#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
STK11	6794	broad.mit.edu	37	19	1207204	1207204	+	Splice_Site	DEL	T	T	-	rs587782096|rs112235354		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			T	-	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:1207204delT	ENST00000326873.7	+	1	1463		c.e1+2		STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11						activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGAAGAAGTAAGTATGGCT	0.597		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																												ENST00000326873.7	1.000000	0.900000	1	9.900000e-01	0.990000	0.994431	0.990000	1.000000		14	yes	Rec	yes	Peutz-Jeghers syndrome	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	19p13.3	6794	D, Mis, N, F, S	serine/threonine kinase 11 gene (LKB1)				"""E, M, O"""	E, M, O		jejunal harmartoma, ovarian, testicular, pancreatic	NSCLC, pancreatic		23	Whole gene deletion(20)|Unknown(3)	p.0?(20)|p.?(3)	cervix(15)|lung(4)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	328						c.e1+2		serine/threonine kinase 11							20.0	22.0	22.0					19																	1207204		1975	4132	6107	SO:0001630	splice_region_variant	6794	0	0		Peutz-Jeghers syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	g.chr19:1207204delT	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.290+2T>-	chr19.hg19:g.1207204delT		1	TSP Lung(3;<1E-08)				STK11_ENST00000585748.1_Intron		NM_000455.4	NP_000446.1	0	3	3	1.828633	Q15831	STK11_HUMAN		1	1463	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	B2RBX7|E7EW76	Splice_Site	DEL	ENST00000326873.7	0	1	hg19		CCDS45896.1	1																																																																																								0.278713		TCGA-IB-A6UG-01A-32D-A33T-08	0.597	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	1	0	1		2	2	2	0	0	0	0	13	0	13	13	1	3.280000	-19.999150	1	0.220000	NM_000455	Intron	0	13	13	0	71	70	0	0	1	1	1	0	0	13	569	0	0.999654	9.998439e-01	1	3	167	90	823	13	71
SEC24D	9871	broad.mit.edu	37	4	119686069	119686069	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr4:119686069delG	ENST00000280551.6	-	10	1422	c.1184delC	c.(1183-1185)ccafs	p.P396fs	SEC24D_ENST00000511481.1_Frame_Shift_Del_p.P27fs|SEC24D_ENST00000379735.5_Frame_Shift_Del_p.P397fs|SEC24D_ENST00000419654.2_5'UTR|SEC24D_ENST00000505134.1_5'UTR			O94855	SC24D_HUMAN	SEC24 family member D	396					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						ATAGAATGGTGGAACTAATAA	0.323																																						ENST00000280551.6	0.880000	0.440000	7.600000e-01	5.300000e-01	0.640000	0.657001	0.640000	0.630000																										0				37						c.(1183-1185)ccafs		SEC24 family member D							87.0	88.0	88.0					4																	119686069		2203	4300	6503	SO:0001589	frameshift_variant	9871	0	0					g.chr4:119686069delG	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1184delC	chr4.hg19:g.119686069delG	ENSP00000280551:p.Pro396fs	0					SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000511481.1_Frame_Shift_Del_p.P27fs|SEC24D_ENST00000379735.5_Frame_Shift_Del_p.P397fs|SEC24D_ENST00000419654.2_5'UTR	p.P396fs			1	2	3	1.965441	O94855	SC24D_HUMAN		10	1422	-			Q8IYI7	Frame_Shift_Del	DEL	ENST00000280551.6	0	1	hg19	c.1184delC	CCDS3710.1	0																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.323	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4	1	0	1		29	2		0	0	0	2	76	0	76	76	1	3.280000	-2.806919	1	0.220000			0	31	45	0	456	451	0	0	1	0		0	0	76	0	0	0.678844	6.517573e-01		0	0	34	0	31	456
HPS1	3257	broad.mit.edu	37	10	100185374	100185374	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:100185374C>T	ENST00000325103.6	-	13	1492	c.1259G>A	c.(1258-1260)cGc>cAc	p.R420H	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Missense_Mutation_p.R420H	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	420					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GGGCTGGGAGCGCAGGGAGGC	0.637									Hermansky-Pudlak syndrome		OREG0020430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000325103.6	1.000000	0.970000	1	9.900000e-01	0.990000	0.997602	0.990000	1.000000																										0				23						c.(1258-1260)cGc>cAc		Hermansky-Pudlak syndrome 1							48.0	41.0	43.0					10																	100185374		2203	4300	6503	SO:0001583	missense	3257	0	0		Hermansky-Pudlak syndrome	Familial Cancer Database	HPS, HPS1-8	g.chr10:100185374C>T	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.1259G>A	chr10.hg19:g.100185374C>T	ENSP00000326649:p.Arg420His	1		OREG0020430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1349	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Missense_Mutation_p.R420H	p.R420H	NM_000195.3	NP_000186.2	2	2	4	2.132970	Q92902	HPS1_HUMAN		13	1492	-		Colorectal(252;0.234)	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Missense_Mutation	SNP	ENST00000325103.6	1	1	hg19	c.1259G>A	CCDS7475.1	1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916483	0.73098	.	.	ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891;ENST00000359632	T;T;T	0.33438	1.41;1.41;1.41	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.59238	0.2179	M	0.77616	2.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.994;1.0;0.999;1.0	T	0.60125	-0.7324	10	0.48119	T	0.1	.	19.1508	0.93487	0.0:1.0:0.0:0.0	.	58;387;420;420	Q658M9;Q92902-2;Q8WXE5;D3DR62	.;.;.;.	H	420;420;387;215	ENSP00000326649:R420H;ENSP00000355310:R420H;ENSP00000352652:R215H	ENSP00000326649:R420H	R	-	2	0	0	HPS1	100175364	100175364	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	5.418000	0.66429	2.524000	0.85096	0.561000	0.74099	CGC	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.637	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	3.280000	-20.000000	1	0.220000	NM_000195, NM_182637, NM_182638, NM_182639		0	25	25	0	168	167	1		1	1		0	0	28	0	0	1.000000	9.931675e-01	0	8	0	48	0	25	168
PPRC1	23082	broad.mit.edu	37	10	103907023	103907023	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:103907023G>A	ENST00000278070.2	+	9	4313	c.4274G>A	c.(4273-4275)cGc>cAc	p.R1425H	PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.R392H|PPRC1_ENST00000489648.1_Intron	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1425	Arg-rich.|Necessary for interaction with CREB1 and NRF1.|Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CGCCGAGGCCGCAACAGCCGT	0.627																																						ENST00000278070.2	0.260000	0.040000	2.000000e-01	8.000000e-02	0.130000	0.146859	0.130000	0.120000																										0				56						c.(4273-4275)cGc>cAc		peroxisome proliferator-activated receptor gamma, coactivator-related 1							77.0	69.0	71.0					10																	103907023		2203	4298	6501	SO:0001583	missense	23082	2	121412	37				g.chr10:103907023G>A	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4274G>A	chr10.hg19:g.103907023G>A	ENSP00000278070:p.Arg1425His	1					PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.R392H|PPRC1_ENST00000489648.1_Intron	p.R1425H	NM_015062.3	NP_055877.3	2	2	4	2.132970	Q5VV67	PPRC1_HUMAN		9	4313	+		Colorectal(252;0.122)	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	0	1	hg19	c.4274G>A	CCDS7529.1	0	.	.	.	.	.	.	.	.	.	.	G	9.681	1.149221	0.21288	.	.	ENSG00000148840	ENST00000278070;ENST00000370012	T;T	0.37915	1.55;1.17	5.04	3.19	0.36642	5.04	3.19	0.36642	.	0.407952	0.26903	N	0.021907	T	0.26011	0.0634	L	0.31926	0.97	0.80722	D	1	B;B	0.19817	0.039;0.023	B;B	0.17433	0.018;0.005	T	0.04454	-1.0950	10	0.21014	T	0.42	.	11.9659	0.53035	0.1434:0.0:0.8566:0.0	.	1305;1425	Q5VV67-2;Q5VV67	.;PPRC1_HUMAN	H	1425;392	ENSP00000278070:R1425H;ENSP00000359029:R392H	ENSP00000278070:R1425H	R	+	2	0	0	PPRC1	103897013	103897013	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	2.955000	0.49121	0.805000	0.34159	-0.379000	0.06801	CGC	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.627	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	100	1	3.280000	-2.256889	0	0.220000	NM_015062		0	6	6	0	519	504	0		1	0		0	0	104	0	0	0.961890	3.037268e-01	0	0	0	84	0	6	519
SFXN4	119559	broad.mit.edu	37	10	120905815	120905815	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:120905815G>C	ENST00000355697.2	-	13	888	c.869C>G	c.(868-870)tCt>tGt	p.S290C	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.S281C	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	290					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		GACAGTACAAGACAGTTTCAA	0.433																																						ENST00000355697.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				11						c.(868-870)tCt>tGt		sideroflexin 4							155.0	144.0	148.0					10																	120905815		2203	4300	6503	SO:0001583	missense	119559	2	121412	34				g.chr10:120905815G>C		CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.869C>G	chr10.hg19:g.120905815G>C	ENSP00000347924:p.Ser290Cys	1					SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.S281C	p.S290C	NM_213649.1	NP_998814.1	2	2	4	2.132970	Q6P4A7	SFXN4_HUMAN		13	888	-		Lung NSC(174;0.094)|all_lung(145;0.123)	Q6WSU4|Q86TD9	Missense_Mutation	SNP	ENST00000355697.2	1	1	hg19	c.869C>G	CCDS7610.1	1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123757	0.37436	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875;ENST00000369131	T;T	0.30182	1.54;1.54	5.07	2.86	0.33363	5.07	2.86	0.33363	.	0.835144	0.10718	N	0.642040	T	0.36331	0.0963	L	0.50333	1.59	0.09310	N	1	D	0.65815	0.995	P	0.56788	0.806	T	0.21724	-1.0237	10	0.38643	T	0.18	-13.2476	2.1131	0.03708	0.1085:0.1772:0.4529:0.2614	.	290	Q6P4A7	SFXN4_HUMAN	C	290;281;173;174	ENSP00000347924:S290C;ENSP00000333200:S281C	ENSP00000333200:S281C	S	-	2	0	0	SFXN4	120895805	120895805	0.007000	0.16637	0.002000	0.10522	0.045000	0.14185	1.193000	0.32162	1.240000	0.43803	0.650000	0.86243	TCT	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.433	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3	1	0	1	2	2	2	2	0	0	0	0	87	87	87	86	1	3.280000	-20.000000	1	0.220000	XM_058406		0	94	92	0	452	447	1		1	1		0	0	87	0	0	1.000000	9.999988e-01	0	18	0	77	0	94	452
PTPRE	5791	broad.mit.edu	37	10	129871718	129871718	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:129871718G>T	ENST00000254667.3	+	17	1861	c.1582G>T	c.(1582-1584)Gtg>Ttg	p.V528L	PTPRE_ENST00000419012.2_Missense_Mutation_p.V528L|PTPRE_ENST00000306042.5_Missense_Mutation_p.V470L	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	528	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GCTGACGGAGGTGCAGGAGAG	0.597																																					Colon(52;977 1184 20575 41685)	ENST00000254667.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				22						c.(1582-1584)Gtg>Ttg		protein tyrosine phosphatase, receptor type, E	Alendronate(DB00630)						99.0	84.0	89.0					10																	129871718		2203	4300	6503	SO:0001583	missense	5791	0	0					g.chr10:129871718G>T	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1582G>T	chr10.hg19:g.129871718G>T	ENSP00000254667:p.Val528Leu	1					PTPRE_ENST00000306042.5_Missense_Mutation_p.V470L|PTPRE_ENST00000419012.2_Missense_Mutation_p.V528L	p.V528L	NM_006504.4	NP_006495.1	2	2	4	2.119299	P23469	PTPRE_HUMAN		17	1861	+		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	ENST00000254667.3	1	1	hg19	c.1582G>T	CCDS7657.1	1	.	.	.	.	.	.	.	.	.	.	G	1.142	-0.649108	0.03506	.	.	ENSG00000132334	ENST00000254667;ENST00000439034;ENST00000419012;ENST00000306042	T;T;T	0.09538	2.97;2.97;2.97	4.75	2.82	0.32997	4.75	2.82	0.32997	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.089012	0.46758	D	0.000262	T	0.01489	0.0048	N	0.00047	-2.435	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.002;0.001;0.002	T	0.42137	-0.9469	10	0.02654	T	1	.	8.7131	0.34395	0.0777:0.286:0.6363:0.0	.	506;528;470;528	F5H0X4;Q5VWH4;P23469-2;P23469	.;.;.;PTPRE_HUMAN	L	528;506;528;470	ENSP00000254667:V528L;ENSP00000402337:V528L;ENSP00000303350:V470L	ENSP00000254667:V528L	V	+	1	0	0	PTPRE	129761708	129761708	1.000000	0.71417	0.989000	0.46669	0.609000	0.37215	2.058000	0.41374	0.557000	0.29117	0.563000	0.77884	GTG	0.358342		TCGA-IB-A6UG-01A-32D-A33T-08	0.597	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	3.280000	-20.000000	1	0.220000			0	36	36	0	157	155	1		1	1		0	0	30	0	0	1.000000	9.973142e-01	0	17	0	26	0	36	157
ANKRD30A	91074	broad.mit.edu	37	10	37508147	37508147	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:37508147A>T	ENST00000602533.1	+	34	3438	c.3339A>T	c.(3337-3339)aaA>aaT	p.K1113N	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.K1113N|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.K1232N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1169					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GGCAGCTTAAAGTTCTGATAG	0.353																																						ENST00000602533.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				158						c.(3337-3339)aaA>aaT		ankyrin repeat domain 30A							121.0	121.0	121.0					10																	37508147		1835	4081	5916	SO:0001583	missense	91074	0	0					g.chr10:37508147A>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3339A>T	chr10.hg19:g.37508147A>T	ENSP00000473551:p.Lys1113Asn	1					ANKRD30A_ENST00000374660.1_Missense_Mutation_p.K1232N|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.K1113N	p.K1113N			2	2	4	2.128278	Q9BXX3	AN30A_HUMAN		34	3438	+			Q5W025	Missense_Mutation	SNP	ENST00000602533.1	1	1	hg19	c.3339A>T		1	.	.	.	.	.	.	.	.	.	.	a	0	-2.770045	0.00081	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.11385	2.78;2.78	2.81	-1.34	0.09143	2.81	-1.34	0.09143	.	.	.	.	.	T	0.03011	0.0089	N	0.04880	-0.145	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.41288	-0.9517	9	0.02654	T	1	.	0.8546	0.01179	0.1973:0.1254:0.1857:0.4916	.	1169	Q9BXX3	AN30A_HUMAN	N	1113;1232	ENSP00000354432:K1113N;ENSP00000363792:K1232N	ENSP00000354432:K1113N	K	+	3	2	2	ANKRD30A	37548153	37548153	0.893000	0.30496	0.000000	0.03702	0.001000	0.01503	1.090000	0.30902	-0.603000	0.05767	-0.457000	0.05445	AAA	0.359501		TCGA-IB-A6UG-01A-32D-A33T-08	0.353	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	1	0	0	2	2	2	2	0	0	0	0	136	136	136	135	1	3.280000	-20.000000	1	0.220000	NM_052997		0	130	130	0	642	635	1		1			0	0	136	0	0	1.000000	0	0	0	0	0	0	130	642
NEUROG3	50674	broad.mit.edu	37	10	71332359	71332359	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:71332359G>A	ENST00000242462.4	-	2	470	c.441C>T	c.(439-441)taC>taT	p.Y147Y		NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	147					central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						GCTCCAGCGCGTACAAGCTGT	0.682																																						ENST00000242462.4	0.530000	0.090000	3.900000e-01	1.600000e-01	0.250000	0.277002	0.250000	0.230000																										0				13						c.(439-441)taC>taT		neurogenin 3							34.0	35.0	34.0					10																	71332359		2203	4300	6503	SO:0001819	synonymous_variant	50674	7	121404	34				g.chr10:71332359G>A	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.441C>T	chr10.hg19:g.71332359G>A		1						p.Y147Y	NM_020999.3	NP_066279.2	2	2	4	2.128278	Q9Y4Z2	NGN3_HUMAN		2	470	-			Q5VVI0|Q6DJX6|Q9BY24	Silent	SNP	ENST00000242462.4	0	1	hg19	c.441C>T	CCDS31212.1	0																																																																																								0.359501		TCGA-IB-A6UG-01A-32D-A33T-08	0.682	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	0	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	3.280000	-6.272953	1	0.220000	NM_020999		0	5	5	0	231	231	0		1			0	0	38	0	0	0.938201	0	0	0	0	0	0	5	231
CYP2C9	1559	broad.mit.edu	37	10	96748637	96748637	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:96748637G>A	ENST00000260682.6	+	9	1337	c.1325G>A	c.(1324-1326)gGc>gAc	p.G442D		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	442					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCCCTGGCCGGCATGGAGCTG	0.453																																					Ovarian(54;1266 1406 16072 35076)	ENST00000260682.6	0.210000	0.020000	1.600000e-01	6.000000e-02	0.100000	0.112749	0.100000	0.090000																										0				34						c.(1324-1326)gGc>gAc		cytochrome P450, family 2, subfamily C, polypeptide 9	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)						156.0	145.0	149.0					10																	96748637		2203	4300	6503	SO:0001583	missense	1559	0	0					g.chr10:96748637G>A	M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.1325G>A	chr10.hg19:g.96748637G>A	ENSP00000260682:p.Gly442Asp	1						p.G442D	NM_000771.3	NP_000762.2	2	2	4	2.132970	P11712	CP2C9_HUMAN		9	1337	+		Colorectal(252;0.0902)	P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	ENST00000260682.6	0	1	hg19	c.1325G>A	CCDS7437.1	0	.	.	.	.	.	.	.	.	.	.	.	9.583	1.123983	0.20959	.	.	ENSG00000138109	ENST00000260682	T	0.67865	-0.29	3.41	2.47	0.30058	3.41	2.47	0.30058	.	0.000000	0.64402	U	0.000002	T	0.41903	0.1179	N	0.04508	-0.205	0.23425	N	0.997706	B;B	0.17465	0.022;0.022	B;B	0.14578	0.011;0.011	T	0.42932	-0.9422	10	0.87932	D	0	.	9.6892	0.40118	0.0:0.0:0.7903:0.2097	.	442;442	Q5VX92;P11712	.;CP2C9_HUMAN	D	442	ENSP00000260682:G442D	ENSP00000260682:G442D	G	+	2	0	0	CYP2C9	96738627	96738627	1.000000	0.71417	0.996000	0.52242	0.064000	0.16182	6.266000	0.72540	0.741000	0.32674	0.446000	0.29264	GGC	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.453	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049501.1	0	0	1	2	2	2	2	0	0	0	0	118	118	118	116	1	3.280000	-2.077616	0	0.220000	NM_000771		0	6	6	0	679	672	0		1	0		0	0	118	0	0	0.963954	0	0	0	0	1	0	6	679
PWWP2B	170394	broad.mit.edu	37	10	134218205	134218205	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr10:134218205C>T	ENST00000305233.5	+	2	260	c.201C>T	c.(199-201)ggC>ggT	p.G67G	PWWP2B_ENST00000368609.4_Silent_p.G67G	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	67										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		ACAGCCATGGCCGGGCTCCCG	0.697																																						ENST00000305233.5	0.200000	0.020000	1.400000e-01	6.000000e-02	0.090000	0.111177	0.090000	0.080000																										0				9						c.(199-201)ggC>ggT		PWWP domain containing 2B							80.0	89.0	86.0					10																	134218205		2136	4275	6411	SO:0001819	synonymous_variant	170394	0	0					g.chr10:134218205C>T	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.201C>T	chr10.hg19:g.134218205C>T		1					PWWP2B_ENST00000368609.4_Silent_p.G67G	p.G67G	NM_138499.3	NP_612508.3	2	2	4	2.119299	Q6NUJ5	PWP2B_HUMAN		2	260	+		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	0	1	hg19	c.201C>T	CCDS7667.2	0																																																																																								0.358342		TCGA-IB-A6UG-01A-32D-A33T-08	0.697	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	0	0	1	2	2	2	2	0	0	0	0	174	174	174	171	1	3.280000	-2.326966	0	0.220000	NM_138499		0	7	6	0	854	848	0		1	0		0	0	174	0	0	0.980055	2.190184e-01	0	0	0	94	0	7	854
INS-IGF2	723961	broad.mit.edu	37	11	2182109	2182109	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:2182109G>A	ENST00000397270.1	-	2	151	c.93C>T	c.(91-93)tgC>tgT	p.C31C	INS_ENST00000397262.1_Silent_p.C31C|INS_ENST00000512523.1_Silent_p.C31C|INS_ENST00000250971.3_Silent_p.C31C|INS-IGF2_ENST00000481781.1_5'Flank|INS_ENST00000381330.4_Silent_p.C31C	NM_001042376.2	NP_001035835.1	F8WCM5	INSR2_HUMAN	INS-IGF2 readthrough	31						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	5		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.0832)|Lung(200;0.156)		GGTGTGAGCCGCACAGGTGTT	0.652																																						ENST00000397270.1	0.340000	0.050000	2.400000e-01	9.000000e-02	0.150000	0.173529	0.150000	0.150000																										0				5						c.(91-93)tgC>tgT		INS-IGF2 readthrough							52.0	52.0	52.0					11																	2182109		2200	4299	6499	SO:0001819	synonymous_variant	723961	3	121154	34				g.chr11:2182109G>A	DQ104205	CCDS41598.1	11p15.5	2011-03-23			ENSG00000129965	ENSG00000129965			33527	other	readthrough						16531418	Standard	NM_001042376		Approved		uc001lvm.3	F8WCM5	OTTHUMG00000166213	ENST00000397270.1:c.93C>T	chr11.hg19:g.2182109G>A		1					INS_ENST00000512523.1_Silent_p.C31C|INS_ENST00000250971.3_Silent_p.C31C|INS_ENST00000397262.1_Silent_p.C31C|INS_ENST00000381330.4_Silent_p.C31C|INS-IGF2_ENST00000481781.1_5'Flank	p.C31C	NM_001042376.2	NP_001035835.1	2	2	4	2.125679	F8WCM5	INSR2_HUMAN	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	2	151	-		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Q1WM24	Silent	SNP	ENST00000397270.1	0	1	hg19	c.93C>T	CCDS41598.1	0																																																																																								0.359501		TCGA-IB-A6UG-01A-32D-A33T-08	0.652	INS-IGF2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000388404.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	3.280000	-2.721589	1	0.220000	NM_001042376.2		0	5	5	0	374	371	0		1	1		0	0	58	0	0	0.936626	9.999979e-01	0	9	0	4151	0	5	374
HPX	3263	broad.mit.edu	37	11	6461433	6461433	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:6461433C>T	ENST00000265983.3	-	4	398	c.298G>A	c.(298-300)Gca>Aca	p.A100T	HPX_ENST00000525057.1_5'UTR	NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	100					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		TGACGGAATGCAGCATCCACA	0.517																																						ENST00000265983.3	0.360000	0.060000	2.700000e-01	1.100000e-01	0.180000	0.194824	0.180000	0.160000																										0				15						c.(298-300)Gca>Aca		hemopexin							126.0	113.0	117.0					11																	6461433		2201	4296	6497	SO:0001583	missense	3263	0	0					g.chr11:6461433C>T	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.298G>A	chr11.hg19:g.6461433C>T	ENSP00000265983:p.Ala100Thr	1					HPX_ENST00000525057.1_5'UTR	p.A100T	NM_000613.2	NP_000604.1	2	2	4	2.125679	P02790	HEMO_HUMAN		4	398	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	B2R957	Missense_Mutation	SNP	ENST00000265983.3	0	1	hg19	c.298G>A	CCDS7763.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412896	0.83340	.	.	ENSG00000110169	ENST00000265983;ENST00000537154	T	0.06528	3.29	4.92	4.92	0.64577	4.92	4.92	0.64577	Hemopexin/matrixin, conserved site (1);Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.33904	0.0879	M	0.92122	3.275	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.40496	-0.9560	10	0.87932	D	0	-23.7514	15.653	0.77112	0.0:1.0:0.0:0.0	.	100;100	B7Z8Q4;P02790	.;HEMO_HUMAN	T	100	ENSP00000265983:A100T	ENSP00000265983:A100T	A	-	1	0	0	HPX	6418009	6418009	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	3.482000	0.53186	2.554000	0.86153	0.555000	0.69702	GCA	0.359501		TCGA-IB-A6UG-01A-32D-A33T-08	0.517	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257256.1	0	0	1	2	22	2	2	1	1	1	1	56	56	56	56	1	3.280000	-2.624164	1	0.220000	NM_000613		0	6	6	0	388	385	0		0	0		1	0	56	0	0	0.001447	0	0	0	0	1	0	6	388
OR2AG2	338755	broad.mit.edu	37	11	6789727	6789727	+	Silent	SNP	C	C	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:6789727C>A	ENST00000338569.2	-	1	559	c.462G>T	c.(460-462)ctG>ctT	p.L154L		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTATAGCAATCAGGGATGCCA	0.507																																						ENST00000338569.2	0.960000	0.400000	8.000000e-01	5.100000e-01	0.640000	0.658070	0.640000	0.640000																										0				28						c.(460-462)ctG>ctT		olfactory receptor, family 2, subfamily AG, member 2							113.0	92.0	99.0					11																	6789727		2201	4296	6497	SO:0001819	synonymous_variant	338755	0	0					g.chr11:6789727C>A	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.462G>T	chr11.hg19:g.6789727C>A		1						p.L154L	NM_001004490.1	NP_001004490.1	2	2	4	2.125679	A6NM03	O2AG2_HUMAN		1	559	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Silent	SNP	ENST00000338569.2	1	1	hg19	c.462G>T	CCDS31413.1	0																																																																																								0.359501		TCGA-IB-A6UG-01A-32D-A33T-08	0.507	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	3.280000	-19.996120	1	0.220000	NM_001004490		0	20	20	0	329	327	0		1			0	0	58	0	0	0.999996	0	0	0	0	0	0	20	329
NELL1	4745	broad.mit.edu	37	11	20968881	20968881	+	Splice_Site	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:20968881G>T	ENST00000357134.5	+	11	1223		c.e11-1		NELL1_ENST00000298925.5_Splice_Site|NELL1_ENST00000325319.5_Splice_Site|NELL1_ENST00000532434.1_Splice_Site	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TTGGCTTCCAGGGTGGAGTTT	0.368																																						ENST00000357134.5	1.000000	0.690000	1	8.000000e-01	0.930000	0.915721	0.930000	1.000000																										0				70						c.e11-1		NEL-like 1 (chicken)							91.0	94.0	93.0					11																	20968881		2203	4300	6503	SO:0001630	splice_region_variant	4745	0	0					g.chr11:20968881G>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1072-1G>T	chr11.hg19:g.20968881G>T		1					NELL1_ENST00000298925.5_Splice_Site|NELL1_ENST00000532434.1_Splice_Site|NELL1_ENST00000325319.5_Splice_Site		NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	2	2	4	2.125679	Q92832	NELL1_HUMAN		11	1223	+			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Splice_Site	SNP	ENST00000357134.5	1	1	hg19		CCDS7855.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010372	0.75046	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	.	.	.	6.17	6.17	0.99709	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0599	0.93085	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	NELL1	20925457	20925457	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.847000	0.75404	2.941000	0.99782	0.655000	0.94253	.	0.359501		TCGA-IB-A6UG-01A-32D-A33T-08	0.368	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	3.280000	-2.578431	1	0.220000	NM_006157	Intron	0	43	43	0	466	458	0		1			0	0	74	0	0	1.000000	0	0	0	0	0	0	43	466
AHNAK	79026	broad.mit.edu	37	11	62297984	62297984	+	Missense_Mutation	SNP	G	G	A	rs569137878		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:62297984G>A	ENST00000378024.4	-	5	4179	c.3905C>T	c.(3904-3906)cCg>cTg	p.P1302L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1302					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTTCCTTCCGGGCCCTCAAG	0.552																																						ENST00000378024.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				268						c.(3904-3906)cCg>cTg		AHNAK nucleoprotein							134.0	145.0	141.0					11																	62297984		2202	4299	6501	SO:0001583	missense	79026	4	121412	40				g.chr11:62297984G>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3905C>T	chr11.hg19:g.62297984G>A	ENSP00000367263:p.Pro1302Leu	1					AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	p.P1302L	NM_001620.1	NP_001611.1	2	2	4	2.130753	Q09666	AHNK_HUMAN		5	4179	-		Melanoma(852;0.155)	A1A586	Missense_Mutation	SNP	ENST00000378024.4	1	1	hg19	c.3905C>T	CCDS31584.1	1	.	.	.	.	.	.	.	.	.	.	g	13.14	2.148809	0.37923	.	.	ENSG00000124942	ENST00000378024	T	0.03242	4.0	4.66	4.66	0.58398	4.66	4.66	0.58398	.	0.000000	0.31612	U	0.007360	T	0.09379	0.0231	M	0.87827	2.91	0.58432	D	0.999999	P	0.50272	0.933	B	0.39152	0.292	T	0.22173	-1.0224	10	0.45353	T	0.12	.	17.5636	0.87913	0.0:0.0:1.0:0.0	.	1302	Q09666	AHNK_HUMAN	L	1302	ENSP00000367263:P1302L	ENSP00000367263:P1302L	P	-	2	0	0	AHNAK	62054560	62054560	0.997000	0.39634	0.103000	0.21229	0.003000	0.03518	2.440000	0.44855	2.309000	0.77851	0.645000	0.84053	CCG	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.552	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	0	0	1	2	2	2	2	0	0	0	0	193	193	193	193	1	3.280000	-2.554368	1	0.220000	NM_024060		0	215	210	0	907	899	1		1	1		0	0	193	0	0	1.000000	9.999845e-01	0	26	0	41	0	215	907
GAL3ST3	89792	broad.mit.edu	37	11	65810433	65810433	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:65810433C>T	ENST00000312006.4	-	3	1122	c.841G>A	c.(841-843)Gcg>Acg	p.A281T	GAL3ST3_ENST00000527878.1_Missense_Mutation_p.A281T	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	281					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						gccagcgccgcggggATGGCG	0.756																																						ENST00000312006.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999621	0.990000	1.000000																										0				14						c.(841-843)Gcg>Acg		galactose-3-O-sulfotransferase 3							3.0	4.0	3.0					11																	65810433		1703	3296	4999	SO:0001583	missense	89792	0	0					g.chr11:65810433C>T	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.841G>A	chr11.hg19:g.65810433C>T	ENSP00000308591:p.Ala281Thr	1					GAL3ST3_ENST00000527878.1_Missense_Mutation_p.A281T	p.A281T	NM_033036.2	NP_149025.1	2	2	4	2.130753	Q96A11	G3ST3_HUMAN		3	1122	-			Q14D05	Missense_Mutation	SNP	ENST00000312006.4	0	1	hg19	c.841G>A	CCDS8128.1	1	.	.	.	.	.	.	.	.	.	.	C	4.128	0.022068	0.08006	.	.	ENSG00000175229	ENST00000312006;ENST00000527878	T;T	0.14640	2.49;2.49	4.49	2.58	0.30949	4.49	2.58	0.30949	.	0.711911	0.12996	N	0.422026	T	0.06142	0.0159	N	0.16833	0.445	0.25445	N	0.988058	B	0.34313	0.448	B	0.26517	0.07	T	0.37663	-0.9696	10	0.14656	T	0.56	-8.5029	5.9018	0.18970	0.1877:0.7113:0.0:0.1009	.	281	Q96A11	G3ST3_HUMAN	T	281	ENSP00000308591:A281T;ENSP00000434829:A281T	ENSP00000308591:A281T	A	-	1	0	0	GAL3ST3	65567009	65567009	0.004000	0.15560	0.976000	0.42696	0.149000	0.21700	0.363000	0.20301	0.427000	0.26145	-1.512000	0.00943	GCG	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.756	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	0	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	3.280000	-19.999990	1	0.220000	NM_033036		0	10	10	0	36	35	0		1			0	0	12	0	0	0.997696	0	0	0	0	0	0	10	36
OR10G9	219870	broad.mit.edu	37	11	123893818	123893818	+	Silent	SNP	C	C	T	rs145074505		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr11:123893818C>T	ENST00000375024.1	+	1	99	c.99C>T	c.(97-99)taC>taT	p.Y33Y		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TGGTGGTTTACGTGCTCACTG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		20546	0.0		0.001	False		,,,				2504	0.0					ENST00000375024.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				61						c.(97-99)taC>taT		olfactory receptor, family 10, subfamily G, member 9		C		0,4402		0,0,2201	172.0	156.0	161.0		99	-4.4	0.0	11	dbSNP_134	161	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	OR10G9	NM_001001953.1		0,1,6499	TT,TC,CC		0.0116,0.0,0.0077		33/312	123893818	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	219870	34	121412	48				g.chr11:123893818C>T	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.99C>T	chr11.hg19:g.123893818C>T		1						p.Y33Y	NM_001001953.1	NP_001001953.1	2	3	5	2.326960	Q8NGN4	O10G9_HUMAN		1	99	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		Silent	SNP	ENST00000375024.1	1	1	hg19	c.99C>T	CCDS31703.1	1																																																																																								0.410609		TCGA-IB-A6UG-01A-32D-A33T-08	0.572	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	1	0	1	2	2	2	2	0	0	0	0	145	145	145	177	1	3.280000	-20.000000	1	0.220000	NM_001001953		0	216	208	0	725	683	0		1			0	0	145	0	0	1.000000	0	0	0	0	0	0	216	725
