#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PER1	5187	broad.mit.edu	37	17	8049954	8049955	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr17:8049954_8049955insT	ENST00000317276.4	-	15	2101_2102	c.1864_1865insA	c.(1864-1866)agcfs	p.S622fs	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Frame_Shift_Ins_p.S602fs|PER1_ENST00000354903.5_Frame_Shift_Ins_p.S606fs	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	622	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTAGGAGCAGCTGGAGGCTTCT	0.639			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																														ENST00000317276.4	0.540000	0.290000	0.480000	0.350000	0.410000	0.418874	0.410000	0.410000				Dom	yes			Dom	yes		17	17p13.1-17p12	17p13.1-17p12	5187	T	period homolog 1 (Drosophila)				L	L	ETV6		AML, CMML		0				47						c.(1864-1866)agcfs	Other conserved DNA damage response genes	period circadian clock 1																																				SO:0001589	frameshift_variant	5187	0	0					g.chr17:8049954_8049955insT	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1865dupA	chr17.hg19:g.8049955_8049955dupT	ENSP00000314420:p.Ser622fs	1					PER1_ENST00000581082.1_Frame_Shift_Ins_p.S602fs|PER1_ENST00000354903.5_Frame_Shift_Ins_p.S606fs|PER1_ENST00000578089.1_5'Flank	p.S622fs	NM_002616.2	NP_002607.2	0	1	1	1.681783	O15534	PER1_HUMAN		15	2101_2102	-			B2RPA8|B4DI49|D3DTR3	Frame_Shift_Ins	INS	ENST00000317276.4	0	1	hg19	c.1864_1865insA	CCDS11131.1	0																																																																																								0.284071		TCGA-IB-A7M4-01A-11D-A36O-08	0.639	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2	1	0	1		2	2		0	0	0	0	62	0	62	60	1	1.980000	-20.000000	1	0.440000			0	37	37	0	281	276	0	0	1	0	0	0	0	62	0	0	1.000000	9.135793e-01	0	0	0	34	0	37	281
ANKRD13C	81573	broad.mit.edu	37	1	70819981	70819981	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:70819981delG	ENST00000370944.4	-	1	424	c.111delC	c.(109-111)accfs	p.T37fs	ANKRD13C_ENST00000262346.6_Frame_Shift_Del_p.T37fs|HHLA3_ENST00000531950.1_5'Flank|HHLA3_ENST00000432224.1_5'Flank|HHLA3_ENST00000359875.5_5'Flank|HHLA3_ENST00000361764.4_5'Flank|HHLA3_ENST00000370940.5_5'Flank	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	37					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						TTCTGGTAAAGGTACCGCCGA	0.602																																						ENST00000370944.4	0.600000	0.370000	0.540000	0.420000	0.470000	0.486081	0.470000	0.480000																										0				19						c.(109-111)accfs		ankyrin repeat domain 13C							55.0	63.0	61.0					1																	70819981		2203	4300	6503	SO:0001589	frameshift_variant	81573	0	0					g.chr1:70819981delG		CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.111delC	chr1.hg19:g.70819981delG	ENSP00000359982:p.Thr37fs	0					HHLA3_ENST00000531950.1_5'Flank|HHLA3_ENST00000432224.1_5'Flank|HHLA3_ENST00000370940.5_5'Flank|HHLA3_ENST00000361764.4_5'Flank|ANKRD13C_ENST00000262346.6_Frame_Shift_Del_p.T37fs|HHLA3_ENST00000359875.5_5'Flank	p.T37fs	NM_030816.4	NP_110443.3	0	0	0	1.943490	Q8N6S4	AN13C_HUMAN		1	424	-			B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Frame_Shift_Del	DEL	ENST00000370944.4	1	1	hg19	c.111delC	CCDS648.2	0																																																																																								0.419569		TCGA-IB-A7M4-01A-11D-A36O-08	0.602	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025903.1	1	0	1		33	2		0	0	0	4	131	0	131	129	1	1.980000	-20.000000	1	0.440000	NM_030816		0	62	106	0	503	485	0	0	1	0	0	0	0	131	0	0	0.999724	4.308822e-01	0	1	0	12	0	62	503
RPL15	6138	broad.mit.edu	37	3	23960714	23960715	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			-	T	-	-		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr3:23960714_23960715insT	ENST00000307839.5	+	4	976_977	c.337_338insT	c.(337-339)ctgfs	p.L113fs	NKIRAS1_ENST00000437230.1_5'Flank|NKIRAS1_ENST00000412028.1_5'Flank|NKIRAS1_ENST00000416026.2_5'Flank|RPL15_ENST00000413699.1_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank|RPL15_ENST00000456530.2_Frame_Shift_Ins_p.L113fs|RPL15_ENST00000415719.1_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000421515.2_Intron|RPL15_ENST00000435882.1_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000415901.2_5'Flank|RPL15_ENST00000354811.5_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000443659.2_5'Flank	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	113					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						CTGTGGGGCTCTGAGAGTCCTG	0.421																																						ENST00000307839.5	1.000000	0.690000	0.960000	0.760000	0.840000	0.855798	0.840000	0.830000																										0				7						c.(337-339)ctgfs		ribosomal protein L15																																				SO:0001589	frameshift_variant	6138	0	0					g.chr3:23960714_23960715insT	AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.338dupT	chr3.hg19:g.23960715_23960715dupT	ENSP00000309334:p.Leu113fs	0					NKIRAS1_ENST00000437230.1_5'Flank|NKIRAS1_ENST00000412028.1_5'Flank|RPL15_ENST00000435882.1_Frame_Shift_Ins_p.L113fs|RPL15_ENST00000415719.1_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000416026.2_5'Flank|NKIRAS1_ENST00000388759.3_5'Flank|RPL15_ENST00000456530.2_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000425478.2_5'Flank|RPL15_ENST00000354811.5_Frame_Shift_Ins_p.L113fs|RPL15_ENST00000413699.1_Frame_Shift_Ins_p.L113fs|NKIRAS1_ENST00000443659.2_5'Flank	p.L113fs	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	2	2	4	2.113889	P61313	RL15_HUMAN		4	976_977	+			P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Frame_Shift_Ins	INS	ENST00000307839.5	0	1	hg19	c.337_338insT	CCDS2640.1	0																																																																																								0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.421	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252885.3	1	0	1		2	2		0	0	0	0	102	0	102	102	1	1.980000	-20.000000	1	0.440000	NM_002948		0	95	90	0	448	412	0	0	1	1	0	0	0	102	0	0	1.000000	1	0	1374	0	7936	0	95	448
VDAC2	7417	broad.mit.edu	37	10	76979095	76979095	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr10:76979095A>G	ENST00000332211.6	+	6	550	c.337A>G	c.(337-339)Acc>Gcc	p.T113A	VDAC2_ENST00000313132.4_Missense_Mutation_p.T128A|VDAC2_ENST00000535553.1_Missense_Mutation_p.T74A|VDAC2_ENST00000543351.1_Missense_Mutation_p.T113A|VDAC2_ENST00000472137.1_3'UTR	NM_003375.3	NP_003366.2	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	113					anion transport (GO:0006820)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein polymerization (GO:0032272)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	10	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	ATTTGATACTACCTTCTCACC	0.239																																						ENST00000332211.6	1.000000	0.790000	1.000000	0.870000	0.960000	0.948667	0.960000	1.000000																										0				10						c.(337-339)Acc>Gcc		voltage-dependent anion channel 2	Dihydroxyaluminium(DB01375)						52.0	54.0	53.0					10																	76979095		2203	4299	6502	SO:0001583	missense	7417	0	0					g.chr10:76979095A>G	BC000165	CCDS7348.1, CCDS53544.1	10q22	2011-11-15			ENSG00000165637	ENSG00000165637		"""Voltage-dependent anion channels"""	12672	protein-coding gene	gene with protein product		193245				7517385, 10049775	Standard	NM_003375		Approved		uc021ptp.1	P45880	OTTHUMG00000018517	ENST00000332211.6:c.337A>G	chr10.hg19:g.76979095A>G	ENSP00000361686:p.Thr113Ala	0					VDAC2_ENST00000472137.1_3'UTR|VDAC2_ENST00000543351.1_Missense_Mutation_p.T113A|VDAC2_ENST00000313132.4_Missense_Mutation_p.T128A|VDAC2_ENST00000535553.1_Missense_Mutation_p.T74A	p.T113A	NM_003375.3	NP_003366.2	1	2	3	2.062135	P45880	VDAC2_HUMAN		6	550	+	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)		Q5VWK1|Q5VWK3|Q6IB40|Q7L3J5|Q9BWK8|Q9Y5I6	Missense_Mutation	SNP	ENST00000332211.6	1	1	hg19	c.337A>G	CCDS7348.1	1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842620	0.51057	.	.	ENSG00000165637	ENST00000298468;ENST00000543351;ENST00000344036;ENST00000332211;ENST00000535553;ENST00000313132;ENST00000447677	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.43478	0.1249	M	0.67569	2.06	0.80722	D	1	B;B;B	0.28082	0.033;0.2;0.149	B;B;B	0.30029	0.11;0.098;0.063	T	0.32161	-0.9917	10	0.23891	T	0.37	.	15.1356	0.72562	1.0:0.0:0.0:0.0	.	74;128;113	B4DKM5;P45880-1;P45880	.;.;VDAC2_HUMAN	A	113;113;113;113;74;128;113	ENSP00000298468:T113A;ENSP00000443092:T113A;ENSP00000344876:T113A;ENSP00000361686:T113A;ENSP00000445901:T74A;ENSP00000361635:T128A;ENSP00000401492:T113A	ENSP00000298468:T113A	T	+	1	0	0	VDAC2	76649101	76649101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.574000	0.82434	1.978000	0.57642	0.460000	0.39030	ACC	0.448493		TCGA-IB-A7M4-01A-11D-A36O-08	0.239	VDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048792.1	1	0	1	2	2	2	2	0	0	0	0	89	89	89	89	1	1.980000	-20.000000	1	0.440000	NM_003375		0	85	84	0	321	315	1		1	1		0	0	89	0	0	1.000000	1	0	223	0	171	0	85	321
NEURL1	9148	broad.mit.edu	37	10	105349367	105349367	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr10:105349367A>C	ENST00000369780.4	+	5	1845	c.1436A>C	c.(1435-1437)gAc>gCc	p.D479A	SH3PXD2A_ENST00000427662.2_Intron|NEURL_ENST00000369777.2_Missense_Mutation_p.D462A	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		479					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CGCCTGTCTGACCCCTTGCTC	0.647																																						ENST00000369780.4	1.000000	0.040000	0.150000	0.070000	0.100000	0.157845	0.100000	0.100000																										0				17						c.(1435-1437)gAc>gCc									80.0	81.0	81.0					10																	105349367		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr10:105349367A>C																												ENST00000369780.4:c.1436A>C	chr10.hg19:g.105349367A>C	ENSP00000358795:p.Asp479Ala	0					NEURL_ENST00000369777.2_Missense_Mutation_p.D462A|SH3PXD2A_ENST00000427662.2_Intron	p.D479A	NM_004210.4	NP_004201.3	1	2	3	2.062135	O76050	NEUL1_HUMAN		5	1845	+			Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	0	1	hg19	c.1436A>C	CCDS7551.1	0	.	.	.	.	.	.	.	.	.	.	A	15.49	2.850177	0.51270	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.100580	0.64402	D	0.000003	T	0.57272	0.2042	M	0.65498	2.005	0.80722	D	1	B	0.17852	0.024	B	0.12156	0.007	T	0.53493	-0.8431	9	0.20046	T	0.44	-30.6731	11.069	0.47993	0.9249:0.0:0.0751:0.0	.	479	O76050	NEU1A_HUMAN	A	479;462	.	ENSP00000358792:D462A	D	+	2	0	0	NEURL	105339357	105339357	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	5.976000	0.70484	1.980000	0.57719	0.459000	0.35465	GAC	0.448493		TCGA-IB-A7M4-01A-11D-A36O-08	0.647	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1	0	0	1	2	2	2	2	0	0	0	0	161	161	161	158	1	1.980000	-2.851309	1	0.440000			0	11	11	0	498	473	0		1	1		0	0	161	0	0	0.997841	5.567946e-02	0	2	0	14	0	11	498
MUC2	4583	broad.mit.edu	37	11	1096405	1096405	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr11:1096405G>A	ENST00000441003.2	+	34	6457	c.6430G>A	c.(6430-6432)Gtg>Atg	p.V2144M	MUC2_ENST00000361558.6_Missense_Mutation_p.V282M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4506					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CTGCACCTACGTGCTGGTGGA	0.602																																						ENST00000441003.2	1.000000	0.830000	1.000000	0.920000	0.990000	0.973574	0.990000	1.000000																										0				102						c.(6430-6432)Gtg>Atg		mucin 2, oligomeric mucus/gel-forming	Pranlukast(DB01411)						90.0	102.0	98.0					11																	1096405		2169	4272	6441	SO:0001583	missense	4583	0	0					g.chr11:1096405G>A	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6430G>A	chr11.hg19:g.1096405G>A	ENSP00000415183:p.Val2144Met	0					MUC2_ENST00000361558.6_Missense_Mutation_p.V282M	p.V2144M	NM_002457.2	NP_002448.2	1	2	3	2.078077	Q02817	MUC2_HUMAN		34	6457	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	Q14878	Missense_Mutation	SNP	ENST00000441003.2	1	1	hg19	c.6430G>A		1	.	.	.	.	.	.	.	.	.	.	g	15.11	2.735694	0.49045	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.62364	0.03;0.03	3.95	3.04	0.35103	3.95	3.04	0.35103	.	.	.	.	.	T	0.75332	0.3835	M	0.80422	2.495	0.09310	N	1	D	0.76494	0.999	P	0.62014	0.897	T	0.63844	-0.6545	9	0.72032	D	0.01	.	9.045	0.36341	0.1805:0.0:0.8195:0.0	.	2144	E7EUV1	.	M	2144;282	ENSP00000415183:V2144M;ENSP00000354885:V282M	ENSP00000354885:V282M	V	+	1	0	0	MUC2	1086405	1086405	1.000000	0.71417	0.942000	0.38095	0.747000	0.42532	3.053000	0.49901	0.869000	0.35703	0.479000	0.44913	GTG	0.449686		TCGA-IB-A7M4-01A-11D-A36O-08	0.602	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	1	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	1.980000	-20.000000	1	0.440000	NM_002457		0	76	75	0	267	264	1		1	1		0	0	92	0	0	1.000000	1	0	68	0	29	0	76	267
MICAL2	9645	broad.mit.edu	37	11	12247727	12247727	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr11:12247727C>G	ENST00000256194.4	+	14	1986	c.1698C>G	c.(1696-1698)gaC>gaG	p.D566E	MICAL2_ENST00000537344.1_Missense_Mutation_p.D566E|MICAL2_ENST00000527546.1_Missense_Mutation_p.D566E|MICAL2_ENST00000342902.5_Missense_Mutation_p.D566E|MICAL2_ENST00000379612.3_Missense_Mutation_p.D566E	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	566	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GCAACTTTGACTCTTTGAATG	0.517																																						ENST00000256194.4	1.000000	0.060000	0.180000	0.090000	0.120000	0.185530	0.120000	0.120000																										0				47						c.(1696-1698)gaC>gaG		microtubule associated monooxygenase, calponin and LIM domain containing 2							95.0	102.0	100.0					11																	12247727		2201	4294	6495	SO:0001583	missense	9645	0	0					g.chr11:12247727C>G	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1698C>G	chr11.hg19:g.12247727C>G	ENSP00000256194:p.Asp566Glu	0					MICAL2_ENST00000537344.1_Missense_Mutation_p.D566E|MICAL2_ENST00000527546.1_Missense_Mutation_p.D566E|MICAL2_ENST00000342902.5_Missense_Mutation_p.D566E|MICAL2_ENST00000379612.3_Missense_Mutation_p.D566E	p.D566E	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	1	2	3	2.078077	O94851	MICA2_HUMAN		14	1986	+			B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	1	1	hg19	c.1698C>G	CCDS7809.1	0	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846635	0.51164	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.39	5.39	0.77823	5.39	5.39	0.77823	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.46308	0.1386	L	0.37750	1.13	0.53005	D	0.999962	B;B;B;B;B	0.10296	0.0;0.001;0.002;0.003;0.0	B;B;B;B;B	0.20184	0.006;0.026;0.028;0.026;0.004	T	0.35450	-0.9788	10	0.28530	T	0.3	.	10.6994	0.45918	0.0:0.879:0.0:0.121	.	566;566;566;566;566	G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;MICA2_HUMAN	E	566;99;566;566;566;566	ENSP00000441689:D566E;ENSP00000256194:D566E;ENSP00000433965:D566E;ENSP00000344894:D566E;ENSP00000368932:D566E	ENSP00000256194:D566E	D	+	3	2	2	MICAL2	12204303	12204303	0.979000	0.34478	1.000000	0.80357	0.988000	0.76386	0.260000	0.18424	2.526000	0.85167	0.563000	0.77884	GAC	0.449686		TCGA-IB-A7M4-01A-11D-A36O-08	0.517	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	0	0	1	2	2	2	2	0	0	0	0	114	114	114	113	1	1.980000	-3.276085	1	0.440000	NM_014632		0	12	12	0	449	442	0		1	1		0	0	114	0	0	0.999054	2.278378e-01	0	2	0	30	0	12	449
OR5B17	219965	broad.mit.edu	37	11	58126293	58126293	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr11:58126293G>T	ENST00000357377.3	-	1	249	c.250C>A	c.(250-252)Ctt>Att	p.L84I		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TCTTCTATAAGCAACCCAGTT	0.458																																						ENST00000357377.3	1.000000	0.810000	1.000000	0.920000	0.990000	0.972913	0.990000	1.000000																										0				30						c.(250-252)Ctt>Att		olfactory receptor, family 5, subfamily B, member 17							85.0	80.0	82.0					11																	58126293		2201	4295	6496	SO:0001583	missense	219965	0	0					g.chr11:58126293G>T	AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.250C>A	chr11.hg19:g.58126293G>T	ENSP00000349945:p.Leu84Ile	0						p.L84I	NM_001005489.1	NP_001005489.1	1	2	3	2.078077	Q8NGF7	OR5BH_HUMAN		1	249	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	Q6IEX1	Missense_Mutation	SNP	ENST00000357377.3	1	1	hg19	c.250C>A	CCDS31548.1	1	.	.	.	.	.	.	.	.	.	.	g	3.439	-0.114369	0.06881	.	.	ENSG00000197786	ENST00000357377	T	0.00529	6.78	3.41	2.49	0.30216	3.41	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.526148	0.14194	U	0.335150	T	0.00724	0.0024	M	0.73430	2.235	0.09310	N	1	B	0.20261	0.043	B	0.27608	0.081	T	0.34650	-0.9820	10	0.66056	D	0.02	-6.3521	9.1737	0.37098	0.1124:0.0:0.8876:0.0	.	84	Q8NGF7	OR5BH_HUMAN	I	84	ENSP00000349945:L84I	ENSP00000349945:L84I	L	-	1	0	0	OR5B17	57882869	57882869	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	-0.201000	0.09464	0.635000	0.30488	0.461000	0.40582	CTT	0.449686		TCGA-IB-A7M4-01A-11D-A36O-08	0.458	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.980000	-20.000000	1	0.440000	NM_001005489		0	53	53	0	182	182	1		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	53	182
KLC2	64837	broad.mit.edu	37	11	66029401	66029401	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr11:66029401C>A	ENST00000417856.1	+	3	660	c.417C>A	c.(415-417)ttC>ttA	p.F139L	RP11-867G23.1_ENST00000530805.1_RNA|KLC2_ENST00000421552.1_Intron|KLC2_ENST00000394067.2_Missense_Mutation_p.F139L|KLC2_ENST00000394066.2_Intron|KLC2_ENST00000394078.1_Missense_Mutation_p.F139L|KLC2_ENST00000394065.2_De_novo_Start_InFrame|KLC2_ENST00000316924.5_Missense_Mutation_p.F139L|RP11-755F10.3_ENST00000533576.1_RNA	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	139					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						ACTTGCTGTTCATGAGCCAGA	0.632																																						ENST00000417856.1	1.000000	0.080000	0.280000	0.130000	0.190000	0.247540	0.190000	0.180000																										0				24						c.(415-417)ttC>ttA		kinesin light chain 2							84.0	67.0	73.0					11																	66029401		2200	4295	6495	SO:0001583	missense	64837	0	0					g.chr11:66029401C>A	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.417C>A	chr11.hg19:g.66029401C>A	ENSP00000399403:p.Phe139Leu	0					RP11-867G23.1_ENST00000530805.1_RNA|KLC2_ENST00000316924.5_Missense_Mutation_p.F139L|KLC2_ENST00000394066.2_Intron|KLC2_ENST00000394065.2_De_novo_Start_InFrame|RP11-755F10.3_ENST00000533576.1_RNA|KLC2_ENST00000394078.1_Missense_Mutation_p.F139L|KLC2_ENST00000394067.2_Missense_Mutation_p.F139L|KLC2_ENST00000421552.1_Intron	p.F139L	NM_001134775.1	NP_001128247.1	1	2	3	2.078077	Q9H0B6	KLC2_HUMAN		3	660	+			A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	ENST00000417856.1	1	0	hg19	c.417C>A	CCDS8130.1	0	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065877	0.76187	.	.	ENSG00000174996	ENST00000417856;ENST00000526758;ENST00000440228;ENST00000394067;ENST00000316924;ENST00000394078;ENST00000475757	T;T;T;T;T;T;T	0.75154	0.85;0.85;-0.91;0.85;0.85;0.85;-0.91	4.15	3.23	0.37069	4.15	3.23	0.37069	Rabaptin, GTPase-Rab5 binding (1);	0.000000	0.64402	D	0.000001	D	0.84037	0.5384	M	0.87827	2.91	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.74348	0.983;0.973	T	0.82032	-0.0658	10	0.44086	T	0.13	-18.3166	5.6991	0.17873	0.0:0.6847:0.0:0.3153	.	139;139	A8MX29;Q9H0B6	.;KLC2_HUMAN	L	139	ENSP00000399403:F139L;ENSP00000437026:F139L;ENSP00000396952:F139L;ENSP00000377631:F139L;ENSP00000314837:F139L;ENSP00000377641:F139L;ENSP00000431253:F139L	ENSP00000314837:F139L	F	+	3	2	2	KLC2	65785977	65785977	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.567000	0.36407	0.953000	0.37825	0.561000	0.74099	TTC	0.449686		TCGA-IB-A7M4-01A-11D-A36O-08	0.632	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	72	1	1.980000	-3.222809	1	0.440000	NM_022822		0	9	9	0	224	222	0		1	0		0	0	73	0	0	0.994259	6.789423e-01	0	0	0	58	0	9	224
IGSF9B	22997	broad.mit.edu	37	11	133807360	133807360	+	Missense_Mutation	SNP	G	G	A	rs534012086		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr11:133807360G>A	ENST00000321016.8	-	5	820	c.590C>T	c.(589-591)tCg>tTg	p.S197L	IGSF9B_ENST00000533871.2_Missense_Mutation_p.S197L			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	197	Ig-like 2.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCGACTGACCGATGTCACTGT	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17434	0.0		0.0	False		,,,				2504	0.0					ENST00000321016.8	1.000000	0.980000	1.000000	0.990000	0.990000	0.998713	0.990000	1.000000																										0				44						c.(589-591)tCg>tTg		immunoglobulin superfamily, member 9B							61.0	70.0	67.0					11																	133807360		2179	4251	6430	SO:0001583	missense	22997	8	121246	38				g.chr11:133807360G>A	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.590C>T	chr11.hg19:g.133807360G>A	ENSP00000317980:p.Ser197Leu	0					IGSF9B_ENST00000533871.2_Missense_Mutation_p.S197L	p.S197L			1	2	3	2.078077	Q9UPX0	TUTLB_HUMAN		5	820	-	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	1	1	hg19	c.590C>T		1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551849	0.65311	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648;ENST00000533160	T;T;T;D	0.96459	-0.76;-1.21;-0.76;-4.02	5.54	4.6	0.57074	5.54	4.6	0.57074	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.96380	0.8819	M	0.62266	1.93	0.09310	N	0.999997	D	0.52996	0.957	P	0.50537	0.643	D	0.91429	0.5164	9	0.52906	T	0.07	.	15.4985	0.75677	0.0:0.0:0.8604:0.1396	.	197	Q9UPX0	TUTLB_HUMAN	L	197;39;197;187	ENSP00000317980:S197L;ENSP00000436552:S39L;ENSP00000436576:S197L;ENSP00000434026:S187L	ENSP00000317980:S197L	S	-	2	0	0	IGSF9B	133312570	133312570	0.981000	0.34729	0.039000	0.18376	0.979000	0.70002	4.882000	0.63121	1.289000	0.44618	0.561000	0.74099	TCG	0.449686		TCGA-IB-A7M4-01A-11D-A36O-08	0.607	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.980000	-5.518651	1	0.440000	XM_290502		0	70	68	0	195	190	1		1	0		0	0	80	0	0	1.000000	0	0	1	0	0	0	70	195
ETV6	2120	broad.mit.edu	37	12	12037406	12037406	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr12:12037406A>G	ENST00000396373.4	+	6	1311	c.1037A>G	c.(1036-1038)tAt>tGt	p.Y346C		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	346					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GATTACGTCTATCAGTTGCTT	0.438			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	ENST00000396373.4	0.970000	0.720000	0.900000	0.770000	0.830000	0.842768	0.830000	0.840000				Dom	yes			Dom	yes		12	12p13	12p13	2120	T	ets variant gene 6 (TEL oncogene)				"""L, E, M"""	L, E, M	NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5		congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	0				45						c.(1036-1038)tAt>tGt		ets variant 6							184.0	163.0	170.0					12																	12037406		2203	4300	6503	SO:0001583	missense	2120	0	0					g.chr12:12037406A>G	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1037A>G	chr12.hg19:g.12037406A>G	ENSP00000379658:p.Tyr346Cys	0						p.Y346C	NM_001987.4	NP_001978.1	1	2	3	2.019051	P41212	ETV6_HUMAN		6	1311	+		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	ENST00000396373.4	1	1	hg19	c.1037A>G	CCDS8643.1	0	.	.	.	.	.	.	.	.	.	.	A	23.9	4.475803	0.84640	.	.	ENSG00000139083	ENST00000396373	T	0.14640	2.49	5.77	5.77	0.91146	5.77	5.77	0.91146	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.34978	0.0916	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03068	-1.1076	10	0.62326	D	0.03	.	15.7572	0.78043	1.0:0.0:0.0:0.0	.	346	P41212	ETV6_HUMAN	C	346	ENSP00000379658:Y346C	ENSP00000379658:Y346C	Y	+	2	0	0	ETV6	11928673	11928673	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.199000	0.70637	0.533000	0.62120	TAT	0.441229		TCGA-IB-A7M4-01A-11D-A36O-08	0.438	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	1	0	1	2	2	2	2	0	0	0	0	244	244	244	243	1	1.980000	-20.000000	1	0.440000	NM_001987		0	153	153	0	676	668	1		1	1		0	0	244	0	0	1.000000	9.998816e-01	0	22	0	37	0	153	676
