	NM_178834		0	52	52	0	1674	1631	0		1	0		0	0	518	0	0	1.000000	3.472250e-01	0	0	0	40	0	52	1674
USP2	9099	broad.mit.edu	37	11	119243920	119243920	+	Missense_Mutation	SNP	G	G	A	rs536224379|rs146943763	byFrequency	TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:119243920G>A	ENST00000260187.2	-	2	565	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W	RP11-334E6.3_ENST00000530918.2_RNA|USP2_ENST00000455332.2_Intron	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	91	Necessary for interaction with MDM4.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CTCTCTGCCCGCTTACCACCC	0.652													G|||	2	0.000399361	0.0	0.0	5008	,	,		16208	0.002		0.0	False		,,,				2504	0.0					ENST00000260187.2	0.330000	0.060000	0.250000	0.110000	0.170000	0.186150	0.170000	0.160000																										0				24						c.(271-273)Cgg>Tgg		ubiquitin specific peptidase 2							63.0	71.0	69.0					11																	119243920		2199	4295	6494	SO:0001583	missense	9099	5	121406	41				g.chr11:119243920G>A	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.271C>T	chr11.hg19:g.119243920G>A	ENSP00000260187:p.Arg91Trp	0					RP11-334E6.3_ENST00000530918.2_RNA|USP2_ENST00000455332.2_Intron	p.R91W	NM_004205.4	NP_004196.4	0	1	1	1.992939	O75604	UBP2_HUMAN		2	565	-		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	ENST00000260187.2	0	1	hg19	c.271C>T	CCDS8422.1	0	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	10.95	1.495124	0.26774	.	.	ENSG00000036672	ENST00000260187;ENST00000530918;ENST00000531070;ENST00000527843	T	0.24538	1.85	5.37	3.3	0.37823	5.37	3.3	0.37823	.	2.634020	0.01228	N	0.008277	T	0.23572	0.0570	L	0.27053	0.805	0.39645	D	0.970387	B	0.02656	0.0	B	0.01281	0.0	T	0.12604	-1.0541	10	0.56958	D	0.05	-5.9847	9.6628	0.39965	0.0813:0.0:0.7696:0.1491	.	91	O75604	UBP2_HUMAN	W	91;61;91;91	ENSP00000260187:R91W	ENSP00000260187:R91W	R	-	1	2	2	USP2	118749130	118749130	0.941000	0.31946	0.996000	0.52242	0.734000	0.41952	2.168000	0.42424	1.262000	0.44165	-0.254000	0.11334	CGG	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.652	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	0	0	1	2	14	2	2	1	1	1	1	207	207	207	203	1	2.040000	-2.355866	0	0.100000	NM_171997		0	6	7	0	729	716	0		0	0		1	0	207	0	0	0.051995	0	0	0	0	1	0	6	729
POU2F3	25833	broad.mit.edu	37	11	120175780	120175780	+	Silent	SNP	C	C	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:120175780C>A	ENST00000543440.2	+	7	636	c.486C>A	c.(484-486)ccC>ccA	p.P162P	POU2F3_ENST00000260264.4_Silent_p.P164P	NM_014352.3	NP_055167.2	Q9UKI9	PO2F3_HUMAN	POU class 2 homeobox 3	162					epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)	17		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		CTTTAGAACCCCACCTGGAAG	0.542																																						ENST00000543440.2	0.490000	0.100000	0.370000	0.160000	0.250000	0.274261	0.250000	0.240000																										0				17						c.(484-486)ccC>ccA		POU class 2 homeobox 3							66.0	70.0	69.0					11																	120175780		2203	4299	6502	SO:0001819	synonymous_variant	25833	0	0					g.chr11:120175780C>A	AF133895	CCDS8431.1, CCDS58190.1	11q23.3	2011-06-20	2007-07-13		ENSG00000137709	ENSG00000137709		"""Homeoboxes / POU class"""	19864	protein-coding gene	gene with protein product		607394	"""POU domain class 2, transcription factor 3"""			10473598	Standard	NM_014352		Approved	OCT11, PLA-1, Skn-1a, Epoc-1	uc021qrk.1	Q9UKI9	OTTHUMG00000166140	ENST00000543440.2:c.486C>A	chr11.hg19:g.120175780C>A		0					POU2F3_ENST00000260264.4_Silent_p.P164P	p.P162P	NM_014352.3	NP_055167.2	0	1	1	1.992939	Q9UKI9	PO2F3_HUMAN		7	636	+		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)	A8K7H8|B4DY07|F5GWW6|Q3MIY3|Q9UKR7|Q9Y504	Silent	SNP	ENST00000543440.2	0	1	hg19	c.486C>A	CCDS8431.1	0																																																																																								0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.542	POU2F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388039.2	0	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	2.040000	-2.740875	1	0.100000			0	6	6	0	489	482	0		1			0	0	103	0	0	0.963601	0	0	0	0	0	0	6	489
SLC25A22	79751	broad.mit.edu	37	11	792328	792328	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:792328C>T	ENST00000320230.5	-	8	1199	c.718G>A	c.(718-720)Gct>Act	p.A240T	CEND1_ENST00000524587.1_5'Flank|CEND1_ENST00000330106.4_5'Flank|SLC25A22_ENST00000531214.1_Missense_Mutation_p.A240T	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	240					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGGCCACAGCGGCGGCACTC	0.682																																					Colon(93;848 1468 3270 23355 49636)	ENST00000320230.5	0.680000	0.250000	0.560000	0.330000	0.430000	0.454050	0.430000	0.430000																										0				5						c.(718-720)Gct>Act		solute carrier family 25 (mitochondrial carrier: glutamate), member 22							50.0	60.0	57.0					11																	792328		2203	4297	6500	SO:0001583	missense	79751	1	121318	32				g.chr11:792328C>T	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.718G>A	chr11.hg19:g.792328C>T	ENSP00000322020:p.Ala240Thr	0					SLC25A22_ENST00000531214.1_Missense_Mutation_p.A240T|CEND1_ENST00000330106.4_5'Flank|CEND1_ENST00000524587.1_5'Flank	p.A240T	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	0	1	1	1.992939	Q9H936	GHC1_HUMAN		8	1199	-		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000320230.5	1	1	hg19	c.718G>A	CCDS7715.1	0	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962796	0.53507	.	.	ENSG00000177542	ENST00000320230;ENST00000531214	T;T	0.78595	-1.19;-1.19	3.8	2.88	0.33553	3.8	2.88	0.33553	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.79845	0.4516	L	0.38953	1.18	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	T	0.76345	-0.2993	10	0.31617	T	0.26	-17.7338	11.5497	0.50713	0.0:0.9115:0.0:0.0885	.	240	Q9H936	GHC1_HUMAN	T	240	ENSP00000322020:A240T;ENSP00000437236:A240T	ENSP00000322020:A240T	A	-	1	0	0	SLC25A22	782328	782328	1.000000	0.71417	0.020000	0.16555	0.002000	0.02628	5.614000	0.67695	0.959000	0.37980	-0.199000	0.12753	GCT	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.682	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257107.2	0	0	1	2	2	2	2	0	0	0	0	207	207	207	206	1	2.040000	-2.675842	1	0.100000			0	15	17	0	673	664	1		1	1		0	0	207	0	0	0.999861	2.376748e-01	0	18	0	22	0	15	673
NUP98	4928	broad.mit.edu	37	11	3697456	3697456	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:3697456T>C	ENST00000324932.7	-	33	5756	c.5336A>G	c.(5335-5337)tAt>tGt	p.Y1779C	NUP98_ENST00000359171.4_3'UTR|NUP98_ENST00000355260.3_Missense_Mutation_p.Y1705C	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1796					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GTCCATGGCATAGTCCTCAGG	0.592			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																	ENST00000324932.7	1.000000	0.350000	0.820000	0.480000	0.630000	0.652737	0.630000	1.000000				Dom	yes			Dom	yes		11	11p15	11p15	4928	T	nucleoporin 98kDa				L	L	HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11		AML		0				66						c.(5335-5337)tAt>tGt		nucleoporin 98kDa							91.0	87.0	89.0					11																	3697456		2201	4298	6499	SO:0001583	missense	4928	2	121412	34				g.chr11:3697456T>C	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.5336A>G	chr11.hg19:g.3697456T>C	ENSP00000316032:p.Tyr1779Cys	0					NUP98_ENST00000355260.3_Missense_Mutation_p.Y1705C|NUP98_ENST00000359171.4_3'UTR	p.Y1779C	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	0	1	1	1.992939	P52948	NUP98_HUMAN		33	5756	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	1	1	hg19	c.5336A>G	CCDS7746.1	0	.	.	.	.	.	.	.	.	.	.	T	17.52	3.410072	0.62399	.	.	ENSG00000110713	ENST00000324932;ENST00000355260	.	.	.	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.218936	0.33144	N	0.005228	T	0.75436	0.3849	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.75374	-0.3340	9	0.44086	T	0.13	-11.2226	14.719	0.69291	0.0:0.0:0.0:1.0	.	1705;1779;1693	P52948-2;P52948-5;P52948-6	.;.;.	C	1779;1705	.	ENSP00000316032:Y1779C	Y	-	2	0	0	NUP98	3654032	3654032	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.619000	0.83057	2.161000	0.67846	0.454000	0.30748	TAT	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.592	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	0	0	1	2	2	2	2	0	0	0	0	109	109	109	108	1	2.040000	-13.098230	1	0.100000	NM_016320		0	13	13	0	399	395	1		1	1		0	0	109	0	0	0.999520	9.232123e-01	0	20	0	118	0	13	399
CKAP5	9793	broad.mit.edu	37	11	46782199	46782199	+	Missense_Mutation	SNP	G	G	A	rs540835227		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:46782199G>A	ENST00000529230.1	-	33	4403	c.4357C>T	c.(4357-4359)Cgc>Tgc	p.R1453C	SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000415402.1_Missense_Mutation_p.R1453C|SNORD67_ENST00000516618.1_RNA|CKAP5_ENST00000312055.5_Missense_Mutation_p.R1453C|CKAP5_ENST00000354558.3_Missense_Mutation_p.R1453C			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1453					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.R1453C(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GGTCCCTTGCGTAACATGTTG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		20329	0.001		0.0	False		,,,				2504	0.0				Ovarian(4;85 273 2202 4844 13323)	ENST00000529230.1	1.000000	0.270000	0.800000	0.400000	0.580000	0.605481	0.580000	1.000000																										1	Substitution - Missense(1)	p.R1453C(1)	kidney(1)	43						c.(4357-4359)Cgc>Tgc		cytoskeleton associated protein 5							239.0	197.0	211.0					11																	46782199		2201	4299	6500	SO:0001583	missense	9793	2	121410	36				g.chr11:46782199G>A		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.4357C>T	chr11.hg19:g.46782199G>A	ENSP00000432768:p.Arg1453Cys	0					SNORD67_ENST00000516618.1_RNA|CKAP5_ENST00000312055.5_Missense_Mutation_p.R1453C|CKAP5_ENST00000415402.1_Missense_Mutation_p.R1453C|SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000354558.3_Missense_Mutation_p.R1453C	p.R1453C			0	1	1	1.992939	Q14008	CKAP5_HUMAN		33	4403	-			Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	1	1	hg19	c.4357C>T	CCDS31477.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.036557|4.036557	0.75617|0.75617	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558;ENST00000526876|ENST00000527333	T;T;T;T|.	0.51071|.	0.72;0.74;0.74;0.74|.	6.03|6.03	5.12|5.12	0.69794|0.69794	6.03|6.03	5.12|5.12	0.69794|0.69794	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56455|0.56455	0.1986|0.1986	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	D;B;B|.	0.89917|.	1.0;0.004;0.002|.	D;B;B|.	0.72625|.	0.978;0.001;0.0|.	T|T	0.52866|0.52866	-0.8518|-0.8518	10|5	0.59425|.	D|.	0.04|.	-10.0088|-10.0088	15.5956|15.5956	0.76578|0.76578	0.0658:0.0:0.9342:0.0|0.0658:0.0:0.9342:0.0	.|.	1453;1453;1453|.	Q14008-3;Q14008-2;Q14008|.	.;.;CKAP5_HUMAN|.	C|M	1453;1453;1453;1453;176|1	ENSP00000432768:R1453C;ENSP00000395302:R1453C;ENSP00000310227:R1453C;ENSP00000346566:R1453C|.	ENSP00000310227:R1453C|.	R|T	-|-	1|2	0|0	0|0	CKAP5|CKAP5	46738775|46738775	46738775|46738775	1.000000|1.000000	0.71417|0.71417	0.939000|0.939000	0.37840|0.37840	0.997000|0.997000	0.91878|0.91878	5.506000|5.506000	0.66993|0.66993	1.556000|1.556000	0.49512|0.49512	0.655000|0.655000	0.94253|0.94253	CGC|ACG	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.483	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	2.040000	-3.468434	1	0.100000	NM_014756		0	8	8	0	273	269	1		1	1		0	0	45	0	0	0.989021	6.820832e-01	0	12	0	67	0	8	273
OR5D13	390142	broad.mit.edu	37	11	55541693	55541693	+	Silent	SNP	T	T	C			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:55541693T>C	ENST00000361760.1	+	1	780	c.780T>C	c.(778-780)ctT>ctC	p.L260L		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				TCCTTTTCCTTTACTGTGTTC	0.458																																						ENST00000361760.1	0.560000	0.080000	0.410000	0.160000	0.260000	0.290344	0.260000	0.240000																										0				40						c.(778-780)ctT>ctC		olfactory receptor, family 5, subfamily D, member 13							122.0	99.0	107.0					11																	55541693		2200	4296	6496	SO:0001819	synonymous_variant	390142	0	0					g.chr11:55541693T>C	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.780T>C	chr11.hg19:g.55541693T>C		0						p.L260L	NM_001001967.1	NP_001001967.1	0	1	1	1.992939	Q8NGL4	OR5DD_HUMAN		1	780	+		all_epithelial(135;0.196)	Q6IF68|Q6IFC9	Silent	SNP	ENST00000361760.1	0	1	hg19	c.780T>C	CCDS31507.1	0																																																																																								0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.458	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	0	0	1	2	2	2	2	0	0	0	0	41	41	41	40	1	2.040000	-5.090844	1	0.100000	NM_001001967		0	4	4	0	326	321	0		1			0	0	41	0	0	0.887377	0	0	0	0	0	0	4	326
TYR	7299	broad.mit.edu	37	11	88911586	88911586	+	Silent	SNP	C	C	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:88911586C>A	ENST00000263321.5	+	1	967	c.465C>A	c.(463-465)acC>acA	p.T155T	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	155			T -> S (in OCA1A). {ECO:0000269|PubMed:15146472}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CCATAGGGACCTATGGCCAAA	0.413																																						ENST00000263321.5	1.000000	0.480000	0.890000	0.590000	0.730000	0.742908	0.730000	1.000000																										0				48						c.(463-465)acC>acA		tyrosinase	Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)						157.0	149.0	151.0					11																	88911586		2201	4299	6500	SO:0001819	synonymous_variant	7299	1	121412	36				g.chr11:88911586C>A	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.465C>A	chr11.hg19:g.88911586C>A		0					TYR_ENST00000526139.1_3'UTR	p.T155T	NM_000372.4	NP_000363.1	0	1	1	1.992939	P14679	TYRO_HUMAN		1	967	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	1	1	hg19	c.465C>A	CCDS8284.1	0																																																																																								0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.413	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	0	0	1	2	2	2	2	0	0	0	0	105	105	105	103	1	2.040000	-2.909917	1	0.100000	NM_000372		0	24	24	0	629	626	0		1			0	0	105	0	0	1.000000	0	0	0	0	0	0	24	629