NOS1	4842	broad.mit.edu	37	12	117728173	117728173	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:117728173C>T	ENST00000338101.4	-	3	915	c.911G>A	c.(910-912)cGc>cAc	p.R304H	NOS1_ENST00000344089.3_Missense_Mutation_p.A323T|NOS1_ENST00000317775.6_Missense_Mutation_p.R304H			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CTTGAGGAAGCGTGGACACTT	0.547																																					Esophageal Squamous(162;1748 2599 51982 52956)	ENST00000338101.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999952	0.990000	1.000000																										0				117						c.(910-912)cGc>cAc		nitric oxide synthase 1 (neuronal)							56.0	58.0	58.0					12																	117728173		2051	4194	6245	SO:0001583	missense	4842	0	0					g.chr12:117728173C>T		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.911G>A	chr12.hg19:g.117728173C>T	ENSP00000337459:p.Arg304His	0					NOS1_ENST00000317775.6_Missense_Mutation_p.R304H|NOS1_ENST00000344089.3_Missense_Mutation_p.A323T	p.R304H			1	2	3	1.998772	Q8WY41	NANO1_HUMAN		3	915	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			Missense_Mutation	SNP	ENST00000338101.4	1	1	hg19	c.911G>A	CCDS55890.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.454934|4.454934	0.84209|0.84209	.|.	.|.	ENSG00000089250|ENSG00000089250	ENST00000344089|ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T|T;T	0.05786|0.01629	3.39|4.77;4.72	5.13|5.13	5.13|5.13	0.70059|0.70059	5.13|5.13	5.13|5.13	0.70059|0.70059	.|Nitric oxide synthase, oxygenase domain (1);	.|0.109676	.|0.64402	.|D	.|0.000008	T|T	0.09774|0.09774	0.0240|0.0240	M|M	0.73598|0.73598	2.24|2.24	0.39371|0.39371	D|D	0.96609|0.96609	.|D	.|0.89917	.|1.0	.|P	.|0.62560	.|0.904	T|T	0.00728|0.00728	-1.1591|-1.1591	7|10	0.87932|0.66056	D|D	0|0.02	-33.7598|-33.7598	18.7669|18.7669	0.91876|0.91876	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|304	.|P29475	.|NOS1_HUMAN	T|H	323|304	ENSP00000339862:A323T|ENSP00000320758:R304H;ENSP00000337459:R304H	ENSP00000339862:A323T|ENSP00000320758:R304H	A|R	-|-	1|2	0|0	0|0	NOS1|NOS1	116212556|116212556	116212556|116212556	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.382000|7.382000	0.79729|0.79729	2.680000|2.680000	0.91292|0.91292	0.467000|0.467000	0.42956|0.42956	GCT|CGC	0.273540		TCGA-IB-A6UG-01A-32D-A33T-08	0.547	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	3.280000	-19.987410	1	0.220000			0	40	40	0	202	197	1		1			0	0	37	0	0	1.000000	0	0	0	0	0	0	40	202
CLIP1	6249	broad.mit.edu	37	12	122825973	122825973	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:122825973G>A	ENST00000540338.1	-	10	1819	c.1778C>T	c.(1777-1779)aCc>aTc	p.T593I	CLIP1_ENST00000361654.4_Missense_Mutation_p.T547I|CLIP1_ENST00000545889.1_Missense_Mutation_p.T283I|CLIP1_ENST00000537178.1_Missense_Mutation_p.T547I|CLIP1_ENST00000302528.7_Missense_Mutation_p.T582I|CLIP1_ENST00000358808.2_Missense_Mutation_p.T582I			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	593					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTCCGTGGCGGTATACAGAGC	0.458																																						ENST00000540338.1	1.000000	0.030000	1	5.000000e-02	0.090000	0.281781	0.090000	0.080000																										0				60						c.(1777-1779)aCc>aTc		CAP-GLY domain containing linker protein 1							142.0	143.0	142.0					12																	122825973		2203	4300	6503	SO:0001583	missense	6249	0	0					g.chr12:122825973G>A		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1778C>T	chr12.hg19:g.122825973G>A	ENSP00000439093:p.Thr593Ile	0					CLIP1_ENST00000361654.4_Missense_Mutation_p.T547I|CLIP1_ENST00000545889.1_Missense_Mutation_p.T283I|CLIP1_ENST00000537178.1_Missense_Mutation_p.T547I|CLIP1_ENST00000302528.7_Missense_Mutation_p.T582I|CLIP1_ENST00000358808.2_Missense_Mutation_p.T582I	p.T593I			1	2	3	1.998772	P30622	CLIP1_HUMAN		10	1819	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	0	1	hg19	c.1778C>T	CCDS58285.1	0	.	.	.	.	.	.	.	.	.	.	G	7.866	0.727207	0.15439	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304	T;T;T;T;T;T	0.61627	2.74;0.69;0.69;0.7;0.69;0.09	5.37	0.13	0.14746	5.37	0.13	0.14746	.	0.766493	0.13191	N	0.406706	T	0.23965	0.0580	N	0.01352	-0.895	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.18116	-1.0347	10	0.44086	T	0.13	3.1754	5.4745	0.16688	0.372:0.1308:0.4972:0.0	.	283;547;582;593	F5H0N7;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	I	283;582;582;427;547;593;516	ENSP00000438743:T283I;ENSP00000303585:T582I;ENSP00000351665:T582I;ENSP00000445531:T547I;ENSP00000439093:T593I;ENSP00000437786:T516I	ENSP00000303585:T582I	T	-	2	0	0	CLIP1	121391926	121391926	0.848000	0.29623	0.000000	0.03702	0.566000	0.35808	2.612000	0.46343	0.033000	0.15463	0.561000	0.74099	ACC	0.273540		TCGA-IB-A6UG-01A-32D-A33T-08	0.458	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	0	0	1	2	2	2	2	0	0	0	0	160	160	160	160	1	3.280000	-2.211683	0	0.220000	NM_002956		0	7	7	0	886	881	0		1	0		0	0	160	0	0	0.980231	1.109853e-01	0	1	0	61	0	7	886
CACNA1C	775	broad.mit.edu	37	12	2797686	2797686	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:2797686C>T	ENST00000347598.4	+	48	6002	c.6002C>T	c.(6001-6003)gCc>gTc	p.A2001V	CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A2024V|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A1978V|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A1959V|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A2024V|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A1961V|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A1972V|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A1988V|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A1994V|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A1961V|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A1972V|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A1972V|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A1970V|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A1973V|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A1988V|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A1981V	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2036					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGCCTTTTGCCACCCCACCA	0.642																																						ENST00000347598.4	1.000000	0.040000	2.300000e-01	7.000000e-02	0.120000	0.247020	0.120000	0.110000																										0				132						c.(6001-6003)gCc>gTc		calcium channel, voltage-dependent, L type, alpha 1C subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						45.0	53.0	51.0					12																	2797686		1943	4134	6077	SO:0001583	missense	775	13	120832	39				g.chr12:2797686C>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6002C>T	chr12.hg19:g.2797686C>T	ENSP00000266376:p.Ala2001Val	0					CACNA1C_ENST00000399637.1_Missense_Mutation_p.A1972V|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A1953V|CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A1988V|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A1988V|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A1972V|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A1981V|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A1961V|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A2024V|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A1970V|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A1973V|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A1972V|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A1978V|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A1959V|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A1994V|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A1953V|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A1961V|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A2024V	p.A2001V	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	2	2	4	2.062782	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	48	6002	+			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	0	1	hg19	c.6002C>T	CCDS44788.1	0	.	.	.	.	.	.	.	.	.	.	C	13.56	2.273195	0.40194	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36	4.86	3.97	0.46021	4.86	3.97	0.46021	.	1.113020	0.06702	N	0.771686	T	0.53658	0.1810	M	0.62723	1.935	0.26184	N	0.979682	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.21520	0.011;0.057;0.01;0.017;0.057;0.026;0.012;0.015;0.007;0.026;0.026;0.01;0.01;0.015;0.006;0.009;0.01;0.008;0.026;0.008;0.012;0.015;0.026;0.01;0.01	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.26310	0.037;0.068;0.011;0.027;0.068;0.068;0.024;0.068;0.038;0.024;0.036;0.017;0.033;0.068;0.005;0.031;0.033;0.019;0.036;0.032;0.016;0.036;0.036;0.017;0.011	T	0.47129	-0.9141	10	0.44086	T	0.13	.	9.6655	0.39981	0.0:0.7805:0.1415:0.078	.	644;1994;1950;2036;1988;1972;1953;1970;1981;1953;1973;1953;1984;2001;1953;1988;2024;1961;1959;1961;1942;1972;1972;1953;1953	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	V	1978;1953;1953;1981;1953;1972;1972;1961;1953;2001;1973;1953;1994;1970;1988;1959;1972;1953;2024;1988;2024;1961;1854	ENSP00000336982:A1978V;ENSP00000382563:A1953V;ENSP00000382552:A1953V;ENSP00000382547:A1981V;ENSP00000382506:A1953V;ENSP00000382530:A1972V;ENSP00000382546:A1972V;ENSP00000382500:A1961V;ENSP00000382549:A1953V;ENSP00000266376:A2001V;ENSP00000382515:A1973V;ENSP00000382510:A1953V;ENSP00000341092:A1994V;ENSP00000382537:A1970V;ENSP00000329877:A1988V;ENSP00000382557:A1959V;ENSP00000385724:A1972V;ENSP00000382512:A1953V;ENSP00000382542:A2024V;ENSP00000382526:A1988V;ENSP00000385896:A2024V;ENSP00000382504:A1961V	ENSP00000323129:A1854V	A	+	2	0	0	CACNA1C	2667947	2667947	1.000000	0.71417	0.629000	0.29254	0.517000	0.34286	4.439000	0.59968	1.051000	0.40369	0.462000	0.41574	GCC	0.339207		TCGA-IB-A6UG-01A-32D-A33T-08	0.642	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	0	0	1	2	2	2	2	0	0	0	0	92	92	92	87	1	3.280000	-2.350234	0	0.220000	NM_000719		0	7	7	0	674	656	0		1	0		0	0	92	0	0	0.978730	6.417475e-03	0	0	0	10	0	7	674
GYS2	2998	broad.mit.edu	37	12	21721886	21721886	+	Nonsense_Mutation	SNP	G	G	A	rs121918419		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:21721886G>A	ENST00000261195.2	-	5	990	c.736C>T	c.(736-738)Cga>Tga	p.R246*		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	246					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)	p.R246*(1)		NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACGGAAGCTCGCTCCATGCAG	0.423																																					Colon(149;9 1820 3690 10544 50424)	ENST00000261195.2	1.000000	0.050000	2.600000e-01	9.000000e-02	0.140000	0.251676	0.140000	0.140000																										1	Substitution - Nonsense(1)	p.R246*(1)	large_intestine(1)	48	GRCh37	CM980965	GYS2	M	rs121918419	c.(736-738)Cga>Tga		glycogen synthase 2 (liver)							161.0	154.0	156.0					12																	21721886		2203	4300	6503	SO:0001587	stop_gained	2998	48	121412	49				g.chr12:21721886G>A		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.736C>T	chr12.hg19:g.21721886G>A	ENSP00000261195:p.Arg246*	0						p.R246*	NM_021957.3	NP_068776.2	2	2	4	2.075980	P54840	GYS2_HUMAN		5	990	-			A0AVD8	Nonsense_Mutation	SNP	ENST00000261195.2	0	1	hg19	c.736C>T	CCDS8690.1	0	.	.	.	.	.	.	.	.	.	.	G	39	7.668078	0.98422	.	.	ENSG00000111713	ENST00000261195	.	.	.	5.16	4.25	0.50352	5.16	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9125	15.0535	0.71894	0.0:0.0:0.8571:0.1429	.	.	.	.	X	246	.	ENSP00000261195:R246X	R	-	1	2	2	GYS2	21613153	21613153	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	3.419000	0.52728	1.363000	0.46019	0.655000	0.94253	CGA	0.342881		TCGA-IB-A6UG-01A-32D-A33T-08	0.423	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	104	1	3.280000	-2.666693	1	0.220000	NM_021957		0	6	5	0	491	486	0		1			0	0	104	0	0	0.963835	0	0	0	0	0	0	6	491
GYS2	2998	broad.mit.edu	37	12	21733405	21733405	+	Silent	SNP	T	T	C	rs553711100		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:21733405T>C	ENST00000261195.2	-	2	428	c.174A>G	c.(172-174)gaA>gaG	p.E58E		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	58					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCTCTCCCCATTCATCTGCTG	0.378													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20433	0.0		0.0	False		,,,				2504	0.0				Colon(149;9 1820 3690 10544 50424)	ENST00000261195.2	1.000000	0.250000	5.500000e-01	3.200000e-01	0.400000	0.473870	0.400000	0.400000																										0				48						c.(172-174)gaA>gaG		glycogen synthase 2 (liver)							193.0	184.0	187.0					12																	21733405		2203	4300	6503	SO:0001819	synonymous_variant	2998	1	121412	32				g.chr12:21733405T>C		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.174A>G	chr12.hg19:g.21733405T>C		0						p.E58E	NM_021957.3	NP_068776.2	2	2	4	2.075980	P54840	GYS2_HUMAN		2	428	-			A0AVD8	Silent	SNP	ENST00000261195.2	1	1	hg19	c.174A>G	CCDS8690.1	0																																																																																								0.342881		TCGA-IB-A6UG-01A-32D-A33T-08	0.378	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	0	0	1	2	2	2	2	0	0	0	0	122	122	122	122	1	3.280000	-3.625987	1	0.220000	NM_021957		0	22	23	0	590	587	0		1			0	0	122	0	0	0.999999	0	0	0	0	0	0	22	590
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.630000	1	8.600000e-01	0.990000	0.949861	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	2	2	4	2.075980	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.342881		TCGA-IB-A6UG-01A-32D-A33T-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	3.280000	-7.680973	1	0.220000	NM_033360		1812	13	13	6219	117	117	1	1	1	1	1	0	0	20	273	1	0.999626	5.381532e-01	1	8	75	9	401	13	117
FMNL3	91010	broad.mit.edu	37	12	50050953	50050953	+	Missense_Mutation	SNP	C	C	T	rs202178648		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:50050953C>T	ENST00000293590.5	-	7	859	c.626G>A	c.(625-627)cGc>cAc	p.R209H	FMNL3_ENST00000335154.5_Missense_Mutation_p.R209H|FMNL3_ENST00000550488.1_Missense_Mutation_p.R209H|FMNL3_ENST00000352151.5_Missense_Mutation_p.R158H			Q8IVF7	FMNL3_HUMAN	formin-like 3	209	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						CAGGGCCCTGCGCCCAGGGAG	0.582																																						ENST00000293590.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				39						c.(625-627)cGc>cAc		formin-like 3		C	HIS/ARG,HIS/ARG	0,4032		0,0,2016	80.0	81.0	81.0		626,473	5.4	1.0	12		81	2,8380		0,2,4189	yes	missense,missense	FMNL3	NM_175736.4,NM_198900.2	29,29	0,2,6205	TT,TC,CC		0.0239,0.0,0.0161	probably-damaging,probably-damaging	209/1028,158/977	50050953	2,12412	2016	4191	6207	SO:0001583	missense	91010	10	120964	41				g.chr12:50050953C>T	AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.626G>A	chr12.hg19:g.50050953C>T	ENSP00000293590:p.Arg209His	0					FMNL3_ENST00000352151.5_Missense_Mutation_p.R158H|FMNL3_ENST00000335154.5_Missense_Mutation_p.R209H|FMNL3_ENST00000550488.1_Missense_Mutation_p.R209H	p.R209H			1	2	3	1.998772	Q8IVF7	FMNL3_HUMAN		7	859	-			B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	ENST00000293590.5	1	1	hg19	c.626G>A		1	.	.	.	.	.	.	.	.	.	.	C	35	5.423799	0.96111	0.0	2.39E-4	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	D;D;D;D	0.81821	-1.51;-1.5;-1.54;-1.5	5.45	5.45	0.79879	5.45	5.45	0.79879	.	0.052637	0.64402	D	0.000001	D	0.89832	0.6829	M	0.77616	2.38	0.49915	D	0.999834	D;D	0.76494	0.999;0.994	D;P	0.80764	0.994;0.754	D	0.89710	0.3911	10	0.52906	T	0.07	.	18.4343	0.90638	0.0:1.0:0.0:0.0	.	158;209	Q8IVF7-2;Q8IVF7-3	.;.	H	209;209;158;209	ENSP00000335655:R209H;ENSP00000447479:R209H;ENSP00000344311:R158H;ENSP00000293590:R209H	ENSP00000293590:R209H	R	-	2	0	0	FMNL3	48337220	48337220	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.865000	0.62998	2.744000	0.94065	0.561000	0.74099	CGC	0.273540		TCGA-IB-A6UG-01A-32D-A33T-08	0.582	FMNL3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	3.280000	-3.361336	1	0.220000	NM_175736		0	81	81	0	382	382	1		1	0		0	0	89	0	0	1.000000	6.474576e-01	0	0	0	12	0	81	382
NACA	4666	broad.mit.edu	37	12	57108169	57108169	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:57108169G>A	ENST00000454682.1	-	5	6081	c.5800C>T	c.(5800-5802)Cgg>Tgg	p.R1934W	NACA_ENST00000552540.1_Missense_Mutation_p.R71W|NACA_ENST00000550952.1_Missense_Mutation_p.R781W|NACA_ENST00000551793.1_5'UTR|NACA_ENST00000546392.1_Missense_Mutation_p.R71W|NACA_ENST00000548563.1_5'UTR|NACA_ENST00000393891.4_Missense_Mutation_p.R71W|NACA_ENST00000356769.3_Missense_Mutation_p.R71W	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1934	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.|Required for DNA-binding. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TTTTCACTCCGACTCTGTTTT	0.388			T	BCL6	NHL																																	ENST00000454682.1	1.000000	0.550000	1	6.800000e-01	0.860000	0.849322	0.860000	1.000000				Dom	yes			Dom	yes		12	12q23-q24.1	12q23-q24.1	4666	T	nascent-polypeptide-associated complex alpha polypeptide				L	L	BCL6		NHL		0				10						c.(5800-5802)Cgg>Tgg		nascent polypeptide-associated complex alpha subunit							137.0	122.0	127.0					12																	57108169		2203	4299	6502	SO:0001583	missense	4666	0	0					g.chr12:57108169G>A	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5800C>T	chr12.hg19:g.57108169G>A	ENSP00000403817:p.Arg1934Trp	0					NACA_ENST00000356769.3_Missense_Mutation_p.R71W|NACA_ENST00000550952.1_Missense_Mutation_p.R781W|NACA_ENST00000552540.1_Missense_Mutation_p.R71W|NACA_ENST00000393891.4_Missense_Mutation_p.R71W|NACA_ENST00000551793.1_5'UTR|NACA_ENST00000546392.1_Missense_Mutation_p.R71W|NACA_ENST00000548563.1_5'UTR	p.R1934W	NM_001113203.2	NP_001106674.2	1	2	3	1.998772	E9PAV3	NACAM_HUMAN		5	6081	-				Missense_Mutation	SNP	ENST00000454682.1	1	1	hg19	c.5800C>T		1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611275	0.46631	.	.	ENSG00000196531	ENST00000550920;ENST00000454682;ENST00000550952;ENST00000356769;ENST00000552540;ENST00000393891;ENST00000546392;ENST00000549259;ENST00000552055;ENST00000549855	T;T;T;T;T;T;T;T;T;T	0.67345	0.14;-0.1;-0.26;0.16;0.16;0.16;0.16;0.18;0.0;0.03	4.73	3.82	0.43975	4.73	3.82	0.43975	Nascent polypeptide-associated complex NAC (1);	0.000000	0.85682	D	0.000000	D	0.83175	0.5197	H	0.95151	3.63	0.53688	D	0.999979	P;D;B	0.59767	0.946;0.986;0.008	P;P;B	0.57960	0.523;0.83;0.002	D	0.86446	0.1770	10	0.87932	D	0	.	11.0665	0.47979	0.0:0.0:0.663:0.337	.	1934;781;71	E9PAV3;F8VU71;Q13765	.;.;NACA_HUMAN	W	69;1934;781;71;71;71;71;71;67;71	ENSP00000448039:R69W;ENSP00000403817:R1934W;ENSP00000448035:R781W;ENSP00000349212:R71W;ENSP00000447821:R71W;ENSP00000377469:R71W;ENSP00000446801:R71W;ENSP00000447133:R71W;ENSP00000450383:R67W;ENSP00000447764:R71W	ENSP00000349212:R71W	R	-	1	2	2	NACA	55394436	55394436	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.742000	0.47434	0.938000	0.37419	0.460000	0.39030	CGG	0.273540		TCGA-IB-A6UG-01A-32D-A33T-08	0.388	NACA-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	3.280000	-8.276200	1	0.220000	NM_005594		0	25	24	0	280	275	0		1	1		0	0	51	0	0	1.000000	1	0	269	0	2777	0	25	280
TMEM132D	121256	broad.mit.edu	37	12	130184773	130184773	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr12:130184773G>A	ENST00000422113.2	-	2	876	c.550C>T	c.(550-552)Cgg>Tgg	p.R184W	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	184					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCCTGCAGCCGGCAGCTGCCC	0.692																																						ENST00000422113.2	1.000000	0.550000	1	7.000000e-01	0.910000	0.874464	0.910000	1.000000																										0				152						c.(550-552)Cgg>Tgg		transmembrane protein 132D							13.0	16.0	15.0					12																	130184773		2197	4288	6485	SO:0001583	missense	121256	2	121288	35				g.chr12:130184773G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.550C>T	chr12.hg19:g.130184773G>A	ENSP00000408581:p.Arg184Trp	0					RP11-174M13.2_ENST00000544036.1_lincRNA	p.R184W	NM_133448.2	NP_597705.2	1	2	3	1.998772	Q14C87	T132D_HUMAN		2	876	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	1	1	hg19	c.550C>T	CCDS9266.1	1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647589	0.67358	.	.	ENSG00000151952	ENST00000422113	T	0.13657	2.57	5.22	3.2	0.36748	5.22	3.2	0.36748	.	0.585904	0.15144	N	0.278095	T	0.37461	0.1004	M	0.86740	2.835	0.32312	N	0.563638	D	0.76494	0.999	P	0.59288	0.855	T	0.56529	-0.7964	9	.	.	.	-33.4486	13.4612	0.61229	0.0:0.0:0.5014:0.4986	.	184	Q14C87	T132D_HUMAN	W	184	ENSP00000408581:R184W	.	R	-	1	2	2	TMEM132D	128750726	128750726	0.099000	0.21834	0.990000	0.47175	0.952000	0.60782	0.262000	0.18460	1.122000	0.41944	0.555000	0.69702	CGG	0.273540		TCGA-IB-A6UG-01A-32D-A33T-08	0.692	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	3.280000	-20.000000	1	0.220000	NM_133448		0	19	19	0	201	196	0		1	0		0	0	37	0	0	0.999991	0	0	0	0	1	0	19	201
PDS5B	23047	broad.mit.edu	37	13	33258137	33258137	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr13:33258137A>T	ENST00000315596.10	+	11	1366	c.1180A>T	c.(1180-1182)Aga>Tga	p.R394*		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	394				R -> G (in Ref. 2; AAD22134). {ECO:0000305}.	cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.R394*(2)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TAATTTTGTGAGAGAGAGAAC	0.274																																						ENST00000315596.10	0.240000	0.030000	1.800000e-01	7.000000e-02	0.110000	0.130938	0.110000	0.120000																										2	Substitution - Nonsense(2)	p.R394*(2)	large_intestine(1)|endometrium(1)	62						c.(1180-1182)Aga>Tga		PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)							140.0	130.0	133.0					13																	33258137		1813	4068	5881	SO:0001587	stop_gained	23047	1	120772	23				g.chr13:33258137A>T	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1180A>T	chr13.hg19:g.33258137A>T	ENSP00000313851:p.Arg394*	1						p.R394*	NM_015032.3	NP_055847.1	0	3	3	1.939135	Q9NTI5	PDS5B_HUMAN		11	1366	+		Lung SC(185;0.0367)	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Nonsense_Mutation	SNP	ENST00000315596.10	0	1	hg19	c.1180A>T	CCDS41878.1	0	.	.	.	.	.	.	.	.	.	.	A	36	5.852697	0.97030	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.045487	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-3.1156	11.2434	0.48982	0.847:0.153:0.0:0.0	.	.	.	.	X	394	.	ENSP00000313851:R394X	R	+	1	2	2	PDS5B	32156137	32156137	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.075000	0.50073	2.064000	0.61679	0.482000	0.46254	AGA	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.274	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	0	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	3.280000	-2.167235	0	0.220000	NM_015032		0	5	5	0	453	447	0		1	0		0	0	96	0	0	0.935675	1.793165e-02	0	0	0	15	0	5	453
ZIC5	85416	broad.mit.edu	37	13	100617645	100617645	+	Missense_Mutation	SNP	G	G	A	rs577823767		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr13:100617645G>A	ENST00000267294.4	-	2	2211	c.1978C>T	c.(1978-1980)Cgg>Tgg	p.R660W		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	660					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTATCGTCCGCACAACTTCA	0.483													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13720	0.0		0.0	False		,,,				2504	0.0					ENST00000267294.4	0.190000	0.020000	1.400000e-01	5.000000e-02	0.090000	0.101150	0.090000	0.090000																										0				9						c.(1978-1980)Cgg>Tgg		Zic family member 5							66.0	66.0	66.0					13																	100617645		2203	4300	6503	SO:0001583	missense	85416	10	121412	40				g.chr13:100617645G>A	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1978C>T	chr13.hg19:g.100617645G>A	ENSP00000267294:p.Arg660Trp	1						p.R660W	NM_033132.3	NP_149123.2	0	3	3	1.939135	Q96T25	ZIC5_HUMAN		2	2211	-	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		Q5VYB0	Missense_Mutation	SNP	ENST00000267294.4	0	1	hg19	c.1978C>T	CCDS9494.2	0	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556755	0.65425	.	.	ENSG00000139800	ENST00000267294	T	0.18016	2.24	6.06	5.14	0.70334	6.06	5.14	0.70334	.	.	.	.	.	T	0.29321	0.0730	L	0.36672	1.1	0.35097	D	0.764889	D	0.89917	1.0	D	0.69654	0.965	T	0.18335	-1.0340	9	0.87932	D	0	.	11.1163	0.48262	0.0:0.0:0.7346:0.2654	.	660	Q96T25	ZIC5_HUMAN	W	660	ENSP00000267294:R660W	ENSP00000267294:R660W	R	-	1	2	2	ZIC5	99415646	99415646	0.998000	0.40836	0.997000	0.53966	0.991000	0.79684	2.915000	0.48805	2.871000	0.98454	0.655000	0.94253	CGG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.483	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	0	0	1	2	2	2	2	0	0	0	0	113	113	113	112	1	3.280000	-2.199264	0	0.220000	NM_033132		0	5	5	0	589	585	0		1	0		0	0	113	0	0	0.936664	1.180399e-04	0	0	0	2	0	5	589
RPL10L	140801	broad.mit.edu	37	14	47120810	47120810	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr14:47120810C>A	ENST00000298283.3	-	1	218	c.130G>T	c.(130-132)Gat>Tat	p.D44Y		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	44					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						GGGAACTCATCCACTTTTGCC	0.502																																						ENST00000298283.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				27						c.(130-132)Gat>Tat		ribosomal protein L10-like							100.0	102.0	101.0					14																	47120810		2203	4300	6503	SO:0001583	missense	140801	0	0					g.chr14:47120810C>A	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.130G>T	chr14.hg19:g.47120810C>A	ENSP00000298283:p.Asp44Tyr	1						p.D44Y	NM_080746.2	NP_542784.1	2	2	4	2.102850	Q96L21	RL10L_HUMAN		1	218	-			Q8IUD1	Missense_Mutation	SNP	ENST00000298283.3	1	1	hg19	c.130G>T	CCDS32071.1	1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777196	0.70107	.	.	ENSG00000165496	ENST00000298283	T	0.74209	-0.82	4.32	4.32	0.51571	4.32	4.32	0.51571	Ribosomal protein L10e/L16 (2);	0.000000	0.85682	D	0.000000	D	0.91123	0.7205	H	0.98629	4.285	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	D	0.94002	0.7276	10	0.87932	D	0	-39.9655	15.1202	0.72438	0.0:1.0:0.0:0.0	.	44	Q96L21	RL10L_HUMAN	Y	44	ENSP00000298283:D44Y	ENSP00000298283:D44Y	D	-	1	0	0	RPL10L	46190560	46190560	1.000000	0.71417	0.997000	0.53966	0.495000	0.33615	7.003000	0.76310	2.688000	0.91661	0.655000	0.94253	GAT	0.351297		TCGA-IB-A6UG-01A-32D-A33T-08	0.502	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1	1	0	1	2	2	2	2	0	0	0	0	104	104	104	104	1	3.280000	-20.000000	1	0.220000			0	92	89	0	477	473	1		1			0	0	104	0	0	1.000000	0	0	0	0	0	0	92	477
MAX	4149	broad.mit.edu	37	14	65560458	65560458	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr14:65560458G>A	ENST00000358664.4	-	3	269	c.139C>T	c.(139-141)Cgg>Tgg	p.R47W	MAX_ENST00000556443.1_Missense_Mutation_p.R38W|MAX_ENST00000246163.2_Missense_Mutation_p.R47W|RP11-840I19.3_ENST00000553633.1_RNA|RP11-840I19.3_ENST00000555261.1_RNA|MAX_ENST00000341653.2_Missense_Mutation_p.R47W|MAX_ENST00000555419.1_Intron|MAX_ENST00000358402.4_Missense_Mutation_p.R38W|MAX_ENST00000557277.1_5'UTR|RP11-840I19.3_ENST00000555898.1_RNA|MAX_ENST00000555667.1_Missense_Mutation_p.R38W|MAX_ENST00000555932.1_Intron|MAX_ENST00000556979.1_Missense_Mutation_p.R47W|RP11-840I19.3_ENST00000556127.1_RNA|MAX_ENST00000557746.1_Missense_Mutation_p.R38W|MAX_ENST00000284165.6_Missense_Mutation_p.R47W	NM_002382.4	NP_002373.3	P61244	MAX_HUMAN	MYC associated factor X	47	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to peptide hormone stimulus (GO:0071375)|cellular response to starvation (GO:0009267)|negative regulation of gene expression (GO:0010629)|neuron apoptotic process (GO:0051402)|protein complex assembly (GO:0006461)|response to axon injury (GO:0048678)|response to insulin (GO:0032868)|retina development in camera-type eye (GO:0060041)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|PML body (GO:0016605)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	17				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		ACTGAGTCCCGCAAACTGTGA	0.483																																						ENST00000358664.4	1.000000	0.050000	2.800000e-01	1.000000e-01	0.170000	0.232067	0.170000	0.150000																										0				17						c.(139-141)Cgg>Tgg		MYC associated factor X							189.0	156.0	167.0					14																	65560458		2203	4300	6503	SO:0001583	missense	4149	0	0					g.chr14:65560458G>A		CCDS9770.1, CCDS9771.1, CCDS9772.1, CCDS9774.1, CCDS41965.1	14q23	2014-09-17	2005-02-08		ENSG00000125952	ENSG00000125952		"""Basic helix-loop-helix proteins"""	6913	protein-coding gene	gene with protein product		154950	"""MAX protein"""			1557420	Standard	NM_002382		Approved	bHLHd4, bHLHd5, bHLHd6, bHLHd7, bHLHd8	uc001xif.2	P61244	OTTHUMG00000142809	ENST00000358664.4:c.139C>T	chr14.hg19:g.65560458G>A	ENSP00000351490:p.Arg47Trp	1					MAX_ENST00000556979.1_Missense_Mutation_p.R47W|RP11-840I19.3_ENST00000553633.1_RNA|RP11-840I19.3_ENST00000555261.1_RNA|MAX_ENST00000358402.4_Missense_Mutation_p.R38W|MAX_ENST00000556443.1_Missense_Mutation_p.R38W|MAX_ENST00000555932.1_Intron|RP11-840I19.3_ENST00000556127.1_RNA|MAX_ENST00000246163.2_Missense_Mutation_p.R47W|MAX_ENST00000557277.1_5'UTR|RP11-840I19.3_ENST00000555898.1_RNA|MAX_ENST00000555419.1_Intron|MAX_ENST00000284165.6_Missense_Mutation_p.R47W|MAX_ENST00000555667.1_Missense_Mutation_p.R38W|MAX_ENST00000557746.1_Missense_Mutation_p.R38W|MAX_ENST00000341653.2_Missense_Mutation_p.R47W	p.R47W	NM_002382.4	NP_002373.3	2	2	4	2.102850	P61244	MAX_HUMAN		3	269	-			A6NH73|A8K265|A8K4G4|A8K824|P25912|P52163|Q14803|Q96CY8	Missense_Mutation	SNP	ENST00000358664.4	0	1	hg19	c.139C>T	CCDS9771.1	0	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499453	0.85069	.	.	ENSG00000125952	ENST00000341653;ENST00000358402;ENST00000284165;ENST00000358664;ENST00000441116;ENST00000556979;ENST00000555667;ENST00000557746;ENST00000556443;ENST00000246163	D;D;D;D;D;D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12;-5.12;-5.12;-5.12;-5.12;-5.12	5.93	5.93	0.95920	5.93	5.93	0.95920	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99453	0.9806	H	0.97390	3.995	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;1.0;0.997;0.998;0.999;0.998;0.999	D	0.98397	1.0566	10	0.87932	D	0	-5.0518	14.004	0.64451	0.0:0.0:0.8485:0.1515	.	47;47;38;38;47;47;47	Q96CY8;Q14803;Q6V3B1;P61244-2;P61244;P61244-3;A6NH73	.;.;.;.;MAX_HUMAN;.;.	W	47;38;47;47;54;47;38;38;38;47	ENSP00000342482:R47W;ENSP00000351175:R38W;ENSP00000284165:R47W;ENSP00000351490:R47W;ENSP00000452378:R47W;ENSP00000452286:R38W;ENSP00000452197:R38W;ENSP00000450818:R38W;ENSP00000246163:R47W	ENSP00000246163:R47W	R	-	1	2	2	MAX	64630211	64630211	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.132000	0.71676	2.814000	0.96858	0.563000	0.77884	CGG	0.351297		TCGA-IB-A6UG-01A-32D-A33T-08	0.483	MAX-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286386.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	3.280000	-2.047474	0	0.220000	NM_197957		0	5	5	0	357	353	0		1	0		0	0	63	0	0	0.936120	5.284117e-01	0	0	0	114	0	5	357
DIO3	1735	broad.mit.edu	37	14	102028612	102028612	+	Missense_Mutation	SNP	G	G	A	rs538885762		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr14:102028612G>A	ENST00000510508.4	+	1	925	c.779G>A	c.(778-780)cGt>cAt	p.R260H	DIO3_ENST00000359323.3_Missense_Mutation_p.R234H|DIO3OS_ENST00000408206.1_lincRNA			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	260					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				TACTTCGAGCGTCTCTATGTC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		19221	0.0		0.0	False		,,,				2504	0.001					ENST00000510508.4	1.000000	0.740000	1	8.700000e-01	0.990000	0.955370	0.990000	1.000000																										0				22						c.(778-780)cGt>cAt		deiodinase, iodothyronine, type III							56.0	63.0	61.0					14																	102028612		2092	4200	6292	SO:0001583	missense	1735	1	121040	27				g.chr14:102028612G>A	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	ENST00000510508.4:c.779G>A	chr14.hg19:g.102028612G>A	ENSP00000427336:p.Arg260His	1					DIO3_ENST00000359323.3_Missense_Mutation_p.R234H|DIO3OS_ENST00000408206.1_lincRNA	p.R260H			2	2	4	2.102850	P55073	IOD3_HUMAN		1	925	+		all_neural(303;0.185)	G3XAM0|Q8WVN5	Missense_Mutation	SNP	ENST00000510508.4	1	1	hg19	c.779G>A	CCDS41992.2	1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902680	0.92035	.	.	ENSG00000197406;ENSG00000258865	ENST00000359323;ENST00000510508	T;T	0.51325	0.71;0.71	3.86	3.86	0.44501	3.86	3.86	0.44501	.	0.000000	0.64402	U	0.000011	T	0.74869	0.3773	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82833	-0.0262	10	0.87932	D	0	.	14.9928	0.71401	0.0:0.0:1.0:0.0	.	234	P55073	IOD3_HUMAN	H	234;260	ENSP00000352273:R234H;ENSP00000427336:R260H	ENSP00000352273:R260H	R	+	2	0	0	DIO3;AL049836.1	101098365	101098365	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.515000	0.98015	1.998000	0.58463	0.462000	0.41574	CGT	0.351297		TCGA-IB-A6UG-01A-32D-A33T-08	0.617	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	0	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	3.280000	-20.000000	1	0.220000	NM_001362		0	42	42	0	413	409	0		1	0		0	0	89	0	0	1.000000	9.039397e-03	0	0	0	2	0	42	413
