#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
IGHMBP2	3508	broad.mit.edu	37	11	68675791	68675791	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr11:68675791delC	ENST00000255078.3	+	3	546	c.435delC	c.(433-435)tacfs	p.Y145fs	IGHMBP2_ENST00000539224.1_Frame_Shift_Del_p.Y145fs	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	145					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATGTCACTTACAGGCGACTGA	0.458																																						ENST00000255078.3	1.000000	2.500000e-01	0.420000	0.300000	0.350000	0.385254	0.350000	0.350000																										0				36						c.(433-435)tacfs		immunoglobulin mu binding protein 2							91.0	87.0	88.0					11																	68675791		2200	4294	6494	SO:0001589	frameshift_variant	3508	0	0					g.chr11:68675791delC	L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.435delC	chr11.hg19:g.68675791delC	ENSP00000255078:p.Tyr145fs	0					IGHMBP2_ENST00000539224.1_Frame_Shift_Del_p.Y145fs	p.Y145fs	NM_002180.2	NP_002171.2	1	2	3	2.124139	P38935	SMBP2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)	3	546	+			A0PJD2|Q00443|Q14177	Frame_Shift_Del	DEL	ENST00000255078.3	0	1	hg19	c.435delC	CCDS8187.1	0																																																																																								0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.458	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	1	0	1		2	2		0	0	0	0	64	0	64	64	1	1.890000	-20.000000	1	0.580000	NM_002180		0	42	47	0	372	367	0	0	1	0	0	0	0	64	0	0	1	2.772671e-01	0	0	0	10	0	42	372
ERC1	23085	broad.mit.edu	37	12	1292488	1292488	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:1292488delA	ENST00000397203.2	+	11	2464	c.2058delA	c.(2056-2058)gcafs	p.A686fs	ERC1_ENST00000589028.1_Frame_Shift_Del_p.A686fs|ERC1_ENST00000543086.3_Frame_Shift_Del_p.A658fs|ERC1_ENST00000360905.4_Frame_Shift_Del_p.A686fs|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000546231.2_Frame_Shift_Del_p.A686fs|ERC1_ENST00000355446.5_Frame_Shift_Del_p.A686fs			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	686					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CTTCTCTGGCATCCTCAGGAC	0.368																																						ENST00000397203.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999743	0.990000	1.000000																										0				38						c.(2056-2058)gcafs		ELKS/RAB6-interacting/CAST family member 1							88.0	88.0	88.0					12																	1292488		2203	4300	6503	SO:0001589	frameshift_variant	23085	0	0					g.chr12:1292488delA	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2058delA	chr12.hg19:g.1292488delA	ENSP00000380386:p.Ala686fs	1					ERC1_ENST00000546231.2_Frame_Shift_Del_p.A686fs|ERC1_ENST00000360905.4_Frame_Shift_Del_p.A686fs|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000589028.1_Frame_Shift_Del_p.A686fs|ERC1_ENST00000543086.3_Frame_Shift_Del_p.A658fs|ERC1_ENST00000355446.5_Frame_Shift_Del_p.A686fs	p.A686fs			1	2	3	2.712258	Q8IUD2	RB6I2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)	11	2464	+	all_epithelial(11;0.0698)|Ovarian(42;0.107)		A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Frame_Shift_Del	DEL	ENST00000397203.2	1	1	hg19	c.2058delA	CCDS8508.1	1																																																																																								0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.368	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	1	0	1		2	2		0	0	0	0	79	0	79	77	1	1.890000	-20.000000	1	0.580000	NM_015064		0	210	212	0	601	600	0	0	1	1	0	0	0	79	0	0	1	8.862921e-01	0	3	0	10	0	210	601
PARP15	165631	broad.mit.edu	37	3	122345673	122345673	+	Splice_Site	DEL	G	G	-			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:122345673delG	ENST00000464300.2	+	9	1297		c.e9-1		PARP15_ENST00000310366.4_Splice_Site|PARP15_ENST00000483793.1_Intron|PARP15_ENST00000465304.1_Splice_Site|PARP15_ENST00000493645.1_Intron	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		TTTTTTTTCAGGAAATGCCGG	0.373																																						ENST00000464300.2	0.760000	4.600000e-01	0.690000	0.530000	0.600000	0.616300	0.600000	0.610000																										0				24						c.e9-1		poly (ADP-ribose) polymerase family, member 15							55.0	53.0	53.0					3																	122345673		2203	4300	6503	SO:0001630	splice_region_variant	165631	0	0					g.chr3:122345673delG	AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.1232-1G>-	chr3.hg19:g.122345673delG		0					PARP15_ENST00000310366.4_Splice_Site|PARP15_ENST00000465304.1_Splice_Site|PARP15_ENST00000493645.1_Intron|PARP15_ENST00000483793.1_Intron		NM_001113523.1	NP_001106995.1	0	0	0	2.070095	Q460N3	PAR15_HUMAN		9	1297	+			J3KR47|Q8N1K3	Splice_Site	DEL	ENST00000464300.2	1	1	hg19		CCDS46893.1	0																																																																																								0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.373	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	1	0	1		2	2		0	0	0	0	42	0	42	41	1	1.890000	-3.156361	1	0.580000	NM_152615	Intron	0	54	63	0	251	249	0	0	1	0	0	0	0	42	0	0	1	1.822986e-13	0	0	0	1	0	54	251
JADE2	23338	broad.mit.edu	37	5	133901907	133901907	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:133901907delC	ENST00000402835.1	+	9	1326	c.1071delC	c.(1069-1071)ttcfs	p.F357fs	PHF15_ENST00000361895.2_Frame_Shift_Del_p.F357fs|PHF15_ENST00000395003.1_Frame_Shift_Del_p.F357fs|PHF15_ENST00000282605.4_Frame_Shift_Del_p.F357fs																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGTCAAGTTCAAGTCATTCT	0.567																																						ENST00000402835.1	0.800000	5.700000e-01	0.730000	0.620000	0.670000	0.681561	0.670000	0.670000																										0				22						c.(1069-1071)ttcfs									117.0	102.0	107.0					5																	133901907		2203	4300	6503	SO:0001589	frameshift_variant	0	0	0					g.chr5:133901907delC																												ENST00000402835.1:c.1071delC	chr5.hg19:g.133901907delC	ENSP00000384671:p.Phe357fs	0					PHF15_ENST00000282605.4_Frame_Shift_Del_p.F357fs|PHF15_ENST00000361895.2_Frame_Shift_Del_p.F357fs|PHF15_ENST00000395003.1_Frame_Shift_Del_p.F357fs	p.F357fs			1	2	3	2.101368			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	9	1326	+				Frame_Shift_Del	DEL	ENST00000402835.1	1	1	hg19	c.1071delC		0																																																																																								0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000318543.1	1	0	1		2	2		0	0	0	0	99	0	99	99	1	1.890000	-20.000000	1	0.580000			0	130	129	0	537	531	0	0	1	1	0	0	0	99	0	0	1	9.999950e-01	0	11	0	62	0	130	537
GBF1	8729	broad.mit.edu	37	10	104117903	104117903	+	Silent	SNP	G	G	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr10:104117903G>T	ENST00000369983.3	+	9	1007	c.747G>T	c.(745-747)ctG>ctT	p.L249L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	249					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GTTCAGAGCTGCCCACTCCCA	0.507																																						ENST00000369983.3	1.000000	7.300000e-01	0.890000	0.780000	0.820000	0.840325	0.820000	0.830000																										0				71						c.(745-747)ctG>ctT		golgi brefeldin A resistant guanine nucleotide exchange factor 1							205.0	202.0	203.0					10																	104117903		2203	4300	6503	SO:0001819	synonymous_variant	8729	0	0					g.chr10:104117903G>T	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.747G>T	chr10.hg19:g.104117903G>T		0						p.L249L	NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	1	2	3	2.146677	Q92538	GBF1_HUMAN		9	1007	+		Colorectal(252;0.0236)	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Silent	SNP	ENST00000369983.3	1	1	hg19	c.747G>T	CCDS7533.1	0																																																																																								0.588356		TCGA-IB-A6UF-01A-23D-A33T-08	0.507	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1	1	0	1	2	2	2	2	0	0	0	0	179	179	179	178	1	1.890000	-20.000000	1	0.580000			0	241	238	0	781	776	1		1	1		0	0	179	0	0	1	9.997901e-01	0	19	0	23	0	241	781
GAD2	2572	broad.mit.edu	37	10	26589858	26589858	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr10:26589858G>A	ENST00000376261.3	+	16	2229	c.1726G>A	c.(1726-1728)Gaa>Aaa	p.E576K	GAD2_ENST00000259271.3_Missense_Mutation_p.E576K	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	576					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CTTCCTGATTGAAGAAATAGA	0.438																																						ENST00000376261.3	1.000000	1.700000e-01	0.300000	0.210000	0.250000	0.278686	0.250000	0.250000																										0				48						c.(1726-1728)Gaa>Aaa		glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)							119.0	116.0	117.0					10																	26589858		2203	4300	6503	SO:0001583	missense	2572	0	0					g.chr10:26589858G>A	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1726G>A	chr10.hg19:g.26589858G>A	ENSP00000365437:p.Glu576Lys	0					GAD2_ENST00000259271.3_Missense_Mutation_p.E576K	p.E576K	NM_001134366.1	NP_001127838.1	1	2	3	2.111627	Q05329	DCE2_HUMAN		16	2229	+			Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	1	1	hg19	c.1726G>A	CCDS7149.1	0	.	.	.	.	.	.	.	.	.	.	G	17.34	3.366041	0.61513	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.39592	1.07;1.07	5.71	5.71	0.89125	5.71	5.71	0.89125	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.173449	0.53938	D	0.000050	T	0.37865	0.1019	L	0.35542	1.07	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.08269	-1.0730	10	0.46703	T	0.11	-27.4343	19.8579	0.96771	0.0:0.0:1.0:0.0	.	576	Q05329	DCE2_HUMAN	K	576	ENSP00000365437:E576K;ENSP00000259271:E576K	ENSP00000259271:E576K	E	+	1	0	0	GAD2	26629864	26629864	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.687000	0.91594	0.655000	0.94253	GAA	0.584816		TCGA-IB-A6UF-01A-23D-A33T-08	0.438	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	1	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	1.890000	-9.272560	1	0.580000	NM_000818		0	38	38	0	488	481	0		1	0		0	0	92	0	0	1	0	0	0	0	1	0	38	488
PTCHD3	374308	broad.mit.edu	37	10	27702453	27702453	+	Missense_Mutation	SNP	G	G	A	rs549609218		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr10:27702453G>A	ENST00000438700.3	-	1	844	c.727C>T	c.(727-729)Cgg>Tgg	p.R243W		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	243					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						CCCTTTTCCCGCGCCACGCGC	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17664	0.0		0.0	False		,,,				2504	0.0					ENST00000438700.3	1.000000	7.300000e-01	1.000000	0.810000	0.890000	0.898314	0.890000	1.000000																										0				55						c.(727-729)Cgg>Tgg		patched domain containing 3							39.0	41.0	41.0					10																	27702453		2203	4300	6503	SO:0001583	missense	374308	1	121406	33				g.chr10:27702453G>A	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.727C>T	chr10.hg19:g.27702453G>A	ENSP00000417658:p.Arg243Trp	0						p.R243W	NM_001034842.3	NP_001030014.2	1	2	3	2.111627	Q3KNS1	PTHD3_HUMAN		1	844	-			I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	1	1	hg19	c.727C>T	CCDS31173.1	1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524459	0.27299	.	.	ENSG00000182077	ENST00000438700	D	0.85702	-2.02	3.93	-0.963	0.10330	3.93	-0.963	0.10330	.	3.428320	0.00760	N	0.001132	T	0.75258	0.3825	N	0.08118	0	0.09310	N	1	B	0.20459	0.045	B	0.09377	0.004	T	0.63985	-0.6513	10	0.66056	D	0.02	-0.2446	14.3009	0.66352	0.0:0.7511:0.2489:0.0	.	243	Q3KNS1	PTHD3_HUMAN	W	243	ENSP00000417658:R243W	ENSP00000417658:R243W	R	-	1	2	2	PTCHD3	27742459	27742459	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.661000	0.05311	-0.023000	0.13963	-0.311000	0.09066	CGG	0.584816		TCGA-IB-A6UF-01A-23D-A33T-08	0.627	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	1	0	1	2	2	2	2	0	0	0	0	51	51	51	49	1	1.890000	-20.000000	1	0.580000	XM_370541		0	78	78	0	225	225	1		1			0	0	51	0	0	1	0	0	0	0	0	0	78	225
RBP3	5949	broad.mit.edu	37	10	48388884	48388884	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr10:48388884C>T	ENST00000224600.4	-	1	2107	c.1994G>A	c.(1993-1995)cGg>cAg	p.R665Q	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	665	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CAGCTTGGCCCGCAGGAGGGC	0.677																																						ENST00000224600.4	1.000000	7.400000e-01	1.000000	0.830000	0.940000	0.926020	0.940000	1.000000																										0				59						c.(1993-1995)cGg>cAg		retinol binding protein 3, interstitial	Vitamin A(DB00162)						21.0	24.0	23.0					10																	48388884		2201	4290	6491	SO:0001583	missense	5949	1	121232	31				g.chr10:48388884C>T	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1994G>A	chr10.hg19:g.48388884C>T	ENSP00000224600:p.Arg665Gln	0					AL731561.2_ENST00000581861.1_RNA	p.R665Q	NM_002900.2	NP_002891.1	1	2	3	2.126813	P10745	RET3_HUMAN		1	2107	-			Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	1	1	hg19	c.1994G>A	CCDS7218.1	1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.163647	0.00318	.	.	ENSG00000107618	ENST00000224600	T	0.61859	0.07	5.53	-2.86	0.05717	5.53	-2.86	0.05717	.	1.155020	0.06333	N	0.706523	T	0.31009	0.0783	N	0.03608	-0.345	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.22871	-1.0204	10	0.13853	T	0.58	-0.4135	11.9866	0.53151	0.0:0.379:0.0:0.621	.	665	P10745	RET3_HUMAN	Q	665	ENSP00000224600:R665Q	ENSP00000224600:R665Q	R	-	2	0	0	RBP3	48008890	48008890	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-1.070000	0.03440	-0.584000	0.05913	-0.254000	0.11334	CGG	0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.677	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.890000	-5.215649	1	0.580000	NM_002900		0	59	59	0	161	158	1		1			0	0	50	0	0	1	0	0	0	0	0	0	59	161
SLIT1	6585	broad.mit.edu	37	10	98764503	98764503	+	Silent	SNP	G	G	C	rs199563334		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr10:98764503G>C	ENST00000266058.4	-	33	3902	c.3657C>G	c.(3655-3657)ggC>ggG	p.G1219G	SLIT1_ENST00000371070.4_Silent_p.G1219G|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1219	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CACGCACATGGCCCTGGTACA	0.597																																						ENST00000266058.4	1.000000	8.800000e-01	1.000000	0.970000	0.990000	0.988343	0.990000	1.000000																										0				78						c.(3655-3657)ggC>ggG		slit homolog 1 (Drosophila)							274.0	194.0	221.0					10																	98764503		2203	4300	6503	SO:0001819	synonymous_variant	6585	0	0					g.chr10:98764503G>C	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3657C>G	chr10.hg19:g.98764503G>C		0					ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Silent_p.G1219G	p.G1219G	NM_003061.2	NP_003052.2	1	2	3	2.146677	O75093	SLIT1_HUMAN		33	3902	-		Colorectal(252;0.162)	Q5T0V1|Q8WWZ2|Q9UIL7	Silent	SNP	ENST00000266058.4	1	1	hg19	c.3657C>G	CCDS7453.1	1																																																																																								0.588356		TCGA-IB-A6UF-01A-23D-A33T-08	0.597	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	1.890000	-20.000000	1	0.580000	NM_003061		0	86	85	0	197	194	1		1			0	0	58	0	0	1	0	0	0	0	0	0	86	197
SORCS1	114815	broad.mit.edu	37	10	108412204	108412204	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr10:108412204G>A	ENST00000263054.6	-	18	2418	c.2411C>T	c.(2410-2412)aCg>aTg	p.T804M	SORCS1_ENST00000369698.1_Missense_Mutation_p.T339M|SORCS1_ENST00000344440.6_Missense_Mutation_p.T804M	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	804	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TCCATCAGCCGTGACTATCCG	0.532																																						ENST00000263054.6	1.000000	9.000000e-01	1.000000	0.970000	0.990000	0.989796	0.990000	1.000000																										0				127						c.(2410-2412)aCg>aTg		sortilin-related VPS10 domain containing receptor 1							117.0	106.0	110.0					10																	108412204		2203	4300	6503	SO:0001583	missense	114815	10	121412	43				g.chr10:108412204G>A	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2411C>T	chr10.hg19:g.108412204G>A	ENSP00000263054:p.Thr804Met	0					SORCS1_ENST00000344440.6_Missense_Mutation_p.T804M|SORCS1_ENST00000369698.1_Missense_Mutation_p.T339M	p.T804M	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	1	2	3	2.146677	Q8WY21	SORC1_HUMAN		18	2418	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	1	1	hg19	c.2411C>T	CCDS7559.1	1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231893	0.58777	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.69561	-0.41;-0.41;-0.41	5.74	5.74	0.90152	5.74	5.74	0.90152	PKD/Chitinase domain (1);PKD domain (1);	0.000000	0.85682	D	0.000000	T	0.80924	0.4717	L	0.61218	1.895	0.54753	D	0.999989	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.993;0.997;0.998;0.997	T	0.78580	-0.2149	9	.	.	.	-17.2727	19.9145	0.97053	0.0:0.0:1.0:0.0	.	804;804;804;804;804	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	M	339;804;804	ENSP00000358712:T339M;ENSP00000263054:T804M;ENSP00000345964:T804M	.	T	-	2	0	0	SORCS1	108402194	108402194	1.000000	0.71417	0.959000	0.39883	0.138000	0.21146	9.277000	0.95755	2.709000	0.92574	0.655000	0.94253	ACG	0.588356		TCGA-IB-A6UF-01A-23D-A33T-08	0.532	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	1	0	1	2	2	2	5	0	0	0	0	68	68	68	68	1	1.890000	-20.000000	1	0.580000	NM_052918		0	135	135	0	317	309	1		1		1	0	2	68	1110	0	1	0	1	0	158	0	494	135	317
ANO3	63982	broad.mit.edu	37	11	26463589	26463589	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr11:26463589C>A	ENST00000256737.3	+	2	1023	c.171C>A	c.(169-171)ttC>ttA	p.F57L	ANO3_ENST00000537978.1_Missense_Mutation_p.F41L|ANO3_ENST00000525139.1_Missense_Mutation_p.F41L|ANO3_ENST00000531646.1_Missense_Mutation_p.F57L	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	57					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						CTTCCCTCTTCCAGTCAACCG	0.468																																						ENST00000256737.3	1.000000	8.800000e-01	1.000000	0.930000	0.980000	0.973933	0.980000	1.000000																										0				68						c.(169-171)ttC>ttA		anoctamin 3							162.0	165.0	164.0					11																	26463589		2203	4300	6503	SO:0001583	missense	63982	0	0					g.chr11:26463589C>A	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.171C>A	chr11.hg19:g.26463589C>A	ENSP00000256737:p.Phe57Leu	0					ANO3_ENST00000537978.1_Missense_Mutation_p.F41L|ANO3_ENST00000525139.1_Missense_Mutation_p.F41L|ANO3_ENST00000531646.1_Missense_Mutation_p.F57L	p.F57L	NM_031418.2	NP_113606.2	1	2	3	2.084175	Q9BYT9	ANO3_HUMAN		2	1023	+			B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	1	1	hg19	c.171C>A	CCDS31447.1	1	.	.	.	.	.	.	.	.	.	.	C	9.670	1.146527	0.21288	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531646	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.24	1.93	0.25924	5.24	1.93	0.25924	.	0.141341	0.49916	D	0.000138	T	0.30230	0.0758	N	0.03608	-0.345	0.27524	N	0.951301	B	0.02656	0.0	B	0.01281	0.0	T	0.19063	-1.0317	10	0.10902	T	0.67	.	6.8171	0.23837	0.0:0.6403:0.0:0.3597	.	57	Q9BYT9	ANO3_HUMAN	L	41;41;57;57	ENSP00000440737:F41L;ENSP00000432576:F41L;ENSP00000256737:F57L;ENSP00000435275:F57L	ENSP00000256737:F57L	F	+	3	2	2	ANO3	26420165	26420165	0.978000	0.34361	1.000000	0.80357	0.958000	0.62258	-0.158000	0.10070	0.268000	0.21939	0.650000	0.86243	TTC	0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.468	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	1	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	1.890000	-20.000000	1	0.580000	NM_031418		0	239	239	0	595	584	1		1			0	0	135	0	0	1	0	0	0	0	0	0	239	595
LPXN	9404	broad.mit.edu	37	11	58317463	58317463	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr11:58317463C>T	ENST00000395074.2	-	6	731	c.643G>A	c.(643-645)Gct>Act	p.A215T	LPXN_ENST00000528489.1_Missense_Mutation_p.A195T|LPXN_ENST00000528954.1_Missense_Mutation_p.A220T	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	215	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				ATGGGAGCAGCGCAGTAAGCA	0.493																																						ENST00000395074.2	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.994293	0.990000	1.000000																										0				14						c.(643-645)Gct>Act		leupaxin							101.0	97.0	99.0					11																	58317463		2201	4295	6496	SO:0001583	missense	9404	2	121412	33				g.chr11:58317463C>T	AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.643G>A	chr11.hg19:g.58317463C>T	ENSP00000378512:p.Ala215Thr	0					LPXN_ENST00000528954.1_Missense_Mutation_p.A220T|LPXN_ENST00000528489.1_Missense_Mutation_p.A195T	p.A215T	NM_004811.2	NP_004802.1	1	2	3	2.093093	O60711	LPXN_HUMAN		6	731	-		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	ENST00000395074.2	1	1	hg19	c.643G>A	CCDS7969.1	1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194268	0.58017	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	D;D	0.87029	-2.2;-2.2	5.95	5.95	0.96441	5.95	5.95	0.96441	Zinc finger, LIM-type (5);	0.121122	0.64402	D	0.000017	D	0.84973	0.5591	N	0.21373	0.66	0.41615	D	0.988935	P;D;P	0.71674	0.845;0.998;0.853	B;P;B	0.58130	0.34;0.833;0.439	D	0.84694	0.0724	10	0.52906	T	0.07	.	8.061	0.30633	0.1594:0.7622:0.0:0.0784	.	195;220;215	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	T	220;215	ENSP00000431284:A220T;ENSP00000378512:A215T	ENSP00000378512:A215T	A	-	1	0	0	LPXN	58074039	58074039	0.996000	0.38824	0.831000	0.32960	0.943000	0.58893	3.514000	0.53422	2.824000	0.97209	0.655000	0.94253	GCT	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.493	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394709.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	1.890000	-11.755210	1	0.580000	NM_004811		0	157	157	0	352	348	1		1	1		0	0	103	0	0	1	9.906770e-01	0	5	0	14	0	157	352
PLCB3	5331	broad.mit.edu	37	11	64031070	64031070	+	Splice_Site	SNP	G	G	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr11:64031070G>T	ENST00000540288.1	+	20	2558		c.e20+1		PLCB3_ENST00000325234.5_Splice_Site|PLCB3_ENST00000279230.6_Splice_Site	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)						inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						ATCCGCTCCGGTGAGGCCTTG	0.647																																						ENST00000540288.1	1.000000	8.300000e-01	1.000000	0.930000	0.990000	0.976609	0.990000	1.000000																										0				33						c.e20+1		phospholipase C, beta 3 (phosphatidylinositol-specific)							64.0	45.0	51.0					11																	64031070		2201	4297	6498	SO:0001630	splice_region_variant	5331	0	0					g.chr11:64031070G>T	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2455+1G>T	chr11.hg19:g.64031070G>T		0					PLCB3_ENST00000325234.5_Splice_Site|PLCB3_ENST00000279230.6_Splice_Site		NM_000932.2	NP_000923.1	1	2	3	2.124139	Q01970	PLCB3_HUMAN		20	2558	+			A5PKZ6|G5E960|Q8N1A4	Splice_Site	SNP	ENST00000540288.1	1	0	hg19		CCDS8064.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205412	0.79127	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	.	.	.	4.85	4.85	0.62838	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0853	0.86610	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	PLCB3	63787646	63787646	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	9.400000	0.97290	2.404000	0.81709	0.561000	0.74099	.	0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.647	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.890000	-20.000000	1	0.580000		Intron	0	64	65	0	151	150	0		1	0		0	0	49	0	0	1	9.068617e-02	0	1	0	1	0	64	151
ELMOD1	55531	broad.mit.edu	37	11	107526732	107526732	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr11:107526732A>T	ENST00000265840.7	+	11	1037	c.772A>T	c.(772-774)Acc>Tcc	p.T258S	ELMOD1_ENST00000443271.2_Missense_Mutation_p.T250S|ELMOD1_ENST00000531234.1_Missense_Mutation_p.T252S	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	258	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		AGCTCTAAAAACCCATTTCTA	0.373																																						ENST00000265840.7	1.000000	9.300000e-01	1.000000	0.990000	0.990000	0.995555	0.990000	1.000000																										0				19						c.(772-774)Acc>Tcc		ELMO/CED-12 domain containing 1							98.0	91.0	93.0					11																	107526732		1864	4093	5957	SO:0001583	missense	55531	1	119174	28				g.chr11:107526732A>T	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.772A>T	chr11.hg19:g.107526732A>T	ENSP00000265840:p.Thr258Ser	0					ELMOD1_ENST00000531234.1_Missense_Mutation_p.T252S|ELMOD1_ENST00000443271.2_Missense_Mutation_p.T250S	p.T258S	NM_018712.3	NP_061182.3	1	2	3	2.124139	Q8N336	ELMD1_HUMAN		11	1037	+		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	ENST00000265840.7	0	1	hg19	c.772A>T	CCDS44723.1	1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.861859	0.51482	.	.	ENSG00000110675	ENST00000531234;ENST00000265840;ENST00000443271	T;T;T	0.27720	1.65;1.65;1.65	6.16	6.16	0.99307	6.16	6.16	0.99307	Engulfment/cell motility, ELMO (2);	0.141782	0.64402	D	0.000006	T	0.26340	0.0643	L	0.39147	1.195	0.80722	D	1	B;B	0.28470	0.213;0.178	B;B	0.30401	0.115;0.07	T	0.05699	-1.0869	10	0.06365	T	0.9	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	258;250	Q8N336;G5E9S5	ELMD1_HUMAN;.	S	252;258;250	ENSP00000433232:T252S;ENSP00000265840:T258S;ENSP00000412257:T250S	ENSP00000265840:T258S	T	+	1	0	0	ELMOD1	107031942	107031942	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.143000	0.77348	2.367000	0.80283	0.528000	0.53228	ACC	0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.373	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	0	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.890000	-16.328000	1	0.580000	NM_018712		0	13	13	0	17	17	0		1			0	0	8	0	0	9.998830e-01	0	0	0	0	0	0	13	17