MTNR1B	4544	broad.mit.edu	37	11	92715132	92715132	+	Missense_Mutation	SNP	G	G	A	rs150751119		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:92715132G>A	ENST00000257068.2	+	2	749	c.743G>A	c.(742-744)cGg>cAg	p.R248Q		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	248					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	AGCGACTTGCGGAGCTTTCTA	0.572																																						ENST00000257068.2	0.690000	0.160000	0.530000	0.250000	0.370000	0.401217	0.370000	0.350000																										0				33						c.(742-744)cGg>cAg		melatonin receptor 1B	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	G	GLN/ARG	0,4402		0,0,2201	114.0	94.0	101.0		743	4.2	1.0	11	dbSNP_134	101	1,8595	1.2+/-3.3	0,1,4297	no	missense	MTNR1B	NM_005959.3	43	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	248/363	92715132	1,12997	2201	4298	6499	SO:0001583	missense	4544	2	121412	40				g.chr11:92715132G>A	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.743G>A	chr11.hg19:g.92715132G>A	ENSP00000257068:p.Arg248Gln	0						p.R248Q	NM_005959.3	NP_005950.1	0	1	1	1.992939	P49286	MTR1B_HUMAN		2	749	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		Missense_Mutation	SNP	ENST00000257068.2	0	1	hg19	c.743G>A	CCDS8290.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.069708	0.93950	0.0	1.16E-4	ENSG00000134640	ENST00000257068	T	0.40225	1.04	4.21	4.21	0.49690	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59528	0.2200	M	0.84683	2.71	0.80722	D	1	D	0.57257	0.979	P	0.51170	0.661	T	0.70923	-0.4740	10	0.72032	D	0.01	-22.6709	17.1314	0.86727	0.0:0.0:1.0:0.0	.	248	P49286	MTR1B_HUMAN	Q	248	ENSP00000257068:R248Q	ENSP00000257068:R248Q	R	+	2	0	0	MTNR1B	92354780	92354780	1.000000	0.71417	0.990000	0.47175	0.851000	0.48451	4.111000	0.57838	2.338000	0.79540	0.491000	0.48974	CGG	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.572	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	108	1	2.040000	-2.029878	0	0.100000			0	7	8	0	377	372	0		1			0	0	108	0	0	0.980098	0	0	0	0	0	0	7	377
TECTA	7007	broad.mit.edu	37	11	121016448	121016448	+	Missense_Mutation	SNP	G	G	A	rs376745254	byFrequency	TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr11:121016448G>A	ENST00000392793.1	+	12	3999	c.3728G>A	c.(3727-3729)cGc>cAc	p.R1243H	TECTA_ENST00000264037.2_Missense_Mutation_p.R1243H|TECTA_ENST00000478058.1_3'UTR			O75443	TECTA_HUMAN	tectorin alpha	1243	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R1243H(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CTGTGTGGCCGCTACAACGGC	0.532													G|||	2	0.000399361	0.0	0.0	5008	,	,		22520	0.0		0.0	False		,,,				2504	0.002					ENST00000392793.1	0.790000	0.220000	0.620000	0.320000	0.460000	0.483080	0.460000	0.440000																									TECTA/TBCEL(2)	1	Substitution - Missense(1)	p.R1243H(1)	lung(1)	135						c.(3727-3729)cGc>cAc		tectorin alpha		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	151.0	122.0	132.0		3728	4.8	1.0	11		132	0,8598		0,0,4299	no	missense	TECTA	NM_005422.2	29	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1243/2156	121016448	1,13003	2203	4299	6502	SO:0001583	missense	7007	7	121412	41				g.chr11:121016448G>A	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3728G>A	chr11.hg19:g.121016448G>A	ENSP00000376543:p.Arg1243His	0					TECTA_ENST00000478058.1_3'UTR|TECTA_ENST00000264037.2_Missense_Mutation_p.R1243H	p.R1243H			0	1	1	1.992939	O75443	TECTA_HUMAN		12	3999	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		Missense_Mutation	SNP	ENST00000392793.1	0	1	hg19	c.3728G>A	CCDS8434.1	0	.	.	.	.	.	.	.	.	.	.	G	19.20	3.782117	0.70222	2.27E-4	0.0	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.59772	0.24;0.24	5.76	4.85	0.62838	5.76	4.85	0.62838	von Willebrand factor, type D domain (3);	0.000000	0.64402	D	0.000005	T	0.55016	0.1894	L	0.36672	1.1	0.33742	D	0.619606	D	0.56287	0.975	P	0.50270	0.636	T	0.67632	-0.5621	10	0.59425	D	0.04	.	11.5134	0.50507	0.137:0.0:0.863:0.0	.	1243	O75443	TECTA_HUMAN	H	1243	ENSP00000376543:R1243H;ENSP00000264037:R1243H	ENSP00000264037:R1243H	R	+	2	0	0	TECTA	120521658	120521658	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.363000	0.44178	2.721000	0.93114	0.591000	0.81541	CGC	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.532	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	0	0	1	2	2	2	2	0	0	0	0	121	121	121	120	1	2.040000	-2.885246	1	0.100000	NM_005422		0	9	8	0	390	388	0		1			0	0	121	0	0	0.994142	0	0	0	0	0	0	9	390
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.310000	1.000000	0.560000	0.930000	0.824213	0.930000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	1.998090	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	2.040000	-4.082842	1	0.100000	NM_033360		438	4	4	7599	93	92	0	1	1	1	1	0	0	18	211	1	0.889430	3.527587e-01	9.908627e-01	8	5	17	232	4	93
ADCY6	112	broad.mit.edu	37	12	49164612	49164612	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr12:49164612G>A	ENST00000307885.4	-	19	3887	c.3193C>T	c.(3193-3195)Cgg>Tgg	p.R1065W	ADCY6_ENST00000550422.1_Missense_Mutation_p.R1012W|MIR4701_ENST00000583094.1_RNA|ADCY6_ENST00000357869.3_Missense_Mutation_p.R1012W	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	1065					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						TCCATGAGCCGCATGGCGTAG	0.552																																						ENST00000307885.4	1.000000	0.120000	0.530000	0.200000	0.310000	0.395864	0.310000	0.280000																										0				29						c.(3193-3195)Cgg>Tgg		adenylate cyclase 6							121.0	111.0	114.0					12																	49164612		2203	4300	6503	SO:0001583	missense	112	3	121412	38				g.chr12:49164612G>A		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.3193C>T	chr12.hg19:g.49164612G>A	ENSP00000311405:p.Arg1065Trp	0					ADCY6_ENST00000357869.3_Missense_Mutation_p.R1012W|MIR4701_ENST00000583094.1_RNA|ADCY6_ENST00000550422.1_Missense_Mutation_p.R1012W	p.R1065W	NM_015270.3	NP_056085.1	1	2	3	1.998090	O43306	ADCY6_HUMAN		19	3887	-			Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	0	1	hg19	c.3193C>T	CCDS8767.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109958	0.77210	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.31510	1.49;1.49;1.49	4.88	4.88	0.63580	4.88	4.88	0.63580	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	M	0.85041	2.73	0.49130	D	0.999752	D;D	0.89917	1.0;0.999	D;D	0.75020	0.963;0.985	T	0.63202	-0.6690	10	0.72032	D	0.01	.	12.7647	0.57385	0.0:0.0:0.8354:0.1646	.	1012;1065	O43306-2;O43306	.;ADCY6_HUMAN	W	1012;1012;1065	ENSP00000350536:R1012W;ENSP00000446730:R1012W;ENSP00000311405:R1065W	ENSP00000311405:R1065W	R	-	1	2	2	ADCY6	47450879	47450879	0.952000	0.32445	1.000000	0.80357	0.994000	0.84299	1.074000	0.30703	2.649000	0.89929	0.650000	0.86243	CGG	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.552	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	0	0	1	2	2	2	2	0	0	0	0	101	101	101	99	1	2.040000	-2.197220	0	0.100000	NM_020983		0	6	6	0	424	420	0		1	0		0	0	101	0	0	0.964200	1.366642e-01	0	0	0	39	0	6	424
GTSF1	121355	broad.mit.edu	37	12	54858949	54858949	+	Missense_Mutation	SNP	C	C	T	rs199823357	byFrequency	TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr12:54858949C>T	ENST00000552397.1	-	3	915	c.19G>A	c.(19-21)Gac>Aac	p.D7N	GTSF1_ENST00000552395.1_Intron|RP11-753H16.3_ENST00000550474.1_RNA|GTSF1_ENST00000305879.5_Missense_Mutation_p.D7N|RP11-753H16.5_ENST00000552785.1_RNA			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1	7						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				TCCAGGGAGTCGGCTGAAAGA	0.428													C|||	5	0.000998403	0.003	0.0014	5008	,	,		14400	0.0		0.0	False		,,,				2504	0.0					ENST00000552397.1	1.000000	0.280000	0.970000	0.420000	0.620000	0.657141	0.620000	1.000000																										0				5						c.(19-21)Gac>Aac		gametocyte specific factor 1		C	ASN/ASP	1,4405		0,1,2202	110.0	103.0	106.0		19	5.6	1.0	12		106	0,8600		0,0,4300	yes	missense	GTSF1	NM_144594.2	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	7/168	54858949	1,13005	2203	4300	6503	SO:0001583	missense	121355	17	121412	43				g.chr12:54858949C>T	AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.19G>A	chr12.hg19:g.54858949C>T	ENSP00000446485:p.Asp7Asn	0					RP11-753H16.3_ENST00000550474.1_RNA|GTSF1_ENST00000305879.5_Missense_Mutation_p.D7N|RP11-753H16.5_ENST00000552785.1_RNA|GTSF1_ENST00000552395.1_Intron	p.D7N			1	2	3	1.998090	Q8WW33	GTSF1_HUMAN		3	915	-		Myeloproliferative disorder(1001;0.00452)	B3KQ60|Q0VGM4|Q8N778	Missense_Mutation	SNP	ENST00000552397.1	0	1	hg19	c.19G>A	CCDS8881.1	0	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672837	0.88445	2.27E-4	0.0	ENSG00000170627	ENST00000552397;ENST00000305879	T;T	0.54071	0.59;0.59	5.57	5.57	0.84162	5.57	5.57	0.84162	.	0.152500	0.56097	D	0.000021	T	0.59878	0.2226	M	0.68952	2.095	0.47621	D	0.999471	D	0.63046	0.992	P	0.48454	0.578	T	0.59451	-0.7452	10	0.37606	T	0.19	-22.3962	17.4106	0.87484	0.0:1.0:0.0:0.0	.	7	Q8WW33	GTSF1_HUMAN	N	7	ENSP00000446485:D7N;ENSP00000304185:D7N	ENSP00000304185:D7N	D	-	1	0	0	GTSF1	53145216	53145216	0.979000	0.34478	0.999000	0.59377	0.916000	0.54674	2.429000	0.44758	2.785000	0.95823	0.655000	0.94253	GAC	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.428	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406187.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	2.040000	-3.269909	1	0.100000	NM_144594		0	8	8	0	274	266	0		1	0		0	0	45	0	0	0.988355	3.250271e-03	0	0	0	3	0	8	274
C12orf74	338809	broad.mit.edu	37	12	93100538	93100538	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr12:93100538G>A	ENST00000397833.3	+	2	582	c.131G>A	c.(130-132)cGc>cAc	p.R44H	C12orf74_ENST00000544406.2_Missense_Mutation_p.R44H	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	44										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						GCCCCAGGCCGCATCTCCACC	0.642																																						ENST00000397833.3	1.000000	0.100000	0.510000	0.180000	0.290000	0.375619	0.290000	0.250000																										0				10						c.(130-132)cGc>cAc		chromosome 12 open reading frame 74							41.0	43.0	43.0					12																	93100538		1915	4120	6035	SO:0001583	missense	338809	7	120848	38				g.chr12:93100538G>A	BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.131G>A	chr12.hg19:g.93100538G>A	ENSP00000380933:p.Arg44His	0					C12orf74_ENST00000544406.2_Missense_Mutation_p.R44H	p.R44H	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	1	2	3	1.998090	Q32Q52	CL074_HUMAN		2	582	+			F5H4P0	Missense_Mutation	SNP	ENST00000397833.3	0	1	hg19	c.131G>A	CCDS41819.1	0	.	.	.	.	.	.	.	.	.	.	G	12.32	1.903105	0.33628	.	.	ENSG00000214215	ENST00000397833;ENST00000544406	.	.	.	4.98	4.08	0.47627	4.98	4.08	0.47627	.	.	.	.	.	T	0.24084	0.0583	N	0.24115	0.695	0.18873	N	0.999983	P;P	0.43938	0.822;0.822	B;B	0.37943	0.261;0.261	T	0.06991	-1.0796	8	0.59425	D	0.04	-16.0586	9.522	0.39140	0.0971:0.0:0.9029:0.0	.	44;44	F5H4P0;Q32Q52	.;CL074_HUMAN	H	44	.	ENSP00000380933:R44H	R	+	2	0	0	C12orf74	91624669	91624669	0.014000	0.17966	0.083000	0.20561	0.338000	0.28826	1.061000	0.30542	1.295000	0.44724	0.462000	0.41574	CGC	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.642	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407285.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	2.040000	-2.799622	1	0.100000	NM_001037671		0	5	5	0	391	386	0		1			0	0	85	0	0	0.935813	0	0	0	0	0	0	5	391
DCLK1	9201	broad.mit.edu	37	13	36445384	36445384	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr13:36445384T>G	ENST00000360631.3	-	5	1128	c.917A>C	c.(916-918)aAg>aCg	p.K306T	DCLK1_ENST00000255448.4_Missense_Mutation_p.K306T|DCLK1_ENST00000379892.4_Missense_Mutation_p.K306T			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	306	Pro/Ser-rich.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GGCAGGGGACTTGCTACGCCT	0.532																																						ENST00000360631.3	1.000000	0.090000	1.000000	0.160000	0.250000	0.381983	0.250000	0.220000																										0				64						c.(916-918)aAg>aCg		doublecortin-like kinase 1							198.0	187.0	191.0					13																	36445384		2203	4300	6503	SO:0001583	missense	9201	0	0					g.chr13:36445384T>G	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.917A>C	chr13.hg19:g.36445384T>G	ENSP00000353846:p.Lys306Thr	0					DCLK1_ENST00000379892.4_Missense_Mutation_p.K306T|DCLK1_ENST00000255448.4_Missense_Mutation_p.K306T	p.K306T			1	2	3	2.019891	O15075	DCLK1_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	5	1128	-		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	0	1	hg19	c.917A>C		0	.	.	.	.	.	.	.	.	.	.	T	21.3	4.125614	0.77436	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	T;T;T	0.68765	-0.35;-0.35;1.65	5.28	5.28	0.74379	5.28	5.28	0.74379	.	0.112949	0.64402	D	0.000015	T	0.80894	0.4711	M	0.75777	2.31	0.53688	D	0.999973	D	0.76494	0.999	D	0.72982	0.979	T	0.82244	-0.0553	10	0.51188	T	0.08	.	15.5029	0.75713	0.0:0.0:0.0:1.0	.	306	O15075-2	.	T	306	ENSP00000255448:K306T;ENSP00000353846:K306T;ENSP00000369222:K306T	ENSP00000255448:K306T	K	-	2	0	0	DCLK1	35343384	35343384	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	5.611000	0.67674	2.115000	0.64714	0.533000	0.62120	AAG	0.111111		TCGA-IB-A5ST-01A-11D-A32N-08	0.532	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	124	1	2.040000	-5.302436	1	0.100000	NM_004734		0	6	6	0	558	548	0		1	0		0	0	127	0	0	0.963149	1.395883e-02	0	0	0	14	0	6	558
FAM155A	728215	broad.mit.edu	37	13	108518385	108518385	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr13:108518385G>A	ENST00000375915.2	-	1	698	c.560C>T	c.(559-561)gCg>gTg	p.A187V		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	187						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CACCGCGTCCGCATTCTCCAC	0.652																																						ENST00000375915.2	1.000000	0.090000	1.000000	0.150000	0.240000	0.372013	0.240000	0.200000																										0				33						c.(559-561)gCg>gTg		family with sequence similarity 155, member A							42.0	51.0	48.0					13																	108518385		2201	4296	6497	SO:0001583	missense	728215	0	0					g.chr13:108518385G>A	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.560C>T	chr13.hg19:g.108518385G>A	ENSP00000365080:p.Ala187Val	0						p.A187V	NM_001080396.2	NP_001073865.1	1	2	3	2.019891	B1AL88	F155A_HUMAN		1	698	-			B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	0	1	hg19	c.560C>T	CCDS32006.1	0	.	.	.	.	.	.	.	.	.	.	G	15.10	2.734242	0.48939	.	.	ENSG00000204442	ENST00000375915	T	0.11169	2.8	5.89	5.04	0.67666	5.89	5.04	0.67666	.	0.189112	0.43919	D	0.000518	T	0.16981	0.0408	L	0.29908	0.895	0.44085	D	0.996848	D	0.71674	0.998	P	0.54346	0.749	T	0.01146	-1.1437	10	0.62326	D	0.03	.	15.5308	0.75960	0.0:0.0:0.8609:0.1391	.	187	B1AL88	F155A_HUMAN	V	187	ENSP00000365080:A187V	ENSP00000365080:A187V	A	-	2	0	0	FAM155A	107316386	107316386	1.000000	0.71417	0.980000	0.43619	0.004000	0.04260	9.147000	0.94646	1.479000	0.48272	-0.314000	0.08810	GCG	0.111111		TCGA-IB-A5ST-01A-11D-A32N-08	0.652	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	0	0	1	2	17	2	2	1	1	1	1	136	136	136	134	1	2.040000	-1.951316	0	0.100000	NM_001080396		0	7	8	0	673	662	0		0	0		1	0	136	0	0	0.028339	5.198303e-03	0	0	0	9	0	7	673
CSPG4	1464	broad.mit.edu	37	15	75968972	75968972	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr15:75968972T>A	ENST00000308508.5	-	10	5980	c.5888A>T	c.(5887-5889)cAg>cTg	p.Q1963L	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1963	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GAGCTGCTGCTGGCTCAGTGA	0.672																																						ENST00000308508.5	1.000000	0.420000	0.860000	0.540000	0.680000	0.702847	0.680000	1.000000																										0				48						c.(5887-5889)cAg>cTg		chondroitin sulfate proteoglycan 4							38.0	48.0	45.0					15																	75968972		2196	4294	6490	SO:0001583	missense	1464	0	0					g.chr15:75968972T>A	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.5888A>T	chr15.hg19:g.75968972T>A	ENSP00000312506:p.Gln1963Leu	0					CTD-2026K11.1_ENST00000569467.1_RNA|AC105020.1_ENST00000435356.1_5'Flank	p.Q1963L	NM_001897.4	NP_001888.2	0	0	0	1.966184	Q6UVK1	CSPG4_HUMAN		10	5980	-			D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	1	1	hg19	c.5888A>T	CCDS10284.1	0	.	.	.	.	.	.	.	.	.	.	T	10.61	1.399616	0.25291	.	.	ENSG00000173546	ENST00000308508	T	0.18016	2.24	5.15	-6.2	0.02072	5.15	-6.2	0.02072	.	0.815436	0.10720	N	0.641890	T	0.09949	0.0244	L	0.34521	1.04	0.09310	N	0.999999	B	0.14438	0.01	B	0.11329	0.006	T	0.33214	-0.9877	10	0.25751	T	0.34	.	8.6049	0.33767	0.0:0.2126:0.3399:0.4475	.	1963	Q6UVK1	CSPG4_HUMAN	L	1963	ENSP00000312506:Q1963L	ENSP00000312506:Q1963L	Q	-	2	0	0	CSPG4	73756027	73756027	0.037000	0.19845	0.433000	0.26760	0.950000	0.60333	0.260000	0.18424	-1.050000	0.03230	-0.337000	0.08149	CAG	0.080695		TCGA-IB-A5ST-01A-11D-A32N-08	0.672	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	1	0	1	2	2	2	2	0	0	0	0	143	143	143	141	1	2.040000	-16.792810	1	0.100000	NM_001897		0	18	18	0	495	493	0		1	0		0	0	143	0	0	0.999982	2.630517e-01	0	0	0	27	0	18	495