TRPM1	4308	broad.mit.edu	37	15	31319127	31319127	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr15:31319127G>A	ENST00000256552.6	-	26	3634	c.3487C>T	c.(3487-3489)Cgt>Tgt	p.R1163C	TRPM1_ENST00000542188.1_Missense_Mutation_p.R1180C|RP11-348B17.1_ENST00000558755.1_RNA|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Missense_Mutation_p.R1141C	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTCAATCCACGATCCCGTTCC	0.463																																						ENST00000256552.6	1.000000	0.660000	1	7.700000e-01	0.900000	0.891153	0.900000	1.000000																										0				99						c.(3487-3489)Cgt>Tgt		transient receptor potential cation channel, subfamily M, member 1							123.0	117.0	119.0					15																	31319127		1911	4129	6040	SO:0001583	missense	4308	8	120844	41				g.chr15:31319127G>A	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3487C>T	chr15.hg19:g.31319127G>A	ENSP00000256552:p.Arg1163Cys	0					RP11-348B17.1_ENST00000558755.1_RNA|TRPM1_ENST00000397795.2_Missense_Mutation_p.R1141C|TRPM1_ENST00000542188.1_Missense_Mutation_p.R1180C|RP11-348B17.1_ENST00000561299.1_RNA	p.R1163C	NM_001252024.1	NP_001238953.1	1	2	3	1.965361				26	3634	-		all_lung(180;1.92e-11)		Missense_Mutation	SNP	ENST00000256552.6	1	1	hg19	c.3487C>T	CCDS58346.1	1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648605	0.67358	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.36878	1.23;1.23;1.23	5.79	5.79	0.91817	5.79	5.79	0.91817	.	0.110302	0.64402	D	0.000012	T	0.43656	0.1257	L	0.47716	1.5	0.52501	D	0.999952	P;P	0.47962	0.903;0.843	P;P	0.51229	0.663;0.462	T	0.18461	-1.0336	10	0.48119	T	0.1	-12.7835	13.9482	0.64099	0.0:0.0:0.7473:0.2527	.	1135;1141	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	C	1141;1180;1163;1141	ENSP00000380897:R1141C;ENSP00000437849:R1180C;ENSP00000256552:R1163C	ENSP00000256552:R1163C	R	-	1	0	0	TRPM1	29106419	29106419	0.999000	0.42202	0.962000	0.40283	0.942000	0.58702	2.188000	0.42612	2.736000	0.93811	0.655000	0.94253	CGT	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.463	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	1	0	1	2	2	2	2	0	0	0	0	70	70	70	68	1	3.280000	-3.318794	1	0.220000	NM_002420		0	42	41	0	429	425	0		1			0	0	70	0	0	1.000000	0	0	0	0	0	0	42	429
RYR3	6263	broad.mit.edu	37	15	33822869	33822869	+	Splice_Site	SNP	T	T	C			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr15:33822869T>C	ENST00000389232.4	+	4	424		c.e4+2		RYR3_ENST00000415757.3_Splice_Site	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGCGGAATGGTAAGCAGCTCT	0.498																																						ENST00000389232.4	0.800000	0.150000	6.000000e-01	2.600000e-01	0.410000	0.440040	0.410000	0.370000																										0				311						c.e4+2		ryanodine receptor 3							63.0	60.0	61.0					15																	33822869		1954	4152	6106	SO:0001630	splice_region_variant	6263	0	0					g.chr15:33822869T>C		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.354+2T>C	chr15.hg19:g.33822869T>C		0					RYR3_ENST00000415757.3_Splice_Site		NM_001036.3	NP_001027.3	1	2	3	1.965361	Q15413	RYR3_HUMAN		4	424	+		all_lung(180;7.18e-09)	O15175|Q15412	Splice_Site	SNP	ENST00000389232.4	0	1	hg19		CCDS45210.1	0	.	.	.	.	.	.	.	.	.	.	T	26.1	4.703043	0.88924	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	5.76	5.76	0.90799	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0668	0.72002	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	RYR3	31610161	31610161	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.637000	0.83313	2.191000	0.70037	0.533000	0.62120	.	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.498	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	3.280000	-7.910571	1	0.220000		Intron	0	5	5	0	128	128	0		1			0	0	26	0	0	0.938752	0	0	0	0	0	0	5	128
ISLR2	57611	broad.mit.edu	37	15	74426584	74426584	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr15:74426584G>A	ENST00000361742.3	+	4	2258	c.1489G>A	c.(1489-1491)Gag>Aag	p.E497K	ISLR2_ENST00000565159.1_Missense_Mutation_p.E497K|ISLR2_ENST00000419208.1_Missense_Mutation_p.E497K|ISLR2_ENST00000453268.2_Missense_Mutation_p.E497K|ISLR2_ENST00000435464.1_Missense_Mutation_p.E497K|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000565540.1_Missense_Mutation_p.E497K|ISLR2_ENST00000445793.1_Missense_Mutation_p.E497K	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	497					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GGCGGAGCGCGAGGCGCGGGT	0.731																																						ENST00000361742.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				36						c.(1489-1491)Gag>Aag		immunoglobulin superfamily containing leucine-rich repeat 2							12.0	12.0	12.0					15																	74426584		2192	4284	6476	SO:0001583	missense	57611	0	0					g.chr15:74426584G>A		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.1489G>A	chr15.hg19:g.74426584G>A	ENSP00000355402:p.Glu497Lys	0					ISLR2_ENST00000453268.2_Missense_Mutation_p.E497K|ISLR2_ENST00000565540.1_Missense_Mutation_p.E497K|ISLR2_ENST00000435464.1_Missense_Mutation_p.E497K|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000419208.1_Missense_Mutation_p.E497K|ISLR2_ENST00000565159.1_Missense_Mutation_p.E497K|ISLR2_ENST00000445793.1_Missense_Mutation_p.E497K	p.E497K	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	1	2	3	1.952518	Q6UXK2	ISLR2_HUMAN		4	2258	+			A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	0	1	hg19	c.1489G>A	CCDS10259.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082884	0.76642	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000419208	T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29	4.83	4.83	0.62350	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.41351	0.1155	L	0.27053	0.805	0.58432	D	0.999995	P	0.48407	0.91	B	0.32805	0.153	T	0.51787	-0.8661	10	0.56958	D	0.05	.	16.6691	0.85261	0.0:0.0:1.0:0.0	.	497	Q6UXK2	ISLR2_HUMAN	K	497	ENSP00000403244:E497K;ENSP00000355402:E497K;ENSP00000411443:E497K;ENSP00000411834:E497K;ENSP00000408872:E497K	ENSP00000355402:E497K	E	+	1	0	0	ISLR2	72213637	72213637	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.347000	0.73004	2.223000	0.72356	0.313000	0.20887	GAG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.731	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	1	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	3.280000	-20.000000	1	0.220000	NM_020851		0	16	16	0	33	33	0		1			0	0	11	0	0	0.999980	0	0	0	0	0	0	16	33
LMAN1L	79748	broad.mit.edu	37	15	75115914	75115914	+	Missense_Mutation	SNP	G	G	A	rs543907196		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr15:75115914G>A	ENST00000309664.5	+	12	1353	c.1214G>A	c.(1213-1215)cGc>cAc	p.R405H	LMAN1L_ENST00000379709.3_Missense_Mutation_p.R393H|CPLX3_ENST00000395018.4_5'Flank|RP11-414J4.2_ENST00000564823.1_RNA	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	405						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCAGCTGTCCGCATGGCTGCA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		18937	0.0		0.0	False		,,,				2504	0.001					ENST00000309664.5	0.290000	0.040000	2.200000e-01	8.000000e-02	0.140000	0.157920	0.140000	0.130000																										0				19						c.(1213-1215)cGc>cAc		lectin, mannose-binding, 1 like							77.0	71.0	73.0					15																	75115914		2197	4296	6493	SO:0001583	missense	79748	14	121412	42				g.chr15:75115914G>A	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.1214G>A	chr15.hg19:g.75115914G>A	ENSP00000310431:p.Arg405His	0					LMAN1L_ENST00000379709.3_Missense_Mutation_p.R393H|RP11-414J4.2_ENST00000564823.1_RNA|CPLX3_ENST00000395018.4_5'Flank	p.R405H	NM_021819.2	NP_068591.2	1	2	3	1.952518	Q9HAT1	LMA1L_HUMAN		12	1353	+			Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	0	1	hg19	c.1214G>A	CCDS10270.1	0	.	.	.	.	.	.	.	.	.	.	G	7.607	0.673992	0.14841	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.39406	1.11;1.08	5.18	-5.19	0.02832	5.18	-5.19	0.02832	.	1.400440	0.04515	N	0.383606	T	0.25158	0.0611	N	0.22421	0.69	0.25604	N	0.986564	B;B	0.14012	0.009;0.005	B;B	0.09377	0.004;0.002	T	0.18493	-1.0335	10	0.33940	T	0.23	.	6.2762	0.20981	0.2272:0.0:0.5161:0.2567	.	393;405	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	H	405;393	ENSP00000310431:R405H;ENSP00000369031:R393H	ENSP00000310431:R405H	R	+	2	0	0	LMAN1L	72902967	72902967	0.000000	0.05858	0.052000	0.19188	0.262000	0.26303	-0.908000	0.04063	-0.806000	0.04398	0.561000	0.74099	CGC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.557	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	3.280000	-3.068703	1	0.220000			0	5	5	0	374	368	0		1			0	0	61	0	0	0.935285	0	0	0	0	0	0	5	374
ACAN	176	broad.mit.edu	37	15	89388927	89388927	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr15:89388927G>A	ENST00000561243.1	+	6	1243	c.1243G>A	c.(1243-1245)Gag>Aag	p.E415K	ACAN_ENST00000352105.7_Missense_Mutation_p.E415K|ACAN_ENST00000558207.1_Missense_Mutation_p.E415K|ACAN_ENST00000559004.1_Missense_Mutation_p.E415K|ACAN_ENST00000439576.2_Missense_Mutation_p.E415K			P16112	PGCA_HUMAN	aggrecan	415					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCTGGAACCCGAGGAGCCCTT	0.612																																						ENST00000561243.1	1.000000	0.630000	1	7.800000e-01	0.970000	0.916758	0.970000	1.000000																										0				93						c.(1243-1245)Gag>Aag		aggrecan							59.0	69.0	65.0					15																	89388927		2138	4260	6398	SO:0001583	missense	176	2	121126	36				g.chr15:89388927G>A	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1243G>A	chr15.hg19:g.89388927G>A	ENSP00000453342:p.Glu415Lys	0					ACAN_ENST00000559004.1_Missense_Mutation_p.E415K|ACAN_ENST00000558207.1_Missense_Mutation_p.E415K|ACAN_ENST00000352105.7_Missense_Mutation_p.E415K|ACAN_ENST00000439576.2_Missense_Mutation_p.E415K	p.E415K			1	2	3	1.952518	P16112	PGCA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)	6	1243	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	1	1	hg19	c.1243G>A	CCDS53970.1	1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010026	0.35415	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02236	4.62;4.38	5.52	3.57	0.40892	5.52	3.57	0.40892	.	.	.	.	.	T	0.02494	0.0076	M	0.68952	2.095	0.09310	N	0.999998	P;P;P	0.43352	0.804;0.804;0.477	B;B;B	0.33392	0.124;0.163;0.032	T	0.38672	-0.9650	9	0.14252	T	0.57	-5.9214	6.9498	0.24538	0.0925:0.1781:0.7295:0.0	.	415;415;415	E7ENV9;E7EX88;Q6PID9	.;.;.	K	415	ENSP00000387356:E415K;ENSP00000341615:E415K	ENSP00000268134:E415K	E	+	1	0	0	ACAN	87189931	87189931	0.576000	0.26700	0.684000	0.30055	0.329000	0.28539	1.208000	0.32345	1.410000	0.46936	0.591000	0.81541	GAG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.612	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	1	0	1	2	2	2	2	0	0	0	0	42	42	42	40	1	3.280000	-3.017773	1	0.220000	NM_001135		0	21	21	0	198	196	0		1	0		0	0	42	0	0	0.999998	0	0	0	0	1	0	21	198
ZC3H7A	29066	broad.mit.edu	37	16	11859420	11859420	+	Silent	SNP	G	G	A	rs374785670		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr16:11859420G>A	ENST00000396516.2	-	13	1841	c.1644C>T	c.(1642-1644)ggC>ggT	p.G548G	ZC3H7A_ENST00000355758.4_Silent_p.G548G			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	548						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TTCCATTGCCGCCAAAGAAAG	0.453																																						ENST00000396516.2	0.220000	0.030000	1.600000e-01	6.000000e-02	0.100000	0.118155	0.100000	0.090000																										0				25						c.(1642-1644)ggC>ggT		zinc finger CCCH-type containing 7A		G		0,4394		0,0,2197	97.0	95.0	95.0		1644	1.0	1.0	16		95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZC3H7A	NM_014153.3		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		548/972	11859420	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	29066	1	121412	34				g.chr16:11859420G>A	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1644C>T	chr16.hg19:g.11859420G>A		0					ZC3H7A_ENST00000355758.4_Silent_p.G548G	p.G548G			1	2	3	1.970767	Q8IWR0	Z3H7A_HUMAN		13	1841	-			D3DUG5|Q9NPE9	Silent	SNP	ENST00000396516.2	0	1	hg19	c.1644C>T	CCDS10550.1	0																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.453	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	0	0	1	2	22	5	2	1	1	1	1	71	71	71	71	1	3.280000	-2.258984	0	0.220000	NM_014153		0	5	5	0	503	499	0		0	0		1	0	71	0	0	0.000601	1.979483e-03	0	0	0	61	0	5	503
IRX6	79190	broad.mit.edu	37	16	55361532	55361532	+	Nonsense_Mutation	SNP	C	C	T	rs554682141		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr16:55361532C>T	ENST00000290552.7	+	4	1780	c.448C>T	c.(448-450)Cga>Tga	p.R150*	IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	150					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						CGCCGGTCGCCGAAAGAACGC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		17281	0.001		0.0	False		,,,				2504	0.0					ENST00000290552.7	1.000000	0.380000	9.000000e-01	5.200000e-01	0.690000	0.710069	0.690000	1.000000																										0				33						c.(448-450)Cga>Tga		iroquois homeobox 6							71.0	57.0	62.0					16																	55361532		2198	4300	6498	SO:0001587	stop_gained	79190	2	121412	31				g.chr16:55361532C>T	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.448C>T	chr16.hg19:g.55361532C>T	ENSP00000290552:p.Arg150*	0					IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	p.R150*	NM_024335.2	NP_077311.2	1	2	3	1.953366	P78412	IRX6_HUMAN		4	1780	+			B2RN06|Q7Z2K0	Nonsense_Mutation	SNP	ENST00000290552.7	0	1	hg19	c.448C>T	CCDS32449.1	0	.	.	.	.	.	.	.	.	.	.	C	47	13.157336	0.99723	.	.	ENSG00000159387	ENST00000290552	.	.	.	6.08	-6.48	0.01896	6.08	-6.48	0.01896	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.7892	21.412	0.99953	0.7449:0.2551:0.0:0.0	.	.	.	.	X	150	.	ENSP00000290552:R150X	R	+	1	2	2	IRX6	53919033	53919033	0.747000	0.28283	0.913000	0.36048	0.165000	0.22458	1.262000	0.32992	-1.091000	0.03065	-0.989000	0.02550	CGA	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.577	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	1	0	1	2	2	2	2	0	0	0	0	31	31	31	30	1	3.280000	-15.938870	1	0.220000	NM_024335		0	12	12	0	166	164	0		1			0	0	31	0	0	0.999163	0	0	0	0	0	0	12	166
SETD6	79918	broad.mit.edu	37	16	58550831	58550831	+	Splice_Site	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr16:58550831C>T	ENST00000219315.4	+	5	841	c.791C>T	c.(790-792)gCg>gTg	p.A264V	SETD6_ENST00000418480.1_3'UTR|SETD6_ENST00000310682.2_Splice_Site_p.A240V|SETD6_ENST00000394266.4_Splice_Site_p.A195V			Q8TBK2	SETD6_HUMAN	SET domain containing 6	264	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						GAATACTCTGCGGTGAGTGGA	0.463																																						ENST00000219315.4	0.170000	0.020000	1.300000e-01	4.000000e-02	0.080000	0.092888	0.080000	0.090000																										0				7						c.(790-792)gCg>gTg		SET domain containing 6							181.0	180.0	180.0					16																	58550831		2198	4300	6498	SO:0001630	splice_region_variant	79918	0	0					g.chr16:58550831C>T	AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.792+1C>T	chr16.hg19:g.58550831C>T		0					SETD6_ENST00000394266.4_Splice_Site_p.A195V|SETD6_ENST00000418480.1_3'UTR|SETD6_ENST00000310682.2_Splice_Site_p.A240V	p.A264V			1	2	3	1.953366	Q8TBK2	SETD6_HUMAN		5	841	+			A8K380|B5ME38|Q9H787	Splice_Site	SNP	ENST00000219315.4	0	1	hg19	c.791C>T	CCDS54013.1	0	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295317	0.60086	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315	T;T;T	0.14022	2.54;2.54;2.54	5.42	4.46	0.54185	5.42	4.46	0.54185	SET domain (2);	0.231004	0.44097	D	0.000482	T	0.11965	0.0291	L	0.48642	1.525	0.36533	D	0.870835	P;P;P	0.42039	0.563;0.769;0.558	B;B;B	0.32724	0.039;0.151;0.023	T	0.17137	-1.0379	10	0.35671	T	0.21	-2.8694	14.3423	0.66636	0.1576:0.8424:0.0:0.0	.	240;264;240	E9PC53;Q8TBK2;Q8TBK2-2	.;SETD6_HUMAN;.	V	240;195;264	ENSP00000310082:A240V;ENSP00000377809:A195V;ENSP00000219315:A264V	ENSP00000219315:A264V	A	+	2	0	0	SETD6	57108332	57108332	0.966000	0.33281	0.999000	0.59377	0.365000	0.29674	2.801000	0.47908	1.237000	0.43756	0.491000	0.48974	GCG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.463	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	0	0	1	2	2	2	2	0	0	0	0	148	148	148	147	1	3.280000	-2.103654	0	0.220000	NM_024860	Missense_Mutation	0	5	5	0	642	640	0		1	0		0	0	148	0	0	0.937246	7.028587e-02	0	0	0	45	0	5	642
GLG1	2734	broad.mit.edu	37	16	74527016	74527016	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr16:74527016C>T	ENST00000422840.2	-	7	1072	c.1073G>A	c.(1072-1074)cGc>cAc	p.R358H	GLG1_ENST00000205061.5_Missense_Mutation_p.R358H|GLG1_ENST00000447066.2_Missense_Mutation_p.R347H	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	358					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CAGCTTTTGGCGGGTTGTAAG	0.443																																						ENST00000422840.2	0.260000	0.040000	1.900000e-01	8.000000e-02	0.130000	0.143460	0.130000	0.120000																										0				57						c.(1072-1074)cGc>cAc		golgi glycoprotein 1							137.0	123.0	128.0					16																	74527016		2198	4300	6498	SO:0001583	missense	2734	0	0					g.chr16:74527016C>T		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1073G>A	chr16.hg19:g.74527016C>T	ENSP00000405984:p.Arg358His	0					GLG1_ENST00000205061.5_Missense_Mutation_p.R358H|GLG1_ENST00000447066.2_Missense_Mutation_p.R347H	p.R358H	NM_001145667.1	NP_001139139.1	1	2	3	1.964395	Q92896	GSLG1_HUMAN		7	1072	-			B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	0	1	hg19	c.1073G>A	CCDS45527.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.459970	0.96240	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.82706	0.5095	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.83731	0.0198	9	0.72032	D	0.01	-3.7566	19.793	0.96468	0.0:1.0:0.0:0.0	.	358;358;347	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	H	358;347;358	.	ENSP00000205061:R358H	R	-	2	0	0	GLG1	73084517	73084517	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.564000	0.82326	2.744000	0.94065	0.655000	0.94253	CGC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.443	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	3.280000	-1.829765	0	0.220000	NM_012201		0	6	6	0	482	475	0		1	0		0	0	85	0	0	0.963582	2.739205e-01	0	0	0	72	0	6	482
CDH15	1013	broad.mit.edu	37	16	89251637	89251637	+	Missense_Mutation	SNP	G	G	C	rs371162466		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr16:89251637G>C	ENST00000289746.2	+	5	624	c.559G>C	c.(559-561)Gca>Cca	p.A187P		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	187	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GACGGACAACGCAGCGCTGCG	0.662																																						ENST00000289746.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999126	0.990000	1.000000																										0				18						c.(559-561)Gca>Cca		cadherin 15, type 1, M-cadherin (myotubule)							51.0	48.0	49.0					16																	89251637		2193	4293	6486	SO:0001583	missense	1013	0	0					g.chr16:89251637G>C	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.559G>C	chr16.hg19:g.89251637G>C	ENSP00000289746:p.Ala187Pro	0						p.A187P	NM_004933.2	NP_004924.1	1	2	3	1.964395	P55291	CAD15_HUMAN		5	624	+				Missense_Mutation	SNP	ENST00000289746.2	1	1	hg19	c.559G>C	CCDS10976.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090995	0.76756	.	.	ENSG00000129910	ENST00000289746	T	0.54675	0.56	4.76	4.76	0.60689	4.76	4.76	0.60689	Cadherin (4);Cadherin-like (1);	0.000000	0.52532	D	0.000065	T	0.80722	0.4677	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86687	0.1920	10	0.59425	D	0.04	.	16.5411	0.84385	0.0:0.0:1.0:0.0	.	187	P55291	CAD15_HUMAN	P	187	ENSP00000289746:A187P	ENSP00000289746:A187P	A	+	1	0	0	CDH15	87779138	87779138	1.000000	0.71417	0.840000	0.33206	0.279000	0.26890	9.248000	0.95456	2.187000	0.69744	0.462000	0.41574	GCA	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.662	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	3.280000	-20.000000	1	0.220000	NM_004933		0	16	16	0	74	74	1		1			0	0	15	0	0	0.999962	0	0	0	0	0	0	16	74
TTC19	54902	broad.mit.edu	37	17	15903527	15903527	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr17:15903527G>A	ENST00000261647.5	+	2	749	c.280G>A	c.(280-282)Gca>Aca	p.A94T	TTC19_ENST00000486880.2_Missense_Mutation_p.A215T|ZSWIM7_ENST00000472495.1_5'Flank|ZSWIM7_ENST00000399280.2_5'Flank|ZSWIM7_ENST00000399277.1_5'Flank|TTC19_ENST00000497842.2_3'UTR|ZSWIM7_ENST00000486655.1_5'Flank	NM_001271420.1|NM_017775.3	NP_001258349.1|NP_060245.3	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	94					cytokinesis (GO:0000910)|mitochondrial respiratory chain complex III assembly (GO:0034551)	centrosome (GO:0005813)|midbody (GO:0030496)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(2)|skin(1)|stomach(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CGAGGCCGAGGCAGAGATCAT	0.731																																						ENST00000261647.5	1.000000	0.810000	1	9.900000e-01	0.990000	0.987035	0.990000	1.000000																										0				5						c.(280-282)Gca>Aca		tetratricopeptide repeat domain 19							12.0	19.0	16.0					17																	15903527		2179	4260	6439	SO:0001583	missense	54902	0	0					g.chr17:15903527G>A	AK094819	CCDS11174.1, CCDS11174.2	17p11.2	2013-01-11			ENSG00000011295	ENSG00000011295		"""Tetratricopeptide (TTC) repeat domain containing"""	26006	protein-coding gene	gene with protein product		613814					Standard	NM_017775		Approved	FLJ20343, MGC19520	uc002gph.3	Q6DKK2	OTTHUMG00000059306	ENST00000261647.5:c.280G>A	chr17.hg19:g.15903527G>A	ENSP00000261647:p.Ala94Thr	1					TTC19_ENST00000486880.2_Missense_Mutation_p.A215T|ZSWIM7_ENST00000472495.1_5'Flank|ZSWIM7_ENST00000399277.1_5'Flank|ZSWIM7_ENST00000399280.2_5'Flank|ZSWIM7_ENST00000486655.1_5'Flank|TTC19_ENST00000497842.2_3'UTR	p.A94T	NM_001271420.1|NM_017775.3	NP_001258349.1|NP_060245.3	0	2	2	1.799994	Q6DKK2	TTC19_HUMAN		2	749	+			A8MZ52|B3KP62|B4DN65|Q2M248|Q7L3U8|Q9H6G3|Q9NXB2	Missense_Mutation	SNP	ENST00000261647.5	0	1	hg19	c.280G>A	CCDS11174.2	1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.688773	0.29962	.	.	ENSG00000011295	ENST00000261647;ENST00000555605;ENST00000395886	D	0.83419	-1.72	5.06	4.02	0.46733	5.06	4.02	0.46733	.	0.498025	0.19407	N	0.115021	T	0.74313	0.3700	L	0.28115	0.83	0.26820	N	0.968808	.	.	.	.	.	.	T	0.62210	-0.6902	8	0.14656	T	0.56	-9.3213	12.296	0.54847	0.0:0.1872:0.8128:0.0	.	.	.	.	T	94;215;94	ENSP00000261647:A94T	ENSP00000261647:A215T	A	+	1	0	0	TTC19	15844252	15844252	1.000000	0.71417	0.999000	0.59377	0.372000	0.29890	2.821000	0.48065	2.355000	0.79922	0.549000	0.68633	GCA	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.731	TTC19-001	NOVEL	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000131725.6	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	3.280000	-20.000000	1	0.220000	NM_017775		0	18	17	0	107	105	0		1	1		0	0	15	0	0	0.999986	9.771074e-01	0	9	0	31	0	18	107
FBXW10	10517	broad.mit.edu	37	17	18671872	18671872	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr17:18671872T>C	ENST00000395665.4	+	10	1951	c.1730T>C	c.(1729-1731)gTg>gCg	p.V577A	FBXW10_ENST00000395667.1_Missense_Mutation_p.V577A|FBXW10_ENST00000308799.4_Missense_Mutation_p.V606A|FBXW10_ENST00000301938.4_Missense_Mutation_p.V577A			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	577										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GAGGGAGCCGTGAAATGCCTG	0.527																																						ENST00000395665.4	0.370000	0.060000	2.800000e-01	1.100000e-01	0.180000	0.200883	0.180000	0.180000																										0				42						c.(1729-1731)gTg>gCg		F-box and WD repeat domain containing 10							129.0	120.0	123.0					17																	18671872		2203	4300	6503	SO:0001583	missense	10517	0	0					g.chr17:18671872T>C	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1730T>C	chr17.hg19:g.18671872T>C	ENSP00000379025:p.Val577Ala	0					FBXW10_ENST00000308799.4_Missense_Mutation_p.V606A|FBXW10_ENST00000301938.4_Missense_Mutation_p.V577A|FBXW10_ENST00000395667.1_Missense_Mutation_p.V577A	p.V577A			1	2	3	1.986990	Q5XX13	FBW10_HUMAN		10	1951	+			C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	0	1	hg19	c.1730T>C	CCDS11199.3	0	.	.	.	.	.	.	.	.	.	.	T	12.96	2.095926	0.36952	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	2.97	2.97	0.34412	2.97	2.97	0.34412	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.081272	0.49305	U	0.000154	D	0.86439	0.5933	M	0.90542	3.125	0.42816	D	0.993975	D;D;D;D	0.89917	0.999;0.998;0.997;1.0	D;D;D;D	0.83275	0.991;0.99;0.992;0.996	D	0.87673	0.2542	10	0.87932	D	0	.	9.3557	0.38164	0.0:0.0:0.0:1.0	.	577;606;577;577	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	A	577;606;577;577	ENSP00000379026:V577A;ENSP00000310382:V606A;ENSP00000306937:V577A;ENSP00000379025:V577A	ENSP00000306937:V577A	V	+	2	0	0	FBXW10	18612597	18612597	1.000000	0.71417	0.971000	0.41717	0.150000	0.21749	6.656000	0.74396	1.356000	0.45884	0.163000	0.16589	GTG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.527	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	0	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	3.280000	-3.274253	1	0.220000	NM_031456		0	5	5	0	292	288	0		1	0		0	0	40	0	0	0.935813	0	0	0	0	1	0	5	292
KCNJ12	3768	broad.mit.edu	37	17	21319100	21319100	+	Missense_Mutation	SNP	G	G	A	rs534524767	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr17:21319100G>A	ENST00000583088.1	+	3	1341	c.446G>A	c.(445-447)cGc>cAc	p.R149H	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R149H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	149					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TACGGGCTGCGCTGTGTGACG	0.642										Prostate(3;0.18)			.|||	5	0.000998403	0.0	0.0	5008	,	,		35116	0.0		0.0	False		,,,				2504	0.0051					ENST00000583088.1	0.740000	0.280000	6.200000e-01	3.700000e-01	0.480000	0.502480	0.480000	0.480000																										0				70						c.(445-447)cGc>cAc		potassium inwardly-rectifying channel, subfamily J, member 12	Dofetilide(DB00204)|Yohimbine(DB01392)						55.0	53.0	54.0					17																	21319100		2203	4300	6503	SO:0001583	missense	3768	43	121410	40				g.chr17:21319100G>A	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.446G>A	chr17.hg19:g.21319100G>A	ENSP00000463778:p.Arg149His	0	Prostate(3;0.18)				KCNJ12_ENST00000331718.5_Missense_Mutation_p.R149H	p.R149H	NM_021012.4	NP_066292.2	1	2	3	1.999556	Q14500	KCJ12_HUMAN		3	1341	+			O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	1	1	hg19	c.446G>A	CCDS11219.1	0	.	.	.	.	.	.	.	.	.	.	G	29.4	4.998856	0.93227	.	.	ENSG00000184185	ENST00000331718	D	0.97016	-4.21	5.32	5.32	0.75619	5.32	5.32	0.75619	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98735	0.9575	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99663	1.0994	10	0.87932	D	0	.	18.9979	0.92821	0.0:0.0:1.0:0.0	.	149	Q14500	IRK12_HUMAN	H	149	ENSP00000328150:R149H	ENSP00000328150:R149H	R	+	2	0	0	KCNJ12	21259693	21259693	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.690000	0.98676	2.496000	0.84212	0.655000	0.94253	CGC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.642	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	0	0	1	2	2	2	2	0	0	0	0	56	56	56	54	1	3.280000	-17.287860	1	0.220000	NM_021012		0	16	16	0	321	316	0		1			0	0	56	0	0	0.999930	0	0	0	0	0	0	16	321
GIT1	28964	broad.mit.edu	37	17	27908966	27908966	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr17:27908966C>T	ENST00000225394.3	-	5	850	c.602G>A	c.(601-603)cGc>cAc	p.R201H	RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000394869.3_Missense_Mutation_p.R201H|GIT1_ENST00000579937.1_Missense_Mutation_p.R201H|GIT1_ENST00000581348.1_Missense_Mutation_p.R201H	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	201					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		AATGGGTGTGCGGCCATTAAC	0.627																																					Colon(81;41 1719 20078 35068)	ENST00000225394.3	0.330000	0.050000	2.500000e-01	1.000000e-01	0.160000	0.179983	0.160000	0.150000																										0				9						c.(601-603)cGc>cAc		G protein-coupled receptor kinase interacting ArfGAP 1							67.0	55.0	59.0					17																	27908966		2203	4300	6503	SO:0001583	missense	28964	4	121356	35				g.chr17:27908966C>T	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.602G>A	chr17.hg19:g.27908966C>T	ENSP00000225394:p.Arg201His	0					GIT1_ENST00000394869.3_Missense_Mutation_p.R201H|GIT1_ENST00000579937.1_Missense_Mutation_p.R201H|GIT1_ENST00000581348.1_Missense_Mutation_p.R201H|RP11-68I3.2_ENST00000581474.1_RNA	p.R201H	NM_014030.3	NP_054749.2	1	2	3	1.999556	Q9Y2X7	GIT1_HUMAN		5	850	-			B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	ENST00000225394.3	0	1	hg19	c.602G>A	CCDS11250.1	0	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063141	0.76187	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.66460	-0.21;-0.21	5.11	5.11	0.69529	5.11	5.11	0.69529	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	L	0.45470	1.425	0.51012	D	0.999901	P;P;P;P	0.39250	0.665;0.482;0.538;0.538	B;B;B;B	0.37650	0.255;0.094;0.153;0.108	T	0.67381	-0.5685	10	0.56958	D	0.05	.	18.7075	0.91644	0.0:1.0:0.0:0.0	.	205;201;201;201	Q59FC3;Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;.;GIT1_HUMAN	H	201	ENSP00000225394:R201H;ENSP00000378338:R201H	ENSP00000225394:R201H	R	-	2	0	0	GIT1	24933092	24933092	0.094000	0.21725	1.000000	0.80357	0.999000	0.98932	0.947000	0.29082	2.826000	0.97356	0.655000	0.94253	CGC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.627	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	3.280000	-2.931837	1	0.220000	NM_014030		0	5	5	0	327	323	0		1	0		0	0	63	0	0	0.935993	2.537132e-01	0	0	0	54	0	5	327
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.830000	1	9.700000e-01	0.990000	0.984300	0.990000	1.000000	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	24185	GRCh37	CM010465|CM900211	TP53	M	rs121912651	c.(742-744)Cgg>Tgg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	7157	1	121412	37	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577539G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	chr17.hg19:g.7577539G>A	ENSP00000269305:p.Arg248Trp	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W	p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.799994	P04637	P53_HUMAN		7	931	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.742C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	2	TP53	7518264	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	3.280000	-2.598876	1	0.220000	NM_000546		0	37	37	0	256	253	1		1	1	1	0	0	70	631	0	1.000000	9.999188e-01	1	50	164	51	699	37	256