C1R	715	broad.mit.edu	37	12	7187985	7187985	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:7187985C>T	ENST00000542285.1	-	11	1962	c.1813G>A	c.(1813-1815)Gtt>Att	p.V605I				P00736	C1R_HUMAN	complement component 1, r subcomponent	657	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|pancreas(1)	16					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACTGCAAAAACGCCCCCACTA	0.572																																						ENST00000542285.1	1.000000	8.700000e-01	1.000000	0.920000	0.960000	0.964953	0.960000	0.990000																										0				16						c.(1813-1815)Gtt>Att		complement component 1, r subcomponent	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						54.0	60.0	58.0					12																	7187985		2041	4216	6257	SO:0001583	missense	715	9	120996	39				g.chr12:7187985C>T	M14058		12p13.31	2014-05-14			ENSG00000159403	ENSG00000159403	3.4.21.41	"""Complement system"""	1246	protein-coding gene	gene with protein product		613785					Standard	NM_001733		Approved		uc010sfy.2	P00736	OTTHUMG00000168149	ENST00000542285.1:c.1813G>A	chr12.hg19:g.7187985C>T	ENSP00000438615:p.Val605Ile	1						p.V605I			0	1	1	1.518149	P00736	C1R_HUMAN		11	1962	-			A6NJQ8|Q68D77|Q8J012	Missense_Mutation	SNP	ENST00000542285.1	1	1	hg19	c.1813G>A		1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178207	0.57692	.	.	ENSG00000159403	ENST00000290575;ENST00000542285	T	0.41758	0.99	5.7	5.7	0.88788	5.7	5.7	0.88788	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.092388	0.46145	D	0.000303	T	0.51483	0.1677	.	.	.	0.30586	N	0.762027	P	0.34934	0.476	B	0.43445	0.42	T	0.56595	-0.7953	9	0.62326	D	0.03	.	19.8479	0.96722	0.0:1.0:0.0:0.0	.	657	P00736	C1R_HUMAN	I	620;605	ENSP00000438615:V605I	ENSP00000290575:V620I	V	-	1	0	0	C1R	7058240	7058240	0.988000	0.35896	0.993000	0.49108	0.102000	0.19082	2.342000	0.43992	2.681000	0.91329	0.655000	0.94253	GTT	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.572	C1R-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.890000	-20.000000	1	0.580000	NM_001733		0	95	94	0	114	113	1		1	1		0	0	46	0	0	1	1	0	152	0	1787	0	95	114
HIST4H4	121504	broad.mit.edu	37	12	14923783	14923783	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:14923783C>T	ENST00000539745.1	-	1	282	c.236G>A	c.(235-237)cGc>cAc	p.R79H	HIST4H4_ENST00000541592.1_5'Flank|RP11-174G6.5_ENST00000562691.2_RNA	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	79					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						GACGGTCTTGCGCTTGGCGTG	0.587											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000539745.1	0.100000	1.000000e-02	0.070000	0.020000	0.040000	0.051452	0.040000	0.040000																										0				6						c.(235-237)cGc>cAc		histone cluster 4, H4							108.0	89.0	95.0					12																	14923783		2203	4300	6503	SO:0001583	missense	121504	1	121412	30				g.chr12:14923783C>T	AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.236G>A	chr12.hg19:g.14923783C>T	ENSP00000443017:p.Arg79His	1		OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	698	HIST4H4_ENST00000541592.1_5'Flank|RP11-174G6.5_ENST00000562691.2_RNA	p.R79H	NM_175054.2	NP_778224.1	0	1	1	1.502393	P62805	H4_HUMAN		1	282	-			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000539745.1	0	1	hg19	c.236G>A	CCDS8665.1	0	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227488	0.79576	.	.	ENSG00000197837	ENST00000539745	T	0.77358	-1.09	3.99	3.09	0.35607	3.99	3.09	0.35607	.	0.000000	0.50627	U	0.000116	T	0.81950	0.4931	.	.	.	0.53005	D	0.999961	.	.	.	.	.	.	T	0.82623	-0.0366	7	0.87932	D	0	.	9.6665	0.39988	0.0:0.8959:0.0:0.1041	.	.	.	.	H	79	ENSP00000443017:R79H	ENSP00000350767:R79H	R	-	2	0	0	HIST4H4	14815050	14815050	1.000000	0.71417	0.991000	0.47740	0.588000	0.36517	5.280000	0.65603	1.035000	0.39972	0.585000	0.79938	CGC	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.587	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400844.1	0	0	1	2	2	2	2	0	0	0	0	72	72	72	70	1	1.890000	-2.784528	1	0.580000	NM_175054		0	5	5	0	277	277	0		1	0		0	0	72	0	0	9.380859e-01	9.927413e-03	0	0	0	7	0	5	277
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	4	5	3.331817	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.744494		TCGA-IB-A6UF-01A-23D-A33T-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.890000	-20.000000	1	0.580000	NM_033360		4368	67	67	3647	112	112	1	1	1	1	1	0	0	21	634	1	1	9.999426e-01	1	17	248	12	277	67	112
SCN8A	6334	broad.mit.edu	37	12	52183167	52183167	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:52183167G>T	ENST00000354534.6	+	24	4562	c.4384G>T	c.(4384-4386)Gtc>Ttc	p.V1462F	SCN8A_ENST00000545061.1_Missense_Mutation_p.V1421F	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1462					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GTTCATTGGTGTCATCATTGA	0.428																																						ENST00000354534.6	1.000000	9.500000e-01	1.000000	0.990000	0.990000	0.997775	0.990000	1.000000																										0				55						c.(4384-4386)Gtc>Ttc		sodium channel, voltage gated, type VIII, alpha subunit	Valproic Acid(DB00313)						170.0	166.0	167.0					12																	52183167		2073	4239	6312	SO:0001583	missense	6334	0	0					g.chr12:52183167G>T	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.4384G>T	chr12.hg19:g.52183167G>T	ENSP00000346534:p.Val1462Phe	0					SCN8A_ENST00000545061.1_Missense_Mutation_p.V1421F	p.V1462F	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	1	2	3	2.092114	Q9UQD0	SCN8A_HUMAN		24	4562	+			B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	1	1	hg19	c.4384G>T	CCDS44891.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844393	0.91197	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133	D;D;D	0.99080	-5.4;-5.4;-5.4	4.37	4.37	0.52481	4.37	4.37	0.52481	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99393	0.9786	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.989	D	0.98548	1.0635	10	0.87932	D	0	.	18.2498	0.89998	0.0:0.0:1.0:0.0	.	1421;1462	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	F	1462;1421;1421	ENSP00000346534:V1462F;ENSP00000440360:V1421F;ENSP00000347255:V1421F	ENSP00000346534:V1462F	V	+	1	0	0	SCN8A	50469434	50469434	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.713000	0.92767	0.655000	0.94253	GTC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.428	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	1	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	1.890000	-20.000000	1	0.580000	NM_014191		0	130	130	0	273	272	1		1			0	0	83	0	0	1	0	0	0	0	0	0	130	273
HOXC4	3221	broad.mit.edu	37	12	54448134	54448134	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:54448134A>G	ENST00000430889.2	+	1	474	c.428A>G	c.(427-429)cAc>cGc	p.H143R	HOXC4_ENST00000303406.4_Missense_Mutation_p.H143R|HOXC4_ENST00000609810.1_Missense_Mutation_p.H143R	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	143					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						AAAAAAATTCACGTTAGCACG	0.652																																						ENST00000430889.2	1.000000	6.700000e-01	0.990000	0.770000	0.870000	0.874722	0.870000	1.000000																										0				13						c.(427-429)cAc>cGc		homeobox C4							26.0	24.0	25.0					12																	54448134		2203	4300	6503	SO:0001583	missense	3221	0	0					g.chr12:54448134A>G		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.428A>G	chr12.hg19:g.54448134A>G	ENSP00000399808:p.His143Arg	0					HOXC4_ENST00000609810.1_Missense_Mutation_p.H143R|HOXC4_ENST00000303406.4_Missense_Mutation_p.H143R	p.H143R	NM_153633.2	NP_705897.1	1	2	3	2.092114	P09017	HXC4_HUMAN		1	474	+				Missense_Mutation	SNP	ENST00000430889.2	1	1	hg19	c.428A>G	CCDS8873.1	1	.	.	.	.	.	.	.	.	.	.	A	15.83	2.949247	0.53186	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.89681	-2.55;-2.55	4.26	4.26	0.50523	4.26	4.26	0.50523	Homeodomain-like (1);	0.117106	0.56097	D	0.000028	D	0.95133	0.8423	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	D	0.95959	0.8960	10	0.87932	D	0	.	12.7918	0.57539	1.0:0.0:0.0:0.0	.	143	P09017	HXC4_HUMAN	R	143	ENSP00000305973:H143R;ENSP00000399808:H143R	ENSP00000305973:H143R	H	+	2	0	0	HOXC4	52734401	52734401	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.711000	0.91396	1.918000	0.55548	0.379000	0.24179	CAC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.652	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1	1	0	1	2	19	2	2	0	0	0	1	32	32	32	31	1	1.890000	-20.000000	1	0.580000			0	52	52	0	154	151	0		1	1		0	0	32	0	0	9.999951e-01	8.053945e-01	0	2	0	9	0	52	154
ARHGAP9	64333	broad.mit.edu	37	12	57873000	57873000	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:57873000C>T	ENST00000356411.2	-	2	328	c.190G>A	c.(190-192)Gca>Aca	p.A64T	ARHGAP9_ENST00000430041.2_5'Flank|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.A135T|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.A64T|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.A64T|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.A143T			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	64	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			AGGCGTCTTGCCAACCACCAG	0.537																																						ENST00000356411.2	0.070000	0	0.050000	0.010000	0.020000	0.043983	0.020000	0.040000																										0				30						c.(190-192)Gca>Aca		Rho GTPase activating protein 9							145.0	122.0	130.0					12																	57873000		2203	4300	6503	SO:0001583	missense	64333	0	0					g.chr12:57873000C>T	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.190G>A	chr12.hg19:g.57873000C>T	ENSP00000348782:p.Ala64Thr	0					ARHGAP9_ENST00000550288.1_Missense_Mutation_p.A143T|ARHGAP9_ENST00000430041.2_5'Flank|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.A64T|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.A135T|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.A64T	p.A64T			1	2	3	2.092114	Q9BRR9	RHG09_HUMAN	GBM - Glioblastoma multiforme(3;3.37e-34)	2	328	-			B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	0	1	hg19	c.190G>A		0	.	.	.	.	.	.	.	.	.	.	C	25.0	4.587742	0.86851	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	4.97	4.97	0.65823	4.97	4.97	0.65823	Src homology-3 domain (4);	0.079838	0.49916	D	0.000134	T	0.55210	0.1906	M	0.64997	1.995	0.33210	D	0.553344	D;D;P;D;D	0.65815	0.986;0.995;0.77;0.982;0.986	P;D;P;P;P	0.67231	0.894;0.95;0.478;0.78;0.86	T	0.67256	-0.5716	10	0.62326	D	0.03	.	14.0957	0.65019	0.0:1.0:0.0:0.0	.	64;143;64;64;64	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9	.;.;RHG09_HUMAN;.;.	T	64;64;64;135;113	ENSP00000377380:A64T;ENSP00000348782:A64T;ENSP00000394307:A64T;ENSP00000377386:A135T	ENSP00000344852:A113T	A	-	1	0	0	ARHGAP9	56159267	56159267	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.695000	0.61767	2.460000	0.83146	0.655000	0.94253	GCA	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.537	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	1.890000	-2.287919	0	0.580000	NM_032496		0	6	6	0	680	671	0		1	0		0	0	106	0	0	9.636218e-01	1.181355e-04	0	0	0	2	0	6	680
PPFIA2	8499	broad.mit.edu	37	12	81839441	81839441	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:81839441G>A	ENST00000549396.1	-	6	624	c.464C>T	c.(463-465)aCg>aTg	p.T155M	PPFIA2_ENST00000333447.7_Missense_Mutation_p.T137M|PPFIA2_ENST00000550584.2_Missense_Mutation_p.T155M|PPFIA2_ENST00000443686.3_Missense_Mutation_p.T81M|PPFIA2_ENST00000548586.1_Missense_Mutation_p.T155M|RP11-315E17.1_ENST00000550272.1_RNA|PPFIA2_ENST00000407050.4_Missense_Mutation_p.T81M|PPFIA2_ENST00000550359.2_Missense_Mutation_p.T2M|PPFIA2_ENST00000549325.1_Missense_Mutation_p.T137M|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000552948.1_Missense_Mutation_p.T155M	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	155	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TTTTACCACCGTCATTCTTAG	0.423																																						ENST00000549396.1	1.000000	7.900000e-01	1.000000	0.900000	0.990000	0.964414	0.990000	1.000000																										0				85						c.(463-465)aCg>aTg		protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2							112.0	104.0	107.0					12																	81839441		1900	4123	6023	SO:0001583	missense	8499	1	120828	26				g.chr12:81839441G>A	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.464C>T	chr12.hg19:g.81839441G>A	ENSP00000450337:p.Thr155Met	0					PPFIA2_ENST00000550359.2_Missense_Mutation_p.T2M|PPFIA2_ENST00000548586.1_Missense_Mutation_p.T155M|PPFIA2_ENST00000443686.3_Missense_Mutation_p.T81M|PPFIA2_ENST00000552948.1_Missense_Mutation_p.T155M|RP11-315E17.1_ENST00000550272.1_RNA|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000550584.2_Missense_Mutation_p.T155M|PPFIA2_ENST00000333447.7_Missense_Mutation_p.T137M|PPFIA2_ENST00000549325.1_Missense_Mutation_p.T137M|PPFIA2_ENST00000407050.4_Missense_Mutation_p.T81M	p.T155M	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	1	2	3	2.092114	O75334	LIPA2_HUMAN		6	624	-			B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	1	1	hg19	c.464C>T	CCDS55857.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.147230	0.94603	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000551442	T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.83	5.83	0.93111	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.61986	0.2391	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.99	T	0.63346	-0.6658	10	0.87932	D	0	-13.5925	20.115	0.97926	0.0:0.0:1.0:0.0	.	55;155	B7Z4H8;O75334	.;LIPA2_HUMAN	M	155;137;81;166;137;155;81;155;137	ENSP00000450337:T155M;ENSP00000450298:T137M;ENSP00000385093:T81M;ENSP00000327416:T137M;ENSP00000449338:T155M;ENSP00000388373:T81M;ENSP00000447868:T155M;ENSP00000449469:T137M	ENSP00000327416:T137M	T	-	2	0	0	PPFIA2	80363572	80363572	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	9.869000	0.99810	2.761000	0.94854	0.650000	0.86243	ACG	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.423	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.890000	-6.123750	1	0.580000			0	54	54	0	130	128	1		1	0		0	0	53	0	0	1	0	0	0	0	1	0	54	130
POLR3B	55703	broad.mit.edu	37	12	106821038	106821038	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr12:106821038G>A	ENST00000228347.4	+	13	1387	c.1165G>A	c.(1165-1167)Gac>Aac	p.D389N	POLR3B_ENST00000539066.1_Missense_Mutation_p.D331N|POLR3B_ENST00000549195.1_3'UTR	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	389					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						AAAGATTGCCGACCAGGTGAT	0.353																																						ENST00000228347.4	0.130000	0	0.080000	0.020000	0.040000	0.065805	0.040000	0.040000																										0				57						c.(1165-1167)Gac>Aac		polymerase (RNA) III (DNA directed) polypeptide B							78.0	75.0	76.0					12																	106821038		2203	4300	6503	SO:0001583	missense	55703	2	121404	33				g.chr12:106821038G>A	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.1165G>A	chr12.hg19:g.106821038G>A	ENSP00000228347:p.Asp389Asn	0					POLR3B_ENST00000549195.1_3'UTR|POLR3B_ENST00000539066.1_Missense_Mutation_p.D331N	p.D389N	NM_018082.5	NP_060552.4	1	2	3	2.092114	Q9NW08	RPC2_HUMAN		13	1387	+			A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	0	1	hg19	c.1165G>A	CCDS9105.1	0	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717076	0.89205	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066;ENST00000549569;ENST00000549195	T;T;T	0.76448	0.03;0.03;-1.02	5.75	5.75	0.90469	5.75	5.75	0.90469	RNA polymerase, beta subunit, protrusion (1);	0.000000	0.85682	D	0.000000	T	0.81754	0.4889	M	0.72894	2.215	0.80722	D	1	P	0.35821	0.523	B	0.40940	0.344	T	0.81274	-0.1007	10	0.54805	T	0.06	-28.5091	20.3046	0.98621	0.0:0.0:1.0:0.0	.	389	Q9NW08	RPC2_HUMAN	N	389;389;331;147;52	ENSP00000228347:D389N;ENSP00000445721:D331N;ENSP00000448398:D147N	ENSP00000228347:D389N	D	+	1	0	0	POLR3B	105345168	105345168	1.000000	0.71417	0.998000	0.56505	0.872000	0.50106	9.304000	0.96190	2.878000	0.98634	0.650000	0.86243	GAC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.353	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	0	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	1.890000	-2.874050	1	0.580000	NM_018082		0	4	4	0	299	294	0		1	0		0	0	49	0	0	8.870701e-01	1.282031e-02	0	0	0	9	0	4	299
TUBA3C	7278	broad.mit.edu	37	13	19751421	19751421	+	Silent	SNP	G	G	A	rs142245280		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr13:19751421G>A	ENST00000400113.3	-	4	806	c.702C>T	c.(700-702)atC>atT	p.I234I		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	234					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TGGAGGACACGATCTGCCCAA	0.567																																						ENST00000400113.3	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.997827	0.990000	1.000000																										0				72						c.(700-702)atC>atT		tubulin, alpha 3c		G		3,4403	6.2+/-15.9	0,3,2200	179.0	151.0	161.0		702	0.3	1.0	13	dbSNP_134	161	0,8600		0,0,4300	no	coding-synonymous	TUBA3C	NM_006001.2		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		234/451	19751421	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	7278	10	121412	45				g.chr13:19751421G>A	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.702C>T	chr13.hg19:g.19751421G>A		0						p.I234I	NM_006001.2	NP_005992.1	1	2	3	2.125837	Q13748	TBA3C_HUMAN		4	806	-		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	1	1	hg19	c.702C>T	CCDS9284.1	1																																																																																								0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	1	0	0	2	2	2	2	0	0	0	0	126	126	126	128	1	1.890000	-20.000000	1	0.580000	NM_006001		0	250	244	0	563	548	0		1			0	0	126	0	0	1	0	0	0	0	0	0	250	563
MTUS2	23281	broad.mit.edu	37	13	30002979	30002979	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr13:30002979G>A	ENST00000542829.1	+	0	134				MTUS2_ENST00000431530.3_Intron|MTUS2_ENST00000380808.2_De_novo_Start_InFrame			Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2							cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGCCTGCCGGGATGGGCCATT	0.607																																						ENST00000542829.1	0.930000	6.100000e-01	0.850000	0.680000	0.760000	0.773584	0.760000	0.770000																										0				20								microtubule associated tumor suppressor candidate 2							95.0	105.0	102.0					13																	30002979		2133	4248	6381			23281	0	0					g.chr13:30002979G>A	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000542829.1:c.-204G>A	chr13.hg19:g.30002979G>A		0					MTUS2_ENST00000380808.2_De_novo_Start_InFrame|MTUS2_ENST00000431530.3_Intron				0	1	1	2.057634	Q5JR59	MTUS2_HUMAN		0	134	+			A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Translation_Start_Site	SNP	ENST00000542829.1	0	1	hg19			0																																																																																								0.578778		TCGA-IB-A6UF-01A-23D-A33T-08	0.607	MTUS2-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.890000	-20.000000	1	0.580000	XM_166270		0	66	66	0	229	224	0		1			0	0	49	0	0	1	0	0	0	0	0	0	66	229
STXBP6	29091	broad.mit.edu	37	14	25325303	25325303	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr14:25325303G>A	ENST00000323944.5	-	4	741	c.290C>T	c.(289-291)tCg>tTg	p.S97L	STXBP6_ENST00000396700.1_Missense_Mutation_p.S97L|STXBP6_ENST00000419632.2_Missense_Mutation_p.S97L|STXBP6_ENST00000548724.1_Missense_Mutation_p.S97L|STXBP6_ENST00000546511.1_Missense_Mutation_p.S97L|STXBP6_ENST00000550887.1_Missense_Mutation_p.S97L|STXBP6_ENST00000358326.2_Missense_Mutation_p.S97L			Q8NFX7	STXB6_HUMAN	syntaxin binding protein 6 (amisyn)	97					negative regulation of exocytosis (GO:0045920)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|large_intestine(3)	7				GBM - Glioblastoma multiforme(265;0.0296)		AAACTCTGCCGAATCCTGGAA	0.388																																						ENST00000323944.5	0.190000	3.000000e-02	0.140000	0.050000	0.090000	0.099740	0.090000	0.080000																										0				7						c.(289-291)tCg>tTg		syntaxin binding protein 6 (amisyn)							68.0	61.0	63.0					14																	25325303		2203	4300	6503	SO:0001583	missense	29091	1	121374	28				g.chr14:25325303G>A	AF161505	CCDS9634.1	14q11.2	2002-12-18			ENSG00000168952	ENSG00000168952			19666	protein-coding gene	gene with protein product		607958				12145319	Standard	NM_014178		Approved	amisyn, HSPC156	uc001wpu.3	Q8NFX7	OTTHUMG00000140186	ENST00000323944.5:c.290C>T	chr14.hg19:g.25325303G>A	ENSP00000324302:p.Ser97Leu	0					STXBP6_ENST00000546511.1_Missense_Mutation_p.S97L|STXBP6_ENST00000550887.1_Missense_Mutation_p.S97L|STXBP6_ENST00000358326.2_Missense_Mutation_p.S97L|STXBP6_ENST00000548724.1_Missense_Mutation_p.S97L|STXBP6_ENST00000419632.2_Missense_Mutation_p.S97L|STXBP6_ENST00000396700.1_Missense_Mutation_p.S97L	p.S97L			1	2	3	2.075291	Q8NFX7	STXB6_HUMAN		4	741	-			D3DS78|Q8N3H1|Q8N8D5|Q96GF3|Q9P008	Missense_Mutation	SNP	ENST00000323944.5	0	1	hg19	c.290C>T	CCDS9634.1	0	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781990	0.49891	.	.	ENSG00000168952	ENST00000396700;ENST00000548724;ENST00000323944;ENST00000419632;ENST00000546511;ENST00000550887;ENST00000358326	.	.	.	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.189920	0.47455	D	0.000223	T	0.33147	0.0853	N	0.14661	0.345	0.50171	D	0.999858	P	0.34587	0.458	B	0.14578	0.011	T	0.28299	-1.0048	9	0.48119	T	0.1	0.0641	16.1225	0.81369	0.0:0.0:1.0:0.0	.	97	Q8NFX7	STXB6_HUMAN	L	97	.	ENSP00000324302:S97L	S	-	2	0	0	STXBP6	24395143	24395143	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	5.030000	0.64128	2.405000	0.81733	0.563000	0.77884	TCG	0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.388	STXBP6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409166.1	0	0	1	2	2	2	2	0	0	0	0	50	50	50	49	1	1.890000	-2.322710	0	0.580000			0	6	6	0	234	232	0		1	0		0	0	50	0	0	9.646186e-01	4.474082e-01	0	0	0	54	0	6	234
NPAS3	64067	broad.mit.edu	37	14	34269655	34269655	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr14:34269655G>A	ENST00000356141.4	+	12	2142	c.2142G>A	c.(2140-2142)tcG>tcA	p.S714S	NPAS3_ENST00000548645.1_Silent_p.S684S|NPAS3_ENST00000357798.5_Silent_p.S701S|NPAS3_ENST00000551492.1_Silent_p.S719S|NPAS3_ENST00000346562.2_Silent_p.S682S			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	714	Gly-rich.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TTCCCGACTCGGTCCTCAccc	0.781																																						ENST00000356141.4	0.530000	1.000000e-01	0.390000	0.160000	0.260000	0.281397	0.260000	0.240000																										0				40						c.(2140-2142)tcG>tcA		neuronal PAS domain protein 3							3.0	5.0	4.0					14																	34269655		1516	3107	4623	SO:0001819	synonymous_variant	64067	0	0					g.chr14:34269655G>A	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2142G>A	chr14.hg19:g.34269655G>A		0					NPAS3_ENST00000357798.5_Silent_p.S701S|NPAS3_ENST00000548645.1_Silent_p.S684S|NPAS3_ENST00000551492.1_Silent_p.S719S|NPAS3_ENST00000346562.2_Silent_p.S682S	p.S714S			1	2	3	2.075291	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	12	2142	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	0	1	hg19	c.2142G>A	CCDS53891.1	0																																																																																								0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.781	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1	0	0	1	2	2	2	2	0	0	0	0	15	15	15	14	1	1.890000	-11.730440	1	0.580000			0	5	5	0	66	64	0		1			0	0	15	0	0	9.351575e-01	0	0	0	0	0	0	5	66
OCA2	4948	broad.mit.edu	37	15	28202828	28202828	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr15:28202828C>T	ENST00000354638.3	-	16	1845	c.1690G>A	c.(1690-1692)Gcc>Acc	p.A564T	OCA2_ENST00000353809.5_Missense_Mutation_p.A540T|OCA2_ENST00000382996.2_Missense_Mutation_p.A564T	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	564					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TCGCGGCTGGCCGGGCTGATG	0.637									Oculocutaneous Albinism																													ENST00000354638.3	0.140000	1.000000e-02	0.100000	0.030000	0.050000	0.069228	0.050000	0.060000																										0				85						c.(1690-1692)Gcc>Acc		oculocutaneous albinism II							25.0	27.0	26.0					15																	28202828		2196	4289	6485	SO:0001583	missense	4948	0	0		Oculocutaneous Albinism	Familial Cancer Database		g.chr15:28202828C>T		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1690G>A	chr15.hg19:g.28202828C>T	ENSP00000346659:p.Ala564Thr	1					OCA2_ENST00000382996.2_Missense_Mutation_p.A564T|OCA2_ENST00000353809.5_Missense_Mutation_p.A540T	p.A564T	NM_000275.2	NP_000266.2	0	2	2	2.110430	Q04671	P_HUMAN		16	1845	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	0	1	hg19	c.1690G>A	CCDS10020.1	0	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800578	0.70567	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.90955	-2.76;-2.57;-2.74	5.8	5.8	0.92144	5.8	5.8	0.92144	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	D	0.89825	0.6827	L	0.29908	0.895	0.53005	D	0.999962	P;P	0.50819	0.929;0.939	P;P	0.53549	0.729;0.673	D	0.87323	0.2319	10	0.23302	T	0.38	-14.3158	17.5483	0.87869	0.0:1.0:0.0:0.0	.	540;564	Q04671-2;Q04671	.;P_HUMAN	T	564;540;564	ENSP00000346659:A564T;ENSP00000261276:A540T;ENSP00000372457:A564T	ENSP00000261276:A540T	A	-	1	0	0	OCA2	25876423	25876423	1.000000	0.71417	0.994000	0.49952	0.464000	0.32679	6.883000	0.75595	2.746000	0.94184	0.591000	0.81541	GCC	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.637	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	0	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	1.890000	-3.761653	1	0.580000	NM_000275		0	4	4	0	242	236	0		1			0	0	53	0	0	8.852180e-01	0	0	0	0	0	0	4	242
IGDCC4	57722	broad.mit.edu	37	15	65681260	65681260	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr15:65681260G>A	ENST00000352385.2	-	15	2802	c.2593C>T	c.(2593-2595)Cgg>Tgg	p.R865W		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	865	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CAGTGCAGCCGAACCGTGGAC	0.652																																						ENST00000352385.2	1.000000	8.500000e-01	1.000000	0.920000	0.980000	0.972118	0.980000	1.000000																										0				44						c.(2593-2595)Cgg>Tgg		immunoglobulin superfamily, DCC subclass, member 4							38.0	30.0	33.0					15																	65681260		2200	4298	6498	SO:0001583	missense	57722	0	0					g.chr15:65681260G>A		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2593C>T	chr15.hg19:g.65681260G>A	ENSP00000319623:p.Arg865Trp	1						p.R865W	NM_020962.1	NP_066013.1	0	1	1	1.514340	Q8TDY8	IGDC4_HUMAN		15	2802	-			Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	1	1	hg19	c.2593C>T	CCDS10206.1	1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703326	0.68501	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.58210	0.35	4.97	4.04	0.47022	4.97	4.04	0.47022	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.356482	0.27397	N	0.019557	T	0.73393	0.3581	M	0.83223	2.63	0.32760	N	0.505288	D	0.89917	1.0	D	0.72338	0.977	T	0.82617	-0.0369	10	0.66056	D	0.02	-15.3636	14.6226	0.68597	0.0:0.0:0.8533:0.1467	.	865	Q8TDY8	IGDC4_HUMAN	W	865;594	ENSP00000319623:R865W	ENSP00000319623:R865W	R	-	1	2	2	IGDCC4	63468313	63468313	1.000000	0.71417	0.796000	0.32109	0.754000	0.42855	4.717000	0.61923	1.074000	0.40909	0.561000	0.74099	CGG	0.417960		TCGA-IB-A6UF-01A-23D-A33T-08	0.652	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.890000	-20.000000	1	0.580000	NM_020962		0	72	69	0	92	91	1		1	0		0	0	39	0	0	1	0	0	0	0	1	0	72	92