ANKS4B	257629	broad.mit.edu	37	16	21261762	21261762	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr16:21261762G>C	ENST00000311620.5	+	2	948	c.875G>C	c.(874-876)aGa>aCa	p.R292T		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	292					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		GATAGCAAGAGAGAGTTTGGT	0.458																																						ENST00000311620.5	1.000000	0.200000	1.000000	0.370000	0.650000	0.673959	0.650000	1.000000																										0				20						c.(874-876)aGa>aCa		ankyrin repeat and sterile alpha motif domain containing 4B							96.0	101.0	100.0					16																	21261762		1996	4175	6171	SO:0001583	missense	257629	0	0					g.chr16:21261762G>C	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.875G>C	chr16.hg19:g.21261762G>C	ENSP00000308772:p.Arg292Thr	0						p.R292T	NM_145865.2	NP_665872.2	1	2	3	2.032587	Q8N8V4	ANS4B_HUMAN		2	948	+				Missense_Mutation	SNP	ENST00000311620.5	0	1	hg19	c.875G>C	CCDS42130.1	0	.	.	.	.	.	.	.	.	.	.	G	4.587	0.108980	0.08780	.	.	ENSG00000175311	ENST00000311620	T	0.44881	0.91	5.77	4.8	0.61643	5.77	4.8	0.61643	.	0.168743	0.53938	N	0.000044	T	0.44932	0.1317	M	0.70595	2.14	0.41181	D	0.986238	B	0.02656	0.0	B	0.04013	0.001	T	0.44236	-0.9341	10	0.59425	D	0.04	-10.1277	14.5212	0.67851	0.0:0.1479:0.8521:0.0	.	292	Q8N8V4	ANS4B_HUMAN	T	292	ENSP00000308772:R292T	ENSP00000308772:R292T	R	+	2	0	0	ANKS4B	21169263	21169263	0.614000	0.27017	0.963000	0.40424	0.060000	0.15804	1.431000	0.34925	1.416000	0.47057	-0.282000	0.10007	AGA	0.113737		TCGA-IB-A5ST-01A-11D-A32N-08	0.458	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	2.040000	-6.573118	1	0.100000	NM_145865		0	4	4	0	154	151	1		1	1		0	0	39	0	0	0.886830	2.535692e-01	0	14	0	17	0	4	154
ITGAD	3681	broad.mit.edu	37	16	31434506	31434506	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr16:31434506G>A	ENST00000389202.2	+	24	2901	c.2852G>A	c.(2851-2853)cGa>cAa	p.R951Q		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	951					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.R951Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GCTGAGCATCGATACCGTGTG	0.498																																						ENST00000389202.2	1.000000	0.200000	1.000000	0.340000	0.560000	0.623630	0.560000	1.000000																										1	Substitution - Missense(1)	p.R951Q(1)	large_intestine(1)	71						c.(2851-2853)cGa>cAa		integrin, alpha D							78.0	67.0	71.0					16																	31434506		2197	4300	6497	SO:0001583	missense	3681	6	121412	36				g.chr16:31434506G>A	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.2852G>A	chr16.hg19:g.31434506G>A	ENSP00000373854:p.Arg951Gln	0						p.R951Q	NM_005353.2	NP_005344.2	1	2	3	2.032587	Q13349	ITAD_HUMAN		24	2901	+			Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	0	1	hg19	c.2852G>A	CCDS32438.1	0	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331575	0.24167	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.44482	0.92	5.59	1.43	0.22495	5.59	1.43	0.22495	Integrin alpha-2 (1);	.	.	.	.	T	0.20251	0.0487	L	0.28400	0.85	0.09310	N	1	P;P	0.47034	0.889;0.889	B;B	0.28638	0.092;0.092	T	0.09443	-1.0674	9	0.20046	T	0.44	.	7.3842	0.26872	0.3411:0.0:0.6589:0.0	.	967;951	Q59H14;Q13349	.;ITAD_HUMAN	Q	967;951	ENSP00000373854:R951Q	ENSP00000373854:R951Q	R	+	2	0	0	ITGAD	31342007	31342007	0.000000	0.05858	0.003000	0.11579	0.453000	0.32348	-0.053000	0.11846	0.704000	0.31869	0.650000	0.86243	CGA	0.113737		TCGA-IB-A5ST-01A-11D-A32N-08	0.498	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	0	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	2.040000	-3.406568	1	0.100000	NM_005353		0	5	5	0	215	212	0		1	0		0	0	47	0	0	0.935984	0	0	0	0	1	0	5	215
LPCAT2	54947	broad.mit.edu	37	16	55579653	55579653	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr16:55579653C>T	ENST00000262134.5	+	9	1043	c.859C>T	c.(859-861)Cca>Tca	p.P287S		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	287					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						TCAGTTTATGCCAGTTCAAGT	0.289																																						ENST00000262134.5	1.000000	0.120000	1.000000	0.200000	0.340000	0.462001	0.340000	0.260000																										0				12						c.(859-861)Cca>Tca		lysophosphatidylcholine acyltransferase 2							95.0	95.0	95.0					16																	55579653		2198	4300	6498	SO:0001583	missense	54947	1	121402	27				g.chr16:55579653C>T	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.859C>T	chr16.hg19:g.55579653C>T	ENSP00000262134:p.Pro287Ser	0						p.P287S	NM_017839.4	NP_060309.2	1	2	3	2.032587	Q7L5N7	PCAT2_HUMAN		9	1043	+			A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	ENST00000262134.5	0	1	hg19	c.859C>T	CCDS10753.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935213	0.92458	.	.	ENSG00000087253	ENST00000262134	D	0.93906	-3.31	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.97192	0.9082	M	0.93898	3.47	0.80722	D	1	D	0.65815	0.995	P	0.55965	0.788	D	0.97520	1.0072	10	0.87932	D	0	-16.5825	20.1358	0.98028	0.0:1.0:0.0:0.0	.	287	Q7L5N7	PCAT2_HUMAN	S	287	ENSP00000262134:P287S	ENSP00000262134:P287S	P	+	1	0	0	LPCAT2	54137154	54137154	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.876000	0.63079	2.865000	0.98341	0.655000	0.94253	CCA	0.113737		TCGA-IB-A5ST-01A-11D-A32N-08	0.289	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256977.2	0	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	2.040000	-1.896728	0	0.100000	NM_017839		0	5	5	0	363	360	0		1	0		0	0	43	0	0	0.936602	2.033785e-01	0	0	0	51	0	5	363
MAP2K3	5606	broad.mit.edu	37	17	21204188	21204188	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr17:21204188G>A	ENST00000342679.4	+	5	531	c.282G>A	c.(280-282)cgG>cgA	p.R94R	MAP2K3_ENST00000316920.6_Silent_p.R65R|MAP2K3_ENST00000361818.5_Silent_p.R65R	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	94	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> L (in dbSNP:rs56067280). {ECO:0000269|PubMed:17344846}.		activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CCCTGCAGCGGATCCGGGCCA	0.612																																						ENST00000342679.4	0.600000	0.130000	0.460000	0.200000	0.310000	0.338410	0.310000	0.290000																										0										c.(280-282)cgG>cgA		mitogen-activated protein kinase kinase 3							97.0	81.0	86.0					17																	21204188		2203	4300	6503	SO:0001819	synonymous_variant	5606	0	0					g.chr17:21204188G>A	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.282G>A	chr17.hg19:g.21204188G>A		0					MAP2K3_ENST00000361818.5_Silent_p.R65R|MAP2K3_ENST00000316920.6_Silent_p.R65R	p.R94R	NM_145109.2	NP_659731.1	0	1	1	1.979359	P46734	MP2K3_HUMAN		5	531	+			B3KSK7|Q99441|Q9UE71|Q9UE72	Silent	SNP	ENST00000342679.4	0	1	hg19	c.282G>A	CCDS11217.1	0																																																																																								0.090450		TCGA-IB-A5ST-01A-11D-A32N-08	0.612	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	0	0	0	2	2	2	2	0	0	0	0	101	101	101	101	1	2.040000	-6.267752	1	0.100000	NM_145109		0	6	6	0	391	383	0		1	1		0	0	101	0	0	0.962993	6.428438e-01	0	9	0	126	0	6	391
MYBBP1A	10514	broad.mit.edu	37	17	4453441	4453441	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr17:4453441G>A	ENST00000254718.4	-	9	1537	c.1231C>T	c.(1231-1233)Cgg>Tgg	p.R411W	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.R411W			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	411	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						AACATGGCCCGCAGCCAGGCC	0.597																																						ENST00000254718.4	0.690000	0.150000	0.530000	0.240000	0.360000	0.391933	0.360000	0.340000																										0				24						c.(1231-1233)Cgg>Tgg		MYB binding protein (P160) 1a							68.0	77.0	74.0					17																	4453441		2203	4300	6503	SO:0001583	missense	10514	1	121412	29				g.chr17:4453441G>A	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.1231C>T	chr17.hg19:g.4453441G>A	ENSP00000254718:p.Arg411Trp	0					MYBBP1A_ENST00000381556.2_Missense_Mutation_p.R411W	p.R411W			0	1	1	1.979359	Q9BQG0	MBB1A_HUMAN		9	1537	-			Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	0	1	hg19	c.1231C>T	CCDS11046.1	0	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462466	0.43736	.	.	ENSG00000132382	ENST00000381556;ENST00000254718;ENST00000426435	T;T	0.52057	0.68;0.68	5.06	5.06	0.68205	5.06	5.06	0.68205	Armadillo-type fold (1);	0.730054	0.13638	N	0.373192	T	0.52549	0.1741	L	0.51422	1.61	0.25166	N	0.990316	D;D	0.60160	0.987;0.984	P;P	0.52909	0.713;0.59	T	0.44559	-0.9320	10	0.41790	T	0.15	-17.3908	10.9319	0.47222	0.0:0.0:0.8133:0.1867	.	411;411	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	W	411	ENSP00000370968:R411W;ENSP00000254718:R411W	ENSP00000254718:R411W	R	-	1	2	2	MYBBP1A	4400190	4400190	0.867000	0.29959	0.946000	0.38457	0.017000	0.09413	4.116000	0.57871	2.642000	0.89623	0.655000	0.94253	CGG	0.090450		TCGA-IB-A5ST-01A-11D-A32N-08	0.597	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	0	0	1	2	2	2	2	0	0	0	0	101	101	101	101	1	2.040000	-2.433878	0	0.100000	NM_014520		0	6	6	0	335	334	0		1	0		0	0	101	0	0	0.965007	2.070832e-01	0	0	0	41	0	6	335
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.360000	0.890000	0.500000	0.670000	0.692844	0.670000	1.000000	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	24185	GRCh37	CM010465|CM900211	TP53	M	rs121912651	c.(742-744)Cgg>Tgg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	7157	1	121412	37	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577539G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	chr17.hg19:g.7577539G>A	ENSP00000269305:p.Arg248Trp	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W	p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.979359	P04637	P53_HUMAN		7	931	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.742C>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	2	TP53	7518264	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	0.090450		TCGA-IB-A5ST-01A-11D-A32N-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	0	0	1	2	2	2	2	0	0	0	0	100	100	100	100	1	2.040000	-2.641153	1	0.100000	NM_000546		0	11	11	0	315	310	0		1	1	1	0	0	100	793	0	0.998262	8.015003e-01	9.999550e-01	22	13	66	552	11	315
MAP2K3	5606	broad.mit.edu	37	17	21204218	21204218	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr17:21204218G>A	ENST00000342679.4	+	5	561	c.312G>A	c.(310-312)caG>caA	p.Q104Q	MAP2K3_ENST00000316920.6_Silent_p.Q75Q|MAP2K3_ENST00000361818.5_Silent_p.Q75Q	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	104	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CACAGGAGCAGAAGCGGCTGC	0.587																																						ENST00000342679.4	0.490000	0.100000	0.370000	0.160000	0.250000	0.274158	0.250000	0.240000																										0										c.(310-312)caG>caA		mitogen-activated protein kinase kinase 3							125.0	102.0	110.0					17																	21204218		2203	4300	6503	SO:0001819	synonymous_variant	5606	0	0					g.chr17:21204218G>A	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.312G>A	chr17.hg19:g.21204218G>A		0					MAP2K3_ENST00000361818.5_Silent_p.Q75Q|MAP2K3_ENST00000316920.6_Silent_p.Q75Q	p.Q104Q	NM_145109.2	NP_659731.1	0	1	1	1.979359	P46734	MP2K3_HUMAN		5	561	+			B3KSK7|Q99441|Q9UE71|Q9UE72	Silent	SNP	ENST00000342679.4	0	1	hg19	c.312G>A	CCDS11217.1	0																																																																																								0.090450		TCGA-IB-A5ST-01A-11D-A32N-08	0.587	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	0	0	0	2	2	2	2	0	0	0	0	133	133	133	133	1	2.040000	-5.437685	1	0.100000	NM_145109		0	6	6	0	487	477	0		1	1		0	0	133	0	0	0.962893	4.841150e-01	0	10	0	110	0	6	487
FFAR3	2865	broad.mit.edu	37	19	35850345	35850345	+	Missense_Mutation	SNP	C	C	T	rs150489647		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr19:35850345C>T	ENST00000327809.4	+	2	754	c.553C>T	c.(553-555)Cgg>Tgg	p.R185W	FFAR3_ENST00000594310.1_Missense_Mutation_p.R185W	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	185					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CCTGCCCGTGCGGCTGGAGAT	0.622																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)	ENST00000327809.4	1.000000	0.150000	1.000000	0.240000	0.390000	0.501218	0.390000	0.320000																										0				17						c.(553-555)Cgg>Tgg		free fatty acid receptor 3							36.0	30.0	32.0					19																	35850345		2201	4298	6499	SO:0001583	missense	2865	1	121404	31				g.chr19:35850345C>T	AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.553C>T	chr19.hg19:g.35850345C>T	ENSP00000328230:p.Arg185Trp	0					FFAR3_ENST00000594310.1_Missense_Mutation_p.R185W	p.R185W	NM_005304.3	NP_005295.1	1	2	3	2.030591	O14843	FFAR3_HUMAN	Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)	2	754	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		B2RWM8|Q14CM7	Missense_Mutation	SNP	ENST00000327809.4	0	1	hg19	c.553C>T	CCDS12459.1	0	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255435	0.39896	.	.	ENSG00000185897	ENST00000327809	T	0.37752	1.18	5.13	2.75	0.32379	5.13	2.75	0.32379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	T	0.59932	0.2230	M	0.82517	2.595	0.38954	D	0.958414	D	0.89917	1.0	D	0.97110	1.0	T	0.65516	-0.6149	10	0.38643	T	0.18	-24.346	13.0743	0.59079	0.316:0.684:0.0:0.0	.	185	O14843	FFAR3_HUMAN	W	185	ENSP00000328230:R185W	ENSP00000328230:R185W	R	+	1	2	2	FFAR3	40542185	40542185	0.985000	0.35326	0.625000	0.29200	0.069000	0.16628	3.235000	0.51328	1.110000	0.41699	0.455000	0.32223	CGG	0.113300		TCGA-IB-A5ST-01A-11D-A32N-08	0.622	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418873.2	0	0	1	2	2	2	2	0	0	0	0	89	89	89	100	1	2.040000	-2.998623	1	0.100000	NM_005304		0	6	6	0	363	315	0		1			0	0	89	0	0	0.947341	0	0	0	0	0	0	6	363