PWP1	11137	broad.mit.edu	37	12	108091262	108091262	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr12:108091262G>A	ENST00000412830.3	+	7	800	c.632G>A	c.(631-633)gGa>gAa	p.G211E	PWP1_ENST00000541166.1_Missense_Mutation_p.G149E	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	211					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						ATTGCTGTAGGAAACATGACC	0.348																																						ENST00000412830.3	1.000000	0.180000	1.000000	0.220000	0.270000	0.411469	0.270000	0.260000																										0				23						c.(631-633)gGa>gAa		PWP1 homolog (S. cerevisiae)							133.0	127.0	129.0					12																	108091262		2203	4300	6503	SO:0001583	missense	11137	0	0					g.chr12:108091262G>A	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.632G>A	chr12.hg19:g.108091262G>A	ENSP00000387365:p.Gly211Glu	1					PWP1_ENST00000541166.1_Missense_Mutation_p.G149E	p.G211E	NM_007062.1	NP_008993.1	2	3	5	2.383851	Q13610	PWP1_HUMAN		7	800	+			A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	1	1	hg19	c.632G>A	CCDS9114.1	0	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936030	0.92458	.	.	ENSG00000136045	ENST00000412830;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.44083	0.93;1.7	5.88	5.88	0.94601	5.88	5.88	0.94601	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.091825	0.85682	D	0.000000	T	0.73830	0.3637	M	0.93898	3.47	0.80722	D	1	D	0.59357	0.985	D	0.63488	0.915	T	0.80221	-0.1472	10	0.87932	D	0	.	19.8332	0.96644	0.0:0.0:1.0:0.0	.	211	Q13610	PWP1_HUMAN	E	211;211;211;211;149	ENSP00000387365:G211E;ENSP00000445249:G149E	ENSP00000258531:G211E	G	+	2	0	0	PWP1	106615392	106615392	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.039000	0.93777	2.779000	0.95612	0.637000	0.83480	GGA	0.527346		TCGA-IB-A7M4-01A-11D-A36O-08	0.348	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	1	0	1	2	2	2	2	0	0	0	0	159	159	159	159	1	1.980000	-5.311288	1	0.440000	NM_007062		0	31	30	0	604	595	0		1	1		0	0	159	0	0	1.000000	9.788459e-01	0	13	0	109	0	31	604
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.810000	1.000000	0.890000	0.990000	0.961391	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.019051	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.441229		TCGA-IB-A7M4-01A-11D-A36O-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	1.980000	-20.000000	1	0.440000	NM_033360		1858	81	81	6158	289	288	1	1	1	1	1	0	0	89	305	1	1.000000	9.590678e-01	1	9	72	12	304	81	289
OR6C6	283365	broad.mit.edu	37	12	55688832	55688832	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr12:55688832C>T	ENST00000358433.2	-	1	184	c.185G>A	c.(184-186)cGt>cAt	p.R62H		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GGAGAAATTACGGAGAAAGAA	0.388																																						ENST00000358433.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999175	0.990000	1.000000																										0				20						c.(184-186)cGt>cAt		olfactory receptor, family 6, subfamily C, member 6							64.0	67.0	66.0					12																	55688832		2203	4300	6503	SO:0001583	missense	283365	3	121400	39				g.chr12:55688832C>T		CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.185G>A	chr12.hg19:g.55688832C>T	ENSP00000351211:p.Arg62His	0						p.R62H	NM_001005493.1	NP_001005493.1	1	2	3	2.019051	A6NF89	OR6C6_HUMAN		1	184	-				Missense_Mutation	SNP	ENST00000358433.2	1	1	hg19	c.185G>A	CCDS31817.1	1	.	.	.	.	.	.	.	.	.	.	-	3.881	-0.025966	0.07589	.	.	ENSG00000188324	ENST00000358433	T	0.01084	5.36	4.24	0.321	0.15883	4.24	0.321	0.15883	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	D	0.000517	T	0.01800	0.0057	M	0.84219	2.685	0.09310	N	1	B	0.15719	0.014	B	0.12837	0.008	T	0.43065	-0.9414	10	0.66056	D	0.02	.	2.1956	0.03910	0.1224:0.4226:0.1199:0.335	.	62	A6NF89	OR6C6_HUMAN	H	62	ENSP00000351211:R62H	ENSP00000351211:R62H	R	-	2	0	0	OR6C6	53975099	53975099	0.000000	0.05858	0.001000	0.08648	0.063000	0.16089	-1.335000	0.02662	-0.046000	0.13446	-1.274000	0.01402	CGT	0.441229		TCGA-IB-A7M4-01A-11D-A36O-08	0.388	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398151.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.980000	-6.084236	1	0.440000			0	80	80	0	217	214	1		1			0	0	79	0	0	1.000000	0	0	0	0	0	0	80	217
TMTC3	160418	broad.mit.edu	37	12	88568385	88568385	+	Splice_Site	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr12:88568385G>A	ENST00000266712.6	+	9	1421	c.1201G>A	c.(1201-1203)Gta>Ata	p.V401I		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	401					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)		p.V401I(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						CTTAAACAGTGTATTTAAAAA	0.318																																						ENST00000266712.6	1.000000	0.810000	1.000000	0.890000	0.970000	0.956618	0.970000	1.000000																										1	Substitution - Missense(1)	p.V401I(1)	prostate(1)	31						c.(1201-1203)Gta>Ata		transmembrane and tetratricopeptide repeat containing 3							78.0	79.0	79.0					12																	88568385		2203	4298	6501	SO:0001630	splice_region_variant	160418	0	0					g.chr12:88568385G>A		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1200-1G>A	chr12.hg19:g.88568385G>A		1						p.V401I	NM_181783.3	NP_861448.2	0	0	0	1.618708	Q6ZXV5	TMTC3_HUMAN		9	1421	+			Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Splice_Site	SNP	ENST00000266712.6	1	0	hg19	c.1201G>A	CCDS9032.1	1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439040	0.25900	.	.	ENSG00000139324	ENST00000266712	T	0.42131	0.98	5.71	4.83	0.62350	5.71	4.83	0.62350	.	0.468547	0.24436	N	0.038556	T	0.28797	0.0714	L	0.27053	0.805	0.26494	N	0.974889	B	0.15930	0.015	B	0.20384	0.029	T	0.16188	-1.0411	10	0.22109	T	0.4	-12.395	9.9853	0.41839	0.2109:0.0:0.7891:0.0	.	401	Q6ZXV5-2	.	I	401	ENSP00000266712:V401I	ENSP00000266712:V401I	V	+	1	0	0	TMTC3	87092516	87092516	0.997000	0.39634	0.990000	0.47175	0.786000	0.44442	0.928000	0.28831	1.426000	0.47256	-0.136000	0.14681	GTA	0.297894		TCGA-IB-A7M4-01A-11D-A36O-08	0.318	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	1	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	1.980000	-20.000000	1	0.440000	NM_181783	Missense_Mutation	0	89	89	0	233	228	1		1	1		0	0	106	0	0	1.000000	3.097978e-01	0	4	0	0	0	89	233
PITPNM2	57605	broad.mit.edu	37	12	123482085	123482085	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr12:123482085G>T	ENST00000542749.1	-	9	1322	c.1259C>A	c.(1258-1260)tCc>tAc	p.S420Y	PITPNM2_ENST00000320201.4_Missense_Mutation_p.S420Y|PITPNM2_ENST00000451868.2_5'Flank|PITPNM2_ENST00000280562.5_Missense_Mutation_p.S420Y|PITPNM2_ENST00000392428.1_Missense_Mutation_p.S141Y			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	420					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GTGGATCTTGGAGGGCGGTGC	0.657																																						ENST00000542749.1	1.000000	0.910000	1.000000	0.990000	0.990000	0.993566	0.990000	1.000000																										0				39						c.(1258-1260)tCc>tAc		phosphatidylinositol transfer protein, membrane-associated 2							94.0	90.0	92.0					12																	123482085		2203	4300	6503	SO:0001583	missense	57605	0	0					g.chr12:123482085G>T	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1259C>A	chr12.hg19:g.123482085G>T	ENSP00000437611:p.Ser420Tyr	0					PITPNM2_ENST00000280562.5_Missense_Mutation_p.S420Y|PITPNM2_ENST00000320201.4_Missense_Mutation_p.S420Y|PITPNM2_ENST00000392428.1_Missense_Mutation_p.S141Y|PITPNM2_ENST00000451868.2_5'Flank	p.S420Y			0	1	1	2.005753	Q9BZ72	PITM2_HUMAN		9	1322	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		Q9P271	Missense_Mutation	SNP	ENST00000542749.1	1	1	hg19	c.1259C>A	CCDS9242.1	1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730448	0.69074	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.83	3.93	0.45458	4.83	3.93	0.45458	.	0.417988	0.23797	N	0.044466	T	0.22360	0.0539	N	0.08118	0	0.37075	D	0.898715	D;D	0.62365	0.98;0.991	P;P	0.58721	0.844;0.73	T	0.35624	-0.9781	10	0.87932	D	0	-38.3331	14.0007	0.64431	0.0:0.4813:0.5187:0.0	.	420;420	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	Y	420;420;141;420	ENSP00000280562:S420Y;ENSP00000322218:S420Y;ENSP00000376223:S141Y;ENSP00000437611:S420Y	ENSP00000280562:S420Y	S	-	2	0	0	PITPNM2	122048038	122048038	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.154000	0.64894	1.019000	0.39547	-0.300000	0.09419	TCC	0.427403		TCGA-IB-A7M4-01A-11D-A36O-08	0.657	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	1	0	1	2	2	2	2	0	0	0	0	147	147	147	145	1	1.980000	-20.000000	1	0.440000	NM_020845		0	129	128	0	401	392	1		1	0		0	0	147	0	0	1.000000	6.005868e-02	0	0	0	2	0	129	401
WASF3	10810	broad.mit.edu	37	13	27259854	27259854	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr13:27259854C>T	ENST00000335327.5	+	10	1559	c.1381C>T	c.(1381-1383)Cgg>Tgg	p.R461W	WASF3_ENST00000361042.4_Missense_Mutation_p.R458W	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	461					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		GCAGGAGCAGCGGGAGCAGGA	0.532																																						ENST00000335327.5	0.910000	0.550000	0.820000	0.630000	0.720000	0.733442	0.720000	0.730000																										0				22						c.(1381-1383)Cgg>Tgg		WAS protein family, member 3							113.0	95.0	101.0					13																	27259854		2203	4300	6503	SO:0001583	missense	10810	0	0					g.chr13:27259854C>T	AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.1381C>T	chr13.hg19:g.27259854C>T	ENSP00000335055:p.Arg461Trp	0					WASF3_ENST00000361042.4_Missense_Mutation_p.R458W	p.R461W	NM_006646.5	NP_006637.2	0	0	0	1.892462	Q9UPY6	WASF3_HUMAN		10	1559	+	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	1	1	hg19	c.1381C>T	CCDS9318.1	0	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650714	0.87958	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.42900	0.96;0.96	5.75	5.75	0.90469	5.75	5.75	0.90469	.	0.110713	0.64402	D	0.000004	T	0.61763	0.2373	L	0.52364	1.645	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.91	T	0.58205	-0.7677	10	0.48119	T	0.1	-11.9041	19.9239	0.97097	0.0:1.0:0.0:0.0	.	458;461	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	W	458;461	ENSP00000354325:R458W;ENSP00000335055:R461W	ENSP00000335055:R461W	R	+	1	2	2	WASF3	26157854	26157854	1.000000	0.71417	0.984000	0.44739	0.961000	0.63080	5.562000	0.67346	2.716000	0.92895	0.561000	0.74099	CGG	0.406025		TCGA-IB-A7M4-01A-11D-A36O-08	0.532	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	76	1	1.980000	-3.187230	1	0.440000			0	53	53	0	259	255	1		1	0		0	0	77	0	0	1.000000	1.404639e-01	0	0	0	4	0	53	259
MTUS2	23281	broad.mit.edu	37	13	29600278	29600278	+	Silent	SNP	G	G	A	rs201515125		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr13:29600278G>A	ENST00000431530.3	+	1	1531	c.1473G>A	c.(1471-1473)acG>acA	p.T491T		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	481						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGAACAAGACGGAGGTGCCTG	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19886	0.0		0.0	False		,,,				2504	0.0					ENST00000431530.3	1.000000	0.580000	0.910000	0.680000	0.790000	0.799003	0.790000	1.000000																										0				20						c.(1471-1473)acG>acA		microtubule associated tumor suppressor candidate 2		G		0,3934		0,0,1967	83.0	90.0	88.0		1473	-3.7	0.0	13		88	1,8305		0,1,4152	no	coding-synonymous	MTUS2	NM_001033602.2		0,1,6119	AA,AG,GG		0.012,0.0,0.0082		491/1380	29600278	1,12239	1967	4153	6120	SO:0001819	synonymous_variant	23281	2	120898	32				g.chr13:29600278G>A	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1473G>A	chr13.hg19:g.29600278G>A		0						p.T491T	NM_001033602.2	NP_001028774.2	0	0	0	1.892462	Q5JR59	MTUS2_HUMAN		1	1531	+			A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000431530.3	1	1	hg19	c.1473G>A	CCDS45022.1	0																																																																																								0.406025		TCGA-IB-A7M4-01A-11D-A36O-08	0.517	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	1	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.980000	-2.976986	1	0.440000	XM_166270		0	38	37	0	167	166	1		1			0	0	70	0	0	1.000000	0	0	0	0	0	0	38	167
IRS2	8660	broad.mit.edu	37	13	110436560	110436560	+	Missense_Mutation	SNP	G	G	A	rs567423781		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr13:110436560G>A	ENST00000375856.3	-	1	2355	c.1841C>T	c.(1840-1842)cCg>cTg	p.P614L		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	614					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GGGGCAGGACGGGCAGAGGCG	0.697													.|||	1	0.000199681	0.0	0.0	5008	,	,		10826	0.0		0.0	False		,,,				2504	0.001				Melanoma(100;613 2409 40847)	ENST00000375856.3	0.740000	0.120000	0.550000	0.220000	0.360000	0.392743	0.360000	0.320000																										0				19						c.(1840-1842)cCg>cTg		insulin receptor substrate 2							13.0	17.0	15.0					13																	110436560		2185	4285	6470	SO:0001583	missense	8660	4	119534	31				g.chr13:110436560G>A	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.1841C>T	chr13.hg19:g.110436560G>A	ENSP00000365016:p.Pro614Leu	0						p.P614L	NM_003749.2	NP_003740.2	0	0	0	1.892462	Q9Y4H2	IRS2_HUMAN	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)	1	2355	-	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	0	1	hg19	c.1841C>T	CCDS9510.1	0	.	.	.	.	.	.	.	.	.	.	G	1.859	-0.463098	0.04476	.	.	ENSG00000185950	ENST00000375856	T	0.17213	2.29	4.2	4.2	0.49525	4.2	4.2	0.49525	.	0.965381	0.08540	U	0.930734	T	0.13670	0.0331	L	0.44542	1.39	0.42996	D	0.994506	B	0.34329	0.449	B	0.16722	0.016	T	0.15263	-1.0443	10	0.10636	T	0.68	-11.5	13.8503	0.63492	0.0:0.0:1.0:0.0	.	614	Q9Y4H2	IRS2_HUMAN	L	614	ENSP00000365016:P614L	ENSP00000365016:P614L	P	-	2	0	0	IRS2	109234561	109234561	0.977000	0.34250	0.980000	0.43619	0.886000	0.51366	2.612000	0.46343	2.156000	0.67533	0.549000	0.68633	CCG	0.406025		TCGA-IB-A7M4-01A-11D-A36O-08	0.697	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.980000	-8.898715	1	0.440000	NM_003749		0	4	4	0	47	46	0		1	1		0	0	18	0	0	0.888377	7.050339e-01	0	6	0	23	0	4	47
MTHFD1	4522	broad.mit.edu	37	14	64854981	64854981	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr14:64854981C>T	ENST00000545908.1	+	1	233	c.4C>T	c.(4-6)Cgc>Tgc	p.R2C	MTHFD1_ENST00000216605.8_5'Flank			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	0	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	ACTGCGCATGCGCCACCGCGT	0.627																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	ENST00000545908.1	1.000000	0.230000	1.000000	0.390000	0.640000	0.678621	0.640000	1.000000																										0				30						c.(4-6)Cgc>Tgc		methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	Tetrahydrofolic acid(DB00116)																																			SO:0001583	missense	4522	0	0					g.chr14:64854981C>T	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.4C>T	chr14.hg19:g.64854981C>T	ENSP00000438588:p.Arg2Cys	1					MTHFD1_ENST00000216605.8_5'Flank	p.R2C			0	3	3	2.177319	P11586	C1TC_HUMAN		1	233	+			B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	0	1	hg19	c.4C>T		0	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172108	0.38315	.	.	ENSG00000100714	ENST00000545908;ENST00000216605	T;T	0.13089	2.62;2.7	4.54	0.576	0.17380	4.54	0.576	0.17380	.	.	.	.	.	T	0.08537	0.0212	.	.	.	0.20074	N	0.999934	B	0.06786	0.001	B	0.04013	0.001	T	0.37197	-0.9716	8	0.87932	D	0	.	1.4441	0.02360	0.1748:0.4661:0.1695:0.1896	.	2	F5H2F4	.	C	2	ENSP00000438588:R2C;ENSP00000216605:R2C	ENSP00000438588:R2C	R	+	1	0	0	MTHFD1	63924734	63924734	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.268000	0.18571	0.094000	0.17404	-0.140000	0.14226	CGC	0.488398		TCGA-IB-A7M4-01A-11D-A36O-08	0.627	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1	0	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	1.980000	-11.159780	1	0.440000			0	5	5	0	43	43	0		1	0		0	0	13	0	0	0.941063	4.434389e-02	0	0	0	3	0	5	43
CSPG4	1464	broad.mit.edu	37	15	75977834	75977834	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr15:75977834G>A	ENST00000308508.5	-	4	4090	c.3998C>T	c.(3997-3999)tCg>tTg	p.S1333L		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1333	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CACATCCAGCGAGAAGGCATC	0.662																																						ENST00000308508.5	1.000000	0.760000	0.990000	0.870000	0.940000	0.933968	0.940000	0.990000																										0				48						c.(3997-3999)tCg>tTg		chondroitin sulfate proteoglycan 4							17.0	18.0	17.0					15																	75977834		2188	4287	6475	SO:0001583	missense	1464	2	121050	31				g.chr15:75977834G>A	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3998C>T	chr15.hg19:g.75977834G>A	ENSP00000312506:p.Ser1333Leu	1						p.S1333L	NM_001897.4	NP_001888.2	0	1	1	1.648770	Q6UVK1	CSPG4_HUMAN		4	4090	-			D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	0	1	hg19	c.3998C>T	CCDS10284.1	1	.	.	.	.	.	.	.	.	.	.	.	10.07	1.250306	0.22880	.	.	ENSG00000173546	ENST00000308508	T	0.19669	2.13	4.76	3.78	0.43462	4.76	3.78	0.43462	.	0.428701	0.21773	N	0.069329	T	0.11110	0.0271	L	0.27053	0.805	0.30136	N	0.804328	B	0.31837	0.342	B	0.17098	0.017	T	0.08006	-1.0743	10	0.20519	T	0.43	.	8.5151	0.33242	0.0964:0.1601:0.7435:0.0	.	1333	Q6UVK1	CSPG4_HUMAN	L	1333	ENSP00000312506:S1333L	ENSP00000312506:S1333L	S	-	2	0	0	CSPG4	73764889	73764889	1.000000	0.71417	0.993000	0.49108	0.240000	0.25518	3.390000	0.52523	2.356000	0.79943	0.505000	0.49811	TCG	0.282051		TCGA-IB-A7M4-01A-11D-A36O-08	0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.980000	-20.000000	1	0.440000	NM_001897		0	24	23	0	34	32	1		1	1		0	0	18	0	0	1.000000	9.982334e-01	0	17	0	2	0	24	34
TBL3	10607	broad.mit.edu	37	16	2024811	2024811	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr16:2024811G>A	ENST00000568546.1	+	6	555	c.427G>A	c.(427-429)Ggg>Agg	p.G143R		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	143					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						GCGGCACTACGGGACACACCA	0.662																																					Melanoma(118;616 1651 35077 38081 48633)	ENST00000568546.1	1.000000	0.060000	0.220000	0.090000	0.140000	0.229200	0.140000	0.130000																										0				18						c.(427-429)Ggg>Agg		transducin (beta)-like 3							68.0	61.0	63.0					16																	2024811		2198	4300	6498	SO:0001583	missense	10607	4	121394	39				g.chr16:2024811G>A	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.427G>A	chr16.hg19:g.2024811G>A	ENSP00000454836:p.Gly143Arg	0						p.G143R	NM_006453.2	NP_006444.2	2	2	4	2.114976	Q12788	TBL3_HUMAN		6	555	+			Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	0	1	hg19	c.427G>A	CCDS10453.1	0	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145173	0.57044	.	.	ENSG00000183751	ENST00000332704	.	.	.	4.97	4.97	0.65823	4.97	4.97	0.65823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.611855	0.18098	N	0.151764	T	0.40498	0.1119	N	0.02247	-0.625	0.42212	D	0.991811	D	0.89917	1.0	D	0.67548	0.952	T	0.50882	-0.8775	9	0.45353	T	0.12	-35.2202	11.1898	0.48679	0.0:0.0:0.7045:0.2955	.	143	Q12788	TBL3_HUMAN	R	143	.	ENSP00000331815:G143R	G	+	1	0	0	TBL3	1964812	1964812	1.000000	0.71417	0.943000	0.38184	0.307000	0.27823	6.648000	0.74359	2.301000	0.77427	0.561000	0.74099	GGG	0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.662	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	0	0	1	2	2	2	2	0	0	0	0	80	80	80	78	1	1.980000	-2.924339	1	0.440000	NM_006453		0	9	9	0	314	306	0		1	1		0	0	80	0	0	0.993707	7.744434e-01	0	3	0	97	0	9	314
PKD1	5310	broad.mit.edu	37	16	2161454	2161454	+	Silent	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr16:2161454G>A	ENST00000262304.4	-	15	3922	c.3714C>T	c.(3712-3714)ggC>ggT	p.G1238G	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.G1238G	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1238	PKD 7. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TGATGTTGTCGCCCGTCTGCA	0.672																																						ENST00000262304.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999714	0.990000	1.000000																										0				72						c.(3712-3714)ggC>ggT		polycystic kidney disease 1 (autosomal dominant)							19.0	18.0	18.0					16																	2161454		2109	4165	6274	SO:0001819	synonymous_variant	5310	9	119332	37				g.chr16:2161454G>A	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3714C>T	chr16.hg19:g.2161454G>A		0					RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.G1238G	p.G1238G	NM_001009944.2	NP_001009944	2	2	4	2.114976	P98161	PKD1_HUMAN		15	3922	-			Q15140|Q15141	Silent	SNP	ENST00000262304.4	1	1	hg19	c.3714C>T	CCDS32369.1	1																																																																																								0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1	0	0	1	2	16	2	2	1	1	1	1	35	35	35	35	1	1.980000	-20.000000	1	0.440000			0	50	49	0	124	121	1		1	1		1	0	35	0	0	0.999999	5.511203e-01	0	2	0	4	0	50	124
SMCR8	140775	broad.mit.edu	37	17	18220237	18220237	+	Silent	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr17:18220237C>T	ENST00000406438.3	+	1	1614	c.1134C>T	c.(1132-1134)gtC>gtT	p.V378V	TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	378						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TTGTGGAGGTCGATGACAGGA	0.448																																						ENST00000406438.3	1.000000	0.740000	0.970000	0.820000	0.890000	0.898563	0.890000	0.920000																										0				21						c.(1132-1134)gtC>gtT		Smith-Magenis syndrome chromosome region, candidate 8							108.0	107.0	107.0					17																	18220237		2203	4300	6503	SO:0001819	synonymous_variant	140775	0	0					g.chr17:18220237C>T	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1134C>T	chr17.hg19:g.18220237C>T		1					TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank	p.V378V	NM_144775.2	NP_658988.2	0	1	1	1.681783	Q8TEV9	SMCR8_HUMAN		1	1614	+			A5PKZ5|Q3ZCN0|Q6PJL3	Silent	SNP	ENST00000406438.3	1	1	hg19	c.1134C>T	CCDS11195.2	1																																																																																								0.284071		TCGA-IB-A7M4-01A-11D-A36O-08	0.448	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	1	0	0	2	2	2	2	0	0	0	0	107	107	107	105	1	1.980000	-20.000000	1	0.440000	NM_144775		0	84	83	0	239	235	1		1	1		0	0	107	0	0	1.000000	8.828876e-01	0	12	0	1	0	84	239