DIS3L	115752	broad.mit.edu	37	15	66607419	66607419	+	Missense_Mutation	SNP	G	G	A	rs200076422		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr15:66607419G>A	ENST00000319212.4	+	7	910	c.860G>A	c.(859-861)cGc>cAc	p.R287H	DIS3L_ENST00000441424.2_Missense_Mutation_p.R153H|DIS3L_ENST00000319194.5_Missense_Mutation_p.R204H|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	287					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GCTCGAAACCGCTCAATTCAT	0.478																																						ENST00000319212.4	0.090000	1.000000e-02	0.070000	0.020000	0.040000	0.049567	0.040000	0.040000																										0				33						c.(859-861)cGc>cAc		DIS3 like exosome 3'-5' exoribonuclease							144.0	125.0	131.0					15																	66607419		2201	4299	6500	SO:0001583	missense	115752	0	0					g.chr15:66607419G>A		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.860G>A	chr15.hg19:g.66607419G>A	ENSP00000321711:p.Arg287His	1					RP11-352G18.2_ENST00000565993.1_RNA|DIS3L_ENST00000441424.2_Missense_Mutation_p.R153H|DIS3L_ENST00000319194.5_Missense_Mutation_p.R204H	p.R287H	NM_001143688.1	NP_001137160.1	0	1	1	1.514340	Q8TF46	DI3L1_HUMAN		7	910	+			Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	0	1	hg19	c.860G>A	CCDS45286.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.664037	0.96745	.	.	ENSG00000166938	ENST00000319194;ENST00000441424;ENST00000319212	T;T;T	0.36699	1.24;1.24;1.24	5.34	5.34	0.76211	5.34	5.34	0.76211	.	0.156269	0.56097	D	0.000038	T	0.72566	0.3476	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.81061	-0.1103	10	0.66056	D	0.02	-15.751	18.3807	0.90449	0.0:0.0:1.0:0.0	.	287;287	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	H	204;153;287	ENSP00000321583:R204H;ENSP00000388980:R153H;ENSP00000321711:R287H	ENSP00000321583:R204H	R	+	2	0	0	DIS3L	64394473	64394473	1.000000	0.71417	0.993000	0.49108	0.963000	0.63663	9.386000	0.97228	2.655000	0.90218	0.561000	0.74099	CGC	0.417960		TCGA-IB-A6UF-01A-23D-A33T-08	0.478	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	0	0	1	2	17	2	2	1	1	1	1	68	68	68	67	1	1.890000	-2.363023	0	0.580000	NM_133375		0	6	5	0	342	339	0		0	0		1	0	68	0	0	1.455269e-02	4.306585e-02	0	0	0	16	0	6	342
MEFV	4210	broad.mit.edu	37	16	3293588	3293588	+	Silent	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr16:3293588C>T	ENST00000219596.1	-	10	1938	c.1899G>A	c.(1897-1899)ccG>ccA	p.P633P	MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000536379.1_Silent_p.P422P|MEFV_ENST00000339854.4_Silent_p.P453P	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	633	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CAAATCTTTGCGGGCCATCAG	0.517																																						ENST00000219596.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999808	0.990000	1.000000																										0				50						c.(1897-1899)ccG>ccA		Mediterranean fever							158.0	170.0	166.0					16																	3293588		2197	4300	6497	SO:0001819	synonymous_variant	4210	2	121410	38				g.chr16:3293588C>T	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1899G>A	chr16.hg19:g.3293588C>T		0					MEFV_ENST00000339854.4_Silent_p.P453P|MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000536379.1_Silent_p.P422P	p.P633P	NM_000243.2	NP_000234.1	2	2	4	2.202141	O15553	MEFV_HUMAN		10	1938	-			D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	1	1	hg19	c.1899G>A	CCDS10498.1	1																																																																																								0.607330		TCGA-IB-A6UF-01A-23D-A33T-08	0.517	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	1	0	1	2	20	2	2	1	1	1	1	196	196	196	196	1	1.890000	-20.000000	1	0.580000	NM_000243		0	352	347	0	818	808	1		1	0		1	0	196	0	0	1	0	0	0	0	1	0	352	818
KIAA0556	23247	broad.mit.edu	37	16	27659970	27659970	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr16:27659970G>A	ENST00000261588.4	+	6	473	c.454G>A	c.(454-456)Gaa>Aaa	p.E152K	KIAA0556_ENST00000567894.1_3'UTR	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	152						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GCTCCACATCGAACCTCCTGT	0.493																																						ENST00000261588.4	1.000000	7.600000e-01	1.000000	0.840000	0.920000	0.924028	0.920000	1.000000																										0				76						c.(454-456)Gaa>Aaa		KIAA0556							101.0	83.0	89.0					16																	27659970		2197	4300	6497	SO:0001583	missense	23247	0	0					g.chr16:27659970G>A	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.454G>A	chr16.hg19:g.27659970G>A	ENSP00000261588:p.Glu152Lys	0					KIAA0556_ENST00000567894.1_3'UTR	p.E152K	NM_015202.2	NP_056017.2	1	2	3	2.168314	O60303	K0556_HUMAN		6	473	+			A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	1	1	hg19	c.454G>A	CCDS32415.1	1	.	.	.	.	.	.	.	.	.	.	G	7.339	0.620581	0.14193	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.50548	0.74	4.82	1.53	0.23141	4.82	1.53	0.23141	.	0.621024	0.16295	N	0.220719	T	0.39989	0.1099	L	0.46157	1.445	0.28141	N	0.929802	D;B	0.55605	0.972;0.086	P;B	0.45099	0.469;0.01	T	0.35025	-0.9805	10	0.10111	T	0.7	-3.534	12.6071	0.56529	0.0:0.4961:0.5039:0.0	.	17;152	Q8N803;O60303	.;K0556_HUMAN	K	152;16	ENSP00000261588:E152K	ENSP00000261588:E152K	E	+	1	0	0	KIAA0556	27567471	27567471	0.034000	0.19679	0.958000	0.39756	0.186000	0.23388	0.800000	0.27042	0.134000	0.18681	-0.181000	0.13052	GAA	0.590683		TCGA-IB-A6UF-01A-23D-A33T-08	0.493	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.890000	-20.000000	1	0.580000	NM_015202		0	86	86	0	243	241	1		1	1		0	0	57	0	0	1	8.235598e-01	0	2	0	9	0	86	243
WFIKKN1	117166	broad.mit.edu	37	16	683104	683104	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr16:683104C>T	ENST00000319070.2	+	2	1016	c.694C>T	c.(694-696)Cgc>Tgc	p.R232C		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	232	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				CCTGATCATGCGCCCTGATCA	0.662																																						ENST00000319070.2	1.000000	0	0.100000	0.020000	0.050000	0.120980	0.050000	0.050000																										0				4						c.(694-696)Cgc>Tgc		WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1							32.0	34.0	34.0					16																	683104		2193	4281	6474	SO:0001583	missense	117166	1	120734	26				g.chr16:683104C>T	AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.694C>T	chr16.hg19:g.683104C>T	ENSP00000324763:p.Arg232Cys	0						p.R232C	NM_053284.2	NP_444514.1	1	2	3	2.156022	Q96NZ8	WFKN1_HUMAN		2	1016	+		Hepatocellular(780;0.00335)	Q7LDW0|Q8NBQ1|Q96S20	Missense_Mutation	SNP	ENST00000319070.2	0	1	hg19	c.694C>T	CCDS10414.1	0	.	.	.	.	.	.	.	.	.	.	c	15.20	2.763443	0.49574	.	.	ENSG00000127578	ENST00000319070	T	0.70631	-0.5	4.71	3.71	0.42584	4.71	3.71	0.42584	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.057277	0.64402	D	0.000003	T	0.81163	0.4765	M	0.72624	2.21	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.82752	-0.0302	10	0.72032	D	0.01	.	11.0862	0.48089	0.3279:0.6721:0.0:0.0	.	232	Q96NZ8	WFKN1_HUMAN	C	232	ENSP00000324763:R232C	ENSP00000324763:R232C	R	+	1	0	0	WFIKKN1	623105	623105	0.996000	0.38824	0.990000	0.47175	0.767000	0.43475	0.491000	0.22419	2.174000	0.68829	0.486000	0.48141	CGC	0.589523		TCGA-IB-A6UF-01A-23D-A33T-08	0.662	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206731.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	45	1	1.890000	-4.086946	1	0.580000	NM_053284		0	4	4	0	284	283	0		1	0		0	0	46	0	0	8.902209e-01	0	0	0	0	1	0	4	284
DPEP2	64174	broad.mit.edu	37	16	68026461	68026461	+	Silent	SNP	G	G	A	rs535237474		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr16:68026461G>A	ENST00000572888.1	-	2	992	c.342C>T	c.(340-342)taC>taT	p.Y114Y	DPEP2_ENST00000412757.2_Silent_p.Y114Y|DPEP2_ENST00000393847.1_Silent_p.Y114Y			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	114					arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		TGGTCTGGCCGTAGCTGAAAT	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		19692	0.0		0.0	False		,,,				2504	0.001					ENST00000572888.1	1.000000	0	0.060000	0.010000	0.030000	0.081876	0.030000	0.040000																										0				17						c.(340-342)taC>taT		dipeptidase 2							101.0	92.0	95.0					16																	68026461		2198	4300	6498	SO:0001819	synonymous_variant	64174	2	121412	34				g.chr16:68026461G>A	AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.342C>T	chr16.hg19:g.68026461G>A		0					DPEP2_ENST00000393847.1_Silent_p.Y114Y|DPEP2_ENST00000412757.2_Silent_p.Y114Y	p.Y114Y			1	2	3	2.128044	Q9H4A9	DPEP2_HUMAN		2	992	-		Ovarian(137;0.192)	B2RCF8|Q6UX92|Q8TC95	Silent	SNP	ENST00000572888.1	0	1	hg19	c.342C>T	CCDS10857.1	0																																																																																								0.587183		TCGA-IB-A6UF-01A-23D-A33T-08	0.602	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	87	1	1.890000	-2.503939	1	0.580000	NM_022355		0	5	5	0	557	550	0		1	0		0	0	88	0	0	9.357163e-01	1.281202e-03	0	0	0	5	0	5	557
ZNF594	84622	broad.mit.edu	37	17	5085387	5085387	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr17:5085387G>A	ENST00000399604.4	-	1	2305	c.2165C>T	c.(2164-2166)gCt>gTt	p.A722V	ZNF594_ENST00000575779.1_Missense_Mutation_p.A722V			Q96JF6	ZN594_HUMAN	zinc finger protein 594	722					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TTTGAGGAAAGCCGTGTGCCA	0.458																																						ENST00000399604.4	0.050000	0	0.040000	0.010000	0.020000	0.028263	0.020000	0.030000																										0				33						c.(2164-2166)gCt>gTt		zinc finger protein 594							140.0	148.0	145.0					17																	5085387		2157	4284	6441	SO:0001583	missense	84622	0	0					g.chr17:5085387G>A	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.2165C>T	chr17.hg19:g.5085387G>A	ENSP00000382513:p.Ala722Val	1					ZNF594_ENST00000575779.1_Missense_Mutation_p.A722V	p.A722V			0	1	1	1.574888	Q96JF6	ZN594_HUMAN		1	2305	-			Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	0	1	hg19	c.2165C>T	CCDS42241.1	0	.	.	.	.	.	.	.	.	.	.	g	1.376	-0.584769	0.03827	.	.	ENSG00000180626	ENST00000399604;ENST00000389222	T	0.28666	1.6	1.17	-2.35	0.06684	1.17	-2.35	0.06684	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15003	0.0362	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21245	-1.0251	9	0.28530	T	0.3	.	3.8079	0.08785	0.0:0.276:0.5078:0.2162	.	722	Q96JF6	ZN594_HUMAN	V	722;289	ENSP00000382513:A722V	ENSP00000373874:A289V	A	-	2	0	0	ZNF594	5026111	5026111	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.467000	0.00461	-1.230000	0.02561	-1.706000	0.00718	GCT	0.417960		TCGA-IB-A6UF-01A-23D-A33T-08	0.458	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	129	1	1.890000	-2.836208	1	0.580000	XM_290737		0	6	6	0	607	593	0		1	0		0	0	131	0	0	9.623361e-01	1.431008e-03	0	0	0	5	0	6	607
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.100000e-01	1.000000	0.890000	0.950000	0.947607	0.950000	1.000000	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	24185	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	c.(817-819)cGt>cAt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	7157	3	121412	34	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577120C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	chr17.hg19:g.7577120C>T	ENSP00000269305:p.Arg273His	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron	p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.575164	P04637	P53_HUMAN		8	1007	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.818G>A	CCDS11118.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	0	TP53	7517845	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	0.410857		TCGA-IB-A6UF-01A-23D-A33T-08	0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	1.890000	-20.000000	1	0.580000	NM_000546		0	54	54	0	68	66	1		1	1	1	0	0	34	1383	0	1	1	1	25	254	27	448	54	68
USH1G	124590	broad.mit.edu	37	17	72915717	72915717	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr17:72915717G>A	ENST00000319642.1	-	2	1396	c.1214C>T	c.(1213-1215)gCc>gTc	p.A405V		NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	405	SAM.				equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					CAGGAGGGCGGCAAAGTCCTC	0.627																																						ENST00000319642.1	0.090000	1.000000e-02	0.070000	0.020000	0.040000	0.048453	0.040000	0.040000																									HN1/USH1G(2)	0				14						c.(1213-1215)gCc>gTc		Usher syndrome 1G (autosomal recessive)							46.0	43.0	44.0					17																	72915717		2203	4298	6501	SO:0001583	missense	124590	0	0					g.chr17:72915717G>A	AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.1214C>T	chr17.hg19:g.72915717G>A	ENSP00000320076:p.Ala405Val	1						p.A405V	NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	0	1	1	1.629491	Q495M9	USH1G_HUMAN		2	1396	-	all_lung(278;0.172)|Lung NSC(278;0.207)		Q8N251	Missense_Mutation	SNP	ENST00000319642.1	0	1	hg19	c.1214C>T	CCDS32725.1	0	.	.	.	.	.	.	.	.	.	.	G	8.703	0.910112	0.17833	.	.	ENSG00000182040	ENST00000319642	T	0.49139	0.79	4.53	0.999	0.19862	4.53	0.999	0.19862	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.770174	0.12427	N	0.469921	T	0.18800	0.0451	N	0.02765	-0.5	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16424	-1.0403	10	0.28530	T	0.3	-6.1315	3.7981	0.08747	0.2204:0.5:0.2796:0.0	.	405	Q495M9	USH1G_HUMAN	V	405	ENSP00000320076:A405V	ENSP00000320076:A405V	A	-	2	0	0	USH1G	70427312	70427312	0.662000	0.27439	0.015000	0.15790	0.947000	0.59692	3.769000	0.55303	0.479000	0.27511	0.555000	0.69702	GCC	0.410857		TCGA-IB-A6UF-01A-23D-A33T-08	0.627	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443676.1	0	0	1	2	14	2	2	1	1	1	1	78	78	78	78	1	1.890000	-2.694812	1	0.580000	NM_173477		0	5	5	0	296	290	0		0			1	0	78	0	0	2.593770e-02	0	0	0	0	0	0	5	296
ZNF750	79755	broad.mit.edu	37	17	80788076	80788076	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr17:80788076G>A	ENST00000269394.3	-	3	2947	c.2114C>T	c.(2113-2115)gCg>gTg	p.A705V	ZNF750_ENST00000572562.1_Missense_Mutation_p.A306V|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	705					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A705V(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CTGCAGCTTCGCCTTCTTAGC	0.567																																						ENST00000269394.3	1.000000	9.100000e-01	1.000000	0.960000	0.990000	0.989593	0.990000	1.000000																										1	Substitution - Missense(1)	p.A705V(1)	large_intestine(1)	31						c.(2113-2115)gCg>gTg		zinc finger protein 750							122.0	101.0	108.0					17																	80788076		2203	4300	6503	SO:0001583	missense	79755	0	0					g.chr17:80788076G>A	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.2114C>T	chr17.hg19:g.80788076G>A	ENSP00000269394:p.Ala705Val	1					TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_Missense_Mutation_p.A306V|TBCD_ENST00000355528.4_Intron|TBCD_ENST00000397466.2_Intron	p.A705V	NM_024702.2	NP_078978.2	0	1	1	1.585809	Q32MQ0	ZN750_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)	3	2947	-	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	Q9H899	Missense_Mutation	SNP	ENST00000269394.3	1	1	hg19	c.2114C>T	CCDS11819.1	1	.	.	.	.	.	.	.	.	.	.	G	2.983	-0.209835	0.06140	.	.	ENSG00000141579	ENST00000269394;ENST00000543850	T	0.11604	2.76	5.28	-0.647	0.11468	5.28	-0.647	0.11468	.	1.559540	0.03792	N	0.263027	T	0.06690	0.0171	L	0.27053	0.805	0.09310	N	1	B	0.24132	0.098	B	0.14578	0.011	T	0.33599	-0.9862	9	.	.	.	0.0083	1.0216	0.01519	0.3312:0.2658:0.2669:0.136	.	705	Q32MQ0	ZN750_HUMAN	V	705;298	ENSP00000269394:A705V	.	A	-	2	0	0	ZNF750	78381365	78381365	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	-0.130000	0.10498	-0.019000	0.14055	-0.339000	0.08088	GCG	0.420290		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.890000	-19.999980	1	0.580000	NM_024702		0	136	136	0	175	176	1		1	0		0	0	79	0	0	1	0	0	0	0	1	0	136	175
GNAL	2774	broad.mit.edu	37	18	11752449	11752449	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr18:11752449G>A	ENST00000423027.3	+	1	338	c.17G>A	c.(16-18)gGc>gAc	p.G6D	GNAL_ENST00000535121.1_Missense_Mutation_p.G6D|GNAL_ENST00000334049.6_Intron|GNAL_ENST00000269162.5_Missense_Mutation_p.G6D			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	6					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						TGTTTGGGCGGCAACAGCAAG	0.557																																						ENST00000423027.3	0.060000	0	0.040000	0.010000	0.020000	0.030418	0.020000	0.030000																										0				12						c.(16-18)gGc>gAc		guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type							96.0	97.0	97.0					18																	11752449		2203	4300	6503	SO:0001583	missense	2774	0	0					g.chr18:11752449G>A	AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.17G>A	chr18.hg19:g.11752449G>A	ENSP00000408489:p.Gly6Asp	1					GNAL_ENST00000334049.6_Intron|GNAL_ENST00000269162.5_Missense_Mutation_p.G6D|GNAL_ENST00000535121.1_Missense_Mutation_p.G6D	p.G6D			0	1	1	1.489096	P38405	GNAL_HUMAN		1	338	+			B7ZA26|Q86XU3	Missense_Mutation	SNP	ENST00000423027.3	0	1	hg19	c.17G>A	CCDS11852.1	0	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599844	0.87055	.	.	ENSG00000141404	ENST00000535121;ENST00000269162;ENST00000423027	D;D;D	0.88975	-2.45;-2.45;-2.45	4.04	4.04	0.47022	4.04	4.04	0.47022	.	.	.	.	.	D	0.90783	0.7106	L	0.34521	1.04	0.34358	D	0.690637	D	0.57257	0.979	D	0.69654	0.965	D	0.93188	0.6580	9	0.59425	D	0.04	.	15.6287	0.76885	0.0:0.0:1.0:0.0	.	6	P38405	GNAL_HUMAN	D	6	ENSP00000439023:G6D;ENSP00000269162:G6D;ENSP00000408489:G6D	ENSP00000269162:G6D	G	+	2	0	0	GNAL	11742449	11742449	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.928000	0.92853	2.542000	0.85734	0.491000	0.48974	GGC	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.557	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254561.2	0	0	1	2	2	2	2	0	0	0	0	107	107	107	105	1	1.890000	-1.947327	0	0.580000	NM_182978, NM_002071		0	5	5	0	474	473	0		1		0	0	0	107	83	0	9.375014e-01	0	6.879596e-02	0	0	0	33	5	474
FHOD3	80206	broad.mit.edu	37	18	33952645	33952645	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr18:33952645G>A	ENST00000359247.4	+	3	275	c.275G>A	c.(274-276)cGg>cAg	p.R92Q	FHOD3_ENST00000257209.4_Missense_Mutation_p.R92Q|FHOD3_ENST00000590592.1_Missense_Mutation_p.R92Q|FHOD3_ENST00000445677.1_Missense_Mutation_p.R92Q	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	92	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.R92Q(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CTCGTTAGGCGGGGCAAGAAG	0.527																																						ENST00000359247.4	1.000000	7.400000e-01	0.980000	0.830000	0.910000	0.908998	0.910000	0.980000																										1	Substitution - Missense(1)	p.R92Q(1)	central_nervous_system(1)	90						c.(274-276)cGg>cAg		formin homology 2 domain containing 3							82.0	62.0	69.0					18																	33952645		2203	4300	6503	SO:0001583	missense	80206	3	121410	31				g.chr18:33952645G>A	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.275G>A	chr18.hg19:g.33952645G>A	ENSP00000352186:p.Arg92Gln	1					FHOD3_ENST00000590592.1_Missense_Mutation_p.R92Q|FHOD3_ENST00000445677.1_Missense_Mutation_p.R92Q|FHOD3_ENST00000257209.4_Missense_Mutation_p.R92Q	p.R92Q	NM_001281739.1	NP_001268668.1	0	1	1	1.487366	Q2V2M9	FHOD3_HUMAN		3	275	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	1	1	hg19	c.275G>A		1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469151	0.84533	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.19250	2.16;2.16;2.16	5.07	5.07	0.68467	5.07	5.07	0.68467	GTPase-binding/formin homology 3 (1);	0.059478	0.64402	D	0.000009	T	0.36635	0.0974	L	0.40543	1.245	0.28823	N	0.897568	D;D;P	0.71674	0.998;0.998;0.705	P;D;B	0.75484	0.74;0.986;0.016	T	0.09378	-1.0677	10	0.62326	D	0.03	.	13.8335	0.63395	0.0:0.0:1.0:0.0	.	92;92;92	Q2V2M9;Q2V2M9-3;E5F5Q0	FHOD3_HUMAN;.;.	Q	92	ENSP00000257209:R92Q;ENSP00000352186:R92Q;ENSP00000411430:R92Q	ENSP00000257209:R92Q	R	+	2	0	0	FHOD3	32206643	32206643	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.372000	0.73123	2.633000	0.89246	0.650000	0.86243	CGG	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.527	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.890000	-9.849917	1	0.580000	XM_371114		0	48	47	0	71	71	1		1	1		0	0	22	0	0	1	8.912068e-01	0	8	0	0	0	48	71
RFX1	5989	broad.mit.edu	37	19	14088833	14088833	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:14088833G>A	ENST00000254325.4	-	8	1134	c.900C>T	c.(898-900)ggC>ggT	p.G300G		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	300					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			TGGCATCGCCGCCCTCCACAT	0.657																																						ENST00000254325.4	0.060000	0	0.040000	0.010000	0.020000	0.029799	0.020000	0.030000																										0				21						c.(898-900)ggC>ggT		regulatory factor X, 1 (influences HLA class II expression)							122.0	110.0	114.0					19																	14088833		2203	4300	6503	SO:0001819	synonymous_variant	5989	1	121406	34				g.chr19:14088833G>A		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.900C>T	chr19.hg19:g.14088833G>A		1						p.G300G	NM_002918.4	NP_002909.4	0	1	1	1.628610	P22670	RFX1_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)	8	1134	-				Silent	SNP	ENST00000254325.4	0	1	hg19	c.900C>T	CCDS12301.1	0																																																																																								0.420290		TCGA-IB-A6UF-01A-23D-A33T-08	0.657	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	0	0	1	2	2	2	2	0	0	0	0	120	120	120	119	1	1.890000	-2.293379	0	0.580000	NM_002918		0	5	5	0	494	484	0		1	0		0	0	120	0	0	9.341090e-01	1.724434e-02	0	0	0	16	0	5	494
TSHZ3	57616	broad.mit.edu	37	19	31768582	31768582	+	Missense_Mutation	SNP	G	G	A	rs112525703		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:31768582G>A	ENST00000240587.4	-	2	2444	c.2117C>T	c.(2116-2118)aCg>aTg	p.T706M		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	706					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GATGATGGCCGTGCTGCCACT	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		1340	0.0		0.0	False		,,,				2504	0.0					ENST00000240587.4	1.000000	8.400000e-01	1.000000	0.910000	0.990000	0.970222	0.990000	1.000000																										0				123						c.(2116-2118)aCg>aTg		teashirt zinc finger homeobox 3							52.0	52.0	52.0					19																	31768582		2203	4300	6503	SO:0001583	missense	57616	3	119666	26				g.chr19:31768582G>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2117C>T	chr19.hg19:g.31768582G>A	ENSP00000240587:p.Thr706Met	0						p.T706M	NM_020856.2	NP_065907.2	0	0	0	2.009038	Q63HK5	TSH3_HUMAN		2	2444	-	Esophageal squamous(110;0.226)		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	1	1	hg19	c.2117C>T	CCDS12421.2	1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	17.95	3.514351	0.64522	.	.	ENSG00000121297	ENST00000240587	T	0.38722	1.12	5.4	5.4	0.78164	5.4	5.4	0.78164	.	5.739330	0.00951	N	0.002966	T	0.67961	0.2949	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.49652	-0.8917	10	0.54805	T	0.06	-23.6274	19.176	0.93603	0.0:0.0:1.0:0.0	.	706	Q63HK5	TSH3_HUMAN	M	706	ENSP00000240587:T706M	ENSP00000240587:T706M	T	-	2	0	0	TSHZ3	36460422	36460422	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	9.441000	0.97557	2.520000	0.84964	0.650000	0.86243	ACG	0.567456		TCGA-IB-A6UF-01A-23D-A33T-08	0.627	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	1	0	1	2	2	2	2	0	0	0	0	83	83	83	81	1	1.890000	-8.963517	1	0.580000	NM_020856		0	116	116	0	272	269	1		1	0		0	0	83	0	0	1	6.684314e-01	0	0	0	7	0	116	272
MRPS12	6183	broad.mit.edu	37	19	39423173	39423173	+	Missense_Mutation	SNP	C	C	T	rs140018981	byFrequency	TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:39423173C>T	ENST00000407800.2	+	2	591	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W	CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000594171.1_5'Flank|SARS2_ENST00000430193.3_5'Flank|CTC-360G5.9_ENST00000599320.1_lincRNA|SARS2_ENST00000448145.2_Intron|MRPS12_ENST00000402029.3_Missense_Mutation_p.R84W|SARS2_ENST00000600042.1_5'Flank|MRPS12_ENST00000308018.4_Missense_Mutation_p.R84W|SARS2_ENST00000221431.6_5'Flank	NM_021107.1	NP_066930.1	O15235	RT12_HUMAN	mitochondrial ribosomal protein S12	84					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)	2	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CTGTCGAGTGCGGCTCAGCAC	0.662													C|||	2	0.000399361	0.0	0.0	5008	,	,		18414	0.002		0.0	False		,,,				2504	0.0					ENST00000407800.2	0.090000	0	0.070000	0.020000	0.030000	0.046371	0.030000	0.040000																										0				2						c.(250-252)Cgg>Tgg		mitochondrial ribosomal protein S12							58.0	54.0	55.0					19																	39423173		2203	4299	6502	SO:0001583	missense	6183	5	121398	35				g.chr19:39423173C>T	Y11681	CCDS12525.1	19q13.1-q13.2	2012-09-13			ENSG00000128626	ENSG00000128626		"""Mitochondrial ribosomal proteins / small subunits"""	10380	protein-coding gene	gene with protein product		603021		RPMS12		9545647, 9790755	Standard	NM_021107		Approved	RPS12, RPSM12	uc002oke.3	O15235		ENST00000407800.2:c.250C>T	chr19.hg19:g.39423173C>T	ENSP00000384952:p.Arg84Trp	0					MRPS12_ENST00000308018.4_Missense_Mutation_p.R84W|MRPS12_ENST00000402029.3_Missense_Mutation_p.R84W|SARS2_ENST00000600042.1_5'Flank|SARS2_ENST00000430193.3_5'Flank|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000221431.6_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|CTC-360G5.9_ENST00000599320.1_lincRNA|SARS2_ENST00000594171.1_5'Flank	p.R84W	NM_021107.1	NP_066930.1	0	0	0	2.009038	O15235	RT12_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)	2	591	+	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Q53X98	Missense_Mutation	SNP	ENST00000407800.2	0	1	hg19	c.250C>T	CCDS12525.1	0	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	21.5	4.155882	0.78114	.	.	ENSG00000128626	ENST00000308018;ENST00000407800;ENST00000402029	T;T;T	0.56611	0.45;0.45;0.45	6.07	5.03	0.67393	6.07	5.03	0.67393	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.054650	0.85682	D	0.000000	D	0.82462	0.5042	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89042	0.3449	10	0.87932	D	0	-32.1337	14.5652	0.68171	0.1473:0.8527:0.0:0.0	.	84	O15235	RT12_HUMAN	W	84	ENSP00000308845:R84W;ENSP00000384952:R84W;ENSP00000384579:R84W	ENSP00000308845:R84W	R	+	1	2	2	MRPS12	44115013	44115013	1.000000	0.71417	0.997000	0.53966	0.411000	0.31082	3.906000	0.56340	1.559000	0.49555	0.655000	0.94253	CGG	0.567456		TCGA-IB-A6UF-01A-23D-A33T-08	0.662	MRPS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463154.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.890000	-2.875097	1	0.580000			0	5	5	0	424	417	0		1	0		0	0	85	0	0	9.351500e-01	7.034281e-01	0	0	0	198	0	5	424