CEACAM7	1087	broad.mit.edu	37	19	42190935	42190935	+	Silent	SNP	G	G	A	rs145571605	byFrequency	TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr19:42190935G>A	ENST00000006724.3	-	2	483	c.282C>T	c.(280-282)ccC>ccT	p.P94P	CEACAM7_ENST00000602225.1_Silent_p.P94P|CEACAM7_ENST00000338196.4_Silent_p.P94P|CEACAM7_ENST00000599715.1_5'UTR|CEACAM7_ENST00000401731.1_Silent_p.P94P	NM_006890.3	NP_008821.1	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 7	94	Ig-like V-type.					anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		CGTTGTGTGCGGGCCCTGGGG	0.443																																						ENST00000006724.3	1.000000	0.060000	1.000000	0.110000	0.180000	0.361485	0.180000	0.150000																										0				18						c.(280-282)ccC>ccT		carcinoembryonic antigen-related cell adhesion molecule 7		G		8,4398	12.9+/-30.5	0,8,2195	175.0	185.0	182.0		282	-3.4	0.0	19	dbSNP_134	182	0,8600		0,0,4300	no	coding-synonymous	CEACAM7	NM_006890.3		0,8,6495	AA,AG,GG		0.0,0.1816,0.0615		94/266	42190935	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	1087	13	121412	48				g.chr19:42190935G>A	X98311	CCDS12583.1	19q13.2	2013-01-29			ENSG00000007306	ENSG00000007306		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1819	protein-coding gene	gene with protein product	"""carcinoembryonic antigen gene family member 2"""			CGM2		7806520, 9135022	Standard	XM_005278379		Approved	CEA	uc002ori.1	Q14002	OTTHUMG00000151063	ENST00000006724.3:c.282C>T	chr19.hg19:g.42190935G>A		0					CEACAM7_ENST00000401731.1_Silent_p.P94P|CEACAM7_ENST00000338196.4_Silent_p.P94P|CEACAM7_ENST00000602225.1_Silent_p.P94P|CEACAM7_ENST00000599715.1_5'UTR	p.P94P	NM_006890.3	NP_008821.1	1	2	3	2.090229	Q14002	CEAM7_HUMAN		2	483	-			A8K848|O15148|O15149|Q0VAC1|Q13983|Q9UPJ2	Silent	SNP	ENST00000006724.3	0	1	hg19	c.282C>T	CCDS12583.1	0																																																																																								0.126214		TCGA-IB-A5ST-01A-11D-A32N-08	0.443	CEACAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321145.1	0	0	1	2	2	2	2	0	0	0	0	220	220	220	218	1	2.040000	-1.658660	0	0.100000	NM_006890		0	7	8	0	964	952	0		1	0		0	0	220	0	0	0.979803	4.399394e-02	0	0	0	39	0	7	964
PSG6	5675	broad.mit.edu	37	19	43411250	43411250	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr19:43411250G>A	ENST00000292125.2	-	5	1108	c.1064C>T	c.(1063-1065)gCg>gTg	p.A355V	PSG6_ENST00000187910.2_Missense_Mutation_p.A355V|PSG6_ENST00000402603.4_Missense_Mutation_p.A262V	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	355	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GTTAGAGTCCGCAAAGCAGGA	0.448																																						ENST00000292125.2	1.000000	0.060000	1.000000	0.100000	0.160000	0.351793	0.160000	0.130000																										0				44						c.(1063-1065)gCg>gTg		pregnancy specific beta-1-glycoprotein 6							185.0	196.0	192.0					19																	43411250		2201	4299	6500	SO:0001583	missense	5675	3	121350	44				g.chr19:43411250G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.1064C>T	chr19.hg19:g.43411250G>A	ENSP00000292125:p.Ala355Val	0					PSG6_ENST00000187910.2_Missense_Mutation_p.A355V|PSG6_ENST00000402603.4_Missense_Mutation_p.A262V	p.A355V	NM_002782.4	NP_002773.1	1	2	3	2.090229	Q00889	PSG6_HUMAN		5	1108	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	0	1	hg19	c.1064C>T	CCDS12613.1	0	.	.	.	.	.	.	.	.	.	.	N	9.184	1.024244	0.19433	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125	T;T;T	0.14144	2.53;2.53;2.53	1.54	1.54	0.23209	1.54	1.54	0.23209	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13500	0.0327	L	0.50847	1.595	0.09310	N	0.999998	B;B;B	0.34372	0.132;0.292;0.451	B;B;B	0.36244	0.184;0.22;0.185	T	0.20840	-1.0263	9	0.59425	D	0.04	.	6.5495	0.22425	0.0:0.0:1.0:0.0	.	355;355;262	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	V	355;262;355	ENSP00000187910:A355V;ENSP00000385736:A262V;ENSP00000292125:A355V	ENSP00000187910:A355V	A	-	2	0	0	PSG6	48103090	48103090	0.001000	0.12720	0.002000	0.10522	0.014000	0.08584	0.729000	0.26028	0.854000	0.35336	0.134000	0.15878	GCG	0.126214		TCGA-IB-A5ST-01A-11D-A32N-08	0.448	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	0	0	1	2	2	2	2	0	0	0	0	273	273	273	269	1	2.040000	-1.714379	0	0.100000	NM_002782		0	8	8	0	1175	1154	0		1			0	0	273	0	0	0.988544	0	0	0	0	0	0	8	1175
SASS6	163786	broad.mit.edu	37	1	100573235	100573235	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:100573235T>G	ENST00000287482.5	-	10	1235	c.1095A>C	c.(1093-1095)caA>caC	p.Q365H	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.Q198H	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	365					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		GCTTTCCTAGTTGTACTTGAT	0.249																																						ENST00000287482.5	1.000000	0.330000	1.000000	0.550000	0.900000	0.815059	0.900000	1.000000																										0				19						c.(1093-1095)caA>caC		spindle assembly 6 homolog (C. elegans)							44.0	47.0	46.0					1																	100573235		2200	4288	6488	SO:0001583	missense	163786	0	0					g.chr1:100573235T>G	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1095A>C	chr1.hg19:g.100573235T>G	ENSP00000287482:p.Gln365His	0					SASS6_ENST00000535161.1_Missense_Mutation_p.Q198H|SASS6_ENST00000462159.1_5'UTR	p.Q365H	NM_194292.1	NP_919268.1	1	2	3	2.024724	Q6UVJ0	SAS6_HUMAN		10	1235	-		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	D3DT55|Q8N3K0	Missense_Mutation	SNP	ENST00000287482.5	0	1	hg19	c.1095A>C	CCDS764.1	1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.250271	0.39797	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.78595	-1.19;-1.19	5.86	-2.04	0.07343	5.86	-2.04	0.07343	.	0.097898	0.64402	D	0.000001	T	0.51363	0.1670	L	0.49350	1.555	0.39686	D	0.970979	B	0.25272	0.122	B	0.26094	0.066	T	0.37267	-0.9713	10	0.34782	T	0.22	-17.8258	8.944	0.35747	0.1162:0.4925:0.0:0.3913	.	365	Q6UVJ0	SAS6_HUMAN	H	365;338;198	ENSP00000287482:Q365H;ENSP00000440169:Q198H	ENSP00000287482:Q365H	Q	-	3	2	2	SASS6	100345823	100345823	0.975000	0.34042	0.975000	0.42487	0.990000	0.78478	0.142000	0.16096	-0.327000	0.08551	0.477000	0.44152	CAA	0.111988		TCGA-IB-A5ST-01A-11D-A32N-08	0.249	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	1	0	1	2	2	2	2	0	0	0	0	13	13	13	12	1	2.040000	-3.684047	1	0.100000	NM_194292		0	5	6	0	128	126	0		1	0		0	0	13	0	0	0.937519	2.287582e-03	0	0	0	2	0	5	128
DBT	1629	broad.mit.edu	37	1	100681577	100681577	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:100681577G>A	ENST00000370132.4	-	6	747	c.734C>T	c.(733-735)cCg>cTg	p.P245L	DBT_ENST00000370131.3_Missense_Mutation_p.P245L	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	245					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		TGTGAATACCGGAGGTTTTGA	0.388																																						ENST00000370132.4	1.000000	0.060000	1.000000	0.110000	0.190000	0.338948	0.190000	0.160000																										0				19						c.(733-735)cCg>cTg		dihydrolipoamide branched chain transacylase E2							235.0	232.0	233.0					1																	100681577		2203	4300	6503	SO:0001583	missense	1629	4	121412	40				g.chr1:100681577G>A	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.734C>T	chr1.hg19:g.100681577G>A	ENSP00000359151:p.Pro245Leu	0					DBT_ENST00000370131.3_Missense_Mutation_p.P245L	p.P245L	NM_001918.3	NP_001909.3	1	2	3	2.024724	P11182	ODB2_HUMAN		6	747	-		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	0	1	hg19	c.734C>T	CCDS767.1	0	.	.	.	.	.	.	.	.	.	.	g	3.697	-0.062301	0.07317	.	.	ENSG00000137992	ENST00000543138;ENST00000370132;ENST00000370131	T;T	0.34275	1.37;1.37	5.66	0.124	0.14714	5.66	0.124	0.14714	Chloramphenicol acetyltransferase-like domain (1);	0.712173	0.14328	N	0.326549	T	0.05227	0.0139	N	0.14661	0.345	0.19945	N	0.999947	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.40534	-0.9558	10	0.16420	T	0.52	1.0E-4	4.1964	0.10445	0.5271:0.0:0.3072:0.1657	.	64;245	F5H1F9;P11182	.;ODB2_HUMAN	L	64;245;245	ENSP00000359151:P245L;ENSP00000359150:P245L	ENSP00000359150:P245L	P	-	2	0	0	DBT	100454165	100454165	0.017000	0.18338	0.003000	0.11579	0.011000	0.07611	0.567000	0.23608	0.358000	0.24211	-0.150000	0.13652	CCG	0.111988		TCGA-IB-A5ST-01A-11D-A32N-08	0.388	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030101.2	0	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	2.040000	-2.005325	0	0.100000	NM_001918		0	5	5	0	643	631	0		1	0		0	0	110	0	0	0.934637	2.661515e-02	0	0	0	26	0	5	643
CSF1	1435	broad.mit.edu	37	1	110458293	110458293	+	Missense_Mutation	SNP	T	T	C	rs375736026		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:110458293T>C	ENST00000329608.6	+	3	591	c.200T>C	c.(199-201)tTt>tCt	p.F67S	CSF1_ENST00000526001.1_3'UTR|CSF1_ENST00000369801.1_Missense_Mutation_p.F67S|CSF1_ENST00000369802.3_Missense_Mutation_p.F67S|CSF1_ENST00000344188.5_Missense_Mutation_p.F67S|CSF1_ENST00000420111.2_Missense_Mutation_p.F67S	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	67					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAAATTACATTTGAGTTTGTA	0.502																																						ENST00000329608.6	1.000000	0.320000	1.000000	0.440000	0.610000	0.661407	0.610000	0.560000																										0				20						c.(199-201)tTt>tCt		colony stimulating factor 1 (macrophage)		T	SER/PHE,SER/PHE,SER/PHE,SER/PHE	1,4405	2.1+/-5.4	0,1,2202	180.0	157.0	164.0		200,200,200,200	3.0	0.1	1		164	0,8600		0,0,4300	no	missense,missense,missense,missense	CSF1	NM_000757.5,NM_172210.2,NM_172211.2,NM_172212.2	155,155,155,155	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	67/555,67/439,67/257,67/555	110458293	1,13005	2203	4300	6503	SO:0001583	missense	1435	1	121412	29				g.chr1:110458293T>C	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.200T>C	chr1.hg19:g.110458293T>C	ENSP00000327513:p.Phe67Ser	0					CSF1_ENST00000369802.3_Missense_Mutation_p.F67S|CSF1_ENST00000526001.1_3'UTR|CSF1_ENST00000344188.5_Missense_Mutation_p.F67S|CSF1_ENST00000369801.1_Missense_Mutation_p.F67S|CSF1_ENST00000420111.2_Missense_Mutation_p.F67S	p.F67S	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	1	2	3	2.013362	P09603	CSF1_HUMAN		3	591	+		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	1	1	hg19	c.200T>C	CCDS816.1	0	.	.	.	.	.	.	.	.	.	.	T	11.27	1.589665	0.28357	2.27E-4	0.0	ENSG00000184371	ENST00000527192;ENST00000525659;ENST00000357302;ENST00000344188;ENST00000329608;ENST00000488198;ENST00000369802;ENST00000420111;ENST00000369801	T;T;T;T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73	5.46	3.04	0.35103	5.46	3.04	0.35103	Four-helical cytokine-like, core (1);	0.227455	0.37304	N	0.002156	T	0.15955	0.0384	M	0.66939	2.045	0.09310	N	1	D;D;D	0.71674	0.998;0.997;0.992	D;P;P	0.64042	0.921;0.886;0.634	T	0.05321	-1.0892	10	0.87932	D	0	.	8.5803	0.33623	0.2814:0.0:0.0:0.7186	.	67;67;67	P09603-3;P09603;P09603-2	.;CSF1_HUMAN;.	S	74;26;67;67;67;26;67;67;67	ENSP00000434527:F74S;ENSP00000431547:F26S;ENSP00000349854:F67S;ENSP00000342718:F67S;ENSP00000327513:F67S;ENSP00000433837:F26S;ENSP00000358817:F67S;ENSP00000407317:F67S;ENSP00000358816:F67S	ENSP00000327513:F67S	F	+	2	0	0	CSF1	110259816	110259816	1.000000	0.71417	0.068000	0.19968	0.003000	0.03518	1.209000	0.32357	0.400000	0.25396	0.459000	0.35465	TTT	0.109352		TCGA-IB-A5ST-01A-11D-A32N-08	0.502	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	2.040000	-11.550550	1	0.100000	NM_000757		0	12	12	0	416	410	0		1	0		0	0	125	0	0	0.999065	5.038684e-01	0	1	0	56	0	12	416
NUP210L	91181	broad.mit.edu	37	1	154072575	154072575	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:154072575C>T	ENST00000368559.3	-	14	1935	c.1864G>A	c.(1864-1866)Gca>Aca	p.A622T	NUP210L_ENST00000271854.3_Missense_Mutation_p.A622T	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	622					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GATTTAGCTGCGATATGTGTA	0.443																																						ENST00000368559.3	1.000000	0.490000	1.000000	0.630000	0.820000	0.822380	0.820000	1.000000																										0				80						c.(1864-1866)Gca>Aca		nucleoporin 210kDa-like							187.0	175.0	178.0					1																	154072575		1937	4152	6089	SO:0001583	missense	91181	13	120854	43				g.chr1:154072575C>T	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1864G>A	chr1.hg19:g.154072575C>T	ENSP00000357547:p.Ala622Thr	0					NUP210L_ENST00000271854.3_Missense_Mutation_p.A622T	p.A622T	NM_207308.2	NP_997191.2	1	2	3	2.062082	Q5VU65	P210L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)	14	1935	-	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	1	1	hg19	c.1864G>A	CCDS41399.1	0	.	.	.	.	.	.	.	.	.	.	C	4.853	0.158628	0.09236	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.06218	3.6;3.33	5.15	2.21	0.28008	5.15	2.21	0.28008	.	0.453697	0.20603	N	0.089102	T	0.01156	0.0038	L	0.28274	0.84	0.09310	N	1	B;B	0.14438	0.01;0.004	B;B	0.08055	0.003;0.002	T	0.47873	-0.9083	10	0.10902	T	0.67	-12.1311	8.7224	0.34449	0.0:0.7554:0.0:0.2446	.	622;622	E7EP56;Q5VU65	.;P210L_HUMAN	T	622	ENSP00000357547:A622T;ENSP00000271854:A622T	ENSP00000271854:A622T	A	-	1	0	0	NUP210L	152339199	152339199	0.001000	0.12720	0.255000	0.24374	0.110000	0.19582	0.689000	0.25437	0.547000	0.28938	0.462000	0.41574	GCA	0.120235		TCGA-IB-A5ST-01A-11D-A32N-08	0.443	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	0	0	1	2	2	2	2	0	0	0	0	131	131	131	130	1	2.040000	-3.455460	1	0.100000	NM_207308		0	21	21	0	551	543	0		1		1	0	0	131	380	0	0.999997	0	9.998789e-01	0	15	0	364	21	551
PIGR	5284	broad.mit.edu	37	1	207105858	207105858	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:207105858G>A	ENST00000356495.4	-	8	2134	c.1951C>T	c.(1951-1953)Ctg>Ttg	p.L651L	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	651					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCCACTGCCAGCACCAGGCCC	0.637																																						ENST00000356495.4	1.000000	0.110000	1.000000	0.190000	0.320000	0.466625	0.320000	0.250000																										0				45						c.(1951-1953)Ctg>Ttg		polymeric immunoglobulin receptor							53.0	55.0	55.0					1																	207105858		2203	4300	6503	SO:0001819	synonymous_variant	5284	0	0					g.chr1:207105858G>A		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1951C>T	chr1.hg19:g.207105858G>A		0					PIGR_ENST00000487208.1_5'Flank	p.L651L	NM_002644.3	NP_002635.2	1	2	3	2.068204	P01833	PIGR_HUMAN		8	2134	-			Q68D81|Q8IZY7	Silent	SNP	ENST00000356495.4	0	1	hg19	c.1951C>T	CCDS1474.1	0																																																																																								0.121523		TCGA-IB-A5ST-01A-11D-A32N-08	0.637	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	105	1	2.040000	-4.879670	1	0.100000	NM_002644		0	5	5	0	401	393	0		1	0		0	0	108	0	0	0.934588	3.938701e-01	0	0	0	95	0	5	401