CACNA1G	8913	broad.mit.edu	37	17	48649968	48649968	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr17:48649968G>A	ENST00000359106.5	+	6	800	c.800G>A	c.(799-801)aGc>aAc	p.S267N	CACNA1G_ENST00000515765.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000514181.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000514079.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000442258.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000513964.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000507609.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000429973.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000507510.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000503485.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000513689.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000507896.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000507336.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000352832.5_Missense_Mutation_p.S267N|CACNA1G_ENST00000502264.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000510115.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000360761.4_Missense_Mutation_p.S267N|CACNA1G_ENST00000358244.5_Missense_Mutation_p.S267N|CACNA1G_ENST00000416767.4_Missense_Mutation_p.S267N|CACNA1G_ENST00000505165.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000510366.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000515411.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000514717.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000515165.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000512389.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000354983.4_Missense_Mutation_p.S267N	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	267					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GAGGATGAGAGCCCCTTCATC	0.667																																						ENST00000359106.5	1.000000	0.270000	1	4.800000e-01	0.770000	0.755070	0.770000	1.000000																										0				47						c.(799-801)aGc>aAc		calcium channel, voltage-dependent, T type, alpha 1G subunit	Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						19.0	21.0	20.0					17																	48649968		2083	4207	6290	SO:0001583	missense	8913	0	0					g.chr17:48649968G>A	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.800G>A	chr17.hg19:g.48649968G>A	ENSP00000352011:p.Ser267Asn	0					CACNA1G_ENST00000515411.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000354983.4_Missense_Mutation_p.S267N|CACNA1G_ENST00000507896.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000513689.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000352832.5_Missense_Mutation_p.S267N|CACNA1G_ENST00000515765.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000514717.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000429973.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000507336.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000505165.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000510115.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000514079.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000512389.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000514181.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000507609.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000360761.4_Missense_Mutation_p.S267N|CACNA1G_ENST00000515165.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000416767.4_Missense_Mutation_p.S267N|CACNA1G_ENST00000510366.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000502264.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000507510.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000358244.5_Missense_Mutation_p.S267N|CACNA1G_ENST00000503485.1_Missense_Mutation_p.S267N|CACNA1G_ENST00000442258.2_Missense_Mutation_p.S267N|CACNA1G_ENST00000513964.1_Missense_Mutation_p.S267N	p.S267N	NM_018896.4	NP_061496.2	1	2	3	2.005240	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)	6	800	+	Breast(11;6.7e-17)		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	0	1	hg19	c.800G>A	CCDS45730.1	0	.	.	.	.	.	.	.	.	.	.	g	5.134	0.210390	0.09757	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96522	-3.9;-3.9;-4.04;-3.84;-3.9;-3.91;-3.92;-4.01;-3.98;-3.99;-4.0;-3.87;-3.87;-3.94;-3.89;-3.85;-3.92;-3.89;-3.87;-3.92;-3.91;-3.87;-3.93;-3.87;-3.94;-3.94	5.36	4.37	0.52481	5.36	4.37	0.52481	Ion transport (1);	0.547135	0.21976	N	0.066369	D	0.85991	0.5826	N	0.03608	-0.345	0.24066	N	0.995992	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.001;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.15052	0.008;0.003;0.003;0.003;0.007;0.002;0.012;0.007;0.012;0.006;0.005;0.002;0.001;0.005;0.012;0.002;0.006;0.001;0.003;0.003;0.003;0.003;0.003;0.001;0.001;0.003	T	0.73662	-0.3912	10	0.02654	T	1	.	7.0875	0.25266	0.3255:0.0:0.6745:0.0	.	267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267;267	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	N	267	ENSP00000353990:S267N;ENSP00000339302:S267N;ENSP00000392390:S267N;ENSP00000347078:S267N;ENSP00000409759:S267N;ENSP00000425522:S267N;ENSP00000426261:S267N;ENSP00000425451:S267N;ENSP00000422407:S267N;ENSP00000426814:S267N;ENSP00000427238:S267N;ENSP00000423112:S267N;ENSP00000420918:S267N;ENSP00000426172:S267N;ENSP00000423045:S267N;ENSP00000427173:S267N;ENSP00000426098:S267N;ENSP00000425698:S267N;ENSP00000426232:S267N;ENSP00000423317:S267N;ENSP00000350979:S267N;ENSP00000352011:S267N;ENSP00000414388:S267N;ENSP00000423155:S267N;ENSP00000422268:S267N;ENSP00000421518:S267N	ENSP00000339302:S267N	S	+	2	0	0	CACNA1G	46004967	46004967	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.681000	0.46926	1.156000	0.42514	0.505000	0.49811	AGC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.667	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	3.280000	-8.875416	1	0.220000	NM_018896		0	4	4	0	52	51	0		1			0	0	16	0	0	0.888573	0	0	0	0	0	0	4	52
DSC1	1823	broad.mit.edu	37	18	28723623	28723623	+	Silent	SNP	A	A	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr18:28723623A>T	ENST00000257198.5	-	8	1332	c.1071T>A	c.(1069-1071)acT>acA	p.T357T	RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_Silent_p.T357T	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	357	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TACTCACAGAAGTTTCTGTGA	0.358																																						ENST00000257198.5	1.000000	0.560000	1	7.200000e-01	0.920000	0.881198	0.920000	1.000000																										0				53						c.(1069-1071)acT>acA		desmocollin 1							110.0	105.0	106.0					18																	28723623		2203	4300	6503	SO:0001819	synonymous_variant	1823	0	0					g.chr18:28723623A>T	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1071T>A	chr18.hg19:g.28723623A>T		0					DSC1_ENST00000257197.3_Silent_p.T357T|RP11-408H20.2_ENST00000581836.1_RNA	p.T357T	NM_024421.2	NP_077739.1	1	2	3	1.777217	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)	8	1332	-			Q9HB01	Silent	SNP	ENST00000257198.5	1	1	hg19	c.1071T>A	CCDS11894.1	1																																																																																								0.228487		TCGA-IB-A6UG-01A-32D-A33T-08	0.358	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	3.280000	-20.000000	1	0.220000	NM_004948, NM_024421		0	18	17	0	167	165	0		1			0	0	46	0	0	0.999984	0	0	0	0	0	0	18	167
NOL4	8715	broad.mit.edu	37	18	31685089	31685089	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr18:31685089C>T	ENST00000261592.5	-	3	747	c.450G>A	c.(448-450)gcG>gcA	p.A150A	NOL4_ENST00000269185.4_Silent_p.A36A|NOL4_ENST00000589544.1_Silent_p.A150A|NOL4_ENST00000538587.1_Silent_p.A76A|NOL4_ENST00000535475.1_5'UTR	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	150						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						ATCGTGTCACCGCTTCTCTTG	0.393																																						ENST00000261592.5	1.000000	0.330000	7.100000e-01	4.200000e-01	0.540000	0.580098	0.540000	0.520000																										0				51						c.(448-450)gcG>gcA		nucleolar protein 4							175.0	163.0	167.0					18																	31685089		2203	4299	6502	SO:0001819	synonymous_variant	8715	3	121410	35				g.chr18:31685089C>T	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.450G>A	chr18.hg19:g.31685089C>T		0					NOL4_ENST00000269185.4_Silent_p.A36A|NOL4_ENST00000589544.1_Silent_p.A150A|NOL4_ENST00000538587.1_Silent_p.A76A|NOL4_ENST00000535475.1_5'UTR	p.A150A	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	1	2	3	1.777217	O94818	NOL4_HUMAN		3	747	-			B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Silent	SNP	ENST00000261592.5	1	1	hg19	c.450G>A	CCDS11907.2	0																																																																																								0.228487		TCGA-IB-A6UG-01A-32D-A33T-08	0.393	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	76	1	3.280000	-2.188533	0	0.220000	NM_003787		0	19	19	0	314	311	0		1	0		0	0	77	0	0	0.999991	0	0	0	0	1	0	19	314
ZNF24	7572	broad.mit.edu	37	18	32920384	32920384	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr18:32920384G>A	ENST00000261332.6	-	2	410	c.231C>T	c.(229-231)tgC>tgT	p.C77C	ZNF24_ENST00000399061.3_Silent_p.C77C|ZNF24_ENST00000589881.1_Silent_p.C77C	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	77	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						GCCACAGACGGCAAAGTTCTC	0.537																																					Colon(42;769 913 8916 19469 46270)	ENST00000261332.6	1.000000	0.030000	1.500000e-01	5.000000e-02	0.090000	0.169772	0.090000	0.080000																										0				15						c.(229-231)tgC>tgT		zinc finger protein 24							104.0	106.0	105.0					18																	32920384		2203	4300	6503	SO:0001819	synonymous_variant	7572	0	0					g.chr18:32920384G>A	AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.231C>T	chr18.hg19:g.32920384G>A		0					ZNF24_ENST00000399061.3_Silent_p.C77C|ZNF24_ENST00000589881.1_Silent_p.C77C	p.C77C	NM_006965.2	NP_008896.2	1	2	3	1.777217	P17028	ZNF24_HUMAN		2	410	-			O14754|Q53YE4|Q6ICR5|Q8IZN4	Silent	SNP	ENST00000261332.6	0	1	hg19	c.231C>T	CCDS11912.1	0																																																																																								0.228487		TCGA-IB-A6UG-01A-32D-A33T-08	0.537	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255769.1	0	0	1	2	2	2	2	0	0	0	0	145	145	145	143	1	3.280000	-2.349021	0	0.220000	NM_006965		0	6	6	0	654	646	0		1	0		0	0	145	0	0	0.963745	3.353563e-02	0	0	0	26	0	6	654
SBNO2	22904	broad.mit.edu	37	19	1119153	1119153	+	Missense_Mutation	SNP	C	C	T	rs376023611		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:1119153C>T	ENST00000361757.3	-	14	1621	c.1384G>A	c.(1384-1386)Gcc>Acc	p.A462T	SBNO2_ENST00000438103.2_Missense_Mutation_p.A405T|SBNO2_ENST00000587024.1_Missense_Mutation_p.A462T	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	462					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCTCCATGGCGCCAACGCCC	0.667																																						ENST00000361757.3	1.000000	0.790000	1	9.900000e-01	0.990000	0.986764	0.990000	1.000000																										0				14						c.(1384-1386)Gcc>Acc		strawberry notch homolog 2 (Drosophila)		C	THR/ALA,THR/ALA	0,4382		0,0,2191	28.0	33.0	32.0		1213,1384	4.2	1.0	19		32	1,8557		0,1,4278	no	missense,missense	SBNO2	NM_001100122.1,NM_014963.2	58,58	0,1,6469	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging,probably-damaging	405/1310,462/1367	1119153	1,12939	2191	4279	6470	SO:0001583	missense	22904	1	120690	26				g.chr19:1119153C>T	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1384G>A	chr19.hg19:g.1119153C>T	ENSP00000354733:p.Ala462Thr	1					SBNO2_ENST00000438103.2_Missense_Mutation_p.A405T|SBNO2_ENST00000587024.1_Missense_Mutation_p.A462T	p.A462T	NM_014963.2	NP_055778.2	0	3	3	1.828633	Q9Y2G9	SBNO2_HUMAN		14	1621	-		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	0	1	hg19	c.1384G>A	CCDS45894.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368391	0.82463	0.0	1.17E-4	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	4.19	4.19	0.49359	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	D	0.85414	0.5691	M	0.92169	3.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.99;0.996;0.993	D	0.89565	0.3809	9	0.87932	D	0	-24.553	15.6769	0.77336	0.0:1.0:0.0:0.0	.	462;462;405	B4DV91;Q9Y2G9;Q9Y2G9-3	.;SBNO2_HUMAN;.	T	462;405;486	.	ENSP00000250872:A486T	A	-	1	0	0	SBNO2	1070153	1070153	1.000000	0.71417	0.986000	0.45419	0.416000	0.31233	7.514000	0.81750	2.160000	0.67779	0.462000	0.41574	GCC	0.278713		TCGA-IB-A6UG-01A-32D-A33T-08	0.667	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	3.280000	-16.892900	1	0.220000	NM_014963		0	9	9	0	51	51	1		1	1		0	0	14	0	0	0.995435	9.999649e-01	0	94	0	44	0	9	51
PIAS4	51588	broad.mit.edu	37	19	4033577	4033577	+	Splice_Site	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:4033577G>A	ENST00000262971.2	+	9	1256	c.1141G>A	c.(1141-1143)Ggg>Agg	p.G381R		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	381					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G381R(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CATCATCGACGGGTGAGCCCG	0.672																																						ENST00000262971.2	1.000000	0.640000	1	8.900000e-01	0.990000	0.956851	0.990000	1.000000																										1	Substitution - Missense(1)	p.G381R(1)	skin(1)	17						c.(1141-1143)Ggg>Agg		protein inhibitor of activated STAT, 4							19.0	18.0	18.0					19																	4033577		2199	4296	6495	SO:0001630	splice_region_variant	51588	0	0					g.chr19:4033577G>A	AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.1142+1G>A	chr19.hg19:g.4033577G>A		1						p.G381R	NM_015897.2	NP_056981.2	0	2	2	1.806944	Q8N2W9	PIAS4_HUMAN		9	1256	+			O75926|Q96G19|Q9UN16	Splice_Site	SNP	ENST00000262971.2	0	0	hg19	c.1141G>A	CCDS12118.1	1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732488	0.69189	.	.	ENSG00000105229	ENST00000262971	T	0.15487	2.42	3.95	3.95	0.45737	3.95	3.95	0.45737	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, MIZ-type (1);	0.000000	0.85682	U	0.000000	T	0.44871	0.1314	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.54721	-0.8251	10	0.87932	D	0	-26.8132	14.9977	0.71446	0.0:0.0:1.0:0.0	.	381	Q8N2W9	PIAS4_HUMAN	R	381	ENSP00000262971:G381R	ENSP00000262971:G381R	G	+	1	0	0	PIAS4	3984577	3984577	1.000000	0.71417	0.801000	0.32222	0.314000	0.28054	9.755000	0.98912	1.762000	0.52044	0.491000	0.48974	GGG	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.672	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457496.1	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	3.280000	-17.647890	1	0.220000	NM_015897	Missense_Mutation	0	10	9	0	65	64	1		1	1		0	0	10	0	0	0.997169	8.892844e-01	0	5	0	23	0	10	65
TSHZ3	57616	broad.mit.edu	37	19	31769759	31769759	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:31769759C>T	ENST00000240587.4	-	2	1267	c.940G>A	c.(940-942)Gcc>Acc	p.A314T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	314					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A314T(1)|p.A131T(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ATGATTTTGGCGGCGACAGGA	0.537																																						ENST00000240587.4	0.260000	0.050000	2.000000e-01	9.000000e-02	0.130000	0.149211	0.130000	0.120000																										2	Substitution - Missense(2)	p.A314T(1)|p.A131T(1)	large_intestine(2)	123						c.(940-942)Gcc>Acc		teashirt zinc finger homeobox 3							88.0	89.0	89.0					19																	31769759		2203	4300	6503	SO:0001583	missense	57616	2	121412	39				g.chr19:31769759C>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.940G>A	chr19.hg19:g.31769759C>T	ENSP00000240587:p.Ala314Thr	1						p.A314T	NM_020856.2	NP_065907.2	2	2	4	2.187476	Q63HK5	TSH3_HUMAN		2	1267	-	Esophageal squamous(110;0.226)		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	0	1	hg19	c.940G>A	CCDS12421.2	0	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.449292	0.01080	.	.	ENSG00000121297	ENST00000240587	T	0.11821	2.74	5.46	3.34	0.38264	5.46	3.34	0.38264	.	0.108055	0.64402	N	0.000007	T	0.07324	0.0185	N	0.16790	0.44	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.14587	-1.0467	10	0.07325	T	0.83	-21.948	11.5359	0.50636	0.0:0.8554:0.0:0.1446	.	314	Q63HK5	TSH3_HUMAN	T	314	ENSP00000240587:A314T	ENSP00000240587:A314T	A	-	1	0	0	TSHZ3	36461599	36461599	1.000000	0.71417	0.875000	0.34327	0.217000	0.24651	5.772000	0.68889	1.294000	0.44707	-0.150000	0.13652	GCC	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.537	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	0	0	1	2	2	2	2	0	0	0	0	108	108	108	104	1	3.280000	-1.817239	0	0.220000	NM_020856		0	7	7	0	584	564	0		1	0		0	0	108	0	0	0.978181	5.351609e-03	0	0	0	8	0	7	584
GRIK5	2901	broad.mit.edu	37	19	42546729	42546729	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:42546729C>T	ENST00000262895.3	-	11	1447	c.1448G>A	c.(1447-1449)gGc>gAc	p.G483D	GRIK5_ENST00000301218.4_Missense_Mutation_p.G483D|GRIK5_ENST00000593562.1_Missense_Mutation_p.G483D	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	483					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GCCAACCATGCCCGTCCAGGA	0.697																																						ENST00000262895.3	0.230000	0.040000	1.800000e-01	7.000000e-02	0.110000	0.127997	0.110000	0.120000																										0				35						c.(1447-1449)gGc>gAc		glutamate receptor, ionotropic, kainate 5							44.0	49.0	47.0					19																	42546729		2202	4297	6499	SO:0001583	missense	2901	0	0					g.chr19:42546729C>T		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1448G>A	chr19.hg19:g.42546729C>T	ENSP00000262895:p.Gly483Asp	1					GRIK5_ENST00000301218.4_Missense_Mutation_p.G483D|GRIK5_ENST00000593562.1_Missense_Mutation_p.G483D	p.G483D	NM_002088.4	NP_002079.3	2	2	4	2.187476	Q16478	GRIK5_HUMAN		11	1447	-		Prostate(69;0.059)	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	0	1	hg19	c.1448G>A	CCDS12595.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.610721	0.96637	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	D;D	0.95949	-3.86;-3.86	6.17	6.17	0.99709	6.17	6.17	0.99709	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.98760	0.9583	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99107	1.0845	10	0.87932	D	0	.	19.6509	0.95805	0.0:1.0:0.0:0.0	.	483	Q16478	GRIK5_HUMAN	D	483	ENSP00000262895:G483D;ENSP00000301218:G483D	ENSP00000262895:G483D	G	-	2	0	0	GRIK5	47238569	47238569	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.699000	0.84547	2.941000	0.99782	0.655000	0.94253	GGC	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.697	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	96	1	3.280000	-2.186031	0	0.220000			0	6	7	0	597	586	0		1	0		0	0	102	0	0	0.963070	2.195097e-03	0	0	0	6	0	6	597
CIC	23152	broad.mit.edu	37	19	42795450	42795450	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:42795450C>G	ENST00000575354.2	+	10	2570	c.2530C>G	c.(2530-2532)Cca>Gca	p.P844A	CIC_ENST00000572681.2_Missense_Mutation_p.P1753A|CIC_ENST00000160740.3_Missense_Mutation_p.P844A	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	844	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				TGCCCCAGCACCAGCCCCTGG	0.672			"""Mis, F, S"""		oligodendroglioma																																	ENST00000575354.2	0.650000	0.170000	5.100000e-01	2.500000e-01	0.370000	0.391759	0.370000	0.360000				Rec	yes			Rec	yes		19	19q13.2	19q13.2	23152	Mis, F, S	capicua homolog				O	O			oligodendroglioma		0				82						c.(2530-2532)Cca>Gca		capicua transcriptional repressor							16.0	17.0	17.0					19																	42795450		2168	4216	6384	SO:0001583	missense	23152	0	0					g.chr19:42795450C>G	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2530C>G	chr19.hg19:g.42795450C>G	ENSP00000458663:p.Pro844Ala	1					CIC_ENST00000160740.3_Missense_Mutation_p.P844A|CIC_ENST00000572681.2_Missense_Mutation_p.P1753A	p.P844A	NM_015125.3	NP_055940.3	2	2	4	2.187476	Q96RK0	CIC_HUMAN		10	2570	+		Prostate(69;0.00682)	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	1	1	hg19	c.2530C>G	CCDS12601.1	0	.	.	.	.	.	.	.	.	.	.	C	12.46	1.943409	0.34283	.	.	ENSG00000079432	ENST00000160740	.	.	.	5.16	1.44	0.22558	5.16	1.44	0.22558	.	.	.	.	.	T	0.23210	0.0561	N	0.08118	0	0.26798	N	0.96927	B	0.02656	0.0	B	0.04013	0.001	T	0.23583	-1.0184	8	0.87932	D	0	-1.575	9.4699	0.38835	0.1253:0.4976:0.3771:0.0	.	844	Q96RK0	CIC_HUMAN	A	844	.	ENSP00000160740:P844A	P	+	1	0	0	CIC	47487290	47487290	0.986000	0.35501	1.000000	0.80357	0.990000	0.78478	0.581000	0.23819	0.537000	0.28751	0.561000	0.74099	CCA	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.672	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2	0	0	1	2	2	2	2	0	0	0	0	47	47	47	45	1	3.280000	-10.017220	1	0.220000			0	8	8	0	243	240	0		1	1		0	0	47	0	0	0.989172	6.852046e-01	0	3	0	68	0	8	243
ZNF473	25888	broad.mit.edu	37	19	50548807	50548807	+	Silent	SNP	C	C	T	rs148474136	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:50548807C>T	ENST00000595661.1	+	6	1602	c.1107C>T	c.(1105-1107)caC>caT	p.H369H	CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000445728.3_Silent_p.H357H|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000391821.2_Silent_p.H369H|ZNF473_ENST00000270617.3_Silent_p.H369H			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	369	Interaction with SLBP/pre-mRNA complex.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		AGAAAACTCACGCTGCAAAAA	0.498																																						ENST00000595661.1	1.000000	0.260000	1	3.500000e-01	0.470000	0.563535	0.470000	0.420000																										0				37						c.(1105-1107)caC>caT		zinc finger protein 473		C	,	4,4402	8.1+/-20.4	0,4,2199	72.0	67.0	68.0		1107,1107	0.7	0.0	19	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ZNF473	NM_001006656.1,NM_015428.1	,	0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384	,	369/872,369/872	50548807	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	25888	11	121412	41				g.chr19:50548807C>T	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.1107C>T	chr19.hg19:g.50548807C>T		1					ZNF473_ENST00000391821.2_Silent_p.H369H|ZNF473_ENST00000270617.3_Silent_p.H369H|CTD-2126E3.3_ENST00000599410.1_RNA|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000445728.3_Silent_p.H357H	p.H369H			3	3	6	2.271201	Q8WTR7	ZN473_HUMAN		6	1602	+		all_neural(266;0.0459)|Ovarian(192;0.0728)	A8K8T7|Q9ULS9|Q9Y4Q7	Silent	SNP	ENST00000595661.1	1	1	hg19	c.1107C>T	CCDS33077.1	0																																																																																								0.399631		TCGA-IB-A6UG-01A-32D-A33T-08	0.498	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	3.280000	-15.080770	1	0.220000	XM_046390		0	16	17	0	429	427	0		1	0		0	0	66	0	0	0.999934	3.611762e-02	0	0	0	8	0	16	429
KLK15	55554	broad.mit.edu	37	19	51330167	51330167	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:51330167C>G	ENST00000598239.1	-	3	478	c.448G>C	c.(448-450)Gag>Cag	p.E150Q	KLK15_ENST00000596931.1_Missense_Mutation_p.E149Q|KLK15_ENST00000326856.4_Missense_Mutation_p.E149Q|KLK15_ENST00000416184.1_Intron|KLK15_ENST00000301421.2_Missense_Mutation_p.E150Q	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	150	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			SHNEPGTAGSPRSQ -> PLSSP (in Ref. 2). {ECO:0000305}.		extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		GTCCCAGGCTCGTTGTGGGAC	0.687																																					Pancreas(140;10 2513 7143 9246)	ENST00000598239.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				24						c.(448-450)Gag>Cag		kallikrein-related peptidase 15							28.0	30.0	29.0					19																	51330167		2202	4300	6502	SO:0001583	missense	55554	0	0					g.chr19:51330167C>G	AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.448G>C	chr19.hg19:g.51330167C>G	ENSP00000469315:p.Glu150Gln	1					KLK15_ENST00000596931.1_Missense_Mutation_p.E149Q|KLK15_ENST00000416184.1_Intron|KLK15_ENST00000326856.4_Missense_Mutation_p.E149Q|KLK15_ENST00000301421.2_Missense_Mutation_p.E150Q	p.E150Q	NM_017509.2	NP_059979.2	3	3	6	2.271201	Q9H2R5	KLK15_HUMAN		3	478	-		all_neural(266;0.057)	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	ENST00000598239.1	1	1	hg19	c.448G>C	CCDS12805.1	1	.	.	.	.	.	.	.	.	.	.	c	9.453	1.091027	0.20471	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.88741	-2.42	4.5	-5.03	0.02973	4.5	-5.03	0.02973	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.995620	0.02210	N	0.063038	T	0.81317	0.4797	N	0.14661	0.345	0.09310	N	1	B;B;B	0.25719	0.132;0.003;0.002	B;B;B	0.34652	0.187;0.013;0.004	T	0.69060	-0.5245	10	0.15952	T	0.53	.	12.5901	0.56437	0.0:0.1856:0.0:0.8144	.	150;149;150	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	Q	150	ENSP00000301421:E150Q	ENSP00000301421:E150Q	E	-	1	0	0	KLK15	56021979	56021979	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.363000	0.07593	-0.801000	0.04427	0.555000	0.69702	GAG	0.399631		TCGA-IB-A6UG-01A-32D-A33T-08	0.687	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465160.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	3.280000	-20.000000	1	0.220000	NM_017509		0	67	65	0	257	251	1		1			0	0	51	0	0	1.000000	0	0	0	0	0	0	67	257
SIGLEC5	8778	broad.mit.edu	37	19	52132769	52132769	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:52132769G>A	ENST00000534261.2	-	4	941	c.542C>T	c.(541-543)aCg>aTg	p.T181M	SIGLEC5_ENST00000570106.2_Missense_Mutation_p.T181M|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.T181M|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.T181M|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.T181M			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	181	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GGCATTCCCCGTCCAGGAGAA	0.657																																						ENST00000534261.2			0	0																														0				27						c.(541-543)aCg>aTg		sialic acid binding Ig-like lectin 5							10.0	11.0	11.0					19																	52132769		2179	4236	6415	SO:0001583	missense	8778	1	119122	29				g.chr19:52132769G>A	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.542C>T	chr19.hg19:g.52132769G>A	ENSP00000473238:p.Thr181Met						SIGLEC5_ENST00000429354.3_Missense_Mutation_p.T181M|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.T181M|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.T181M|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.T181M	p.T181M							O15389	SIGL5_HUMAN		4	941	-		all_neural(266;0.0726)		Missense_Mutation	SNP	ENST00000534261.2	0	1	hg19	c.542C>T	CCDS33088.1		.	.	.	.	.	.	.	.	.	.	g	2.485	-0.318873	0.05386	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.22743	1.94;1.94	3.83	-7.65	0.01281	3.83	-7.65	0.01281	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	3.012550	0.01183	N	0.007122	T	0.11067	0.0270	N	0.16266	0.395	0.09310	N	1	P	0.40660	0.726	B	0.39068	0.289	T	0.14364	-1.0475	10	0.15066	T	0.55	.	7.7193	0.28723	0.6524:0.0:0.1321:0.2155	.	181	O15389	SIGL5_HUMAN	M	181	ENSP00000222107:T181M;ENSP00000415200:T181M	ENSP00000222107:T181M	T	-	2	0	0	SIGLEC5	56824581	56824581	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.692000	0.00198	-2.466000	0.00533	-0.948000	0.02665	ACG			TCGA-IB-A6UG-01A-32D-A33T-08	0.657	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	0	0	1	2	2	2	2	0	0	0	0	19	19	19	28	1	3.280000	-19.863340	1	0.220000	NM_003830		0	25	14	0	65	44	0		1	0		0	0	19	0	0	0.999993	0	0	0	0	1	0	25	65
ZNF480	147657	broad.mit.edu	37	19	52817449	52817449	+	Missense_Mutation	SNP	C	C	T	rs201346974	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:52817449C>T	ENST00000595962.1	+	3	182	c.116C>T	c.(115-117)gCg>gTg	p.A39V	ZNF480_ENST00000334564.7_Missense_Mutation_p.A39V|ZNF480_ENST00000490272.1_Intron|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000335090.6_Intron	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	39	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		TTCTCTCAGGCGGAGTGGAAA	0.473													c|||	3	0.000599042	0.0	0.0	5008	,	,		16201	0.0		0.0	False		,,,				2504	0.0031					ENST00000595962.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999413	0.990000	1.000000																										0				12						c.(115-117)gCg>gTg		zinc finger protein 480		C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	179.0	149.0	159.0		116	0.9	0.3	19		159	0,8600		0,0,4300	no	missense	ZNF480	NM_144684.2	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	39/536	52817449	1,13005	2203	4300	6503	SO:0001583	missense	147657	0	0					g.chr19:52817449C>T	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.116C>T	chr19.hg19:g.52817449C>T	ENSP00000471754:p.Ala39Val	1					ZNF480_ENST00000334564.7_Missense_Mutation_p.A39V|ZNF480_ENST00000490272.1_Intron|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000335090.6_Intron	p.A39V	NM_144684.2	NP_653285.2	3	3	6	2.270755	Q8WV37	ZN480_HUMAN		3	182	+			Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	1	1	hg19	c.116C>T	CCDS12850.2	1	.	.	.	.	.	.	.	.	.	.	C	5.169	0.216831	0.09810	2.27E-4	0.0	ENSG00000198464	ENST00000354515;ENST00000468240;ENST00000334564	T;T	0.01725	4.67;4.67	2.04	0.945	0.19543	2.04	0.945	0.19543	Krueppel-associated box (4);	.	.	.	.	T	0.01695	0.0054	L	0.46157	1.445	0.22933	N	0.998546	P;B	0.40476	0.718;0.161	B;B	0.30782	0.038;0.12	T	0.47484	-0.9114	9	0.66056	D	0.02	.	6.0962	0.20021	0.7277:0.2723:0.0:0.0	.	39;39	F8WEZ9;Q8WV37	.;ZN480_HUMAN	V	61;39;39	ENSP00000417424:A39V;ENSP00000334164:A39V	ENSP00000334164:A39V	A	+	2	0	0	ZNF480	57509261	57509261	0.981000	0.34729	0.315000	0.25238	0.071000	0.16799	0.684000	0.25364	0.048000	0.15891	-0.602000	0.04101	GCG	0.399631		TCGA-IB-A6UG-01A-32D-A33T-08	0.473	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3	1	0	1	2	2	2	2	0	0	0	0	128	128	128	125	1	3.280000	-3.318794	1	0.220000	NM_144684		0	77	76	0	642	638	1		1	0		0	0	128	0	0	1.000000	8.982995e-01	0	0	0	35	0	77	642
ZNF549	256051	broad.mit.edu	37	19	58049499	58049499	+	Missense_Mutation	SNP	G	G	A	rs546163846		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:58049499G>A	ENST00000376233.3	+	4	1308	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H	ZNF549_ENST00000240719.3_Missense_Mutation_p.R363H|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000594943.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCCTATGACCGCATTCGACAC	0.433																																						ENST00000376233.3	1.000000	0.070000	1	1.300000e-01	0.230000	0.380765	0.230000	0.190000																										0				21						c.(1126-1128)cGc>cAc		zinc finger protein 549							67.0	63.0	64.0					19																	58049499		2203	4300	6503	SO:0001583	missense	256051	3	121412	37				g.chr19:58049499G>A	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.1127G>A	chr19.hg19:g.58049499G>A	ENSP00000365407:p.Arg376His	1					ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000240719.3_Missense_Mutation_p.R363H	p.R376H	NM_001199295.1	NP_001186224	3	3	6	2.271543	Q6P9A3	ZN549_HUMAN		4	1308	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	0	1	hg19	c.1127G>A	CCDS56106.1	0	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456252	0.43634	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.15139	2.45;2.45	2.64	-5.28	0.02755	2.64	-5.28	0.02755	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16471	0.0396	M	0.73598	2.24	0.09310	N	1	B;B	0.18863	0.0;0.031	B;B	0.12156	0.0;0.007	T	0.39623	-0.9605	9	0.87932	D	0	.	4.6998	0.12822	0.3606:0.0:0.142:0.4974	.	376;363	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	H	363;376	ENSP00000240719:R363H;ENSP00000365407:R376H	ENSP00000240719:R363H	R	+	2	0	0	ZNF549	62741311	62741311	0.001000	0.12720	0.000000	0.03702	0.575000	0.36095	0.804000	0.27098	-1.086000	0.03084	-0.350000	0.07774	CGC	0.399631		TCGA-IB-A6UG-01A-32D-A33T-08	0.433	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	3.280000	-2.794334	1	0.220000	NM_153263		0	5	5	0	319	314	0		1	0		0	0	58	0	0	0.935430	3.751610e-03	0	0	0	5	0	5	319