SLFN13	146857	broad.mit.edu	37	17	33767722	33767722	+	Silent	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr17:33767722C>T	ENST00000285013.6	-	6	2861	c.2586G>A	c.(2584-2586)agG>agA	p.R862R	SLFN13_ENST00000526861.1_Silent_p.R862R|SLFN13_ENST00000360502.2_Silent_p.R544R|SLFN13_ENST00000542635.1_Silent_p.R862R|SLFN13_ENST00000534689.1_Silent_p.R544R|SLFN13_ENST00000533791.1_Silent_p.R862R	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	862						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ACACTATGCTCCTTTCCAGGC	0.478																																						ENST00000285013.6	1.000000	0.040000	0.150000	0.060000	0.090000	0.220875	0.090000	0.090000																										0				31						c.(2584-2586)agG>agA		schlafen family member 13							229.0	202.0	211.0					17																	33767722		2203	4300	6503	SO:0001819	synonymous_variant	146857	0	0					g.chr17:33767722C>T	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2586G>A	chr17.hg19:g.33767722C>T		1					SLFN13_ENST00000360502.2_Silent_p.R544R|SLFN13_ENST00000534689.1_Silent_p.R544R|SLFN13_ENST00000526861.1_Silent_p.R862R|SLFN13_ENST00000533791.1_Silent_p.R862R|SLFN13_ENST00000542635.1_Silent_p.R862R	p.R862R	NM_144682.5	NP_653283.3	2	2	4	2.168698	Q68D06	SLN13_HUMAN		6	2861	-			E1P645|Q658M1|Q6ZS51|Q96A81	Silent	SNP	ENST00000285013.6	0	1	hg19	c.2586G>A	CCDS32620.1	0																																																																																								0.481097		TCGA-IB-A7M4-01A-11D-A36O-08	0.478	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	0	0	1	2	2	2	2	0	0	0	0	195	195	195	192	1	1.980000	-2.205970	0	0.440000	NM_144682		0	15	14	0	808	796	0		1	0		0	0	195	0	0	0.999853	1.043118e-01	0	0	0	28	0	15	808
SPATA20	64847	broad.mit.edu	37	17	48631760	48631760	+	Silent	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr17:48631760G>A	ENST00000356488.4	+	14	2141	c.2058G>A	c.(2056-2058)gcG>gcA	p.A686A	CACNA1G-AS1_ENST00000505793.1_RNA|CACNA1G-AS1_ENST00000505495.1_RNA|SPATA20_ENST00000393244.3_Silent_p.A642A|CACNA1G-AS1_ENST00000508920.1_RNA|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Silent_p.A702A	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	686					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			TCCCGGTGGCGTTGCCCGAGA	0.647																																						ENST00000356488.4	1.000000	0.010000	0.130000	0.030000	0.060000	0.192714	0.060000	0.060000																										0				24						c.(2056-2058)gcG>gcA		spermatogenesis associated 20							114.0	94.0	101.0					17																	48631760		2203	4300	6503	SO:0001819	synonymous_variant	64847	19	121412	45				g.chr17:48631760G>A		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.2058G>A	chr17.hg19:g.48631760G>A		1					CACNA1G-AS1_ENST00000508920.1_RNA|SPATA20_ENST00000393244.3_Silent_p.A642A|CACNA1G-AS1_ENST00000505495.1_RNA|SPATA20_ENST00000006658.6_Silent_p.A702A|CACNA1G-AS1_ENST00000505793.1_RNA|SPATA20_ENST00000511937.1_3'UTR	p.A686A	NM_001258372.1	NP_001245301.1	2	2	4	2.153852	Q8TB22	SPT20_HUMAN	BRCA - Breast invasive adenocarcinoma(22;9.38e-09)	14	2141	+	Breast(11;1.23e-18)		Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	0	1	hg19	c.2058G>A	CCDS58563.1	0																																																																																								0.478973		TCGA-IB-A7M4-01A-11D-A36O-08	0.647	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	0	0	1	2	16	6	2	1	1	1	1	92	92	92	91	1	1.980000	-2.621283	1	0.440000	NM_022827		0	5	5	0	414	409	0		0	0		1	0	92	0	0	0.011357	1.458673e-02	0	0	0	113	0	5	414
TP53	7157	broad.mit.edu	37	17	7577532	7577532	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr17:7577532G>A	ENST00000269305.4	-	7	938	c.749C>T	c.(748-750)cCc>cTc	p.P250L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.P250L|TP53_ENST00000359597.4_Missense_Mutation_p.P250L|TP53_ENST00000445888.2_Missense_Mutation_p.P250L|TP53_ENST00000455263.2_Missense_Mutation_p.P250L|TP53_ENST00000413465.2_Missense_Mutation_p.P250L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	250	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P250L(45)|p.0?(8)|p.?(5)|p.P250H(4)|p.P250F(3)|p.P250N(2)|p.M246_P250delMNRRP(2)|p.P250_L252delPIL(2)|p.P250Q(2)|p.R248_P250delRRP(1)|p.P250_T253delPILT(1)|p.N247_P250delNRRP(1)|p.R249_P250delRP(1)|p.R249_T256delRPILTIIT(1)|p.I251fs*94(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGTGAGGATGGGCCTCCGGTT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.820000	1.000000	0.900000	0.960000	0.954674	0.960000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		80	Substitution - Missense(56)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(1)	p.P250L(45)|p.0?(8)|p.?(5)|p.P250H(4)|p.P250F(3)|p.P250N(2)|p.M246_P250delMNRRP(2)|p.P250_L252delPIL(2)|p.P250Q(2)|p.R248_P250delRRP(1)|p.P250_T253delPILT(1)|p.N247_P250delNRRP(1)|p.R249_P250delRP(1)|p.R249_T256delRPILTIIT(1)|p.I251fs*94(1)|p.R249_I251delRPI(1)	large_intestine(14)|lung(10)|breast(10)|upper_aerodigestive_tract(5)|biliary_tract(5)|skin(5)|ovary(5)|stomach(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|oesophagus(3)|liver(2)|urinary_tract(1)|eye(1)|peritoneum(1)|pancreas(1)|thyroid(1)	24185	GRCh37	CM973401	TP53	M		c.(748-750)cCc>cTc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						154.0	112.0	126.0					17																	7577532		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577532G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.749C>T	chr17.hg19:g.7577532G>A	ENSP00000269305:p.Pro250Leu	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.P250L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P250L|TP53_ENST00000420246.2_Missense_Mutation_p.P250L|TP53_ENST00000359597.4_Missense_Mutation_p.P250L|TP53_ENST00000413465.2_Missense_Mutation_p.P250L	p.P250L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.681783	P04637	P53_HUMAN		7	938	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.749C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504438	0.85176	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.996;0.998;0.998;1.0	D	0.96045	0.9027	10	0.87932	D	0	-1.5308	15.3618	0.74483	0.0:0.0:1.0:0.0	.	250;250;250;250;250	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	L	250;250;250;250;250;250;239;118	ENSP00000410739:P250L;ENSP00000352610:P250L;ENSP00000269305:P250L;ENSP00000398846:P250L;ENSP00000391127:P250L;ENSP00000391478:P250L;ENSP00000425104:P118L	ENSP00000269305:P250L	P	-	2	0	0	TP53	7518257	7518257	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.601000	0.98297	2.564000	0.86499	0.462000	0.41574	CCC	0.284071		TCGA-IB-A7M4-01A-11D-A36O-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.980000	-20.000000	1	0.440000	NM_000546		0	63	63	0	135	132	1		1	1	1	0	0	87	560	0	1.000000	1	1	100	167	21	404	63	135
CLTC	1213	broad.mit.edu	37	17	57725004	57725004	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr17:57725004C>A	ENST00000269122.3	+	3	770	c.496C>A	c.(496-498)Ctt>Att	p.L166I	CLTC_ENST00000393043.1_Missense_Mutation_p.L166I|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	166	Globular terminal domain.|WD40-like repeat 4.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					AAAGTGGTTACTTCTGACTGG	0.393			T	"""ALK, TFE3"""	"""ALCL, renal """																																	ENST00000269122.3	1.000000	0.840000	1.000000	0.920000	0.990000	0.974259	0.990000	1.000000				Dom	yes			Dom	yes		17	17q11-qter	17q11-qter	1213	T	"""clathrin, heavy polypeptide (Hc)"""				L	L	ALK, TFE3		ALCL, renal 	CLTC/ALK(44)|CLTC/TFE3(2)	0				9						c.(496-498)Ctt>Att		clathrin, heavy chain (Hc)							112.0	107.0	109.0					17																	57725004		2203	4300	6503	SO:0001583	missense	1213	0	0					g.chr17:57725004C>A	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.496C>A	chr17.hg19:g.57725004C>A	ENSP00000269122:p.Leu166Ile	1					CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.L166I	p.L166I	NM_004859.3	NP_004850.1	2	2	4	2.153852	Q00610	CLH1_HUMAN		3	770	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	1	1	hg19	c.496C>A	CCDS32696.1	1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.210186	0.58343	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.42513	0.97;0.97	5.79	5.79	0.91817	5.79	5.79	0.91817	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	L	0.50333	1.59	0.80722	D	1	D;B	0.56968	0.978;0.001	D;B	0.77557	0.99;0.015	T	0.53885	-0.8375	10	0.42905	T	0.14	.	15.153	0.72717	0.0:0.931:0.0:0.069	.	166;166	Q00610;Q00610-2	CLH1_HUMAN;.	I	166	ENSP00000269122:L166I;ENSP00000376763:L166I	ENSP00000269122:L166I	L	+	1	0	0	CLTC	55079786	55079786	1.000000	0.71417	1.000000	0.80357	0.498000	0.33706	4.985000	0.63845	2.739000	0.93911	0.655000	0.94253	CTT	0.478973		TCGA-IB-A7M4-01A-11D-A36O-08	0.393	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	1	0	1	2	2	2	2	0	0	0	0	122	122	122	121	1	1.980000	-20.000000	1	0.440000	NM_004859		0	101	100	0	388	381	1		1	1		0	0	122	0	0	1.000000	1	0	53	0	71	0	101	388
ZNF521	25925	broad.mit.edu	37	18	22806481	22806481	+	Silent	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr18:22806481C>T	ENST00000361524.3	-	4	1549	c.1401G>A	c.(1399-1401)ctG>ctA	p.L467L	ZNF521_ENST00000584787.1_Silent_p.L247L|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Silent_p.L467L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	467					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CAGAAACAATCAGACCTGGGT	0.463			T	PAX5	ALL																																	ENST00000361524.3	1.000000	0.210000	1.000000	0.270000	0.360000	0.486926	0.360000	0.340000				Dom	yes			Dom	yes		18	18q11.2	18q11.2	25925	T	zinc finger protein 521				L	L	PAX5		ALL		0				149						c.(1399-1401)ctG>ctA		zinc finger protein 521							89.0	88.0	88.0					18																	22806481		2203	4300	6503	SO:0001819	synonymous_variant	25925	0	0					g.chr18:22806481C>T	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1401G>A	chr18.hg19:g.22806481C>T		1					ZNF521_ENST00000538137.2_Silent_p.L467L|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Silent_p.L247L	p.L467L	NM_015461.2	NP_056276.1	2	7	9	3.039103	Q96K83	ZN521_HUMAN		4	1549	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	1	1	hg19	c.1401G>A	CCDS32806.1	0																																																																																								0.632449		TCGA-IB-A7M4-01A-11D-A36O-08	0.463	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	1	0	0	2	2	2	2	0	0	0	0	98	98	98	97	1	1.980000	-19.985880	1	0.440000	NM_015461		0	21	22	0	418	411	0		1			0	0	98	0	0	0.999997	0	0	0	0	0	0	21	418
KLHL14	57565	broad.mit.edu	37	18	30322007	30322007	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr18:30322007C>T	ENST00000359358.4	-	3	1391	c.953G>A	c.(952-954)cGc>cAc	p.R318H	KLHL14_ENST00000358095.4_Missense_Mutation_p.R318H	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	318						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.R318H(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						CTTGTTAGAGCGAATTCTTCA	0.428																																						ENST00000359358.4	1.000000	0.070000	1.000000	0.110000	0.170000	0.310650	0.170000	0.150000																										1	Substitution - Missense(1)	p.R318H(1)	breast(1)	31						c.(952-954)cGc>cAc		kelch-like family member 14							97.0	92.0	94.0					18																	30322007		2203	4300	6503	SO:0001583	missense	57565	1	121412	29				g.chr18:30322007C>T	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.953G>A	chr18.hg19:g.30322007C>T	ENSP00000352314:p.Arg318His	1					KLHL14_ENST00000358095.4_Missense_Mutation_p.R318H	p.R318H	NM_020805.1	NP_065856.1	1	3	4	2.800587	Q9P2G3	KLH14_HUMAN		3	1391	-			A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	0	1	hg19	c.953G>A	CCDS32813.1	0	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025617	0.75390	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;D	0.81996	-1.21;-1.56	6.11	6.11	0.99139	6.11	6.11	0.99139	Galactose oxidase, beta-propeller (1);	0.053328	0.85682	D	0.000000	D	0.92267	0.7547	M	0.84082	2.675	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	D	0.92111	0.5696	10	0.87932	D	0	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	318	Q9P2G3	KLH14_HUMAN	H	318	ENSP00000352314:R318H;ENSP00000350808:R318H	ENSP00000350808:R318H	R	-	2	0	0	KLHL14	28576005	28576005	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.298000	0.78815	2.906000	0.99361	0.655000	0.94253	CGC	0.581715		TCGA-IB-A7M4-01A-11D-A36O-08	0.428	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1	0	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	1.980000	-3.427231	1	0.440000			0	9	8	0	345	338	0		1	0		0	0	53	0	0	0.993747	0	0	0	0	1	0	9	345
CYP4F22	126410	broad.mit.edu	37	19	15655075	15655075	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr19:15655075T>C	ENST00000269703.3	+	10	1320	c.1121T>C	c.(1120-1122)cTg>cCg	p.L374P	CYP4F22_ENST00000601005.2_Missense_Mutation_p.L374P	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	374						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						GGCCGGGAGCTGGAGGAGCTG	0.542																																						ENST00000269703.3	0.380000	0.090000	0.300000	0.140000	0.200000	0.224189	0.200000	0.200000																										0				37						c.(1120-1122)cTg>cCg		cytochrome P450, family 4, subfamily F, polypeptide 22							48.0	44.0	45.0					19																	15655075		2203	4300	6503	SO:0001583	missense	126410	0	0					g.chr19:15655075T>C		CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.1121T>C	chr19.hg19:g.15655075T>C	ENSP00000269703:p.Leu374Pro	0					CYP4F22_ENST00000601005.2_Missense_Mutation_p.L374P	p.L374P	NM_173483.3	NP_775754.2	0	0	0	1.979553	Q6NT55	CP4FN_HUMAN		10	1320	+			Q8N8H4	Missense_Mutation	SNP	ENST00000269703.3	0	1	hg19	c.1121T>C	CCDS12331.1	0	.	.	.	.	.	.	.	.	.	.	T	0.522	-0.861607	0.02610	.	.	ENSG00000171954	ENST00000269703	T	0.67523	-0.27	5.21	1.34	0.21922	5.21	1.34	0.21922	.	0.814660	0.10833	N	0.629139	T	0.31009	0.0783	N	0.01493	-0.835	0.39648	D	0.970427	B	0.02656	0.0	B	0.06405	0.002	T	0.17715	-1.0360	10	0.13108	T	0.6	.	3.4617	0.07535	0.1692:0.2777:0.0:0.5531	.	374	Q6NT55	CP4FN_HUMAN	P	374	ENSP00000269703:L374P	ENSP00000269703:L374P	L	+	2	0	0	CYP4F22	15516075	15516075	0.170000	0.23016	0.998000	0.56505	0.993000	0.82548	0.276000	0.18716	0.272000	0.22027	0.496000	0.49642	CTG	0.429967		TCGA-IB-A7M4-01A-11D-A36O-08	0.542	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461338.2	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.980000	-10.137330	1	0.440000	NM_173483		0	7	6	0	149	147	0		1	0		0	0	36	0	0	0.980016	0	0	0	0	1	0	7	149
EPS15L1	58513	broad.mit.edu	37	19	16547778	16547778	+	Silent	SNP	C	C	T	rs33914440	byFrequency	TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr19:16547778C>T	ENST00000248070.6	-	6	481	c.342G>A	c.(340-342)ccG>ccA	p.P114P	EPS15L1_ENST00000535753.2_Silent_p.P114P|EPS15L1_ENST00000602009.1_5'Flank|EPS15L1_ENST00000455140.2_Silent_p.P114P|EPS15L1_ENST00000594975.1_Silent_p.P114P|EPS15L1_ENST00000597937.1_Silent_p.P114P	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	114	Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						CTGCAGAGGGCGGTGTGACCA	0.522													C|||	91	0.0181709	0.0045	0.013	5008	,	,		19717	0.0		0.0646	False		,,,				2504	0.0112					ENST00000248070.6	0.760000	0.440000	0.680000	0.510000	0.590000	0.601519	0.590000	0.590000																										0				30						c.(340-342)ccG>ccA		epidermal growth factor receptor pathway substrate 15-like 1		C		66,4340	61.1+/-98.1	0,66,2137	111.0	107.0	108.0		342	-2.0	0.0	19	dbSNP_126	108	606,7994	159.2+/-212.6	26,554,3720	no	coding-synonymous	EPS15L1	NM_021235.1		26,620,5857	TT,TC,CC		7.0465,1.498,5.1668		114/865	16547778	672,12334	2203	4300	6503	SO:0001819	synonymous_variant	58513	6085	121412	69				g.chr19:16547778C>T	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.342G>A	chr19.hg19:g.16547778C>T		0					EPS15L1_ENST00000455140.2_Silent_p.P114P|EPS15L1_ENST00000602009.1_5'Flank|EPS15L1_ENST00000535753.2_Silent_p.P114P|EPS15L1_ENST00000594975.1_Silent_p.P114P|EPS15L1_ENST00000597937.1_Silent_p.P114P	p.P114P	NM_021235.2	NP_067058.1	0	0	0	1.979553	Q9UBC2	EP15R_HUMAN		6	481	-			A2RRF3|A5PL29|B4DKA3	Silent	SNP	ENST00000248070.6	1	0	hg19	c.342G>A	CCDS32944.1	0																																																																																								0.429967		TCGA-IB-A7M4-01A-11D-A36O-08	0.522	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	0	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	1.980000	-2.857362	1	0.440000	NM_021235		0	47	48	0	306	299	1		1	1		0	0	83	0	0	1.000000	8.456231e-01	0	7	0	17	0	47	306
DPY19L3	147991	broad.mit.edu	37	19	32971419	32971419	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr19:32971419C>T	ENST00000342179.5	+	18	2160	c.1945C>T	c.(1945-1947)Cgg>Tgg	p.R649W	DPY19L3_ENST00000586987.1_Missense_Mutation_p.R649W|DPY19L3_ENST00000392250.2_Missense_Mutation_p.R649W	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	649						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GAGGCACCGCCGGGGCTGCCG	0.632																																						ENST00000342179.5	0.390000	0.130000	0.320000	0.180000	0.240000	0.256911	0.240000	0.240000																										0				32						c.(1945-1947)Cgg>Tgg		dpy-19-like 3 (C. elegans)							40.0	41.0	40.0					19																	32971419		2203	4300	6503	SO:0001583	missense	147991	1	121408	30				g.chr19:32971419C>T		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1945C>T	chr19.hg19:g.32971419C>T	ENSP00000344937:p.Arg649Trp	0					DPY19L3_ENST00000392250.2_Missense_Mutation_p.R649W|DPY19L3_ENST00000586987.1_Missense_Mutation_p.R649W	p.R649W	NM_207325.2	NP_997208.2	0	0	0	1.979553	Q6ZPD9	D19L3_HUMAN		18	2160	+	Esophageal squamous(110;0.162)		Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	1	1	hg19	c.1945C>T	CCDS12422.1	0	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596002	0.86953	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.56776	0.44;0.44	5.43	3.18	0.36537	5.43	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.70378	0.3217	M	0.77103	2.36	0.50813	D	0.999891	D	0.89917	1.0	D	0.91635	0.999	T	0.74172	-0.3751	10	0.72032	D	0.01	-13.2638	11.7833	0.52028	0.6264:0.3736:0.0:0.0	.	649	Q6ZPD9	D19L3_HUMAN	W	649	ENSP00000376081:R649W;ENSP00000344937:R649W	ENSP00000344937:R649W	R	+	1	2	2	DPY19L3	37663259	37663259	0.949000	0.32298	0.934000	0.37439	0.968000	0.65278	1.706000	0.37878	1.214000	0.43395	0.563000	0.77884	CGG	0.429967		TCGA-IB-A7M4-01A-11D-A36O-08	0.632	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	1	0	0	2	2	2	2	0	0	0	0	79	79	79	79	1	1.980000	-3.325330	1	0.440000	NM_207325		0	13	13	0	227	225	0		1	1		0	0	79	0	0	0.999564	7.637243e-02	0	3	0	5	0	13	227
ZNF569	148266	broad.mit.edu	37	19	37903725	37903725	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr19:37903725C>T	ENST00000316950.6	-	6	2392	c.1835G>A	c.(1834-1836)gGa>gAa	p.G612E	ZNF569_ENST00000392150.2_Missense_Mutation_p.G453E|ZNF569_ENST00000392149.2_Missense_Mutation_p.G612E	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGGCTTTTCCACATTTATT	0.408																																						ENST00000316950.6	1.000000	0.960000	1.000000	0.990000	0.990000	0.998340	0.990000	1.000000																										0				40						c.(1834-1836)gGa>gAa		zinc finger protein 569							116.0	114.0	115.0					19																	37903725		2203	4300	6503	SO:0001583	missense	148266	0	0					g.chr19:37903725C>T	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1835G>A	chr19.hg19:g.37903725C>T	ENSP00000325018:p.Gly612Glu	0					ZNF569_ENST00000392150.2_Missense_Mutation_p.G453E|ZNF569_ENST00000392149.2_Missense_Mutation_p.G612E	p.G612E	NM_152484.2	NP_689697.2	0	0	0	1.979553	Q5MCW4	ZN569_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	6	2392	-			A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	1	1	hg19	c.1835G>A	CCDS12503.1	1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575704	0.65878	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.58210	0.35;0.35	4.1	3.06	0.35304	4.1	3.06	0.35304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62109	0.2401	L	0.46819	1.47	0.44890	D	0.997908	D;D	0.89917	1.0;1.0	D;D	0.69479	0.964;0.964	T	0.63328	-0.6662	9	0.62326	D	0.03	.	11.1105	0.48230	0.0:0.9057:0.0:0.0943	.	453;612	Q17RR6;Q5MCW4	.;ZN569_HUMAN	E	612;268;453	ENSP00000325018:G612E;ENSP00000375993:G453E	ENSP00000325018:G612E	G	-	2	0	0	ZNF569	42595565	42595565	0.996000	0.38824	0.999000	0.59377	0.998000	0.95712	2.285000	0.43487	1.061000	0.40601	0.655000	0.94253	GGA	0.429967		TCGA-IB-A7M4-01A-11D-A36O-08	0.408	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	1	0	1	2	17	2	2	0	0	0	1	147	147	147	143	1	1.980000	-20.000000	1	0.440000	NM_152484		0	171	168	0	514	504	1		1	0		0	0	147	0	0	1.000000	6.277213e-02	0	1	0	1	0	171	514
ZNF613	79898	broad.mit.edu	37	19	52448407	52448407	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr19:52448407G>A	ENST00000293471.6	+	6	1950	c.1271G>A	c.(1270-1272)gGa>gAa	p.G424E	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.G388E	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		ACTCACACTGGAGAGAAACCC	0.418																																						ENST00000293471.6	1.000000	0.050000	0.170000	0.080000	0.110000	0.165510	0.110000	0.110000																										0				19						c.(1270-1272)gGa>gAa		zinc finger protein 613							74.0	70.0	71.0					19																	52448407		2203	4300	6503	SO:0001583	missense	79898	0	0					g.chr19:52448407G>A	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1271G>A	chr19.hg19:g.52448407G>A	ENSP00000293471:p.Gly424Glu	0					ZNF613_ENST00000391794.4_Missense_Mutation_p.G388E|ZNF613_ENST00000601794.1_3'UTR	p.G424E	NM_001031721.3	NP_001026891.2	1	2	3	2.033799	Q6PF04	ZN613_HUMAN		6	1950	+		all_neural(266;0.117)	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	0	1	hg19	c.1271G>A	CCDS33089.1	0	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114923	0.56505	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.25749	1.78;4.74	3.36	3.36	0.38483	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36932	N	0.002329	T	0.37732	0.1014	L	0.31476	0.935	0.31474	N	0.66797	D	0.89917	1.0	D	0.97110	1.0	T	0.43686	-0.9376	10	0.87932	D	0	.	14.0307	0.64613	0.0:0.0:1.0:0.0	.	424	Q6PF04	ZN613_HUMAN	E	424;388;98	ENSP00000293471:G424E;ENSP00000375671:G388E	ENSP00000293471:G424E	G	+	2	0	0	ZNF613	57140219	57140219	0.974000	0.33945	0.998000	0.56505	0.929000	0.56500	1.109000	0.31135	1.890000	0.54733	0.655000	0.94253	GGA	0.447296		TCGA-IB-A7M4-01A-11D-A36O-08	0.418	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	0	0	1	2	2	2	2	0	0	0	0	103	103	103	100	1	1.980000	-3.699657	1	0.440000	NM_024840		0	9	9	0	358	354	0		1	0		0	0	103	0	0	0.994067	7.986632e-02	0	0	0	17	0	9	358
ZNF773	374928	broad.mit.edu	37	19	58016113	58016113	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr19:58016113G>T	ENST00000282292.4	+	2	262	c.122G>T	c.(121-123)cGc>cTc	p.R41L	ZNF773_ENST00000593916.1_Missense_Mutation_p.R40L|ZNF773_ENST00000598770.1_Missense_Mutation_p.R40L|AC003005.4_ENST00000601674.1_3'UTR|ZNF773_ENST00000599847.1_Missense_Mutation_p.R41L	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	41	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		CTCCTCTACCGCAATGTGATG	0.527																																						ENST00000282292.4	1.000000	0.740000	1.000000	0.810000	0.900000	0.902285	0.900000	1.000000																										0				22						c.(121-123)cGc>cTc		zinc finger protein 773							127.0	108.0	115.0					19																	58016113		2203	4297	6500	SO:0001583	missense	374928	0	0					g.chr19:58016113G>T	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.122G>T	chr19.hg19:g.58016113G>T	ENSP00000282292:p.Arg41Leu	0					AC003005.4_ENST00000601674.1_3'UTR|ZNF773_ENST00000598770.1_Missense_Mutation_p.R40L|ZNF773_ENST00000599847.1_Missense_Mutation_p.R41L|ZNF773_ENST00000593916.1_Missense_Mutation_p.R40L	p.R41L	NM_198542.1	NP_940944.1	1	2	3	2.049236	Q6PK81	ZN773_HUMAN		2	262	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	Q96DL8	Missense_Mutation	SNP	ENST00000282292.4	1	1	hg19	c.122G>T	CCDS33134.1	1	.	.	.	.	.	.	.	.	.	.	G	0.697	-0.792230	0.02884	.	.	ENSG00000152439	ENST00000332030;ENST00000282292	T	0.02709	4.19	1.39	-0.898	0.10550	1.39	-0.898	0.10550	Krueppel-associated box (4);	.	.	.	.	T	0.04861	0.0131	M	0.69523	2.12	0.09310	N	1	B;B	0.32573	0.376;0.1	B;B	0.37692	0.256;0.154	T	0.32955	-0.9887	9	0.45353	T	0.12	.	5.4787	0.16710	0.3572:0.0:0.6428:0.0	.	40;41	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	L	64;41	ENSP00000282292:R41L	ENSP00000282292:R41L	R	+	2	0	0	ZNF773	62707925	62707925	0.000000	0.05858	0.001000	0.08648	0.769000	0.43574	-0.343000	0.07791	-0.200000	0.10300	0.305000	0.20034	CGC	0.447296		TCGA-IB-A7M4-01A-11D-A36O-08	0.527	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466475.1	1	0	0	2	2	2	2	0	0	0	0	133	133	133	150	1	1.980000	-3.553700	1	0.440000	NM_198542		0	92	87	0	379	353	0		1	1		0	0	133	0	0	1.000000	1.013782e-01	0	2	0	1	0	92	379