SNAP47	116841	broad.mit.edu	37	1	227947156	227947156	+	Missense_Mutation	SNP	G	G	A	rs183802543		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:227947156G>A	ENST00000366759.4	+	3	1507	c.1093G>A	c.(1093-1095)Gca>Aca	p.A365T	SNAP47_ENST00000366760.1_Missense_Mutation_p.A123T|SNAP47_ENST00000315781.5_Missense_Mutation_p.A365T	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	365					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.A365T(1)		endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						CTCTTCCCCCGCAGAGAAGAG	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		20427	0.0		0.001	False		,,,				2504	0.0					ENST00000366759.4	1.000000	0.070000	1.000000	0.120000	0.200000	0.384385	0.200000	0.160000																										1	Substitution - Missense(1)	p.A365T(1)	large_intestine(1)	17						c.(1093-1095)Gca>Aca		synaptosomal-associated protein, 47kDa		G	THR/ALA	0,4406		0,0,2203	115.0	118.0	117.0		1093	1.1	0.0	1		117	1,8599	1.2+/-3.3	0,1,4299	no	missense	SNAP47	NM_053052.3	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	365/465	227947156	1,13005	2203	4300	6503	SO:0001583	missense	116841	9	121412	45				g.chr1:227947156G>A	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.1093G>A	chr1.hg19:g.227947156G>A	ENSP00000355721:p.Ala365Thr	0					SNAP47_ENST00000315781.5_Missense_Mutation_p.A365T|SNAP47_ENST00000366760.1_Missense_Mutation_p.A123T	p.A365T	NM_053052.3	NP_444280.2	1	2	3	2.068204	Q5SQN1	SNP47_HUMAN		3	1507	+			B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	0	1	hg19	c.1093G>A	CCDS1562.1	0	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	5.504|5.504	0.277926|0.277926	0.10403|0.10403	0.0|0.0	1.16E-4|1.16E-4	ENSG00000143740|ENSG00000143740	ENST00000366760;ENST00000366759;ENST00000315781|ENST00000418653;ENST00000426344	T;T;T|.	0.45668|.	0.89;2.2;2.18|.	5.04|5.04	1.08|1.08	0.20341|0.20341	5.04|5.04	1.08|1.08	0.20341|0.20341	.|.	0.734758|.	0.13883|.	N|.	0.356219|.	T|T	0.45438|0.45438	0.1342|0.1342	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.33379|.	0.001;0.196;0.41;0.41;0.196|.	B;B;B;B;B|.	0.25140|.	0.005;0.008;0.058;0.049;0.011|.	T|T	0.35724|0.35724	-0.9777|-0.9777	10|5	0.14656|.	T|.	0.56|.	-15.4879|-15.4879	7.4981|7.4981	0.27500|0.27500	0.445:0.0:0.555:0.0|0.445:0.0:0.555:0.0	.|.	123;365;177;365;123|.	Q5SQN1-3;Q5SQN1;Q5TBZ4;Q5SQN1-2;Q5SQN1-4|.	.;SNP47_HUMAN;.;.;.|.	T|H	123;365;365|177;356	ENSP00000355722:A123T;ENSP00000355721:A365T;ENSP00000314157:A365T|.	ENSP00000314157:A365T|.	A|R	+|+	1|2	0|0	0|0	SNAP47|SNAP47	226013779|226013779	226013779|226013779	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.011000|0.011000	0.07611|0.07611	0.327000|0.327000	0.19663|0.19663	0.045000|0.045000	0.15804|0.15804	0.561000|0.561000	0.74099|0.74099	GCA|CGC	0.121523		TCGA-IB-A5ST-01A-11D-A32N-08	0.517	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	0	0	1	2	14	2	2	0	0	0	1	209	209	209	208	1	2.040000	-2.244694	0	0.100000	NM_053052		0	6	6	0	750	745	0		0	0		0	0	209	0	0	0.054446	2.213118e-01	0	0	0	95	0	6	750
CAPN9	10753	broad.mit.edu	37	1	230928629	230928629	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:230928629G>A	ENST00000271971.2	+	17	1938	c.1825G>A	c.(1825-1827)Ggc>Agc	p.G609S	RP11-99J16__A.2_ENST00000412344.1_RNA|RP11-99J16__A.2_ENST00000428480.1_RNA|RP11-99J16__A.2_ENST00000452640.1_RNA|CAPN9_ENST00000354537.1_Missense_Mutation_p.G583S|CAPN9_ENST00000366666.2_Missense_Mutation_p.G546S|CAPN9_ENST00000480004.1_3'UTR	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	609	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				TGACAAGTCCGGCACCATGTC	0.512																																						ENST00000271971.2	1.000000	0.530000	1.000000	0.650000	0.820000	0.826204	0.820000	1.000000																										0				25						c.(1825-1827)Ggc>Agc		calpain 9							156.0	157.0	156.0					1																	230928629		2203	4300	6503	SO:0001583	missense	10753	1	121412	35				g.chr1:230928629G>A	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1825G>A	chr1.hg19:g.230928629G>A	ENSP00000271971:p.Gly609Ser	0					CAPN9_ENST00000366666.2_Missense_Mutation_p.G546S|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Missense_Mutation_p.G583S|CAPN9_ENST00000480004.1_3'UTR|RP11-99J16__A.2_ENST00000428480.1_RNA|RP11-99J16__A.2_ENST00000452640.1_RNA	p.G609S	NM_006615.2	NP_006606.1	1	2	3	2.068204	O14815	CAN9_HUMAN		17	1938	+	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	1	1	hg19	c.1825G>A	CCDS1586.1	0	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649288	0.87958	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	D;D;D	0.85339	-1.97;-1.97;-1.97	5.49	4.57	0.56435	5.49	4.57	0.56435	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94138	0.8120	H	0.94886	3.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.95185	0.8303	10	0.66056	D	0.02	.	13.7944	0.63162	0.0746:0.0:0.9254:0.0	.	546;583;609	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	S	609;583;546	ENSP00000271971:G609S;ENSP00000346538:G583S;ENSP00000355626:G546S	ENSP00000271971:G609S	G	+	1	0	0	CAPN9	228995252	228995252	1.000000	0.71417	0.868000	0.34077	0.964000	0.63967	7.352000	0.79404	1.314000	0.45095	0.655000	0.94253	GGC	0.121523		TCGA-IB-A5ST-01A-11D-A32N-08	0.512	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	0	0	1	2	2	2	2	0	0	0	0	170	170	170	168	1	2.040000	-2.698337	1	0.100000	NM_006615		0	28	29	0	729	715	0		1	0		0	0	170	0	0	1.000000	3.586647e-02	0	0	0	8	0	28	729
PHACTR4	65979	broad.mit.edu	37	1	28792265	28792265	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:28792265C>T	ENST00000373839.3	+	5	602	c.341C>T	c.(340-342)gCc>gTc	p.A114V	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.A124V	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	114					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		ATAGGGAATGCCAGATCATCT	0.463																																						ENST00000373839.3	1.000000	0.100000	1.000000	0.170000	0.290000	0.414192	0.290000	0.230000																										0				32						c.(340-342)gCc>gTc		phosphatase and actin regulator 4							157.0	146.0	150.0					1																	28792265		1892	4123	6015	SO:0001583	missense	65979	0	0					g.chr1:28792265C>T	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.341C>T	chr1.hg19:g.28792265C>T	ENSP00000362945:p.Ala114Val	0					PHACTR4_ENST00000373836.3_Missense_Mutation_p.A124V|PHACTR4_ENST00000493669.1_3'UTR	p.A114V	NM_001048183.1	NP_001041648.1	1	2	3	2.024928	Q8IZ21	PHAR4_HUMAN		5	602	+		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	0	1	hg19	c.341C>T	CCDS41293.1	0	.	.	.	.	.	.	.	.	.	.	C	4.838	0.155841	0.09236	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.34275	1.37;1.37	5.03	4.1	0.47936	5.03	4.1	0.47936	.	1.184050	0.06004	N	0.648230	T	0.29423	0.0733	L	0.27053	0.805	0.09310	N	1	B;B;B	0.10296	0.003;0.002;0.003	B;B;B	0.09377	0.004;0.002;0.003	T	0.19582	-1.0301	10	0.30854	T	0.27	0.1306	10.8568	0.46804	0.0:0.9105:0.0:0.0895	.	124;114;98	Q8IZ21-2;Q8IZ21;Q8IZ21-3	.;PHAR4_HUMAN;.	V	114;124;113	ENSP00000362945:A114V;ENSP00000362942:A124V	ENSP00000362942:A124V	A	+	2	0	0	PHACTR4	28664852	28664852	0.004000	0.15560	0.013000	0.15412	0.029000	0.11900	1.972000	0.40540	1.315000	0.45114	0.655000	0.94253	GCC	0.111988		TCGA-IB-A5ST-01A-11D-A32N-08	0.463	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	0	0	1	2	2	2	2	0	0	0	0	92	92	92	90	1	2.040000	-2.522450	1	0.100000	NM_023923		0	5	5	0	423	420	0		1	0		0	0	92	0	0	0.936727	9.135986e-02	0	0	0	35	0	5	423
ABCA4	24	broad.mit.edu	37	1	94543309	94543309	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:94543309G>A	ENST00000370225.3	-	11	1577	c.1491C>T	c.(1489-1491)ttC>ttT	p.F497F	ABCA4_ENST00000535735.1_Silent_p.F497F	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	497					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCCTCCAGTCGAAGTTGGCCA	0.537																																						ENST00000370225.3	1.000000	0.350000	1.000000	0.460000	0.600000	0.658548	0.600000	0.560000																										0				147						c.(1489-1491)ttC>ttT		ATP-binding cassette, sub-family A (ABC1), member 4							164.0	156.0	159.0					1																	94543309		2203	4300	6503	SO:0001819	synonymous_variant	24	0	0					g.chr1:94543309G>A	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1491C>T	chr1.hg19:g.94543309G>A		0					ABCA4_ENST00000535735.1_Silent_p.F497F	p.F497F	NM_000350.2	NP_000341.2	1	2	3	2.024724	P78363	ABCA4_HUMAN		11	1577	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	1	1	hg19	c.1491C>T	CCDS747.1	0																																																																																								0.111988		TCGA-IB-A5ST-01A-11D-A32N-08	0.537	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	0	0	1	2	2	2	2	0	0	0	0	177	177	177	176	1	2.040000	-2.825295	1	0.100000	NM_000350		0	18	17	0	637	633	0		1			0	0	177	0	0	0.999981	0	0	0	0	0	0	18	637
OR2M5	127059	broad.mit.edu	37	1	248309150	248309150	+	Missense_Mutation	SNP	G	G	A	rs147580819		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr1:248309150G>A	ENST00000366476.1	+	1	701	c.701G>A	c.(700-702)cGt>cAt	p.R234H		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GGAGAGGGTCGTCGCAAAGCT	0.463													g|||	1	0.000199681	0.0	0.0	5008	,	,		21867	0.0		0.001	False		,,,				2504	0.0					ENST00000366476.1	1.000000	0.370000	1.000000	0.460000	0.580000	0.661018	0.580000	0.530000																										0				49						c.(700-702)cGt>cAt		olfactory receptor, family 2, subfamily M, member 5		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	259.0	244.0	249.0		701	1.3	0.0	1	dbSNP_134	249	0,8600		0,0,4300	no	missense	OR2M5	NM_001004690.1	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	234/313	248309150	1,13005	2203	4300	6503	SO:0001583	missense	127059	8	121412	45				g.chr1:248309150G>A		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.701G>A	chr1.hg19:g.248309150G>A	ENSP00000355432:p.Arg234His	0						p.R234H	NM_001004690.1	NP_001004690.1	1	2	3	2.068204	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)	1	701	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)			Missense_Mutation	SNP	ENST00000366476.1	1	1	hg19	c.701G>A	CCDS31105.1	0	.	.	.	.	.	.	.	.	.	.	g	9.703	1.154991	0.21371	2.27E-4	0.0	ENSG00000162727	ENST00000366476	T	0.00333	8.07	3.28	1.33	0.21861	3.28	1.33	0.21861	GPCR, rhodopsin-like superfamily (1);	1.008340	0.08001	N	0.988776	T	0.00412	0.0013	M	0.83483	2.645	0.09310	N	1	B	0.15473	0.013	B	0.12837	0.008	T	0.42189	-0.9466	10	0.72032	D	0.01	.	8.818	0.35007	0.1975:0.0:0.8025:0.0	.	234	A3KFT3	OR2M5_HUMAN	H	234	ENSP00000355432:R234H	ENSP00000355432:R234H	R	+	2	0	0	OR2M5	246375773	246375773	0.000000	0.05858	0.000000	0.03702	0.702000	0.40608	0.556000	0.23438	0.062000	0.16340	-0.326000	0.08463	CGT	0.121523		TCGA-IB-A5ST-01A-11D-A32N-08	0.463	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	0	0	1	2	21	2	2	1	1	1	1	166	166	166	165	1	2.040000	-2.540902	1	0.100000	NM_001004690		0	27	28	0	1002	996	0		1			1	0	166	0	0	0.841795	0	0	0	0	0	0	27	1002
SLC32A1	140679	broad.mit.edu	37	20	37356192	37356192	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr20:37356192G>A	ENST00000217420.1	+	2	751	c.488G>A	c.(487-489)gGc>gAc	p.G163D		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	163					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	TGCTACACCGGCAAGATCCTC	0.637																																						ENST00000217420.1	1.000000	0.100000	1.000000	0.180000	0.310000	0.439205	0.310000	0.240000																										0				38						c.(487-489)gGc>gAc		solute carrier family 32 (GABA vesicular transporter), member 1	Glycine(DB00145)						79.0	64.0	69.0					20																	37356192		2203	4300	6503	SO:0001583	missense	140679	0	0					g.chr20:37356192G>A	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.488G>A	chr20.hg19:g.37356192G>A	ENSP00000217420:p.Gly163Asp	0						p.G163D	NM_080552.2	NP_542119.1	1	2	3	2.034055	Q9H598	VIAAT_HUMAN		2	751	+		Myeloproliferative disorder(115;0.00878)	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	0	1	hg19	c.488G>A	CCDS13307.1	0	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208888	0.79240	.	.	ENSG00000101438	ENST00000217420	T	0.02345	4.33	4.43	4.43	0.53597	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	M	0.81112	2.525	0.80722	D	1	D	0.67145	0.996	D	0.72075	0.976	T	0.00406	-1.1759	10	0.51188	T	0.08	-22.1911	14.5807	0.68288	0.0:0.0:1.0:0.0	.	163	Q9H598	VIAAT_HUMAN	D	163	ENSP00000217420:G163D	ENSP00000217420:G163D	G	+	2	0	0	SLC32A1	36789606	36789606	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.631000	0.98424	2.317000	0.78254	0.563000	0.77884	GGC	0.114173		TCGA-IB-A5ST-01A-11D-A32N-08	0.637	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	0	0	1	2	14	2	2	1	1	1	1	108	108	108	107	1	2.040000	-2.798540	1	0.100000	NM_080552		0	5	5	0	405	392	0		0			1	0	108	0	0	0.025384	0	0	0	0	0	0	5	405
C2orf16	84226	broad.mit.edu	37	2	27804824	27804824	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr2:27804824G>C	ENST00000408964.2	+	1	5436	c.5385G>C	c.(5383-5385)gaG>gaC	p.E1795D	RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000355467.4_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000413371.2_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1795	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GTCCCTCTGAGAGAAGCCATC	0.547																																						ENST00000408964.2	0.850000	0.410000	0.740000	0.500000	0.610000	0.626812	0.610000	0.600000																										0				47						c.(5383-5385)gaG>gaC		chromosome 2 open reading frame 16							154.0	157.0	156.0					2																	27804824		1922	4129	6051	SO:0001583	missense	84226	0	0					g.chr2:27804824G>C	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.5385G>C	chr2.hg19:g.27804824G>C	ENSP00000386190:p.Glu1795Asp	0					ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000379717.1_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA	p.E1795D	NM_032266.3	NP_115642.3	0	0	0	1.971007	Q68DN1	CB016_HUMAN		1	5436	+	Acute lymphoblastic leukemia(172;0.155)		B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	1	1	hg19	c.5385G>C	CCDS42666.1	0	.	.	.	.	.	.	.	.	.	.	g	10.19	1.281825	0.23392	.	.	ENSG00000221843	ENST00000408964	T	0.05786	3.39	3.95	1.17	0.20885	3.95	1.17	0.20885	.	.	.	.	.	T	0.07369	0.0186	L	0.53249	1.67	0.09310	N	1	P	0.38300	0.626	B	0.36504	0.226	T	0.24297	-1.0164	9	0.52906	T	0.07	.	7.9068	0.29767	0.2806:0.0:0.7194:0.0	.	1795	Q68DN1	CB016_HUMAN	D	1795	ENSP00000386190:E1795D	ENSP00000386190:E1795D	E	+	3	2	2	C2orf16	27658328	27658328	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.437000	0.21543	0.251000	0.21505	0.407000	0.27541	GAG	0.082569		TCGA-IB-A5ST-01A-11D-A32N-08	0.547	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	0	0	1	2	2	2	2	0	0	0	0	186	186	186	184	1	2.040000	-2.589719	1	0.100000	NM_032266		0	27	27	0	836	812	0		1	0		0	0	186	0	0	1.000000	0	0	0	0	1	0	27	836
STK11IP	114790	broad.mit.edu	37	2	220479983	220479983	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr2:220479983C>T	ENST00000456909.1	+	24	3127	c.3037C>T	c.(3037-3039)Cag>Tag	p.Q1013*	STK11IP_ENST00000295641.10_Nonsense_Mutation_p.Q1024*			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	1024					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTCAGGGAGCAGCAGCCACT	0.647																																						ENST00000456909.1	1.000000	0.420000	1.000000	0.740000	0.990000	0.911306	0.990000	1.000000																										0				23						c.(3037-3039)Cag>Tag		serine/threonine kinase 11 interacting protein							16.0	19.0	18.0					2																	220479983		2089	4208	6297	SO:0001587	stop_gained	114790	0	0					g.chr2:220479983C>T	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.3037C>T	chr2.hg19:g.220479983C>T	ENSP00000389383:p.Gln1013*	0					STK11IP_ENST00000295641.10_Nonsense_Mutation_p.Q1024*	p.Q1013*			1	2	3	2.017676	Q8N1F8	S11IP_HUMAN		24	3127	+		Renal(207;0.0183)	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Nonsense_Mutation	SNP	ENST00000456909.1	0	1	hg19	c.3037C>T		1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116420	0.56505	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	.	.	.	4.53	4.53	0.55603	4.53	4.53	0.55603	.	0.160319	0.38959	N	0.001506	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-14.4814	12.6615	0.56815	0.0:1.0:0.0:0.0	.	.	.	.	X	1013;1024	.	ENSP00000295641:Q1024X	Q	+	1	0	0	STK11IP	220188227	220188227	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	1.799000	0.38824	2.363000	0.80096	0.561000	0.74099	CAG	0.110232		TCGA-IB-A5ST-01A-11D-A32N-08	0.647	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	0	0	0	2	2	2	2	0	0	0	0	25	25	25	24	1	2.040000	-8.735047	1	0.100000	NM_052902		0	4	1	0	69	68	0		0	0		0	0	25	0	0	0.878570	8.176645e-01	0	0	0	56	0	4	69