IRGQ	126298	broad.mit.edu	37	19	44096739	44096739	+	Silent	SNP	G	G	A	rs553066545		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:44096739G>A	ENST00000602269.1	-	2	1496	c.1311C>T	c.(1309-1311)ggC>ggT	p.G437G	IRGQ_ENST00000601520.1_Intron|L34079.2_ENST00000594374.1_Intron|IRGQ_ENST00000422989.1_Silent_p.G437G			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	437	IRG-type G.									endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CTGGGAGTCCGCCAGGCCGTA	0.721																																						ENST00000602269.1	1.000000	0	0.110000	0.020000	0.050000	0.187137	0.050000	0.050000																										0				18						c.(1309-1311)ggC>ggT		immunity-related GTPase family, Q							27.0	31.0	30.0					19																	44096739		2203	4296	6499	SO:0001819	synonymous_variant	126298	0	0					g.chr19:44096739G>A	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.1311C>T	chr19.hg19:g.44096739G>A		1					IRGQ_ENST00000601520.1_Intron|IRGQ_ENST00000422989.1_Silent_p.G437G|L34079.2_ENST00000594374.1_Intron	p.G437G			2	2	4	2.278325	Q8WZA9	IRGQ_HUMAN		2	1496	-		Prostate(69;0.0199)	B2RNP3	Silent	SNP	ENST00000602269.1	0	1	hg19	c.1311C>T	CCDS33040.1	0																																																																																								0.619703		TCGA-IB-A6UF-01A-23D-A33T-08	0.721	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	73	1	1.890000	-2.951012	1	0.580000	NM_001007561		0	5	5	0	400	395	0		1	0		0	0	75	0	0	9.358512e-01	2.431941e-03	0	0	0	5	0	5	400
BCAM	4059	broad.mit.edu	37	19	45316707	45316707	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:45316707C>A	ENST00000270233.6	+	6	636	c.614C>A	c.(613-615)aCc>aAc	p.T205N	BCAM_ENST00000589651.1_Missense_Mutation_p.T205N	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	205	Ig-like V-type 2.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GGCTACATGACCAGCCGCACG	0.711																																						ENST00000270233.6	1.000000	8.600000e-01	1.000000	0.940000	0.990000	0.980470	0.990000	1.000000																										0				22						c.(613-615)aCc>aAc		basal cell adhesion molecule (Lutheran blood group)							31.0	32.0	31.0					19																	45316707		2191	4272	6463	SO:0001583	missense	4059	0	0					g.chr19:45316707C>A	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.614C>A	chr19.hg19:g.45316707C>A	ENSP00000270233:p.Thr205Asn	1					BCAM_ENST00000589651.1_Missense_Mutation_p.T205N	p.T205N	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	2	2	4	2.278325	P50895	BCAM_HUMAN		6	636	+	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	1	1	hg19	c.614C>A	CCDS12644.1	1	.	.	.	.	.	.	.	.	.	.	.	9.602	1.128897	0.21041	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.78126	-1.15;-1.15	4.15	2.85	0.33270	4.15	2.85	0.33270	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76421	0.3985	M	0.74258	2.255	0.20196	N	0.999921	P	0.42556	0.783	B	0.44133	0.442	T	0.64989	-0.6277	9	0.27785	T	0.31	-14.6738	7.5419	0.27744	0.0:0.8263:0.0:0.1737	.	205	P50895	BCAM_HUMAN	N	205	ENSP00000270233:T205N;ENSP00000375817:T205N	ENSP00000270233:T205N	T	+	2	0	0	BCAM	50008547	50008547	0.118000	0.22208	0.873000	0.34254	0.413000	0.31143	0.707000	0.25704	2.026000	0.59711	0.462000	0.41574	ACC	0.619703		TCGA-IB-A6UF-01A-23D-A33T-08	0.711	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	0	0	1	2	2	2	2	0	0	0	0	71	71	71	70	1	1.890000	-20.000000	1	0.580000	NM_005581		0	105	104	0	286	283	1		1	1		0	0	71	0	0	1	1	0	33	0	198	0	105	286
C3	718	broad.mit.edu	37	19	6678284	6678284	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:6678284G>A	ENST00000245907.6	-	40	4821	c.4729C>T	c.(4729-4731)Cag>Tag	p.Q1577*	C3_ENST00000599668.1_5'UTR	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1577	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGTCCAACCTGCACCTCATCC	0.607																																						ENST00000245907.6	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.068318	0.050000	0.060000																										0				72						c.(4729-4731)Cag>Tag		complement component 3	Intravenous Immunoglobulin(DB00028)						86.0	66.0	73.0					19																	6678284		2203	4300	6503	SO:0001587	stop_gained	718	0	0					g.chr19:6678284G>A	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4729C>T	chr19.hg19:g.6678284G>A	ENSP00000245907:p.Gln1577*	1					C3_ENST00000599668.1_5'UTR	p.Q1577*	NM_000064.2	NP_000055.2	0	1	1	1.628610	P01024	CO3_HUMAN		40	4821	-			A7E236	Nonsense_Mutation	SNP	ENST00000245907.6	0	1	hg19	c.4729C>T	CCDS32883.1	0	.	.	.	.	.	.	.	.	.	.	G	42	9.718089	0.99247	.	.	ENSG00000125730	ENST00000245907	.	.	.	5.24	5.24	0.73138	5.24	5.24	0.73138	.	2.360010	0.02152	U	0.058110	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	12.1339	0.53959	0.0:0.1729:0.8271:0.0	.	.	.	.	X	1577	.	ENSP00000245907:Q1577X	Q	-	1	0	0	C3	6629284	6629284	0.738000	0.28186	0.992000	0.48379	0.134000	0.20937	1.336000	0.33850	2.463000	0.83235	0.454000	0.30748	CAG	0.420290		TCGA-IB-A6UF-01A-23D-A33T-08	0.607	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	0	0	0	2	2	2	2	0	0	0	0	55	55	55	54	1	1.890000	-6.691296	1	0.580000	NM_000064		0	5	0	0	211	205	0		0	1		0	0	55	0	0	9.292954e-01	1	0	4	0	6101	0	5	211
FTL	2512	broad.mit.edu	37	19	49468811	49468811	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr19:49468811C>T	ENST00000331825.6	+	1	254	c.47C>T	c.(46-48)gCc>gTc	p.A16V	CTD-2639E6.9_ENST00000599784.1_lincRNA	NM_000146.3	NP_000137.2	P02792	FRIL_HUMAN	ferritin, light polypeptide	16	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|membrane (GO:0016020)	ferric iron binding (GO:0008199)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)			cervix(1)|kidney(3)|lung(5)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	GTGGAGGCAGCCGTCAACAGC	0.567																																						ENST00000331825.6	1.000000	0	0.120000	0.020000	0.040000	0.196499	0.040000	0.050000																										0				9						c.(46-48)gCc>gTc		ferritin, light polypeptide	Iron Dextran(DB00893)						70.0	69.0	69.0					19																	49468811		2203	4300	6503	SO:0001583	missense	2512	0	0					g.chr19:49468811C>T	AY207005	CCDS33070.1	19q13.33	2014-05-19			ENSG00000087086	ENSG00000087086			3999	protein-coding gene	gene with protein product	"""ferritin light polypeptide-like 3"", ""L apoferritin"", ""ferritin L subunit"", ""ferritin light chain"", ""ferritin L-chain"", ""neurodegeneration with brain iron accumulation 3"""	134790				3000916, 9526618	Standard	NM_000146		Approved	MGC71996, NBIA3	uc002plo.3	P02792		ENST00000331825.6:c.47C>T	chr19.hg19:g.49468811C>T	ENSP00000366525:p.Ala16Val	1					CTD-2639E6.9_ENST00000599784.1_lincRNA	p.A16V	NM_000146.3	NP_000137.2	2	2	4	2.313384	P02792	FRIL_HUMAN		1	254	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	B2R4B9|Q6IBT7|Q7Z2W1|Q86WI9|Q8WU07|Q96AU9|Q96CU0|Q9BTZ8	Missense_Mutation	SNP	ENST00000331825.6	0	1	hg19	c.47C>T	CCDS33070.1	0	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979521	0.74360	.	.	ENSG00000087086	ENST00000331825;ENST00000397259	T	0.66638	-0.22	5.14	1.49	0.22878	5.14	1.49	0.22878	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.309717	0.34025	N	0.004328	T	0.68723	0.3032	M	0.88310	2.945	0.27691	N	0.946119	B;B	0.31730	0.236;0.337	B;B	0.32980	0.087;0.156	T	0.67309	-0.5703	10	0.72032	D	0.01	.	9.6464	0.39870	0.1386:0.5426:0.3188:0.0	.	16;16	P02792;F5H1X1	FRIL_HUMAN;.	V	16	ENSP00000366525:A16V	ENSP00000366525:A16V	A	+	2	0	0	FTL	54160623	54160623	0.985000	0.35326	1.000000	0.80357	0.998000	0.95712	1.633000	0.37113	0.787000	0.33731	0.655000	0.94253	GCC	0.625602		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	FTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466233.1	0	0	1	2	19	185	2	1	1	1	1	85	85	85	84	1	1.890000	-2.760313	1	0.580000	NM_000146		0	5	5	0	488	482	0		0	0		1	0	85	0	0	2.690923e-03	1.181639e-02	0	9	0	6999	0	5	488
RSBN1	54665	broad.mit.edu	37	1	114308998	114308998	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:114308998G>A	ENST00000261441.5	-	7	2076	c.2013C>T	c.(2011-2013)tgC>tgT	p.C671C	RSBN1_ENST00000369581.2_5'UTR	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	671						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TATCATTGTCGCAAAGCTGAA	0.418																																						ENST00000261441.5	1.000000	0	0.070000	0.020000	0.040000	0.116159	0.040000	0.040000																										0				29						c.(2011-2013)tgC>tgT		round spermatid basic protein 1							90.0	83.0	86.0					1																	114308998		2203	4300	6503	SO:0001819	synonymous_variant	54665	1	121412	25				g.chr1:114308998G>A	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.2013C>T	chr1.hg19:g.114308998G>A		0					RSBN1_ENST00000369581.2_5'UTR	p.C671C	NM_018364.3	NP_060834.2	2	2	4	2.170352	Q5VWQ0	RSBN1_HUMAN		7	2076	-	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	0	1	hg19	c.2013C>T	CCDS862.1	0																																																																																								0.600836		TCGA-IB-A6UF-01A-23D-A33T-08	0.418	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	85	1	1.890000	-2.488091	0	0.580000	NM_018364		0	6	6	0	531	528	0		1	0		0	0	87	0	0	9.645367e-01	2.733183e-02	0	0	0	19	0	6	531
COPA	1314	broad.mit.edu	37	1	160302256	160302256	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:160302256G>A	ENST00000241704.7	-	6	707	c.478C>T	c.(478-480)Cgc>Tgc	p.R160C	COPA_ENST00000368069.3_Missense_Mutation_p.R160C	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	160					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCCCAAACGCGCACAGTCTGG	0.483																																						ENST00000241704.7	0.110000	0	0.080000	0.020000	0.050000	0.060039	0.050000	0.060000																										0				46						c.(478-480)Cgc>Tgc		coatomer protein complex, subunit alpha							114.0	103.0	107.0					1																	160302256		2203	4300	6503	SO:0001583	missense	1314	0	0					g.chr1:160302256G>A	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.478C>T	chr1.hg19:g.160302256G>A	ENSP00000241704:p.Arg160Cys	1					COPA_ENST00000368069.3_Missense_Mutation_p.R160C	p.R160C	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	1	2	3	2.671010	P53621	COPA_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)	6	707	-	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	0	1	hg19	c.478C>T	CCDS1202.1	0	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326408	0.81690	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.68025	-0.3;-0.3	5.05	4.13	0.48395	5.05	4.13	0.48395	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.053904	0.64402	N	0.000001	T	0.79621	0.4477	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84076	0.0382	10	0.87932	D	0	-11.1798	12.468	0.55771	0.0814:0.0:0.9186:0.0	.	160;160	P53621;P53621-2	COPA_HUMAN;.	C	160	ENSP00000357048:R160C;ENSP00000241704:R160C	ENSP00000241704:R160C	R	-	1	0	0	COPA	158568880	158568880	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.381000	0.97205	1.351000	0.45789	0.561000	0.74099	CGC	0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.483	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	1.890000	-3.010007	1	0.580000	NM_004371		0	6	6	0	506	503	0		1	0		0	0	63	0	0	9.645216e-01	6.921644e-01	0	0	0	192	0	6	506
TOMM40L	84134	broad.mit.edu	37	1	161197719	161197719	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:161197719C>T	ENST00000367988.3	+	6	693	c.424C>T	c.(424-426)Cgg>Tgg	p.R142W	TOMM40L_ENST00000367987.1_Missense_Mutation_p.R142W|MIR5187_ENST00000583479.1_RNA|NR1I3_ENST00000479324.1_5'Flank|TOMM40L_ENST00000545897.1_Missense_Mutation_p.R108W|TOMM40L_ENST00000474486.1_3'UTR	NM_032174.4	NP_115550.2	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)-like	142					ion transport (GO:0006811)|protein transport (GO:0015031)	mitochondrial outer membrane (GO:0005741)|pore complex (GO:0046930)|protein complex (GO:0043234)	porin activity (GO:0015288)			large_intestine(2)|liver(4)|lung(4)	10	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TGGCGAGTATCGGGGAGATGA	0.517											OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000367988.3	0.880000	5.300000e-01	0.800000	0.610000	0.690000	0.708444	0.690000	0.690000																										0				10						c.(424-426)Cgg>Tgg		translocase of outer mitochondrial membrane 40 homolog (yeast)-like							60.0	56.0	57.0					1																	161197719		2203	4300	6503	SO:0001583	missense	84134	0	0					g.chr1:161197719C>T		CCDS1227.1, CCDS65700.1	1q23.3	2008-02-05	2007-01-12		ENSG00000158882	ENSG00000158882			25756	protein-coding gene	gene with protein product			"""translocase of outer mitochondrial membrane 40 homolog-like (yeast)"""				Standard	NM_032174		Approved	FLJ12770, TOMM40B	uc001fzd.3	Q969M1	OTTHUMG00000034345	ENST00000367988.3:c.424C>T	chr1.hg19:g.161197719C>T	ENSP00000356967:p.Arg142Trp	1		OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1814	TOMM40L_ENST00000474486.1_3'UTR|TOMM40L_ENST00000367987.1_Missense_Mutation_p.R142W|NR1I3_ENST00000479324.1_5'Flank|TOMM40L_ENST00000545897.1_Missense_Mutation_p.R108W|MIR5187_ENST00000583479.1_RNA	p.R142W	NM_032174.4	NP_115550.2	1	2	3	2.671010	Q969M1	TM40L_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)	6	693	+	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		B7Z4U0|D3DVG9	Missense_Mutation	SNP	ENST00000367988.3	1	1	hg19	c.424C>T	CCDS1227.1	0	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552943	0.65425	.	.	ENSG00000158882	ENST00000367988;ENST00000545897;ENST00000542686;ENST00000367987	T;T;T	0.46819	0.86;0.86;0.86	5.91	4.99	0.66335	5.91	4.99	0.66335	.	0.053759	0.64402	D	0.000001	T	0.34716	0.0907	M	0.74881	2.28	0.47214	D	0.999355	P;P;P	0.43431	0.807;0.807;0.807	B;B;B	0.40506	0.331;0.331;0.331	T	0.41716	-0.9493	9	0.42905	T	0.14	-26.3182	11.9964	0.53206	0.3146:0.6854:0.0:0.0	.	108;24;142	B7Z4U0;Q9H9G4;Q969M1	.;.;TM40L_HUMAN	W	142;108;89;142	ENSP00000356967:R142W;ENSP00000443233:R108W;ENSP00000356966:R142W	ENSP00000356966:R142W	R	+	1	2	2	TOMM40L	159464343	159464343	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.184000	0.42575	1.475000	0.48197	0.655000	0.94253	CGG	0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.517	TOMM40L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083029.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.890000	-3.234208	1	0.580000	NM_032174		0	51	51	0	273	272	1		1	1		0	0	30	0	0	1	8.434478e-01	0	5	0	15	0	51	273
RGS2	5997	broad.mit.edu	37	1	192779364	192779364	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:192779364C>T	ENST00000235382.5	+	2	210	c.179C>T	c.(178-180)aCc>aTc	p.T60I	RGS2_ENST00000483295.1_3'UTR	NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	60	Necessary for membrane association.				brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			large_intestine(3)|lung(1)|urinary_tract(1)	5						AAGCCCAAAACCGGCAAAAAA	0.358																																					Pancreas(71;51 2183 4981)	ENST00000235382.5	1.000000	7.000000e-01	0.940000	0.770000	0.850000	0.860980	0.850000	1.000000																										0				5						c.(178-180)aCc>aTc		regulator of G-protein signaling 2							76.0	81.0	79.0					1																	192779364		2203	4300	6503	SO:0001583	missense	5997	0	0					g.chr1:192779364C>T	L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.179C>T	chr1.hg19:g.192779364C>T	ENSP00000235382:p.Thr60Ile	1					RGS2_ENST00000483295.1_3'UTR	p.T60I	NM_002923.3	NP_002914.1	1	2	3	2.671010	P41220	RGS2_HUMAN		2	210	+			Q6I9U5	Missense_Mutation	SNP	ENST00000235382.5	1	1	hg19	c.179C>T	CCDS1377.1	1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.596210	0.28445	.	.	ENSG00000116741	ENST00000235382	T	0.70749	-0.51	5.9	4.97	0.65823	5.9	4.97	0.65823	.	0.873372	0.10199	N	0.703678	T	0.53932	0.1827	N	0.14661	0.345	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.43410	-0.9393	10	0.41790	T	0.15	.	8.6472	0.34013	0.1532:0.7709:0.0:0.0759	.	60	P41220	RGS2_HUMAN	I	60	ENSP00000235382:T60I	ENSP00000235382:T60I	T	+	2	0	0	RGS2	191045987	191045987	0.003000	0.15002	0.641000	0.29422	0.958000	0.62258	0.491000	0.22419	1.469000	0.48083	0.655000	0.94253	ACC	0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.358	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086396.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	1.890000	-20.000000	1	0.580000	NM_002923		0	92	90	0	385	381	1		1	1		0	0	77	0	0	1	1	0	13	0	123	0	92	385
LGR6	59352	broad.mit.edu	37	1	202287853	202287853	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:202287853G>A	ENST00000367278.3	+	18	2511	c.2422G>A	c.(2422-2424)Gtc>Atc	p.V808I	LGR6_ENST00000439764.2_Missense_Mutation_p.V669I|LGR6_ENST00000255432.7_Missense_Mutation_p.V756I	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	808					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						GCCCGAGGCCGTCAAGTCTGT	0.647																																						ENST00000367278.3	1.000000	0	1.000000	0.010000	0.030000	0.265663	0.030000	0.030000																										0				36						c.(2422-2424)Gtc>Atc		leucine-rich repeat containing G protein-coupled receptor 6							105.0	89.0	95.0					1																	202287853		2203	4300	6503	SO:0001583	missense	59352	1	121412	39				g.chr1:202287853G>A	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2422G>A	chr1.hg19:g.202287853G>A	ENSP00000356247:p.Val808Ile	1					LGR6_ENST00000255432.7_Missense_Mutation_p.V756I|LGR6_ENST00000439764.2_Missense_Mutation_p.V669I	p.V808I	NM_001017403.1	NP_001017403.1	1	3	4	2.724539	Q9HBX8	LGR6_HUMAN		18	2511	+			Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	0	1	hg19	c.2422G>A	CCDS30971.1	0	.	.	.	.	.	.	.	.	.	.	G	2.892	-0.229549	0.06022	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	T;T;T	0.37058	1.22;1.22;1.22	4.6	1.6	0.23607	4.6	1.6	0.23607	.	0.252924	0.32852	N	0.005573	T	0.12689	0.0308	N	0.04959	-0.14	0.22081	N	0.999379	B;B;B	0.25609	0.13;0.021;0.014	B;B;B	0.18561	0.022;0.004;0.007	T	0.19095	-1.0316	10	0.15952	T	0.53	.	3.813	0.08804	0.4036:0.1804:0.4161:0.0	.	669;756;808	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	I	808;756;669	ENSP00000356247:V808I;ENSP00000255432:V756I;ENSP00000387869:V669I	ENSP00000255432:V756I	V	+	1	0	0	LGR6	200554476	200554476	0.967000	0.33354	0.995000	0.50966	0.988000	0.76386	1.184000	0.32053	0.260000	0.21731	0.485000	0.47835	GTC	0.681577		TCGA-IB-A6UF-01A-23D-A33T-08	0.647	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	0	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	1.890000	-2.111528	0	0.580000	NM_021636		0	6	7	0	944	929	0		1	0		0	0	97	0	0	9.633681e-01	4.494163e-03	0	0	0	13	0	6	944
ELK4	2005	broad.mit.edu	37	1	205589560	205589560	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:205589560G>A	ENST00000357992.4	-	3	953	c.614C>T	c.(613-615)gCt>gTt	p.A205V	ELK4_ENST00000468523.1_5'Flank|ELK4_ENST00000289703.4_Missense_Mutation_p.A205V	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)	205					cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			AATGGTGGCAGCAACAGGTTC	0.478			T	SLC45A3	prostate																																	ENST00000357992.4	1.000000	0	1.000000	0.020000	0.040000	0.275181	0.040000	0.030000				Dom	yes			Dom	yes		1	1q32	1q32	2005	T	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""				E	E	SLC45A3		prostate	SLC45A3/ELK4(18)	0				12						c.(613-615)gCt>gTt		ELK4, ETS-domain protein (SRF accessory protein 1)							76.0	79.0	78.0					1																	205589560		2203	4300	6503	SO:0001583	missense	2005	0	0					g.chr1:205589560G>A	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.614C>T	chr1.hg19:g.205589560G>A	ENSP00000350681:p.Ala205Val	1					ELK4_ENST00000289703.4_Missense_Mutation_p.A205V|ELK4_ENST00000468523.1_5'Flank	p.A205V	NM_001973.3	NP_001964.2	1	3	4	2.724539	P28324	ELK4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0908)	3	953	-	Breast(84;0.07)		P28323|Q6GSJ2	Missense_Mutation	SNP	ENST00000357992.4	0	1	hg19	c.614C>T	CCDS1456.1	0	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.038791	0.00402	.	.	ENSG00000158711	ENST00000539916;ENST00000357992;ENST00000289703	T;T	0.29655	1.77;1.56	5.8	3.91	0.45181	5.8	3.91	0.45181	.	0.648183	0.17214	N	0.182595	T	0.14700	0.0355	N	0.08118	0	0.09310	N	1	B;B	0.22683	0.073;0.006	B;B	0.21708	0.036;0.01	T	0.31223	-0.9951	10	0.10377	T	0.69	.	10.5205	0.44916	0.1355:0.1148:0.7496:0.0	.	205;205	P28324-2;P28324	.;ELK4_HUMAN	V	295;205;205	ENSP00000350681:A205V;ENSP00000289703:A205V	ENSP00000289703:A205V	A	-	2	0	0	ELK4	203856183	203856183	0.127000	0.22367	0.001000	0.08648	0.182000	0.23217	1.974000	0.40559	0.372000	0.24591	-0.813000	0.03139	GCT	0.681577		TCGA-IB-A6UF-01A-23D-A33T-08	0.478	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	0	0	1	2	2	2	2	0	0	0	0	89	89	89	89	1	1.890000	-2.743540	1	0.580000	NM_021795		0	5	5	0	566	560	0		1	0		0	0	89	0	0	9.360415e-01	2.458778e-02	0	0	0	22	0	5	566
CTSE	1510	broad.mit.edu	37	1	206331027	206331027	+	Missense_Mutation	SNP	G	G	A	rs145069780	byFrequency	TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:206331027G>A	ENST00000358184.2	+	9	1151	c.1033G>A	c.(1033-1035)Gtg>Atg	p.V345M	CTSE_ENST00000360218.2_Silent_p.S297S|CTSE_ENST00000361052.3_Missense_Mutation_p.V350M|CTSE_ENST00000432969.2_Silent_p.S222S	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	350					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			ACAGGACTTCGTGGATGGAAT	0.552													g|||	4	0.000798722	0.0	0.0	5008	,	,		20997	0.0		0.002	False		,,,				2504	0.002					ENST00000358184.2	1.000000	9.700000e-01	1.000000	0.990000	0.990000	0.998779	0.990000	1.000000																										0				16						c.(1033-1035)Gtg>Atg		cathepsin E		G	MET/VAL,	1,4405	2.1+/-5.4	0,1,2202	189.0	184.0	186.0		1033,891	4.1	0.3	1	dbSNP_134	186	22,8578	16.0+/-53.3	0,22,4278	yes	missense,coding-synonymous	CTSE	NM_001910.3,NM_148964.2	21,	0,23,6480	AA,AG,GG		0.2558,0.0227,0.1768	possibly-damaging,	345/397,297/364	206331027	23,12983	2203	4300	6503	SO:0001583	missense	1510	165	121410	59				g.chr1:206331027G>A	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.1033G>A	chr1.hg19:g.206331027G>A	ENSP00000350911:p.Val345Met	1					CTSE_ENST00000360218.2_Silent_p.S297S|CTSE_ENST00000432969.2_Silent_p.S222S|CTSE_ENST00000361052.3_Missense_Mutation_p.V350M	p.V345M	NM_001910.3	NP_001901.1	1	3	4	2.724539	P14091	CATE_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0754)	9	1151	+			Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	ENST00000358184.2	1	1	hg19	c.1033G>A	CCDS1462.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	g	9.329	1.060007	0.19987	2.27E-4	0.002558	ENSG00000196188	ENST00000358184;ENST00000361052	T;T	0.57752	0.38;0.38	4.98	4.05	0.47172	4.98	4.05	0.47172	.	0.566694	0.16139	N	0.227824	T	0.33585	0.0868	N	0.25380	0.74	0.19775	N	0.99996	B	0.27498	0.18	B	0.19148	0.024	T	0.23476	-1.0187	10	0.62326	D	0.03	.	3.6214	0.08097	0.2362:0.0:0.5746:0.1892	.	345	P14091-1	.	M	345;350	ENSP00000350911:V345M;ENSP00000354337:V350M	ENSP00000350911:V345M	V	+	1	0	0	CTSE	204497650	204497650	0.000000	0.05858	0.282000	0.24776	0.431000	0.31685	0.742000	0.26216	1.421000	0.47157	0.551000	0.68910	GTG	0.681577		TCGA-IB-A6UF-01A-23D-A33T-08	0.552	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	1	0	1	2	2	2	2	0	0	0	0	184	184	184	183	1	1.890000	-2.690609	1	0.580000	NM_001910		0	304	301	0	976	969	1		1	1		0	0	184	0	0	1	1	0	172	0	386	0	304	976
FAM71A	149647	broad.mit.edu	37	1	212798637	212798637	+	Missense_Mutation	SNP	C	C	T	rs555988865		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:212798637C>T	ENST00000294829.3	+	1	849	c.418C>T	c.(418-420)Cgc>Tgc	p.R140C	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	140						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		ACAACAGCTGCGCCTGAAGTT	0.483																																						ENST00000294829.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				36						c.(418-420)Cgc>Tgc		family with sequence similarity 71, member A							100.0	105.0	103.0					1																	212798637		2203	4300	6503	SO:0001583	missense	149647	0	0					g.chr1:212798637C>T		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.418C>T	chr1.hg19:g.212798637C>T	ENSP00000294829:p.Arg140Cys	1					RP11-338C15.5_ENST00000427949.1_RNA	p.R140C	NM_153606.3	NP_705834.2	1	2	3	2.682530	Q8IYT1	FA71A_HUMAN		1	849	+			Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	1	1	hg19	c.418C>T	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645226	0.67358	.	.	ENSG00000162771	ENST00000294829	T	0.19250	2.16	4.29	4.29	0.51040	4.29	4.29	0.51040	.	0.312745	0.22908	N	0.054176	T	0.45236	0.1332	M	0.74546	2.27	0.47698	D	0.999498	D	0.89917	1.0	D	0.83275	0.996	T	0.43589	-0.9382	10	0.72032	D	0.01	-20.9761	12.4812	0.55844	0.0:1.0:0.0:0.0	.	140	Q8IYT1	FA71A_HUMAN	C	140	ENSP00000294829:R140C	ENSP00000294829:R140C	R	+	1	0	0	FAM71A	210865260	210865260	0.385000	0.25172	1.000000	0.80357	0.701000	0.40568	0.230000	0.17852	2.405000	0.81733	0.557000	0.71058	CGC	0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.483	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	109	1	1.890000	-20.000000	1	0.580000	NM_153606		0	396	394	0	453	450	0		1			0	0	109	0	0	1	0	0	0	0	0	0	396	453
ERMAP	114625	broad.mit.edu	37	1	43296629	43296629	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:43296629G>A	ENST00000372517.2	+	4	520	c.276G>A	c.(274-276)ccG>ccA	p.P92P	ERMAP_ENST00000328249.3_Silent_p.P2P|ERMAP_ENST00000487556.1_Intron|ERMAP_ENST00000372514.3_Silent_p.P92P	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	92	Ig-like V-type.					cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATCTGATGCCGGAATATAAGG	0.572																																						ENST00000372517.2	1.000000	1.000000e-02	0.110000	0.030000	0.060000	0.137153	0.060000	0.060000																										0				11						c.(274-276)ccG>ccA		erythroblast membrane-associated protein (Scianna blood group)							117.0	102.0	107.0					1																	43296629		2203	4300	6503	SO:0001819	synonymous_variant	114625	2	121412	31				g.chr1:43296629G>A	AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.276G>A	chr1.hg19:g.43296629G>A		0					ERMAP_ENST00000328249.3_Silent_p.P2P|ERMAP_ENST00000487556.1_Intron|ERMAP_ENST00000372514.3_Silent_p.P92P	p.P92P	NM_001017922.1	NP_001017922.1	2	2	4	2.170352	Q96PL5	ERMAP_HUMAN		4	520	+	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Silent	SNP	ENST00000372517.2	0	1	hg19	c.276G>A	CCDS475.1	0																																																																																								0.600836		TCGA-IB-A6UF-01A-23D-A33T-08	0.572	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020180.1	0	0	1	2	2	2	2	0	0	0	0	42	42	42	41	1	1.890000	-3.019038	1	0.580000	NM_018538		0	4	4	0	254	252	0		1	0		0	0	42	0	0	8.892517e-01	6.161030e-02	0	0	0	20	0	4	254