AGL	178	broad.mit.edu	37	1	100382219	100382219	+	Silent	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:100382219G>A	ENST00000294724.4	+	33	4891	c.4413G>A	c.(4411-4413)ccG>ccA	p.P1471P	AGL_ENST00000370161.2_Silent_p.P1455P|AGL_ENST00000361915.3_Silent_p.P1471P|AGL_ENST00000370163.3_Silent_p.P1471P|AGL_ENST00000370165.3_Silent_p.P1471P|AGL_ENST00000361302.3_Silent_p.P1455P|AGL_ENST00000361522.4_Silent_p.P1454P	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1471					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TGATGGGCCCGGAGACTACTG	0.353																																						ENST00000294724.4	0.380000	0.150000	0.320000	0.190000	0.250000	0.262386	0.250000	0.250000																										0				69						c.(4411-4413)ccG>ccA		amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase							83.0	88.0	86.0					1																	100382219		2203	4300	6503	SO:0001819	synonymous_variant	178	0	0					g.chr1:100382219G>A	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.4413G>A	chr1.hg19:g.100382219G>A		0					AGL_ENST00000370161.2_Silent_p.P1455P|AGL_ENST00000361522.4_Silent_p.P1454P|AGL_ENST00000361302.3_Silent_p.P1455P|AGL_ENST00000370165.3_Silent_p.P1471P|AGL_ENST00000361915.3_Silent_p.P1471P|AGL_ENST00000370163.3_Silent_p.P1471P	p.P1471P	NM_000028.2	NP_000019.2	0	1	1	1.966678	P35573	GDE_HUMAN		33	4891	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	ENST00000294724.4	1	1	hg19	c.4413G>A	CCDS759.1	0																																																																																								0.429967		TCGA-IB-A7M4-01A-11D-A36O-08	0.353	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	1	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	1.980000	-2.807443	1	0.440000	NM_000028		0	17	17	0	286	282	0		1	1		0	0	82	0	0	0.999965	2.658557e-01	0	3	0	14	0	17	286
TBX15	6913	broad.mit.edu	37	1	119441695	119441695	+	Missense_Mutation	SNP	C	C	T	rs141002143	byFrequency	TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:119441695C>T	ENST00000369429.3	-	7	989	c.980G>A	c.(979-981)cGc>cAc	p.R327H	TBX15_ENST00000207157.3_Missense_Mutation_p.R221H			Q96SF7	TBX15_HUMAN	T-box 15	327					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		GGTGAGTGTGCGCACAGGAGG	0.493													C|||	6	0.00119808	0.0015	0.0014	5008	,	,		19288	0.003		0.0	False		,,,				2504	0.0					ENST00000369429.3	0.820000	0.470000	0.730000	0.550000	0.630000	0.648315	0.630000	0.640000																										0				37						c.(979-981)cGc>cAc		T-box 15		C	HIS/ARG	18,4388	25.3+/-52.1	0,18,2185	150.0	130.0	137.0		662	5.7	1.0	1	dbSNP_134	137	0,8600		0,0,4300	yes	missense	TBX15	NM_152380.2	29	0,18,6485	TT,TC,CC		0.0,0.4085,0.1384	probably-damaging	221/497	119441695	18,12988	2203	4300	6503	SO:0001583	missense	6913	57	121404	50				g.chr1:119441695C>T	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.980G>A	chr1.hg19:g.119441695C>T	ENSP00000358437:p.Arg327His	0					TBX15_ENST00000207157.3_Missense_Mutation_p.R221H	p.R327H			0	0	0	1.936642	Q96SF7	TBX15_HUMAN		7	989	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	1	0	hg19	c.980G>A		0	4	0.0018315018315018315	1	0.0020325203252032522	1	0.0027624309392265192	2	0.0034965034965034965	0	0.0	C	33	5.284276	0.95517	0.004085	0.0	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873;ENST00000393149	D;D;D	0.88664	-2.41;-2.34;-1.7	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.129767	0.49305	D	0.000159	D	0.92678	0.7673	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.987;0.98	D	0.92398	0.5927	10	0.66056	D	0.02	.	20.073	0.97731	0.0:1.0:0.0:0.0	.	91;327	E9PCG3;Q96SF7	.;TBX15_HUMAN	H	91;221;327;22;21	ENSP00000207157:R221H;ENSP00000358437:R327H;ENSP00000398625:R22H	ENSP00000207157:R221H	R	-	2	0	0	TBX15	119243218	119243218	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.181000	0.77682	2.811000	0.96726	0.655000	0.94253	CGC	0.419569		TCGA-IB-A7M4-01A-11D-A36O-08	0.493	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	1	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	1.980000	-2.718232	1	0.440000	NM_152380		0	44	42	0	257	250	1		1	0		0	0	83	0	0	1.000000	0	0	0	0	1	0	44	257
IVL	3713	broad.mit.edu	37	1	152882593	152882593	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:152882593A>G	ENST00000368764.3	+	2	384	c.320A>G	c.(319-321)cAg>cGg	p.Q107R	IVL_ENST00000392667.2_5'UTR			P07476	INVO_HUMAN	involucrin	107					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCAGAGCAGCAGCTTAAGCAG	0.488																																						ENST00000368764.3	0.980000	0.550000	0.880000	0.650000	0.760000	0.771027	0.760000	0.760000																										0				29						c.(319-321)cAg>cGg		involucrin							55.0	57.0	56.0					1																	152882593		2203	4300	6503	SO:0001583	missense	3713	0	0					g.chr1:152882593A>G	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.320A>G	chr1.hg19:g.152882593A>G	ENSP00000357753:p.Gln107Arg	0					IVL_ENST00000392667.2_5'UTR	p.Q107R			0	0	0	1.927308	P07476	INVO_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	2	384	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	1	1	hg19	c.320A>G	CCDS1030.1	0	.	.	.	.	.	.	.	.	.	.	A	10.78	1.447930	0.26074	.	.	ENSG00000163207	ENST00000368764	T	0.10573	2.86	4.46	3.29	0.37713	4.46	3.29	0.37713	.	.	.	.	.	T	0.07279	0.0184	N	0.19112	0.55	0.47407	D	0.999415	D	0.59357	0.985	D	0.65233	0.933	T	0.31081	-0.9956	9	0.33141	T	0.24	.	8.638	0.33959	0.8286:0.0:0.0:0.1714	.	107	P07476	INVO_HUMAN	R	107	ENSP00000357753:Q107R	ENSP00000357753:Q107R	Q	+	2	0	0	IVL	151149217	151149217	0.000000	0.05858	0.055000	0.19348	0.058000	0.15608	0.047000	0.14056	0.800000	0.34041	0.402000	0.26972	CAG	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.488	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.980000	-20.000000	1	0.440000	NM_005547		0	38	38	0	178	174	1		1			0	0	68	0	0	1.000000	0	0	0	0	0	0	38	178
ZBTB7B	51043	broad.mit.edu	37	1	154988280	154988280	+	Silent	SNP	C	C	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:154988280C>A	ENST00000368426.3	+	3	1281	c.1144C>A	c.(1144-1146)Cga>Aga	p.R382R	ZBTB7B_ENST00000535420.1_Silent_p.R382R|ZBTB7B_ENST00000292176.2_Silent_p.R382R|ZBTB7B_ENST00000417934.2_Silent_p.R416R	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	382					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTGCGGTGTTCGATTCACCAG	0.632																																						ENST00000368426.3	0.330000	0.100000	0.260000	0.140000	0.190000	0.207398	0.190000	0.190000																										0				29						c.(1144-1146)Cga>Aga		zinc finger and BTB domain containing 7B							35.0	39.0	37.0					1																	154988280		2195	4293	6488	SO:0001819	synonymous_variant	51043	0	0					g.chr1:154988280C>A	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.1144C>A	chr1.hg19:g.154988280C>A		0					ZBTB7B_ENST00000417934.2_Silent_p.R416R|ZBTB7B_ENST00000535420.1_Silent_p.R382R|ZBTB7B_ENST00000292176.2_Silent_p.R382R	p.R382R	NM_001256455.1	NP_001243384.1	0	0	0	1.927308	O15156	ZBT7B_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)	3	1281	+	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Silent	SNP	ENST00000368426.3	1	0	hg19	c.1144C>A	CCDS1081.1	0																																																																																								0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.632	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	1.980000	-12.752270	1	0.440000	NM_015872		0	11	11	0	237	232	0		1	0		0	0	59	0	0	0.998253	7.170339e-01	0	0	0	55	0	11	237
FCRL2	79368	broad.mit.edu	37	1	157736756	157736756	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:157736756C>G	ENST00000361516.3	-	7	1216	c.1168G>C	c.(1168-1170)Gat>Cat	p.D390H	FCRL2_ENST00000469986.1_Missense_Mutation_p.D137H|FCRL2_ENST00000368181.4_Missense_Mutation_p.D106H|FCRL2_ENST00000392274.3_Missense_Mutation_p.D390H	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	390					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTATAGCCATCAGGTCCTGAG	0.443																																						ENST00000361516.3	0.190000	0.020000	0.140000	0.040000	0.080000	0.095521	0.080000	0.080000																										0				51						c.(1168-1170)Gat>Cat		Fc receptor-like 2							99.0	102.0	101.0					1																	157736756		2203	4300	6503	SO:0001583	missense	79368	0	0					g.chr1:157736756C>G	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.1168G>C	chr1.hg19:g.157736756C>G	ENSP00000355157:p.Asp390His	0					FCRL2_ENST00000469986.1_Missense_Mutation_p.D137H|FCRL2_ENST00000392274.3_Missense_Mutation_p.D390H|FCRL2_ENST00000368181.4_Missense_Mutation_p.D106H	p.D390H	NM_030764.3	NP_110391.2	0	0	0	1.927308	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)	7	1216	-	all_hematologic(112;0.0378)		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	0	1	hg19	c.1168G>C	CCDS1168.1	0	.	.	.	.	.	.	.	.	.	.	C	9.353	1.066107	0.20067	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181;ENST00000392274;ENST00000469986	T;T;T;T	0.22336	2.06;3.62;1.96;3.04	3.22	-4.53	0.03462	3.22	-4.53	0.03462	.	4.697510	0.00866	U	0.001962	T	0.06962	0.0177	L	0.40543	1.245	0.09310	N	1	P;P;B;B	0.47762	0.9;0.799;0.032;0.376	P;B;B;B	0.45913	0.497;0.263;0.025;0.071	T	0.10520	-1.0626	10	0.52906	T	0.07	.	1.3638	0.02197	0.1577:0.2103:0.156:0.476	.	390;106;390;137	B4DVJ9;Q96LA5-5;Q96LA5;Q96LA5-2	.;.;FCRL2_HUMAN;.	H	106;390;106;390;137	ENSP00000355157:D390H;ENSP00000357163:D106H;ENSP00000376100:D390H;ENSP00000417393:D137H	ENSP00000292389:D106H	D	-	1	0	0	FCRL2	156003380	156003380	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.231000	0.00548	-0.956000	0.03631	-0.140000	0.14226	GAT	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.443	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	0	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.980000	-2.860572	1	0.440000	NM_030764		0	4	4	0	220	217	0		1	0		0	0	65	0	0	0.887979	5.451211e-03	0	0	0	5	0	4	220
PLXNA2	5362	broad.mit.edu	37	1	208390894	208390894	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:208390894C>T	ENST00000367033.3	-	2	1131	c.374G>A	c.(373-375)cGc>cAc	p.R125H		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	125	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGCCAGCAGGCGGTTCTCAGA	0.577																																						ENST00000367033.3	1.000000	0.860000	1.000000	0.930000	0.990000	0.978796	0.990000	1.000000																										0				80						c.(373-375)cGc>cAc		plexin A2							94.0	99.0	98.0					1																	208390894		2203	4300	6503	SO:0001583	missense	5362	1	121412	34				g.chr1:208390894C>T	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.374G>A	chr1.hg19:g.208390894C>T	ENSP00000356000:p.Arg125His	0						p.R125H	NM_025179.3	NP_079455.3	0	0	0	1.927308	O75051	PLXA2_HUMAN		2	1131	-			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	1	1	hg19	c.374G>A	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793291	0.90453	.	.	ENSG00000076356	ENST00000367033	T	0.10573	2.86	5.64	5.64	0.86602	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.43798	-0.9369	10	0.87932	D	0	.	19.7016	0.96057	0.0:1.0:0.0:0.0	.	179;125	O75051-2;O75051	.;PLXA2_HUMAN	H	125	ENSP00000356000:R125H	ENSP00000356000:R125H	R	-	2	0	0	PLXNA2	206457517	206457517	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.512000	0.81728	2.662000	0.90505	0.514000	0.50259	CGC	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.577	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	1	0	1	2	2	2	2	0	0	0	0	144	144	144	142	1	1.980000	-4.936967	1	0.440000	NM_025179		0	112	110	0	362	357	1		1	0		0	0	144	0	0	1.000000	5.219958e-01	0	1	0	6	0	112	362
LYST	1130	broad.mit.edu	37	1	235944227	235944227	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:235944227G>A	ENST00000389794.3	-	16	5326	c.5152C>T	c.(5152-5154)Cga>Tga	p.R1718*	LYST_ENST00000389793.2_Nonsense_Mutation_p.R1718*|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1718					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGTTCACATCGCAAAATTTCT	0.294																																						ENST00000389794.3	0.140000	0.020000	0.110000	0.040000	0.070000	0.080594	0.070000	0.070000																										0				162						c.(5152-5154)Cga>Tga		lysosomal trafficking regulator							35.0	38.0	37.0					1																	235944227		2202	4300	6502	SO:0001587	stop_gained	1130	0	0					g.chr1:235944227G>A	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.5152C>T	chr1.hg19:g.235944227G>A	ENSP00000374444:p.Arg1718*	0					LYST_ENST00000389793.2_Nonsense_Mutation_p.R1718*|LYST_ENST00000536965.1_3'UTR	p.R1718*			0	0	0	1.927308	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)	16	5326	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	ENST00000389794.3	0	1	hg19	c.5152C>T	CCDS31062.1	0	.	.	.	.	.	.	.	.	.	.	G	45	12.019982	0.99627	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	.	.	.	5.05	4.11	0.48088	5.05	4.11	0.48088	.	0.354342	0.31872	N	0.006937	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6163	0.56578	0.0:0.0:0.6889:0.3111	.	.	.	.	X	1718	.	ENSP00000374443:R1718X	R	-	1	2	2	LYST	234010850	234010850	0.998000	0.40836	0.850000	0.33497	0.976000	0.68499	2.716000	0.47219	1.193000	0.43086	0.467000	0.42956	CGA	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.294	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5	0	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	1.980000	-3.027400	1	0.440000			0	6	6	0	368	366	0		1	0		0	0	83	0	0	0.964699	3.929659e-04	0	0	0	2	0	6	368
RYR2	6262	broad.mit.edu	37	1	237780691	237780691	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:237780691C>T	ENST00000366574.2	+	38	6138	c.5821C>T	c.(5821-5823)Cgt>Tgt	p.R1941C	RYR2_ENST00000360064.6_Missense_Mutation_p.R1939C|RYR2_ENST00000542537.1_Missense_Mutation_p.R1925C	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1941	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGACAATCAACGTTTCCGATA	0.473																																						ENST00000366574.2	0.170000	0.020000	0.130000	0.040000	0.070000	0.089607	0.070000	0.070000																										0				586						c.(5821-5823)Cgt>Tgt		ryanodine receptor 2 (cardiac)							100.0	92.0	94.0					1																	237780691		1980	4184	6164	SO:0001583	missense	6262	3	120904	40				g.chr1:237780691C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5821C>T	chr1.hg19:g.237780691C>T	ENSP00000355533:p.Arg1941Cys	0					RYR2_ENST00000542537.1_Missense_Mutation_p.R1925C|RYR2_ENST00000360064.6_Missense_Mutation_p.R1939C	p.R1941C	NM_001035.2	NP_001026.2	0	0	0	1.927308	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)	38	6138	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	0	1	hg19	c.5821C>T	CCDS55691.1	0	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152395	0.57259	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73897	-0.79;-0.79;-0.79	5.39	5.39	0.77823	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000005	T	0.67078	0.2855	L	0.39397	1.21	0.80722	D	1	D	0.55800	0.973	B	0.41813	0.367	T	0.71708	-0.4511	10	0.56958	D	0.05	.	14.0546	0.64759	0.1508:0.8492:0.0:0.0	.	1941	Q92736	RYR2_HUMAN	C	1941;1939;1925	ENSP00000355533:R1941C;ENSP00000353174:R1939C;ENSP00000443798:R1925C	ENSP00000353174:R1939C	R	+	1	0	0	RYR2	235847314	235847314	0.849000	0.29639	0.949000	0.38748	0.983000	0.72400	1.765000	0.38481	2.517000	0.84864	0.650000	0.86243	CGT	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.473	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	0	0	0	2	2	2	2	0	0	0	0	52	52	52	52	1	1.980000	-5.516103	1	0.440000	NM_001035		0	4	4	0	235	235	0		1			0	0	52	0	0	0.891119	0	0	0	0	0	0	4	235
KIF26B	55083	broad.mit.edu	37	1	245772663	245772663	+	Missense_Mutation	SNP	C	C	T	rs115703444	byFrequency	TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:245772663C>T	ENST00000407071.2	+	8	2187	c.1747C>T	c.(1747-1749)Cgc>Tgc	p.R583C	KIF26B_ENST00000366518.4_Missense_Mutation_p.R202C	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	583	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CATAAACGAACGCAAGGAAAA	0.567													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17666	0.0		0.0	False		,,,				2504	0.0					ENST00000407071.2	1.000000	0.480000	0.950000	0.610000	0.770000	0.776739	0.770000	1.000000																										0				51						c.(1747-1749)Cgc>Tgc		kinesin family member 26B		C	CYS/ARG	1,3841		0,1,1920	36.0	37.0	37.0		1747	5.2	1.0	1	dbSNP_132	37	0,8244		0,0,4122	yes	missense	KIF26B	NM_018012.3	180	0,1,6042	TT,TC,CC		0.0,0.026,0.0083	probably-damaging	583/2109	245772663	1,12085	1921	4122	6043	SO:0001583	missense	55083	18	120844	40				g.chr1:245772663C>T	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1747C>T	chr1.hg19:g.245772663C>T	ENSP00000385545:p.Arg583Cys	0					KIF26B_ENST00000366518.4_Missense_Mutation_p.R202C	p.R583C	NM_018012.3	NP_060482.2	0	0	0	1.927308	Q2KJY2	KI26B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.022)	8	2187	+	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	1	1	hg19	c.1747C>T	CCDS44342.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.12	2.440500	0.43326	2.6E-4	0.0	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.76060	-0.99;-0.99	5.22	5.22	0.72569	5.22	5.22	0.72569	Kinesin, motor domain (4);	.	.	.	.	T	0.79015	0.4375	L	0.52364	1.645	0.80722	D	1	P;P	0.48407	0.91;0.869	P;P	0.51550	0.488;0.673	T	0.80223	-0.1471	9	0.56958	D	0.05	.	19.1397	0.93443	0.0:1.0:0.0:0.0	.	202;583	B7WPD9;Q2KJY2	.;KI26B_HUMAN	C	583;202;199	ENSP00000385545:R583C;ENSP00000355475:R202C	ENSP00000355475:R202C	R	+	1	0	0	KIF26B	243839286	243839286	1.000000	0.71417	0.976000	0.42696	0.742000	0.42306	2.108000	0.41854	2.590000	0.87494	0.650000	0.86243	CGC	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.567	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.980000	-20.000000	1	0.440000	XM_371354		0	17	17	0	79	76	1		1	0		0	0	30	0	0	0.999975	2.322260e-01	0	1	0	4	0	17	79
MEGF6	1953	broad.mit.edu	37	1	3511972	3511972	+	Silent	SNP	C	C	T	rs373577278		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:3511972C>T	ENST00000356575.4	-	3	532	c.306G>A	c.(304-306)acG>acA	p.T102T		NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	102	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TCCGGGCCTCCGTGGTATACA	0.637													c|||	1	0.000199681	0.0	0.0	5008	,	,		14108	0.001		0.0	False		,,,				2504	0.0				Ovarian(73;978 3658)	ENST00000356575.4	0.460000	0.200000	0.390000	0.260000	0.320000	0.331765	0.320000	0.320000																										0				19						c.(304-306)acG>acA		multiple EGF-like-domains 6				1,4033		0,1,2016	35.0	43.0	40.0		306	-4.7	0.0	1		40	0,8354		0,0,4177	no	coding-synonymous	MEGF6	NM_001409.3		0,1,6193	TT,TC,CC		0.0,0.0248,0.0081		102/1542	3511972	1,12387	2017	4177	6194	SO:0001819	synonymous_variant	1953	14	120880	42				g.chr1:3511972C>T	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.306G>A	chr1.hg19:g.3511972C>T		0						p.T102T	NM_001409.3	NP_001400.3	0	0	0	1.902310	O75095	MEGF6_HUMAN		3	532	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	1	1	hg19	c.306G>A	CCDS41237.1	0																																																																																								0.408784		TCGA-IB-A7M4-01A-11D-A36O-08	0.637	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	1	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	1.980000	-2.879466	1	0.440000	NM_001409		0	23	23	0	285	279	0		1	0		0	0	102	0	0	0.999999	6.223421e-03	0	0	0	2	0	23	285
STIL	6491	broad.mit.edu	37	1	47748097	47748097	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:47748097T>C	ENST00000360380.3	-	12	1531	c.1168A>G	c.(1168-1170)Ata>Gta	p.I390V	STIL_ENST00000371877.3_Missense_Mutation_p.I390V|STIL_ENST00000396221.2_Missense_Mutation_p.I390V|STIL_ENST00000337817.5_Missense_Mutation_p.I390V|STIL_ENST00000243182.6_Missense_Mutation_p.I390V	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	390					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TGATCATGTATTGGCATCTTC	0.388																																						ENST00000360380.3	1.000000	0.740000	0.990000	0.820000	0.900000	0.904158	0.900000	1.000000																										0				36						c.(1168-1170)Ata>Gta		SCL/TAL1 interrupting locus							117.0	119.0	119.0					1																	47748097		2203	4300	6503	SO:0001583	missense	6491	0	0					g.chr1:47748097T>C	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1168A>G	chr1.hg19:g.47748097T>C	ENSP00000353544:p.Ile390Val	0					STIL_ENST00000371877.3_Missense_Mutation_p.I390V|STIL_ENST00000396221.2_Missense_Mutation_p.I390V|STIL_ENST00000243182.6_Missense_Mutation_p.I390V|STIL_ENST00000337817.5_Missense_Mutation_p.I390V	p.I390V	NM_001282936.1	NP_001269865.1	0	0	0	1.943490	Q15468	STIL_HUMAN		12	1531	-		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	1	1	hg19	c.1168A>G	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	T	0.547	-0.850932	0.02651	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07	5.74	-4.22	0.03800	5.74	-4.22	0.03800	.	0.663385	0.16965	N	0.192348	T	0.17916	0.0430	N	0.13043	0.29	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.003;0.003;0.003;0.003;0.003	T	0.33701	-0.9858	10	0.08599	T	0.76	-1.1589	9.5812	0.39488	0.0:0.5654:0.122:0.3126	.	390;343;390;390;390	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	V	390;390;390;390;390;343	ENSP00000353544:I390V;ENSP00000337367:I390V;ENSP00000360944:I390V;ENSP00000379523:I390V;ENSP00000243182:I390V;ENSP00000411664:I343V	ENSP00000243182:I390V	I	-	1	0	0	STIL	47520684	47520684	0.053000	0.20554	0.184000	0.23157	0.125000	0.20455	-0.250000	0.08830	-0.747000	0.04759	0.459000	0.35465	ATA	0.419569		TCGA-IB-A7M4-01A-11D-A36O-08	0.388	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	1	0	1	2	2	2	2	0	0	0	0	116	116	116	115	1	1.980000	-20.000000	1	0.440000	NM_003035		0	95	92	0	364	360	1		1	0		0	0	116	0	0	1.000000	2.800527e-01	0	1	0	4	0	95	364