RBM15B	29890	broad.mit.edu	37	3	51430415	51430415	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr3:51430415C>T	ENST00000323686.4	+	1	1685	c.1585C>T	c.(1585-1587)Cgg>Tgg	p.R529W		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	529					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CGACCTGGTGCGGGACAGGAC	0.612																																						ENST00000323686.4	0.450000	0.080000	0.330000	0.140000	0.220000	0.243404	0.220000	0.200000																										0				12						c.(1585-1587)Cgg>Tgg		RNA binding motif protein 15B							44.0	49.0	48.0					3																	51430415		2203	4300	6503	SO:0001583	missense	29890	0	0					g.chr3:51430415C>T	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1585C>T	chr3.hg19:g.51430415C>T	ENSP00000313890:p.Arg529Trp	0						p.R529W	NM_013286.4	NP_037418.3	0	0	0	1.960797	Q8NDT2	RB15B_HUMAN		1	1685	+			A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	ENST00000323686.4	0	1	hg19	c.1585C>T	CCDS33764.1	0	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846050	0.51164	.	.	ENSG00000179837	ENST00000323686;ENST00000541145	T	0.18174	2.23	5.55	4.67	0.58626	5.55	4.67	0.58626	.	.	.	.	.	T	0.37348	0.1000	L	0.57536	1.79	0.50313	D	0.999868	D	0.89917	1.0	D	0.77004	0.989	T	0.14924	-1.0455	9	0.87932	D	0	-16.0835	13.3329	0.60500	0.4055:0.5945:0.0:0.0	.	529	Q8NDT2	RB15B_HUMAN	W	529;202	ENSP00000313890:R529W	ENSP00000313890:R529W	R	+	1	2	2	RBM15B	51405455	51405455	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	0.873000	0.28052	1.329000	0.45376	0.655000	0.94253	CGG	0.077869		TCGA-IB-A5ST-01A-11D-A32N-08	0.612	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	0	0	1	2	2	2	2	0	0	0	0	133	133	133	131	1	2.040000	-2.733920	1	0.100000	NM_013286		0	5	5	0	462	452	0		1	0		0	0	133	0	0	0.934243	5.208244e-01	0	0	0	145	0	5	462
SLC34A2	10568	broad.mit.edu	37	4	25674740	25674740	+	Silent	SNP	G	G	A	rs546457472		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr4:25674740G>A	ENST00000382051.3	+	10	1130	c.1080G>A	c.(1078-1080)ccG>ccA	p.P360P	SLC34A2_ENST00000503434.1_Silent_p.P359P|SLC34A2_ENST00000504570.1_Silent_p.P359P	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	360					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				TCCACCTCCCGGATCTTGCTG	0.512			T	ROS1	NSCLC								G|||	1	0.000199681	0.0008	0.0	5008	,	,		20622	0.0		0.0	False		,,,				2504	0.0					ENST00000382051.3	1.000000	0.390000	1.000000	0.510000	0.670000	0.709165	0.670000	0.620000				Dom	yes			Dom	yes		4	4p15.2	4p15.2	10568	T	"""solute carrier family 34 (sodium phosphate), member 2"""				E	E	ROS1		NSCLC	SLC34A2/ROS1(14)	0				41						c.(1078-1080)ccG>ccA		solute carrier family 34 (type II sodium/phosphate contransporter), member 2							204.0	181.0	189.0					4																	25674740		2203	4300	6503	SO:0001819	synonymous_variant	10568	5	121412	41				g.chr4:25674740G>A	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1080G>A	chr4.hg19:g.25674740G>A		0					SLC34A2_ENST00000503434.1_Silent_p.P359P|SLC34A2_ENST00000504570.1_Silent_p.P359P	p.P360P	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	1	2	3	2.016602	O95436	NPT2B_HUMAN		10	1130	+		Breast(46;0.0503)	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	ENST00000382051.3	1	1	hg19	c.1080G>A	CCDS3435.1	0																																																																																								0.110232		TCGA-IB-A5ST-01A-11D-A32N-08	0.512	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	0	0	1	2	2	2	2	0	0	0	0	144	144	144	143	1	2.040000	-2.514101	1	0.100000	NM_006424		0	18	19	0	562	556	0		1			0	0	144	0	0	0.999981	0	0	0	0	0	0	18	562
H2AFZ	3015	broad.mit.edu	37	4	100870830	100870830	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr4:100870830G>A	ENST00000296417.5	-	2	288	c.71C>T	c.(70-72)gCc>gTc	p.A24V	DNAJB14_ENST00000442697.2_5'Flank|RP11-15B17.1_ENST00000507494.1_RNA|H2AFZ_ENST00000529158.1_5'UTR|RP11-15B17.1_ENST00000514624.1_RNA|RP11-15B17.1_ENST00000501976.2_RNA	NM_002106.3	NP_002097.1	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z	24					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular vesicular exosome (GO:0070062)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|endometrium(3)|lung(1)	5				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		CTGCAAGCCGGCTCTCTGCGA	0.567																																						ENST00000296417.5	1.000000	0.070000	0.310000	0.110000	0.180000	0.276290	0.180000	0.160000																										0				5						c.(70-72)gCc>gTc		H2A histone family, member Z							80.0	89.0	86.0					4																	100870830		2203	4300	6503	SO:0001583	missense	3015	0	0					g.chr4:100870830G>A	X52317	CCDS3654.1	4q23	2011-01-27			ENSG00000164032	ENSG00000164032		"""Histones / Replication-independent"""	4741	protein-coding gene	gene with protein product		142763		H2AZ		1697587	Standard	XM_005262971		Approved	H2A.Z	uc003hvo.1	P0C0S5	OTTHUMG00000131048	ENST00000296417.5:c.71C>T	chr4.hg19:g.100870830G>A	ENSP00000296417:p.Ala24Val	0					RP11-15B17.1_ENST00000507494.1_RNA|DNAJB14_ENST00000442697.2_5'Flank|H2AFZ_ENST00000529158.1_5'UTR|RP11-15B17.1_ENST00000514624.1_RNA|RP11-15B17.1_ENST00000501976.2_RNA	p.A24V	NM_002106.3	NP_002097.1	1	2	3	1.998437	P0C0S5	H2AZ_HUMAN		2	288	-			B2RD56|P17317|Q6I9U0	Missense_Mutation	SNP	ENST00000296417.5	0	1	hg19	c.71C>T	CCDS3654.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.224399	0.95139	.	.	ENSG00000164032	ENST00000296417	D	0.87256	-2.23	3.33	3.33	0.38152	3.33	3.33	0.38152	Histone-fold (2);Histone core (1);Histone H2A (3);	0.103484	0.64402	N	0.000003	D	0.96056	0.8715	H	0.99435	4.565	0.80722	D	1	D	0.69078	0.997	D	0.64144	0.922	D	0.97952	1.0332	10	0.87932	D	0	-4.0732	14.8277	0.70125	0.0:0.0:1.0:0.0	.	24	P0C0S5	H2AZ_HUMAN	V	24	ENSP00000296417:A24V	ENSP00000296417:A24V	A	-	2	0	0	H2AFZ	101089853	101089853	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.355000	0.90083	1.697000	0.51169	0.455000	0.32223	GCC	0.106256		TCGA-IB-A5ST-01A-11D-A32N-08	0.567	H2AFZ-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000253695.1	0	0	1	2	2	2	2	0	0	0	0	173	173	173	172	1	2.040000	-2.035847	0	0.100000	NM_002106		0	6	6	0	744	733	0		1	1		0	0	173	0	0	0.963424	9.839036e-01	0	2	0	943	0	6	744
SLCO4C1	353189	broad.mit.edu	37	5	101576467	101576467	+	Missense_Mutation	SNP	G	G	A	rs374536178		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:101576467G>A	ENST00000310954.6	-	11	2117	c.1831C>T	c.(1831-1833)Cgg>Tgg	p.R611W		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		GCTAGGGACCGTTGTCTGTGA	0.338																																						ENST00000310954.6	0.570000	0.180000	0.460000	0.250000	0.340000	0.364837	0.340000	0.330000																										0				50						c.(1831-1833)Cgg>Tgg		solute carrier organic anion transporter family, member 4C1		G	TRP/ARG	0,4406		0,0,2203	131.0	140.0	137.0		1831	6.0	0.3	5		137	1,8595	1.2+/-3.3	0,1,4297	no	missense	SLCO4C1	NM_180991.4	101	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	611/725	101576467	1,13001	2203	4298	6501	SO:0001583	missense	353189	7	121402	42				g.chr5:101576467G>A	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1831C>T	chr5.hg19:g.101576467G>A	ENSP00000309741:p.Arg611Trp	0						p.R611W	NM_180991.4	NP_851322.3	0	1	1	1.992074				11	2117	-		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Missense_Mutation	SNP	ENST00000310954.6	0	1	hg19	c.1831C>T	CCDS34205.1	0	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261188	0.59431	0.0	1.16E-4	ENSG00000173930	ENST00000310954	T	0.50548	0.74	5.96	5.96	0.96718	5.96	5.96	0.96718	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000013	T	0.76026	0.3930	M	0.93898	3.47	0.32241	N	0.57269	D	0.89917	1.0	D	0.91635	0.999	D	0.84319	0.0515	10	0.87932	D	0	.	13.8945	0.63764	0.0:0.0:0.8477:0.1523	.	611	Q6ZQN7	SO4C1_HUMAN	W	611	ENSP00000309741:R611W	ENSP00000309741:R611W	R	-	1	2	2	SLCO4C1	101604366	101604366	0.980000	0.34600	0.263000	0.24496	0.635000	0.38103	3.947000	0.56652	2.832000	0.97577	0.655000	0.94253	CGG	0.093199		TCGA-IB-A5ST-01A-11D-A32N-08	0.338	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	0	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	2.040000	-2.353780	0	0.100000	NM_180991		0	11	10	0	630	626	0		1			0	0	57	0	0	0.998261	0	0	0	0	0	0	11	630
LVRN	206338	broad.mit.edu	37	5	115351411	115351411	+	Missense_Mutation	SNP	G	G	A	rs186045980		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:115351411G>A	ENST00000357872.4	+	18	2829	c.2705G>A	c.(2704-2706)cGg>cAg	p.R902Q	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		902						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										GAAGTTGGCCGGTATGTCGCA	0.408																																						ENST00000357872.4	0.830000	0.130000	0.600000	0.240000	0.390000	0.428331	0.390000	0.360000																										0										c.(2704-2706)cGg>cAg				G	GLN/ARG	1,4403	2.1+/-5.4	0,1,2201	78.0	77.0	78.0		2705	0.7	0.0	5		78	3,8597	3.0+/-9.4	0,3,4297	yes	missense	AQPEP	NM_173800.4	43	0,4,6498	AA,AG,GG		0.0349,0.0227,0.0308	possibly-damaging	902/991	115351411	4,13000	2202	4300	6502	SO:0001583	missense	0	16	121412	42				g.chr5:115351411G>A																												ENST00000357872.4:c.2705G>A	chr5.hg19:g.115351411G>A	ENSP00000350541:p.Arg902Gln	0					AQPEP_ENST00000515454.1_3'UTR	p.R902Q	NM_173800.4	NP_776161.3	0	1	1	1.992074	Q6Q4G3	AMPQ_HUMAN		18	2829	+			A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	0	1	hg19	c.2705G>A	CCDS4124.1	0	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896123	0.33442	2.27E-4	3.49E-4	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.07908	3.15	5.6	0.743	0.18347	5.6	0.743	0.18347	.	0.296928	0.24198	N	0.040657	T	0.05318	0.0141	N	0.17594	0.5	0.09310	N	1	D	0.61697	0.99	P	0.51550	0.673	T	0.19192	-1.0313	10	0.05833	T	0.94	.	4.4203	0.11477	0.3159:0.0:0.5388:0.1453	.	902	Q6Q4G3	AMPQ_HUMAN	Q	902;891	ENSP00000350541:R902Q	ENSP00000350541:R902Q	R	+	2	0	0	AC010282.1	115379310	115379310	0.005000	0.15991	0.032000	0.17829	0.747000	0.42532	0.827000	0.27421	-0.148000	0.11234	-0.471000	0.05019	CGG	0.093199		TCGA-IB-A5ST-01A-11D-A32N-08	0.408	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1	0	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	2.040000	-2.772747	1	0.100000			0	4	4	0	215	213	0		1	0		0	0	42	0	0	0.889005	0	0	0	0	1	0	4	215
TAS2R1	50834	broad.mit.edu	37	5	9629467	9629467	+	Silent	SNP	C	C	T	rs140696180	byFrequency	TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:9629467C>T	ENST00000382492.2	-	1	996	c.678G>A	c.(676-678)gcG>gcA	p.A226A	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	226					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						TAGACAGCAACGCGCTGATGG	0.498																																						ENST00000382492.2	1.000000	0.260000	1.000000	0.400000	0.600000	0.646273	0.600000	1.000000																										0				39						c.(676-678)gcG>gcA		taste receptor, type 2, member 1		C		0,4406		0,0,2203	67.0	75.0	72.0		678	-11.1	0.0	5	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TAS2R1	NM_019599.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		226/300	9629467	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	50834	6	121412	40				g.chr5:9629467C>T	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.678G>A	chr5.hg19:g.9629467C>T		0					CTD-2001E22.1_ENST00000504182.2_RNA	p.A226A	NM_019599.2	NP_062545.1	1	2	3	2.018291	Q9NYW7	TA2R1_HUMAN		1	996	-			Q646G8	Silent	SNP	ENST00000382492.2	0	1	hg19	c.678G>A	CCDS3876.1	0																																																																																								0.110672		TCGA-IB-A5ST-01A-11D-A32N-08	0.498	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2	0	0	0	2	2	2	2	0	0	0	0	44	44	44	42	1	2.040000	-8.646002	1	0.100000			0	8	8	0	299	297	0		1			0	0	44	0	0	0.989332	0	0	0	0	0	0	8	299
ANKRD55	79722	broad.mit.edu	37	5	55472007	55472007	+	Missense_Mutation	SNP	C	C	T	rs201977310		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:55472007C>T	ENST00000341048.4	-	4	435	c.284G>A	c.(283-285)cGc>cAc	p.R95H	ANKRD55_ENST00000513241.2_Missense_Mutation_p.R66H|ANKRD55_ENST00000504958.2_Missense_Mutation_p.R95H	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	95										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TAAACTTGTGCGGCCATAAGC	0.542																																						ENST00000341048.4	1.000000	0.070000	1.000000	0.120000	0.210000	0.343860	0.210000	0.180000																										0				34						c.(283-285)cGc>cAc		ankyrin repeat domain 55							161.0	136.0	144.0					5																	55472007		2203	4300	6503	SO:0001583	missense	79722	14	121412	46				g.chr5:55472007C>T	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.284G>A	chr5.hg19:g.55472007C>T	ENSP00000342295:p.Arg95His	0					ANKRD55_ENST00000504958.2_Missense_Mutation_p.R95H|ANKRD55_ENST00000513241.2_Missense_Mutation_p.R66H	p.R95H	NM_024669.2	NP_078945.2	1	2	3	2.018291	Q3KP44	ANR55_HUMAN		4	435	-		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	0	1	hg19	c.284G>A	CCDS34161.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.426908	0.96131	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000513241;ENST00000519586	T;T;T	0.66460	-0.21;-0.21;-0.21	5.31	5.31	0.75309	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.77837	0.4190	L	0.47190	1.495	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	T	0.76607	-0.2897	10	0.41790	T	0.15	.	18.5715	0.91137	0.0:1.0:0.0:0.0	.	95	B3KVT8	.	H	95;95;95;66;95	ENSP00000342295:R95H;ENSP00000424230:R95H;ENSP00000423507:R66H	ENSP00000342295:R95H	R	-	2	0	0	ANKRD55	55507764	55507764	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	6.485000	0.73625	2.462000	0.83206	0.563000	0.77884	CGC	0.110672		TCGA-IB-A5ST-01A-11D-A32N-08	0.542	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	0	0	1	2	17	2	2	1	1	1	1	124	124	124	122	1	2.040000	-1.684063	0	0.100000	NM_024669		0	5	5	0	576	570	0		0			1	0	124	0	0	0.007354	0	0	0	0	0	0	5	576
OTP	23440	broad.mit.edu	37	5	76932865	76932865	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:76932865G>A	ENST00000306422.3	-	2	1366	c.228C>T	c.(226-228)agC>agT	p.S76S	OTP_ENST00000515716.1_5'Flank	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	76					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		GGTCTTTGGCGCTCACCGCCA	0.711																																						ENST00000306422.3	1.000000	0.280000	0.820000	0.420000	0.600000	0.622886	0.600000	1.000000																										0				13						c.(226-228)agC>agT		orthopedia homeobox							29.0	35.0	33.0					5																	76932865		2201	4296	6497	SO:0001819	synonymous_variant	23440	0	0					g.chr5:76932865G>A		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.228C>T	chr5.hg19:g.76932865G>A		0					OTP_ENST00000515716.1_5'Flank	p.S76S	NM_032109.2	NP_115485.1	0	1	1	1.992074	Q5XKR4	OTP_HUMAN		2	1366	-		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		Silent	SNP	ENST00000306422.3	1	1	hg19	c.228C>T	CCDS4039.1	0																																																																																								0.093199		TCGA-IB-A5ST-01A-11D-A32N-08	0.711	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2	0	0	1	2	2	2	2	0	0	0	0	88	88	88	86	1	2.040000	-9.014540	1	0.100000			0	8	9	0	264	256	0		1			0	0	88	0	0	0.988500	0	0	0	0	0	0	8	264