PTPRF	5792	broad.mit.edu	37	1	44054537	44054537	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:44054537T>C	ENST00000359947.4	+	8	1155	c.815T>C	c.(814-816)cTc>cCc	p.L272P	PTPRF_ENST00000438120.1_Missense_Mutation_p.L272P|PTPRF_ENST00000372414.3_Missense_Mutation_p.L272P|PTPRF_ENST00000372413.3_Missense_Mutation_p.L272P|PTPRF_ENST00000422171.2_5'Flank	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	272	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCCGAGGAGCTCACCAAGGAG	0.622																																						ENST00000359947.4	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.997855	0.990000	1.000000																										0				72						c.(814-816)cTc>cCc		protein tyrosine phosphatase, receptor type, F							129.0	101.0	110.0					1																	44054537		2203	4300	6503	SO:0001583	missense	5792	0	0					g.chr1:44054537T>C	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.815T>C	chr1.hg19:g.44054537T>C	ENSP00000353030:p.Leu272Pro	0					PTPRF_ENST00000438120.1_Missense_Mutation_p.L272P|PTPRF_ENST00000372414.3_Missense_Mutation_p.L272P|PTPRF_ENST00000372413.3_Missense_Mutation_p.L272P|PTPRF_ENST00000422171.2_5'Flank	p.L272P	NM_002840.3	NP_002831.2	2	2	4	2.170352	P10586	PTPRF_HUMAN		8	1155	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	1	1	hg19	c.815T>C	CCDS489.2	1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.180087	0.78564	.	.	ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.62	5.62	0.85841	5.62	5.62	0.85841	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.30999	N	0.008451	D	0.86863	0.6035	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.996;1.0	D	0.87323	0.2319	10	0.33141	T	0.24	.	16.1281	0.81408	0.0:0.0:0.0:1.0	.	272;272	P10586-2;P10586	.;PTPRF_HUMAN	P	272	ENSP00000353030:L272P;ENSP00000398822:L272P;ENSP00000361491:L272P;ENSP00000361490:L272P	ENSP00000353030:L272P	L	+	2	0	0	PTPRF	43827124	43827124	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	8.036000	0.88901	2.268000	0.75426	0.533000	0.62120	CTC	0.600836		TCGA-IB-A6UF-01A-23D-A33T-08	0.622	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.890000	-20.000000	1	0.580000			0	68	68	0	140	136	1		1	1		0	0	30	0	0	1	1	0	45	0	95	0	68	140
MTR	4548	broad.mit.edu	37	1	237057764	237057764	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr1:237057764C>A	ENST00000366577.5	+	30	3706	c.3312C>A	c.(3310-3312)tgC>tgA	p.C1104*	MTR_ENST00000470570.1_3'UTR|MTR_ENST00000535889.1_Nonsense_Mutation_p.C1053*	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	1104	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CCGTTGCCTGCTTTGGGGTAG	0.582																																						ENST00000366577.5	0.090000	0	0.070000	0.010000	0.030000	0.044665	0.030000	0.030000																										0				67						c.(3310-3312)tgC>tgA		5-methyltetrahydrofolate-homocysteine methyltransferase	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						133.0	108.0	116.0					1																	237057764		2203	4300	6503	SO:0001587	stop_gained	4548	0	0					g.chr1:237057764C>A	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.3312C>A	chr1.hg19:g.237057764C>A	ENSP00000355536:p.Cys1104*	1					MTR_ENST00000470570.1_3'UTR|MTR_ENST00000535889.1_Nonsense_Mutation_p.C1053*	p.C1104*	NM_000254.2	NP_000245.2	1	2	3	2.682530	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	30	3706	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Nonsense_Mutation	SNP	ENST00000366577.5	0	1	hg19	c.3312C>A	CCDS1614.1	0	.	.	.	.	.	.	.	.	.	.	C	39	7.595927	0.98381	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	.	.	.	5.57	4.66	0.58398	5.57	4.66	0.58398	.	0.270973	0.36591	N	0.002508	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-15.4112	10.8432	0.46728	0.0:0.8558:0.0:0.1442	.	.	.	.	X	958;1104;1053;658	.	ENSP00000355535:C658X	C	+	3	2	2	MTR	235124387	235124387	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.490000	0.22403	1.495000	0.48549	0.655000	0.94253	TGC	0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.582	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	0	0	1	2	2	2	2	0	0	0	0	89	89	89	89	1	1.890000	-4.291930	1	0.580000	NM_000254		0	5	7	0	574	567	0		1	0		0	0	89	0	0	9.360644e-01	1.308971e-02	0	0	0	16	0	5	574
FERMT1	55612	broad.mit.edu	37	20	6090996	6090996	+	Missense_Mutation	SNP	G	G	A	rs147864238		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr20:6090996G>A	ENST00000217289.4	-	5	1483	c.695C>T	c.(694-696)gCg>gTg	p.A232V	FERMT1_ENST00000536936.1_Intron	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	232	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						GTACATATCCGCAAGTGCTTC	0.532																																						ENST00000217289.4	0.100000	1.000000e-02	0.080000	0.020000	0.040000	0.053567	0.040000	0.040000																										0				17						c.(694-696)gCg>gTg		fermitin family member 1		G	VAL/ALA	0,4406		0,0,2203	133.0	114.0	120.0		695	4.8	0.6	20	dbSNP_134	120	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FERMT1	NM_017671.4	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	232/678	6090996	1,13005	2203	4300	6503	SO:0001583	missense	55612	32	121412	51				g.chr20:6090996G>A	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.695C>T	chr20.hg19:g.6090996G>A	ENSP00000217289:p.Ala232Val	1					FERMT1_ENST00000536936.1_Intron	p.A232V	NM_017671.4	NP_060141.3	0	1	1	1.529228	Q9BQL6	FERM1_HUMAN		5	1483	-			D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	0	1	hg19	c.695C>T	CCDS13098.1	0	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169656	0.57584	0.0	1.16E-4	ENSG00000101311	ENST00000217289;ENST00000339538	T	0.48201	0.82	5.81	4.85	0.62838	5.81	4.85	0.62838	FERM, N-terminal (1);Band 4.1 domain (1);	0.047428	0.85682	D	0.000000	T	0.50837	0.1639	M	0.66506	2.035	0.80722	D	1	B;B	0.33044	0.326;0.395	B;B	0.35312	0.078;0.2	T	0.53450	-0.8437	10	0.49607	T	0.09	-4.3671	16.8229	0.85923	0.0:0.1287:0.8713:0.0	.	232;232	Q9BQL6-4;Q9BQL6	.;FERM1_HUMAN	V	232	ENSP00000217289:A232V	ENSP00000217289:A232V	A	-	2	0	0	FERMT1	6038996	6038996	1.000000	0.71417	0.595000	0.28798	0.348000	0.29142	6.593000	0.74100	1.427000	0.47276	0.655000	0.94253	GCG	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.532	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	0	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	1.890000	-2.969779	1	0.580000	NM_017671		0	4	4	0	221	219	0		1	0		0	0	57	0	0	8.890485e-01	1.478176e-01	0	0	0	30	0	4	221
PAK7	57144	broad.mit.edu	37	20	9546990	9546990	+	Silent	SNP	C	C	G			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr20:9546990C>G	ENST00000378429.3	-	6	1578	c.1032G>C	c.(1030-1032)ctG>ctC	p.L344L	PAK7_ENST00000378423.1_Silent_p.L344L|PAK7_ENST00000353224.5_Silent_p.L344L	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	344	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CAGACCCTGACAGTGGAGGGC	0.537																																						ENST00000378429.3	1.000000	8.200000e-01	0.980000	0.870000	0.920000	0.928633	0.920000	0.940000																										0				81						c.(1030-1032)ctG>ctC		p21 protein (Cdc42/Rac)-activated kinase 7							119.0	121.0	120.0					20																	9546990		2203	4300	6503	SO:0001819	synonymous_variant	57144	0	0					g.chr20:9546990C>G	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1032G>C	chr20.hg19:g.9546990C>G		1					PAK7_ENST00000353224.5_Silent_p.L344L|PAK7_ENST00000378423.1_Silent_p.L344L	p.L344L	NM_020341.3	NP_065074.1	0	1	1	1.529228	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)	6	1578	-			A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	ENST00000378429.3	1	1	hg19	c.1032G>C	CCDS13107.1	1																																																																																								0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.537	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1	1	0	1	2	2	2	2	0	0	0	0	137	137	137	137	1	1.890000	-20.000000	1	0.580000			0	185	183	0	295	292	1		1	0		0	0	137	0	0	1	0	0	0	0	1	0	185	295
ZFP64	55734	broad.mit.edu	37	20	50769918	50769918	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr20:50769918G>A	ENST00000216923.4	-	6	1162	c.813C>T	c.(811-813)agC>agT	p.S271S	ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Silent_p.S269S|ZFP64_ENST00000346617.4_Silent_p.S217S	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						TCAAGTCCGAGCTGATTTTGA	0.557																																						ENST00000216923.4	1.000000	8.400000e-01	1.000000	0.930000	0.990000	0.978973	0.990000	1.000000																										0				33						c.(811-813)agC>agT		ZFP64 zinc finger protein							52.0	49.0	50.0					20																	50769918		2203	4300	6503	SO:0001819	synonymous_variant	55734	1	121412	26				g.chr20:50769918G>A	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.813C>T	chr20.hg19:g.50769918G>A		1					ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000346617.4_Silent_p.S217S|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Silent_p.S269S|ZFP64_ENST00000477786.1_Intron	p.S271S	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	1	2	3	2.663319	Q9NPA5	ZF64A_HUMAN		6	1162	-			Q9NTS7|Q9NVH4	Silent	SNP	ENST00000216923.4	1	1	hg19	c.813C>T	CCDS13440.1	1																																																																																								0.674419		TCGA-IB-A6UF-01A-23D-A33T-08	0.557	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	40	1	1.890000	-20.000000	1	0.580000	NM_018197		0	81	79	0	265	262	1		1	0		0	0	41	0	0	1	8.951666e-01	0	0	0	15	0	81	265
TIAM1	7074	broad.mit.edu	37	21	32513695	32513695	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr21:32513695C>A	ENST00000286827.3	-	22	4074	c.3603G>T	c.(3601-3603)agG>agT	p.R1201S	TIAM1_ENST00000541036.1_Missense_Mutation_p.R1141S	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1201	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CGAACAGCTCCCTGAGCAGAA	0.622																																						ENST00000286827.3	1.000000	8.500000e-01	0.990000	0.900000	0.950000	0.951173	0.950000	0.980000																										0				115						c.(3601-3603)agG>agT		T-cell lymphoma invasion and metastasis 1							136.0	120.0	126.0					21																	32513695		2203	4300	6503	SO:0001583	missense	7074	0	0					g.chr21:32513695C>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3603G>T	chr21.hg19:g.32513695C>A	ENSP00000286827:p.Arg1201Ser	1					TIAM1_ENST00000541036.1_Missense_Mutation_p.R1141S	p.R1201S	NM_003253.2	NP_003244.2	0	1	1	1.500265	Q13009	TIAM1_HUMAN		22	4074	-			B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	1	1	hg19	c.3603G>T	CCDS13609.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.53|16.53	3.149449|3.149449	0.57151|0.57151	.|.	.|.	ENSG00000156299|ENSG00000156299	ENST00000399841|ENST00000286827;ENST00000541036	.|T;T	.|0.68181	.|-0.31;-0.31	5.54|5.54	4.6|4.6	0.57074|0.57074	5.54|5.54	4.6|4.6	0.57074|0.57074	.|Guanine-nucleotide dissociation stimulator, CDC24, conserved site (1);Dbl homology (DH) domain (5);	.|0.286916	.|0.38663	.|N	.|0.001620	.|T	.|0.49779	.|0.1577	L|L	0.28740|0.28740	0.885|0.885	0.45580|0.45580	D|D	0.998526|0.998526	.|P;P;B	.|0.38195	.|0.568;0.622;0.393	.|B;B;B	.|0.35770	.|0.133;0.21;0.137	.|T	.|0.53641	.|-0.8410	.|10	0.87932|0.54805	D|T	0|0.06	.|.	6.7797|6.7797	0.23638|0.23638	0.0:0.7003:0.1511:0.1486|0.0:0.7003:0.1511:0.1486	.|.	.|1141;1141;1201	.|F5GZ53;B7ZLR6;Q13009	.|.;.;TIAM1_HUMAN	X|S	1041|1201;1141	.|ENSP00000286827:R1201S;ENSP00000441570:R1141S	ENSP00000382735:G1041X|ENSP00000286827:R1201S	G|R	-|-	1|3	0|2	0|2	TIAM1|TIAM1	31435566|31435566	31435566|31435566	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.903000|0.903000	0.53119|0.53119	1.201000|1.201000	0.32259|0.32259	2.590000|2.590000	0.87494|0.87494	0.563000|0.563000	0.77884|0.77884	GGA|AGG	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.622	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	1	0	1	2	2	2	2	0	0	0	0	120	120	120	120	1	1.890000	-20.000000	1	0.580000	NM_003253		0	179	177	0	265	261	1		1	0		0	0	120	0	0	1	6.680394e-01	0	0	0	5	0	179	265
PIWIL3	440822	broad.mit.edu	37	22	25124284	25124284	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr22:25124284G>A	ENST00000332271.5	-	15	2208	c.1792C>T	c.(1792-1794)Cta>Tta	p.L598L	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Silent_p.L480L|PIWIL3_ENST00000527701.1_Silent_p.L480L	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	598	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TTGGTACATAGGTATCTTTTT	0.418																																						ENST00000332271.5	1.000000	8.600000e-01	1.000000	0.910000	0.950000	0.955915	0.950000	1.000000																										0				50						c.(1792-1794)Cta>Tta		piwi-like RNA-mediated gene silencing 3							197.0	181.0	186.0					22																	25124284		2203	4300	6503	SO:0001819	synonymous_variant	440822	0	0					g.chr22:25124284G>A	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.1792C>T	chr22.hg19:g.25124284G>A		1					PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000527701.1_Silent_p.L480L|PIWIL3_ENST00000533313.1_Silent_p.L480L	p.L598L	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	0	1	1	1.577093	Q7Z3Z3	PIWL3_HUMAN		15	2208	-				Silent	SNP	ENST00000332271.5	1	1	hg19	c.1792C>T	CCDS33623.1	1																																																																																								0.410857		TCGA-IB-A6UF-01A-23D-A33T-08	0.418	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	0	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	1.890000	-20.000000	1	0.580000	NM_001008496		0	193	192	0	289	288	1		1			0	0	132	0	0	1	0	0	0	0	0	0	193	289
TBC1D22A	25771	broad.mit.edu	37	22	47189570	47189570	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr22:47189570G>A	ENST00000337137.4	+	3	458	c.292G>A	c.(292-294)Gcc>Acc	p.A98T	TBC1D22A_ENST00000407381.3_Missense_Mutation_p.A98T|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.A51T|TBC1D22A_ENST00000472791.1_3'UTR|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.A51T|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.A79T	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	98							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		CATGGAGACGGCCAACCGTGT	0.687																																						ENST00000337137.4	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.065718	0.050000	0.060000																										0				22						c.(292-294)Gcc>Acc		TBC1 domain family, member 22A							44.0	37.0	39.0					22																	47189570		2203	4300	6503	SO:0001583	missense	25771	0	0					g.chr22:47189570G>A	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.292G>A	chr22.hg19:g.47189570G>A	ENSP00000336724:p.Ala98Thr	1					TBC1D22A_ENST00000406733.1_Missense_Mutation_p.A51T|TBC1D22A_ENST00000472791.1_3'UTR|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.A79T|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.A98T|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.A51T	p.A98T	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	0	1	1	1.577093	Q8WUA7	TB22A_HUMAN		3	458	+		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	0	1	hg19	c.292G>A	CCDS14078.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.260204	0.95368	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T;T	0.52295	1.71;0.67;1.27;0.99;1.71	4.8	4.8	0.61643	4.8	4.8	0.61643	.	0.053327	0.85682	D	0.000000	T	0.68787	0.3039	M	0.79475	2.455	0.80722	D	1	P;D;D;P	0.76494	0.87;0.998;0.999;0.87	P;D;D;P	0.70935	0.542;0.969;0.971;0.542	T	0.71813	-0.4479	10	0.52906	T	0.07	-6.3978	16.6066	0.84831	0.0:0.0:1.0:0.0	.	98;79;98;98	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	T	98;51;98;79;51	ENSP00000336724:A98T;ENSP00000370383:A51T;ENSP00000384036:A98T;ENSP00000347932:A79T;ENSP00000385634:A51T	ENSP00000336724:A98T	A	+	1	0	0	TBC1D22A	45568234	45568234	1.000000	0.71417	0.734000	0.30879	0.788000	0.44548	8.819000	0.91997	2.484000	0.83849	0.609000	0.83330	GCC	0.410857		TCGA-IB-A6UF-01A-23D-A33T-08	0.687	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	0	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.890000	-6.203835	1	0.580000	NM_014346		0	5	5	0	216	209	0		1	0		0	0	42	0	0	9.328330e-01	3.788982e-01	0	0	0	50	0	5	216
LYPD6B	130576	broad.mit.edu	37	2	150071135	150071135	+	Missense_Mutation	SNP	G	G	A	rs373317284		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:150071135G>A	ENST00000409029.1	+	7	665	c.463G>A	c.(463-465)Gta>Ata	p.V155I	LYPD6B_ENST00000498249.1_3'UTR|LYPD6B_ENST00000409642.3_Missense_Mutation_p.V179I|LYPD6B_ENST00000280115.7_Missense_Mutation_p.V179I|LYPD6B_ENST00000409876.1_Missense_Mutation_p.V155I			Q8NI32	LPD6B_HUMAN	LY6/PLAUR domain containing 6B	155						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11						AGTGTTTGCCGTAATGCACGC	0.483																																						ENST00000409029.1	0.060000	0	0.050000	0.010000	0.020000	0.031568	0.020000	0.030000																										0				11						c.(463-465)Gta>Ata		LY6/PLAUR domain containing 6B		G	ILE/VAL	0,4126		0,0,2063	176.0	176.0	176.0		535	0.9	0.0	2		176	1,8403		0,1,4201	no	missense	LYPD6B	NM_177964.3	29	0,1,6264	AA,AG,GG		0.0119,0.0,0.0080	benign	179/208	150071135	1,12529	2063	4202	6265	SO:0001583	missense	130576	11	121004	45				g.chr2:150071135G>A		CCDS46423.1	2q23.2	2012-07-20			ENSG00000150556	ENSG00000150556			27018	protein-coding gene	gene with protein product	"""cancer/testis antigen 116"""					18360792	Standard	NM_177964		Approved	CT116, LYPD7	uc002twv.1	Q8NI32	OTTHUMG00000153743	ENST00000409029.1:c.463G>A	chr2.hg19:g.150071135G>A	ENSP00000386650:p.Val155Ile	0					LYPD6B_ENST00000409876.1_Missense_Mutation_p.V155I|LYPD6B_ENST00000498249.1_3'UTR|LYPD6B_ENST00000280115.7_Missense_Mutation_p.V179I|LYPD6B_ENST00000409642.3_Missense_Mutation_p.V179I	p.V155I			0	0	0	2.040573	Q8NI32	LPD6B_HUMAN		7	665	+			D3DP90|Q53TK0|Q7Z747|Q8IXK7	Missense_Mutation	SNP	ENST00000409029.1	0	1	hg19	c.463G>A		0	.	.	.	.	.	.	.	.	.	.	G	10.06	1.245572	0.22796	0.0	1.19E-4	ENSG00000150556	ENST00000409642;ENST00000409876;ENST00000409029;ENST00000280115	T;T;T;T	0.16597	2.33;2.33;2.33;2.33	5.78	0.937	0.19494	5.78	0.937	0.19494	.	0.357652	0.26983	N	0.021502	T	0.11922	0.0290	L	0.35723	1.085	0.09310	N	1	B;B	0.21821	0.035;0.061	B;B	0.16722	0.01;0.016	T	0.28586	-1.0039	9	.	.	.	-22.7644	10.208	0.43124	0.3397:0.0:0.6603:0.0	.	155;179	Q8NI32;Q8NI32-2	LPD6B_HUMAN;.	I	179;155;155;179	ENSP00000387077:V179I;ENSP00000386479:V155I;ENSP00000386650:V155I;ENSP00000280115:V179I	.	V	+	1	0	0	LYPD6B	149779381	149779381	0.832000	0.29368	0.002000	0.10522	0.186000	0.23388	1.506000	0.35747	0.113000	0.18004	-1.871000	0.00553	GTA	0.575071		TCGA-IB-A6UF-01A-23D-A33T-08	0.483	LYPD6B-003	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000332299.2	0	0	1	2	2	2	2	0	0	0	0	150	150	150	150	1	1.890000	-1.957102	0	0.580000	NM_177964		0	6	5	0	727	717	0		1	0		0	0	150	0	0	9.633900e-01	4.984479e-02	0	0	0	35	0	6	727
LRP2	4036	broad.mit.edu	37	2	170044768	170044768	+	Missense_Mutation	SNP	G	G	A	rs142093111	byFrequency	TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:170044768G>A	ENST00000263816.3	-	49	9325	c.9040C>T	c.(9040-9042)Cgg>Tgg	p.R3014W		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3014	LDL-receptor class A 23. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCATTGTGCCGGTCACACCTG	0.468																																						ENST00000263816.3	0.110000	1.000000e-02	0.080000	0.020000	0.050000	0.058259	0.050000	0.050000																										0				315						c.(9040-9042)Cgg>Tgg		low density lipoprotein receptor-related protein 2	"""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"	G	TRP/ARG	0,4406		0,0,2203	103.0	104.0	104.0		9040	-1.3	0.1	2	dbSNP_134	104	3,8597	3.0+/-9.4	0,3,4297	yes	missense	LRP2	NM_004525.2	101	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	3014/4656	170044768	3,13003	2203	4300	6503	SO:0001583	missense	4036	21	121412	45				g.chr2:170044768G>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9040C>T	chr2.hg19:g.170044768G>A	ENSP00000263816:p.Arg3014Trp	0						p.R3014W	NM_004525.2	NP_004516.2	0	0	0	2.040573	P98164	LRP2_HUMAN		49	9325	-			O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	0	1	hg19	c.9040C>T	CCDS2232.1	0	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004957	0.35415	0.0	3.49E-4	ENSG00000081479	ENST00000263816	D	0.95588	-3.75	5.68	-1.28	0.09318	5.68	-1.28	0.09318	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.158354	0.53938	N	0.000058	D	0.91331	0.7266	M	0.74881	2.28	0.80722	D	1	P	0.35307	0.494	B	0.27608	0.081	T	0.83269	-0.0044	10	0.44086	T	0.13	.	5.5847	0.17267	0.2891:0.0:0.3935:0.3174	.	3014	P98164	LRP2_HUMAN	W	3014	ENSP00000263816:R3014W	ENSP00000263816:R3014W	R	-	1	2	2	LRP2	169753014	169753014	1.000000	0.71417	0.145000	0.22337	0.574000	0.36063	1.361000	0.34136	-0.131000	0.11578	0.650000	0.86243	CGG	0.575071		TCGA-IB-A6UF-01A-23D-A33T-08	0.468	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.890000	-2.497065	0	0.580000	NM_004525		0	5	5	0	343	341	0		1			0	0	61	0	0	9.370272e-01	0	0	0	0	0	0	5	343
HOXD10	3236	broad.mit.edu	37	2	176981813	176981813	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:176981813G>A	ENST00000249501.4	+	1	507	c.252G>A	c.(250-252)ccG>ccA	p.P84P	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	84					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GGACAGATCCGAACAGATCTT	0.453																																						ENST00000249501.4	0.920000	6.400000e-01	0.860000	0.700000	0.770000	0.784971	0.770000	0.780000																										0				17						c.(250-252)ccG>ccA		homeobox D10							103.0	99.0	100.0					2																	176981813		2203	4300	6503	SO:0001819	synonymous_variant	3236	0	0					g.chr2:176981813G>A		CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.252G>A	chr2.hg19:g.176981813G>A		0					HOXD10_ENST00000490088.2_Intron	p.P84P	NM_002148.3	NP_002139.2	0	0	0	2.040573	P28358	HXD10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	1	507	+			Q6NT10	Silent	SNP	ENST00000249501.4	1	1	hg19	c.252G>A	CCDS2266.1	0																																																																																								0.575071		TCGA-IB-A6UF-01A-23D-A33T-08	0.453	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2	1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.890000	-4.225160	1	0.580000			0	89	87	0	299	295	1		1			0	0	80	0	0	1	0	0	0	0	0	0	89	299
CXCR2	3579	broad.mit.edu	37	2	219000390	219000390	+	Missense_Mutation	SNP	G	G	A	rs186640530		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:219000390G>A	ENST00000318507.2	+	3	1293	c.866G>A	c.(865-867)cGc>cAc	p.R289H		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	289					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						TGTGAGCGCCGCAATCACATC	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		19234	0.001		0.0	False		,,,				2504	0.0					ENST00000318507.2	0.070000	0	0.050000	0.010000	0.020000	0.036049	0.020000	0.040000																										0				22						c.(865-867)cGc>cAc		chemokine (C-X-C motif) receptor 2							83.0	78.0	79.0					2																	219000390		2203	4300	6503	SO:0001583	missense	3579	6	121412	40				g.chr2:219000390G>A	U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.866G>A	chr2.hg19:g.219000390G>A	ENSP00000319635:p.Arg289His	0						p.R289H	NM_001557.3	NP_001548.1	0	0	0	2.040573	P25025	CXCR2_HUMAN		3	1293	+			Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	ENST00000318507.2	0	1	hg19	c.866G>A	CCDS2408.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.03	2.114961	0.37339	.	.	ENSG00000180871	ENST00000318507	T	0.37411	1.2	5.36	4.47	0.54385	5.36	4.47	0.54385	GPCR, rhodopsin-like superfamily (1);	0.057955	0.64402	D	0.000006	T	0.48502	0.1503	M	0.70108	2.13	0.09310	N	0.999998	P	0.38767	0.646	P	0.50231	0.635	T	0.40440	-0.9563	9	.	.	.	.	9.7981	0.40748	0.1635:0.0:0.8365:0.0	.	289	P25025	CXCR2_HUMAN	H	289	ENSP00000319635:R289H	.	R	+	2	0	0	CXCR2	218708635	218708635	0.930000	0.31532	0.358000	0.25811	0.045000	0.14185	3.615000	0.54167	1.243000	0.43853	0.456000	0.33151	CGC	0.575071		TCGA-IB-A6UF-01A-23D-A33T-08	0.597	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	0	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	1.890000	-2.383918	0	0.580000	NM_001557		0	5	5	0	551	545	0		1			0	0	92	0	0	9.360015e-01	0	0	0	0	0	0	5	551
STK16	8576	broad.mit.edu	37	2	220113194	220113194	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:220113194G>A	ENST00000409638.3	+	8	1003	c.831G>A	c.(829-831)ccG>ccA	p.P277P	TUBA4A_ENST00000498660.1_5'Flank|STK16_ENST00000409743.1_Silent_p.P245P|STK16_ENST00000409260.1_Silent_p.P322P|GLB1L_ENST00000295759.7_5'Flank|GLB1L_ENST00000392089.2_5'Flank|STK16_ENST00000409516.3_Silent_p.P159P|STK16_ENST00000396738.2_Silent_p.P277P	NM_001008910.2	NP_001008910.1	O75716	STK16_HUMAN	serine/threonine kinase 16	277	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in dbSNP:rs35454203). {ECO:0000269|PubMed:17344846}.		cellular response to transforming growth factor beta stimulus (GO:0071560)|protein autophosphorylation (GO:0046777)	Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCGTGGACCCGCATCAGCGTC	0.567																																					Pancreas(34;887 922 17165 36961 39622)	ENST00000409638.3	0.070000	0	0.050000	0.010000	0.030000	0.037223	0.030000	0.040000																										0				1						c.(829-831)ccG>ccA		serine/threonine kinase 16							106.0	113.0	111.0					2																	220113194		2073	4207	6280	SO:0001819	synonymous_variant	8576	0	0					g.chr2:220113194G>A	AF060798	CCDS42822.1	2q35	2010-04-16			ENSG00000115661	ENSG00000115661			11394	protein-coding gene	gene with protein product		604719				9712705	Standard	NM_001008910		Approved	PKL12, MPSK	uc002vko.2	O75716	OTTHUMG00000154520	ENST00000409638.3:c.831G>A	chr2.hg19:g.220113194G>A		0					STK16_ENST00000409260.1_Silent_p.P322P|STK16_ENST00000396738.2_Silent_p.P277P|STK16_ENST00000409516.3_Silent_p.P159P|GLB1L_ENST00000295759.7_5'Flank|STK16_ENST00000409743.1_Silent_p.P245P|GLB1L_ENST00000392089.2_5'Flank|TUBA4A_ENST00000498660.1_5'Flank	p.P277P	NM_001008910.2	NP_001008910.1	0	0	0	2.040573	O75716	STK16_HUMAN		8	1003	+		Renal(207;0.0474)	A8K9H9|Q5U0F8|Q96KI2|Q9BUH4|Q9UEN3|Q9UP78	Silent	SNP	ENST00000409638.3	0	1	hg19	c.831G>A	CCDS42822.1	0																																																																																								0.575071		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	STK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335679.1	0	0	1	2	2	2	2	0	0	0	0	109	109	109	108	1	1.890000	-1.930485	0	0.580000			0	6	7	0	625	622	0		1	0		0	0	109	0	0	9.647575e-01	5.150588e-01	0	0	0	163	0	6	625