ZNF418	147686	broad.mit.edu	37	19	58437576	58437576	+	Missense_Mutation	SNP	C	C	T	rs373108176		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr19:58437576C>T	ENST00000396147.1	-	4	2264	c.1973G>A	c.(1972-1974)cGa>cAa	p.R658Q	ZNF418_ENST00000425570.3_Missense_Mutation_p.R679Q|ZNF418_ENST00000595830.1_Missense_Mutation_p.R658Q|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000599852.1_Missense_Mutation_p.R573Q	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	658					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		AGAAGAGCTTCGATGAAATGA	0.413																																						ENST00000396147.1	1.000000	0.160000	1	2.300000e-01	0.330000	0.460330	0.330000	0.290000																										0				31						c.(1972-1974)cGa>cAa		zinc finger protein 418		C	GLN/ARG	0,4404		0,0,2202	111.0	114.0	113.0		1973	-1.4	0.0	19		113	1,8597		0,1,4298	no	missense	ZNF418	NM_133460.1	43	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	658/677	58437576	1,13001	2202	4299	6501	SO:0001583	missense	147686	1	121408	40				g.chr19:58437576C>T	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.1973G>A	chr19.hg19:g.58437576C>T	ENSP00000379451:p.Arg658Gln	1					ZNF418_ENST00000425570.3_Missense_Mutation_p.R679Q|ZNF418_ENST00000595830.1_Missense_Mutation_p.R658Q|ZNF418_ENST00000599852.1_Missense_Mutation_p.R573Q|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank	p.R658Q	NM_133460.1	NP_597717.1	3	3	6	2.271543	Q8TF45	ZN418_HUMAN		4	2264	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	ENST00000396147.1	1	1	hg19	c.1973G>A	CCDS42642.1	0	.	.	.	.	.	.	.	.	.	.	.	3.656	-0.070523	0.07228	0.0	1.16E-4	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	T;T	0.07567	3.18;3.18	2.41	-1.42	0.08913	2.41	-1.42	0.08913	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02267	0.0070	N	0.02334	-0.595	0.09310	N	1	B	0.24132	0.098	B	0.10450	0.005	T	0.44283	-0.9338	9	0.02654	T	1	.	6.7371	0.23415	0.0:0.4089:0.0:0.5911	.	658	Q8TF45	ZN418_HUMAN	Q	658;679;624	ENSP00000379451:R658Q;ENSP00000407039:R679Q	ENSP00000379451:R658Q	R	-	2	0	0	ZNF418	63129388	63129388	0.000000	0.05858	0.000000	0.03702	0.831000	0.47069	-3.966000	0.00324	-0.253000	0.09514	0.313000	0.20887	CGA	0.399631		TCGA-IB-A6UG-01A-32D-A33T-08	0.413	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	0	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	3.280000	-2.649041	1	0.220000	NM_133460		0	13	13	0	505	499	0		1	0		0	0	79	0	0	0.999499	2.953536e-02	0	0	0	10	0	13	505
CHRNB2	1141	broad.mit.edu	37	1	154543680	154543680	+	Silent	SNP	C	C	T	rs201024705		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:154543680C>T	ENST00000368476.3	+	5	645	c.381C>T	c.(379-381)taC>taT	p.Y127Y		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	127					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	ACGGCATGTACGAGGTGTCCT	0.552																																						ENST00000368476.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				28						c.(379-381)taC>taT		cholinergic receptor, nicotinic, beta 2 (neuronal)	Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)						142.0	130.0	134.0					1																	154543680		2203	4300	6503	SO:0001819	synonymous_variant	1141	0	0					g.chr1:154543680C>T	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.381C>T	chr1.hg19:g.154543680C>T		1						p.Y127Y	NM_000748.2	NP_000739.1	0	5	5	2.256617	P17787	ACHB2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)	5	645	+	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Q9UEH9	Silent	SNP	ENST00000368476.3	1	1	hg19	c.381C>T	CCDS1070.1	1																																																																																								0.400138		TCGA-IB-A6UG-01A-32D-A33T-08	0.552	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	1	0	1	2	2	2	2	0	0	0	0	110	110	110	108	1	3.280000	-20.000000	1	0.220000	NM_000748		0	274	273	0	486	479	1		1	0		0	0	110	0	0	1.000000	0	0	0	0	1	0	274	486
NME7	29922	broad.mit.edu	37	1	169256604	169256604	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:169256604C>T	ENST00000367811.3	-	7	947	c.691G>A	c.(691-693)Gca>Aca	p.A231T	NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Missense_Mutation_p.A195T	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	231					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)	p.A231T(1)		central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					GCAGTGTTTGCCGGCCCACAA	0.358																																						ENST00000367811.3	1.000000	0.010000	1.300000e-01	4.000000e-02	0.080000	0.148931	0.080000	0.090000																										1	Substitution - Missense(1)	p.A231T(1)	kidney(1)	16						c.(691-693)Gca>Aca		NME/NM23 family member 7							220.0	216.0	217.0					1																	169256604		2203	4300	6503	SO:0001583	missense	29922	2	121410	33				g.chr1:169256604C>T	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.691G>A	chr1.hg19:g.169256604C>T	ENSP00000356785:p.Ala231Thr	1					NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Missense_Mutation_p.A195T	p.A231T	NM_013330.3	NP_037462.1	0	5	5	2.256617	Q9Y5B8	NDK7_HUMAN		7	947	-	all_hematologic(923;0.208)		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	ENST00000367811.3	0	1	hg19	c.691G>A	CCDS1277.1	0	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961854	0.34659	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.55413	0.52;0.52	4.57	3.65	0.41850	4.57	3.65	0.41850	.	0.526155	0.22030	N	0.065617	T	0.15565	0.0375	L	0.27053	0.805	0.29275	N	0.870411	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.001	T	0.09378	-1.0677	9	0.14252	T	0.57	-11.2605	7.7247	0.28753	0.0:0.8061:0.0:0.1939	.	235;231	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	T	195;231	ENSP00000433341:A195T;ENSP00000356785:A231T	ENSP00000356785:A231T	A	-	1	0	0	NME7	167523228	167523228	0.999000	0.42202	0.998000	0.56505	0.981000	0.71138	1.468000	0.35332	0.914000	0.36822	0.637000	0.83480	GCA	0.400138		TCGA-IB-A6UG-01A-32D-A33T-08	0.358	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083688.1	0	0	1	2	2	2	2	0	0	0	0	199	199	199	199	1	3.280000	-1.667255	0	0.220000	NM_013330		0	7	7	0	1121	1107	0		1	0		0	0	199	0	0	0.979703	5.615228e-02	0	0	0	52	0	7	1121
TMEM52	339456	broad.mit.edu	37	1	1849752	1849752	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:1849752G>A	ENST00000310991.3	-	4	296	c.289C>T	c.(289-291)Ccc>Tcc	p.P97S	TMEM52_ENST00000378602.3_Missense_Mutation_p.P82S	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	97						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACGTCGCAGGGCTGCCGTGCT	0.632																																						ENST00000310991.3	1.000000	0.590000	1	7.300000e-01	0.910000	0.882618	0.910000	1.000000																										0				3						c.(289-291)Ccc>Tcc		transmembrane protein 52							49.0	51.0	50.0					1																	1849752		2203	4299	6502	SO:0001583	missense	339456	1	121308	36				g.chr1:1849752G>A	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.289C>T	chr1.hg19:g.1849752G>A	ENSP00000311122:p.Pro97Ser	1					TMEM52_ENST00000378602.3_Missense_Mutation_p.P82S	p.P97S	NM_178545.3	NP_848640.1	2	2	4	1.841880	Q8NDY8	TMM52_HUMAN		4	296	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	Q4VXS6|Q6UX25	Missense_Mutation	SNP	ENST00000310991.3	1	1	hg19	c.289C>T	CCDS35.1	1	.	.	.	.	.	.	.	.	.	.	.	13.04	2.117061	0.37339	.	.	ENSG00000178821	ENST00000378602;ENST00000310991	T;T	0.56776	0.44;0.44	3.92	2.99	0.34606	3.92	2.99	0.34606	.	0.000000	0.52532	D	0.000072	T	0.57710	0.2072	M	0.68317	2.08	0.29515	N	0.853898	B;P	0.50819	0.06;0.939	B;P	0.50934	0.046;0.654	T	0.59542	-0.7435	10	0.72032	D	0.01	-26.7541	9.9162	0.41436	0.1049:0.0:0.8951:0.0	.	97;82	Q8NDY8;Q8NDY8-2	TMM52_HUMAN;.	S	82;97	ENSP00000367865:P82S;ENSP00000311122:P97S	ENSP00000311122:P97S	P	-	1	0	0	TMEM52	1839612	1839612	0.947000	0.32204	0.526000	0.27913	0.180000	0.23129	1.620000	0.36976	0.763000	0.33175	0.511000	0.50034	CCC	0.260664		TCGA-IB-A6UG-01A-32D-A33T-08	0.632	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	67	1	3.280000	-2.540643	1	0.220000	NM_178545		0	25	25	0	253	247	0		1	0		0	0	69	0	0	1.000000	9.997177e-01	0	0	0	132	0	25	253
TNR	7143	broad.mit.edu	37	1	175292513	175292513	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:175292513G>A	ENST00000367674.2	-	23	4765	c.4057C>T	c.(4057-4059)Cgg>Tgg	p.R1353W	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Missense_Mutation_p.R1353W			Q92752	TENR_HUMAN	tenascin R	1353					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AAGGACTGCCGTTTTCTCCCT	0.478																																						ENST00000367674.2	1.000000	0.730000	1	8.500000e-01	0.980000	0.942902	0.980000	1.000000																										0				177						c.(4057-4059)Cgg>Tgg		tenascin R							153.0	138.0	143.0					1																	175292513		2203	4300	6503	SO:0001583	missense	7143	0	0					g.chr1:175292513G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.4057C>T	chr1.hg19:g.175292513G>A	ENSP00000356646:p.Arg1353Trp	1					TNR_ENST00000263525.2_Missense_Mutation_p.R1353W|RP3-518E13.2_ENST00000569593.1_RNA	p.R1353W			0	5	5	2.256617	Q92752	TENR_HUMAN		23	4765	-	Renal(580;0.146)		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	1	1	hg19	c.4057C>T	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.823924	0.50739	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.29142	1.58;1.58	5.37	5.37	0.77165	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.45776	0.1359	L	0.47716	1.5	0.53005	D	0.99996	D	0.89917	1.0	D	0.63283	0.913	T	0.40213	-0.9575	10	0.87932	D	0	.	13.652	0.62316	0.0:0.0:0.8451:0.1549	.	1353	Q92752	TENR_HUMAN	W	1353;1353;1263	ENSP00000356646:R1353W;ENSP00000263525:R1353W	ENSP00000263525:R1353W	R	-	1	2	2	TNR	173559136	173559136	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	3.266000	0.51569	2.513000	0.84729	0.561000	0.74099	CGG	0.400138		TCGA-IB-A6UG-01A-32D-A33T-08	0.478	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	1	0	1	2	2	2	2	0	0	0	0	95	95	95	94	1	3.280000	-12.802390	1	0.220000	NM_003285		0	50	49	0	559	547	0		1			0	0	95	0	0	1.000000	0	0	0	0	0	0	50	559
NBPF3	84224	broad.mit.edu	37	1	21801427	21801427	+	Silent	SNP	A	A	G			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:21801427A>G	ENST00000318249.5	+	8	1325	c.975A>G	c.(973-975)aaA>aaG	p.K325K	NBPF3_ENST00000454000.2_Silent_p.K255K|NBPF3_ENST00000318220.6_Silent_p.K269K|NBPF3_ENST00000342104.5_Silent_p.K325K	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	325	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGAAGAAAAAGGGCCAGTGT	0.398																																						ENST00000318249.5	1.000000	0.020000	2.300000e-01	5.000000e-02	0.090000	0.234101	0.090000	0.070000																										0				20						c.(973-975)aaA>aaG		neuroblastoma breakpoint family, member 3							195.0	217.0	209.0					1																	21801427		2203	4300	6503	SO:0001819	synonymous_variant	84224	0	0					g.chr1:21801427A>G	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.975A>G	chr1.hg19:g.21801427A>G		0					NBPF3_ENST00000342104.5_Silent_p.K325K|NBPF3_ENST00000318220.6_Silent_p.K269K|NBPF3_ENST00000454000.2_Silent_p.K255K	p.K325K	NM_032264.3	NP_115640.1	1	2	3	1.821982	Q9H094	NBPF3_HUMAN		8	1325	+		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	0	1	hg19	c.975A>G	CCDS216.1	0																																																																																								0.237611		TCGA-IB-A6UG-01A-32D-A33T-08	0.398	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	137	137	137	137	1	3.280000	-2.239016	0	0.220000	NM_032264		0	5	5	0	604	599	0		1	0		0	0	137	0	0	0.936410	2.985218e-03	0	0	0	8	0	5	604
LAX1	54900	broad.mit.edu	37	1	203739994	203739994	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:203739994C>T	ENST00000442561.2	+	2	518	c.128C>T	c.(127-129)gCg>gTg	p.A43V	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.A27V	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	43					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)	p.A43V(1)		central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TCCGGGTTTGCGGGACTCCTC	0.483																																						ENST00000442561.2	1.000000	0.030000	2.000000e-01	7.000000e-02	0.120000	0.183170	0.120000	0.100000																										1	Substitution - Missense(1)	p.A43V(1)	endometrium(1)	24						c.(127-129)gCg>gTg		lymphocyte transmembrane adaptor 1							159.0	150.0	153.0					1																	203739994		2203	4300	6503	SO:0001583	missense	54900	1	121412	39				g.chr1:203739994C>T	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.128C>T	chr1.hg19:g.203739994C>T	ENSP00000406970:p.Ala43Val	1					LAX1_ENST00000367217.5_Missense_Mutation_p.A27V|LAX1_ENST00000367215.1_3'UTR	p.A43V	NM_017773.3	NP_060243.2	0	5	5	2.254602	Q8IWV1	LAX1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)	2	518	+	all_cancers(21;0.0915)		B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	0	1	hg19	c.128C>T	CCDS1441.2	0	.	.	.	.	.	.	.	.	.	.	C	5.080	0.200425	0.09652	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.38	1.43	0.22495	5.38	1.43	0.22495	.	0.327636	0.26007	N	0.026914	T	0.20210	0.0486	L	0.32530	0.975	0.09310	N	1	B;B	0.33379	0.41;0.201	B;B	0.28139	0.086;0.055	T	0.18147	-1.0346	9	0.17832	T	0.49	-3.1747	7.1389	0.25543	0.0:0.6291:0.0:0.3709	.	27;43	B7Z744;Q8IWV1	.;LAX1_HUMAN	V	43;27	.	ENSP00000356186:A27V	A	+	2	0	0	LAX1	202006617	202006617	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.145000	0.16157	0.013000	0.14918	-0.254000	0.11334	GCG	0.403168		TCGA-IB-A6UG-01A-32D-A33T-08	0.483	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	0	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	3.280000	-1.689357	0	0.220000	NM_017773		0	6	6	0	607	604	0		1	0		0	0	81	0	0	0.964575	8.697730e-04	0	0	0	4	0	6	607
EPHA8	2046	broad.mit.edu	37	1	22903359	22903359	+	Missense_Mutation	SNP	G	G	A	rs201689882	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:22903359G>A	ENST00000166244.3	+	3	881	c.809G>A	c.(808-810)cGg>cAg	p.R270Q	EPHA8_ENST00000374644.4_Missense_Mutation_p.R270Q|EPHA8_ENST00000538803.1_Missense_Mutation_p.R270Q	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	270	Cys-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAGGAGCGGCGGGATGCCTGT	0.677													G|||	2	0.000399361	0.0008	0.0	5008	,	,		13700	0.0		0.001	False		,,,				2504	0.0					ENST00000166244.3	1.000000	0.250000	1	3.800000e-01	0.560000	0.613626	0.560000	0.480000																										0				61						c.(808-810)cGg>cAg		EPH receptor A8							23.0	24.0	24.0					1																	22903359		2199	4296	6495	SO:0001583	missense	2046	1	121064	26				g.chr1:22903359G>A	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.809G>A	chr1.hg19:g.22903359G>A	ENSP00000166244:p.Arg270Gln	0					EPHA8_ENST00000538803.1_Missense_Mutation_p.R270Q|EPHA8_ENST00000374644.4_Missense_Mutation_p.R270Q	p.R270Q	NM_020526.3	NP_065387.1	1	2	3	1.821982	P29322	EPHA8_HUMAN		3	881	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	0	1	hg19	c.809G>A	CCDS225.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.89	1.773458	0.31411	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;D;D	0.97256	1.61;-4.31;-4.31	4.09	0.842	0.18927	4.09	0.842	0.18927	.	0.145914	0.44097	N	0.000490	D	0.92120	0.7502	L	0.41236	1.265	0.37767	D	0.926539	B;B	0.22851	0.003;0.076	B;B	0.15870	0.004;0.014	D	0.85467	0.1170	10	0.45353	T	0.12	.	3.7537	0.08576	0.3071:0.0:0.5103:0.1826	.	270;270	P29322;P29322-2	EPHA8_HUMAN;.	Q	270	ENSP00000166244:R270Q;ENSP00000363775:R270Q;ENSP00000440274:R270Q	ENSP00000166244:R270Q	R	+	2	0	0	EPHA8	22775946	22775946	0.735000	0.28153	0.998000	0.56505	0.990000	0.78478	1.043000	0.30316	0.358000	0.24211	0.442000	0.29010	CGG	0.237611		TCGA-IB-A6UG-01A-32D-A33T-08	0.677	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	0	0	1	2	2	2	2	0	0	0	0	24	24	24	22	1	3.280000	-2.896200	1	0.220000	NM_020526		0	8	8	0	141	134	0		1			0	0	24	0	0	0.987816	0	0	0	0	0	0	8	141
GJA4	2701	broad.mit.edu	37	1	35260163	35260163	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:35260163C>T	ENST00000342280.4	+	2	437	c.349C>T	c.(349-351)Ccg>Tcg	p.P117S		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	117					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GCGGGCACTGCCGGCCAAGGA	0.667																																						ENST00000342280.4	1.000000	0.060000	5.500000e-01	1.200000e-01	0.210000	0.333027	0.210000	0.160000																										0				14						c.(349-351)Ccg>Tcg		gap junction protein, alpha 4, 37kDa							25.0	28.0	27.0					1																	35260163		2203	4300	6503	SO:0001583	missense	2701	0	0					g.chr1:35260163C>T	M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.349C>T	chr1.hg19:g.35260163C>T	ENSP00000343676:p.Pro117Ser	0						p.P117S	NM_002060.2	NP_002051.2	1	2	3	1.821982	P35212	CXA4_HUMAN		2	437	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)	A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Missense_Mutation	SNP	ENST00000342280.4	0	1	hg19	c.349C>T	CCDS30669.1	0	.	.	.	.	.	.	.	.	.	.	C	2.482	-0.319516	0.05386	.	.	ENSG00000187513	ENST00000342280;ENST00000450137;ENST00000543143	D;D	0.97232	-4.27;-4.3	5.11	4.2	0.49525	5.11	4.2	0.49525	.	0.976137	0.08425	N	0.947757	D	0.93128	0.7812	L	0.29908	0.895	0.19300	N	0.999979	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.83316	-0.0020	10	0.13470	T	0.59	.	9.298	0.37827	0.0:0.7788:0.1446:0.0766	.	117;117	Q5JW71;P35212	.;CXA4_HUMAN	S	117	ENSP00000343676:P117S;ENSP00000409186:P117S	ENSP00000343676:P117S	P	+	1	0	0	GJA4	35032750	35032750	0.958000	0.32768	0.903000	0.35520	0.138000	0.21146	1.218000	0.32467	1.146000	0.42352	0.563000	0.77884	CCG	0.237611		TCGA-IB-A6UG-01A-32D-A33T-08	0.667	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011556.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	3.280000	-3.884781	1	0.220000	NM_002060		0	4	4	0	214	214	0		1	0		0	0	45	0	0	0.891170	1.025126e-01	0	0	0	23	0	4	214
PTPRF	5792	broad.mit.edu	37	1	44069169	44069169	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:44069169G>A	ENST00000359947.4	+	15	2763	c.2423G>A	c.(2422-2424)cGc>cAc	p.R808H	PTPRF_ENST00000438120.1_Missense_Mutation_p.R799H|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_Missense_Mutation_p.R808H|PTPRF_ENST00000422171.2_Missense_Mutation_p.R156H|PTPRF_ENST00000372413.3_Missense_Mutation_p.R799H	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	808	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GATGGTGCCCGCAGCAAGCCC	0.632																																						ENST00000359947.4	1.000000	0.060000	3.600000e-01	1.000000e-01	0.160000	0.292874	0.160000	0.140000																										0				72						c.(2422-2424)cGc>cAc		protein tyrosine phosphatase, receptor type, F							88.0	86.0	87.0					1																	44069169		2203	4300	6503	SO:0001583	missense	5792	1	121412	36				g.chr1:44069169G>A	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2423G>A	chr1.hg19:g.44069169G>A	ENSP00000353030:p.Arg808His	0					PTPRF_ENST00000438120.1_Missense_Mutation_p.R799H|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_Missense_Mutation_p.R808H|PTPRF_ENST00000372413.3_Missense_Mutation_p.R799H|PTPRF_ENST00000422171.2_Missense_Mutation_p.R156H	p.R808H	NM_002840.3	NP_002831.2	1	2	3	1.821982	P10586	PTPRF_HUMAN		15	2763	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	0	1	hg19	c.2423G>A	CCDS489.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.81|19.81	3.895738|3.895738	0.72639|0.72639	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000429895|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407	.|T;T;T;T;T;T	.|0.54279	.|2.28;0.58;2.28;0.58;0.58;0.59	4.79|4.79	4.79|4.79	0.61399|0.61399	4.79|4.79	4.79|4.79	0.61399|0.61399	.|Fibronectin, type III (3);Immunoglobulin-like fold (1);	.|0.000000	.|0.31660	.|N	.|0.007279	T|T	0.73682|0.73682	0.3618|0.3618	M|M	0.80422|0.80422	2.495|2.495	0.80722|0.80722	D|D	1|1	.|D;D;P;D;D	.|0.89917	.|1.0;1.0;0.88;1.0;1.0	.|D;D;B;D;D	.|0.97110	.|0.999;0.986;0.288;0.995;1.0	T|T	0.73007|0.73007	-0.4118|-0.4118	5|10	.|0.30854	.|T	.|0.27	.|.	18.2203|18.2203	0.89899|0.89899	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|455;156;567;799;808	.|Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586	.|.;.;.;.;PTPRF_HUMAN	T|H	456|808;799;808;799;156;62	.|ENSP00000353030:R808H;ENSP00000398822:R799H;ENSP00000361491:R808H;ENSP00000361490:R799H;ENSP00000387885:R156H;ENSP00000361484:R62H	.|ENSP00000353030:R808H	A|R	+|+	1|2	0|0	0|0	PTPRF|PTPRF	43841756|43841756	43841756|43841756	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	7.456000|7.456000	0.80751|0.80751	2.387000|2.387000	0.81309|0.81309	0.655000|0.655000	0.94253|0.94253	GCA|CGC	0.237611		TCGA-IB-A6UG-01A-32D-A33T-08	0.632	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1	0	0	1	2	2	2	2	0	0	0	0	94	94	94	93	1	3.280000	-2.533984	1	0.220000			0	7	7	0	451	444	0		1	0		0	0	94	0	0	0.979681	5.910966e-01	0	0	0	120	0	7	451
DEPDC1	55635	broad.mit.edu	37	1	68947194	68947194	+	Missense_Mutation	SNP	G	G	A	rs200248484		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:68947194G>A	ENST00000456315.2	-	9	1978	c.1864C>T	c.(1864-1866)Cgt>Tgt	p.R622C	DEPDC1_ENST00000370966.5_Missense_Mutation_p.R338C|RP4-694A7.2_ENST00000425820.1_RNA	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	622	Interaction with ZNF224.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		GAAATCATACGCATTAAAAGT	0.398																																						ENST00000456315.2	1.000000	0.380000	1	5.400000e-01	0.760000	0.764171	0.760000	1.000000																										0				13						c.(1864-1866)Cgt>Tgt		DEP domain containing 1							80.0	76.0	77.0					1																	68947194		2203	4299	6502	SO:0001583	missense	55635	3	121310	35				g.chr1:68947194G>A	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.1864C>T	chr1.hg19:g.68947194G>A	ENSP00000412292:p.Arg622Cys	0					DEPDC1_ENST00000370966.5_Missense_Mutation_p.R338C|RP4-694A7.2_ENST00000425820.1_RNA	p.R622C	NM_001114120.1	NP_001107592.1	1	2	3	1.821982	Q5TB30	DEP1A_HUMAN		9	1978	-			A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Missense_Mutation	SNP	ENST00000456315.2	1	1	hg19	c.1864C>T	CCDS44159.1	0	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635313	0.47049	.	.	ENSG00000024526	ENST00000456315;ENST00000370966	D;D	0.86627	-2.15;-2.15	5.72	4.78	0.61160	5.72	4.78	0.61160	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	D	0.92770	0.7701	M	0.83483	2.645	0.44539	D	0.997495	P;D	0.89917	0.793;1.0	B;D	0.87578	0.181;0.998	D	0.93210	0.6599	10	0.72032	D	0.01	-2.5002	15.1757	0.72910	0.0:0.0:0.7481:0.2519	.	622;338	Q5TB30;Q5TB30-2	DEP1A_HUMAN;.	C	622;338	ENSP00000412292:R622C;ENSP00000360005:R338C	ENSP00000360005:R338C	R	-	1	0	0	DEPDC1	68719782	68719782	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.266000	0.51569	2.691000	0.91804	0.655000	0.94253	CGT	0.237611		TCGA-IB-A6UG-01A-32D-A33T-08	0.398	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	3.280000	-5.355585	1	0.220000	NM_017779		0	10	10	0	124	122	0		1	1		0	0	30	0	0	0.997013	1.991898e-02	0	3	0	0	0	10	124
SUSD4	55061	broad.mit.edu	37	1	223465929	223465929	+	Silent	SNP	G	G	A	rs148470082	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr1:223465929G>A	ENST00000343846.3	-	2	846	c.213C>T	c.(211-213)agC>agT	p.S71S	SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000494793.2_Silent_p.S71S|SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000344029.6_Silent_p.S71S|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000366878.4_Silent_p.S71S			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	71	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		AAACCCCTCCGCTGGGGGTCC	0.498													G|||	9	0.00179712	0.0	0.0	5008	,	,		18555	0.0		0.0	False		,,,				2504	0.0092					ENST00000343846.3	1.000000	0.740000	1	8.700000e-01	0.990000	0.953533	0.990000	1.000000																										0				17						c.(211-213)agC>agT		sushi domain containing 4		G	,	0,4406		0,0,2203	63.0	73.0	70.0		213,213	-6.6	0.0	1	dbSNP_134	70	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	SUSD4	NM_001037175.2,NM_017982.3	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	71/291,71/491	223465929	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	55061	34	121412	46				g.chr1:223465929G>A	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.213C>T	chr1.hg19:g.223465929G>A		1					SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_Silent_p.S71S|SUSD4_ENST00000494793.2_Silent_p.S71S|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000344029.6_Silent_p.S71S	p.S71S			0	5	5	2.273711	Q5VX71	SUSD4_HUMAN		2	846	-			D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Silent	SNP	ENST00000343846.3	1	1	hg19	c.213C>T	CCDS41471.1	1																																																																																								0.403168		TCGA-IB-A6UG-01A-32D-A33T-08	0.498	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	1	0	1	2	2	2	2	0	0	0	0	88	88	88	86	1	3.280000	-11.933480	1	0.220000	NM_017982		0	43	41	0	466	463	0		1	1		0	0	88	0	0	1.000000	6.996838e-01	0	2	0	26	0	43	466
RIN2	54453	broad.mit.edu	37	20	19970910	19970910	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr20:19970910C>A	ENST00000255006.6	+	9	2319	c.2170C>A	c.(2170-2172)Ctg>Atg	p.L724M	RIN2_ENST00000440354.2_Missense_Mutation_p.L242M|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	675	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CATGCTGCTGCTGCGGGTCTG	0.557																																						ENST00000255006.6	1.000000	0.650000	1	8.600000e-01	0.990000	0.949536	0.990000	1.000000																										0				27						c.(2170-2172)Ctg>Atg		Ras and Rab interactor 2							44.0	45.0	45.0					20																	19970910		2065	4206	6271	SO:0001583	missense	54453	0	0					g.chr20:19970910C>A	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2170C>A	chr20.hg19:g.19970910C>A	ENSP00000255006:p.Leu724Met	0					RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.L242M	p.L724M	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	1	2	3	1.957393	Q8WYP3	RIN2_HUMAN		9	2319	+			Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	1	1	hg19	c.2170C>A	CCDS56182.1	1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845521	0.71603	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.36699	1.24;1.24	5.83	2.72	0.32119	5.83	2.72	0.32119	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.85682	D	0.000000	T	0.62490	0.2432	M	0.88704	2.975	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.64554	-0.6380	9	.	.	.	-20.4278	10.7252	0.46064	0.0:0.7838:0.0:0.2162	.	242;675	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	M	724;242	ENSP00000255006:L724M;ENSP00000391239:L242M	.	L	+	1	2	2	RIN2	19918910	19918910	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	1.382000	0.34374	0.313000	0.23062	-0.194000	0.12790	CTG	0.294501		TCGA-IB-A6UG-01A-32D-A33T-08	0.557	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	3.280000	-19.998580	1	0.220000			0	15	15	0	124	122	1		1	1		0	0	26	0	0	0.999891	9.772297e-01	0	8	0	47	0	15	124
INSM1	3642	broad.mit.edu	37	20	20349690	20349690	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr20:20349690C>T	ENST00000310227.1	+	1	926	c.779C>T	c.(778-780)gCg>gTg	p.A260V		NM_002196.2	NP_002187.1	Q01101	INSM1_HUMAN	insulinoma-associated 1	260					adrenal chromaffin cell differentiation (GO:0061104)|cell cycle (GO:0007049)|endocrine pancreas development (GO:0031018)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|noradrenergic neuron development (GO:0003358)|norepinephrine biosynthetic process (GO:0042421)|pancreatic A cell differentiation (GO:0003310)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of gene expression (GO:0010468)|regulation of protein complex assembly (GO:0043254)|sympathetic ganglion development (GO:0061549)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell differentiation (GO:0003309)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|cyclin binding (GO:0030332)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			liver(1)|lung(3)|ovary(1)|prostate(1)	6				READ - Rectum adenocarcinoma(2;0.0649)		gcggggggcgcggcgcggccg	0.716																																						ENST00000310227.1	1.000000	0.920000	1	9.900000e-01	0.990000	0.994963	0.990000	1.000000																										0				6						c.(778-780)gCg>gTg		insulinoma-associated 1							5.0	6.0	6.0					20																	20349690		1939	3835	5774	SO:0001583	missense	3642	1	114260	20				g.chr20:20349690C>T		CCDS13143.1	20p11.2	2012-07-10			ENSG00000173404	ENSG00000173404			6090	protein-coding gene	gene with protein product		600010				8188699, 16569215	Standard	NM_002196		Approved	IA-1, IA1	uc002wrx.3	Q01101	OTTHUMG00000032004	ENST00000310227.1:c.779C>T	chr20.hg19:g.20349690C>T	ENSP00000312631:p.Ala260Val	0						p.A260V	NM_002196.2	NP_002187.1	1	2	3	1.957393	Q01101	INSM1_HUMAN		1	926	+				Missense_Mutation	SNP	ENST00000310227.1	0	1	hg19	c.779C>T	CCDS13143.1	1	.	.	.	.	.	.	.	.	.	.	C	4.993	0.184394	0.09495	.	.	ENSG00000173404	ENST00000310227	T	0.00711	5.8	3.53	2.46	0.29980	3.53	2.46	0.29980	.	0.183785	0.33553	U	0.004798	T	0.00496	0.0016	N	0.12182	0.205	0.24619	N	0.993683	B	0.33103	0.397	B	0.20184	0.028	T	0.53906	-0.8372	10	0.41790	T	0.15	.	6.9677	0.24632	0.0:0.5981:0.2959:0.1059	.	260	Q01101	INSM1_HUMAN	V	260	ENSP00000312631:A260V	ENSP00000312631:A260V	A	+	2	0	0	INSM1	20297690	20297690	0.003000	0.15002	0.122000	0.21767	0.349000	0.29174	1.908000	0.39907	1.699000	0.51192	0.306000	0.20318	GCG	0.294501		TCGA-IB-A6UG-01A-32D-A33T-08	0.716	INSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078223.1	1	0	1	2	2	2	2	0	0	0	0	11	11	11	10	1	3.280000	-19.999610	1	0.220000	NM_002196		0	13	13	0	70	69	0		1			0	0	11	0	0	0.999655	0	0	0	0	0	0	13	70
DSCAM	1826	broad.mit.edu	37	21	41648061	41648061	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr21:41648061G>A	ENST00000400454.1	-	11	2796	c.2319C>T	c.(2317-2319)ggC>ggT	p.G773G		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	773	Ig-like C2-type 8.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGACGTCTGCGCCCACATCGT	0.483																																					Melanoma(134;970 1778 1785 21664 32388)	ENST00000400454.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999996	0.990000	1.000000																										0				142						c.(2317-2319)ggC>ggT		Down syndrome cell adhesion molecule							90.0	96.0	94.0					21																	41648061		2076	4253	6329	SO:0001819	synonymous_variant	1826	1	121034	35				g.chr21:41648061G>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2319C>T	chr21.hg19:g.41648061G>A		1						p.G773G	NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	0	2	2	1.779519	O60469	DSCAM_HUMAN		11	2796	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	O60468	Silent	SNP	ENST00000400454.1	1	1	hg19	c.2319C>T	CCDS42929.1	1																																																																																								0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.483	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	3.280000	-3.040396	1	0.220000	NM_001389		0	61	60	0	283	281	1		1			0	0	79	0	0	1.000000	0	0	0	0	0	0	61	283