ANKRD34B	340120	broad.mit.edu	37	5	79855633	79855633	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:79855633T>C	ENST00000338682.3	-	5	878	c.206A>G	c.(205-207)tAc>tGc	p.Y69C		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	69						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CTCTAACAGGTATTTCACCAT	0.448																																						ENST00000338682.3	0.740000	0.310000	0.630000	0.400000	0.500000	0.522447	0.500000	0.500000																										0				28						c.(205-207)tAc>tGc		ankyrin repeat domain 34B							160.0	161.0	160.0					5																	79855633		2203	4300	6503	SO:0001583	missense	340120	0	0					g.chr5:79855633T>C		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.206A>G	chr5.hg19:g.79855633T>C	ENSP00000339802:p.Tyr69Cys	0						p.Y69C	NM_001004441.2	NP_001004441.2	0	1	1	1.992074	A5PLL1	AN34B_HUMAN		5	878	-		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)	B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	1	1	hg19	c.206A>G	CCDS34194.1	0	.	.	.	.	.	.	.	.	.	.	T	20.9	4.063229	0.76187	.	.	ENSG00000189127	ENST00000338682	T	0.65916	-0.18	5.78	5.78	0.91487	5.78	5.78	0.91487	Ankyrin repeat-containing domain (4);	0.081459	0.50627	U	0.000101	T	0.72382	0.3453	L	0.41027	1.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74948	-0.3490	10	0.72032	D	0.01	-14.1729	14.9417	0.70997	0.0:0.0:0.0:1.0	.	69	A5PLL1	AN34B_HUMAN	C	69	ENSP00000339802:Y69C	ENSP00000339802:Y69C	Y	-	2	0	0	ANKRD34B	79891389	79891389	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	7.900000	0.87376	2.201000	0.70794	0.459000	0.35465	TAC	0.093199		TCGA-IB-A5ST-01A-11D-A32N-08	0.448	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	0	0	1	2	16	2	2	1	1	1	1	175	175	175	175	1	2.040000	-3.099789	1	0.100000	NM_001004441		0	20	19	0	766	758	0		1			1	0	175	0	0	0.789149	0	0	0	0	0	0	20	766
DIAPH1	1729	broad.mit.edu	37	5	140908384	140908384	+	Missense_Mutation	SNP	C	C	T	rs373654027		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr5:140908384C>T	ENST00000398557.4	-	22	3043	c.2903G>A	c.(2902-2904)cGt>cAt	p.R968H	DIAPH1_ENST00000398562.2_Missense_Mutation_p.R944H|DIAPH1_ENST00000389054.3_Missense_Mutation_p.R965H|DIAPH1_ENST00000494967.1_5'UTR|DIAPH1_ENST00000520569.1_Missense_Mutation_p.R911H|DIAPH1_ENST00000518047.1_Missense_Mutation_p.R956H|DIAPH1_ENST00000389057.5_Missense_Mutation_p.R959H|DIAPH1_ENST00000253811.6_Missense_Mutation_p.R969H|DIAPH1_ENST00000398566.3_Missense_Mutation_p.R960H	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	968	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCACTCTTACGTAACTCCTC	0.448																																						ENST00000398557.4	0.670000	0.120000	0.500000	0.210000	0.330000	0.362977	0.330000	0.300000																										0				23						c.(2902-2904)cGt>cAt		diaphanous-related formin 1							90.0	85.0	87.0					5																	140908384		2040	4206	6246	SO:0001583	missense	1729	2	121004	33				g.chr5:140908384C>T	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.2903G>A	chr5.hg19:g.140908384C>T	ENSP00000381565:p.Arg968His	0					DIAPH1_ENST00000494967.1_5'UTR|DIAPH1_ENST00000389057.5_Missense_Mutation_p.R959H|DIAPH1_ENST00000520569.1_Missense_Mutation_p.R911H|DIAPH1_ENST00000389054.3_Missense_Mutation_p.R965H|DIAPH1_ENST00000398562.2_Missense_Mutation_p.R944H|DIAPH1_ENST00000253811.6_Missense_Mutation_p.R969H|DIAPH1_ENST00000518047.1_Missense_Mutation_p.R956H|DIAPH1_ENST00000398566.3_Missense_Mutation_p.R960H	p.R968H	NM_005219.4	NP_005210.3	0	1	1	1.992074	O60610	DIAP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	22	3043	-			A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	0	1	hg19	c.2903G>A	CCDS43374.1	0	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859456	0.32884	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	T;T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.27	4.4	0.53042	5.27	4.4	0.53042	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.224000	0.36815	N	0.002392	T	0.21550	0.0519	M	0.66439	2.03	0.53688	D	0.999978	B;B;B	0.28971	0.229;0.145;0.145	B;B;B	0.18561	0.022;0.022;0.022	T	0.04440	-1.0951	10	0.87932	D	0	.	9.2173	0.37355	0.0:0.8317:0.0:0.1683	.	911;959;968	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	H	965;911;944;959;960;968;969;956	ENSP00000373706:R965H;ENSP00000429282:R911H;ENSP00000381570:R944H;ENSP00000373709:R959H;ENSP00000381572:R960H;ENSP00000381565:R968H;ENSP00000253811:R969H;ENSP00000428268:R956H	ENSP00000253811:R969H	R	-	2	0	0	DIAPH1	140888568	140888568	0.432000	0.25554	0.794000	0.32065	0.295000	0.27426	1.344000	0.33941	1.209000	0.43321	-0.259000	0.10710	CGT	0.093199		TCGA-IB-A5ST-01A-11D-A32N-08	0.448	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	2.040000	-3.055023	1	0.100000	NM_005219		0	5	5	0	311	310	1		1	1		0	0	68	0	0	0.937503	7.398675e-01	0	20	0	139	0	5	311
MAP7	9053	broad.mit.edu	37	6	136742933	136742933	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr6:136742933G>A	ENST00000354570.3	-	2	482	c.72C>T	c.(70-72)ccC>ccT	p.P24P	MAP7_ENST00000454590.1_Silent_p.P46P|MAP7_ENST00000544465.1_Silent_p.P9P|MAP7_ENST00000432797.2_5'UTR|MAP7_ENST00000438100.2_Silent_p.P46P	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	24					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		TGTAGCTGTCGGGTGCTACAG	0.373																																						ENST00000354570.3	1.000000	0.140000	1.000000	0.230000	0.360000	0.461445	0.360000	0.310000																										0				33						c.(70-72)ccC>ccT		microtubule-associated protein 7							101.0	99.0	100.0					6																	136742933		2203	4300	6503	SO:0001819	synonymous_variant	9053	0	0					g.chr6:136742933G>A	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.72C>T	chr6.hg19:g.136742933G>A		0					MAP7_ENST00000432797.2_5'UTR|MAP7_ENST00000454590.1_Silent_p.P46P|MAP7_ENST00000438100.2_Silent_p.P46P|MAP7_ENST00000544465.1_Silent_p.P9P	p.P24P	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	1	2	3	2.016431	Q14244	MAP7_HUMAN		2	482	-	Colorectal(23;0.24)		B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Silent	SNP	ENST00000354570.3	0	1	hg19	c.72C>T	CCDS5178.1	0																																																																																								0.110232		TCGA-IB-A5ST-01A-11D-A32N-08	0.373	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	0	0	1	2	16	3	2	1	1	1	1	86	86	86	85	1	2.040000	-2.334696	0	0.100000	NM_003980		0	6	6	0	386	381	0		0	0		1	0	86	0	0	0.022908	7.789148e-03	0	0	0	21	0	6	386
TNXB	7148	broad.mit.edu	37	6	32064921	32064921	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr6:32064921C>T	ENST00000479795.1	-	3	849	c.709G>A	c.(709-711)Gca>Aca	p.A237T	TNXB_ENST00000375244.3_Missense_Mutation_p.A237T|TNXB_ENST00000375247.2_Missense_Mutation_p.A237T			P22105	TENX_HUMAN	tenascin XB	237	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAGAAGCCTGCCCGGCACACA	0.701																																						ENST00000479795.1	1.000000	0.320000	1.000000	0.560000	0.900000	0.819564	0.900000	1.000000																										0				8						c.(709-711)Gca>Aca		tenascin XB							20.0	24.0	23.0					6																	32064921		2145	4231	6376	SO:0001583	missense	7148	1	120824	20				g.chr6:32064921C>T	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.709G>A	chr6.hg19:g.32064921C>T	ENSP00000418248:p.Ala237Thr	0					TNXB_ENST00000375247.2_Missense_Mutation_p.A237T|TNXB_ENST00000375244.3_Missense_Mutation_p.A237T	p.A237T			0	1	1	1.992253	P22105	TENX_HUMAN		3	849	-			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000479795.1	0	1	hg19	c.709G>A		1	.	.	.	.	.	.	.	.	.	.	C	0.442	-0.898065	0.02472	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;T	0.11277	3.88;3.88;2.79	4.22	0.161	0.14977	4.22	0.161	0.14977	.	0.689881	0.12572	N	0.457242	T	0.02047	0.0064	L	0.31294	0.92	0.09310	N	1	B	0.28419	0.211	B	0.26094	0.066	T	0.44528	-0.9322	10	0.44086	T	0.13	.	4.2281	0.10590	0.154:0.3014:0.452:0.0926	.	237	P22105-3	.	T	237	ENSP00000364393:A237T;ENSP00000364396:A237T;ENSP00000418248:A237T	ENSP00000364393:A237T	A	-	1	0	0	TNXB	32172899	32172899	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-0.163000	0.09997	-0.190000	0.10465	0.655000	0.94253	GCA	0.093656		TCGA-IB-A5ST-01A-11D-A32N-08	0.701	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	0	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	2.040000	-3.381323	1	0.100000	NM_019105		0	4	4	0	85	84	0		1	0		0	0	16	0	0	0.889324	9.135970e-02	0	0	0	9	0	4	85
LGSN	51557	broad.mit.edu	37	6	63990012	63990012	+	Nonsense_Mutation	SNP	G	G	A	rs371133744		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr6:63990012G>A	ENST00000370657.4	-	4	1477	c.1444C>T	c.(1444-1446)Cga>Tga	p.R482*	LGSN_ENST00000370658.5_3'UTR			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	482					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						ACAAAATATCGAATAAAGGTT	0.378																																						ENST00000370657.4	1.000000	0.320000	1.000000	0.450000	0.640000	0.679925	0.640000	1.000000																										0				34						c.(1444-1446)Cga>Tga		lengsin, lens protein with glutamine synthetase domain							74.0	78.0	76.0					6																	63990012		2203	4300	6503	SO:0001587	stop_gained	51557	3	121412	40				g.chr6:63990012G>A	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.1444C>T	chr6.hg19:g.63990012G>A	ENSP00000359691:p.Arg482*	0					LGSN_ENST00000370658.5_3'UTR	p.R482*			1	2	3	2.016431	Q5TDP6	LGSN_HUMAN		4	1477	-			A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Nonsense_Mutation	SNP	ENST00000370657.4	0	1	hg19	c.1444C>T	CCDS4964.1	0	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373680	0.61624	.	.	ENSG00000146166	ENST00000370657	.	.	.	5.7	3.86	0.44501	5.7	3.86	0.44501	.	0.362303	0.32884	N	0.005523	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-5.5437	14.1084	0.65107	0.0:0.0:0.6109:0.3891	.	.	.	.	X	482	.	ENSP00000359691:R482X	R	-	1	2	2	LGSN	64047971	64047971	1.000000	0.71417	0.856000	0.33681	0.358000	0.29455	4.385000	0.59613	0.703000	0.31848	0.655000	0.94253	CGA	0.110232		TCGA-IB-A5ST-01A-11D-A32N-08	0.378	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	2.040000	-2.908631	1	0.100000	NM_016571		0	11	11	0	372	368	0		1			0	0	69	0	0	0.998292	0	0	0	0	0	0	11	372
ARID1B	57492	broad.mit.edu	37	6	157528497	157528497	+	Silent	SNP	G	G	A	rs373301793		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr6:157528497G>A	ENST00000350026.5	+	19	6184	c.6183G>A	c.(6181-6183)tcG>tcA	p.S2061S	ARID1B_ENST00000275248.4_Silent_p.S2056S|ARID1B_ENST00000367148.1_Silent_p.S2114S|ARID1B_ENST00000346085.5_Silent_p.S2074S	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2061					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GACCCAACTCGGTCCTGTCGC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		21077	0.0		0.0	False		,,,				2504	0.001					ENST00000350026.5	1.000000	0.570000	1.000000	0.680000	0.810000	0.825805	0.810000	1.000000																										0				81						c.(6181-6183)tcG>tcA		AT rich interactive domain 1B (SWI1-like)							188.0	194.0	192.0					6																	157528497		2203	4296	6499	SO:0001819	synonymous_variant	57492	5	121412	42				g.chr6:157528497G>A	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6183G>A	chr6.hg19:g.157528497G>A		0					ARID1B_ENST00000275248.4_Silent_p.S2056S|ARID1B_ENST00000367148.1_Silent_p.S2114S|ARID1B_ENST00000346085.5_Silent_p.S2074S	p.S2061S	NM_017519.2	NP_059989.2	1	2	3	2.016431	Q8NFD5	ARI1B_HUMAN		19	6184	+		Breast(66;0.000162)|Ovarian(120;0.0265)	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	1	1	hg19	c.6183G>A	CCDS5251.2	0																																																																																								0.110232		TCGA-IB-A5ST-01A-11D-A32N-08	0.532	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	0	0	1	2	2	2	2	0	0	0	0	282	282	282	276	1	2.040000	-2.479587	0	0.100000	NM_020732		0	40	39	0	995	980	1		1	1		0	0	282	0	0	1.000000	8.928402e-01	0	15	0	83	0	40	995
HECW1	23072	broad.mit.edu	37	7	43484703	43484703	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr7:43484703G>A	ENST00000395891.2	+	11	2537	c.1932G>A	c.(1930-1932)gcG>gcA	p.A644A	HECW1_ENST00000453890.1_Silent_p.A644A	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	644					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CCAATGGCGCGGCCCAGGATG	0.711																																						ENST00000395891.2	1.000000	0.330000	1.000000	0.530000	0.820000	0.787144	0.820000	1.000000																										0				125						c.(1930-1932)gcG>gcA		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1							12.0	17.0	16.0					7																	43484703		2094	4189	6283	SO:0001819	synonymous_variant	23072	0	0					g.chr7:43484703G>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1932G>A	chr7.hg19:g.43484703G>A		0					HECW1_ENST00000453890.1_Silent_p.A644A	p.A644A	NM_015052.3	NP_055867.3	1	2	3	2.008968	Q76N89	HECW1_HUMAN		11	2537	+			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	1	1	hg19	c.1932G>A	CCDS5469.2	0																																																																																								0.108470		TCGA-IB-A5ST-01A-11D-A32N-08	0.711	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	0	0	1	2	2	2	2	0	0	0	0	37	37	37	34	1	2.040000	-8.782163	1	0.100000	NM_015052		0	6	6	0	160	159	0		1			0	0	37	0	0	0.965187	0	0	0	0	0	0	6	160