TMEM214	54867	broad.mit.edu	37	2	27259437	27259437	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:27259437C>T	ENST00000238788.9	+	6	865	c.803C>T	c.(802-804)gCc>gTc	p.A268V	TMEM214_ENST00000404032.3_Missense_Mutation_p.A223V	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	268					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GCAGGTTTTGCCAACCTCACC	0.567																																						ENST00000238788.9	0.070000	0	0.050000	0.010000	0.020000	0.032377	0.020000	0.030000																										0				18						c.(802-804)gCc>gTc		transmembrane protein 214							99.0	99.0	99.0					2																	27259437		1938	4140	6078	SO:0001583	missense	54867	0	0					g.chr2:27259437C>T		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.803C>T	chr2.hg19:g.27259437C>T	ENSP00000238788:p.Ala268Val	0					TMEM214_ENST00000404032.3_Missense_Mutation_p.A223V	p.A268V	NM_017727.4	NP_060197.4	1	2	3	2.078345	Q6NUQ4	TM214_HUMAN		6	865	+			A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	0	1	hg19	c.803C>T	CCDS42664.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.596|9.596	1.127379|1.127379	0.20959|0.20959	.|.	.|.	ENSG00000119777|ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397|ENST00000425720	T;T|.	0.42131|.	0.98;0.98|.	5.55|5.55	2.24|2.24	0.28232|0.28232	5.55|5.55	2.24|2.24	0.28232|0.28232	.|.	0.863457|.	0.10873|.	N|.	0.624759|.	T|T	0.23846|0.23846	0.0577|0.0577	N|N	0.16478|0.16478	0.41|0.41	0.09310|0.09310	N|N	0.999999|0.999999	B;B|.	0.11235|.	0.004;0.001|.	B;B|.	0.12837|.	0.006;0.008|.	T|T	0.23297|0.23297	-1.0192|-1.0192	10|5	0.22706|.	T|.	0.39|.	-0.0745|-0.0745	9.7642|9.7642	0.40550|0.40550	0.0:0.7292:0.1201:0.1507|0.0:0.7292:0.1201:0.1507	.|.	223;268|.	Q6NUQ4-2;Q6NUQ4|.	.;TM214_HUMAN|.	V|S	268;223;10|27	ENSP00000238788:A268V;ENSP00000384417:A223V|.	ENSP00000238788:A268V|.	A|P	+|+	2|1	0|0	0|0	TMEM214|TMEM214	27112941|27112941	27112941|27112941	0.001000|0.001000	0.12720|0.12720	0.400000|0.400000	0.26346|0.26346	0.988000|0.988000	0.76386|0.76386	1.447000|1.447000	0.35101|0.35101	0.687000|0.687000	0.31509|0.31509	0.561000|0.561000	0.74099|0.74099	GCC|CCA	0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	0	0	1	2	2	2	2	0	0	0	0	151	151	151	150	1	1.890000	-2.180138	0	0.580000	NM_017727		0	6	6	0	719	707	0		1	0		0	0	151	0	0	9.632171e-01	4.578474e-01	0	0	0	167	0	6	719
SNRNP200	23020	broad.mit.edu	37	2	96967391	96967391	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:96967391G>A	ENST00000323853.5	-	4	522	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	SNRNP200_ENST00000349783.5_Missense_Mutation_p.R149W	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	149					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCCTTGTCCCGCAGCTTTTCA	0.463																																						ENST00000323853.5	0.080000	0	0.060000	0.010000	0.030000	0.050088	0.030000	0.040000																										0				90						c.(445-447)Cgg>Tgg		small nuclear ribonucleoprotein 200kDa (U5)							168.0	158.0	161.0					2																	96967391		2203	4300	6503	SO:0001583	missense	23020	1	121412	34				g.chr2:96967391G>A	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.445C>T	chr2.hg19:g.96967391G>A	ENSP00000317123:p.Arg149Trp	0					SNRNP200_ENST00000349783.5_Missense_Mutation_p.R149W	p.R149W	NM_014014.4	NP_054733.2	1	2	3	2.099429	O75643	U520_HUMAN		4	522	-			O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	0	1	hg19	c.445C>T	CCDS2020.1	0	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994162	0.74703	.	.	ENSG00000144028	ENST00000323853;ENST00000349783	T;T	0.46819	0.86;0.86	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.120859	0.53938	D	0.000047	T	0.59128	0.2171	M	0.62088	1.915	0.80722	D	1	D	0.69078	0.997	P	0.51657	0.676	T	0.63337	-0.6660	10	0.87932	D	0	-16.1737	18.3443	0.90315	0.0:0.0:1.0:0.0	.	149	O75643	U520_HUMAN	W	149	ENSP00000317123:R149W;ENSP00000326937:R149W	ENSP00000317123:R149W	R	-	1	2	2	SNRNP200	96331118	96331118	1.000000	0.71417	0.985000	0.45067	0.868000	0.49771	3.196000	0.51020	2.636000	0.89361	0.455000	0.32223	CGG	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.463	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	0	0	1	2	2	2	2	0	0	0	0	114	114	114	113	1	1.890000	-1.783854	0	0.580000	NM_014014		0	7	7	0	670	666	0		1	0		0	0	114	0	0	9.802596e-01	1.298924e-01	0	0	0	52	0	7	670
SAG	6295	broad.mit.edu	37	2	234237147	234237147	+	Missense_Mutation	SNP	G	G	A	rs201978529		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr2:234237147G>A	ENST00000409110.1	+	8	766	c.536G>A	c.(535-537)cGc>cAc	p.R179H	SAG_ENST00000449594.2_Missense_Mutation_p.R45H	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	179					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		TTACTGATCCGCAAAGTACAG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		19420	0.0		0.001	False		,,,				2504	0.0					ENST00000409110.1	0.070000	0	0.050000	0.010000	0.030000	0.036843	0.030000	0.040000																										0				9						c.(535-537)cGc>cAc		S-antigen; retina and pineal gland (arrestin)		G	HIS/ARG	0,3988		0,0,1994	171.0	150.0	157.0		536	4.2	1.0	2		157	1,8335		0,1,4167	no	missense	SAG	NM_000541.4	29	0,1,6161	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	179/406	234237147	1,12323	1994	4168	6162	SO:0001583	missense	6295	4	120928	40				g.chr2:234237147G>A		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.536G>A	chr2.hg19:g.234237147G>A	ENSP00000386444:p.Arg179His	0					SAG_ENST00000449594.2_Missense_Mutation_p.R45H	p.R179H	NM_000541.4	NP_000532.2	1	2	3	2.077192	P10523	ARRS_HUMAN		8	766	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	0	1	hg19	c.536G>A	CCDS46545.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.3	3.967692	0.74131	0.0	1.2E-4	ENSG00000130561	ENST00000252857;ENST00000409110;ENST00000449594	T;T	0.26660	1.72;1.72	4.18	4.18	0.49190	4.18	4.18	0.49190	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58708	0.2141	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.67900	0.731;0.954	T	0.71573	-0.4552	10	0.87932	D	0	-6.7464	17.0843	0.86606	0.0:0.0:1.0:0.0	.	45;179	B7Z7L5;P10523	.;ARRS_HUMAN	H	179;179;45	ENSP00000386444:R179H;ENSP00000392889:R45H	ENSP00000252857:R179H	R	+	2	0	0	SAG	233901886	233901886	1.000000	0.71417	0.962000	0.40283	0.213000	0.24496	9.551000	0.98112	2.337000	0.79520	0.650000	0.86243	CGC	0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.602	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	0	0	1	2	2	2	2	0	0	0	0	122	122	122	122	1	1.890000	-2.065670	0	0.580000	NM_000541		0	6	6	0	639	634	0		1			0	0	122	0	0	9.642434e-01	0	0	0	0	0	0	6	639
OSBPL11	114885	broad.mit.edu	37	3	125298799	125298799	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:125298799G>A	ENST00000296220.5	-	3	608	c.319C>T	c.(319-321)Cag>Tag	p.Q107*		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	107	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						CCTGCAAGCTGCAAAGTTCCT	0.403																																						ENST00000296220.5	0.070000	0	0.050000	0.010000	0.030000	0.037718	0.030000	0.040000																										0				27						c.(319-321)Cag>Tag		oxysterol binding protein-like 11							115.0	118.0	117.0					3																	125298799		2203	4300	6503	SO:0001587	stop_gained	114885	0	0					g.chr3:125298799G>A	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.319C>T	chr3.hg19:g.125298799G>A	ENSP00000296220:p.Gln107*	0						p.Q107*	NM_022776.4	NP_073613.2	0	0	0	2.070095	Q9BXB4	OSB11_HUMAN		3	608	-			A8K9I7	Nonsense_Mutation	SNP	ENST00000296220.5	0	1	hg19	c.319C>T	CCDS3033.1	0	.	.	.	.	.	.	.	.	.	.	G	40	7.930052	0.98565	.	.	ENSG00000144909	ENST00000296220	.	.	.	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.268957	0.38272	N	0.001758	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	13.9553	18.6341	0.91371	0.0:0.0:1.0:0.0	.	.	.	.	X	107	.	ENSP00000296220:Q107X	Q	-	1	0	0	OSBPL11	126781489	126781489	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.587000	0.98229	2.628000	0.89032	0.655000	0.94253	CAG	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.403	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	1.890000	-2.461193	0	0.580000	NM_022776		0	5	5	0	533	527	0		1	0		0	0	80	0	0	9.359506e-01	5.981737e-03	0	0	0	10	0	5	533
C3orf22	152065	broad.mit.edu	37	3	126268739	126268739	+	Missense_Mutation	SNP	G	G	A	rs373190783		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:126268739G>A	ENST00000318225.2	-	4	776	c.398C>T	c.(397-399)gCg>gTg	p.A133V		NM_152533.1	NP_689746.1	Q8N5N4	CC022_HUMAN	chromosome 3 open reading frame 22	133										large_intestine(1)|lung(3)|ovary(2)|prostate(1)	7				GBM - Glioblastoma multiforme(114;0.147)		CAGCCCTGCCGCCTTGCTGGT	0.627																																						ENST00000318225.2	1.000000	9.100000e-01	1.000000	0.990000	0.990000	0.994177	0.990000	1.000000																										0				7						c.(397-399)gCg>gTg		chromosome 3 open reading frame 22		G	VAL/ALA	0,4406		0,0,2203	55.0	53.0	54.0		398	-0.5	0.0	3		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	C3orf22	NM_152533.1	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	133/142	126268739	1,13005	2203	4300	6503	SO:0001583	missense	152065	4	121412	33				g.chr3:126268739G>A		CCDS3040.1	3q21.3	2011-09-30			ENSG00000180697	ENSG00000180697			28534	protein-coding gene	gene with protein product						12477932	Standard	NM_152533		Approved	MGC34728	uc003ejb.3	Q8N5N4	OTTHUMG00000162731	ENST00000318225.2:c.398C>T	chr3.hg19:g.126268739G>A	ENSP00000316644:p.Ala133Val	0						p.A133V	NM_152533.1	NP_689746.1	0	0	0	2.070095	Q8N5N4	CC022_HUMAN		4	776	-			B3KUS9	Missense_Mutation	SNP	ENST00000318225.2	1	1	hg19	c.398C>T	CCDS3040.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228530	0.39399	0.0	1.16E-4	ENSG00000180697	ENST00000318225	.	.	.	1.92	-0.536	0.11876	1.92	-0.536	0.11876	.	.	.	.	.	T	0.09818	0.0241	N	0.19112	0.55	0.09310	N	1	P	0.41188	0.741	B	0.25405	0.06	T	0.22730	-1.0208	8	0.02654	T	1	6.4871	4.5161	0.11935	0.4702:0.0:0.5298:0.0	.	133	Q8N5N4	CC022_HUMAN	V	133	.	ENSP00000316644:A133V	A	-	2	0	0	C3orf22	127751429	127751429	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.292000	0.08332	-0.154000	0.11118	0.313000	0.20887	GCG	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.627	C3orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370231.2	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.890000	-20.000000	1	0.580000	NM_152533		0	83	82	0	174	174	1		1			0	0	43	0	0	1	0	0	0	0	0	0	83	174
MCM2	4171	broad.mit.edu	37	3	127337969	127337969	+	Missense_Mutation	SNP	G	G	A	rs147793264		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:127337969G>A	ENST00000265056.7	+	13	2357	c.2113G>A	c.(2113-2115)Gcc>Acc	p.A705T	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	705					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						TGCTGAGCCCGCCATGCCCAA	0.637																																						ENST00000265056.7	0.150000	1.000000e-02	0.110000	0.030000	0.060000	0.076655	0.060000	0.060000																										0				6						c.(2113-2115)Gcc>Acc		minichromosome maintenance complex component 2		G	THR/ALA	0,4406		0,0,2203	45.0	38.0	40.0		2113	0.6	0.0	3	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	no	missense	MCM2	NM_004526.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	705/905	127337969	1,13005	2203	4300	6503	SO:0001583	missense	4171	0	0					g.chr3:127337969G>A	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2113G>A	chr3.hg19:g.127337969G>A	ENSP00000265056:p.Ala705Thr	0					MCM2_ENST00000468414.1_3'UTR	p.A705T	NM_004526.2	NP_004517.2	0	0	0	2.070095	P49736	MCM2_HUMAN		13	2357	+			Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	0	1	hg19	c.2113G>A	CCDS3043.1	0	.	.	.	.	.	.	.	.	.	.	G	1.635	-0.517936	0.04171	0.0	1.16E-4	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142	T	0.02421	4.3	5.61	0.559	0.17272	5.61	0.559	0.17272	.	1.165010	0.06316	N	0.703534	T	0.01976	0.0062	N	0.05467	-0.045	0.19300	N	0.999978	B;B;B	0.14012	0.001;0.009;0.008	B;B;B	0.16289	0.002;0.015;0.009	T	0.50065	-0.8871	10	0.15066	T	0.55	-10.4948	10.4606	0.44577	0.4466:0.0:0.5534:0.0	.	755;575;705	F5H1E9;B4DSV5;P49736	.;.;MCM2_HUMAN	T	705;609;755	ENSP00000265056:A705T	ENSP00000265056:A705T	A	+	1	0	0	MCM2	128820659	128820659	0.111000	0.22076	0.014000	0.15608	0.049000	0.14656	0.425000	0.21346	-0.197000	0.10350	-0.964000	0.02622	GCC	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.637	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1	0	0	0	2	2	2	2	0	0	0	0	35	35	35	33	1	1.890000	-5.364141	1	0.580000			0	4	4	0	218	207	0		1	0		0	0	35	0	0	8.788610e-01	2.259680e-01	0	1	0	39	0	4	218
LHFPL4	375323	broad.mit.edu	37	3	9547694	9547694	+	Silent	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:9547694C>T	ENST00000287585.6	-	3	885	c.600G>A	c.(598-600)cgG>cgA	p.R200R		NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	213						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					GGTCTGTTTGCCGGTTGCCCA	0.657																																						ENST00000287585.6	0.070000	0	0.050000	0.010000	0.020000	0.040568	0.020000	0.020000																										0				10						c.(598-600)cgG>cgA		lipoma HMGIC fusion partner-like 4							109.0	94.0	99.0					3																	9547694		2203	4300	6503	SO:0001819	synonymous_variant	375323	0	0					g.chr3:9547694C>T	AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.600G>A	chr3.hg19:g.9547694C>T		0						p.R200R	NM_198560.2	NP_940962.1	1	2	3	2.093118	Q86UP9	LHPL3_HUMAN		3	885	-	Medulloblastoma(99;0.227)		A1L383|A4D0Q5	Silent	SNP	ENST00000287585.6	0	1	hg19	c.600G>A	CCDS33691.1	0																																																																																								0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.657	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338298.1	0	0	1	2	31	2	2	1	1	1	2	108	108	108	107	1	1.890000	-2.362691	0	0.580000	NM_198560		0	6	6	0	748	745	0		0			1	0	108	0	0	1.564122e-05	0	0	0	0	0	0	6	748
SCN11A	11280	broad.mit.edu	37	3	38938452	38938452	+	Missense_Mutation	SNP	G	G	A	rs537371340		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:38938452G>A	ENST00000302328.3	-	14	2485	c.2287C>T	c.(2287-2289)Cgc>Tgc	p.R763C	SCN11A_ENST00000450244.1_Missense_Mutation_p.R763C|SCN11A_ENST00000444237.2_Missense_Mutation_p.R763C|SCN11A_ENST00000456224.3_Missense_Mutation_p.R763C	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	763					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGAGGATGCGGAATACCACT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		16955	0.0		0.0	False		,,,				2504	0.001					ENST00000302328.3	1.000000	8.400000e-01	1.000000	0.920000	0.990000	0.972358	0.990000	1.000000																										0				119						c.(2287-2289)Cgc>Tgc		sodium channel, voltage-gated, type XI, alpha subunit	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)						125.0	113.0	117.0					3																	38938452		2203	4300	6503	SO:0001583	missense	11280	5	121412	38				g.chr3:38938452G>A	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2287C>T	chr3.hg19:g.38938452G>A	ENSP00000307599:p.Arg763Cys	0					SCN11A_ENST00000456224.3_Missense_Mutation_p.R763C|SCN11A_ENST00000450244.1_Missense_Mutation_p.R763C|SCN11A_ENST00000444237.2_Missense_Mutation_p.R763C	p.R763C	NM_014139.2	NP_054858.2	1	2	3	2.093118	Q9UI33	SCNBA_HUMAN		14	2485	-			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	1	1	hg19	c.2287C>T	CCDS33737.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.468244	0.96274	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.95	5.95	0.96441	5.95	5.95	0.96441	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99208	0.9725	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98760	1.0724	10	0.87932	D	0	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	763	Q9UI33	SCNBA_HUMAN	C	763	ENSP00000307599:R763C;ENSP00000400945:R763C;ENSP00000416757:R763C;ENSP00000408028:R763C	ENSP00000307599:R763C	R	-	1	0	0	SCN11A	38913456	38913456	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.812000	0.86109	2.827000	0.97445	0.650000	0.86243	CGC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.473	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	1	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.890000	-7.485149	1	0.580000	NM_014139		0	96	96	0	233	229	1		1			0	0	70	0	0	1	0	0	0	0	0	0	96	233
CCR2	729230	broad.mit.edu	37	3	46401296	46401296	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:46401296G>A	ENST00000400888.2	+	2	1109	c.1070G>A	c.(1069-1071)gGa>gAa	p.G357E	CCR2_ENST00000292301.4_Missense_Mutation_p.G357E			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	357					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		CGTGGAAAAGGAAAGTCAATT	0.493																																						ENST00000400888.2	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.063499	0.040000	0.040000																										0				14						c.(1069-1071)gGa>gAa		chemokine (C-C motif) receptor 2							102.0	93.0	96.0					3																	46401296		1568	3582	5150	SO:0001583	missense	729230	0	0					g.chr3:46401296G>A		CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.1070G>A	chr3.hg19:g.46401296G>A	ENSP00000383681:p.Gly357Glu	0					CCR2_ENST00000292301.4_Missense_Mutation_p.G357E	p.G357E			1	2	3	2.093118	P41597	CCR2_HUMAN		2	1109	+			A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	ENST00000400888.2	0	1	hg19	c.1070G>A	CCDS43078.1	0	.	.	.	.	.	.	.	.	.	.	G	9.639	1.138456	0.21123	.	.	ENSG00000121807	ENST00000292301;ENST00000400888	T;T	0.68765	-0.35;-0.35	3.45	-1.8	0.07907	3.45	-1.8	0.07907	.	2.790660	0.01671	N	0.025619	T	0.43678	0.1258	N	0.08118	0	0.09310	N	1	B	0.25904	0.137	B	0.27887	0.084	T	0.19516	-1.0303	10	0.22109	T	0.4	.	4.2507	0.10693	0.3066:0.3232:0.3702:0.0	.	357	P41597	CCR2_HUMAN	E	357	ENSP00000292301:G357E;ENSP00000383681:G357E	ENSP00000292301:G357E	G	+	2	0	0	CCR2	46376300	46376300	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.258000	0.08733	-0.422000	0.07405	-0.156000	0.13503	GGA	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.493	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	1.890000	-5.505612	1	0.580000	NM_000647		0	6	6	0	439	435	0		1			0	0	63	0	0	9.639711e-01	0	0	0	0	0	0	6	439
ASTE1	28990	broad.mit.edu	37	3	130744081	130744081	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr3:130744081G>A	ENST00000264992.3	-	3	511	c.70C>T	c.(70-72)Cgg>Tgg	p.R24W	NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000356918.4_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.R24W	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	24					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R24W(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTGTGTCCCGCAACTTCAAA	0.403																																						ENST00000264992.3	0.060000	0	0.050000	0.010000	0.020000	0.032122	0.020000	0.030000																										1	Substitution - Missense(1)	p.R24W(1)	endometrium(1)	22						c.(70-72)Cgg>Tgg		asteroid homolog 1 (Drosophila)							97.0	97.0	97.0					3																	130744081		2203	4300	6503	SO:0001583	missense	28990	0	0					g.chr3:130744081G>A	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.70C>T	chr3.hg19:g.130744081G>A	ENSP00000264992:p.Arg24Trp	0					ASTE1_ENST00000514044.1_Missense_Mutation_p.R24W|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank	p.R24W	NM_014065.2	NP_054784.2	0	0	0	2.070095	Q2TB18	ASTE1_HUMAN		3	511	-			B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	0	1	hg19	c.70C>T	CCDS3068.1	0	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562030	0.65538	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270;ENST00000505545;ENST00000504725	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.44	2.22	0.28083	5.44	2.22	0.28083	XPG N-terminal (1);	0.048280	0.85682	D	0.000000	T	0.70202	0.3197	M	0.74881	2.28	0.42751	D	0.993773	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74682	-0.3583	10	0.87932	D	0	-23.8367	13.7698	0.63018	0.0:0.0:0.4438:0.5562	.	24;24	D6RG30;Q2TB18	.;ASTE1_HUMAN	W	24	ENSP00000426421:R24W;ENSP00000264992:R24W;ENSP00000425683:R24W;ENSP00000422851:R24W	ENSP00000264992:R24W	R	-	1	2	2	ASTE1	132226771	132226771	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.943000	0.40253	0.599000	0.29845	0.650000	0.86243	CGG	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.403	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	0	0	1	2	2	2	2	0	0	0	0	136	136	136	136	1	1.890000	-2.035640	0	0.580000	NM_014065		0	6	6	0	722	717	0		1	0		0	0	136	0	0	9.643126e-01	2.115282e-03	0	0	0	7	0	6	722
FSTL5	56884	broad.mit.edu	37	4	162841645	162841645	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr4:162841645A>T	ENST00000306100.5	-	4	756	c.320T>A	c.(319-321)tTc>tAc	p.F107Y	FSTL5_ENST00000536695.1_Missense_Mutation_p.F106Y|FSTL5_ENST00000379164.4_Missense_Mutation_p.F106Y|FSTL5_ENST00000427802.2_Missense_Mutation_p.F106Y	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	107	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GTTTTCATAGAATTCTCCGTC	0.433																																						ENST00000306100.5	1.000000	7.700000e-01	1.000000	0.860000	0.960000	0.944076	0.960000	1.000000																										0				91						c.(319-321)tTc>tAc		follistatin-like 5							131.0	119.0	123.0					4																	162841645		2203	4300	6503	SO:0001583	missense	56884	0	0					g.chr4:162841645A>T	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.320T>A	chr4.hg19:g.162841645A>T	ENSP00000305334:p.Phe107Tyr	0					FSTL5_ENST00000379164.4_Missense_Mutation_p.F106Y|FSTL5_ENST00000536695.1_Missense_Mutation_p.F106Y|FSTL5_ENST00000427802.2_Missense_Mutation_p.F106Y	p.F107Y	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	1	2	3	2.083006	Q8N475	FSTL5_HUMAN		4	756	-	all_hematologic(180;0.24)		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	1	1	hg19	c.320T>A	CCDS3802.1	1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.552502	0.86127	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.04156	3.69;3.69;3.69;3.69	5.86	5.86	0.93980	5.86	5.86	0.93980	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.056975	0.64402	D	0.000001	T	0.08268	0.0206	L	0.33093	0.98	0.47994	D	0.999564	D;B;D	0.53619	0.961;0.134;0.961	P;B;P	0.48770	0.589;0.017;0.589	T	0.13176	-1.0519	10	0.51188	T	0.08	.	15.7408	0.77894	1.0:0.0:0.0:0.0	.	106;106;107	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	Y	107;106;106;106	ENSP00000305334:F107Y;ENSP00000368462:F106Y;ENSP00000389270:F106Y;ENSP00000440409:F106Y	ENSP00000305334:F107Y	F	-	2	0	0	FSTL5	163061095	163061095	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	8.910000	0.92685	2.367000	0.80283	0.528000	0.53228	TTC	0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.433	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.890000	-20.000000	1	0.580000	NM_020116		0	68	68	0	175	173	1		1			0	0	25	0	0	1	0	0	0	0	0	0	68	175
FRAS1	80144	broad.mit.edu	37	4	79462159	79462159	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr4:79462159C>T	ENST00000264895.6	+	74	12360	c.11920C>T	c.(11920-11922)Cgg>Tgg	p.R3974W		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3970					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CTGCACTGTGCGGAACGTCAA	0.473																																						ENST00000264895.6	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.112669	0.050000	0.060000																										0				103						c.(11920-11922)Cgg>Tgg		Fraser extracellular matrix complex subunit 1							74.0	74.0	74.0					4																	79462159		1930	4143	6073	SO:0001583	missense	80144	1	120856	31				g.chr4:79462159C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11920C>T	chr4.hg19:g.79462159C>T	ENSP00000264895:p.Arg3974Trp	0						p.R3974W	NM_025074.6	NP_079350.5	1	2	3	2.151450	Q86XX4	FRAS1_HUMAN		74	12360	+			A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	0	1	hg19	c.11920C>T	CCDS54771.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.68|14.68	2.608257|2.608257	0.46527|0.46527	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.51325	.|0.71	6.08|6.08	4.27|4.27	0.50696|0.50696	6.08|6.08	4.27|4.27	0.50696|0.50696	.|.	.|0.056812	.|0.64402	.|D	.|0.000004	T|T	0.62392|0.62392	0.2424|0.2424	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.77004	.|0.989	T|T	0.66559|0.66559	-0.5893|-0.5893	5|10	.|0.87932	.|D	.|0	.|.	14.4407|14.4407	0.67314|0.67314	0.4855:0.5145:0.0:0.0|0.4855:0.5145:0.0:0.0	.|.	.|3974	.|E9PHH6	.|.	V|W	2202|3974	.|ENSP00000264895:R3974W	.|ENSP00000264895:R3974W	A|R	+|+	2|1	0|2	0|2	FRAS1|FRAS1	79681183|79681183	79681183|79681183	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.071000|0.071000	0.16799|0.16799	2.329000|2.329000	0.43876|0.43876	1.543000|1.543000	0.49345|0.49345	0.591000|0.591000	0.81541|0.81541	GCG|CGG	0.588356		TCGA-IB-A6UF-01A-23D-A33T-08	0.473	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.890000	-2.927346	1	0.580000			0	6	6	0	400	384	0		1	0		0	0	60	0	0	9.606618e-01	4.747088e-03	0	0	0	6	0	6	400
CLCN3	1182	broad.mit.edu	37	4	170618575	170618575	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr4:170618575G>A	ENST00000513761.1	+	9	1812	c.1253G>A	c.(1252-1254)cGc>cAc	p.R418H	CLCN3_ENST00000360642.3_Missense_Mutation_p.R391H|CLCN3_ENST00000347613.4_Missense_Mutation_p.R418H|CLCN3_ENST00000504131.2_Missense_Mutation_p.R401H	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	418					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TGTCGTCGACGCAAGTCCACG	0.438																																						ENST00000513761.1	0.070000	0	0.050000	0.010000	0.030000	0.038253	0.030000	0.040000																										0				29						c.(1252-1254)cGc>cAc		chloride channel, voltage-sensitive 3							128.0	124.0	125.0					4																	170618575		2203	4300	6503	SO:0001583	missense	1182	0	0					g.chr4:170618575G>A	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1253G>A	chr4.hg19:g.170618575G>A	ENSP00000424603:p.Arg418His	0					CLCN3_ENST00000360642.3_Missense_Mutation_p.R391H|CLCN3_ENST00000347613.4_Missense_Mutation_p.R418H|CLCN3_ENST00000504131.2_Missense_Mutation_p.R401H	p.R418H	NM_001829.3	NP_001820.2	1	2	3	2.083006	P51790	CLCN3_HUMAN		9	1812	+		Prostate(90;0.00601)|Renal(120;0.0183)	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	0	1	hg19	c.1253G>A	CCDS34101.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.870874|4.870874	0.91587|0.91587	.|.	.|.	ENSG00000109572|ENSG00000109572	ENST00000515420|ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131;ENST00000507875	.|D;D;D;D;D	.|0.94650	.|-3.48;-3.48;-3.48;-3.48;-3.48	5.84|5.84	5.84|5.84	0.93424|0.93424	5.84|5.84	5.84|5.84	0.93424|0.93424	.|Chloride channel, core (2);	.|0.046411	.|0.85682	.|D	.|0.000000	D|D	0.98425|0.98425	0.9476|0.9476	H|H	0.96777|0.96777	3.88|3.88	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.999;1.0;0.999;0.999;1.0	.|D;D;D;D;D	.|0.77557	.|0.984;0.99;0.984;0.984;0.972	D|D	0.99023|0.99023	1.0818|1.0818	5|10	.|0.87932	.|D	.|0	-4.8294|-4.8294	20.1392|20.1392	0.98050|0.98050	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|391;401;391;418;418	.|B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.|.;.;.;CLCN3_HUMAN;.	T|H	73|418;418;391;401;391	.|ENSP00000424603:R418H;ENSP00000261514:R418H;ENSP00000353857:R391H;ENSP00000424540:R401H;ENSP00000425323:R391H	.|ENSP00000261514:R418H	A|R	+|+	1|2	0|0	0|0	CLCN3|CLCN3	170855150|170855150	170855150|170855150	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.968000|7.968000	0.87980|0.87980	2.765000|2.765000	0.95021|0.95021	0.557000|0.557000	0.71058|0.71058	GCA|CGC	0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.438	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2	0	0	1	2	2	2	2	0	0	0	0	117	117	117	115	1	1.890000	-2.170206	0	0.580000			0	6	5	0	617	611	0		1	0		0	0	117	0	0	9.638607e-01	8.874039e-02	0	0	0	43	0	6	617