COL6A1	1291	broad.mit.edu	37	21	47423408	47423408	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr21:47423408C>T	ENST00000361866.3	+	35	2682	c.2568C>T	c.(2566-2568)gcC>gcT	p.A856A	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	856	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		AGCGCCTGGCCGAGCGCTTCC	0.706																																						ENST00000361866.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.998783	0.990000	1.000000																										0				33						c.(2566-2568)gcC>gcT		collagen, type VI, alpha 1							17.0	20.0	19.0					21																	47423408		2188	4250	6438	SO:0001819	synonymous_variant	1291	14	120706	42				g.chr21:47423408C>T	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2568C>T	chr21.hg19:g.47423408C>T		1					COL6A1_ENST00000498614.1_3'UTR	p.A856A	NM_001848.2	NP_001839.2	0	2	2	1.779519	P12109	CO6A1_HUMAN		35	2682	+	all_hematologic(128;0.24)		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	ENST00000361866.3	1	1	hg19	c.2568C>T	CCDS13727.1	1																																																																																								0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.706	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	3.280000	-20.000000	1	0.220000	NM_001848		0	29	29	0	150	146	1		1	1		0	0	49	0	0	1.000000	1	0	7	0	246	0	29	150
POTEH	23784	broad.mit.edu	37	22	16279226	16279226	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr22:16279226C>A	ENST00000343518.6	-	4	1048	c.997G>T	c.(997-999)Gca>Tca	p.A333S	RNU6-816P_ENST00000390914.1_RNA|POTEH-AS1_ENST00000422014.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	333										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TTTAAATTTGCTTTTTTCTTG	0.323																																						ENST00000343518.6			0	0																														0				37						c.(997-999)Gca>Tca		POTE ankyrin domain family, member H																																				SO:0001583	missense	23784	0	0					g.chr22:16279226C>A	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.997G>T	chr22.hg19:g.16279226C>A	ENSP00000340610:p.Ala333Ser						POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	p.A333S	NM_001136213.1	NP_001129685.1					Q6S545	POTEH_HUMAN		4	1048	-			A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	0	1	hg19	c.997G>T	CCDS46658.1		.	.	.	.	.	.	.	.	.	.	.	12.84	2.059525	0.36373	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.61392	0.11	1.38	0.308	0.15815	1.38	0.308	0.15815	Ankyrin repeat-containing domain (4);	0.217456	0.22410	U	0.060437	T	0.70116	0.3187	M	0.82823	2.61	0.09310	N	1	D;D	0.76494	0.976;0.999	D;D	0.87578	0.91;0.998	T	0.58306	-0.7659	10	0.72032	D	0.01	.	3.5736	0.07926	0.0:0.7344:0.0:0.2656	.	333;296	Q6S545;A6NKF6	POTEH_HUMAN;.	S	296;333	ENSP00000340610:A333S	ENSP00000340610:A333S	A	-	1	0	0	POTEH	14659226	14659226	0.302000	0.24454	0.001000	0.08648	0.061000	0.15899	1.944000	0.40263	0.148000	0.19059	0.175000	0.17021	GCA			TCGA-IB-A6UG-01A-32D-A33T-08	0.323	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	0	0	1	2	2	2	2	0	0	0	0	408	408	408	424	1	3.280000	-3.221884	1	0.220000	NM_001136213		0	34	19	0	2461	1079	0		1			0	0	408	0	0	0.999968	0	0	0	0	0	0	34	2461
RSPH14	27156	broad.mit.edu	37	22	23406095	23406095	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr22:23406095G>A	ENST00000216036.4	-	5	834	c.638C>T	c.(637-639)gCg>gTg	p.A213V		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		213										breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		ATTAAGGAGCGCACGGGCGGC	0.632																																						ENST00000216036.4	0.380000	0.050000	2.800000e-01	1.000000e-01	0.170000	0.197542	0.170000	0.150000																										0				18						c.(637-639)gCg>gTg									68.0	61.0	64.0					22																	23406095		2203	4300	6503	SO:0001583	missense	0	1	121412	32				g.chr22:23406095G>A																												ENST00000216036.4:c.638C>T	chr22.hg19:g.23406095G>A	ENSP00000216036:p.Ala213Val	0						p.A213V	NM_014433.2	NP_055248.1	1	2	3	2.005848	Q9UHP6	RTDR1_HUMAN		5	834	-	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			Missense_Mutation	SNP	ENST00000216036.4	0	1	hg19	c.638C>T	CCDS13803.1	0	.	.	.	.	.	.	.	.	.	.	G	5.511	0.279316	0.10458	.	.	ENSG00000100218	ENST00000216036	T	0.54279	0.58	4.71	1.43	0.22495	4.71	1.43	0.22495	Armadillo-like helical (1);Armadillo-type fold (1);	1.325690	0.04962	N	0.462276	T	0.46521	0.1397	L	0.56769	1.78	0.09310	N	0.999997	B	0.29115	0.233	B	0.20384	0.029	T	0.22765	-1.0207	10	0.28530	T	0.3	-5.5588	6.8903	0.24226	0.3029:0.0:0.6971:0.0	.	213	Q9UHP6	RTDR1_HUMAN	V	213	ENSP00000216036:A213V	ENSP00000216036:A213V	A	-	2	0	0	RTDR1	21736095	21736095	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.081000	0.30791	0.169000	0.19679	0.555000	0.69702	GCG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.632	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1	0	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	3.280000	-5.063110	1	0.220000			0	4	4	0	247	243	0		1	0		0	0	49	0	0	0.887291	1.374886e-03	0	0	0	3	0	4	247
GNAZ	2781	broad.mit.edu	37	22	23438122	23438122	+	Silent	SNP	G	G	A	rs143475223		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr22:23438122G>A	ENST00000248996.4	+	2	906	c.240G>A	c.(238-240)tcG>tcA	p.S80S	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	80					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		CCATCGACTCGCTGACCCGCA	0.622																																						ENST00000248996.4	0.600000	0.360000	5.400000e-01	4.100000e-01	0.470000	0.484349	0.470000	0.480000																										0				19						c.(238-240)tcG>tcA		guanine nucleotide binding protein (G protein), alpha z polypeptide		G	,	1,4405	2.1+/-5.4	0,1,2202	155.0	160.0	158.0		240,	-8.1	0.9	22	dbSNP_134	158	0,8600		0,0,4300	no	coding-synonymous,intron	GNAZ,RTDR1	NM_002073.2,NM_014433.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	80/356,	23438122	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2781	7	121412	46				g.chr22:23438122G>A		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.240G>A	chr22.hg19:g.23438122G>A		0					RTDR1_ENST00000216036.4_Intron	p.S80S	NM_002073.2	NP_002064.1	1	2	3	2.005848	P19086	GNAZ_HUMAN		2	906	+	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		B2R6C1|Q4QRJ6	Silent	SNP	ENST00000248996.4	1	1	hg19	c.240G>A	CCDS13804.1	0																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.622	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	1	0	1	2	2	2	2	0	0	0	0	265	265	265	262	1	3.280000	-5.607851	1	0.220000	NM_002073		0	57	57	0	1147	1142	0		1	0		0	0	265	0	0	1.000000	0	0	0	0	1	0	57	1147
MYH9	4627	broad.mit.edu	37	22	36712651	36712651	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr22:36712651G>A	ENST00000216181.5	-	12	1521	c.1291C>T	c.(1291-1293)Ctg>Ttg	p.L431L	RN7SL349P_ENST00000582364.1_RNA	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	431	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TTGATGCGCAGCACCAGCCAG	0.607			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													ENST00000216181.5	0.230000	0.030000	1.700000e-01	6.000000e-02	0.110000	0.123459	0.110000	0.100000				Dom	yes			Dom	yes		22	22q13.1	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	yes	Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome	L	L	ALK		ALCL		0				86						c.(1291-1293)Ctg>Ttg		myosin, heavy chain 9, non-muscle							74.0	71.0	72.0					22																	36712651		2203	4300	6503	SO:0001819	synonymous_variant	4627	0	0		Hereditary Macrothrombocytopenia, MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	g.chr22:36712651G>A		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1291C>T	chr22.hg19:g.36712651G>A		0					RN7SL349P_ENST00000582364.1_RNA	p.L431L	NM_002473.4	NP_002464.1	1	2	3	2.005848	P35579	MYH9_HUMAN		12	1521	-			A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	0	1	hg19	c.1291C>T	CCDS13927.1	0																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.607	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	0	0	1	2	2	2	2	0	0	0	0	85	85	85	83	1	3.280000	-2.528261	1	0.220000	NM_002473		0	5	5	0	481	476	0		1	0		0	0	85	0	0	0.936133	9.167354e-01	0	0	0	432	0	5	481
MCHR1	2847	broad.mit.edu	37	22	41077637	41077637	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr22:41077637G>A	ENST00000249016.4	+	2	1670	c.974G>A	c.(973-975)cGc>cAc	p.R325H	MCHR1_ENST00000498400.1_3'UTR|MCHR1_ENST00000381433.2_Missense_Mutation_p.R199H	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	325					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						AGGGTGACCCGCACAGCCATC	0.617																																						ENST00000249016.4			0	0																														0				20						c.(973-975)cGc>cAc		melanin-concentrating hormone receptor 1							91.0	74.0	79.0					22																	41077637		2203	4300	6503	SO:0001583	missense	2847	4	121412	36				g.chr22:41077637G>A		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.974G>A	chr22.hg19:g.41077637G>A	ENSP00000249016:p.Arg325His						MCHR1_ENST00000498400.1_3'UTR|MCHR1_ENST00000381433.2_Missense_Mutation_p.R199H	p.R325H	NM_005297.3	NP_005288.3					Q99705	MCHR1_HUMAN		2	1670	+			B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	0	1	hg19	c.974G>A	CCDS14004.1		.	.	.	.	.	.	.	.	.	.	G	26.5	4.747866	0.89663	.	.	ENSG00000128285	ENST00000249016;ENST00000381433	T;T	0.40225	1.04;1.04	5.24	5.24	0.73138	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68805	0.3041	M	0.85630	2.765	0.51233	D	0.999918	D	0.89917	1.0	D	0.91635	0.999	T	0.73344	-0.4012	10	0.62326	D	0.03	.	16.6948	0.85332	0.0:0.0:1.0:0.0	.	325	Q99705	MCHR1_HUMAN	H	325;199	ENSP00000249016:R325H;ENSP00000370841:R199H	ENSP00000249016:R325H	R	+	2	0	0	MCHR1	39407583	39407583	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.679000	0.74513	2.607000	0.88179	0.655000	0.94253	CGC			TCGA-IB-A6UG-01A-32D-A33T-08	0.617	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	71	1	3.280000	-2.924391	1	0.220000	NM_005297		0	6	6	0	396	393	0		1			0	0	73	0	0	0.964433	0	0	0	0	0	0	6	396
MERTK	10461	broad.mit.edu	37	2	112785977	112785977	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:112785977A>G	ENST00000295408.4	+	19	2793	c.2536A>G	c.(2536-2538)Acc>Gcc	p.T846A	MERTK_ENST00000421804.2_Missense_Mutation_p.T846A|MERTK_ENST00000409780.1_Missense_Mutation_p.T670A			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	846	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						AGACCGCCCCACCTTTTCAGT	0.443																																						ENST00000295408.4	1.000000	0.600000	1	7.200000e-01	0.860000	0.859452	0.860000	1.000000																										0				46						c.(2536-2538)Acc>Gcc		MER proto-oncogene, tyrosine kinase							64.0	71.0	68.0					2																	112785977		2203	4300	6503	SO:0001583	missense	10461	0	0					g.chr2:112785977A>G	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2536A>G	chr2.hg19:g.112785977A>G	ENSP00000295408:p.Thr846Ala	0					MERTK_ENST00000421804.2_Missense_Mutation_p.T846A|MERTK_ENST00000409780.1_Missense_Mutation_p.T670A	p.T846A			1	2	3	1.949331	Q12866	MERTK_HUMAN		19	2793	+			Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	1	1	hg19	c.2536A>G	CCDS2094.1	1	.	.	.	.	.	.	.	.	.	.	A	11.42	1.634279	0.29068	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780;ENST00000449344	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.75	1.76	0.24704	5.75	1.76	0.24704	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.494897	0.14911	U	0.291237	T	0.60932	0.2307	M	0.64676	1.99	0.18873	N	0.999985	B	0.20988	0.05	B	0.25614	0.062	T	0.55617	-0.8113	10	0.62326	D	0.03	-7.7489	6.9481	0.24530	0.4709:0.126:0.0:0.4031	.	846	Q12866	MERTK_HUMAN	A	846;846;505;670;170	ENSP00000295408:T846A;ENSP00000389152:T846A;ENSP00000387277:T670A;ENSP00000412660:T170A	ENSP00000295408:T846A	T	+	1	0	0	MERTK	112502448	112502448	0.001000	0.12720	0.045000	0.18777	0.584000	0.36387	0.722000	0.25925	0.040000	0.15660	0.533000	0.62120	ACC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.443	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2	1	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	3.280000	-20.000000	1	0.220000			0	33	32	0	354	350	0		1	0		0	0	89	0	0	1.000000	4.149036e-02	0	0	0	4	0	33	354
SCN3A	6328	broad.mit.edu	37	2	166018859	166018859	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:166018859C>T	ENST00000360093.3	-	9	1481	c.990G>A	c.(988-990)ggG>ggA	p.G330G	SCN3A_ENST00000409101.3_Silent_p.G330G|SCN3A_ENST00000283254.7_Silent_p.G330G	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	330					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTCTTTTTGCCCATCCAAAA	0.294																																						ENST00000360093.3	0.160000	0.020000	1.200000e-01	4.000000e-02	0.070000	0.086016	0.070000	0.070000																										0				120						c.(988-990)ggG>ggA		sodium channel, voltage-gated, type III, alpha subunit	Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)						85.0	103.0	97.0					2																	166018859		2201	4299	6500	SO:0001819	synonymous_variant	6328	0	0					g.chr2:166018859C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.990G>A	chr2.hg19:g.166018859C>T		0					SCN3A_ENST00000283254.7_Silent_p.G330G|SCN3A_ENST00000409101.3_Silent_p.G330G	p.G330G	NM_001081677.1	NP_001075146.1	1	2	3	1.949331	Q9NY46	SCN3A_HUMAN		9	1481	-			Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	0	1	hg19	c.990G>A		0																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.294	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	144	144	144	142	1	3.280000	-1.698013	0	0.220000	NM_006922		0	6	6	0	811	799	0		1			0	0	144	0	0	0.963405	0	0	0	0	0	0	6	811
SCN2A	6326	broad.mit.edu	37	2	166245632	166245632	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:166245632C>T	ENST00000375437.2	+	27	5606	c.5316C>T	c.(5314-5316)atC>atT	p.I1772I	SCN2A_ENST00000357398.3_Silent_p.I1772I|SCN2A_ENST00000283256.6_Silent_p.I1772I|SCN2A_ENST00000375427.2_Silent_p.I1772I	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1772					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACATGTACATCGCGGTCATCC	0.443																																						ENST00000375437.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				118						c.(5314-5316)atC>atT		sodium channel, voltage-gated, type II, alpha subunit	Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)						101.0	102.0	101.0					2																	166245632		2202	4281	6483	SO:0001819	synonymous_variant	6326	0	0					g.chr2:166245632C>T	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5316C>T	chr2.hg19:g.166245632C>T		0					SCN2A_ENST00000357398.3_Silent_p.I1772I|SCN2A_ENST00000375427.2_Silent_p.I1772I|SCN2A_ENST00000283256.6_Silent_p.I1772I	p.I1772I	NM_001040142.1	NP_001035232.1	1	2	3	1.949331	Q99250	SCN2A_HUMAN		27	5606	+			A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	0	1	hg19	c.5316C>T	CCDS33314.1	1																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.443	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	1	0	1	2	2	2	2	0	0	0	0	126	126	126	151	1	3.280000	-20.000000	1	0.220000	NM_021007		0	114	104	0	442	397	1		1			0	0	126	0	0	1.000000	0	0	0	0	0	0	114	442
HECW2	57520	broad.mit.edu	37	2	197135945	197135945	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:197135945G>A	ENST00000260983.3	-	17	3489	c.3307C>T	c.(3307-3309)Cct>Tct	p.P1103S	HECW2_ENST00000409111.1_Missense_Mutation_p.P747S	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1103					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GTAAGATCAGGTTGACGCTCC	0.328																																						ENST00000260983.3	1.000000	0.630000	1	7.900000e-01	0.980000	0.920897	0.980000	1.000000																										0				113						c.(3307-3309)Cct>Tct		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2							86.0	83.0	84.0					2																	197135945		2203	4300	6503	SO:0001583	missense	57520	0	0					g.chr2:197135945G>A	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3307C>T	chr2.hg19:g.197135945G>A	ENSP00000260983:p.Pro1103Ser	0					HECW2_ENST00000409111.1_Missense_Mutation_p.P747S	p.P1103S	NM_020760.1	NP_065811.1	1	2	3	1.966308	Q9P2P5	HECW2_HUMAN		17	3489	-			B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	1	1	hg19	c.3307C>T	CCDS33354.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186065	0.78789	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.84660	-1.88;-1.88	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.85911	0.5807	L	0.51422	1.61	0.80722	D	1	D	0.57899	0.981	P	0.49140	0.601	T	0.82764	-0.0296	10	0.22706	T	0.39	.	19.8791	0.96888	0.0:0.0:1.0:0.0	.	1103	Q9P2P5	HECW2_HUMAN	S	747;1103	ENSP00000386775:P747S;ENSP00000260983:P1103S	ENSP00000260983:P1103S	P	-	1	0	0	HECW2	196844190	196844190	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.821000	0.99360	2.706000	0.92434	0.467000	0.42956	CCT	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.328	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	3.280000	-9.159397	1	0.220000	NM_020760		0	20	20	0	186	186	0		1	0		0	0	27	0	0	0.999996	0	0	0	0	1	0	20	186
CCDC108	255101	broad.mit.edu	37	2	219870881	219870881	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:219870881G>T	ENST00000341552.5	-	31	4867	c.4784C>A	c.(4783-4785)cCa>cAa	p.P1595Q	CCDC108_ENST00000453220.1_Missense_Mutation_p.P1595Q|CCDC108_ENST00000441968.1_Missense_Mutation_p.P1595Q|AC097468.4_ENST00000441450.1_RNA	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1595						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCCTCCTTTGGGGTCTGCAG	0.622																																						ENST00000341552.5	1.000000	0.750000	1	8.600000e-01	0.980000	0.949885	0.980000	1.000000																										0				80						c.(4783-4785)cCa>cAa		coiled-coil domain containing 108							56.0	64.0	61.0					2																	219870881		2203	4300	6503	SO:0001583	missense	255101	0	0					g.chr2:219870881G>T	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4784C>A	chr2.hg19:g.219870881G>T	ENSP00000340776:p.Pro1595Gln	0					CCDC108_ENST00000441968.1_Missense_Mutation_p.P1595Q|AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000453220.1_Missense_Mutation_p.P1595Q	p.P1595Q	NM_194302.2	NP_919278.2	1	2	3	1.966308	Q6ZU64	CC108_HUMAN		31	4867	-		Renal(207;0.0915)	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	1	1	hg19	c.4784C>A	CCDS2430.2	1	.	.	.	.	.	.	.	.	.	.	G	6.343	0.431430	0.12045	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04917	3.53;3.53;3.53	5.56	3.73	0.42828	5.56	3.73	0.42828	.	1.183400	0.06364	N	0.712220	T	0.08223	0.0205	L	0.48642	1.525	0.09310	N	1	B	0.19935	0.04	B	0.17979	0.02	T	0.42310	-0.9459	10	0.30854	T	0.27	0.573	8.21	0.31478	0.0809:0.3029:0.6162:0.0	.	1595	Q6ZU64	CC108_HUMAN	Q	1595	ENSP00000340776:P1595Q;ENSP00000413377:P1595Q;ENSP00000409117:P1595Q	ENSP00000340776:P1595Q	P	-	2	0	0	CCDC108	219579125	219579125	0.055000	0.20627	0.001000	0.08648	0.215000	0.24574	2.473000	0.45145	0.681000	0.31386	0.655000	0.94253	CCA	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.622	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	1	0	1	2	2	2	2	0	0	0	0	104	104	104	103	1	3.280000	-2.806910	1	0.220000	NM_194302		0	55	55	0	505	498	0		1			0	0	104	0	0	1.000000	0	0	0	0	0	0	55	505
TMEM198	130612	broad.mit.edu	37	2	220414551	220414551	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:220414551G>T	ENST00000344458.2	+	6	1643	c.1058G>T	c.(1057-1059)tGc>tTc	p.C353F	TMEM198_ENST00000373883.3_Missense_Mutation_p.C353F|RP11-256I23.1_ENST00000596829.1_RNA|MIR3132_ENST00000581997.1_RNA			Q66K66	TM198_HUMAN	transmembrane protein 198	353					multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CTGACAGCCTGCTCAGGCCCC	0.627																																						ENST00000344458.2	1.000000	0.600000	9.500000e-01	7.000000e-01	0.810000	0.825001	0.810000	1.000000																										0				16						c.(1057-1059)tGc>tTc		transmembrane protein 198							53.0	60.0	58.0					2																	220414551		2203	4300	6503	SO:0001583	missense	130612	0	0					g.chr2:220414551G>T	BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.1058G>T	chr2.hg19:g.220414551G>T	ENSP00000343507:p.Cys353Phe	0					RP11-256I23.1_ENST00000596829.1_RNA|MIR3132_ENST00000581997.1_RNA|TMEM198_ENST00000373883.3_Missense_Mutation_p.C353F	p.C353F			1	2	3	1.966308	Q66K66	TM198_HUMAN		6	1643	+		Renal(207;0.0376)		Missense_Mutation	SNP	ENST00000344458.2	1	1	hg19	c.1058G>T	CCDS33385.1	0	.	.	.	.	.	.	.	.	.	.	G	13.93	2.385363	0.42308	.	.	ENSG00000188760	ENST00000344458;ENST00000373883	.	.	.	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.567610	0.18237	N	0.147345	T	0.41442	0.1159	N	0.08118	0	0.42499	D	0.992924	B	0.29909	0.261	B	0.28139	0.086	T	0.41288	-0.9517	9	0.46703	T	0.11	-22.6022	18.6999	0.91617	0.0:0.0:1.0:0.0	.	353	Q66K66	TM198_HUMAN	F	353	.	ENSP00000343507:C353F	C	+	2	0	0	TMEM198	220122795	220122795	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.327000	0.52045	2.824000	0.97209	0.655000	0.94253	TGC	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.627	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	1	0	0	2	2	2	2	0	0	0	0	102	102	102	100	1	3.280000	-20.000000	1	0.220000	NM_001005209		0	42	42	0	476	474	0		1	0		0	0	102	0	0	1.000000	4.697136e-01	0	1	0	18	0	42	476
SPHKAP	80309	broad.mit.edu	37	2	228996774	228996774	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:228996774G>A	ENST00000392056.3	-	2	106	c.60C>T	c.(58-60)gaC>gaT	p.D20D	SPHKAP_ENST00000344657.5_Silent_p.D20D	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	20						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GTTCCAAAACGTCATACATCC	0.463																																						ENST00000392056.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999214	0.990000	1.000000																										0				185						c.(58-60)gaC>gaT		SPHK1 interactor, AKAP domain containing							90.0	92.0	91.0					2																	228996774		2203	4300	6503	SO:0001819	synonymous_variant	80309	0	0					g.chr2:228996774G>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.60C>T	chr2.hg19:g.228996774G>A		0					SPHKAP_ENST00000344657.5_Silent_p.D20D	p.D20D	NM_001142644.1	NP_001136116.1	1	2	3	1.966308	Q2M3C7	SPKAP_HUMAN		2	106	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	1	1	hg19	c.60C>T	CCDS46537.1	1																																																																																								0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.463	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	3.280000	-19.999120	1	0.220000	NM_030623		0	55	55	0	364	360	1		1			0	0	73	0	0	1.000000	0	0	0	0	0	0	55	364
POMC	5443	broad.mit.edu	37	2	25384428	25384428	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:25384428G>A	ENST00000405623.1	-	3	781	c.326C>T	c.(325-327)gCg>gTg	p.A109V	POMC_ENST00000395826.2_Missense_Mutation_p.A109V|RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000380794.1_Missense_Mutation_p.A109V|POMC_ENST00000264708.3_Missense_Mutation_p.A109V			P01189	COLI_HUMAN	proopiomelanocortin	109					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	GTCTTCGCCCGCTGAGACGTC	0.721																																					Colon(110;1515 1566 8452 10082 43216)	ENST00000405623.1	1.000000	0.780000	1	9.900000e-01	0.990000	0.986281	0.990000	1.000000																										0				12						c.(325-327)gCg>gTg		proopiomelanocortin	Loperamide(DB00836)						5.0	6.0	6.0					2																	25384428		2048	3950	5998	SO:0001583	missense	5443	0	0					g.chr2:25384428G>A		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.326C>T	chr2.hg19:g.25384428G>A	ENSP00000384092:p.Ala109Val	0					POMC_ENST00000264708.3_Missense_Mutation_p.A109V|RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000395826.2_Missense_Mutation_p.A109V|POMC_ENST00000380794.1_Missense_Mutation_p.A109V	p.A109V			1	2	3	1.949331	P01189	COLI_HUMAN		3	781	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		P78442|Q53T23|Q9UD39|Q9UD40	Missense_Mutation	SNP	ENST00000405623.1	0	1	hg19	c.326C>T	CCDS1717.1	1	.	.	.	.	.	.	.	.	.	.	G	6.712	0.500039	0.12762	.	.	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	T;T;T;T;T	0.79554	-1.27;-1.27;-1.27;-1.27;-1.28	4.67	-2.23	0.06930	4.67	-2.23	0.06930	.	0.794205	0.10616	N	0.653875	T	0.50633	0.1627	N	0.03050	-0.425	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.37361	-0.9709	10	0.39692	T	0.17	-10.6454	1.6553	0.02780	0.3084:0.2269:0.3493:0.1154	.	109	P01189	COLI_HUMAN	V	109	ENSP00000370171:A109V;ENSP00000384092:A109V;ENSP00000264708:A109V;ENSP00000379170:A109V;ENSP00000387993:A109V	ENSP00000264708:A109V	A	-	2	0	0	POMC	25237932	25237932	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.224000	0.17738	-0.089000	0.12484	0.462000	0.41574	GCG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.721	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	3.280000	-19.953260	1	0.220000	NM_001035256		0	9	9	0	51	49	0		1	0		0	0	10	0	0	0.994642	1.298963e-01	0	0	0	4	0	9	51
KIF1A	547	broad.mit.edu	37	2	241679772	241679772	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr2:241679772C>T	ENST00000320389.7	-	34	3614	c.3456G>A	c.(3454-3456)ccG>ccA	p.P1152P	KIF1A_ENST00000498729.2_Silent_p.P1253P	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1152					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCACCACGGCCGGGATGTAAC	0.652																																						ENST00000320389.7	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				66						c.(3454-3456)ccG>ccA		kinesin family member 1A							64.0	73.0	70.0					2																	241679772		2053	4188	6241	SO:0001819	synonymous_variant	547	5	121014	36				g.chr2:241679772C>T	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.3456G>A	chr2.hg19:g.241679772C>T		0					KIF1A_ENST00000498729.2_Silent_p.P1253P	p.P1152P	NM_004321.6	NP_004312.2	1	2	3	1.966308	Q12756	KIF1A_HUMAN		34	3614	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	1	1	hg19	c.3456G>A	CCDS46561.1	1	.	.	.	.	.	.	.	.	.	.	C	8.323	0.824643	0.16678	.	.	ENSG00000130294	ENST00000431776	.	.	.	4.3	-8.6	0.00889	4.3	-8.6	0.00889	.	.	.	.	.	T	0.32466	0.0830	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38628	-0.9652	4	.	.	.	.	0.4882	0.00559	0.3187:0.2189:0.1339:0.3285	.	.	.	.	Q	76	.	.	R	-	2	0	0	KIF1A	241328445	241328445	0.000000	0.05858	0.332000	0.25469	0.904000	0.53231	-1.756000	0.01813	-2.439000	0.00551	-1.728000	0.00702	CGG	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.652	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	1	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	3.280000	-5.023670	1	0.220000	NM_138483		0	73	71	0	216	213	1		1	0		0	0	55	0	0	1.000000	8.747266e-01	0	0	0	13	0	73	216
TRANK1	9881	broad.mit.edu	37	3	36896676	36896676	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr3:36896676T>C	ENST00000429976.2	-	12	4652	c.4405A>G	c.(4405-4407)Agg>Ggg	p.R1469G	TRANK1_ENST00000301807.6_Missense_Mutation_p.R919G|TRANK1_ENST00000428977.2_Missense_Mutation_p.R919G	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1469							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GAGTGGGACCTGTAATTCTGG	0.527																																						ENST00000429976.2	1.000000	0.070000	4.000000e-01	1.400000e-01	0.240000	0.292329	0.240000	0.200000																										0				73						c.(4405-4407)Agg>Ggg		tetratricopeptide repeat and ankyrin repeat containing 1							55.0	53.0	54.0					3																	36896676		1970	4162	6132	SO:0001583	missense	9881	0	0					g.chr3:36896676T>C	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4405A>G	chr3.hg19:g.36896676T>C	ENSP00000416168:p.Arg1469Gly	1					TRANK1_ENST00000428977.2_Missense_Mutation_p.R919G|TRANK1_ENST00000301807.6_Missense_Mutation_p.R919G	p.R1469G	NM_014831.2	NP_055646.2	2	2	4	2.111415	O15050	TRNK1_HUMAN		12	4652	-			Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	0	1	hg19	c.4405A>G	CCDS46789.2	0	.	.	.	.	.	.	.	.	.	.	T	18.87	3.714865	0.68844	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	D;D;D	0.98090	-4.71;-4.71;-4.71	5.54	2.99	0.34606	5.54	2.99	0.34606	.	0.000000	0.64402	D	0.000006	D	0.98248	0.9420	M	0.72894	2.215	0.42207	D	0.99179	D	0.89917	1.0	D	0.83275	0.996	D	0.98977	1.0803	10	0.87932	D	0	.	13.4212	0.60998	0.0:0.0:0.304:0.696	.	1469	O15050	TRNK1_HUMAN	G	919;1469;919	ENSP00000416826:R919G;ENSP00000416168:R1469G;ENSP00000301807:R919G	ENSP00000301807:R919G	R	-	1	2	2	TRANK1	36871680	36871680	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.445000	0.21677	1.021000	0.39600	0.459000	0.35465	AGG	0.354839		TCGA-IB-A6UG-01A-32D-A33T-08	0.527	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	3.280000	-3.272842	1	0.220000	NM_014831		0	4	4	0	200	198	0		1	0		0	0	33	0	0	0.888885	1.320877e-02	0	0	0	7	0	4	200
PDZRN3	23024	broad.mit.edu	37	3	73433515	73433515	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr3:73433515G>A	ENST00000263666.4	-	10	2316	c.2202C>T	c.(2200-2202)gaC>gaT	p.D734D	PDZRN3_ENST00000462146.2_Silent_p.D391D|PDZRN3_ENST00000466780.1_Silent_p.D391D|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000479530.1_Silent_p.D451D|PDZRN3_ENST00000535920.1_Silent_p.D456D	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	734					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GTCTGCGCACGTCGATGCTGG	0.612																																						ENST00000263666.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				69						c.(2200-2202)gaC>gaT		PDZ domain containing ring finger 3							52.0	46.0	48.0					3																	73433515		2203	4300	6503	SO:0001819	synonymous_variant	23024	0	0					g.chr3:73433515G>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2202C>T	chr3.hg19:g.73433515G>A		1					PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Silent_p.D456D|PDZRN3_ENST00000466780.1_Silent_p.D391D|PDZRN3_ENST00000479530.1_Silent_p.D451D|PDZRN3_ENST00000462146.2_Silent_p.D391D	p.D734D	NM_015009.1	NP_055824.1	2	2	4	2.111415	Q9UPQ7	PZRN3_HUMAN		10	2316	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	1	1	hg19	c.2202C>T	CCDS33789.1	1																																																																																								0.354839		TCGA-IB-A6UG-01A-32D-A33T-08	0.612	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	3.280000	-20.000000	1	0.220000	XM_041363		0	49	49	0	203	201	1		1	0		0	0	58	0	0	1.000000	6.100392e-01	0	0	0	10	0	49	203
PDZRN3	23024	broad.mit.edu	37	3	73434878	73434878	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr3:73434878T>C	ENST00000263666.4	-	9	1691	c.1577A>G	c.(1576-1578)gAc>gGc	p.D526G	PDZRN3_ENST00000462146.2_Missense_Mutation_p.D183G|PDZRN3_ENST00000466780.1_Missense_Mutation_p.D183G|PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000479530.1_Missense_Mutation_p.D243G|PDZRN3_ENST00000535920.1_Missense_Mutation_p.D248G	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	526					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CTCCAGCATGTCCATGTGCAG	0.567																																						ENST00000263666.4	1.000000	0.560000	9.600000e-01	6.700000e-01	0.800000	0.813223	0.800000	1.000000																										0				69						c.(1576-1578)gAc>gGc		PDZ domain containing ring finger 3							209.0	159.0	176.0					3																	73434878		2203	4300	6503	SO:0001583	missense	23024	0	0					g.chr3:73434878T>C	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1577A>G	chr3.hg19:g.73434878T>C	ENSP00000263666:p.Asp526Gly	1					PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000535920.1_Missense_Mutation_p.D248G|PDZRN3_ENST00000466780.1_Missense_Mutation_p.D183G|PDZRN3_ENST00000479530.1_Missense_Mutation_p.D243G|PDZRN3_ENST00000462146.2_Missense_Mutation_p.D183G	p.D526G	NM_015009.1	NP_055824.1	2	2	4	2.111415	Q9UPQ7	PZRN3_HUMAN		9	1691	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	1	1	hg19	c.1577A>G	CCDS33789.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.35|18.35	3.603678|3.603678	0.66445|0.66445	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909|ENST00000494559	T;T;T;T;T;T|.	0.10477|.	2.87;3.59;3.48;3.48;3.59;3.58|.	5.58|5.58	5.58|5.58	0.84498|0.84498	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70029|0.70029	0.3177|0.3177	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	B;D;B;D|.	0.89917|.	0.004;1.0;0.005;0.999|.	B;D;B;D|.	0.87578|.	0.02;0.998;0.013;0.995|.	T|T	0.68625|0.68625	-0.5359|-0.5359	10|5	0.32370|.	T|.	0.25|.	.|.	15.4073|15.4073	0.74890|0.74890	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	248;243;243;526|.	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7|.	.;.;.;PZRN3_HUMAN|.	G|A	526;248;183;183;243;526;224|123	ENSP00000263666:D526G;ENSP00000442026:D248G;ENSP00000418168:D183G;ENSP00000418484:D183G;ENSP00000418624:D243G;ENSP00000419250:D224G|.	ENSP00000263666:D526G|.	D|T	-|-	2|1	0|0	0|0	PDZRN3|PDZRN3	73517568|73517568	73517568|73517568	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.852000|7.852000	0.86927|0.86927	2.117000|2.117000	0.64856|0.64856	0.533000|0.533000	0.62120|0.62120	GAC|ACA	0.354839		TCGA-IB-A6UG-01A-32D-A33T-08	0.567	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	3.280000	-9.208489	1	0.220000	XM_041363		0	34	33	0	436	435	0		1	0		0	0	79	0	0	1.000000	1.154710e-01	0	0	0	8	0	34	436