OR14C36	127066	broad.mit.edu	37	1	248513002	248513002	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr1:248513002C>A	ENST00000317861.1	+	1	926	c.926C>A	c.(925-927)tCa>tAa	p.S309*		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						ATTTTTTATTCAGAAAATGTG	0.328																																						ENST00000317861.1	0.200000	0.050000	0.160000	0.080000	0.110000	0.123382	0.110000	0.110000																										0				43						c.(925-927)tCa>tAa		olfactory receptor, family 14, subfamily C, member 36							49.0	61.0	57.0					1																	248513002		1968	3820	5788	SO:0001587	stop_gained	127066	0	0					g.chr1:248513002C>A	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.926C>A	chr1.hg19:g.248513002C>A	ENSP00000324534:p.Ser309*	0						p.S309*	NM_001001918.1	NP_001001918.1	0	0	0	1.927308	Q8NHC7	O14CZ_HUMAN		1	926	+			Q6IEZ6	Nonsense_Mutation	SNP	ENST00000317861.1	0	1	hg19	c.926C>A	CCDS31112.1	0	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118676	0.37436	.	.	ENSG00000177174	ENST00000317861	.	.	.	3.07	3.07	0.35406	3.07	3.07	0.35406	.	1.879040	0.04039	U	0.302756	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9262	0.41494	0.0:1.0:0.0:0.0	.	.	.	.	X	309	.	ENSP00000324534:S309X	S	+	2	0	0	OR14C36	246579625	246579625	0.000000	0.05858	0.235000	0.24058	0.127000	0.20565	-0.623000	0.05546	1.773000	0.52216	0.388000	0.25769	TCA	0.414226		TCGA-IB-A7M4-01A-11D-A36O-08	0.328	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	1.980000	-2.797699	1	0.440000	NM_001001918		0	10	9	0	374	372	0		1			0	0	107	0	0	0.996848	0	0	0	0	0	0	10	374
HM13	81502	broad.mit.edu	37	20	30125989	30125989	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr20:30125989C>G	ENST00000340852.5	+	3	414	c.290C>G	c.(289-291)tCc>tGc	p.S97C	HM13_ENST00000335574.5_Missense_Mutation_p.S97C|HM13_ENST00000398174.3_Missense_Mutation_p.S97C|HM13_ENST00000376127.3_Missense_Mutation_p.S97C	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13	97					membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			CAGATATTCTCCCAGGAGTAC	0.512																																						ENST00000340852.5	1.000000	0.690000	1.000000	0.790000	0.900000	0.901692	0.900000	1.000000																										0				12						c.(289-291)tCc>tGc		histocompatibility (minor) 13							123.0	106.0	111.0					20																	30125989		2203	4300	6503	SO:0001583	missense	81502	0	0					g.chr20:30125989C>G	AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.290C>G	chr20.hg19:g.30125989C>G	ENSP00000343032:p.Ser97Cys	1					HM13_ENST00000335574.5_Missense_Mutation_p.S97C|HM13_ENST00000376127.3_Missense_Mutation_p.S97C|HM13_ENST00000398174.3_Missense_Mutation_p.S97C	p.S97C	NM_030789.2	NP_110416.1	1	3	4	2.488582	Q8TCT9	HM13_HUMAN	all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)	3	414	+	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	Missense_Mutation	SNP	ENST00000340852.5	1	1	hg19	c.290C>G	CCDS13182.1	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826944	0.90955	.	.	ENSG00000101294	ENST00000335574;ENST00000340852;ENST00000398174;ENST00000376127;ENST00000344042	T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.098626	0.64402	D	0.000001	T	0.57666	0.2069	M	0.92833	3.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.992;0.987;0.982;0.987	T	0.67692	-0.5605	10	0.62326	D	0.03	-3.5946	17.8794	0.88835	0.0:1.0:0.0:0.0	.	97;97;97;97	Q8TCT9;Q8TCT9-4;Q8TCT9-2;Q8TCT9-5	HM13_HUMAN;.;.;.	C	97	ENSP00000335294:S97C;ENSP00000343032:S97C;ENSP00000381237:S97C;ENSP00000365296:S97C;ENSP00000341347:S97C	ENSP00000335294:S97C	S	+	2	0	0	HM13	29589650	29589650	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.840000	0.75369	2.567000	0.86603	0.655000	0.94253	TCC	0.561541		TCGA-IB-A7M4-01A-11D-A36O-08	0.512	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078527.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.980000	-3.019294	1	0.440000	NM_178580		0	68	68	0	385	381	1		1	1		0	0	76	0	0	1.000000	1	0	67	0	247	0	68	385
MYLK2	85366	broad.mit.edu	37	20	30414610	30414610	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr20:30414610G>A	ENST00000375994.2	+	7	1366	c.1093G>A	c.(1093-1095)Gga>Aga	p.G365R	MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_Missense_Mutation_p.G365R			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	365	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CATCGAGGGCGGAGAGCTCTT	0.587																																						ENST00000375994.2	1.000000	0.080000	1.000000	0.150000	0.240000	0.400511	0.240000	0.200000																										0				33						c.(1093-1095)Gga>Aga		myosin light chain kinase 2							119.0	95.0	103.0					20																	30414610		2203	4300	6503	SO:0001583	missense	85366	1	121412	29				g.chr20:30414610G>A	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1093G>A	chr20.hg19:g.30414610G>A	ENSP00000365162:p.Gly365Arg	1					MYLK2_ENST00000375985.4_Missense_Mutation_p.G365R|MYLK2_ENST00000468730.1_3'UTR	p.G365R			1	3	4	2.488582	Q9H1R3	MYLK2_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)	7	1366	+			Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	0	1	hg19	c.1093G>A	CCDS13191.1	0	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370531	0.82573	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.57273	0.41;0.41	3.66	3.66	0.41972	3.66	3.66	0.41972	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.70168	0.3193	M	0.83012	2.62	0.58432	D	0.999999	D	0.67145	0.996	P	0.59595	0.86	T	0.77606	-0.2525	9	0.87932	D	0	.	14.5797	0.68278	0.0:0.0:1.0:0.0	.	365	Q9H1R3	MYLK2_HUMAN	R	365	ENSP00000365162:G365R;ENSP00000365152:G365R	ENSP00000365152:G365R	G	+	1	0	0	MYLK2	29878271	29878271	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.494000	0.97962	1.882000	0.54519	0.435000	0.28638	GGA	0.561541		TCGA-IB-A7M4-01A-11D-A36O-08	0.587	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.980000	-8.282029	1	0.440000	NM_033118		0	6	6	0	171	165	0		1			0	0	45	0	0	0.961928	0	0	0	0	0	0	6	171
BMP2	650	broad.mit.edu	37	20	6759506	6759506	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr20:6759506C>G	ENST00000378827.4	+	3	2180	c.961C>G	c.(961-963)Cac>Gac	p.H321D		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	321					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						CCCGGGGTATCACGCCTTTTA	0.512																																						ENST00000378827.4	0.410000	0.170000	0.350000	0.220000	0.270000	0.288081	0.270000	0.280000																										0				13						c.(961-963)Cac>Gac		bone morphogenetic protein 2							160.0	134.0	143.0					20																	6759506		2203	4300	6503	SO:0001583	missense	650	0	0					g.chr20:6759506C>G		CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.961C>G	chr20.hg19:g.6759506C>G	ENSP00000368104:p.His321Asp	1						p.H321D	NM_001200.2	NP_001191.1	0	1	1	1.537272	P12643	BMP2_HUMAN		3	2180	+				Missense_Mutation	SNP	ENST00000378827.4	1	1	hg19	c.961C>G	CCDS13099.1	0	.	.	.	.	.	.	.	.	.	.	C	8.617	0.890572	0.17613	.	.	ENSG00000125845	ENST00000378827	D	0.83673	-1.75	5.57	5.57	0.84162	5.57	5.57	0.84162	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.132179	0.64402	D	0.000002	T	0.69378	0.3104	N	0.10664	0.02	0.53005	D	0.999968	B	0.14012	0.009	B	0.15052	0.012	T	0.65944	-0.6045	10	0.52906	T	0.07	.	14.6309	0.68655	0.1798:0.8202:0.0:0.0	.	321	P12643	BMP2_HUMAN	D	321	ENSP00000368104:H321D	ENSP00000368104:H321D	H	+	1	0	0	BMP2	6707506	6707506	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.436000	0.44819	2.775000	0.95449	0.650000	0.86243	CAC	0.286079		TCGA-IB-A7M4-01A-11D-A36O-08	0.512	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3	1	0	1	2	2	2	2	0	0	0	0	77	77	77	76	1	1.980000	-7.380157	1	0.440000			0	19	19	0	224	222	0		1	1		0	0	77	0	0	0.999992	7.420389e-01	0	9	0	24	0	19	224
TOP1	7150	broad.mit.edu	37	20	39750710	39750710	+	Missense_Mutation	SNP	C	C	A	rs193297810		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr20:39750710C>A	ENST00000361337.2	+	20	2360	c.2110C>A	c.(2110-2112)Caa>Aaa	p.Q704K	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	704					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	GCTGGAAGTTCAAGCCACAGA	0.478			T	NUP98	AML*																																	ENST00000361337.2	1.000000	0.100000	1.000000	0.130000	0.180000	0.333476	0.180000	0.180000				Dom	yes			Dom	yes		20	20q12-q13.1	20q12-q13.1	7150	T	topoisomerase (DNA) I				L	L	NUP98		AML*		0				37						c.(2110-2112)Caa>Aaa		topoisomerase (DNA) I	Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)						92.0	89.0	90.0					20																	39750710		2203	4300	6503	SO:0001583	missense	7150	0	0					g.chr20:39750710C>A		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.2110C>A	chr20.hg19:g.39750710C>A	ENSP00000354522:p.Gln704Lys	1					RP1-1J6.2_ENST00000454626.1_RNA	p.Q704K	NM_003286.2	NP_003277.1	0	6	6	2.522433	P11387	TOP1_HUMAN		20	2360	+		Myeloproliferative disorder(115;0.00878)	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	ENST00000361337.2	0	1	hg19	c.2110C>A	CCDS13312.1	0	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595991	0.66332	.	.	ENSG00000198900	ENST00000361337	T	0.47869	0.83	5.91	4.93	0.64822	5.91	4.93	0.64822	DNA breaking-rejoining enzyme, catalytic core (1);DNA topoisomerase I, C-terminal, eukaryotic-type (1);DNA topoisomerase I, catalytic core, alpha/beta subdomain, eukaryotic-type (1);DNA topoisomerases I, dispensable insert, eukaryotic-type (1);	0.101665	0.64402	D	0.000001	T	0.50531	0.1621	M	0.67569	2.06	0.80722	D	1	B	0.20261	0.043	B	0.26969	0.075	T	0.50825	-0.8782	10	0.52906	T	0.07	-14.8363	16.5333	0.84366	0.131:0.869:0.0:0.0	.	704	P11387	TOP1_HUMAN	K	704	ENSP00000354522:Q704K	ENSP00000354522:Q704K	Q	+	1	0	0	TOP1	39184124	39184124	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.802000	0.62539	2.793000	0.96121	0.655000	0.94253	CAA	0.547511		TCGA-IB-A7M4-01A-11D-A36O-08	0.478	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	122	1	1.980000	-2.149438	0	0.440000			0	19	18	0	610	594	0		1	1		0	0	125	0	0	0.999988	9.995536e-01	0	4	0	394	0	19	610
ADAMTS5	11096	broad.mit.edu	37	21	28315795	28315795	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr21:28315795G>A	ENST00000284987.5	-	3	1430	c.1309C>T	c.(1309-1311)Cgc>Tgc	p.R437C		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	437	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GACATTAAGCGCTTATCTTCT	0.453																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	ENST00000284987.5	1.000000	0.080000	0.250000	0.120000	0.170000	0.216056	0.170000	0.170000																										0				72						c.(1309-1311)Cgc>Tgc		ADAM metallopeptidase with thrombospondin type 1 motif, 5							114.0	100.0	105.0					21																	28315795		2203	4300	6503	SO:0001583	missense	11096	7	121406	38				g.chr21:28315795G>A	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1309C>T	chr21.hg19:g.28315795G>A	ENSP00000284987:p.Arg437Cys	0						p.R437C	NM_007038.3	NP_008969.2	1	2	3	2.048140	Q9UNA0	ATS5_HUMAN		3	1430	-			Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	1	1	hg19	c.1309C>T	CCDS13579.1	0	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445910	0.84101	.	.	ENSG00000154736	ENST00000284987	T	0.21543	2.0	5.4	5.4	0.78164	5.4	5.4	0.78164	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.16514	0.0397	N	0.00405	-1.535	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.60556	-0.7240	10	0.87932	D	0	.	15.0918	0.72201	0.0:0.0:0.858:0.142	.	437	Q9UNA0	ATS5_HUMAN	C	437	ENSP00000284987:R437C	ENSP00000284987:R437C	R	-	1	0	0	ADAMTS5	27237666	27237666	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.848000	0.62874	2.828000	0.97474	0.650000	0.86243	CGC	0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.453	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1	0	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.980000	-3.826209	1	0.440000			0	9	9	0	236	236	0		1	0		0	0	65	0	0	0.994467	1.795742e-03	0	0	0	2	0	9	236
CNTNAP5	129684	broad.mit.edu	37	2	125671709	125671709	+	Silent	SNP	C	C	T	rs374804076		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr2:125671709C>T	ENST00000431078.1	+	24	4129	c.3765C>T	c.(3763-3765)atC>atT	p.I1255I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1255					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.I1255I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCTGTATCATCGGCATCATGA	0.468																																						ENST00000431078.1	1.000000	0.140000	0.290000	0.180000	0.230000	0.265476	0.230000	0.230000																										1	Substitution - coding silent(1)	p.I1255I(1)	prostate(1)	176						c.(3763-3765)atC>atT		contactin associated protein-like 5		C		1,3945		0,1,1972	174.0	164.0	167.0		3765	-8.1	0.0	2		167	0,8350		0,0,4175	no	coding-synonymous	CNTNAP5	NM_130773.2		0,1,6147	TT,TC,CC		0.0,0.0253,0.0081		1255/1307	125671709	1,12295	1973	4175	6148	SO:0001819	synonymous_variant	129684	4	120902	44				g.chr2:125671709C>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3765C>T	chr2.hg19:g.125671709C>T		0						p.I1255I	NM_130773.2	NP_570129.1	1	2	3	2.033132	Q8WYK1	CNTP5_HUMAN		24	4129	+			Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	1	1	hg19	c.3765C>T	CCDS46401.1	0																																																																																								0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.468	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3	1	0	1	2	14	2	2	1	1	1	1	138	138	138	136	1	1.980000	-3.295186	1	0.440000			0	25	25	0	477	471	0		1			1	0	138	0	0	0.973005	0	0	0	0	0	0	25	477
MYO7B	4648	broad.mit.edu	37	2	128335762	128335762	+	Missense_Mutation	SNP	C	C	T	rs377172629		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr2:128335762C>T	ENST00000409816.2	+	8	936	c.904C>T	c.(904-906)Cgc>Tgc	p.R302C	MYO7B_ENST00000389524.4_Missense_Mutation_p.R302C|MYO7B_ENST00000428314.1_Missense_Mutation_p.R302C			Q6PIF6	MYO7B_HUMAN	myosin VIIB	302	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CGCCCACATCCGCTCGGCCAT	0.622																																						ENST00000409816.2	1.000000	0.530000	0.890000	0.630000	0.740000	0.761996	0.740000	0.740000																										0				75						c.(904-906)Cgc>Tgc		myosin VIIB		C	CYS/ARG	0,4248		0,0,2124	62.0	68.0	66.0		904	3.4	0.9	2		66	1,8451		0,1,4225	no	missense	MYO7B	NM_001080527.1	180	0,1,6349	TT,TC,CC		0.0118,0.0,0.0079	possibly-damaging	302/2117	128335762	1,12699	2124	4226	6350	SO:0001583	missense	4648	2	121120	35				g.chr2:128335762C>T		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.904C>T	chr2.hg19:g.128335762C>T	ENSP00000386461:p.Arg302Cys	0					MYO7B_ENST00000428314.1_Missense_Mutation_p.R302C|MYO7B_ENST00000389524.4_Missense_Mutation_p.R302C	p.R302C			1	2	3	2.033132	Q6PIF6	MYO7B_HUMAN		8	936	+	Colorectal(110;0.1)		Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	1	1	hg19	c.904C>T	CCDS46405.1	0	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740794	0.69304	0.0	1.18E-4	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.88431	-2.38;-2.38;-2.38	4.25	3.36	0.38483	4.25	3.36	0.38483	Myosin head, motor domain (2);	0.061993	0.64402	D	0.000003	D	0.87569	0.6210	M	0.79475	2.455	0.80722	D	1	P	0.40250	0.709	B	0.36289	0.221	D	0.88167	0.2861	10	0.87932	D	0	.	12.4074	0.55447	0.0:0.9171:0.0:0.0828	.	302	Q6PIF6	MYO7B_HUMAN	C	302	ENSP00000374175:R302C;ENSP00000415090:R302C;ENSP00000386461:R302C	ENSP00000374175:R302C	R	+	1	0	0	MYO7B	128052232	128052232	0.998000	0.40836	0.872000	0.34217	0.964000	0.63967	3.741000	0.55090	1.136000	0.42199	0.563000	0.77884	CGC	0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.622	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	1	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	1.980000	-20.000000	1	0.440000	XM_291001		0	33	32	0	171	168	1		1	1		0	0	45	0	0	1.000000	3.890862e-01	0	3	0	5	0	33	171
SCN9A	6335	broad.mit.edu	37	2	167141148	167141148	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr2:167141148G>A	ENST00000409435.1	-	11	1788	c.1789C>T	c.(1789-1791)Cga>Tga	p.R597*	SCN9A_ENST00000375387.4_Nonsense_Mutation_p.R598*|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Nonsense_Mutation_p.R597*|SCN9A_ENST00000303354.6_Nonsense_Mutation_p.R598*			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	597					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGCTGCGTCGCTCCTGGGGT	0.542																																						ENST00000409435.1	1.000000	0.200000	0.380000	0.250000	0.310000	0.342287	0.310000	0.310000																										0				108						c.(1789-1791)Cga>Tga		sodium channel, voltage-gated, type IX, alpha subunit	Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)						96.0	102.0	100.0					2																	167141148		2139	4260	6399	SO:0001587	stop_gained	6335	0	0					g.chr2:167141148G>A	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1789C>T	chr2.hg19:g.167141148G>A	ENSP00000386330:p.Arg597*	0					AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Nonsense_Mutation_p.R597*|SCN9A_ENST00000303354.6_Nonsense_Mutation_p.R598*|SCN9A_ENST00000375387.4_Nonsense_Mutation_p.R598*	p.R597*			1	2	3	2.033132	Q15858	SCN9A_HUMAN		11	1788	-			A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Nonsense_Mutation	SNP	ENST00000409435.1	0	1	hg19	c.1789C>T	CCDS46441.1	0	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918909	0.73098	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	.	.	.	5.64	3.8	0.43715	5.64	3.8	0.43715	.	0.000000	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1065	0.72324	0.0:0.0:0.7411:0.2589	.	.	.	.	X	597;598;598;597;462;462	.	ENSP00000304748:R598X	R	-	1	2	2	SCN9A	166849394	166849394	0.826000	0.29277	1.000000	0.80357	0.365000	0.29674	1.783000	0.38664	0.812000	0.34326	-0.270000	0.10280	CGA	0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.542	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	1	0	1	2	2	2	2	0	0	0	0	121	121	121	120	1	1.980000	-3.221912	1	0.440000	NM_002977		0	26	26	0	363	351	0		1			0	0	121	0	0	1.000000	0	0	0	0	0	0	26	363
ITGA6	3655	broad.mit.edu	37	2	173356152	173356152	+	Splice_Site	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr2:173356152G>A	ENST00000264106.6	+	24	3209		c.e24-1		ITGA6_ENST00000409532.1_Splice_Site|ITGA6_ENST00000343713.4_Splice_Site|ITGA6_ENST00000375221.2_Splice_Site|ITGA6_ENST00000409080.1_Splice_Site|ITGA6_ENST00000264107.7_Splice_Site|AC093818.1_ENST00000442417.1_RNA			P23229	ITA6_HUMAN	integrin, alpha 6						amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.?(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TCTCCAAACAGGAATATTCCA	0.463																																						ENST00000264106.6	1.000000	0.110000	0.280000	0.150000	0.200000	0.245865	0.200000	0.200000																										2	Unknown(2)	p.?(2)	lung(2)	44						c.e24-1		integrin, alpha 6							93.0	84.0	87.0					2																	173356152		2203	4300	6503	SO:0001630	splice_region_variant	3655	0	0					g.chr2:173356152G>A		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.3007-1G>A	chr2.hg19:g.173356152G>A		0					AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000409532.1_Splice_Site|ITGA6_ENST00000264107.7_Splice_Site|ITGA6_ENST00000409080.1_Splice_Site|ITGA6_ENST00000375221.2_Splice_Site|ITGA6_ENST00000343713.4_Splice_Site				1	2	3	2.033132	P23229	ITA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0979)	24	3209	+			B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Splice_Site	SNP	ENST00000264106.6	1	1	hg19			0	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408478	0.62399	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358;ENST00000416789	.	.	.	5.21	5.21	0.72293	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7456	0.91791	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ITGA6	173064398	173064398	1.000000	0.71417	0.998000	0.56505	0.705000	0.40729	8.573000	0.90759	2.432000	0.82394	0.467000	0.42956	.	0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.463	ITGA6-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	1.980000	-2.989364	1	0.440000		Intron	0	15	15	0	322	319	0		1	0		0	0	83	0	0	0.999872	0	0	0	0	1	0	15	322
WIPF1	7456	broad.mit.edu	37	2	175436585	175436585	+	Silent	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr2:175436585G>A	ENST00000392547.2	-	5	1047	c.948C>T	c.(946-948)ccC>ccT	p.P316P	WIPF1_ENST00000409415.3_Silent_p.P316P|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000359761.3_Silent_p.P316P|WIPF1_ENST00000467149.1_5'Flank|WIPF1_ENST00000392546.2_Silent_p.P316P|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000409891.1_Silent_p.P316P|WIPF1_ENST00000272746.5_Silent_p.P316P	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	316	Pro-rich.				actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GAGGCGGCCCGGGCCTGCTGG	0.662																																						ENST00000392547.2	1.000000	0.620000	1.000000	0.730000	0.860000	0.861510	0.860000	1.000000																										0				32						c.(946-948)ccC>ccT		WAS/WASL interacting protein family, member 1							23.0	27.0	26.0					2																	175436585		2203	4300	6503	SO:0001819	synonymous_variant	7456	1	121396	32				g.chr2:175436585G>A	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.948C>T	chr2.hg19:g.175436585G>A		0					WIPF1_ENST00000409415.3_Silent_p.P316P|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000467149.1_5'Flank|WIPF1_ENST00000272746.5_Silent_p.P316P|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000392546.2_Silent_p.P316P|WIPF1_ENST00000409891.1_Silent_p.P316P|WIPF1_ENST00000359761.3_Silent_p.P316P	p.P316P	NM_003387.4	NP_003378.3	1	2	3	2.033132	O43516	WIPF1_HUMAN		5	1047	-			B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Silent	SNP	ENST00000392547.2	1	1	hg19	c.948C>T	CCDS2260.1	1																																																																																								0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.662	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.980000	-3.208148	1	0.440000	NM_003387		0	34	33	0	148	145	1		1	1		0	0	57	0	0	1.000000	9.991404e-01	0	2	0	49	0	34	148
COL6A3	1293	broad.mit.edu	37	2	238280504	238280504	+	Missense_Mutation	SNP	C	C	T	rs146092501	byFrequency	TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr2:238280504C>T	ENST00000295550.4	-	9	4608	c.4156G>A	c.(4156-4158)Gaa>Aaa	p.E1386K	COL6A3_ENST00000409809.1_Missense_Mutation_p.E1180K|COL6A3_ENST00000347401.3_Missense_Mutation_p.E1185K|COL6A3_ENST00000392003.2_Missense_Mutation_p.E979K|COL6A3_ENST00000353578.4_Missense_Mutation_p.E1180K|COL6A3_ENST00000346358.4_Missense_Mutation_p.E1186K|COL6A3_ENST00000392004.3_Missense_Mutation_p.E1180K|COL6A3_ENST00000472056.1_Missense_Mutation_p.E779K	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1386	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.		E -> K (in BM; dbSNP:rs146092501). {ECO:0000269|PubMed:15689448}.		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AACACATATTCGGGGCTCAGC	0.617													C|||	9	0.00179712	0.0	0.0	5008	,	,		15506	0.0		0.008	False		,,,				2504	0.001					ENST00000295550.4	1.000000	0.710000	1.000000	0.790000	0.890000	0.894332	0.890000	1.000000																										0				217	GRCh37	CM050230	COL6A3	M	rs146092501	c.(4156-4158)Gaa>Aaa		collagen, type VI, alpha 3		C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	4,4402	8.1+/-20.4	0,4,2199	76.0	74.0	74.0		4156,2935,3538,2335,3538	5.6	0.9	2	dbSNP_134	74	42,8558	27.9+/-77.7	0,42,4258	yes	missense,missense,missense,missense,missense	COL6A3	NM_004369.3,NM_057164.4,NM_057165.4,NM_057166.4,NM_057167.3	56,56,56,56,56	0,46,6457	TT,TC,CC		0.4884,0.0908,0.3537	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1386/3178,979/1037,1180/1238,779/2571,1180/2972	238280504	46,12960	2203	4300	6503	SO:0001583	missense	1293	726	121412	61				g.chr2:238280504C>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4156G>A	chr2.hg19:g.238280504C>T	ENSP00000295550:p.Glu1386Lys	0					COL6A3_ENST00000472056.1_Missense_Mutation_p.E779K|COL6A3_ENST00000409809.1_Missense_Mutation_p.E1180K|COL6A3_ENST00000392004.3_Missense_Mutation_p.E1180K|COL6A3_ENST00000353578.4_Missense_Mutation_p.E1180K|COL6A3_ENST00000346358.4_Missense_Mutation_p.E1186K|COL6A3_ENST00000392003.2_Missense_Mutation_p.E979K|COL6A3_ENST00000347401.3_Missense_Mutation_p.E1185K	p.E1386K	NM_004369.3	NP_004360.2	1	2	3	2.033132	P12111	CO6A3_HUMAN		9	4608	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	1	0	hg19	c.4156G>A	CCDS33412.1	1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	C	17.41	3.383806	0.61845	9.08E-4	0.004884	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	D;D;D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.64	5.64	0.86602	5.64	5.64	0.86602	von Willebrand factor, type A (3);	0.108957	0.40144	N	0.001174	T	0.77438	0.4130	L	0.33293	1	0.09310	N	0.999993	D;D;D;D;D	0.64830	0.99;0.981;0.961;0.994;0.986	P;P;P;P;P	0.60415	0.874;0.745;0.658;0.746;0.588	T	0.70425	-0.4875	10	0.23302	T	0.38	.	9.5113	0.39078	0.0:0.7818:0.1441:0.0741	.	779;979;1180;1180;1386	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	K	1386;1185;1180;779;1180;1186;1180;979	ENSP00000295550:E1386K;ENSP00000315609:E1185K;ENSP00000315873:E1180K;ENSP00000418285:E779K;ENSP00000386844:E1180K;ENSP00000295546:E1186K;ENSP00000375861:E1180K;ENSP00000375860:E979K	ENSP00000295550:E1386K	E	-	1	0	0	COL6A3	237945243	237945243	0.862000	0.29867	0.876000	0.34364	0.398000	0.30690	1.784000	0.38674	2.659000	0.90383	0.650000	0.86243	GAA	0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	0	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.980000	-2.172057	0	0.440000	NM_004369		0	69	68	0	286	282	1		1	1		0	0	99	0	0	1.000000	1	0	2	0	109	0	69	286