SEPT8	23176	broad.mit.edu	37	5	132098218	132098218	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:132098218G>A	ENST00000378719.2	-	5	891	c.654C>T	c.(652-654)ccC>ccT	p.P218P	SEPT8_ENST00000378706.1_Silent_p.P218P|SEPT8_ENST00000378701.1_Silent_p.P216P|SEPT8_ENST00000378721.4_Silent_p.P216P|SEPT8_ENST00000296873.7_Silent_p.P218P|SEPT8_ENST00000481030.1_5'Flank|SEPT8_ENST00000448933.1_Silent_p.P158P|SEPT8_ENST00000378699.2_Silent_p.P158P|SEPT8_ENST00000458488.2_Silent_p.P218P	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	218	Septin-type G.				cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)		SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CATCATCCGTGGGGAACTGGT	0.582																																						ENST00000378719.2	1.000000	9.400000e-01	1.000000	0.990000	0.990000	0.996589	0.990000	1.000000																									SEPT8/AFF4(2)	0				11						c.(652-654)ccC>ccT		septin 8							129.0	126.0	127.0					5																	132098218		2095	4252	6347	SO:0001819	synonymous_variant	23176	0	0					g.chr5:132098218G>A	AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.654C>T	chr5.hg19:g.132098218G>A		0					SEPT8_ENST00000378706.1_Silent_p.P218P|SEPT8_ENST00000458488.2_Silent_p.P218P|SEPT8_ENST00000378721.4_Silent_p.P216P|SEPT8_ENST00000481030.1_5'Flank|SEPT8_ENST00000296873.7_Silent_p.P218P|SEPT8_ENST00000448933.1_Silent_p.P158P|SEPT8_ENST00000378699.2_Silent_p.P158P|SEPT8_ENST00000378701.1_Silent_p.P216P	p.P218P	NM_001098811.1	NP_001092281.1	1	2	3	2.101368	Q92599	SEPT8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	5	891	-		all_cancers(142;0.0751)|Breast(839;0.198)	A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Silent	SNP	ENST00000378719.2	1	1	hg19	c.654C>T	CCDS43358.1	1																																																																																								0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.582	SEPT8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132827.2	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.890000	-10.753750	1	0.580000	XM_034872		0	127	124	0	272	271	1		1	1		0	0	58	0	0	1	1	0	10	0	63	0	127	272
PPP2CA	5515	broad.mit.edu	37	5	133541798	133541798	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:133541798A>G	ENST00000481195.1	-	2	407	c.127T>C	c.(127-129)Tcc>Ccc	p.S43P	CDKL3_ENST00000609383.1_3'UTR|PPP2CA_ENST00000231504.5_5'UTR|CTD-2410N18.4_ENST00000518409.1_RNA|CTD-2410N18.5_ENST00000519718.1_Intron|CDKL3_ENST00000609654.1_Missense_Mutation_p.S393P	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	43					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	TGCACGTTGGATTCTTTTGTC	0.378																																						ENST00000481195.1	1.000000	7.700000e-01	1.000000	0.850000	0.930000	0.928633	0.930000	1.000000																										0				12						c.(127-129)Tcc>Ccc		protein phosphatase 2, catalytic subunit, alpha isozyme	Vitamin E(DB00163)						134.0	120.0	125.0					5																	133541798		2203	4300	6503	SO:0001583	missense	5515	0	0					g.chr5:133541798A>G		CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.127T>C	chr5.hg19:g.133541798A>G	ENSP00000418447:p.Ser43Pro	0					CDKL3_ENST00000609383.1_3'UTR|CDKL3_ENST00000609654.1_Missense_Mutation_p.S393P|PPP2CA_ENST00000231504.5_5'UTR|CTD-2410N18.5_ENST00000519718.1_Intron|CTD-2410N18.4_ENST00000518409.1_RNA	p.S43P	NM_002715.2	NP_002706.1	1	2	3	2.101368	P67775	PP2AA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	2	407	-			P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	1	1	hg19	c.127T>C	CCDS4173.1	1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.782504	0.70222	.	.	ENSG00000113575	ENST00000481195;ENST00000523082	T;T	0.03745	3.82;3.82	5.35	5.35	0.76521	5.35	5.35	0.76521	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.107193	0.64402	D	0.000003	T	0.09423	0.0232	L	0.39245	1.2	0.80722	D	1	B;B	0.29571	0.249;0.001	P;B	0.46049	0.502;0.002	T	0.23013	-1.0200	10	0.62326	D	0.03	-5.6143	15.6174	0.76778	1.0:0.0:0.0:0.0	.	393;43	B7Z2C5;P67775	.;PP2AA_HUMAN	P	43;30	ENSP00000418447:S43P;ENSP00000428816:S30P	ENSP00000418447:S43P	S	-	1	0	0	PPP2CA	133569697	133569697	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.287000	0.95975	2.161000	0.67846	0.482000	0.46254	TCC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.378	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.890000	-20.000000	1	0.580000	NM_002715		0	90	90	0	243	240	1		1	1		0	0	70	0	0	1	1	0	73	0	146	0	90	243
PCDHB1	29930	broad.mit.edu	37	5	140431291	140431291	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:140431291G>A	ENST00000306549.3	+	1	313	c.236G>A	c.(235-237)cGc>cAc	p.R79H		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R79L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGCTCCACCGCAAGACGGGA	0.567																																						ENST00000306549.3	0.110000	0	0.070000	0.020000	0.040000	0.061186	0.040000	0.040000																										1	Substitution - Missense(1)	p.R79L(1)	upper_aerodigestive_tract(1)	53						c.(235-237)cGc>cAc		protocadherin beta 1							62.0	67.0	65.0					5																	140431291		2203	4300	6503	SO:0001583	missense	29930	0	0					g.chr5:140431291G>A	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.236G>A	chr5.hg19:g.140431291G>A	ENSP00000307234:p.Arg79His	0						p.R79H	NM_013340.2	NP_037472.2	1	2	3	2.101368	Q9Y5F3	PCDB1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	313	+			Q2M257	Missense_Mutation	SNP	ENST00000306549.3	0	1	hg19	c.236G>A	CCDS4243.1	0	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452174	0.26074	.	.	ENSG00000171815	ENST00000306549	T	0.38887	1.11	5.81	5.81	0.92471	5.81	5.81	0.92471	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.48767	D	0.000178	T	0.38480	0.1042	L	0.46614	1.455	0.22719	N	0.998819	D	0.59357	0.985	P	0.48795	0.59	T	0.42749	-0.9433	10	0.30078	T	0.28	.	5.4729	0.16680	0.0748:0.1974:0.598:0.1299	.	79	Q9Y5F3	PCDB1_HUMAN	H	79	ENSP00000307234:R79H	ENSP00000307234:R79H	R	+	2	0	0	PCDHB1	140411475	140411475	0.000000	0.05858	1.000000	0.80357	0.929000	0.56500	0.076000	0.14712	2.756000	0.94617	0.655000	0.94253	CGC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.567	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	0	0	1	2	2	2	2	0	0	0	0	94	94	94	93	1	1.890000	-2.618802	1	0.580000	NM_013340		0	6	6	0	459	448	0		1			0	0	94	0	0	9.625183e-01	0	0	0	0	0	0	6	459
PCDHGB1	56104	broad.mit.edu	37	5	140730509	140730509	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:140730509C>T	ENST00000523390.1	+	1	682	c.682C>T	c.(682-684)Cga>Tga	p.R228*	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	228	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATCTGGATCCGAGTTACGGA	0.547																																						ENST00000523390.1	1.000000	8.800000e-01	1.000000	0.950000	0.990000	0.985139	0.990000	1.000000																										0				16						c.(682-684)Cga>Tga		protocadherin gamma subfamily B, 1							67.0	69.0	68.0					5																	140730509		1922	4139	6061	SO:0001587	stop_gained	56104	1	120854	29				g.chr5:140730509C>T	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.682C>T	chr5.hg19:g.140730509C>T	ENSP00000429273:p.Arg228*	0					PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	p.R228*	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	1	2	3	2.101368	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	682	+			Q3SY75|Q9Y5C8	Nonsense_Mutation	SNP	ENST00000523390.1	0	1	hg19	c.682C>T	CCDS54923.1	1	.	.	.	.	.	.	.	.	.	.	.	14.38	2.518092	0.44763	.	.	ENSG00000254221	ENST00000523390	.	.	.	5.36	1.88	0.25563	5.36	1.88	0.25563	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	7.6146	0.28150	0.6252:0.2816:0.0:0.0931	.	.	.	.	X	228	.	ENSP00000429273:R228X	R	+	1	2	2	PCDHGB1	140710693	140710693	0.000000	0.05858	0.031000	0.17742	0.055000	0.15305	0.430000	0.21428	0.655000	0.30866	0.563000	0.77884	CGA	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.547	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	1	0	1	2	2	2	2	0	0	0	0	88	88	88	79	1	1.890000	-9.525268	1	0.580000	NM_018922		0	140	128	0	330	295	1		1	0		0	0	88	0	0	1	7.991053e-01	0	0	0	9	0	140	330
PCDH12	51294	broad.mit.edu	37	5	141335933	141335933	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:141335933A>T	ENST00000231484.3	-	1	2694	c.1484T>A	c.(1483-1485)gTc>gAc	p.V495D	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	495	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGTATGAGACTTTTCCATT	0.473																																						ENST00000231484.3	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.993967	0.990000	1.000000																										0				38						c.(1483-1485)gTc>gAc		protocadherin 12							103.0	102.0	103.0					5																	141335933		2203	4300	6503	SO:0001583	missense	51294	0	0					g.chr5:141335933A>T	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1484T>A	chr5.hg19:g.141335933A>T	ENSP00000231484:p.Val495Asp	0					AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	p.V495D	NM_016580.2	NP_057664.1	1	2	3	2.101368	Q9NPG4	PCD12_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2694	-		all_hematologic(541;0.0999)	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	1	1	hg19	c.1484T>A	CCDS4269.1	1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.325820	0.41197	.	.	ENSG00000113555	ENST00000231484	T	0.55234	0.53	5.16	5.16	0.70880	5.16	5.16	0.70880	Cadherin (4);Cadherin-like (1);	0.463335	0.22727	N	0.056374	T	0.77315	0.4112	H	0.94886	3.595	0.80722	D	1	D	0.67145	0.996	P	0.62089	0.898	D	0.83734	0.0200	10	0.87932	D	0	.	12.9983	0.58660	1.0:0.0:0.0:0.0	.	495	Q9NPG4	PCD12_HUMAN	D	495	ENSP00000231484:V495D	ENSP00000231484:V495D	V	-	2	0	0	PCDH12	141316117	141316117	1.000000	0.71417	0.835000	0.33067	0.159000	0.22180	9.139000	0.94554	2.169000	0.68431	0.533000	0.62120	GTC	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.473	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.890000	-20.000000	1	0.580000	NM_016580		0	107	106	0	233	231	1		1	0		0	0	46	0	0	1	6.115445e-01	0	0	0	6	0	107	233
FAT2	2196	broad.mit.edu	37	5	150930181	150930181	+	Silent	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:150930181C>T	ENST00000261800.5	-	7	4560	c.4548G>A	c.(4546-4548)tcG>tcA	p.S1516S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1516	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGAGGGCCCCGAGCCGAGGT	0.532																																						ENST00000261800.5	0.150000	2.000000e-02	0.110000	0.040000	0.070000	0.086931	0.070000	0.070000																										0				196						c.(4546-4548)tcG>tcA		FAT atypical cadherin 2							82.0	80.0	81.0					5																	150930181		2203	4300	6503	SO:0001819	synonymous_variant	2196	2	121412	35				g.chr5:150930181C>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4548G>A	chr5.hg19:g.150930181C>T		0						p.S1516S	NM_001447.2	NP_001438.1	1	2	3	2.101368	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	7	4560	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	0	1	hg19	c.4548G>A	CCDS4317.1	0																																																																																								0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.532	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	0	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	1.890000	-2.046387	0	0.580000	NM_001447		0	8	8	0	390	385	0		1			0	0	74	0	0	9.889771e-01	0	0	0	0	0	0	8	390
FAM71B	153745	broad.mit.edu	37	5	156593091	156593091	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:156593091C>T	ENST00000302938.4	-	1	184	c.89G>A	c.(88-90)cGa>cAa	p.R30Q		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	30						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTACAATTGTCGTTGCAGGTC	0.403																																						ENST00000302938.4	1.000000	8.500000e-01	1.000000	0.910000	0.980000	0.967033	0.980000	1.000000																										0				68						c.(88-90)cGa>cAa		family with sequence similarity 71, member B							137.0	131.0	133.0					5																	156593091		2203	4300	6503	SO:0001583	missense	153745	1	121412	33				g.chr5:156593091C>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.89G>A	chr5.hg19:g.156593091C>T	ENSP00000305596:p.Arg30Gln	0						p.R30Q	NM_130899.2	NP_570969.2	1	2	3	2.101368	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	1	184	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	1	1	hg19	c.89G>A	CCDS4335.1	1	.	.	.	.	.	.	.	.	.	.	C	6.047	0.377072	0.11466	.	.	ENSG00000170613	ENST00000302938	T	0.04970	3.52	4.67	2.9	0.33743	4.67	2.9	0.33743	.	0.174270	0.35151	N	0.003414	T	0.02929	0.0087	N	0.12887	0.27	0.09310	N	1	P	0.35600	0.511	B	0.23419	0.046	T	0.44877	-0.9299	10	0.38643	T	0.18	-3.3554	8.0345	0.30484	0.0:0.8053:0.0:0.1947	.	30	Q8TC56	FA71B_HUMAN	Q	30	ENSP00000305596:R30Q	ENSP00000305596:R30Q	R	-	2	0	0	FAM71B	156525669	156525669	0.000000	0.05858	0.004000	0.12327	0.097000	0.18754	0.218000	0.17622	0.663000	0.31027	-0.143000	0.13931	CGA	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.403	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	1	0	1	2	2	2	2	0	0	0	0	98	98	98	97	1	1.890000	-20.000000	1	0.580000	NM_130899		0	167	166	0	421	417	1		1			0	0	98	0	0	1	0	0	0	0	0	0	167	421
UNC5A	90249	broad.mit.edu	37	5	176301068	176301068	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:176301068G>A	ENST00000329542.4	+	7	1260	c.986G>A	c.(985-987)cGg>cAg	p.R329Q	UNC5A_ENST00000261961.3_Missense_Mutation_p.R289Q	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	329					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTTATTGCCGGAAGAAGGAG	0.622																																						ENST00000329542.4	0.120000	0	0.080000	0.020000	0.040000	0.065436	0.040000	0.040000																										0				34						c.(985-987)cGg>cAg		unc-5 homolog A (C. elegans)							117.0	102.0	107.0					5																	176301068		2203	4300	6503	SO:0001583	missense	90249	0	0					g.chr5:176301068G>A	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.986G>A	chr5.hg19:g.176301068G>A	ENSP00000332737:p.Arg329Gln	0					UNC5A_ENST00000261961.3_Missense_Mutation_p.R289Q	p.R329Q	NM_133369.2	NP_588610.2	1	2	3	2.101368	Q6ZN44	UNC5A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	7	1260	+	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	0	1	hg19	c.986G>A	CCDS34299.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.481357	0.96307	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.51071	0.72;1.03	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.64746	0.2626	L	0.52126	1.63	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.71414	0.973;0.973	T	0.66874	-0.5813	10	0.72032	D	0.01	-35.8421	18.9122	0.92490	0.0:0.0:1.0:0.0	.	289;329	Q6ZN44-3;Q6ZN44	.;UNC5A_HUMAN	Q	329;289	ENSP00000332737:R329Q;ENSP00000261961:R289Q	ENSP00000261961:R289Q	R	+	2	0	0	UNC5A	176233674	176233674	1.000000	0.71417	0.976000	0.42696	0.927000	0.56198	6.361000	0.73070	2.481000	0.83766	0.484000	0.47621	CGG	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.622	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	0	0	1	2	18	2	2	1	1	1	1	58	58	58	57	1	1.890000	-2.840249	1	0.580000	XM_030300		0	4	4	0	301	299	0		0			1	0	58	0	0	1.719143e-03	0	0	0	0	0	0	4	301
IRX1	79192	broad.mit.edu	37	5	3599380	3599380	+	Silent	SNP	C	C	T	rs61743903	byFrequency	TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:3599380C>T	ENST00000302006.3	+	2	370	c.318C>T	c.(316-318)ccC>ccT	p.P106P	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	106					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GGGTGCACCCCGCCACCTTCG	0.642													C|||	29	0.00579073	0.0212	0.0014	5008	,	,		15656	0.0		0.0	False		,,,				2504	0.0					ENST00000302006.3	1.000000	7.700000e-01	1.000000	0.850000	0.940000	0.932866	0.940000	1.000000																										0				43						c.(316-318)ccC>ccT		iroquois homeobox 1		C		67,4339	58.1+/-94.6	1,65,2137	37.0	41.0	40.0		318	-8.0	0.0	5	dbSNP_129	40	0,8600		0,0,4300	no	coding-synonymous	IRX1	NM_024337.3		1,65,6437	TT,TC,CC		0.0,1.5207,0.5151		106/481	3599380	67,12939	2203	4300	6503	SO:0001819	synonymous_variant	79192	162	121406	52				g.chr5:3599380C>T	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.318C>T	chr5.hg19:g.3599380C>T		0					CTD-2012M11.3_ENST00000559410.1_RNA	p.P106P	NM_024337.3	NP_077313.3	1	2	3	2.078617	P78414	IRX1_HUMAN		2	370	+			Q7Z2F8|Q8N312	Silent	SNP	ENST00000302006.3	1	0	hg19	c.318C>T	CCDS34132.1	1																																																																																								0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.642	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.890000	-2.716909	1	0.580000	NM_024337		0	85	84	0	226	223	1		1			0	0	46	0	0	1	0	0	0	0	0	0	85	226
ITGA2	3673	broad.mit.edu	37	5	52376439	52376439	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:52376439G>A	ENST00000296585.5	+	25	3170	c.3027G>A	c.(3025-3027)gtG>gtA	p.V1009V		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	1009					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TAACTGGGGTGCAAACAGACA	0.383																																						ENST00000296585.5	0.110000	0	0.080000	0.020000	0.040000	0.055443	0.040000	0.040000																										0				47						c.(3025-3027)gtG>gtA		integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)							125.0	119.0	121.0					5																	52376439		2203	4300	6503	SO:0001819	synonymous_variant	3673	0	0					g.chr5:52376439G>A		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.3027G>A	chr5.hg19:g.52376439G>A		0						p.V1009V	NM_002203.3	NP_002194.2	1	2	3	2.078617	P17301	ITA2_HUMAN		25	3170	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	Q14595	Silent	SNP	ENST00000296585.5	0	1	hg19	c.3027G>A	CCDS3957.1	0																																																																																								0.581214		TCGA-IB-A6UF-01A-23D-A33T-08	0.383	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	0	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.890000	-2.922330	1	0.580000	NM_002203		0	5	5	0	366	363	0		1	0		0	0	54	0	0	9.366072e-01	3.847937e-01	0	0	0	84	0	5	366
SQSTM1	8878	broad.mit.edu	37	5	179252186	179252186	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr5:179252186G>C	ENST00000389805.4	+	5	892	c.714G>C	c.(712-714)aaG>aaC	p.K238N	SQSTM1_ENST00000376929.3_Missense_Mutation_p.K154N|SQSTM1_ENST00000402874.3_Missense_Mutation_p.K154N|SQSTM1_ENST00000360718.5_Missense_Mutation_p.K154N|SQSTM1_ENST00000510187.1_Missense_Mutation_p.K238N	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	238			K -> E (polymorphism confirmed at protein level; dbSNP:rs11548633). {ECO:0000269|PubMed:17488105}.		apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATTTCCTGAAGAACGTTGGGG	0.468																																						ENST00000389805.4	1.000000	7.400000e-01	0.980000	0.810000	0.890000	0.896797	0.890000	1.000000																									SQSTM1/ALK(2)	0				13						c.(712-714)aaG>aaC		sequestosome 1							124.0	112.0	116.0					5																	179252186		2203	4300	6503	SO:0001583	missense	8878	0	0					g.chr5:179252186G>C	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.714G>C	chr5.hg19:g.179252186G>C	ENSP00000374455:p.Lys238Asn	0					SQSTM1_ENST00000360718.5_Missense_Mutation_p.K154N|SQSTM1_ENST00000402874.3_Missense_Mutation_p.K154N|SQSTM1_ENST00000376929.3_Missense_Mutation_p.K154N|SQSTM1_ENST00000510187.1_Missense_Mutation_p.K238N	p.K238N	NM_003900.4	NP_003891.1	1	2	3	2.101368	Q13501	SQSTM_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	5	892	+	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	1	1	hg19	c.714G>C	CCDS34317.1	1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201297	0.58234	.	.	ENSG00000161011	ENST00000376929;ENST00000514093;ENST00000389805;ENST00000454378;ENST00000402874;ENST00000510187;ENST00000360718	D;T;D;D;T;D	0.83506	-1.73;1.84;-1.72;-1.73;2.33;-1.73	5.15	4.28	0.50868	5.15	4.28	0.50868	.	0.267149	0.41097	N	0.000953	D	0.86590	0.5969	M	0.65498	2.005	0.58432	D	0.999996	P;D	0.63880	0.477;0.993	B;P	0.53954	0.106;0.738	D	0.87728	0.2577	10	0.72032	D	0.01	-32.8687	13.713	0.62680	0.0746:0.0:0.9254:0.0	.	238;238	Q13501;E7EMC7	SQSTM_HUMAN;.	N	154;154;238;94;154;238;154	ENSP00000366128:K154N;ENSP00000427308:K154N;ENSP00000374455:K238N;ENSP00000385553:K154N;ENSP00000424477:K238N;ENSP00000353944:K154N	ENSP00000353944:K154N	K	+	3	2	2	SQSTM1	179184792	179184792	1.000000	0.71417	0.995000	0.50966	0.124000	0.20399	3.988000	0.56951	1.167000	0.42706	0.561000	0.74099	AAG	0.582422		TCGA-IB-A6UF-01A-23D-A33T-08	0.468	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1	1	0	1	2	2	2	2	0	0	0	0	83	83	83	81	1	1.890000	-20.000000	1	0.580000			0	97	97	0	278	274	1		1	1		0	0	83	0	0	1	1	0	418	0	734	0	97	278
VARS	7407	broad.mit.edu	37	6	31760017	31760017	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr6:31760017G>A	ENST00000375663.3	-	6	1288	c.848C>T	c.(847-849)cCa>cTa	p.P283L	VARS_ENST00000444930.2_5'UTR	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	283					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	GGGTGGGGTTGGGAGGTCATA	0.537																																						ENST00000375663.3	0.160000	4.000000e-02	0.130000	0.060000	0.090000	0.100615	0.090000	0.100000																										0				30						c.(847-849)cCa>cTa		valyl-tRNA synthetase	L-Valine(DB00161)						78.0	80.0	80.0					6																	31760017		1511	2709	4220	SO:0001583	missense	7407	0	0					g.chr6:31760017G>A	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.848C>T	chr6.hg19:g.31760017G>A	ENSP00000364815:p.Pro283Leu	1					VARS_ENST00000444930.2_5'UTR	p.P283L	NM_006295.2	NP_006286.1	0	2	2	2.179468	P26640	SYVC_HUMAN		6	1288	-			B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	0	1	hg19	c.848C>T	CCDS34412.1	0	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025223	0.54683	.	.	ENSG00000204394	ENST00000375663	T	0.04234	3.67	5.25	4.36	0.52297	5.25	4.36	0.52297	.	0.058877	0.64402	D	0.000002	T	0.03095	0.0091	M	0.61703	1.905	0.80722	D	1	B	0.20671	0.047	B	0.14578	0.011	T	0.16660	-1.0395	10	0.54805	T	0.06	-15.574	12.7975	0.57567	0.0:0.0:0.835:0.165	.	283	P26640	SYVC_HUMAN	L	283	ENSP00000364815:P283L	ENSP00000364815:P283L	P	-	2	0	0	VARS	31867996	31867996	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	5.919000	0.70005	1.166000	0.42689	0.313000	0.20887	CCA	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.537	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.890000	-2.232479	0	0.580000	NM_006295		0	13	13	0	464	455	0		1	1		0	0	87	0	0	9.994839e-01	6.400332e-01	0	4	0	72	0	13	464
BTNL2	56244	broad.mit.edu	37	6	32362627	32362627	+	Silent	SNP	G	G	A	rs144584698	byFrequency	TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr6:32362627G>A	ENST00000374993.1	-	6	1253	c.1254C>T	c.(1252-1254)caC>caT	p.H418H	BTNL2_ENST00000374995.3_Silent_p.H324H|BTNL2_ENST00000429232.2_3'UTR|BTNL2_ENST00000540315.1_Silent_p.H208H|BTNL2_ENST00000414363.1_Silent_p.H208H|HCG23_ENST00000426643.1_RNA|BTNL2_ENST00000454136.3_Silent_p.H418H|BTNL2_ENST00000544175.1_Silent_p.H141H	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	418						integral component of membrane (GO:0016021)		p.H418H(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						ATGTCTGCACGTGGAACAGCC	0.547																																						ENST00000374993.1	0.070000	1.000000e-02	0.060000	0.020000	0.030000	0.046069	0.030000	0.040000																										1	Substitution - coding silent(1)	p.H418H(1)	endometrium(1)	19						c.(1252-1254)caC>caT		butyrophilin-like 2 (MHC class II associated)							210.0	203.0	205.0					6																	32362627		2203	4300	6503	SO:0001819	synonymous_variant	56244	42	121412	49				g.chr6:32362627G>A	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.1254C>T	chr6.hg19:g.32362627G>A		1					BTNL2_ENST00000540315.1_Silent_p.H208H|BTNL2_ENST00000414363.1_Silent_p.H208H|BTNL2_ENST00000454136.3_Silent_p.H418H|BTNL2_ENST00000429232.2_3'UTR|BTNL2_ENST00000544175.1_Silent_p.H141H|HCG23_ENST00000426643.1_RNA|BTNL2_ENST00000374995.3_Silent_p.H324H	p.H418H	NM_019602.1	NP_062548.1	0	1	1	1.554870	Q9UIR0	BTNL2_HUMAN		6	1253	-			A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Silent	SNP	ENST00000374993.1	0	1	hg19	c.1254C>T		0																																																																																								0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.547	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	127	127	127	126	1	1.890000	-3.092293	1	0.580000	NM_019602		0	10	10	0	571	562	0		1			0	0	127	0	0	9.966688e-01	0	0	0	0	0	0	10	571