KIAA1407	57577	broad.mit.edu	37	3	113755633	113755633	+	Splice_Site	SNP	T	T	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr3:113755633T>A	ENST00000295878.3	-	5	562	c.416A>T	c.(415-417)gAt>gTt	p.D139V	KIAA1407_ENST00000545063.1_5'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	139										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						GCCACATAAATCTGGGGGAAA	0.294																																						ENST00000295878.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				40						c.(415-417)gAt>gTt		KIAA1407							66.0	62.0	63.0					3																	113755633		2203	4300	6503	SO:0001630	splice_region_variant	57577	0	0					g.chr3:113755633T>A	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.416-1A>T	chr3.hg19:g.113755633T>A		1					KIAA1407_ENST00000545063.1_5'UTR	p.D139V	NM_020817.1	NP_065868.1	2	2	4	2.111415	Q8NCU4	K1407_HUMAN		5	562	-			B4DYL1|Q9P2E0	Splice_Site	SNP	ENST00000295878.3	0	1	hg19	c.416A>T	CCDS2977.1	1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949426	0.73787	.	.	ENSG00000163617	ENST00000295878;ENST00000491000;ENST00000483766	T;T	0.52983	1.26;0.64	5.28	5.28	0.74379	5.28	5.28	0.74379	.	0.056870	0.64402	D	0.000002	T	0.62660	0.2446	L	0.55481	1.735	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.989	P;D;P	0.66497	0.9;0.944;0.892	T	0.64521	-0.6388	10	0.56958	D	0.05	.	15.3725	0.74577	0.0:0.0:0.0:1.0	.	126;15;139	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	V	139;126;103	ENSP00000295878:D139V;ENSP00000418099:D126V	ENSP00000295878:D139V	D	-	2	0	0	KIAA1407	115238323	115238323	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	5.908000	0.69916	2.207000	0.71202	0.528000	0.53228	GAT	0.354839		TCGA-IB-A6UG-01A-32D-A33T-08	0.294	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	0	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	3.280000	-20.000000	1	0.220000	NM_020817	Missense_Mutation	0	44	44	0	194	193	0		1	0		0	0	38	0	0	1.000000	6.813097e-01	0	0	0	12	0	44	194
TRPC3	7222	broad.mit.edu	37	4	122846207	122846207	+	Missense_Mutation	SNP	C	C	T	rs201312365		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr4:122846207C>T	ENST00000379645.3	-	3	1215	c.1142G>A	c.(1141-1143)cGt>cAt	p.R381H	TRPC3_ENST00000264811.5_Missense_Mutation_p.R308H|TRPC3_ENST00000513531.1_Missense_Mutation_p.R308H	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	296					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R308P(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AAGTTTGACACGACTTAATGA	0.423																																						ENST00000379645.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.R308P(1)	ovary(1)	51						c.(1141-1143)cGt>cAt		transient receptor potential cation channel, subfamily C, member 3							211.0	188.0	196.0					4																	122846207		2203	4300	6503	SO:0001583	missense	7222	1	121412	37				g.chr4:122846207C>T	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1142G>A	chr4.hg19:g.122846207C>T	ENSP00000368966:p.Arg381His	0					TRPC3_ENST00000264811.5_Missense_Mutation_p.R308H|TRPC3_ENST00000513531.1_Missense_Mutation_p.R308H	p.R381H	NM_001130698.1	NP_001124170.1	1	2	3	1.965441	Q13507	TRPC3_HUMAN		3	1215	-			A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	1	1	hg19	c.1142G>A	CCDS47130.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.670425	0.96754	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.74315	-0.83;-0.83;-0.83	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.075570	0.56097	D	0.000024	D	0.89643	0.6774	M	0.91768	3.24	0.80722	D	1	D;D;D	0.89917	0.986;1.0;0.996	P;D;P	0.70716	0.684;0.97;0.781	D	0.90928	0.4788	10	0.87932	D	0	-16.1466	20.3081	0.98638	0.0:1.0:0.0:0.0	.	296;308;381	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	H	308;381;308	ENSP00000264811:R308H;ENSP00000368966:R381H;ENSP00000426899:R308H	ENSP00000264811:R308H	R	-	2	0	0	TRPC3	123065657	123065657	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.755000	0.85180	2.795000	0.96236	0.655000	0.94253	CGT	0.297297		TCGA-IB-A6UG-01A-32D-A33T-08	0.423	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	3.280000	-20.000000	1	0.220000	NM_003305		0	96	95	0	475	470	1		1		0	0	0	93	0	0	1.000000	0	0	0	1	0	0	96	475
SLC12A7	10723	broad.mit.edu	37	5	1083957	1083957	+	Silent	SNP	G	G	A	rs552429468	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:1083957G>A	ENST00000264930.5	-	8	1075	c.1032C>T	c.(1030-1032)aaC>aaT	p.N344N		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	344					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GCTGGGAGCCGTTGCAGAAGA	0.647													G|||	2	0.000399361	0.0	0.0	5008	,	,		16849	0.0		0.0	False		,,,				2504	0.002					ENST00000264930.5	0.310000	0.030000	2.300000e-01	9.000000e-02	0.150000	0.165380	0.150000	0.130000																										0				32						c.(1030-1032)aaC>aaT		solute carrier family 12 (potassium/chloride transporter), member 7	Potassium Chloride(DB00761)						80.0	73.0	76.0					5																	1083957		2200	4300	6500	SO:0001819	synonymous_variant	10723	34	121174	43				g.chr5:1083957G>A	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1032C>T	chr5.hg19:g.1083957G>A		1						p.N344N	NM_006598.2	NP_006589.2	2	4	6	2.534355	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)	8	1075	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	ENST00000264930.5	0	1	hg19	c.1032C>T	CCDS34129.1	0																																																																																								0.458333		TCGA-IB-A6UG-01A-32D-A33T-08	0.647	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	0	0	1	2	2	2	2	0	0	0	0	86	86	86	84	1	3.280000	-3.295407	1	0.220000	NM_006598		0	5	5	0	466	459	0		1	0		0	0	86	0	0	0.935364	2.077010e-01	0	0	0	66	0	5	466
SLC6A18	348932	broad.mit.edu	37	5	1246093	1246093	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:1246093G>A	ENST00000324642.3	+	12	1910	c.1787G>A	c.(1786-1788)cGg>cAg	p.R596Q		NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	596					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CGGCGGAGGCGGACGTGGAGG	0.731																																						ENST00000324642.3	1.000000	0.400000	1	5.700000e-01	0.800000	0.792628	0.800000	1.000000																										0				34						c.(1786-1788)cGg>cAg		solute carrier family 6 (neutral amino acid transporter), member 18							14.0	17.0	16.0					5																	1246093		2196	4279	6475	SO:0001583	missense	348932	0	0					g.chr5:1246093G>A	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1787G>A	chr5.hg19:g.1246093G>A	ENSP00000323549:p.Arg596Gln	1						p.R596Q	NM_182632.2	NP_872438.2	2	4	6	2.534355	Q96N87	S6A18_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)	12	1910	+	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)			Missense_Mutation	SNP	ENST00000324642.3	0	1	hg19	c.1787G>A	CCDS3860.1	0	.	.	.	.	.	.	.	.	.	.	G	7.231	0.599235	0.13939	.	.	ENSG00000164363	ENST00000324642	T	0.74002	-0.8	4.41	0.824	0.18818	4.41	0.824	0.18818	.	6.616820	0.01082	N	0.005003	T	0.53077	0.1774	N	0.08118	0	0.09310	N	0.999999	B	0.21147	0.052	B	0.06405	0.002	T	0.41592	-0.9500	10	0.12766	T	0.61	.	6.3418	0.21327	0.4495:0.0:0.5505:0.0	.	596	Q96N87	S6A18_HUMAN	Q	596	ENSP00000323549:R596Q	ENSP00000323549:R596Q	R	+	2	0	0	SLC6A18	1299093	1299093	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.408000	0.02485	-0.179000	0.10654	0.305000	0.20034	CGG	0.458333		TCGA-IB-A6UG-01A-32D-A33T-08	0.731	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	3.280000	-13.054980	1	0.220000	NM_182632		0	9	9	0	144	139	0		1			0	0	17	0	0	0.993779	0	0	0	0	0	0	9	144
DNAH5	1767	broad.mit.edu	37	5	13776708	13776708	+	Silent	SNP	G	G	A	rs563907105		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:13776708G>A	ENST00000265104.4	-	55	9317	c.9213C>T	c.(9211-9213)caC>caT	p.H3071H		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3071	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGAAGTAGTCGTGCAGGTTCT	0.468									Kartagener syndrome				G|||	1	0.000199681	0.0008	0.0	5008	,	,		18448	0.0		0.0	False		,,,				2504	0.0					ENST00000265104.4	0.350000	0.070000	2.700000e-01	1.200000e-01	0.190000	0.203107	0.190000	0.180000																										0				378						c.(9211-9213)caC>caT		dynein, axonemal, heavy chain 5							114.0	105.0	108.0					5																	13776708		2203	4300	6503	SO:0001819	synonymous_variant	1767	2	121410	38	Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr5:13776708G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9213C>T	chr5.hg19:g.13776708G>A		1						p.H3071H	NM_001369.2	NP_001360.1	2	4	6	2.534355	Q8TE73	DYH5_HUMAN		55	9317	-	Lung NSC(4;0.00476)		Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	0	1	hg19	c.9213C>T	CCDS3882.1	0																																																																																								0.458333		TCGA-IB-A6UG-01A-32D-A33T-08	0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	3.280000	-2.924833	1	0.220000	NM_001369		0	8	8	0	569	562	0		1	0		0	0	85	0	0	0.988908	2.680007e-04	0	0	0	2	0	8	569
PCDHA10	56139	broad.mit.edu	37	5	140236911	140236911	+	Silent	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:140236911G>A	ENST00000307360.5	+	1	1278	c.1278G>A	c.(1276-1278)gcG>gcA	p.A426A	PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Silent_p.A426A|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	426	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGACCGCGCGGGACGGGG	0.647																																						ENST00000307360.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				79						c.(1276-1278)gcG>gcA		protocadherin alpha 10							106.0	103.0	104.0					5																	140236911		2197	4274	6471	SO:0001819	synonymous_variant	56139	0	0					g.chr5:140236911G>A	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1278G>A	chr5.hg19:g.140236911G>A		1					PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.A426A|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron	p.A426A	NM_018901.2	NP_061724.1	0	2	2	1.763896	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1278	+			A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	1	1	hg19	c.1278G>A	CCDS54921.1	1																																																																																								0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.647	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	1	0	1	2	2	2	2	0	0	0	0	236	236	236	235	1	3.280000	-20.000000	1	0.220000	NM_018901		0	203	202	0	684	682	1		1	0		0	0	236	0	0	1.000000	0	0	0	0	1	0	203	684
GRIA1	2890	broad.mit.edu	37	5	153174277	153174277	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:153174277C>T	ENST00000285900.5	+	14	2710	c.2367C>T	c.(2365-2367)agC>agT	p.S789S	GRIA1_ENST00000521843.2_Silent_p.S720S|GRIA1_ENST00000340592.5_Intron|GRIA1_ENST00000518142.1_Silent_p.S709S|GRIA1_ENST00000518783.1_Silent_p.S799S|GRIA1_ENST00000448073.4_Intron	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	789					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	AGTGCGGCAGCGGGGGAGGTG	0.463																																						ENST00000285900.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999960	0.990000	1.000000																										0				81						c.(2365-2367)agC>agT		glutamate receptor, ionotropic, AMPA 1	Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)						50.0	52.0	52.0					5																	153174277		2203	4300	6503	SO:0001819	synonymous_variant	2890	1	121412	28				g.chr5:153174277C>T		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2367C>T	chr5.hg19:g.153174277C>T		1					GRIA1_ENST00000518142.1_Silent_p.S709S|GRIA1_ENST00000340592.5_Intron|GRIA1_ENST00000448073.4_Intron|GRIA1_ENST00000521843.2_Silent_p.S720S|GRIA1_ENST00000518783.1_Silent_p.S799S	p.S789S	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	0	2	2	1.763896	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	14	2710	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	1	1	hg19	c.2367C>T	CCDS4322.1	1																																																																																								0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.463	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	3.280000	-3.886840	1	0.220000			0	40	40	0	180	178	1		1			0	0	46	0	0	1.000000	0	0	0	0	0	0	40	180
FBXL7	23194	broad.mit.edu	37	5	15928366	15928366	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:15928366C>T	ENST00000504595.1	+	3	976	c.495C>T	c.(493-495)aaC>aaT	p.N165N	FBXL7_ENST00000329673.7_Silent_p.N153N|FBXL7_ENST00000510662.1_Silent_p.N118N	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	165					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						AGACCATCAACGTGGACCGCG	0.667																																						ENST00000504595.1	1.000000	0.320000	9.900000e-01	4.800000e-01	0.710000	0.719186	0.710000	1.000000																										0				60						c.(493-495)aaC>aaT		F-box and leucine-rich repeat protein 7							24.0	28.0	27.0					5																	15928366		2118	4226	6344	SO:0001819	synonymous_variant	23194	0	0					g.chr5:15928366C>T	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.495C>T	chr5.hg19:g.15928366C>T		1					FBXL7_ENST00000329673.7_Silent_p.N153N|FBXL7_ENST00000510662.1_Silent_p.N118N	p.N165N	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	2	4	6	2.534355	Q9UJT9	FBXL7_HUMAN		3	976	+			B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	0	1	hg19	c.495C>T	CCDS54833.1	0																																																																																								0.458333		TCGA-IB-A6UG-01A-32D-A33T-08	0.667	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	17	1	3.280000	-10.625520	1	0.220000	NM_012304		0	7	7	0	130	127	0		1	0		0	0	18	0	0	0.979953	3.204897e-02	0	0	0	5	0	7	130
KIF4B	285643	broad.mit.edu	37	5	154393886	154393886	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:154393886G>A	ENST00000435029.4	+	1	627	c.467G>A	c.(466-468)cGt>cAt	p.R156H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	156	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.R156L(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGCCCATCTCGTGAGAAAGCT	0.358																																						ENST00000435029.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										2	Substitution - Missense(2)	p.R156L(2)	lung(2)	58						c.(466-468)cGt>cAt		kinesin family member 4B							157.0	160.0	159.0					5																	154393886		2203	4300	6503	SO:0001583	missense	285643	3	121412	38				g.chr5:154393886G>A	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.467G>A	chr5.hg19:g.154393886G>A	ENSP00000387875:p.Arg156His	1						p.R156H	NM_001099293.1	NP_001092763.1	0	2	2	1.763896	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)	1	627	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)		Missense_Mutation	SNP	ENST00000435029.4	1	1	hg19	c.467G>A	CCDS47324.1	1	.	.	.	.	.	.	.	.	.	.	g	9.001	0.980005	0.18812	.	.	ENSG00000226650	ENST00000435029	T	0.72835	-0.69	1.73	0.834	0.18880	1.73	0.834	0.18880	Kinesin, motor domain (4);	.	.	.	.	T	0.57169	0.2035	L	0.39514	1.22	0.36431	D	0.864927	B	0.14012	0.009	B	0.18561	0.022	T	0.55256	-0.8169	9	0.54805	T	0.06	.	6.1483	0.20298	0.1824:0.0:0.8176:0.0	.	156	Q2VIQ3	KIF4B_HUMAN	H	156	ENSP00000387875:R156H	ENSP00000387875:R156H	R	+	2	0	0	KIF4B	154374079	154374079	0.001000	0.12720	0.940000	0.37924	0.851000	0.48451	-1.547000	0.02186	0.307000	0.22880	0.655000	0.94253	CGT	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.358	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1	1	0	1	2	19	2	2	1	1	1	1	113	113	113	113	1	3.280000	-20.000000	1	0.220000			0	135	132	0	509	507	1		1			1	0	113	0	0	1.000000	0	0	0	0	0	0	135	509
ADAMTS16	170690	broad.mit.edu	37	5	5191804	5191804	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:5191804C>T	ENST00000274181.7	+	8	1352	c.1214C>T	c.(1213-1215)gCa>gTa	p.A405V	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.A405V	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	405	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ACAGGATTTGCACCCATAAGT	0.388																																						ENST00000274181.7	0.270000	0.030000	2.000000e-01	8.000000e-02	0.130000	0.147143	0.130000	0.120000																										0				107						c.(1213-1215)gCa>gTa		ADAM metallopeptidase with thrombospondin type 1 motif, 16							139.0	130.0	133.0					5																	5191804		1910	4121	6031	SO:0001583	missense	170690	0	0					g.chr5:5191804C>T	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1214C>T	chr5.hg19:g.5191804C>T	ENSP00000274181:p.Ala405Val	1					ADAMTS16_ENST00000511368.1_Missense_Mutation_p.A405V	p.A405V	NM_139056.2	NP_620687.2	2	4	6	2.534355	Q8TE57	ATS16_HUMAN		8	1352	+			C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	0	1	hg19	c.1214C>T	CCDS43299.1	0	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870816	0.91587	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	D;D	0.95656	-3.77;-3.77	4.74	4.74	0.60224	4.74	4.74	0.60224	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.98629	0.9541	H	0.97783	4.075	0.80722	D	1	D;D;D	0.89917	0.992;1.0;0.995	D;D;D	0.75020	0.939;0.985;0.976	D	0.99818	1.1045	10	0.87932	D	0	.	16.5194	0.84309	0.0:1.0:0.0:0.0	.	405;405;405	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	V	405	ENSP00000274181:A405V;ENSP00000421631:A405V	ENSP00000274181:A405V	A	+	2	0	0	ADAMTS16	5244804	5244804	1.000000	0.71417	0.952000	0.39060	0.889000	0.51656	7.324000	0.79115	2.186000	0.69663	0.655000	0.94253	GCA	0.458333		TCGA-IB-A6UG-01A-32D-A33T-08	0.388	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	0	0	1	2	2	2	2	0	0	0	0	86	86	86	86	1	3.280000	-2.178036	0	0.220000	NM_139056		0	6	7	0	613	609	0		1	0		0	0	86	0	0	0.964577	4.307491e-04	0	0	0	3	0	6	613
ADAMTS12	81792	broad.mit.edu	37	5	33576636	33576636	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:33576636C>A	ENST00000504830.1	-	19	3830	c.3495G>T	c.(3493-3495)caG>caT	p.Q1165H	ADAMTS12_ENST00000504582.1_5'Flank|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Q1080H	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1165	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TGTCCTCAGGCTGTTCTCTTT	0.473										HNSCC(64;0.19)																												ENST00000504830.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				216						c.(3493-3495)caG>caT		ADAM metallopeptidase with thrombospondin type 1 motif, 12							179.0	163.0	168.0					5																	33576636		2203	4300	6503	SO:0001583	missense	81792	0	0					g.chr5:33576636C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3495G>T	chr5.hg19:g.33576636C>A	ENSP00000422554:p.Gln1165His	1	HNSCC(64;0.19)				ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Q1080H|ADAMTS12_ENST00000504582.1_5'Flank	p.Q1165H	NM_030955.2	NP_112217.2	2	2	4	2.143143	P58397	ATS12_HUMAN		19	3830	-			A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	1	1	hg19	c.3495G>T	CCDS34140.1	1	.	.	.	.	.	.	.	.	.	.	C	5.753	0.323334	0.10900	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60171	0.22;0.21	5.28	-0.364	0.12553	5.28	-0.364	0.12553	.	1.070710	0.07089	N	0.838451	T	0.50497	0.1619	L	0.32530	0.975	0.09310	N	1	P;P	0.46220	0.874;0.8	P;B	0.48141	0.568;0.365	T	0.43540	-0.9385	10	0.15499	T	0.54	.	9.923	0.41474	0.0:0.5766:0.0:0.4234	.	1080;1165	P58397-3;P58397	.;ATS12_HUMAN	H	1165;1080	ENSP00000422554:Q1165H;ENSP00000344847:Q1080H	ENSP00000344847:Q1080H	Q	-	3	2	2	ADAMTS12	33612393	33612393	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.263000	0.18478	0.012000	0.14892	0.655000	0.94253	CAG	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.473	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	1	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	3.280000	-20.000000	1	0.220000	NM_030955		0	86	86	0	429	425	1		1	0		0	0	105	0	0	1.000000	4.594746e-01	0	0	0	9	0	86	429
FLT4	2324	broad.mit.edu	37	5	180051060	180051060	+	Splice_Site	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr5:180051060G>A	ENST00000261937.6	-	11	1501	c.1423C>T	c.(1423-1425)Cgg>Tgg	p.R475W	FLT4_ENST00000393347.3_Splice_Site_p.R475W|FLT4_ENST00000502649.1_Splice_Site_p.R475W|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	475	Ig-like C2-type 5.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGCCGCCGCCGGCTGCCAGGA	0.647																																					Colon(97;1075 1466 27033 27547 35871)	ENST00000261937.6	1.000000	0.810000	1	9.800000e-01	0.990000	0.983675	0.990000	1.000000																										0				71						c.(1423-1425)Cgg>Tgg		fms-related tyrosine kinase 4	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)						34.0	33.0	33.0					5																	180051060		2202	4298	6500	SO:0001630	splice_region_variant	2324	3	121272	33				g.chr5:180051060G>A	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1422-1C>T	chr5.hg19:g.180051060G>A		1					FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Splice_Site_p.R475W|FLT4_ENST00000393347.3_Splice_Site_p.R475W	p.R475W	NM_182925.4	NP_891555.2	0	2	2	1.763896	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	11	1501	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Splice_Site	SNP	ENST00000261937.6	1	0	hg19	c.1423C>T	CCDS4457.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228890	0.39399	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.77489	-1.1;-1.09;-1.09	4.79	2.85	0.33270	4.79	2.85	0.33270	Immunoglobulin subtype (1);Immunoglobulin-like (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor 3 (VEGFR3), N-terminal (1);	.	.	.	.	T	0.68650	0.3024	N	0.08118	0	0.43462	D	0.995669	D;D;D;D	0.71674	0.998;0.998;0.996;0.998	P;P;P;P	0.58970	0.849;0.809;0.72;0.72	T	0.66344	-0.5947	9	0.37606	T	0.19	.	7.737	0.28821	0.084:0.0:0.7557:0.1603	.	475;285;475;475	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	W	475;475;475;285	ENSP00000261937:R475W;ENSP00000377016:R475W;ENSP00000426057:R475W	ENSP00000261937:R475W	R	-	1	2	2	FLT4	179983666	179983666	0.775000	0.28604	0.985000	0.45067	0.017000	0.09413	0.047000	0.14056	1.163000	0.42636	-0.258000	0.10820	CGG	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.647	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4	1	0	1	2	2	2	2	0	0	0	0	47	47	47	45	1	3.280000	-20.000000	1	0.220000		Missense_Mutation	0	28	28	0	187	184	1		1	0		0	0	47	0	0	1.000000	1.874583e-01	0	0	0	6	0	28	187
ZNF184	7738	broad.mit.edu	37	6	27419354	27419354	+	Nonsense_Mutation	SNP	G	G	A	rs377450857		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr6:27419354G>A	ENST00000211936.6	-	6	2268	c.1984C>T	c.(1984-1986)Cga>Tga	p.R662*	ZNF184_ENST00000377419.1_Nonsense_Mutation_p.R662*	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GTGTGAATTCGTTGATGCTGA	0.423																																						ENST00000211936.6	1.000000	0.680000	1	8.000000e-01	0.930000	0.914488	0.930000	1.000000																										0				48						c.(1984-1986)Cga>Tga		zinc finger protein 184		G	stop/ARG	0,4406		0,0,2203	97.0	103.0	101.0		1984	2.9	0.3	6		101	1,8599		0,1,4299	no	stop-gained	ZNF184	NM_007149.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		662/752	27419354	1,13005	2203	4300	6503	SO:0001587	stop_gained	7738	1	121412	18				g.chr6:27419354G>A	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1984C>T	chr6.hg19:g.27419354G>A	ENSP00000211936:p.Arg662*	1					ZNF184_ENST00000377419.1_Nonsense_Mutation_p.R662*	p.R662*	NM_007149.2	NP_009080.2	0	2	2	1.759974	Q99676	ZN184_HUMAN		6	2268	-			B2R715|O60792|Q8TBA9	Nonsense_Mutation	SNP	ENST00000211936.6	0	0	hg19	c.1984C>T	CCDS4624.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.740066	0.97805	0.0	1.16E-4	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	.	.	.	4.85	2.87	0.33458	4.85	2.87	0.33458	.	0.385319	0.19188	N	0.120492	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.467	0.44614	0.0:0.0:0.4853:0.5147	.	.	.	.	X	662;662;578	.	ENSP00000211936:R662X	R	-	1	2	2	ZNF184	27527333	27527333	0.006000	0.16342	0.276000	0.24689	0.998000	0.95712	1.414000	0.34736	1.336000	0.45506	0.591000	0.81541	CGA	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.423	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	3.280000	-3.142702	1	0.220000	NM_007149		0	40	40	0	347	344	1		1	1		0	0	77	0	0	1.000000	3.253306e-01	0	3	0	8	0	40	347
DAXX	1616	broad.mit.edu	37	6	33289539	33289539	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr6:33289539C>T	ENST00000374542.5	-	2	368	c.164G>A	c.(163-165)gGc>gAc	p.G55D	DAXX_ENST00000266000.6_Missense_Mutation_p.G55D|DAXX_ENST00000477162.1_5'UTR|DAXX_ENST00000414083.2_Intron	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	55	Necessary for interaction with USP7 and ATRX.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						GCATTTCTTGCCGCCCGAACT	0.602			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																	ENST00000374542.5	0.100000	0.010000	7.000000e-02	2.000000e-02	0.040000	0.054794	0.040000	0.050000				Rec	yes			Rec	yes		6	6p21.3	6p21.3	1616	Mis, F, N	death-domain associated protein				E	E			Pancreatic neuroendocrine tumors. Paediatric GBM		0				55						c.(163-165)gGc>gAc		death-domain associated protein							221.0	227.0	225.0					6																	33289539		2203	4300	6503	SO:0001583	missense	1616	0	0					g.chr6:33289539C>T	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.164G>A	chr6.hg19:g.33289539C>T	ENSP00000363668:p.Gly55Asp	1					DAXX_ENST00000414083.2_Intron|DAXX_ENST00000477162.1_5'UTR|DAXX_ENST00000266000.6_Missense_Mutation_p.G55D	p.G55D	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	0	2	2	1.773331	Q9UER7	DAXX_HUMAN		2	368	-			B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	0	1	hg19	c.164G>A	CCDS4776.1	0	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608951	0.28623	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000446403;ENST00000453407	.	.	.	4.89	4.02	0.46733	4.89	4.02	0.46733	.	0.660504	0.16364	N	0.217655	T	0.29355	0.0731	L	0.36672	1.1	0.80722	D	1	P;P	0.46784	0.884;0.884	P;P	0.44860	0.462;0.462	T	0.03503	-1.1030	9	0.25106	T	0.35	-0.4917	10.4358	0.44435	0.1947:0.8053:0.0:0.0	.	67;55	B4E1C1;Q9UER7	.;DAXX_HUMAN	D	55	.	ENSP00000266000:G55D	G	-	2	0	0	DAXX	33397517	33397517	0.869000	0.29996	0.983000	0.44433	0.735000	0.41995	1.033000	0.30191	1.281000	0.44480	0.549000	0.68633	GGC	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.602	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1	0	0	1	2	17	2	2	1	1	1	1	290	290	290	287	1	3.280000	-2.138773	0	0.220000			0	7	7	0	1316	1302	0		0	0		1	0	290	0	0	0.029433	2.296276e-02	0	0	0	37	0	7	1316
KIF6	221458	broad.mit.edu	37	6	39513398	39513398	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr6:39513398C>T	ENST00000287152.7	-	11	1342	c.1248G>A	c.(1246-1248)gcG>gcA	p.A416A	KIF6_ENST00000373215.3_Silent_p.A416A|KIF6_ENST00000373213.4_Silent_p.A255A|KIF6_ENST00000538893.1_Silent_p.A416A|KIF6_ENST00000373216.3_Silent_p.A416A	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	416					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TACGCATATCCGCGCCAACCT	0.363																																						ENST00000287152.7	1.000000	0.990000	1	9.900000e-01	0.990000	0.999874	0.990000	1.000000																										0				52						c.(1246-1248)gcG>gcA		kinesin family member 6							117.0	113.0	115.0					6																	39513398		2203	4300	6503	SO:0001819	synonymous_variant	221458	3	121410	36				g.chr6:39513398C>T	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1248G>A	chr6.hg19:g.39513398C>T		1					KIF6_ENST00000538893.1_Silent_p.A416A|KIF6_ENST00000373216.3_Silent_p.A416A|KIF6_ENST00000373215.3_Silent_p.A416A|KIF6_ENST00000373213.4_Silent_p.A255A	p.A416A	NM_145027.4	NP_659464.3	2	2	4	2.168044	Q6ZMV9	KIF6_HUMAN		11	1342	-			Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Silent	SNP	ENST00000287152.7	1	1	hg19	c.1248G>A	CCDS4844.1	1	.	.	.	.	.	.	.	.	.	.	C	1.650	-0.514326	0.04200	.	.	ENSG00000164627	ENST00000458470	.	.	.	5.56	-10.3	0.00346	5.56	-10.3	0.00346	.	.	.	.	.	T	0.26231	0.0640	.	.	.	0.47584	D	0.999465	.	.	.	.	.	.	T	0.48990	-0.8985	4	.	.	.	.	6.4908	0.22115	0.2761:0.1099:0.5103:0.1038	.	.	.	.	Q	308	.	.	R	-	2	0	0	KIF6	39621376	39621376	0.004000	0.15560	0.015000	0.15790	0.301000	0.27625	-1.882000	0.01624	-1.844000	0.01178	-2.773000	0.00119	CGG	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.363	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	3.280000	-2.540688	1	0.220000	NM_145027		0	55	54	0	367	360	1		1			0	0	66	0	0	1.000000	0	0	0	0	0	0	55	367
SUPT3H	8464	broad.mit.edu	37	6	44929553	44929553	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr6:44929553G>T	ENST00000371459.1	-	7	682	c.517C>A	c.(517-519)Caa>Aaa	p.Q173K	SUPT3H_ENST00000371460.1_Missense_Mutation_p.Q184K|SUPT3H_ENST00000371461.2_Missense_Mutation_p.Q184K|SUPT3H_ENST00000306867.5_Missense_Mutation_p.Q173K	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	255					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						ATTCGAGTTTGTCTTTCTGCT	0.274																																						ENST00000371459.1	0.800000	0.320000	6.700000e-01	4.100000e-01	0.530000	0.551738	0.530000	0.520000																										0				12						c.(517-519)Caa>Aaa		suppressor of Ty 3 homolog (S. cerevisiae)							70.0	74.0	73.0					6																	44929553		2202	4293	6495	SO:0001583	missense	8464	0	0					g.chr6:44929553G>T	AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.517C>A	chr6.hg19:g.44929553G>T	ENSP00000360514:p.Gln173Lys	0					SUPT3H_ENST00000306867.5_Missense_Mutation_p.Q173K|SUPT3H_ENST00000371461.2_Missense_Mutation_p.Q184K|SUPT3H_ENST00000371460.1_Missense_Mutation_p.Q184K	p.Q173K	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	1	3	4	2.112062	O75486	SUPT3_HUMAN		7	682	-			A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	ENST00000371459.1	1	0	hg19	c.517C>A	CCDS34465.1	0	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344276	0.41498	.	.	ENSG00000196284	ENST00000371460;ENST00000371459;ENST00000306867;ENST00000371461	T;T;T;T	0.42900	0.96;0.98;0.98;0.96	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.269901	0.43260	D	0.000594	T	0.48642	0.1511	L	0.45581	1.43	0.53005	D	0.999967	B;D	0.54964	0.169;0.969	B;D	0.64877	0.075;0.93	T	0.15407	-1.0438	10	0.26408	T	0.33	.	19.8205	0.96591	0.0:0.0:1.0:0.0	.	184;255	O75486-3;O75486	.;SUPT3_HUMAN	K	184;173;173;184	ENSP00000360515:Q184K;ENSP00000360514:Q173K;ENSP00000306718:Q173K;ENSP00000360516:Q184K	ENSP00000306718:Q173K	Q	-	1	0	0	SUPT3H	45037531	45037531	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.017000	0.70805	2.670000	0.90874	0.585000	0.79938	CAA	0.360656		TCGA-IB-A6UG-01A-32D-A33T-08	0.274	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106911.2	1	0	0	2	2	2	2	0	0	0	0	58	58	58	58	1	3.280000	-18.070020	1	0.220000	NM_181356		0	17	0	0	341	336	0		0	0		0	0	58	0	0	0.999945	4.402228e-01	0	0	0	30	0	17	341