IQCB1	9657	broad.mit.edu	37	3	121526279	121526279	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr3:121526279C>A	ENST00000310864.6	-	7	713	c.499G>T	c.(499-501)Gat>Tat	p.D167Y	IQCB1_ENST00000349820.6_Missense_Mutation_p.D167Y	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	167					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		AAGAAATGATCACTTTGTAGT	0.308																																						ENST00000310864.6	1.000000	0.050000	0.140000	0.070000	0.090000	0.189501	0.090000	0.090000																										0				30						c.(499-501)Gat>Tat		IQ motif containing B1							113.0	112.0	113.0					3																	121526279		2203	4297	6500	SO:0001583	missense	9657	0	0					g.chr3:121526279C>A	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.499G>T	chr3.hg19:g.121526279C>A	ENSP00000311505:p.Asp167Tyr	0					IQCB1_ENST00000349820.6_Missense_Mutation_p.D167Y	p.D167Y	NM_001023570.2	NP_001018864.2	2	2	4	2.113889	Q15051	IQCB1_HUMAN		7	713	-			Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	0	1	hg19	c.499G>T	CCDS33837.1	0	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849869	0.51270	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.36520	1.25;2.89	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.355758	0.34156	N	0.004215	T	0.41282	0.1152	L	0.27053	0.805	0.31110	N	0.710065	P;D	0.63046	0.91;0.992	B;P	0.56960	0.424;0.81	T	0.44605	-0.9317	10	0.72032	D	0.01	-6.9459	14.1128	0.65134	0.0:1.0:0.0:0.0	.	167;167	Q15051;Q15051-2	IQCB1_HUMAN;.	Y	167	ENSP00000311505:D167Y;ENSP00000323756:D167Y	ENSP00000311505:D167Y	D	-	1	0	0	IQCB1	123008969	123008969	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	1.598000	0.36740	2.706000	0.92434	0.557000	0.71058	GAT	0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.308	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	0	0	1	2	17	2	2	1	1	1	1	198	198	198	197	1	1.980000	-2.527107	1	0.440000	NM_014642		0	19	19	0	909	901	0		1	0		1	0	198	0	0	0.682396	1.373876e-01	0	0	0	30	0	19	909
NPHP3	27031	broad.mit.edu	37	3	132407536	132407536	+	Missense_Mutation	SNP	C	C	T	rs200722938		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr3:132407536C>T	ENST00000337331.5	-	21	3169	c.3083G>A	c.(3082-3084)cGt>cAt	p.R1028H	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	1028					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TTCAAGTTCACGAGCAGTATA	0.388																																						ENST00000337331.5	1.000000	0.320000	0.490000	0.360000	0.410000	0.473565	0.410000	0.410000																										0				42						c.(3082-3084)cGt>cAt		nephronophthisis 3 (adolescent)							105.0	112.0	110.0					3																	132407536		2203	4300	6503	SO:0001583	missense	27031	3	121412	41				g.chr3:132407536C>T	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.3083G>A	chr3.hg19:g.132407536C>T	ENSP00000338766:p.Arg1028His	0					NPHP3_ENST00000326682.8_3'UTR	p.R1028H	NM_153240.4	NP_694972.3	2	2	4	2.113889	Q7Z494	NPHP3_HUMAN		21	3169	-			Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	1	1	hg19	c.3083G>A	CCDS3078.1	0	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683896	0.88639	.	.	ENSG00000113971	ENST00000393144;ENST00000393156;ENST00000337331	T	0.64085	-0.08	5.57	5.57	0.84162	5.57	5.57	0.84162	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.71813	0.3384	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.72481	-0.4280	10	0.52906	T	0.07	-17.9717	19.5469	0.95302	0.0:1.0:0.0:0.0	.	1028	Q7Z494	NPHP3_HUMAN	H	308;90;1028	ENSP00000338766:R1028H	ENSP00000338766:R1028H	R	-	2	0	0	NPHP3	133890226	133890226	1.000000	0.71417	0.896000	0.35187	0.560000	0.35617	5.823000	0.69272	2.632000	0.89209	0.491000	0.48974	CGT	0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.388	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	1	0	1	2	2	2	2	0	0	0	0	213	213	213	213	1	1.980000	-18.324050	1	0.440000	NM_153240		0	76	73	0	804	792	0		1	1		0	0	213	0	0	1.000000	3.802078e-01	0	4	0	11	0	76	804
RPL14	9045	broad.mit.edu	37	3	40503613	40503613	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr3:40503613G>A	ENST00000396203.2	+	6	670	c.538G>A	c.(538-540)Gcc>Acc	p.A180T	RPL14_ENST00000416518.1_3'UTR|RPL14_ENST00000338970.6_Missense_Mutation_p.A180T	NM_001034996.2	NP_001030168.1	P50914	RL14_HUMAN	ribosomal protein L14	180	4 X 5 AA tandem repeats of Q-K-A-[PAS]-X.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)								KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GAAGGTTCCTGCCCAGAAAGC	0.552																																						ENST00000396203.2	1.000000	0.870000	1.000000	0.990000	0.990000	0.989844	0.990000	1.000000																										0										c.(538-540)Gcc>Acc		ribosomal protein L14							18.0	18.0	18.0					3																	40503613		2202	4300	6502	SO:0001583	missense	9045	0	0					g.chr3:40503613G>A	D87735	CCDS33739.1, CCDS43070.1	3p22-p21.2	2008-07-18			ENSG00000188846	ENSG00000188846		"""L ribosomal proteins"""	10305	protein-coding gene	gene with protein product	"""CAG-ISL 7"", ""60S ribosomal protein L14"""					9480843	Standard	NM_003973		Approved	L14, hRL14, RL14, CTG-B33	uc003ckg.4	P50914	OTTHUMG00000156046	ENST00000396203.2:c.538G>A	chr3.hg19:g.40503613G>A	ENSP00000379506:p.Ala180Thr	0					RPL14_ENST00000416518.1_3'UTR|RPL14_ENST00000338970.6_Missense_Mutation_p.A180T	p.A180T	NM_001034996.2	NP_001030168.1	2	2	4	2.113889	P50914	RL14_HUMAN		6	670	+			Q45RF0|Q53G20|Q8TBD5|Q8WUT0|Q92579|Q96GR0|Q9BSB8|Q9BW65|Q9BYF6	Missense_Mutation	SNP	ENST00000396203.2	1	1	hg19	c.538G>A	CCDS43070.1	1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638177	0.29157	.	.	ENSG00000188846	ENST00000338970;ENST00000396203	T;T	0.51071	0.72;0.72	4.03	3.15	0.36227	4.03	3.15	0.36227	.	0.000000	0.42821	U	0.000651	T	0.32194	0.0821	L	0.27053	0.805	0.22479	N	0.999065	B	0.02656	0.0	B	0.04013	0.001	T	0.27938	-1.0059	10	0.66056	D	0.02	.	8.253	0.31737	0.1159:0.0:0.8841:0.0	.	180	P50914	RL14_HUMAN	T	180	ENSP00000345156:A180T;ENSP00000379506:A180T	ENSP00000345156:A180T	A	+	1	0	0	RPL14	40478617	40478617	0.082000	0.21442	0.047000	0.18901	0.779000	0.44077	2.579000	0.46059	0.989000	0.38761	-0.154000	0.13518	GCC	0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.552	RPL14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342889.2	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.980000	-20.000000	1	0.440000	NM_003973		0	50	49	0	162	160	1		1	1		0	0	47	0	0	1.000000	1	0	3186	0	3804	0	50	162
EIF4G1	1981	broad.mit.edu	37	3	184043334	184043334	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr3:184043334G>A	ENST00000346169.2	+	20	3299	c.3028G>A	c.(3028-3030)Gag>Aag	p.E1010K	SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000414031.1_Missense_Mutation_p.E970K|EIF4G1_ENST00000319274.6_Missense_Mutation_p.E1010K|EIF4G1_ENST00000392537.2_Missense_Mutation_p.E923K|EIF4G1_ENST00000434061.2_Missense_Mutation_p.E815K|EIF4G1_ENST00000350481.5_Missense_Mutation_p.E846K|EIF4G1_ENST00000435046.2_Missense_Mutation_p.E814K|EIF4G1_ENST00000411531.1_Missense_Mutation_p.E971K|EIF4G1_ENST00000424196.1_Missense_Mutation_p.E1017K|EIF4G1_ENST00000342981.4_Missense_Mutation_p.E1011K|EIF4G1_ENST00000352767.3_Missense_Mutation_p.E1017K|EIF4G1_ENST00000382330.3_Missense_Mutation_p.E1017K|EIF4G1_ENST00000427845.1_Missense_Mutation_p.E924K|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000441154.1_Missense_Mutation_p.E847K	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1010	eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TAAGGAGGCTGAGATGGAAGA	0.577																																						ENST00000346169.2	1.000000	0.020000	0.110000	0.040000	0.060000	0.157969	0.060000	0.070000																										0				75						c.(3028-3030)Gag>Aag		eukaryotic translation initiation factor 4 gamma, 1							111.0	105.0	107.0					3																	184043334		2203	4300	6503	SO:0001583	missense	1981	0	0					g.chr3:184043334G>A	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.3028G>A	chr3.hg19:g.184043334G>A	ENSP00000316879:p.Glu1010Lys	0					EIF4G1_ENST00000411531.1_Missense_Mutation_p.E971K|EIF4G1_ENST00000352767.3_Missense_Mutation_p.E1017K|EIF4G1_ENST00000392537.2_Missense_Mutation_p.E923K|EIF4G1_ENST00000382330.3_Missense_Mutation_p.E1017K|EIF4G1_ENST00000427845.1_Missense_Mutation_p.E924K|EIF4G1_ENST00000350481.5_Missense_Mutation_p.E846K|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000434061.2_Missense_Mutation_p.E815K|EIF4G1_ENST00000435046.2_Missense_Mutation_p.E814K|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000441154.1_Missense_Mutation_p.E847K|EIF4G1_ENST00000342981.4_Missense_Mutation_p.E1011K|EIF4G1_ENST00000414031.1_Missense_Mutation_p.E970K|EIF4G1_ENST00000319274.6_Missense_Mutation_p.E1010K|EIF4G1_ENST00000424196.1_Missense_Mutation_p.E1017K	p.E1010K	NM_198241.2	NP_937884	2	2	4	2.113889	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)	20	3299	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	0	1	hg19	c.3028G>A	CCDS3259.1	0	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293252	0.23564	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.04706	3.82;3.81;3.73;3.81;3.6;3.81;3.74;3.82;3.82;3.81;3.81;3.6;3.57;3.57	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.06050	0.0157	L	0.44542	1.39	0.80722	D	1	B;B;B	0.25312	0.123;0.063;0.059	B;B;B	0.25506	0.061;0.019;0.019	T	0.20571	-1.0271	10	0.05833	T	0.94	-17.1574	19.4726	0.94969	0.0:0.0:1.0:0.0	.	1017;1011;1010	E9PFM1;D3DNT2;Q04637	.;.;IF4G1_HUMAN	K	1010;970;923;1017;846;1017;924;1011;1010;1017;971;847;815;814	ENSP00000316879:E1010K;ENSP00000391935:E970K;ENSP00000376320:E923K;ENSP00000371767:E1017K;ENSP00000317600:E846K;ENSP00000338020:E1017K;ENSP00000407682:E924K;ENSP00000343450:E1011K;ENSP00000323737:E1010K;ENSP00000416255:E1017K;ENSP00000395974:E971K;ENSP00000399858:E847K;ENSP00000411826:E815K;ENSP00000404754:E814K	ENSP00000323737:E1010K	E	+	1	0	0	EIF4G1	185526028	185526028	1.000000	0.71417	0.972000	0.41901	0.947000	0.59692	6.342000	0.72982	2.618000	0.88619	0.561000	0.74099	GAG	0.468085		TCGA-IB-A7M4-01A-11D-A36O-08	0.577	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	0	0	1	2	2	2	2	0	0	0	0	163	163	163	163	1	1.980000	-3.075490	1	0.440000	NM_182917		0	8	8	0	624	618	0		1	1		0	0	163	0	0	0.988941	9.316506e-01	0	2	0	369	0	8	624
PCDH10	57575	broad.mit.edu	37	4	134084224	134084224	+	Missense_Mutation	SNP	C	C	G	rs376447518		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr4:134084224C>G	ENST00000264360.5	+	4	3716	c.2890C>G	c.(2890-2892)Cgc>Ggc	p.R964G		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	964					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TTCTGATGGACGCCAGGCTGC	0.522																																						ENST00000264360.5	0.190000	0.050000	0.150000	0.070000	0.110000	0.119541	0.110000	0.110000																										0				136						c.(2890-2892)Cgc>Ggc		protocadherin 10							166.0	140.0	148.0					4																	134084224		2203	4300	6503	SO:0001583	missense	57575	0	0					g.chr4:134084224C>G	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2890C>G	chr4.hg19:g.134084224C>G	ENSP00000264360:p.Arg964Gly	0						p.R964G	NM_032961.1	NP_116586.1	0	0	0	1.953199	Q9P2E7	PCD10_HUMAN		4	3716	+			Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	0	1	hg19	c.2890C>G	CCDS34063.1	0	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749340	0.69533	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.53857	0.6	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.000000	0.40302	N	0.001138	T	0.54854	0.1884	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.61232	-0.7104	10	0.40728	T	0.16	.	18.6158	0.91302	0.0:1.0:0.0:0.0	.	964	Q9P2E7	PCD10_HUMAN	G	964	ENSP00000264360:R964G	ENSP00000264360:R964G	R	+	1	0	0	PCDH10	134303674	134303674	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.320000	0.79064	2.717000	0.92951	0.650000	0.86243	CGC	0.422204		TCGA-IB-A7M4-01A-11D-A36O-08	0.522	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	1.980000	-9.434484	1	0.440000	NM_032961		0	10	10	0	392	389	0		1	0		0	0	125	0	0	0.996847	0	0	0	0	1	0	10	392
LRBA	987	broad.mit.edu	37	4	151199141	151199141	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr4:151199141G>A	ENST00000357115.3	-	57	8608	c.8365C>T	c.(8365-8367)Cga>Tga	p.R2789*	LRBA_ENST00000510413.1_Nonsense_Mutation_p.R2777*|LRBA_ENST00000535741.1_Nonsense_Mutation_p.R2778*|LRBA_ENST00000503716.1_5'UTR	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2789						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TGCCCATCTCGGCTCAGCTGG	0.547																																						ENST00000357115.3	0.360000	0.130000	0.300000	0.170000	0.220000	0.239443	0.220000	0.230000																										0				91						c.(8365-8367)Cga>Tga		LPS-responsive vesicle trafficking, beach and anchor containing							71.0	61.0	64.0					4																	151199141		2203	4300	6503	SO:0001587	stop_gained	987	0	0					g.chr4:151199141G>A	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.8365C>T	chr4.hg19:g.151199141G>A	ENSP00000349629:p.Arg2789*	0					LRBA_ENST00000510413.1_Nonsense_Mutation_p.R2777*|LRBA_ENST00000535741.1_Nonsense_Mutation_p.R2778*|LRBA_ENST00000503716.1_5'UTR	p.R2789*	NM_006726.4	NP_006717.2	0	0	0	1.953199	P50851	LRBA_HUMAN		57	8608	-	all_hematologic(180;0.151)		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Nonsense_Mutation	SNP	ENST00000357115.3	0	1	hg19	c.8365C>T	CCDS3773.1	0	.	.	.	.	.	.	.	.	.	.	G	51	18.130073	0.99899	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115	.	.	.	5.23	4.38	0.52667	5.23	4.38	0.52667	.	0.062472	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4711	0.67517	0.0:0.0:0.7348:0.2652	.	.	.	.	X	2778;2777;2789	.	ENSP00000349629:R2789X	R	-	1	2	2	LRBA	151418591	151418591	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.422000	0.44696	1.176000	0.42840	0.655000	0.94253	CGA	0.422204		TCGA-IB-A7M4-01A-11D-A36O-08	0.547	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	74	1	1.980000	-2.848768	1	0.440000			0	15	14	0	276	272	0		1	0		0	0	77	0	0	0.999866	7.974074e-01	0	1	0	56	0	15	276
SEMA6A	57556	broad.mit.edu	37	5	115782948	115782948	+	Silent	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:115782948C>T	ENST00000343348.6	-	19	3241	c.2454G>A	c.(2452-2454)ctG>ctA	p.L818L	SEMA6A_ENST00000510263.1_Silent_p.L818L|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000282394.6_Silent_p.L295L|CTB-118N6.3_ENST00000512128.1_RNA|SEMA6A_ENST00000513137.1_Silent_p.L245L|SEMA6A_ENST00000503865.1_Silent_p.L197L|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000257414.8_Silent_p.L835L|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	818	Pro-rich.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GCGTGATGGGCAGGACCACCA	0.662																																						ENST00000343348.6	0.420000	0.220000	0.370000	0.260000	0.310000	0.321383	0.310000	0.320000																										0				31						c.(2452-2454)ctG>ctA		sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A							77.0	79.0	79.0					5																	115782948		2058	4198	6256	SO:0001819	synonymous_variant	57556	0	0					g.chr5:115782948C>T	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2454G>A	chr5.hg19:g.115782948C>T		0					CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000513137.1_Silent_p.L245L|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000282394.6_Silent_p.L295L|SEMA6A_ENST00000257414.8_Silent_p.L835L|SEMA6A_ENST00000510263.1_Silent_p.L818L|SEMA6A_ENST00000503865.1_Silent_p.L197L|CTB-118N6.3_ENST00000512128.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA	p.L818L	NM_020796.3	NP_065847	0	0	0	1.910850	Q9H2E6	SEM6A_HUMAN		19	3241	-		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)	Q9P2H9	Silent	SNP	ENST00000343348.6	1	1	hg19	c.2454G>A	CCDS47256.1	0	.	.	.	.	.	.	.	.	.	.	C	2.211	-0.380738	0.05000	.	.	ENSG00000092421	ENST00000515129	.	.	.	5.11	2.34	0.29019	5.11	2.34	0.29019	.	.	.	.	.	T	0.58438	0.2122	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49273	-0.8957	4	.	.	.	.	9.5769	0.39463	0.3536:0.5783:0.0:0.0681	.	.	.	.	Y	333	.	.	C	-	2	0	0	SEMA6A	115810847	115810847	0.999000	0.42202	0.997000	0.53966	0.854000	0.48673	0.742000	0.26216	-0.041000	0.13558	-2.997000	0.00077	TGC	0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.662	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	1	0	1	2	2	2	2	0	0	0	0	151	151	151	150	1	1.980000	-20.000000	1	0.440000	NM_020796		0	37	37	0	471	467	0		1	0		0	0	151	0	0	1.000000	3.067231e-02	0	0	0	4	0	37	471
DMXL1	1657	broad.mit.edu	37	5	118506551	118506551	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:118506551A>C	ENST00000311085.8	+	24	6145	c.6065A>C	c.(6064-6066)gAt>gCt	p.D2022A	DMXL1_ENST00000539542.1_Missense_Mutation_p.D2022A	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2022										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CCATCAGAAGATATAATTGCA	0.313																																						ENST00000311085.8	0.980000	0.630000	0.900000	0.710000	0.790000	0.807570	0.790000	0.800000																										0				86						c.(6064-6066)gAt>gCt		Dmx-like 1							45.0	49.0	48.0					5																	118506551		2202	4298	6500	SO:0001583	missense	1657	0	0					g.chr5:118506551A>C	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.6065A>C	chr5.hg19:g.118506551A>C	ENSP00000309690:p.Asp2022Ala	0					DMXL1_ENST00000539542.1_Missense_Mutation_p.D2022A	p.D2022A	NM_005509.4	NP_005500.4	0	0	0	1.910850	Q9Y485	DMXL1_HUMAN		24	6145	+		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		Missense_Mutation	SNP	ENST00000311085.8	1	1	hg19	c.6065A>C	CCDS4125.1	0	.	.	.	.	.	.	.	.	.	.	A	19.04	3.749710	0.69533	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.77750	-1.12;-1.12	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.89444	0.6717	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91353	0.5106	10	0.87932	D	0	-19.8717	15.606	0.76672	1.0:0.0:0.0:0.0	.	2022;2022	F5H269;Q9Y485	.;DMXL1_HUMAN	A	2022	ENSP00000309690:D2022A;ENSP00000439479:D2022A	ENSP00000309690:D2022A	D	+	2	0	0	DMXL1	118534450	118534450	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.083000	0.62718	0.455000	0.32223	GAT	0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.313	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	1.980000	-20.000000	1	0.440000	NM_005509		0	63	63	0	276	273	1		1	0		0	0	71	0	0	1.000000	1.631252e-01	0	1	0	3	0	63	276
FTMT	94033	broad.mit.edu	37	5	121188177	121188177	+	Silent	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:121188177G>A	ENST00000321339.1	+	1	528	c.519G>A	c.(517-519)tcG>tcA	p.S173S		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	173	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TGAACCAGTCGTTGCTGGAAT	0.517																																						ENST00000321339.1	0.350000	0.170000	0.300000	0.210000	0.250000	0.259793	0.250000	0.250000																										0				33						c.(517-519)tcG>tcA		ferritin mitochondrial							130.0	120.0	123.0					5																	121188177		2203	4300	6503	SO:0001819	synonymous_variant	94033	2	121412	38				g.chr5:121188177G>A	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.519G>A	chr5.hg19:g.121188177G>A		0						p.S173S	NM_177478.1	NP_803431.1	0	0	0	1.910850	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	1	528	+		all_cancers(142;0.0124)|Prostate(80;0.0322)		Silent	SNP	ENST00000321339.1	1	1	hg19	c.519G>A	CCDS4128.1	0																																																																																								0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.517	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	1	0	1	2	2	2	2	0	0	0	0	151	151	151	147	1	1.980000	-6.820153	1	0.440000	NM_177478		0	32	32	0	514	507	0		1			0	0	151	0	0	1.000000	0	0	0	0	0	0	32	514
LOX	4015	broad.mit.edu	37	5	121409724	121409724	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:121409724C>T	ENST00000231004.4	-	4	1318	c.1019G>A	c.(1018-1020)tGt>tAt	p.C340Y	LOX_ENST00000513319.1_5'UTR|SRFBP1_ENST00000504881.1_Intron	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	340	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		GTGTGCAGTACATGCAAATCG	0.478																																						ENST00000231004.4	0.330000	0.190000	0.300000	0.220000	0.260000	0.268513	0.260000	0.270000																										0				8						c.(1018-1020)tGt>tAt		lysyl oxidase							194.0	183.0	187.0					5																	121409724		2203	4300	6503	SO:0001583	missense	4015	0	0					g.chr5:121409724C>T		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.1019G>A	chr5.hg19:g.121409724C>T	ENSP00000231004:p.Cys340Tyr	0					SRFBP1_ENST00000504881.1_Intron|LOX_ENST00000513319.1_5'UTR	p.C340Y	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	0	0	0	1.910850	P28300	LYOX_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	4	1318	-		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	1	1	hg19	c.1019G>A	CCDS4129.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811350	0.90707	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.45668	0.89	5.98	5.98	0.97165	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.75803	0.3899	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81088	-0.1091	10	0.87932	D	0	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	340	P28300	LYOX_HUMAN	Y	340;300	ENSP00000231004:C340Y	ENSP00000231004:C340Y	C	-	2	0	0	LOX	121437623	121437623	1.000000	0.71417	0.982000	0.44146	0.965000	0.64279	7.487000	0.81328	2.835000	0.97688	0.650000	0.86243	TGT	0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.478	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2	0	0	1	2	2	2	2	0	0	0	0	255	255	255	252	1	1.980000	-9.466318	1	0.440000			0	58	58	0	889	881	0		1	0		0	0	255	0	0	1.000000	5.422736e-01	0	1	0	28	0	58	889