ASCC3	10973	broad.mit.edu	37	6	101248186	101248186	+	Missense_Mutation	SNP	G	G	A	rs371905084		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr6:101248186G>A	ENST00000369162.2	-	6	1461	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	ASCC3_ENST00000522650.1_Missense_Mutation_p.R373W	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	373					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.R373W(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTTTGTATCCGCAATTCCTTA	0.348																																						ENST00000369162.2	0.090000	0	0.070000	0.020000	0.030000	0.046980	0.030000	0.040000																										1	Substitution - Missense(1)	p.R373W(1)	kidney(1)	92						c.(1117-1119)Cgg>Tgg		activating signal cointegrator 1 complex subunit 3		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	119.0	117.0	118.0		1117	-2.6	0.5	6		118	0,8600		0,0,4300	no	missense	ASCC3	NM_006828.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	373/2203	101248186	1,13005	2203	4300	6503	SO:0001583	missense	10973	15	121406	42				g.chr6:101248186G>A	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1117C>T	chr6.hg19:g.101248186G>A	ENSP00000358159:p.Arg373Trp	1					ASCC3_ENST00000522650.1_Missense_Mutation_p.R373W	p.R373W	NM_006828.2	NP_006819.2	0	1	1	1.475687	Q8N3C0	ASCC3_HUMAN		6	1461	-		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	0	1	hg19	c.1117C>T	CCDS5046.1	0	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041379	0.55003	2.27E-4	0.0	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.61627	0.29;0.09	5.51	-2.59	0.06209	5.51	-2.59	0.06209	.	0.066271	0.64402	D	0.000020	T	0.64170	0.2574	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.71414	0.973;0.958	T	0.73075	-0.4097	10	0.49607	T	0.09	.	18.3564	0.90358	0.0:0.0:0.3701:0.6299	.	373;373	E7EW23;Q8N3C0	.;HELC1_HUMAN	W	373	ENSP00000358159:R373W;ENSP00000430769:R373W	ENSP00000358159:R373W	R	-	1	2	2	ASCC3	101354907	101354907	0.988000	0.35896	0.515000	0.27774	0.665000	0.39181	0.223000	0.17719	-0.294000	0.08973	-0.310000	0.09108	CGG	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.348	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	0	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.890000	-2.132978	0	0.580000	NM_006828		0	4	4	0	253	249	0		1	0		0	0	62	0	0	8.873700e-01	8.556404e-03	0	0	0	7	0	4	253
ZAN	7455	broad.mit.edu	37	7	100383688	100383688	+	RNA	SNP	G	G	A	rs200555930		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr7:100383688G>A	ENST00000348028.3	+	0	7068				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CATTCAGTGCGGGGACTTCCG	0.582																																						ENST00000348028.3	1.000000	9.100000e-01	1.000000	0.970000	0.990000	0.990528	0.990000	1.000000																										0				139								zonadhesin (gene/pseudogene)							66.0	69.0	68.0					7																	100383688		1975	4173	6148			7455	0	0					g.chr7:100383688G>A	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		chr7.hg19:g.100383688G>A		0					ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA				1	2	3	2.105735	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)	0	7068	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	0	1	hg19			1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924391	0.34002	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.04119	3.7;3.7;3.7;3.7	4.77	-3.44	0.04796	4.77	-3.44	0.04796	von Willebrand factor, type C (1);	1.461850	0.04593	N	0.397035	T	0.02193	0.0068	.	.	.	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.43988	-0.9357	9	0.15066	T	0.55	.	1.2273	0.01936	0.3587:0.2435:0.2418:0.1559	.	775;2301;2302	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	R	2301;2301;2301;775	ENSP00000445943:G2301R;ENSP00000445091:G2301R;ENSP00000444427:G2301R;ENSP00000441117:G775R	ENSP00000445091:G2301R	G	+	1	0	0	ZAN	100221624	100221624	0.000000	0.05858	0.000000	0.03702	0.633000	0.38033	-1.866000	0.01647	-0.883000	0.03982	-0.823000	0.03104	GGG	0.584816		TCGA-IB-A6UF-01A-23D-A33T-08	0.582	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	72	1	1.890000	-10.081640	1	0.580000	NM_003386		0	156	154	0	363	361	0		1			0	0	75	0	0	1	0	0	0	0	0	0	156	363
PDAP1	11333	broad.mit.edu	37	7	98997952	98997952	+	Silent	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr7:98997952C>T	ENST00000350498.3	-	4	589	c.309G>A	c.(307-309)ggG>ggA	p.G103G	PDAP1_ENST00000496335.1_5'Flank	NM_014891.6	NP_055706.1	Q13442	HAP28_HUMAN	PDGFA associated protein 1	103					cell proliferation (GO:0008283)|signal transduction (GO:0007165)		poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GCTCCTTTGGCCCGTCCAGAT	0.562																																						ENST00000350498.3	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.089843	0.050000	0.060000																										0				9						c.(307-309)ggG>ggA		PDGFA associated protein 1							168.0	123.0	138.0					7																	98997952		2203	4300	6503	SO:0001819	synonymous_variant	11333	0	0					g.chr7:98997952C>T	U41745	CCDS5662.1	7q	2008-07-18			ENSG00000106244	ENSG00000106244			14634	protein-coding gene	gene with protein product	"""PDGF associated protein"""	607075				8780057	Standard	NM_014891		Approved	PAP1, PAP, HASPP28	uc003uqe.3	Q13442	OTTHUMG00000154629	ENST00000350498.3:c.309G>A	chr7.hg19:g.98997952C>T		0					PDAP1_ENST00000496335.1_5'Flank	p.G103G	NM_014891.6	NP_055706.1	1	2	3	2.105735	Q13442	HAP28_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)	4	589	-	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		D6W5S5|Q92906	Silent	SNP	ENST00000350498.3	0	1	hg19	c.309G>A	CCDS5662.1	0																																																																																								0.584816		TCGA-IB-A6UF-01A-23D-A33T-08	0.562	PDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336388.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.890000	-2.564360	1	0.580000	NM_014891		0	5	5	0	325	323	0		1	0		0	0	46	0	0	9.370029e-01	9.935721e-01	0	1	0	670	0	5	325
DGKI	9162	broad.mit.edu	37	7	137269964	137269964	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr7:137269964G>A	ENST00000288490.5	-	14	1554	c.1554C>T	c.(1552-1554)ggC>ggT	p.G518G	DGKI_ENST00000446122.1_Silent_p.G518G|DGKI_ENST00000424189.2_Silent_p.G518G|DGKI_ENST00000453654.2_Silent_p.G218G	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	518					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CCTTACATACGCCATCTTCAA	0.483																																						ENST00000288490.5	1.000000	7.200000e-01	0.920000	0.780000	0.840000	0.854595	0.840000	0.850000																										0				84						c.(1552-1554)ggC>ggT		diacylglycerol kinase, iota							141.0	133.0	136.0					7																	137269964		2203	4300	6503	SO:0001819	synonymous_variant	9162	10	121412	42				g.chr7:137269964G>A	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1554C>T	chr7.hg19:g.137269964G>A		0					DGKI_ENST00000424189.2_Silent_p.G518G|DGKI_ENST00000446122.1_Silent_p.G518G|DGKI_ENST00000453654.2_Silent_p.G218G	p.G518G	NM_004717.2	NP_004708.1	1	2	3	2.105735	O75912	DGKI_HUMAN		14	1554	-			A4D1Q9|Q9NZ49	Silent	SNP	ENST00000288490.5	1	1	hg19	c.1554C>T	CCDS5845.1	0																																																																																								0.584816		TCGA-IB-A6UF-01A-23D-A33T-08	0.483	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	1	0	1	2	22	2	2	1	1	1	1	84	84	84	84	1	1.890000	-20.000000	1	0.580000	NM_004717		0	144	144	0	448	447	0		1			1	0	84	0	0	1	0	0	0	0	0	0	144	448
ADRA1A	148	broad.mit.edu	37	8	26722237	26722237	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr8:26722237C>T	ENST00000519229.1	-	1	256	c.250G>A	c.(250-252)Gcc>Acc	p.A84T	ADRA1A_ENST00000354550.4_Missense_Mutation_p.A84T|ADRA1A_ENST00000276393.4_Missense_Mutation_p.A84T|ADRA1A_ENST00000380581.2_Missense_Mutation_p.A84T|ADRA1A_ENST00000380582.3_Missense_Mutation_p.A84T|ADRA1A_ENST00000380587.1_Missense_Mutation_p.A84T|ADRA1A_ENST00000380573.3_Missense_Mutation_p.A84T|ADRA1A_ENST00000380586.1_Missense_Mutation_p.A84T|ADRA1A_ENST00000380572.3_Missense_Mutation_p.A84T|ADRA1A_ENST00000358857.5_Missense_Mutation_p.A84T			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	154					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TCGAAGATGGCGGAGAAGGGC	0.627																																						ENST00000519229.1	0.050000	0	0.040000	0.010000	0.020000	0.030257	0.020000	0.030000																										0				36						c.(250-252)Gcc>Acc		adrenoceptor alpha 1A	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)						157.0	156.0	157.0					8																	26722237		2203	4300	6503	SO:0001583	missense	148	1	121412	41				g.chr8:26722237C>T	L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.250G>A	chr8.hg19:g.26722237C>T	ENSP00000430793:p.Ala84Thr	1					ADRA1A_ENST00000380572.3_Missense_Mutation_p.A84T|ADRA1A_ENST00000380581.2_Missense_Mutation_p.A84T|ADRA1A_ENST00000380573.3_Missense_Mutation_p.A84T|ADRA1A_ENST00000380582.3_Missense_Mutation_p.A84T|ADRA1A_ENST00000354550.4_Missense_Mutation_p.A84T|ADRA1A_ENST00000380587.1_Missense_Mutation_p.A84T|ADRA1A_ENST00000380586.1_Missense_Mutation_p.A84T|ADRA1A_ENST00000358857.5_Missense_Mutation_p.A84T|ADRA1A_ENST00000276393.4_Missense_Mutation_p.A84T	p.A84T			0	1	1	1.557174	P25100	ADA1D_HUMAN		1	256	-		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)	Q9NPY0	Missense_Mutation	SNP	ENST00000519229.1	0	1	hg19	c.250G>A		0	.	.	.	.	.	.	.	.	.	.	C	27.5	4.836309	0.91117	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17	4.83	4.83	0.62350	4.83	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.057498	0.64402	D	0.000001	T	0.57504	0.2058	L	0.61387	1.9	0.80722	D	1	D;D;D;D;P;D	0.89917	0.992;0.992;0.997;0.998;0.944;1.0	P;P;D;D;B;D	0.67900	0.875;0.875;0.918;0.923;0.284;0.954	T	0.61337	-0.7083	10	0.66056	D	0.02	.	17.898	0.88895	0.0:1.0:0.0:0.0	.	84;84;84;84;84;84	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	T	84	ENSP00000369960:A84T;ENSP00000369961:A84T;ENSP00000369956:A84T;ENSP00000369955:A84T;ENSP00000430793:A84T;ENSP00000346557:A84T;ENSP00000276393:A84T;ENSP00000369947:A84T;ENSP00000369946:A84T;ENSP00000351725:A84T	ENSP00000276393:A84T	A	-	1	0	0	ADRA1A	26778154	26778154	1.000000	0.71417	0.941000	0.38009	0.992000	0.81027	7.776000	0.85560	2.365000	0.80145	0.563000	0.77884	GCC	0.408451		TCGA-IB-A6UF-01A-23D-A33T-08	0.627	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000376207.1	0	0	1	2	2	2	2	0	0	0	0	188	188	188	187	1	1.890000	-2.195804	0	0.580000	NM_033303		0	6	6	0	557	550	0		1			0	0	188	0	0	9.637538e-01	0	0	0	0	0	0	6	557
SNTG1	54212	broad.mit.edu	37	8	51664572	51664572	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr8:51664572G>C	ENST00000522124.1	+	18	1957	c.1296G>C	c.(1294-1296)tgG>tgC	p.W432C	SNTG1_ENST00000518864.1_Missense_Mutation_p.W432C|SNTG1_ENST00000276467.5_Intron|SNTG1_ENST00000517473.1_Intron	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	432					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CTGTCCTTTGGAGGTATAAAT	0.333																																						ENST00000522124.1	1.000000	7.700000e-01	1.000000	0.840000	0.920000	0.923702	0.920000	1.000000																										0				66						c.(1294-1296)tgG>tgC		syntrophin, gamma 1							124.0	129.0	127.0					8																	51664572		2203	4300	6503	SO:0001583	missense	54212	0	0					g.chr8:51664572G>C	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1296G>C	chr8.hg19:g.51664572G>C	ENSP00000429842:p.Trp432Cys	1					SNTG1_ENST00000276467.5_Intron|SNTG1_ENST00000517473.1_Intron|SNTG1_ENST00000518864.1_Missense_Mutation_p.W432C	p.W432C	NM_018967.2	NP_061840.1	1	2	3	2.557942	Q9NSN8	SNTG1_HUMAN		18	1957	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	1	1	hg19	c.1296G>C	CCDS6147.1	1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560557	0.65538	.	.	ENSG00000147481	ENST00000518864;ENST00000522124	T;T	0.78816	-1.21;-1.21	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.87783	0.6264	M	0.74467	2.265	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.89183	0.3545	10	0.87932	D	0	-14.0967	17.8066	0.88602	0.0:0.0:1.0:0.0	.	432	Q9NSN8	SNTG1_HUMAN	C	432	ENSP00000429276:W432C;ENSP00000429842:W432C	ENSP00000429276:W432C	W	+	3	0	0	SNTG1	51827125	51827125	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.157000	0.94714	2.501000	0.84356	0.637000	0.83480	TGG	0.668456		TCGA-IB-A6UF-01A-23D-A33T-08	0.333	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1	1	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	1.890000	-3.522370	1	0.580000			0	110	110	0	411	409	1		1	0		0	0	92	0	0	1	0	0	0	0	1	0	110	411
OPRK1	4986	broad.mit.edu	37	8	54163405	54163405	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr8:54163405C>G	ENST00000265572.3	-	2	490	c.193G>C	c.(193-195)Gtc>Ctc	p.V65L	OPRK1_ENST00000520287.1_Missense_Mutation_p.V65L	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	65					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ACGGAGTAGACCGCCGTGATG	0.701																																						ENST00000265572.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				43						c.(193-195)Gtc>Ctc		opioid receptor, kappa 1	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)						43.0	34.0	37.0					8																	54163405		2203	4298	6501	SO:0001583	missense	4986	0	0					g.chr8:54163405C>G		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.193G>C	chr8.hg19:g.54163405C>G	ENSP00000265572:p.Val65Leu	1					OPRK1_ENST00000520287.1_Missense_Mutation_p.V65L	p.V65L	NM_000912.3	NP_000903.2	1	2	3	2.557942	P41145	OPRK_HUMAN		2	490	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	1	1	hg19	c.193G>C	CCDS6152.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781523	0.90282	.	.	ENSG00000082556	ENST00000265572;ENST00000520287;ENST00000396798	T;T	0.35421	1.31;1.31	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.124940	0.56097	D	0.000033	T	0.28830	0.0715	L	0.42245	1.32	0.80722	D	1	B	0.13594	0.008	B	0.16722	0.016	T	0.10520	-1.0626	10	0.02654	T	1	.	16.1573	0.81676	0.0:1.0:0.0:0.0	.	65	P41145	OPRK_HUMAN	L	65;65;51	ENSP00000265572:V65L;ENSP00000429706:V65L	ENSP00000265572:V65L	V	-	1	0	0	OPRK1	54325958	54325958	0.999000	0.42202	0.962000	0.40283	0.954000	0.61252	4.205000	0.58466	2.586000	0.87340	0.456000	0.33151	GTC	0.668456		TCGA-IB-A6UF-01A-23D-A33T-08	0.701	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1	1	0	1	2	2	2	2	0	0	0	0	27	27	27	26	1	1.890000	-20.000000	1	0.580000			0	135	132	0	195	193	0		1			0	0	27	0	0	1	0	0	0	0	0	0	135	195
MOS	4342	broad.mit.edu	37	8	57025772	57025772	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr8:57025772G>A	ENST00000311923.1	-	1	769	c.770C>T	c.(769-771)aCg>aTg	p.T257M		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			GGCTTTAGGCGTCACGCCCTC	0.572																																					Esophageal Squamous(124;373 2870 4778)	ENST00000311923.1	1.000000	7.700000e-01	1.000000	0.840000	0.930000	0.926916	0.930000	1.000000																										0				22						c.(769-771)aCg>aTg		v-mos Moloney murine sarcoma viral oncogene homolog							59.0	64.0	62.0					8																	57025772		2203	4300	6503	SO:0001583	missense	4342	0	0					g.chr8:57025772G>A		CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.770C>T	chr8.hg19:g.57025772G>A	ENSP00000310722:p.Thr257Met	1						p.T257M	NM_005372.1	NP_005363.1	1	2	3	2.557942	P00540	MOS_HUMAN	Epithelial(17;0.00117)|all cancers(17;0.00879)	1	769	-			Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	1	1	hg19	c.770C>T	CCDS6164.1	1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623610	0.46840	.	.	ENSG00000172680	ENST00000311923	D	0.94613	-3.47	5.8	4.93	0.64822	5.8	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.063339	0.64402	D	0.000005	D	0.97770	0.9268	M	0.92412	3.305	0.49582	D	0.999808	D	0.89917	1.0	D	0.79784	0.993	D	0.98669	1.0687	10	0.87932	D	0	.	14.8663	0.70419	0.0686:0.0:0.9314:0.0	.	257	P00540	MOS_HUMAN	M	257	ENSP00000310722:T257M	ENSP00000310722:T257M	T	-	2	0	0	MOS	57188326	57188326	1.000000	0.71417	0.031000	0.17742	0.125000	0.20455	9.281000	0.95811	1.470000	0.48102	0.561000	0.74099	ACG	0.668456		TCGA-IB-A6UF-01A-23D-A33T-08	0.572	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.890000	-20.000000	1	0.580000	NM_005372		0	104	101	0	386	381	1		1			0	0	65	0	0	1	0	0	0	0	0	0	104	386
CDH17	1015	broad.mit.edu	37	8	95142932	95142932	+	Missense_Mutation	SNP	G	G	A	rs199497492		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr8:95142932G>A	ENST00000027335.3	-	17	2444	c.2320C>T	c.(2320-2322)Cgg>Tgg	p.R774W	CDH17_ENST00000450165.2_Missense_Mutation_p.R774W|CDH17_ENST00000441892.2_Intron	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	774	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.R774W(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CCTGCTGGCCGGAAACAACTT	0.448																																						ENST00000027335.3	1.000000	2.000000e-02	0.140000	0.040000	0.080000	0.147558	0.080000	0.080000																										1	Substitution - Missense(1)	p.R774W(1)	large_intestine(1)	52						c.(2320-2322)Cgg>Tgg		cadherin 17, LI cadherin (liver-intestine)							78.0	73.0	75.0					8																	95142932		2203	4300	6503	SO:0001583	missense	1015	1	121390	26				g.chr8:95142932G>A	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.2320C>T	chr8.hg19:g.95142932G>A	ENSP00000027335:p.Arg774Trp	1					CDH17_ENST00000441892.2_Intron|CDH17_ENST00000450165.2_Missense_Mutation_p.R774W	p.R774W	NM_004063.3	NP_004054.3	1	2	3	2.557942	Q12864	CAD17_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)	17	2444	-	Breast(36;4.65e-06)		Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	0	1	hg19	c.2320C>T	CCDS6260.1	0	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417426	0.25552	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.58358	0.34;0.34	5.84	2.83	0.33086	5.84	2.83	0.33086	Cadherin (1);	0.561125	0.16175	N	0.226091	T	0.46014	0.1371	L	0.56769	1.78	0.27273	N	0.95831	D	0.63046	0.992	B	0.40534	0.332	T	0.37549	-0.9701	10	0.37606	T	0.19	-0.1227	11.2752	0.49163	0.0:0.0:0.5163:0.4836	.	774	Q12864	CAD17_HUMAN	W	774	ENSP00000027335:R774W;ENSP00000401468:R774W	ENSP00000027335:R774W	R	-	1	2	2	CDH17	95212108	95212108	0.965000	0.33210	0.969000	0.41365	0.045000	0.14185	1.376000	0.34306	0.760000	0.33108	-0.282000	0.10007	CGG	0.668456		TCGA-IB-A6UF-01A-23D-A33T-08	0.448	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	0	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.890000	-2.840292	1	0.580000	NM_004063		0	5	5	0	287	287	0		1	0		0	0	36	0	0	9.380657e-01	1.888756e-02	0	0	0	10	0	5	287
SNTB1	6641	broad.mit.edu	37	8	121644818	121644818	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr8:121644818C>T	ENST00000395601.3	-	4	1276	c.862G>A	c.(862-864)Gca>Aca	p.A288T	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Missense_Mutation_p.A288T	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	288	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CTGAACCATGCCTGGGCCGTG	0.552																																						ENST00000395601.3	1.000000	1.000000e-02	0.110000	0.030000	0.060000	0.127310	0.060000	0.060000																										0				24						c.(862-864)Gca>Aca		syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)							126.0	110.0	115.0					8																	121644818		2203	4300	6503	SO:0001583	missense	6641	0	0					g.chr8:121644818C>T	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.862G>A	chr8.hg19:g.121644818C>T	ENSP00000378965:p.Ala288Thr	1					SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Missense_Mutation_p.A288T	p.A288T	NM_021021.3	NP_066301.1	1	2	3	2.557942	Q13884	SNTB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)	4	1276	-	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	ENST00000395601.3	0	1	hg19	c.862G>A	CCDS6334.1	0	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270243	0.59540	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.54675	0.56;0.56	6.03	6.03	0.97812	6.03	6.03	0.97812	Pleckstrin homology domain (2);	0.098404	0.64402	D	0.000001	T	0.50171	0.1600	L	0.45581	1.43	0.54753	D	0.999987	B;B	0.28350	0.017;0.208	B;B	0.26310	0.013;0.068	T	0.36286	-0.9754	10	0.30854	T	0.27	.	20.5596	0.99324	0.0:1.0:0.0:0.0	.	288;288	Q13884;Q13884-2	SNTB1_HUMAN;.	T	288	ENSP00000378965:A288T;ENSP00000431124:A288T	ENSP00000378965:A288T	A	-	1	0	0	SNTB1	121713999	121713999	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	2.745000	0.47459	2.868000	0.98415	0.555000	0.69702	GCA	0.668456		TCGA-IB-A6UF-01A-23D-A33T-08	0.552	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	0	0	0	2	2	2	2	0	0	0	0	37	37	37	37	1	1.890000	-5.088515	1	0.580000	NM_021021		0	5	4	0	380	370	0		1	0		0	0	37	0	0	9.330520e-01	1.596156e-01	0	0	0	45	0	5	380
GARNL3	84253	broad.mit.edu	37	9	130145778	130145778	+	Silent	SNP	T	T	G	rs201763226	byFrequency	TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr9:130145778T>G	ENST00000373387.4	+	23	2575	c.2223T>G	c.(2221-2223)tcT>tcG	p.S741S	GARNL3_ENST00000435213.2_Silent_p.S719S|GARNL3_ENST00000496711.1_3'UTR|GARNL3_ENST00000314904.5_Silent_p.S741S	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	741	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						TTCAACCTTCTGCGTCAGATT	0.388																																						ENST00000373387.4	1.000000	1.000000e-01	0.240000	0.130000	0.170000	0.215270	0.170000	0.170000																										0				41						c.(2221-2223)tcT>tcG		GTPase activating Rap/RanGAP domain-like 3							111.0	104.0	107.0					9																	130145778		2203	4300	6503	SO:0001819	synonymous_variant	84253	0	0					g.chr9:130145778T>G	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.2223T>G	chr9.hg19:g.130145778T>G		0					GARNL3_ENST00000496711.1_3'UTR|GARNL3_ENST00000314904.5_Silent_p.S741S|GARNL3_ENST00000435213.2_Silent_p.S719S	p.S741S	NM_032293.4	NP_115669.3	1	2	3	2.116127	Q5VVW2	GARL3_HUMAN		23	2575	+			B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Silent	SNP	ENST00000373387.4	1	1	hg19	c.2223T>G	CCDS6869.2	0																																																																																								0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.388	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.890000	-4.890839	1	0.580000	NM_032293		0	15	15	0	286	281	0		1	0		0	0	45	0	0	9.998663e-01	8.510238e-03	0	0	0	3	0	15	286
FRMPD1	22844	broad.mit.edu	37	9	37708409	37708409	+	Silent	SNP	C	C	T	rs368503284		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr9:37708409C>T	ENST00000539465.1	+	4	866	c.273C>T	c.(271-273)caC>caT	p.H91H	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Silent_p.H91H			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	91	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GCTCTGCTCACGGCAAGCTTT	0.493																																						ENST00000539465.1	1.000000	8.500000e-01	1.000000	0.910000	0.980000	0.965970	0.980000	1.000000																										0				93						c.(271-273)caC>caT		FERM and PDZ domain containing 1		C		0,4406		0,0,2203	129.0	118.0	122.0		273	-4.8	0.9	9		122	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FRMPD1	NM_014907.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		91/1579	37708409	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22844	4	121412	39				g.chr9:37708409C>T	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.273C>T	chr9.hg19:g.37708409C>T		0					FRMPD1_ENST00000377765.3_Silent_p.H91H|RP11-613M10.9_ENST00000540557.1_Intron	p.H91H			0	0	0	2.054757	Q5SYB0	FRPD1_HUMAN		4	866	+			B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	1	1	hg19	c.273C>T	CCDS6612.1	1																																																																																								0.577550		TCGA-IB-A6UF-01A-23D-A33T-08	0.493	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	1	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	1.890000	-9.314138	1	0.580000	NM_014907		0	149	149	0	369	366	1		1			0	0	83	0	0	1	0	0	0	0	0	0	149	369
EHMT1	79813	broad.mit.edu	37	9	140671243	140671243	+	Silent	SNP	C	C	T	rs374533940		TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chr9:140671243C>T	ENST00000460843.1	+	12	1992	c.1965C>T	c.(1963-1965)ccC>ccT	p.P655P	EHMT1_ENST00000334856.6_Silent_p.P624P|EHMT1_ENST00000462484.1_Silent_p.P655P|EHMT1_ENST00000371394.2_3'UTR	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	655					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CACCAGTCCCCGGGCAGGAGA	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		16849	0.0		0.0	False		,,,				2504	0.001					ENST00000460843.1	1.000000	7.400000e-01	1.000000	0.820000	0.910000	0.910080	0.910000	1.000000																										0				41						c.(1963-1965)ccC>ccT		euchromatic histone-lysine N-methyltransferase 1		C	,	0,4406		0,0,2203	79.0	70.0	73.0		1965,1965	-5.7	0.1	9		73	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	EHMT1	NM_001145527.1,NM_024757.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	655/809,655/1299	140671243	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79813	10	121412	42				g.chr9:140671243C>T	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1965C>T	chr9.hg19:g.140671243C>T		0					EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000462484.1_Silent_p.P655P|EHMT1_ENST00000334856.6_Silent_p.P624P	p.P655P	NM_024757.4	NP_079033.4	1	2	3	2.116127	Q9H9B1	EHMT1_HUMAN		12	1992	+	all_cancers(76;0.164)		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	ENST00000460843.1	1	1	hg19	c.1965C>T	CCDS7050.2	1																																																																																								0.586003		TCGA-IB-A6UF-01A-23D-A33T-08	0.627	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	1	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	1.890000	-4.905162	1	0.580000	NM_024757		0	81	78	0	230	226	1		1	1		0	0	60	0	0	1	9.999974e-01	0	15	0	42	0	81	230
KIAA2022	340533	broad.mit.edu	37	X	73960072	73960072	+	Silent	SNP	G	G	A			TCGA-IB-A6UF-01A-23D-A33T-08	TCGA-IB-A6UF-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d6b923f-0fd7-4174-b1e8-5dd4ffaa618c	b6896b2e-5d98-49fd-a3e7-f3e75306d1ee	g.chrX:73960072G>A	ENST00000055682.6	-	3	4931	c.4320C>T	c.(4318-4320)aaC>aaT	p.N1440N		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1440					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GTGTCGGTCCGTTATTGCCTA	0.453																																						ENST00000055682.6	1.000000	8.800000e-01	0.990000	0.920000	0.960000	0.960084	0.960000	0.990000																										0				109						c.(4318-4320)aaC>aaT		KIAA2022							208.0	172.0	184.0					X																	73960072		2203	4300	6503	SO:0001819	synonymous_variant	340533	8	121410	41				g.chrX:73960072G>A		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4320C>T	chrX.hg19:g.73960072G>A								p.N1440N	NM_001008537.2	NP_001008537.1	0	1	1		Q5QGS0	K2022_HUMAN		3	4931	-			A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	1	1	hg19	c.4320C>T	CCDS35337.1	1	.	.	.	.	.	.	.	.	.	.	G	3.844	-0.033191	0.07543	.	.	ENSG00000050030	ENST00000424929	.	.	.	5.36	-7.06	0.01568	5.36	-7.06	0.01568	.	.	.	.	.	T	0.59878	0.2226	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64232	-0.6456	4	.	.	.	-17.3921	13.7648	0.62988	0.309:0.0916:0.5995:0.0	.	.	.	.	W	42	.	.	R	-	1	2	2	KIAA2022	73876797	73876797	0.008000	0.16893	0.938000	0.37757	0.996000	0.88848	-0.935000	0.03950	-1.139000	0.02881	0.544000	0.68410	CGG	0.580000		TCGA-IB-A6UF-01A-23D-A33T-08	0.453	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	1	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	1.890000	-20.000000	1	0.580000	NM_001008537		0	183	183	0	135	135	1		1			0	0	45	0	0	1	0	0	0	0	0	0	183	135