GABRR2	2570	broad.mit.edu	37	6	89974189	89974189	+	Missense_Mutation	SNP	G	G	A	rs149245573		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr6:89974189G>A	ENST00000402938.3	-	8	1161	c.1028C>T	c.(1027-1029)gCg>gTg	p.A343V	GABRR2_ENST00000602399.1_Missense_Mutation_p.A368V	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	343					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A343V(3)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GTTGACAGCCGCATACTCCAG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		20743	0.0		0.001	False		,,,				2504	0.0					ENST00000402938.3	0.380000	0.050000	2.800000e-01	1.000000e-01	0.170000	0.195388	0.170000	0.160000																										3	Substitution - Missense(3)	p.A343V(3)	prostate(2)|lung(1)	21						c.(1027-1029)gCg>gTg		gamma-aminobutyric acid (GABA) A receptor, rho 2	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)						116.0	88.0	97.0					6																	89974189		2203	4300	6503	SO:0001583	missense	2570	1	121412	29				g.chr6:89974189G>A		CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.1028C>T	chr6.hg19:g.89974189G>A	ENSP00000386029:p.Ala343Val	1					GABRR2_ENST00000602399.1_Missense_Mutation_p.A368V	p.A343V	NM_002043.3	NP_002034.3	0	2	2	1.766904	P28476	GBRR2_HUMAN		8	1161	-		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)	A2BDE4|Q9H153	Missense_Mutation	SNP	ENST00000402938.3	0	1	hg19	c.1028C>T	CCDS5020.3	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	36	5.780845	0.96929	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.93	5.93	0.95920	5.93	5.93	0.95920	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.82015	0.4945	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81116	-0.1079	8	.	.	.	.	20.3437	0.98782	0.0:0.0:1.0:0.0	.	368	P28476	GBRR2_HUMAN	V	368	.	.	A	-	2	0	0	GABRR2	90030908	90030908	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	9.869000	0.99810	2.815000	0.96918	0.561000	0.74099	GCG	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.597	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041482.3	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	3.280000	-3.062005	1	0.220000			0	4	4	0	223	222	0		1			0	0	46	0	0	0.890111	0	0	0	0	0	0	4	223
SSPO	23145	broad.mit.edu	37	7	149500902	149500902	+	RNA	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr7:149500902G>T	ENST00000378016.2	+	0	8219							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCAGGTTCAGGTGTGCGACAG	0.697																																						ENST00000378016.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999968	0.990000	1.000000																										0												SCO-spondin							19.0	24.0	22.0					7																	149500902		2090	4213	6303			23145	0	0					g.chr7:149500902G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149500902G>T		0									1	2	3	1.942062	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)	0	8219	+	Melanoma(164;0.165)|Ovarian(565;0.177)		Q76B61	RNA	SNP	ENST00000378016.2	1	0	hg19			1																																																																																								0.296600		TCGA-IB-A6UG-01A-32D-A33T-08	0.697	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript		1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	3.280000	-20.000000	1	0.220000			0	25	25	0	104	104	1		1			0	0	26	0	0	1.000000	0	0	0	0	0	0	25	104
FER1L6	654463	broad.mit.edu	37	8	125035751	125035751	+	Missense_Mutation	SNP	G	G	A	rs371597054		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:125035751G>A	ENST00000522917.1	+	18	2407	c.2201G>A	c.(2200-2202)cGc>cAc	p.R734H	FER1L6_ENST00000399018.1_Missense_Mutation_p.R734H|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	734						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GCCTATGCCCGCATCGCCTCC	0.527																																						ENST00000522917.1	1.000000	0.060000	2.600000e-01	1.000000e-01	0.160000	0.244907	0.160000	0.140000																										0				118						c.(2200-2202)cGc>cAc		fer-1-like family member 6		G	HIS/ARG	0,3952		0,0,1976	100.0	103.0	102.0		2201	5.8	1.0	8		102	1,8321		0,1,4160	no	missense	FER1L6	NM_001039112.2	29	0,1,6136	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	734/1858	125035751	1,12273	1976	4161	6137	SO:0001583	missense	654463	9	120906	42				g.chr8:125035751G>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2201G>A	chr8.hg19:g.125035751G>A	ENSP00000428280:p.Arg734His	1					FER1L6-AS1_ENST00000518567.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.R734H	p.R734H	NM_001039112.2	NP_001034201.2	3	4	7	2.619755	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)	18	2407	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)			Missense_Mutation	SNP	ENST00000522917.1	0	1	hg19	c.2201G>A	CCDS43767.1	0	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971850	0.92919	0.0	1.2E-4	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.79352	-1.26;-1.26	5.81	5.81	0.92471	5.81	5.81	0.92471	Ferlin B-domain (1);	0.162857	0.34435	U	0.003970	D	0.89550	0.6747	M	0.91663	3.23	0.58432	D	0.999998	D	0.76494	0.999	D	0.70935	0.971	D	0.91017	0.4854	10	0.72032	D	0.01	.	12.8851	0.58038	0.0779:0.0:0.9221:0.0	.	734	Q2WGJ9	FR1L6_HUMAN	H	734	ENSP00000428280:R734H;ENSP00000381982:R734H	ENSP00000381982:R734H	R	+	2	0	0	FER1L6	125104932	125104932	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	9.072000	0.93986	2.751000	0.94390	0.555000	0.69702	CGC	0.476334		TCGA-IB-A6UG-01A-32D-A33T-08	0.527	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	3.280000	-2.094368	0	0.220000	NM_001039112		0	8	9	0	702	694	0		1	0		0	0	87	0	0	0.988974	5.263936e-04	0	0	0	3	0	8	702
ADRA1A	148	broad.mit.edu	37	8	26627895	26627895	+	Missense_Mutation	SNP	G	G	A	rs151273238	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:26627895G>A	ENST00000519229.1	-	2	1178	c.1172C>T	c.(1171-1173)aCg>aTg	p.T391M	ADRA1A_ENST00000380573.3_Missense_Mutation_p.T391M|ADRA1A_ENST00000380582.3_Missense_Mutation_p.T391M|ADRA1A_ENST00000276393.4_Missense_Mutation_p.T391M|ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000354550.4_Missense_Mutation_p.T391M|ADRA1A_ENST00000380586.1_Missense_Mutation_p.T391M|ADRA1A_ENST00000380587.1_Intron			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	349					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	AACGCCATCCGTCTTGGAGAT	0.562													G|||	3	0.000599042	0.0008	0.0	5008	,	,		18274	0.001		0.0	False		,,,				2504	0.001					ENST00000519229.1	1.000000	0.850000	1	9.500000e-01	0.990000	0.983539	0.990000	1.000000																										0				36						c.(1171-1173)aCg>aTg		adrenoceptor alpha 1A	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	G	MET/THR,MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	122.0	118.0	120.0		1172,1172,1172,1172	5.1	1.0	8	dbSNP_134	120	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense	ADRA1A	NM_000680.2,NM_033302.2,NM_033303.3,NM_033304.2	81,81,81,81	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	391/467,391/430,391/476,391/456	26627895	4,13002	2203	4300	6503	SO:0001583	missense	148	23	121412	49				g.chr8:26627895G>A	L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.1172C>T	chr8.hg19:g.26627895G>A	ENSP00000430793:p.Thr391Met	0					ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380573.3_Missense_Mutation_p.T391M|ADRA1A_ENST00000380582.3_Missense_Mutation_p.T391M|ADRA1A_ENST00000354550.4_Missense_Mutation_p.T391M|ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Missense_Mutation_p.T391M|ADRA1A_ENST00000276393.4_Missense_Mutation_p.T391M	p.T391M			1	2	3	1.792119	P25100	ADA1D_HUMAN		2	1178	-		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)	Q9NPY0	Missense_Mutation	SNP	ENST00000519229.1	1	1	hg19	c.1172C>T		1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	G	14.75	2.627392	0.46944	4.54E-4	2.33E-4	ENSG00000120907	ENST00000380586;ENST00000380582;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573	T;T;T;T;T;T	0.62941	2.02;0.07;0.05;-0.01;0.06;0.06	5.96	5.06	0.68205	5.96	5.06	0.68205	.	0.667620	0.14213	N	0.333955	T	0.64159	0.2573	L	0.51422	1.61	0.80722	D	1	P;P;P;D	0.54772	0.521;0.954;0.851;0.968	B;P;B;B	0.46049	0.128;0.502;0.332;0.374	T	0.67122	-0.5750	10	0.72032	D	0.01	.	16.2148	0.82198	0.0:0.0:0.8577:0.1423	.	391;391;391;391	P35348;P35348-4;P35348-3;B0ZBD3	ADA1A_HUMAN;.;.;.	M	391	ENSP00000369960:T391M;ENSP00000369956:T391M;ENSP00000430793:T391M;ENSP00000346557:T391M;ENSP00000276393:T391M;ENSP00000369947:T391M	ENSP00000276393:T391M	T	-	2	0	0	ADRA1A	26683812	26683812	1.000000	0.71417	0.954000	0.39281	0.837000	0.47467	4.852000	0.62904	1.445000	0.47624	0.655000	0.94253	ACG	0.230997		TCGA-IB-A6UG-01A-32D-A33T-08	0.562	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000376207.1	1	0	1	2	2	2	2	0	0	0	0	133	133	133	132	1	3.280000	-11.297450	1	0.220000	NM_033303		0	74	74	0	566	562	1		1			0	0	133	0	0	1.000000	0	0	0	0	0	0	74	566
FZD3	7976	broad.mit.edu	37	8	28385210	28385210	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:28385210G>T	ENST00000240093.3	+	5	1411	c.933G>T	c.(931-933)tgG>tgT	p.W311C	FZD3_ENST00000537916.1_Missense_Mutation_p.W311C|RNA5SP259_ENST00000365541.1_RNA	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	311					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		CCATCACATGGTTTTTAGCAG	0.433																																						ENST00000240093.3	1.000000	0.870000	1	9.900000e-01	0.990000	0.989439	0.990000	1.000000																										0				41						c.(931-933)tgG>tgT		frizzled class receptor 3							118.0	113.0	115.0					8																	28385210		2203	4300	6503	SO:0001583	missense	7976	0	0					g.chr8:28385210G>T	AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.933G>T	chr8.hg19:g.28385210G>T	ENSP00000240093:p.Trp311Cys	0					FZD3_ENST00000537916.1_Missense_Mutation_p.W311C|RNA5SP259_ENST00000365541.1_RNA	p.W311C	NM_017412.3	NP_059108.1	1	2	3	1.792119	Q9NPG1	FZD3_HUMAN		5	1411	+		Ovarian(32;2.06e-05)	A8K615	Missense_Mutation	SNP	ENST00000240093.3	1	1	hg19	c.933G>T	CCDS6069.1	1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476133	0.63737	.	.	ENSG00000104290	ENST00000537916;ENST00000240093	D;D	0.91464	-2.85;-2.85	5.32	5.32	0.75619	5.32	5.32	0.75619	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.96765	0.8944	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97815	1.0253	10	0.87932	D	0	.	17.5384	0.87840	0.0:0.0:1.0:0.0	.	311	Q9NPG1	FZD3_HUMAN	C	311	ENSP00000437489:W311C;ENSP00000240093:W311C	ENSP00000240093:W311C	W	+	3	0	0	FZD3	28441129	28441129	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.482000	0.83794	0.563000	0.77884	TGG	0.230997		TCGA-IB-A6UG-01A-32D-A33T-08	0.433	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219986.2	1	0	1	2	2	2	2	0	0	0	0	80	80	80	78	1	3.280000	-19.954380	1	0.220000	NM_145866		0	53	53	0	379	378	1		1	0		0	0	80	0	0	1.000000	1.655719e-01	0	0	0	6	0	53	379
MRPL15	29088	broad.mit.edu	37	8	55049226	55049226	+	Splice_Site	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:55049226G>A	ENST00000260102.4	+	2	337		c.e2+1			NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15						translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			AAGGACATAGGTAAGGTTGCT	0.418																																						ENST00000260102.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				10						c.e2+1		mitochondrial ribosomal protein L15							68.0	72.0	71.0					8																	55049226		2203	4300	6503	SO:0001630	splice_region_variant	29088	1	121412	28				g.chr8:55049226G>A	AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.263+1G>A	chr8.hg19:g.55049226G>A		1							NM_014175.3	NP_054894.1	3	3	6	2.268370	Q9P015	RM15_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)	2	337	+		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	Q96Q54|Q9H0Y1	Splice_Site	SNP	ENST00000260102.4	1	1	hg19		CCDS6158.1	1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645927	0.67358	.	.	ENSG00000137547	ENST00000260102;ENST00000519831	.	.	.	5.05	4.17	0.49024	5.05	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9287	0.70898	0.0:0.0:0.8558:0.1441	.	.	.	.	.	-1	.	.	.	+	.	.	.	MRPL15	55211779	55211779	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.855000	0.99526	1.326000	0.45319	-0.181000	0.13052	.	0.397590		TCGA-IB-A6UG-01A-32D-A33T-08	0.418	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378254.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	3.280000	-20.000000	1	0.220000	NM_014175	Intron	0	80	80	0	413	410	1		1	1		0	0	65	0	0	1.000000	2.705279e-02	0	2	0	0	0	80	413
MMP16	4325	broad.mit.edu	37	8	89198805	89198805	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:89198805C>T	ENST00000286614.6	-	3	585	c.304G>A	c.(304-306)Ggt>Agt	p.G102S	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	102					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCAGGTACACCGCATCGGGGC	0.378																																						ENST00000286614.6	1.000000	0.620000	1	7.200000e-01	0.840000	0.849201	0.840000	1.000000																										0				81						c.(304-306)Ggt>Agt		matrix metallopeptidase 16 (membrane-inserted)	Marimastat(DB00786)						168.0	149.0	155.0					8																	89198805		2203	4300	6503	SO:0001583	missense	4325	2	121410	35				g.chr8:89198805C>T	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.304G>A	chr8.hg19:g.89198805C>T	ENSP00000286614:p.Gly102Ser	1					MMP16_ENST00000544227.1_5'UTR	p.G102S	NM_005941.4	NP_005932.2	3	4	7	2.619755	P51512	MMP16_HUMAN		3	585	-			B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	1	1	hg19	c.304G>A	CCDS6246.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.102432	0.94245	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.65549	-0.16;-0.16	5.72	5.72	0.89469	5.72	5.72	0.89469	Peptidoglycan binding-like (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.985	T	0.79757	-0.1669	10	0.41790	T	0.15	.	19.8778	0.96885	0.0:1.0:0.0:0.0	.	102;102	P51512-2;P51512	.;MMP16_HUMAN	S	102;119	ENSP00000286614:G102S;ENSP00000429147:G119S	ENSP00000286614:G102S	G	-	1	0	0	MMP16	89267921	89267921	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	2.710000	0.92621	0.585000	0.79938	GGT	0.476334		TCGA-IB-A6UG-01A-32D-A33T-08	0.378	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	1	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	3.280000	-2.402339	0	0.220000	NM_005941		0	50	48	0	769	744	0		1	0		0	0	113	0	0	1.000000	0	0	0	0	1	0	50	769
RAD54B	25788	broad.mit.edu	37	8	95419794	95419794	+	Silent	SNP	C	C	T	rs113276250	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:95419794C>T	ENST00000336148.5	-	5	778	c.654G>A	c.(652-654)tcG>tcA	p.S218S		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	218					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GAGAAGAATGCGAGATAGCAG	0.398								Direct reversal of damage;Homologous recombination					C|||	12	0.00239617	0.0076	0.0029	5008	,	,		15352	0.0		0.0	False		,,,				2504	0.0					ENST00000336148.5	1.000000	0.030000	2.800000e-01	9.000000e-02	0.160000	0.243051	0.160000	0.130000																										0				39						c.(652-654)tcG>tcA	Direct reversal of damage;Homologous recombination	RAD54 homolog B (S. cerevisiae)		C	,	34,4372	39.2+/-71.8	0,34,2169	111.0	110.0	110.0		102,654	2.6	0.0	8	dbSNP_132	110	1,8599		0,1,4299	yes	coding-synonymous,coding-synonymous	RAD54B	NM_001205263.1,NM_012415.3	,	0,35,6468	TT,TC,CC		0.0116,0.7717,0.2691	,	34/727,218/911	95419794	35,12971	2203	4300	6503	SO:0001819	synonymous_variant	25788	95	121408	53				g.chr8:95419794C>T	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.654G>A	chr8.hg19:g.95419794C>T		1						p.S218S	NM_012415.3	NP_036547.1	3	4	7	2.619755	Q9Y620	RA54B_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)	5	778	-	Breast(36;4.5e-05)		F6WBS8	Silent	SNP	ENST00000336148.5	0	1	hg19	c.654G>A	CCDS6262.1	0																																																																																								0.476334		TCGA-IB-A6UG-01A-32D-A33T-08	0.398	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	0	0	1	2	2	2	2	0	0	0	0	80	80	80	78	1	3.280000	-2.382980	0	0.220000	NM_012415		0	5	5	0	471	466	0		1	0		0	0	80	0	0	0.936101	2.631803e-03	0	0	0	6	0	5	471
COL22A1	169044	broad.mit.edu	37	8	139737642	139737642	+	Silent	SNP	C	C	T	rs367667199		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr8:139737642C>T	ENST00000303045.6	-	24	2627	c.2181G>A	c.(2179-2181)ccG>ccA	p.P727P	COL22A1_ENST00000435777.1_Silent_p.P727P	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	727	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GAGAACCTCCCGGTCCAGGGG	0.582										HNSCC(7;0.00092)																												ENST00000303045.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				211						c.(2179-2181)ccG>ccA		collagen, type XXII, alpha 1		C		1,4405	2.1+/-5.4	0,1,2202	59.0	66.0	63.0		2181	-9.9	0.6	8		63	0,8600		0,0,4300	no	coding-synonymous	COL22A1	NM_152888.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		727/1627	139737642	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	169044	7	121410	42				g.chr8:139737642C>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2181G>A	chr8.hg19:g.139737642C>T		1	HNSCC(7;0.00092)				COL22A1_ENST00000435777.1_Silent_p.P727P	p.P727P	NM_152888.1	NP_690848.1	3	4	7	2.619755	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)	24	2627	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	1	1	hg19	c.2181G>A	CCDS6376.1	1																																																																																								0.476334		TCGA-IB-A6UG-01A-32D-A33T-08	0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	3.280000	-4.408309	1	0.220000	XM_291257		0	170	167	0	544	534	1		1	1		0	0	91	0	0	1.000000	8.513645e-01	0	9	0	4	0	170	544
PRPF4	9128	broad.mit.edu	37	9	116049072	116049072	+	Missense_Mutation	SNP	C	C	T	rs575911571		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr9:116049072C>T	ENST00000374198.4	+	9	1001	c.899C>T	c.(898-900)gCg>gTg	p.A300V	PRPF4_ENST00000374199.4_Missense_Mutation_p.A299V	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	300					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						GCCTCTTGTGCGGCTGATGGC	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		18454	0.0		0.001	False		,,,				2504	0.0					ENST00000374198.4	1.000000	0.010000	9.000000e-02	3.000000e-02	0.050000	0.114169	0.050000	0.060000																										0				23						c.(898-900)gCg>gTg		pre-mRNA processing factor 4							353.0	352.0	353.0					9																	116049072		2203	4300	6503	SO:0001583	missense	9128	4	121412	43				g.chr9:116049072C>T	AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.899C>T	chr9.hg19:g.116049072C>T	ENSP00000363313:p.Ala300Val	0					PRPF4_ENST00000374199.4_Missense_Mutation_p.A299V	p.A300V	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	1	2	3	1.945305	O43172	PRP4_HUMAN		9	1001	+			O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	ENST00000374198.4	0	1	hg19	c.899C>T	CCDS6791.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.163644	0.94727	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.61040	0.14;0.14	5.82	5.82	0.92795	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.155793	0.56097	D	0.000025	T	0.72244	0.3436	L	0.56340	1.77	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.65140	0.932;0.849	T	0.73040	-0.4108	10	0.72032	D	0.01	.	19.0872	0.93209	0.0:1.0:0.0:0.0	.	315;300	Q59EL4;O43172	.;PRP4_HUMAN	V	299;300	ENSP00000363315:A299V;ENSP00000363313:A300V	ENSP00000363313:A300V	A	+	2	0	0	PRPF4	115088893	115088893	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.378000	0.79679	2.752000	0.94435	0.655000	0.94253	GCG	0.292389		TCGA-IB-A6UG-01A-32D-A33T-08	0.468	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	0	0	1	2	2	2	2	0	0	0	0	338	338	338	337	1	3.280000	-2.138998	0	0.220000	NM_004697		0	10	10	0	1786	1780	0		1	0		0	0	338	0	0	0.996804	2.782200e-02	0	0	0	41	0	10	1786
RIC1	57589	broad.mit.edu	37	9	5765691	5765691	+	Silent	SNP	C	C	T			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr9:5765691C>T	ENST00000414202.2	+	21	3221	c.3030C>T	c.(3028-3030)ttC>ttT	p.F1010F	KIAA1432_ENST00000449720.2_Silent_p.F894F|KIAA1432_ENST00000251879.6_Silent_p.F1010F|KIAA1432_ENST00000418622.3_Silent_p.F931F|KIAA1432_ENST00000381532.2_Silent_p.F931F	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GATTTGAGTTCTTCAGGAATC	0.433																																						ENST00000414202.2	1.000000	0.840000	1	9.300000e-01	0.990000	0.976912	0.990000	1.000000																										0				45						c.(3028-3030)ttC>ttT									235.0	230.0	232.0					9																	5765691		2203	4300	6503	SO:0001819	synonymous_variant	0	0	0					g.chr9:5765691C>T																												ENST00000414202.2:c.3030C>T	chr9.hg19:g.5765691C>T		1					KIAA1432_ENST00000449720.2_Silent_p.F894F|KIAA1432_ENST00000251879.6_Silent_p.F1010F|KIAA1432_ENST00000418622.3_Silent_p.F931F|KIAA1432_ENST00000381532.2_Silent_p.F931F	p.F1010F	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2	0	3	3	1.930506				21	3221	+		Acute lymphoblastic leukemia(23;0.154)		Silent	SNP	ENST00000414202.2	1	1	hg19	c.3030C>T	CCDS34982.2	1	.	.	.	.	.	.	.	.	.	.	C	9.774	1.173584	0.21704	.	.	ENSG00000107036	ENST00000545641	.	.	.	6.04	6.04	0.98038	6.04	6.04	0.98038	.	.	.	.	.	T	0.77336	0.4115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73886	-0.3841	4	.	.	.	-18.4469	20.5948	0.99439	0.0:1.0:0.0:0.0	.	.	.	.	F	902	.	.	L	+	1	0	0	KIAA1432	5755691	5755691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.004000	0.49513	2.873000	0.98535	0.563000	0.77884	CTT	0.296600		TCGA-IB-A6UG-01A-32D-A33T-08	0.433	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3	1	0	1	2	2	2	2	0	0	0	0	178	178	178	178	1	3.280000	-20.000000	1	0.220000			0	98	97	0	859	849	0		1	1		0	0	178	0	0	1.000000	6.977822e-01	0	3	0	20	0	98	859
PTPRD	5789	broad.mit.edu	37	9	8518207	8518207	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr9:8518207G>A	ENST00000381196.4	-	18	1727	c.1184C>T	c.(1183-1185)gCt>gTt	p.A395V	PTPRD_ENST00000537002.1_Missense_Mutation_p.A392V|PTPRD_ENST00000358503.5_Missense_Mutation_p.A382V|PTPRD_ENST00000397617.3_Missense_Mutation_p.A385V|PTPRD_ENST00000360074.4_Missense_Mutation_p.A382V|PTPRD_ENST00000486161.1_Missense_Mutation_p.A395V|PTPRD_ENST00000397606.3_Missense_Mutation_p.A385V|PTPRD_ENST00000355233.5_Missense_Mutation_p.A395V|PTPRD_ENST00000397611.3_Missense_Mutation_p.A392V|PTPRD_ENST00000540109.1_Missense_Mutation_p.A395V|PTPRD_ENST00000356435.5_Missense_Mutation_p.A395V	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	395	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GTTATTGACAGCAACAACCCT	0.527										TSP Lung(15;0.13)																												ENST00000381196.4	0.170000	0.020000	1.200000e-01	4.000000e-02	0.080000	0.089430	0.080000	0.090000																										0				168						c.(1183-1185)gCt>gTt		protein tyrosine phosphatase, receptor type, D							142.0	141.0	141.0					9																	8518207		2203	4300	6503	SO:0001583	missense	5789	0	0					g.chr9:8518207G>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1184C>T	chr9.hg19:g.8518207G>A	ENSP00000370593:p.Ala395Val	1	TSP Lung(15;0.13)				PTPRD_ENST00000360074.4_Missense_Mutation_p.A382V|PTPRD_ENST00000358503.5_Missense_Mutation_p.A382V|PTPRD_ENST00000355233.5_Missense_Mutation_p.A395V|PTPRD_ENST00000356435.5_Missense_Mutation_p.A395V|PTPRD_ENST00000537002.1_Missense_Mutation_p.A392V|PTPRD_ENST00000397606.3_Missense_Mutation_p.A385V|PTPRD_ENST00000397617.3_Missense_Mutation_p.A385V|PTPRD_ENST00000540109.1_Missense_Mutation_p.A395V|PTPRD_ENST00000397611.3_Missense_Mutation_p.A392V|PTPRD_ENST00000486161.1_Missense_Mutation_p.A395V	p.A395V	NM_002839.3	NP_002830.1	0	3	3	1.930506	P23468	PTPRD_HUMAN		18	1727	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	0	1	hg19	c.1184C>T	CCDS43786.1	0	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814087	0.70912	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.16	5.16	0.70880	5.16	5.16	0.70880	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88104	0.6347	H	0.96239	3.79	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D	0.91635	0.999;0.997;0.997;0.997;0.996;0.994;0.969;0.999;0.946	D	0.92021	0.5626	9	.	.	.	.	18.6464	0.91411	0.0:0.0:1.0:0.0	.	385;389;395;395;392;392;382;395;395	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	V	395;395;382;382;395;385;392;392;395;395;395;385	ENSP00000370593:A395V;ENSP00000348812:A395V;ENSP00000353187:A382V;ENSP00000351293:A382V;ENSP00000347373:A395V;ENSP00000380741:A385V;ENSP00000380735:A392V;ENSP00000440515:A392V;ENSP00000438164:A395V;ENSP00000417093:A395V;ENSP00000380731:A385V	.	A	-	2	0	0	PTPRD	8508207	8508207	1.000000	0.71417	1.000000	0.80357	0.159000	0.22180	9.807000	0.99171	2.392000	0.81423	0.460000	0.39030	GCT	0.296600		TCGA-IB-A6UG-01A-32D-A33T-08	0.527	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3	0	0	1	2	2	2	2	0	0	0	0	121	121	121	121	1	3.280000	-2.195254	0	0.220000			0	6	6	0	779	770	0		1	0		0	0	121	0	0	0.963779	0	0	0	0	1	0	6	779
CDKN2A	1029	broad.mit.edu	37	9	21971120	21971120	+	Nonsense_Mutation	SNP	G	G	A	rs121913388		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr9:21971120G>A	ENST00000304494.5	-	2	508	c.238C>T	c.(238-240)Cga>Tga	p.R80*	CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	80			R -> L (in a head and neck tumor).|R -> P (in CMM2; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGCACGGGTCGGGTGAGAGTG	0.726	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17																								1474	Whole gene deletion(1316)|Substitution - Nonsense(100)|Unknown(44)|Substitution - Missense(7)|Deletion - Frameshift(6)|Deletion - In frame(1)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)	haematopoietic_and_lymphoid_tissue(298)|skin(206)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(76)|oesophagus(72)|upper_aerodigestive_tract(63)|soft_tissue(60)|pleura(51)|pancreas(37)|ovary(36)|kidney(32)|breast(32)|biliary_tract(16)|thyroid(15)|NS(14)|stomach(14)|large_intestine(7)|autonomic_ganglia(7)|meninges(7)|liver(6)|salivary_gland(4)|thymus(4)|vulva(3)|endometrium(3)|prostate(2)	4199	GRCh37	CM014695	CDKN2A	M	rs121913388	c.(238-240)Cga>Tga		cyclin-dependent kinase inhibitor 2A							11.0	14.0	13.0					9																	21971120		2172	4246	6418	SO:0001587	stop_gained	1029	0	0					g.chr9:21971120G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.238C>T	chr9.hg19:g.21971120G>A	ENSP00000307101:p.Arg80*	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*	p.R80*	NM_000077.4	NP_000068.1	0	3	3	1.930506	P42771	CD2A1_HUMAN		2	508	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.238C>T	CCDS6510.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.328457|7.328457	0.98214|0.98214	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	D;D|.	0.86497|.	-2.13;-2.02|.	5.93|5.93	5.01|5.01	0.66863|0.66863	5.93|5.93	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.37136|.	N|.	0.002233|.	T|.	0.44561|.	0.1299|.	L|L	0.36672|0.36672	1.1|1.1	0.47511|0.47511	D|D	0.999443|0.999443	D|.	0.59357|.	0.985|.	B|.	0.40602|.	0.334|.	T|.	0.34825|.	-0.9813|.	10|.	0.13108|0.02654	T|T	0.6|1	-2.989|-2.989	8.7197|8.7197	0.34434|0.34434	0.0759:0.0:0.7715:0.1526|0.0759:0.0:0.7715:0.1526	.|.	135|.	Q8N726|.	CD2A2_HUMAN|.	L|X	135;94|80	ENSP00000355153:P135L;ENSP00000432664:P94L|.	ENSP00000355153:P135L|ENSP00000307101:R80X	P|R	-|-	2|1	0|2	0|2	CDKN2A|CDKN2A	21961120|21961120	21961120|21961120	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	2.363000|2.363000	0.44178|0.44178	1.464000|1.464000	0.47987|0.47987	0.650000|0.650000	0.86243|0.86243	CCG|CGA	0.296600		TCGA-IB-A6UG-01A-32D-A33T-08	0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	25	1	3.280000	-6.798055	1	0.220000	NM_000077		0	49	40	0	100	83	0		1	1	1	0	0	28	97	0	1.000000	1	1	97	55	8	116	49	100
COL27A1	85301	broad.mit.edu	37	9	117029789	117029789	+	Silent	SNP	G	G	A	rs377713952		TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chr9:117029789G>A	ENST00000356083.3	+	34	3844	c.3453G>A	c.(3451-3453)ccG>ccA	p.P1151P		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1151	Collagen-like 9.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						TTCAGGGGCCGCCTGGTGCAG	0.562																																						ENST00000356083.3	1.000000	0.580000	1	7.300000e-01	0.920000	0.887802	0.920000	1.000000																										0				80						c.(3451-3453)ccG>ccA		collagen, type XXVII, alpha 1		G		1,4405	2.1+/-5.4	0,1,2202	67.0	73.0	71.0		3453	-10.2	0.0	9		71	0,8600		0,0,4300	no	coding-synonymous	COL27A1	NM_032888.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1151/1861	117029789	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	85301	5	121412	39				g.chr9:117029789G>A	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3453G>A	chr9.hg19:g.117029789G>A		0						p.P1151P	NM_032888.2	NP_116277.2	1	2	3	1.945305	Q8IZC6	CORA1_HUMAN		34	3844	+			Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	1	1	hg19	c.3453G>A	CCDS6802.1	1																																																																																								0.292389		TCGA-IB-A6UG-01A-32D-A33T-08	0.562	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	3.280000	-3.142705	1	0.220000	NM_032888		0	20	20	0	202	201	0		1	0		0	0	30	0	0	0.999996	6.784022e-01	0	0	0	25	0	20	202
SHROOM4	57477	broad.mit.edu	37	X	50376908	50376908	+	Missense_Mutation	SNP	C	C	T	rs3761506	byFrequency	TCGA-IB-A6UG-01A-32D-A33T-08	TCGA-IB-A6UG-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d9c69f8-3543-4192-9cc1-d843dd6cfd19	2bc45b2a-1d0c-4e9b-9d09-a72efe60fd1a	g.chrX:50376908C>T	ENST00000289292.7	-	4	2448	c.2165G>A	c.(2164-2166)cGt>cAt	p.R722H	SHROOM4_ENST00000376020.2_Missense_Mutation_p.R722H|SHROOM4_ENST00000460112.3_Missense_Mutation_p.R606H			Q9ULL8	SHRM4_HUMAN	shroom family member 4	722			R -> H (in dbSNP:rs3761506).		actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					ATGACCTCCACGGACTCCACA	0.557													C|||	18	0.00476821	0.0	0.0014	3775	,	,		14433	0.0169		0.0	False		,,,				2504	0.0					ENST00000289292.7	1.000000	0.690000	9.800000e-01	8.000000e-01	0.900000	0.895021	0.900000	0.990000																										0				52						c.(2164-2166)cGt>cAt		shroom family member 4		C	HIS/ARG	5,3830		0,5,1627,571	57.0	43.0	47.0		2165	-2.1	0.0	X	dbSNP_107	47	0,6728		0,0,2428,1872	yes	missense	SHROOM4	NM_020717.3	29	0,5,4055,2443	TT,TC,CC,C		0.0,0.1304,0.0473	possibly-damaging	722/1494	50376908	5,10558	2203	4300	6503	SO:0001583	missense	57477	153	121410	51				g.chrX:50376908C>T	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.2165G>A	chrX.hg19:g.50376908C>T	ENSP00000289292:p.Arg722His						SHROOM4_ENST00000460112.3_Missense_Mutation_p.R606H|SHROOM4_ENST00000376020.2_Missense_Mutation_p.R722H	p.R722H			0	1	1		Q9ULL8	SHRM4_HUMAN		4	2448	-	Ovarian(276;0.236)		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	1	0	hg19	c.2165G>A	CCDS35277.1	1	9	0.0054249547920434	0	0.0	0	0.0	9	0.01584507042253521	0	0.0	C	0.008	-1.928348	0.00493	0.001304	0.0	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	D;D;D	0.88046	-2.33;-2.33;-2.33	5.52	-2.07	0.07276	5.52	-2.07	0.07276	.	2.325820	0.00911	N	0.002463	T	0.65647	0.2711	L	0.29908	0.895	0.09310	N	1	B	0.17667	0.023	B	0.12837	0.008	T	0.60016	-0.7345	10	0.13470	T	0.59	.	6.0462	0.19762	0.1932:0.4336:0.0:0.3732	rs3761506;rs52829651;rs3761506	722	Q9ULL8	SHRM4_HUMAN	H	722;722;606	ENSP00000289292:R722H;ENSP00000365188:R722H;ENSP00000421450:R606H	ENSP00000289292:R722H	R	-	2	0	0	SHROOM4	50393648	50393648	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.524000	0.06222	-1.613000	0.01577	-3.241000	0.00051	CGT	0.220000		TCGA-IB-A6UG-01A-32D-A33T-08	0.557	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	3.280000	-2.785289	1	0.220000	NM_020717		0	29	29	0	94	91	1		1	0		0	0	34	0	0	1.000000	1.473866e-01	0	0	0	3	0	29	94