RASGRF2	5924	broad.mit.edu	37	5	80376464	80376464	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:80376464T>G	ENST00000265080.4	+	7	1084	c.1017T>G	c.(1015-1017)ttT>ttG	p.F339L	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	339	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ATCAAGAATTTGTGCGTAATC	0.403																																						ENST00000265080.4	0.360000	0.200000	0.320000	0.240000	0.270000	0.284783	0.270000	0.280000																										0				75						c.(1015-1017)ttT>ttG		Ras protein-specific guanine nucleotide-releasing factor 2							108.0	105.0	106.0					5																	80376464		2203	4300	6503	SO:0001583	missense	5924	0	0					g.chr5:80376464T>G	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1017T>G	chr5.hg19:g.80376464T>G	ENSP00000265080:p.Phe339Leu	0					RASGRF2_ENST00000502677.1_3'UTR	p.F339L	NM_006909.2	NP_008840.1	0	0	0	1.910850	O14827	RGRF2_HUMAN		7	1084	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	1	1	hg19	c.1017T>G	CCDS4052.1	0	.	.	.	.	.	.	.	.	.	.	T	31	5.090469	0.94149	.	.	ENSG00000113319	ENST00000265080	T	0.68181	-0.31	5.7	4.55	0.56014	5.7	4.55	0.56014	Dbl homology (DH) domain (5);	0.095640	0.85682	D	0.000000	T	0.75072	0.3800	L	0.50333	1.59	0.58432	D	0.999995	D;D	0.76494	0.999;0.994	D;D	0.69307	0.963;0.933	T	0.76160	-0.3061	10	0.72032	D	0.01	.	11.4093	0.49917	0.0:0.0702:0.0:0.9298	.	339;339	D6RAS9;O14827	.;RGRF2_HUMAN	L	339	ENSP00000265080:F339L	ENSP00000265080:F339L	F	+	3	2	2	RASGRF2	80412220	80412220	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.483000	0.53194	1.006000	0.39211	0.459000	0.35465	TTT	0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.403	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	1	0	0	2	2	2	2	0	0	0	0	222	222	222	222	1	1.980000	-20.000000	1	0.440000	NM_006909		0	49	49	0	707	702	0		1	0		0	0	222	0	0	1.000000	3.847422e-02	0	1	0	4	0	49	707
ACOT12	134526	broad.mit.edu	37	5	80640798	80640798	+	Missense_Mutation	SNP	C	C	T	rs199564842		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:80640798C>T	ENST00000307624.3	-	8	864	c.836G>A	c.(835-837)cGt>cAt	p.R279H	ACOT12_ENST00000508234.1_5'Flank	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	279	Acyl coenzyme A hydrolase 2.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		GTTGATGTGACGCCCTCGGCC	0.493													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19431	0.0		0.0	False		,,,				2504	0.0					ENST00000307624.3	1.000000	0.670000	0.940000	0.750000	0.840000	0.850711	0.840000	1.000000																										0				23						c.(835-837)cGt>cAt		acyl-CoA thioesterase 12							115.0	109.0	111.0					5																	80640798		2203	4300	6503	SO:0001583	missense	134526	12	121412	43				g.chr5:80640798C>T	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.836G>A	chr5.hg19:g.80640798C>T	ENSP00000303246:p.Arg279His	0					ACOT12_ENST00000508234.1_5'Flank	p.R279H	NM_130767.2	NP_570123.1	0	0	0	1.910850	Q8WYK0	ACO12_HUMAN		8	864	-		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	1	1	hg19	c.836G>A	CCDS4055.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	23.7	4.451499	0.84209	.	.	ENSG00000172497	ENST00000307624	T	0.32753	1.44	5.53	4.64	0.57946	5.53	4.64	0.57946	.	0.131978	0.52532	D	0.000073	T	0.57932	0.2087	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.65067	-0.6258	10	0.87932	D	0	-19.3255	15.1428	0.72623	0.0:0.8576:0.1424:0.0	.	279	Q8WYK0	ACO12_HUMAN	H	279	ENSP00000303246:R279H	ENSP00000303246:R279H	R	-	2	0	0	ACOT12	80676554	80676554	1.000000	0.71417	0.454000	0.27019	0.882000	0.50991	6.380000	0.73158	1.301000	0.44836	0.561000	0.74099	CGT	0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.493	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	0	0	1	2	2	2	2	0	0	0	0	116	116	116	116	1	1.980000	-20.000000	1	0.440000	NM_130767		0	65	64	0	266	265	1		1			0	0	116	0	0	1.000000	0	0	0	0	0	0	65	266
PCDHGA2	56113	broad.mit.edu	37	5	140720214	140720214	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr5:140720214C>T	ENST00000394576.2	+	1	1676	c.1676C>T	c.(1675-1677)gCg>gTg	p.A559V	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGACAACGCGCCCGAGATC	0.622																																						ENST00000394576.2	0.290000	0.160000	0.260000	0.180000	0.220000	0.228323	0.220000	0.230000																										0				77						c.(1675-1677)gCg>gTg		protocadherin gamma subfamily A, 2							152.0	153.0	152.0					5																	140720214		2203	4300	6503	SO:0001583	missense	56113	1	121412	35				g.chr5:140720214C>T	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1676C>T	chr5.hg19:g.140720214C>T	ENSP00000378077:p.Ala559Val	0					PCDHGA1_ENST00000517417.1_Intron	p.A559V	NM_018915.2	NP_061738.1	0	0	0	1.910850	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1676	+			Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	1	1	hg19	c.1676C>T	CCDS47289.1	0	.	.	.	.	.	.	.	.	.	.	.	7.268	0.606631	0.14002	.	.	ENSG00000081853	ENST00000394576	T	0.03181	4.02	5.02	1.19	0.21007	5.02	1.19	0.21007	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	1.143520	0.06915	U	0.808345	T	0.07007	0.0178	M	0.69185	2.1	0.09310	N	1	B;B	0.22541	0.005;0.071	B;B	0.24394	0.053;0.033	T	0.41016	-0.9532	10	0.44086	T	0.13	.	10.0865	0.42421	0.0:0.7185:0.0:0.2815	.	559;559	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	V	559	ENSP00000378077:A559V	ENSP00000378077:A559V	A	+	2	0	0	PCDHGA2	140700398	140700398	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.115000	0.15540	0.005000	0.14708	-0.225000	0.12378	GCG	0.411517		TCGA-IB-A7M4-01A-11D-A36O-08	0.622	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	1	0	0	2	2	2	2	0	0	0	0	264	264	264	262	1	1.980000	-6.525954	1	0.440000	NM_018915		0	45	45	0	823	810	0		1	0		0	0	264	0	0	1.000000	2.853108e-03	0	0	0	2	0	45	823
PHACTR1	221692	broad.mit.edu	37	6	13273094	13273094	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr6:13273094G>A	ENST00000379350.1	+	10	1523	c.1394G>A	c.(1393-1395)cGg>cAg	p.R465Q	PHACTR1_ENST00000457702.2_Missense_Mutation_p.R320Q|RP1-257A7.4_ENST00000399446.2_RNA|PHACTR1_ENST00000379335.3_Missense_Mutation_p.R29Q|RP1-257A7.4_ENST00000606627.1_RNA|PHACTR1_ENST00000332995.7_Missense_Mutation_p.R465Q|PHACTR1_ENST00000379329.1_Missense_Mutation_p.R29Q			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	465					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TTCCGTAGGCGGCTGAGCCAG	0.483																																						ENST00000379350.1	0.300000	0.140000	0.250000	0.170000	0.200000	0.223178	0.200000	0.210000																										0				26						c.(1393-1395)cGg>cAg		phosphatase and actin regulator 1							205.0	210.0	209.0					6																	13273094		1889	4116	6005	SO:0001583	missense	221692	2	120826	37				g.chr6:13273094G>A	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.1394G>A	chr6.hg19:g.13273094G>A	ENSP00000368655:p.Arg465Gln	0					PHACTR1_ENST00000379329.1_Missense_Mutation_p.R29Q|PHACTR1_ENST00000332995.7_Missense_Mutation_p.R465Q|RP1-257A7.4_ENST00000399446.2_RNA|PHACTR1_ENST00000379335.3_Missense_Mutation_p.R29Q|PHACTR1_ENST00000457702.2_Missense_Mutation_p.R320Q|RP1-257A7.4_ENST00000606627.1_RNA	p.R465Q			1	2	3	2.032223	Q9C0D0	PHAR1_HUMAN	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)	10	1523	+	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	1	1	hg19	c.1394G>A		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.030241|6.030241	0.97216|0.97216	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000415087|ENST00000379350;ENST00000332995;ENST00000457702;ENST00000379335;ENST00000379329	.|T;T;T	.|0.56941	.|0.43;1.11;1.18	5.91|5.91	5.91|5.91	0.95273|0.95273	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72851|0.72851	0.3512|0.3512	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.997	.|D;D	.|0.91635	.|0.999;0.947	T|T	0.75536|0.75536	-0.3283|-0.3283	5|10	.|0.87932	.|D	.|0	-14.4638|-14.4638	19.29|19.29	0.94095|0.94095	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|465;465	.|Q9C0D0;Q9C0D0-2	.|PHAR1_HUMAN;.	S|Q	300|465;465;320;29;29	.|ENSP00000368655:R465Q;ENSP00000329880:R465Q;ENSP00000397669:R320Q	.|ENSP00000329880:R465Q	G|R	+|+	1|2	0|0	0|0	PHACTR1|PHACTR1	13381073|13381073	13381073|13381073	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	1.000000|1.000000	0.99986|0.99986	8.473000|8.473000	0.90410|0.90410	2.799000|2.799000	0.96334|0.96334	0.650000|0.650000	0.86243|0.86243	GGC|CGG	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.483	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	1	0	1	2	2	2	2	0	0	0	0	183	183	183	182	1	1.980000	-4.625984	1	0.440000	XM_166420		0	38	37	0	785	776	0		1	0		0	0	183	0	0	1.000000	0	0	0	0	1	0	38	785
CPNE5	57699	broad.mit.edu	37	6	36710085	36710085	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr6:36710085G>A	ENST00000244751.2	-	21	2366	c.1742C>T	c.(1741-1743)gCc>gTc	p.A581V	CPNE5_ENST00000393189.2_Missense_Mutation_p.A289V|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	581						extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GGGCGTGCGGGCTGGGGACTG	0.682																																						ENST00000244751.2	0.850000	0.470000	0.740000	0.550000	0.630000	0.649257	0.630000	0.630000																										0				25						c.(1741-1743)gCc>gTc		copine V							41.0	44.0	43.0					6																	36710085		2201	4299	6500	SO:0001583	missense	57699	0	0					g.chr6:36710085G>A	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1742C>T	chr6.hg19:g.36710085G>A	ENSP00000244751:p.Ala581Val	0					CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_Missense_Mutation_p.A289V	p.A581V	NM_020939.1	NP_065990.1	1	2	3	2.033469	Q9HCH3	CPNE5_HUMAN		21	2366	-			Q7Z6C8	Missense_Mutation	SNP	ENST00000244751.2	1	1	hg19	c.1742C>T	CCDS4825.1	0	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444369	0.43429	.	.	ENSG00000124772	ENST00000244751;ENST00000393189	T;T	0.12039	3.51;2.72	4.6	2.8	0.32819	4.6	2.8	0.32819	.	0.243896	0.41823	D	0.000812	T	0.02970	0.0088	L	0.36672	1.1	0.27941	N	0.937519	B	0.06786	0.001	B	0.04013	0.001	T	0.42481	-0.9449	10	0.29301	T	0.29	.	6.038	0.19718	0.1033:0.1925:0.7042:0.0	.	581	Q9HCH3	CPNE5_HUMAN	V	581;289	ENSP00000244751:A581V;ENSP00000376885:A289V	ENSP00000244751:A581V	A	-	2	0	0	CPNE5	36818063	36818063	0.057000	0.20700	0.864000	0.33941	0.739000	0.42172	0.598000	0.24074	0.551000	0.29008	0.561000	0.74099	GCC	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.682	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	72	1	1.980000	-19.957780	1	0.440000	NM_020939		0	46	46	0	283	279	1		1	0		0	0	73	0	0	1.000000	2.058567e-01	0	0	0	6	0	46	283
KLHDC3	116138	broad.mit.edu	37	6	42985680	42985680	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr6:42985680T>C	ENST00000326974.4	+	4	616	c.421T>C	c.(421-423)Tac>Cac	p.Y141H	KLHDC3_ENST00000244670.8_Intron|KLHDC3_ENST00000332245.8_Missense_Mutation_p.Y82H	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	141					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CAAGATCATGTACATTTTTGG	0.512																																						ENST00000326974.4	0.130000	0.020000	0.100000	0.040000	0.060000	0.080781	0.060000	0.060000																										0				9						c.(421-423)Tac>Cac		kelch domain containing 3							119.0	115.0	117.0					6																	42985680		2203	4300	6503	SO:0001583	missense	116138	0	0					g.chr6:42985680T>C	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.421T>C	chr6.hg19:g.42985680T>C	ENSP00000313995:p.Tyr141His	0					KLHDC3_ENST00000332245.8_Missense_Mutation_p.Y82H|KLHDC3_ENST00000244670.8_Intron	p.Y141H	NM_057161.3	NP_476502.1	1	2	3	2.033469	Q9BQ90	KLDC3_HUMAN	Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)	4	616	+			A8K2W9	Missense_Mutation	SNP	ENST00000326974.4	0	1	hg19	c.421T>C	CCDS4880.1	0	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033569	0.75504	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000394096;ENST00000426116;ENST00000332245	T;T	0.24350	1.86;1.86	5.15	5.15	0.70609	5.15	5.15	0.70609	Kelch-type beta propeller (1);	0.065520	0.64402	D	0.000006	T	0.61590	0.2359	H	0.98276	4.19	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.73708	0.981;0.981;0.981	T	0.78833	-0.2048	10	0.87932	D	0	.	14.9695	0.71223	0.0:0.0:0.0:1.0	.	141;82;141	E7ENU0;E7ERR0;Q9BQ90	.;.;KLDC3_HUMAN	H	141;141;141;114;82	ENSP00000313995:Y141H;ENSP00000331562:Y82H	ENSP00000313995:Y141H	Y	+	1	0	0	KLHDC3	43093658	43093658	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.693000	0.84214	1.950000	0.56595	0.459000	0.35465	TAC	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.512	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040570.1	0	0	1	2	2	2	2	0	0	0	0	118	118	118	117	1	1.980000	-6.596216	1	0.440000	NM_057161		0	8	8	0	562	553	0		1	1		0	0	118	0	0	0.988742	7.288690e-01	0	6	0	172	0	8	562
DST	667	broad.mit.edu	37	6	56325048	56325048	+	Missense_Mutation	SNP	G	G	A	rs532258725	byFrequency	TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr6:56325048G>A	ENST00000361203.3	-	97	22011	c.22004C>T	c.(22003-22005)aCg>aTg	p.T7335M	DST_ENST00000370769.4_Missense_Mutation_p.T7446M|DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Missense_Mutation_p.T7624M|DST_ENST00000446842.2_Missense_Mutation_p.T7120M|DST_ENST00000370788.2_Missense_Mutation_p.T5249M|DST_ENST00000244364.6_Missense_Mutation_p.T5045M|DST_ENST00000421834.2_Missense_Mutation_p.T5331M			Q03001	DYST_HUMAN	dystonin	7444	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTGTATTGGCGTTCCCTGTAT	0.443													G|||	2	0.000399361	0.0	0.0	5008	,	,		18635	0.002		0.0	False		,,,				2504	0.0					ENST00000361203.3	1.000000	0.940000	1.000000	0.990000	0.990000	0.996880	0.990000	1.000000																										0				105						c.(22003-22005)aCg>aTg		dystonin							94.0	95.0	95.0					6																	56325048		1915	4128	6043	SO:0001583	missense	667	11	120852	41				g.chr6:56325048G>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.22004C>T	chr6.hg19:g.56325048G>A	ENSP00000354508:p.Thr7335Met	0					DST_ENST00000370788.2_Missense_Mutation_p.T5249M|DST_ENST00000421834.2_Missense_Mutation_p.T5331M|DST_ENST00000370754.5_Missense_Mutation_p.T7624M|DST_ENST00000446842.2_Missense_Mutation_p.T7120M|DST_ENST00000312431.6_3'UTR|DST_ENST00000244364.6_Missense_Mutation_p.T5045M|DST_ENST00000370769.4_Missense_Mutation_p.T7446M	p.T7335M			1	2	3	2.033469	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)	97	22011	-	Lung NSC(77;0.103)		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	1	1	hg19	c.22004C>T		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.352831|4.352831	0.82132|0.82132	.|.	.|.	ENSG00000151914|ENSG00000151914	ENST00000523292|ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.|T;T;T;T;T;T;T	.|0.65732	.|0.71;-0.16;-0.17;-0.07;0.78;-0.04;-0.11	6.17|6.17	6.17|6.17	0.99709|0.99709	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.56097	.|D	.|0.000029	T|T	0.73590|0.73590	0.3606|0.3606	L|L	0.55481|0.55481	1.735|1.735	.|.	.|.	.|.	.|D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;0.972;0.999;0.999;0.993	.|D;D;D;D;P;P;P;P	.|0.87578	.|0.998;0.996;0.994;0.998;0.503;0.802;0.891;0.73	T|T	0.70085|0.70085	-0.4969|-0.4969	4|9	.|0.49607	.|T	.|0.09	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|5331;7446;7624;7444;5045;132;132;5249	.|Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8;Q9BSP9;Q86T18;E7ERU0	.|.;.;.;DYST_HUMAN;.;.;.;.	C|M	133|5045;7624;7446;5331;7120;5249;7335	.|ENSP00000244364:T5045M;ENSP00000359790:T7624M;ENSP00000359805:T7446M;ENSP00000400883:T5331M;ENSP00000393645:T7120M;ENSP00000359824:T5249M;ENSP00000354508:T7335M	.|ENSP00000244364:T5045M	R|T	-|-	1|2	0|0	0|0	DST|DST	56433007|56433007	56433007|56433007	1.000000|1.000000	0.71417|0.71417	0.899000|0.899000	0.35326|0.35326	0.996000|0.996000	0.88848|0.88848	7.542000|7.542000	0.82095|0.82095	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CGC|ACG	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.443	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	1	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	1.980000	-20.000000	1	0.440000	NM_001723		0	83	82	0	245	245	1		1	1		0	0	63	0	0	1.000000	1	0	26	0	65	0	83	245
KCNQ5	56479	broad.mit.edu	37	6	73904417	73904417	+	Silent	SNP	G	G	A	rs546835876		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr6:73904417G>A	ENST00000370398.1	+	14	2188	c.2079G>A	c.(2077-2079)acG>acA	p.T693T	KCNQ5_ENST00000414165.2_Silent_p.T583T|KCNQ5_ENST00000342056.2_Silent_p.T712T|KCNQ5_ENST00000402622.2_Silent_p.T703T|KCNQ5_ENST00000355635.3_Silent_p.T694T|KCNQ5_ENST00000403813.2_Silent_p.T684T|KCNQ5_ENST00000355194.4_Silent_p.T693T	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	693					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	TCATTCTGACGCCAAATGAGT	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		20969	0.0		0.0	False		,,,				2504	0.001				GBM(142;1375 1859 14391 23261 44706)	ENST00000370398.1	1.000000	0.830000	1.000000	0.900000	0.980000	0.964557	0.980000	1.000000																										0				57						c.(2077-2079)acG>acA		potassium voltage-gated channel, KQT-like subfamily, member 5	Ezogabine(DB04953)						129.0	129.0	129.0					6																	73904417		2203	4300	6503	SO:0001819	synonymous_variant	56479	9	121412	44				g.chr6:73904417G>A	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2079G>A	chr6.hg19:g.73904417G>A		0					KCNQ5_ENST00000355635.3_Silent_p.T694T|KCNQ5_ENST00000355194.4_Silent_p.T693T|KCNQ5_ENST00000414165.2_Silent_p.T583T|KCNQ5_ENST00000342056.2_Silent_p.T712T|KCNQ5_ENST00000403813.2_Silent_p.T684T|KCNQ5_ENST00000402622.2_Silent_p.T703T	p.T693T	NM_019842.3	NP_062816.2	1	2	3	2.033469	Q9NR82	KCNQ5_HUMAN		14	2188	+		all_epithelial(107;0.116)|Lung NSC(302;0.219)	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Silent	SNP	ENST00000370398.1	1	1	hg19	c.2079G>A	CCDS4976.1	1																																																																																								0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.502	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	1	0	1	2	2	2	2	0	0	0	0	160	160	160	160	1	1.980000	-4.035921	1	0.440000	NM_019842		0	117	113	0	422	416	1		1	0		0	0	160	0	0	1.000000	0	0	0	0	1	0	117	422
CUL1	8454	broad.mit.edu	37	7	148484186	148484186	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr7:148484186G>A	ENST00000325222.4	+	13	1732	c.1453G>A	c.(1453-1455)Gaa>Aaa	p.E485K	CUL1_ENST00000602748.1_Missense_Mutation_p.E485K|CUL1_ENST00000409469.1_Missense_Mutation_p.E485K	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	485					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.E485K(4)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGACGATGCCGAAGCCAGCAT	0.458																																						ENST00000325222.4	1.000000	0.160000	0.350000	0.210000	0.270000	0.304901	0.270000	0.270000																										4	Substitution - Missense(4)	p.E485K(4)	urinary_tract(2)|lung(1)|central_nervous_system(1)	40						c.(1453-1455)Gaa>Aaa		cullin 1							80.0	73.0	76.0					7																	148484186		2203	4300	6503	SO:0001583	missense	8454	0	0					g.chr7:148484186G>A	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1453G>A	chr7.hg19:g.148484186G>A	ENSP00000326804:p.Glu485Lys	0					CUL1_ENST00000602748.1_Missense_Mutation_p.E485K|CUL1_ENST00000409469.1_Missense_Mutation_p.E485K	p.E485K	NM_003592.2	NP_003583.2	1	2	3	2.014673	Q13616	CUL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	13	1732	+	Melanoma(164;0.15)		D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	1	1	hg19	c.1453G>A	CCDS34772.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.288263	0.95517	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	D;D	0.86865	-2.18;-2.18	5.5	5.5	0.81552	5.5	5.5	0.81552	Cullin, N-terminal (1);Cullin homology (3);	0.047140	0.85682	D	0.000000	D	0.95847	0.8648	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.98	D	0.96814	0.9599	10	0.87932	D	0	-0.8542	19.4118	0.94677	0.0:0.0:1.0:0.0	.	412;485	E7EWR0;Q13616	.;CUL1_HUMAN	K	485;485;443;412	ENSP00000387160:E485K;ENSP00000326804:E485K	ENSP00000326804:E485K	E	+	1	0	0	CUL1	148115119	148115119	1.000000	0.71417	0.913000	0.36048	0.576000	0.36127	9.497000	0.97970	2.595000	0.87683	0.655000	0.94253	GAA	0.446093		TCGA-IB-A7M4-01A-11D-A36O-08	0.458	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	1	0	1	2	14	6	2	1	1	1	1	82	82	82	82	1	1.980000	-2.842321	1	0.440000	NM_003592		0	19	18	0	309	303	0		1	1		1	0	82	0	0	0.841242	5.099373e-01	0	7	0	89	0	19	309
CSMD3	114788	broad.mit.edu	37	8	113349048	113349048	+	Silent	SNP	A	A	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr8:113349048A>T	ENST00000297405.5	-	44	7096	c.6852T>A	c.(6850-6852)ggT>ggA	p.G2284G	CSMD3_ENST00000352409.3_Silent_p.G2214G|CSMD3_ENST00000343508.3_Silent_p.G2244G|CSMD3_ENST00000455883.2_Silent_p.G2180G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2284	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTATATTCCCACCACAAAGAG	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												ENST00000297405.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				646						c.(6850-6852)ggT>ggA		CUB and Sushi multiple domains 3							66.0	61.0	63.0					8																	113349048		2203	4300	6503	SO:0001819	synonymous_variant	114788	0	0					g.chr8:113349048A>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6852T>A	chr8.hg19:g.113349048A>T		1	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_ENST00000352409.3_Silent_p.G2214G|CSMD3_ENST00000455883.2_Silent_p.G2180G|CSMD3_ENST00000343508.3_Silent_p.G2244G	p.G2284G	NM_198123.1	NP_937756.1	1	3	4	2.513552	Q7Z407	CSMD3_HUMAN		44	7096	-			Q96PZ3	Silent	SNP	ENST00000297405.5	1	1	hg19	c.6852T>A	CCDS6315.1	1																																																																																								0.553856		TCGA-IB-A7M4-01A-11D-A36O-08	0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	1	0	1	2	2	2	2	0	0	0	0	114	114	114	114	1	1.980000	-20.000000	1	0.440000	NM_052900		0	164	162	0	314	310	1		1			0	0	114	0	0	1.000000	0	0	0	0	0	0	164	314
SCRIB	23513	broad.mit.edu	37	8	144891159	144891159	+	Missense_Mutation	SNP	C	C	T	rs370311838		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr8:144891159C>T	ENST00000320476.3	-	15	1741	c.1735G>A	c.(1735-1737)Ggg>Agg	p.G579R	SCRIB_ENST00000356994.2_Missense_Mutation_p.G579R|SCRIB_ENST00000377533.3_Missense_Mutation_p.G498R	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	579	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTGTCATCCCCGGGCAGCAGT	0.642																																					Pancreas(51;966 1133 10533 14576 29674)	ENST00000320476.3	1.000000	0.250000	0.590000	0.320000	0.400000	0.486838	0.400000	0.390000																										0				42						c.(1735-1737)Ggg>Agg		scribbled planar cell polarity protein		C	ARG/GLY,ARG/GLY	0,4406		0,0,2203	50.0	50.0	50.0		1735,1735	-7.9	0.0	8		50	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	SCRIB	NM_015356.3,NM_182706.3	125,125	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	579/1631,579/1656	144891159	1,13003	2203	4299	6502	SO:0001583	missense	23513	2	121410	34				g.chr8:144891159C>T	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1735G>A	chr8.hg19:g.144891159C>T	ENSP00000322938:p.Gly579Arg	1					SCRIB_ENST00000356994.2_Missense_Mutation_p.G579R|SCRIB_ENST00000377533.3_Missense_Mutation_p.G498R	p.G579R	NM_015356.4	NP_056171	1	4	5	3.074370	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)	15	1741	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	1	1	hg19	c.1735G>A	CCDS6411.1	0	.	.	.	.	.	.	.	.	.	.	c	7.938	0.742196	0.15642	0.0	1.16E-4	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.36340	1.49;1.45;1.26	4.79	-7.88	0.01178	4.79	-7.88	0.01178	.	.	.	.	.	T	0.13543	0.0328	N	0.11756	0.17	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.09377	0.001;0.004	T	0.25502	-1.0130	9	0.13853	T	0.58	.	5.0756	0.14630	0.0935:0.0875:0.2007:0.6183	.	579;579	Q14160;Q14160-3	SCRIB_HUMAN;.	R	579;579;498	ENSP00000349486:G579R;ENSP00000322938:G579R;ENSP00000366756:G498R	ENSP00000322938:G579R	G	-	1	0	0	SCRIB	144963147	144963147	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.067000	0.14510	-1.579000	0.01646	0.401000	0.26515	GGG	0.633508		TCGA-IB-A7M4-01A-11D-A36O-08	0.642	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	55	1	1.980000	-2.690843	1	0.440000	NM_015356		0	26	26	0	446	441	0		1	1		0	0	58	0	0	1.000000	9.955213e-01	0	9	0	136	0	26	446