ANK1	286	broad.mit.edu	37	8	41519413	41519413	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr8:41519413G>A	ENST00000347528.4	-	41	5608	c.5525C>T	c.(5524-5526)gCc>gTc	p.A1842V	RP11-930P14.1_ENST00000520418.1_RNA|ANK1_ENST00000522543.1_Missense_Mutation_p.A117V|ANK1_ENST00000379758.2_Intron|MIR486_ENST00000408108.1_RNA|ANK1_ENST00000289734.7_Missense_Mutation_p.A1842V|RP11-930P14.1_ENST00000522388.1_RNA|ANK1_ENST00000522231.1_Missense_Mutation_p.A117V|ANK1_ENST00000265709.8_Missense_Mutation_p.A1883V|ANK1_ENST00000352337.4_Intron|ANK1_ENST00000314214.8_Missense_Mutation_p.A117V|ANK1_ENST00000457297.1_Intron|ANK1_ENST00000396942.1_Missense_Mutation_p.A1842V|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000396945.1_Intron	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1842	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTCCTGGGCGGCATCGGCGCT	0.572																																						ENST00000347528.4	1.000000	0.130000	0.650000	0.210000	0.340000	0.432034	0.340000	0.290000																										0				122						c.(5524-5526)gCc>gTc		ankyrin 1, erythrocytic							50.0	55.0	53.0					8																	41519413		2203	4300	6503	SO:0001583	missense	286	0	0					g.chr8:41519413G>A	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5525C>T	chr8.hg19:g.41519413G>A	ENSP00000339620:p.Ala1842Val	0					ANK1_ENST00000396945.1_Intron|ANK1_ENST00000289734.7_Missense_Mutation_p.A1842V|ANK1_ENST00000457297.1_Intron|RP11-930P14.1_ENST00000522388.1_RNA|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000396942.1_Missense_Mutation_p.A1842V|ANK1_ENST00000522543.1_Missense_Mutation_p.A117V|MIR486_ENST00000408108.1_RNA|ANK1_ENST00000379758.2_Intron|RP11-930P14.1_ENST00000520418.1_RNA|ANK1_ENST00000352337.4_Intron|ANK1_ENST00000522231.1_Missense_Mutation_p.A117V|ANK1_ENST00000314214.8_Missense_Mutation_p.A117V|ANK1_ENST00000265709.8_Missense_Mutation_p.A1883V	p.A1842V	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	1	2	3	2.008365	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)	41	5608	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	0	1	hg19	c.5525C>T	CCDS6119.1	0	.	.	.	.	.	.	.	.	.	.	G	9.965	1.223834	0.22457	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000396942;ENST00000522231;ENST00000522543;ENST00000314214;ENST00000265709	T;T;T;D;D;D;T	0.86432	-0.2;-0.18;-0.18;-1.71;-2.11;-2.12;-0.23	5.94	2.12	0.27331	5.94	2.12	0.27331	.	0.199600	0.40144	N	0.001173	T	0.81645	0.4866	L	0.42245	1.32	0.53005	D	0.99996	P;B;B;B;B;B;B;P;P	0.39940	0.481;0.005;0.125;0.001;0.0;0.0;0.076;0.572;0.696	B;B;B;B;B;B;B;B;B	0.41946	0.137;0.002;0.056;0.0;0.0;0.001;0.042;0.371;0.173	T	0.76465	-0.2949	10	0.42905	T	0.14	.	8.182	0.31315	0.0:0.0672:0.2624:0.6704	.	117;1883;1680;1842;1842;1842;996;117;117	Q6PK32;P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39;Q53ER1;E5RFL7	.;.;.;ANK1_HUMAN;.;.;.;.;.	V	1842;1842;1842;117;117;117;1883	ENSP00000339620:A1842V;ENSP00000289734:A1842V;ENSP00000380147:A1842V;ENSP00000428750:A117V;ENSP00000430368:A117V;ENSP00000319123:A117V;ENSP00000265709:A1883V	ENSP00000265709:A1883V	A	-	2	0	0	ANK1	41638570	41638570	0.851000	0.29673	0.459000	0.27081	0.000000	0.00434	0.325000	0.19628	0.502000	0.28037	-0.397000	0.06425	GCC	0.108470		TCGA-IB-A5ST-01A-11D-A32N-08	0.572	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	117	1	2.040000	-2.810154	1	0.100000	NM_020475		0	6	5	0	405	399	0		1	0		0	0	119	0	0	0.963340	4.636260e-03	0	0	0	6	0	6	405
PRUNE2	158471	broad.mit.edu	37	9	79320990	79320990	+	Missense_Mutation	SNP	G	G	A	rs374932024		TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr9:79320990G>A	ENST00000376718.3	-	8	6323	c.6200C>T	c.(6199-6201)gCg>gTg	p.A2067V	PRUNE2_ENST00000428286.1_Missense_Mutation_p.A1708V	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2067					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CAAGTCAGGCGCGGCAGAGGC	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		20429	0.001		0.0	False		,,,				2504	0.0					ENST00000376718.3	0.420000	0.090000	0.320000	0.150000	0.220000	0.242698	0.220000	0.210000																										0				16						c.(6199-6201)gCg>gTg		prune homolog 2 (Drosophila)		G	VAL/ALA	0,3136		0,0,1568	136.0	128.0	131.0		6200	3.9	0.0	9		131	1,7163		0,1,3581	no	missense	PRUNE2	NM_015225.2	64	0,1,5149	AA,AG,GG		0.014,0.0,0.0097	benign	2067/3089	79320990	1,10299	1568	3582	5150	SO:0001583	missense	158471	3	120416	42				g.chr9:79320990G>A	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6200C>T	chr9.hg19:g.79320990G>A	ENSP00000365908:p.Ala2067Val	0					PRUNE2_ENST00000428286.1_Missense_Mutation_p.A1708V	p.A2067V	NM_015225.2	NP_056040.2	0	0	0	1.974317	Q8WUY3	PRUN2_HUMAN		8	6323	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	0	1	hg19	c.6200C>T	CCDS47982.1	0	.	.	.	.	.	.	.	.	.	.	G	2.507	-0.313854	0.05422	0.0	1.4E-4	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.42131	0.98;0.98	6.03	3.94	0.45596	6.03	3.94	0.45596	.	0.708846	0.12837	N	0.435169	T	0.20577	0.0495	N	0.14661	0.345	0.09310	N	1	B	0.15930	0.015	B	0.09377	0.004	T	0.27606	-1.0069	10	0.05959	T	0.93	-5.9616	6.8158	0.23829	0.0987:0.0:0.5223:0.379	.	2067	Q8WUY3	PRUN2_HUMAN	V	2067;1708;2066	ENSP00000365908:A2067V;ENSP00000397425:A1708V	ENSP00000365908:A2067V	A	-	2	0	0	PRUNE2	78510810	78510810	0.011000	0.17503	0.005000	0.12908	0.012000	0.07955	1.895000	0.39778	1.500000	0.48636	0.655000	0.94253	GCG	0.084435		TCGA-IB-A5ST-01A-11D-A32N-08	0.512	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	0	0	1	2	2	2	2	1	1	1	0	147	147	147	147	1	2.040000	-3.073847	1	0.100000	NM_138818		0	7	7	0	628	622	0		1	0		1	0	147	0	0	0.980019	1.040939e-03	0	0	0	4	0	7	628
HABP4	22927	broad.mit.edu	37	9	99227683	99227683	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr9:99227683C>T	ENST00000375249.4	+	3	652	c.577C>T	c.(577-579)Cgc>Tgc	p.R193C	HABP4_ENST00000375251.3_Intron	NM_014282.2	NP_055097.2			hyaluronan binding protein 4											NS(1)|cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				AGGGGGTATGCGCGGCAGAGG	0.483																																						ENST00000375249.4	0.530000	0.140000	0.420000	0.210000	0.300000	0.319337	0.300000	0.280000																										0				13						c.(577-579)Cgc>Tgc		hyaluronan binding protein 4							101.0	114.0	109.0					9																	99227683		2203	4300	6503	SO:0001583	missense	22927	3	121412	38				g.chr9:99227683C>T	AF241831	CCDS6719.1	9q22.3-q31	2008-02-05			ENSG00000130956	ENSG00000130956			17062	protein-coding gene	gene with protein product						9523163, 10887182	Standard	XM_005251812		Approved	IHABP4, SERBP1L	uc010msg.3	Q5JVS0	OTTHUMG00000020298	ENST00000375249.4:c.577C>T	chr9.hg19:g.99227683C>T	ENSP00000364398:p.Arg193Cys	0					HABP4_ENST00000375251.3_Intron	p.R193C	NM_014282.2	NP_055097.2	0	0	0	1.974317				3	652	+		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)		Missense_Mutation	SNP	ENST00000375249.4	0	1	hg19	c.577C>T	CCDS6719.1	0	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837388	0.50951	.	.	ENSG00000130956	ENST00000375249	T	0.37752	1.18	4.86	2.77	0.32553	4.86	2.77	0.32553	.	0.269438	0.30538	N	0.009418	T	0.42381	0.1200	L	0.43923	1.385	0.49213	D	0.999769	D	0.71674	0.998	P	0.53185	0.72	T	0.40515	-0.9559	10	0.72032	D	0.01	-7.7391	14.0166	0.64527	0.4686:0.5314:0.0:0.0	.	193	Q5JVS0	HABP4_HUMAN	C	193	ENSP00000364398:R193C	ENSP00000364398:R193C	R	+	1	0	0	HABP4	98267504	98267504	1.000000	0.71417	0.350000	0.25708	0.389000	0.30415	1.202000	0.32271	0.558000	0.29135	0.644000	0.83932	CGC	0.084435		TCGA-IB-A5ST-01A-11D-A32N-08	0.483	HABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053269.1	0	0	1	2	22	5	2	1	1	1	2	122	122	122	120	1	2.040000	-1.649369	0	0.100000	NM_014282		0	8	7	0	533	526	0		0	0		1	0	122	0	0	0.006463	2.645105e-02	0	0	0	89	0	8	533
ADAMTS13	11093	broad.mit.edu	37	9	136310876	136310876	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chr9:136310876G>A	ENST00000371929.3	+	21	3111	c.2667G>A	c.(2665-2667)acG>acA	p.T889T	ADAMTS13_ENST00000536611.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Silent_p.T858T|ADAMTS13_ENST00000355699.2_Silent_p.T889T	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	889					cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCATCAGGACGGGGGCTCAAG	0.677																																						ENST00000371929.3	0.820000	0.180000	0.630000	0.290000	0.430000	0.463886	0.430000	0.400000																										0				36						c.(2665-2667)acG>acA		ADAM metallopeptidase with thrombospondin type 1 motif, 13							51.0	49.0	49.0					9																	136310876		2203	4300	6503	SO:0001819	synonymous_variant	11093	1	121364	28				g.chr9:136310876G>A	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2667G>A	chr9.hg19:g.136310876G>A		0					ADAMTS13_ENST00000536611.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000356589.2_Silent_p.T858T|ADAMTS13_ENST00000355699.2_Silent_p.T889T|ADAMTS13_ENST00000371916.1_3'UTR	p.T889T	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	0	0	0	1.974317	Q76LX8	ATS13_HUMAN		21	3111	+			Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	0	1	hg19	c.2667G>A	CCDS6970.1	0																																																																																								0.084435		TCGA-IB-A5ST-01A-11D-A32N-08	0.677	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	2.040000	-3.318474	1	0.100000	NM_139025		0	6	6	0	277	273	0		1	0		0	0	84	0	0	0.963859	2.018008e-03	0	0	0	3	0	6	277
CXorf57	55086	broad.mit.edu	37	X	105855530	105855530	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chrX:105855530G>A	ENST00000372548.4	+	1	329	c.220G>A	c.(220-222)Gtc>Atc	p.V74I	CXorf57_ENST00000372544.2_Missense_Mutation_p.V74I	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	74							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TGTGCTGGCCGTCCAGAGGTA	0.567																																						ENST00000372548.4	0.460000	0.090000	0.350000	0.150000	0.230000	0.256315	0.230000	0.220000																										0				31						c.(220-222)Gtc>Atc		chromosome X open reading frame 57							96.0	84.0	88.0					X																	105855530		2203	4300	6503	SO:0001583	missense	55086	1	121410	40				g.chrX:105855530G>A	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.220G>A	chrX.hg19:g.105855530G>A	ENSP00000361628:p.Val74Ile						CXorf57_ENST00000372544.2_Missense_Mutation_p.V74I	p.V74I	NM_018015.5	NP_060485.4	0	1	1		Q6NSI4	CX057_HUMAN		1	329	+			H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	0	1	hg19	c.220G>A	CCDS14519.1	0	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122698	0.37436	.	.	ENSG00000147231	ENST00000372544;ENST00000372548	T;T	0.80304	-1.36;-1.36	3.47	1.69	0.24217	3.47	1.69	0.24217	Nucleic acid-binding, OB-fold-like (1);	0.292022	0.28338	N	0.015703	T	0.70518	0.3233	M	0.64997	1.995	0.26035	N	0.981682	P;P;B	0.36125	0.538;0.538;0.366	B;B;B	0.29942	0.109;0.109;0.035	T	0.58446	-0.7635	10	0.30078	T	0.28	-2.4941	7.0559	0.25099	0.233:0.0:0.767:0.0	.	74;74;74	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	I	74	ENSP00000361623:V74I;ENSP00000361628:V74I	ENSP00000361623:V74I	V	+	1	0	0	CXorf57	105742186	105742186	0.338000	0.24775	0.468000	0.27192	0.810000	0.45777	0.505000	0.22642	0.314000	0.23086	0.600000	0.82982	GTC	0.100000		TCGA-IB-A5ST-01A-11D-A32N-08	0.567	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	0	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	2.040000	-2.875267	1	0.100000	NM_018015		0	6	7	0	529	524	0		1	0		0	0	105	0	0	0.964328	5.750309e-04	0	0	0	3	0	6	529
MXRA5	25878	broad.mit.edu	37	X	3242386	3242386	+	Missense_Mutation	SNP	G	G	A	rs146759954	byFrequency	TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chrX:3242386G>A	ENST00000217939.6	-	5	1494	c.1340C>T	c.(1339-1341)aCg>aTg	p.T447M		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	447						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTTCTTGGCCGTACTCTGACG	0.488													G|||	1	0.000264901	0.0008	0.0	3775	,	,		15729	0.0		0.0	False		,,,				2504	0.0					ENST00000217939.6	0.430000	0.120000	0.340000	0.180000	0.250000	0.266293	0.250000	0.240000																										0				157						c.(1339-1341)aCg>aTg		matrix-remodelling associated 5		G	MET/THR	1,3834		0,1,0,1631,571	128.0	125.0	126.0		1340	3.6	0.0	X	dbSNP_134	126	3,6725		0,1,2,2427,1870	yes	missense	MXRA5	NM_015419.3	81	0,2,2,4058,2441	AA,AG,A,GG,G		0.0446,0.0261,0.0379	possibly-damaging	447/2829	3242386	4,10559	2203	4300	6503	SO:0001583	missense	25878	91	121412	54				g.chrX:3242386G>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1340C>T	chrX.hg19:g.3242386G>A	ENSP00000217939:p.Thr447Met							p.T447M	NM_015419.3	NP_056234.2	0	1	1		Q9NR99	MXRA5_HUMAN		5	1494	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	0	1	hg19	c.1340C>T	CCDS14124.1	0	1	6.027727546714888E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.72	1.724062	0.30593	2.61E-4	4.46E-4	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.75050	-0.9	3.63	3.63	0.41609	3.63	3.63	0.41609	.	0.177406	0.26673	U	0.023082	T	0.80793	0.4691	M	0.76002	2.32	0.25976	N	0.982438	D	0.76494	0.999	P	0.57846	0.828	T	0.72874	-0.4160	10	0.72032	D	0.01	.	9.133	0.36857	0.1065:0.0:0.8935:0.0	.	447	Q9NR99	MXRA5_HUMAN	M	447	ENSP00000217939:T447M	ENSP00000217939:T447M	T	-	2	0	0	MXRA5	3252386	3252386	1.000000	0.71417	0.006000	0.13384	0.069000	0.16628	5.122000	0.64697	1.439000	0.47511	0.431000	0.28591	ACG	0.100000		TCGA-IB-A5ST-01A-11D-A32N-08	0.488	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	0	0	1	2	2	2	2	0	0	0	0	178	178	178	175	1	2.040000	-2.023486	0	0.100000	NM_015419		0	10	10	0	805	786	0		1	0		0	0	178	0	0	0.996502	2.198303e-01	0	0	0	65	0	10	805
ZNF645	158506	broad.mit.edu	37	X	22292036	22292036	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chrX:22292036C>T	ENST00000323684.1	+	1	972	c.928C>T	c.(928-930)Cgt>Tgt	p.R310C		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	310	Pro-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TAACTCGGTTCGTAGCCAAGT	0.468																																						ENST00000323684.1	0.990000	0.340000	0.810000	0.460000	0.620000	0.640135	0.620000	1.000000																										0				27						c.(928-930)Cgt>Tgt		zinc finger protein 645							136.0	104.0	115.0					X																	22292036		2203	4300	6503	SO:0001583	missense	158506	0	0					g.chrX:22292036C>T	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.928C>T	chrX.hg19:g.22292036C>T	ENSP00000323348:p.Arg310Cys							p.R310C	NM_152577.3	NP_689790.1	0	1	1		Q8N7E2	ZN645_HUMAN		1	972	+			A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	1	1	hg19	c.928C>T	CCDS14205.1	0	.	.	.	.	.	.	.	.	.	.	C	7.658	0.684388	0.14907	.	.	ENSG00000175809	ENST00000323684	T	0.30448	1.53	2.42	-0.0632	0.13778	2.42	-0.0632	0.13778	.	3.358530	0.02026	N	0.048193	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24799	-1.0150	10	0.56958	D	0.05	.	5.4112	0.16349	0.0:0.3033:0.0:0.6967	.	310	Q8N7E2	ZN645_HUMAN	C	310	ENSP00000323348:R310C	ENSP00000323348:R310C	R	+	1	0	0	ZNF645	22201957	22201957	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	3.443000	0.52907	-0.088000	0.12506	-0.296000	0.09543	CGT	0.100000		TCGA-IB-A5ST-01A-11D-A32N-08	0.468	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	0	0	1	2	2	2	2	0	0	0	0	95	95	95	92	1	2.040000	-3.171695	1	0.100000	NM_152577		0	12	12	0	381	378	0		1			0	0	95	0	0	0.999106	0	0	0	0	0	0	12	381
CXorf56	63932	broad.mit.edu	37	X	118699217	118699217	+	Silent	SNP	G	G	A			TCGA-IB-A5ST-01A-11D-A32N-08	TCGA-IB-A5ST-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b266696a-1d45-466a-b065-83f20b4cdc07	726db08f-fb65-418f-9709-8628f97515b5	g.chrX:118699217G>A	ENST00000371594.4	-	1	180	c.102C>T	c.(100-102)tgC>tgT	p.C34C	CXorf56_ENST00000536133.1_Silent_p.C34C|CXorf56_ENST00000320339.4_5'UTR	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	34										cervix(1)|endometrium(2)|lung(7)	10						CCATCTGGCCGCACAAACAGT	0.577																																						ENST00000371594.4	0.370000	0.060000	0.280000	0.110000	0.180000	0.200937	0.180000	0.170000																										0				10						c.(100-102)tgC>tgT		chromosome X open reading frame 56							78.0	75.0	76.0					X																	118699217		2203	4300	6503	SO:0001819	synonymous_variant	63932	0	0					g.chrX:118699217G>A	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.102C>T	chrX.hg19:g.118699217G>A							CXorf56_ENST00000320339.4_5'UTR|CXorf56_ENST00000536133.1_Silent_p.C34C	p.C34C	NM_022101.3	NP_071384.1	0	1	1		Q9H5V9	CX056_HUMAN		1	180	-			A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Silent	SNP	ENST00000371594.4	0	1	hg19	c.102C>T	CCDS14579.1	0																																																																																								0.100000		TCGA-IB-A5ST-01A-11D-A32N-08	0.577	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	138	138	138	135	1	2.040000	-1.975407	0	0.100000	NM_022101		0	5	5	0	581	572	0		1	0		0	0	138	0	0	0.934920	8.869372e-02	0	1	0	46	0	5	581