BMP1	649	broad.mit.edu	37	8	22037971	22037971	+	Missense_Mutation	SNP	G	G	A	rs577420762		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr8:22037971G>A	ENST00000306385.5	+	8	1722	c.1052G>A	c.(1051-1053)cGc>cAc	p.R351H	BMP1_ENST00000397816.3_Missense_Mutation_p.R351H|BMP1_ENST00000306349.8_Missense_Mutation_p.R351H|BMP1_ENST00000397814.3_Missense_Mutation_p.R351H|BMP1_ENST00000354870.5_3'UTR	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	351	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		TGCGTGTGGCGCATCTCTGTC	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18854	0.0		0.0	False		,,,				2504	0.0					ENST00000306385.5	0.100000	0.010000	0.070000	0.020000	0.040000	0.051342	0.040000	0.040000																										0				30						c.(1051-1053)cGc>cAc		bone morphogenetic protein 1							191.0	165.0	174.0					8																	22037971		2203	4300	6503	SO:0001583	missense	649	2	121412	41				g.chr8:22037971G>A		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.1052G>A	chr8.hg19:g.22037971G>A	ENSP00000305714:p.Arg351His	1					BMP1_ENST00000397816.3_Missense_Mutation_p.R351H|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000306349.8_Missense_Mutation_p.R351H|BMP1_ENST00000397814.3_Missense_Mutation_p.R351H	p.R351H	NM_006129.4	NP_006120.1	0	1	1	1.634903	P13497	BMP1_HUMAN		8	1722	+			A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	0	1	hg19	c.1052G>A	CCDS6026.1	0	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795501	0.90453	.	.	ENSG00000168487	ENST00000306385;ENST00000397816;ENST00000306349;ENST00000397814	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.66	5.66	0.87406	5.66	5.66	0.87406	CUB (5);	0.000000	0.39274	U	0.001412	T	0.53722	0.1814	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.89917	0.99;1.0;0.998;0.994	P;D;P;P	0.91635	0.818;0.999;0.886;0.629	T	0.42241	-0.9463	10	0.35671	T	0.21	.	18.5112	0.90917	0.0:0.0:1.0:0.0	.	351;424;351;351	P13497;Q59F71;P13497-2;P13497-6	BMP1_HUMAN;.;.;.	H	351	ENSP00000305714:R351H;ENSP00000380917:R351H;ENSP00000306121:R351H;ENSP00000380915:R351H	ENSP00000306121:R351H	R	+	2	0	0	BMP1	22093916	22093916	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	6.755000	0.74914	2.665000	0.90641	0.561000	0.74099	CGC	0.284071		TCGA-IB-A7M4-01A-11D-A36O-08	0.612	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	0	0	1	2	2	2	2	0	0	0	0	152	152	152	149	1	1.980000	-2.051240	0	0.440000	NM_006132		0	5	5	0	406	399	0		1	0		0	0	152	0	0	0.935044	1.254665e-01	0	0	0	41	0	5	406
SLCO5A1	81796	broad.mit.edu	37	8	70591817	70591817	+	Missense_Mutation	SNP	C	C	T	rs151145765	byFrequency	TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr8:70591817C>T	ENST00000260126.4	-	8	2526	c.1820G>A	c.(1819-1821)cGc>cAc	p.R607H	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.R552H|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.R607H	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	607						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GATCACTTGGCGACTTTGGAC	0.453													C|||	13	0.00259585	0.0098	0.0	5008	,	,		19209	0.0		0.0	False		,,,				2504	0.0					ENST00000260126.4	1.000000	0.060000	0.170000	0.090000	0.120000	0.168200	0.120000	0.120000																										0				53						c.(1819-1821)cGc>cAc		solute carrier organic anion transporter family, member 5A1		C	HIS/ARG,HIS/ARG,HIS/ARG	12,4394	20.2+/-43.8	0,12,2191	143.0	134.0	137.0		1820,1655,1820	5.6	1.0	8	dbSNP_134	137	0,8600		0,0,4300	yes	missense,missense,missense	SLCO5A1	NM_001146008.1,NM_001146009.1,NM_030958.2	29,29,29	0,12,6491	TT,TC,CC		0.0,0.2724,0.0923	probably-damaging,probably-damaging,probably-damaging	607/688,552/794,607/849	70591817	12,12994	2203	4300	6503	SO:0001583	missense	81796	39	121412	50				g.chr8:70591817C>T	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1820G>A	chr8.hg19:g.70591817C>T	ENSP00000260126:p.Arg607His	0					SLCO5A1_ENST00000524945.1_Missense_Mutation_p.R607H|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.R552H	p.R607H	NM_030958.2	NP_112220.2	1	2	3	2.053415	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)	8	2526	-	Breast(64;0.0654)		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	0	1	hg19	c.1820G>A	CCDS6205.1	0	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	22.7	4.328881	0.81690	0.002724	0.0	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.41758	1.1;1.47;0.99	5.62	5.62	0.85841	5.62	5.62	0.85841	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000005	T	0.53222	0.1783	N	0.25890	0.77	0.49798	D	0.99982	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.987;0.986	T	0.46331	-0.9199	10	0.30854	T	0.27	.	19.6614	0.95875	0.0:1.0:0.0:0.0	.	552;607;607	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	H	607;607;552	ENSP00000260126:R607H;ENSP00000434422:R607H;ENSP00000431611:R552H	ENSP00000260126:R607H	R	-	2	0	0	SLCO5A1	70754371	70754371	1.000000	0.71417	0.989000	0.46669	0.645000	0.38454	6.038000	0.70964	2.633000	0.89246	0.655000	0.94253	CGC	0.447296		TCGA-IB-A7M4-01A-11D-A36O-08	0.453	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	0	0	1	2	2	2	2	0	0	0	0	148	148	148	148	1	1.980000	-2.670482	1	0.440000	NM_030958		0	15	15	0	561	552	0		1			0	0	148	0	0	0.999855	0	0	0	0	0	0	15	561
STK3	6788	broad.mit.edu	37	8	99468195	99468195	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr8:99468195G>A	ENST00000419617.2	-	11	1491	c.1351C>T	c.(1351-1353)Cgg>Tgg	p.R451W	STK3_ENST00000523601.1_Missense_Mutation_p.R479W	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	451	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		GCTTTTAACCGCATCTGTAGT	0.383																																						ENST00000419617.2	1.000000	0.080000	1.000000	0.140000	0.230000	0.403854	0.230000	0.190000																										0				17						c.(1351-1353)Cgg>Tgg		serine/threonine kinase 3							115.0	104.0	108.0					8																	99468195		1863	4109	5972	SO:0001583	missense	6788	1	120776	24				g.chr8:99468195G>A	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.1351C>T	chr8.hg19:g.99468195G>A	ENSP00000390500:p.Arg451Trp	1					STK3_ENST00000523601.1_Missense_Mutation_p.R479W	p.R451W	NM_006281.3	NP_006272.2	1	3	4	2.513552	Q13188	STK3_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	11	1491	-	Breast(36;2.4e-06)	Breast(495;0.106)	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	0	1	hg19	c.1351C>T	CCDS47900.1	0	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912410	0.72983	.	.	ENSG00000104375	ENST00000419617;ENST00000523601	T;T	0.75260	-0.91;-0.92	5.51	4.58	0.56647	5.51	4.58	0.56647	SARAH domain (1);SARAH (1);	0.000000	0.85682	D	0.000000	D	0.83594	0.5288	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.977;0.982	D	0.84708	0.0732	10	0.87932	D	0	.	12.0474	0.53487	0.0:0.0:0.6717:0.3283	.	451;479	Q13188;B3KYA7	STK3_HUMAN;.	W	451;479	ENSP00000390500:R451W;ENSP00000429744:R479W	ENSP00000390500:R451W	R	-	1	2	2	STK3	99537371	99537371	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	1.638000	0.37165	2.746000	0.94184	0.591000	0.81541	CGG	0.553856		TCGA-IB-A7M4-01A-11D-A36O-08	0.383	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	0	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.980000	-3.846188	1	0.440000	NM_006281		0	6	6	0	173	169	0		1	1		0	0	37	0	0	0.963270	6.368836e-01	0	4	0	56	0	6	173
PLEC	5339	broad.mit.edu	37	8	144991972	144991972	+	Missense_Mutation	SNP	G	G	A	rs200521669		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr8:144991972G>A	ENST00000322810.4	-	32	12597	c.12428C>T	c.(12427-12429)tCg>tTg	p.S4143L	PLEC_ENST00000436759.2_Missense_Mutation_p.S4033L|PLEC_ENST00000398774.2_Missense_Mutation_p.S3974L|PLEC_ENST00000356346.3_Missense_Mutation_p.S3992L|PLEC_ENST00000354589.3_Missense_Mutation_p.S4006L|PLEC_ENST00000527096.1_Missense_Mutation_p.S4029L|PLEC_ENST00000345136.3_Missense_Mutation_p.S4006L|PLEC_ENST00000354958.2_Missense_Mutation_p.S3984L|PLEC_ENST00000357649.2_Missense_Mutation_p.S4010L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4143	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCGCTCGGCCGACAGCAGCTT	0.607																																						ENST00000322810.4	1.000000	0.120000	0.440000	0.180000	0.250000	0.364634	0.250000	0.230000																										0				137						c.(12427-12429)tCg>tTg		plectin		G	LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER	2,4334		0,2,2166	45.0	53.0	51.0		12098,11975,11951,12428,11921,12017,12029,12017	5.1	1.0	8		51	0,8534		0,0,4267	yes	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	145,145,145,145,145,145,145,145	0,2,6433	AA,AG,GG		0.0,0.0461,0.0155	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	4033/4575,3992/4534,3984/4526,4143/4685,3974/4516,4006/4548,4010/4552,4006/4548	144991972	2,12868	2168	4267	6435	SO:0001583	missense	5339	3	121208	36				g.chr8:144991972G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12428C>T	chr8.hg19:g.144991972G>A	ENSP00000323856:p.Ser4143Leu	1					PLEC_ENST00000436759.2_Missense_Mutation_p.S4033L|PLEC_ENST00000354589.3_Missense_Mutation_p.S4006L|PLEC_ENST00000527096.1_Missense_Mutation_p.S4029L|PLEC_ENST00000357649.2_Missense_Mutation_p.S4010L|PLEC_ENST00000354958.2_Missense_Mutation_p.S3984L|PLEC_ENST00000345136.3_Missense_Mutation_p.S4006L|PLEC_ENST00000356346.3_Missense_Mutation_p.S3992L|PLEC_ENST00000398774.2_Missense_Mutation_p.S3974L	p.S4143L	NM_201380.2	NP_958782.1	1	4	5	3.074370	Q15149	PLEC_HUMAN		32	12597	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	0	1	hg19	c.12428C>T	CCDS43772.1	0	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279669	0.23307	4.61E-4	0.0	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.000000	0.64402	U	0.000014	D	0.84511	0.5488	L	0.58302	1.8	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.999;0.998;0.998;0.998;0.998	D	0.85805	0.1376	10	0.87932	D	0	.	18.2755	0.90081	0.0:0.0:1.0:0.0	.	4033;3992;3984;4143;3974;4006;4010;4006	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	L	4006;4010;4006;3974;4143;3984;3992;4033;4029	ENSP00000344848:S4006L;ENSP00000350277:S4010L;ENSP00000346602:S4006L;ENSP00000381756:S3974L;ENSP00000323856:S4143L;ENSP00000347044:S3984L;ENSP00000348702:S3992L;ENSP00000388180:S4033L;ENSP00000434583:S4029L	ENSP00000323856:S4143L	S	-	2	0	0	PLEC	145063960	145063960	1.000000	0.71417	0.996000	0.52242	0.232000	0.25224	9.595000	0.98260	2.654000	0.90174	0.549000	0.68633	TCG	0.633508		TCGA-IB-A7M4-01A-11D-A36O-08	0.607	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	0	0	0	2	2	2	2	0	0	0	0	60	60	60	58	1	1.980000	-3.462155	1	0.440000	NM_000445		0	12	12	0	345	341	0		1	1		0	0	60	0	0	0.999077	1	0	45	0	1189	0	12	345
PRUNE2	158471	broad.mit.edu	37	9	79323756	79323756	+	Missense_Mutation	SNP	G	G	A	rs546948015		TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr9:79323756G>A	ENST00000376718.3	-	8	3557	c.3434C>T	c.(3433-3435)gCg>gTg	p.A1145V	PRUNE2_ENST00000428286.1_Missense_Mutation_p.A786V	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1145					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GGGGATTGCCGCACCCCCACT	0.522													A|||	1	0.000199681	0.0	0.0	5008	,	,		20449	0.0		0.001	False		,,,				2504	0.0					ENST00000376718.3	0.120000	0.010000	0.080000	0.030000	0.050000	0.070200	0.050000	0.060000																										0				16						c.(3433-3435)gCg>gTg		prune homolog 2 (Drosophila)							121.0	111.0	114.0					9																	79323756		1568	3582	5150	SO:0001583	missense	158471	4	120486	37				g.chr9:79323756G>A	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3434C>T	chr9.hg19:g.79323756G>A	ENSP00000365908:p.Ala1145Val	0					PRUNE2_ENST00000428286.1_Missense_Mutation_p.A786V	p.A1145V	NM_015225.2	NP_056040.2	1	2	3	2.026129	Q8WUY3	PRUN2_HUMAN		8	3557	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	0	1	hg19	c.3434C>T	CCDS47982.1	0	.	.	.	.	.	.	.	.	.	.	A	2.851	-0.238399	0.05944	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.38401	1.15;1.14	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.121361	0.37577	N	0.002034	T	0.12603	0.0306	N	0.01576	-0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16748	-1.0392	10	0.02654	T	1	-10.7943	11.0795	0.48051	0.9304:0.0:0.0696:0.0	.	1145	Q8WUY3	PRUN2_HUMAN	V	1145;786;1144	ENSP00000365908:A1145V;ENSP00000397425:A786V	ENSP00000365908:A1145V	A	-	2	0	0	PRUNE2	78513576	78513576	0.218000	0.23608	0.794000	0.32065	0.308000	0.27856	0.910000	0.28571	1.126000	0.42016	-0.254000	0.11334	GCG	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.522	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	0	0	1	2	2	2	2	0	0	0	0	164	164	164	164	1	1.980000	-1.925693	0	0.440000	NM_138818		0	7	7	0	589	576	0		1			0	0	164	0	0	0.979119	0	0	0	0	0	0	7	589
PTPDC1	138639	broad.mit.edu	37	9	96847575	96847575	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr9:96847575A>G	ENST00000375360.3	+	3	465	c.125A>G	c.(124-126)gAg>gGg	p.E42G	PTPDC1_ENST00000288976.3_Missense_Mutation_p.E94G	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	42					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						AAAGTAGGGGAGCGTTTACGG	0.453																																						ENST00000375360.3	1.000000	0.870000	1.000000	0.930000	0.990000	0.978770	0.990000	1.000000																										0				32						c.(124-126)gAg>gGg		protein tyrosine phosphatase domain containing 1							103.0	89.0	94.0					9																	96847575		2203	4300	6503	SO:0001583	missense	138639	0	0					g.chr9:96847575A>G	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.125A>G	chr9.hg19:g.96847575A>G	ENSP00000364509:p.Glu42Gly	0					PTPDC1_ENST00000288976.3_Missense_Mutation_p.E94G	p.E42G	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	1	2	3	2.026129	A2A3K4	PTPC1_HUMAN		3	465	+			Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	1	1	hg19	c.125A>G	CCDS6707.1	1	.	.	.	.	.	.	.	.	.	.	.	24.7	4.564213	0.86335	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.75589	-0.95;-0.95	5.51	5.51	0.81932	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.86818	0.6024	M	0.83953	2.67	0.54753	D	0.999987	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.81914	0.981;0.992;0.971;0.995	D	0.88807	0.3289	10	0.87932	D	0	-27.4699	15.0953	0.72229	1.0:0.0:0.0:0.0	.	96;94;96;42	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	G	42;94	ENSP00000364509:E42G;ENSP00000288976:E94G	ENSP00000288976:E94G	E	+	2	0	0	PTPDC1	95887396	95887396	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.771000	0.91751	2.226000	0.72624	0.482000	0.46254	GAG	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.453	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	0	0	1	2	2	2	2	0	0	0	0	158	158	158	156	1	1.980000	-20.000000	1	0.440000	NM_177995, NM_152422		0	149	146	0	521	515	1		1	1		0	0	158	0	0	1.000000	5.008225e-02	0	2	0	0	0	149	521
DBH	1621	broad.mit.edu	37	9	136508616	136508616	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chr9:136508616G>A	ENST00000393056.2	+	4	838	c.826G>A	c.(826-828)Gtc>Atc	p.V276I		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	276					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.V276I(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GATGGACAGCGTCCCCCACTT	0.657																																						ENST00000393056.2	0.240000	0.060000	0.180000	0.090000	0.130000	0.147442	0.130000	0.120000																										1	Substitution - Missense(1)	p.V276I(1)	pancreas(1)	36						c.(826-828)Gtc>Atc		dopamine beta-hydroxylase (dopamine beta-monooxygenase)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)						77.0	76.0	76.0					9																	136508616		2203	4300	6503	SO:0001583	missense	1621	1	121410	36				g.chr9:136508616G>A	X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.826G>A	chr9.hg19:g.136508616G>A	ENSP00000376776:p.Val276Ile	0						p.V276I	NM_000787.3	NP_000778.3	1	2	3	2.023196	P09172	DOPO_HUMAN		4	838	+			Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	0	1	hg19	c.826G>A	CCDS6977.2	0	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.699360	0.00725	.	.	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.29917	1.55;1.55	4.9	-8.25	0.01025	4.9	-8.25	0.01025	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.610624	0.17687	N	0.165404	T	0.07954	0.0199	N	0.04373	-0.215	0.19775	N	0.99995	B	0.06786	0.001	B	0.11329	0.006	T	0.25502	-1.0130	10	0.02654	T	1	-15.1191	7.9737	0.30143	0.4294:0.0:0.3685:0.2021	.	276	P09172	DOPO_HUMAN	I	276;213;213	ENSP00000376776:V276I;ENSP00000263611:V213I	ENSP00000263611:V213I	V	+	1	0	0	DBH	135498437	135498437	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.053000	0.03500	-1.933000	0.01052	-0.410000	0.06199	GTC	0.442453		TCGA-IB-A7M4-01A-11D-A36O-08	0.657	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.980000	-3.607988	1	0.440000	NM_000787		0	10	9	0	348	346	0		1			0	0	87	0	0	0.996850	0	0	0	0	0	0	10	348
NHS	4810	broad.mit.edu	37	X	17745920	17745920	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chrX:17745920G>C	ENST00000380060.3	+	6	3969	c.3631G>C	c.(3631-3633)Gaa>Caa	p.E1211Q	NHS_ENST00000398097.3_Missense_Mutation_p.E1055Q	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1232					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					CTGCGATCCAGAAACCATAAC	0.408																																						ENST00000380060.3	0.130000	0.040000	0.110000	0.050000	0.070000	0.085231	0.070000	0.080000																										0				71						c.(3631-3633)Gaa>Caa		Nance-Horan syndrome (congenital cataracts and dental anomalies)							86.0	85.0	85.0					X																	17745920		2203	4300	6503	SO:0001583	missense	4810	0	0					g.chrX:17745920G>C		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3631G>C	chrX.hg19:g.17745920G>C	ENSP00000369400:p.Glu1211Gln						NHS_ENST00000398097.3_Missense_Mutation_p.E1055Q	p.E1211Q	NM_198270.2	NP_938011.1	0	1	1		Q6T4R5	NHS_HUMAN		6	3969	+	Hepatocellular(33;0.183)		B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	1	1	hg19	c.3631G>C	CCDS14181.1	0	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714361	0.30413	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.50277	0.8;0.75	5.79	5.79	0.91817	5.79	5.79	0.91817	.	0.270289	0.35970	N	0.002870	T	0.47544	0.1451	L	0.54323	1.7	0.24754	N	0.992961	P;P;P;P	0.51933	0.919;0.919;0.919;0.949	P;P;P;P	0.47346	0.51;0.51;0.51;0.544	T	0.45381	-0.9265	10	0.17832	T	0.49	-17.3353	13.2279	0.59924	0.0773:0.0:0.9227:0.0	.	1232;1053;1055;1211	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	Q	1211;1055;1053	ENSP00000369400:E1211Q;ENSP00000381170:E1055Q	ENSP00000369397:E1053Q	E	+	1	0	0	NHS	17655841	17655841	1.000000	0.71417	0.952000	0.39060	0.101000	0.19017	4.755000	0.62198	2.444000	0.82710	0.544000	0.68410	GAA	0.440000		TCGA-IB-A7M4-01A-11D-A36O-08	0.408	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	1.980000	-3.717508	1	0.440000	NM_198270		0	13	13	0	357	351	0		1	0		0	0	107	0	0	0.999503	2.013857e-02	0	0	0	6	0	13	357
FAM133A	286499	broad.mit.edu	37	X	92964973	92964973	+	Silent	SNP	T	T	C			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chrX:92964973T>C	ENST00000355813.5	+	4	1081	c.555T>C	c.(553-555)ccT>ccC	p.P185P	FAM133A_ENST00000332647.4_Silent_p.P185P|FAM133A_ENST00000322139.4_Silent_p.P185P|FAM133A_ENST00000538690.1_Silent_p.P185P	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	185	Lys-rich.|Ser-rich.									breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						AAAGTTACCCTGATGATAAAC	0.368																																						ENST00000355813.5	0.430000	0.110000	0.340000	0.160000	0.240000	0.258568	0.240000	0.230000																										0				20						c.(553-555)ccT>ccC		family with sequence similarity 133, member A							25.0	23.0	23.0					X																	92964973		2202	4297	6499	SO:0001819	synonymous_variant	286499	0	0					g.chrX:92964973T>C	AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.555T>C	chrX.hg19:g.92964973T>C							FAM133A_ENST00000538690.1_Silent_p.P185P|FAM133A_ENST00000322139.4_Silent_p.P185P|FAM133A_ENST00000332647.4_Silent_p.P185P	p.P185P	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	0	1	1		Q8N9E0	F133A_HUMAN		4	1081	+				Silent	SNP	ENST00000355813.5	0	1	hg19	c.555T>C	CCDS14466.1	0																																																																																								0.440000		TCGA-IB-A7M4-01A-11D-A36O-08	0.368	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.980000	-13.224930	1	0.440000	NM_173698		0	7	7	0	60	60	1		1			0	0	16	0	0	0.982577	0	0	0	0	0	0	7	60
USP26	83844	broad.mit.edu	37	X	132160691	132160691	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-A7M4-01A-11D-A36O-08	TCGA-IB-A7M4-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	69885b57-a521-4397-a1cc-a2580e98fda1	18d4d3f9-58cf-49c3-baa2-b4151bd1fa5a	g.chrX:132160691G>T	ENST00000511190.1	-	6	2027	c.1558C>A	c.(1558-1560)Cac>Aac	p.H520N	USP26_ENST00000370832.1_Missense_Mutation_p.H520N|USP26_ENST00000406273.1_Missense_Mutation_p.H520N	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	520	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CGTTTGAGGTGAACAATAAGG	0.383																																					NSCLC(104;342 1621 36940 47097 52632)	ENST00000511190.1	0.130000	0.050000	0.110000	0.060000	0.080000	0.091186	0.080000	0.090000																										0				60						c.(1558-1560)Cac>Aac		ubiquitin specific peptidase 26							152.0	155.0	154.0					X																	132160691		2203	4299	6502	SO:0001583	missense	83844	0	0					g.chrX:132160691G>T	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1558C>A	chrX.hg19:g.132160691G>T	ENSP00000423390:p.His520Asn						USP26_ENST00000406273.1_Missense_Mutation_p.H520N|USP26_ENST00000370832.1_Missense_Mutation_p.H520N	p.H520N	NM_031907.1	NP_114113.1	0	1	1		Q9BXU7	UBP26_HUMAN		6	2027	-	Acute lymphoblastic leukemia(192;0.000127)		B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	1	0	hg19	c.1558C>A	CCDS14635.1	0	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047339	0.36085	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.77877	-1.13;-1.13;-1.13	3.8	3.8	0.43715	3.8	3.8	0.43715	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.115910	0.35378	N	0.003241	D	0.85687	0.5754	M	0.76574	2.34	0.32585	N	0.527976	D	0.89917	1.0	D	0.97110	1.0	D	0.87940	0.2716	10	0.87932	D	0	-18.1599	10.167	0.42886	0.0:0.0:1.0:0.0	.	520	Q9BXU7	UBP26_HUMAN	N	520	ENSP00000359869:H520N;ENSP00000423390:H520N;ENSP00000384360:H520N	ENSP00000359869:H520N	H	-	1	0	0	USP26	131988357	131988357	1.000000	0.71417	0.751000	0.31187	0.034000	0.12701	6.092000	0.71414	2.153000	0.67306	0.529000	0.55759	CAC	0.440000		TCGA-IB-A7M4-01A-11D-A36O-08	0.383	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	1	0	1	2	2	2	2	0	0	0	0	167	167	167	166	1	1.980000	-3.416538	1	0.440000	NM_031907		0	21	20	0	524	518	0		1			0	0	167	0	0	0.999997	0	0	0	0	0	0	21	524
