#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
LDB1	8861	broad.mit.edu	37	10	103868035	103868035	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr10:103868035C>T	ENST00000425280.1	-	11	1393	c.1051G>A	c.(1051-1053)Ggg>Agg	p.G351R	LDB1_ENST00000490751.1_5'Flank|LDB1_ENST00000361198.5_Missense_Mutation_p.G315R	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	351	LIM-binding domain (LID). {ECO:0000250}.				anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		TCCTCGTCCCCGAACTCCCCG	0.632																																						ENST00000425280.1	1.000000	0.490000	1.000000	0.710000	0.980000	0.889537	0.980000	1.000000																										0				21						c.(1051-1053)Ggg>Agg		LIM domain binding 1							103.0	77.0	86.0					10																	103868035		2203	4300	6503	SO:0001583	missense	8861	0	0					g.chr10:103868035C>T	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.1051G>A	chr10.hg19:g.103868035C>T	ENSP00000392466:p.Gly351Arg	0					LDB1_ENST00000361198.5_Missense_Mutation_p.G315R|LDB1_ENST00000490751.1_5'Flank	p.G351R	NM_001113407.1	NP_001106878.1	0	1	1	1.992979	Q86U70	LDB1_HUMAN		11	1393	-		Colorectal(252;0.122)	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	1	1	hg19	c.1051G>A	CCDS44472.1	1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210721	0.79240	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	T;T	0.27890	1.64;1.64	5.49	5.49	0.81192	5.490000	5.490000	0.811920	.	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	M	0.85777	2.775	0.80722	D	1	D	0.54772	0.968	B	0.37144	0.242	T	0.58120	-0.7692	10	0.87932	D	0	-3.4047	19.3379	0.94326	0.0:1.0:0.0:0.0	.	351	Q86U70	LDB1_HUMAN	R	315;351	ENSP00000354616:G315R;ENSP00000392466:G351R	ENSP00000354616:G315R	G	-	1	0	0	LDB1	103858025	103858025	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.742000	0.94016	0.455000	0.32223	GGG	0.071832		TCGA-IB-AAUM-01A-11D-A377-08	0.632	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	2.040000	-2.947337	1	0.080000	NM_001113407		0	9	9	0	216	215	0		1	1		0	0	41	0	0	0.994381	8.434276e-01	0	8	0	75	0	9	216
DSCAML1	57453	broad.mit.edu	37	11	117307881	117307881	+	Silent	SNP	G	G	A	rs376657003		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr11:117307881G>A	ENST00000321322.6	-	26	4858	c.4857C>T	c.(4855-4857)tgC>tgT	p.C1619C	DSCAML1_ENST00000527706.1_Silent_p.C1349C	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1559					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.C1619C(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TTTCATTGCCGCAGCCCGCAC	0.632																																						ENST00000321322.6	0.730000	0.160000	0.550000	0.250000	0.380000	0.411276	0.380000	0.350000																										1	Substitution - coding silent(1)	p.C1619C(1)	large_intestine(1)	110						c.(4855-4857)tgC>tgT		Down syndrome cell adhesion molecule like 1		G		0,4402		0,0,2201	88.0	82.0	84.0		4857	-1.2	1.0	11		84	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	DSCAML1	NM_020693.2		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		1619/2114	117307881	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	57453	5	121412	37				g.chr11:117307881G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.4857C>T	chr11.hg19:g.117307881G>A		0					DSCAML1_ENST00000527706.1_Silent_p.C1349C	p.C1619C	NM_020693.2	NP_065744.2	0	1	1	1.991255	Q8TD84	DSCL1_HUMAN		26	4858	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	0	1	hg19	c.4857C>T	CCDS8384.1	0																																																																																								0.071457		TCGA-IB-AAUM-01A-11D-A377-08	0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	0	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	2.040000	-2.172429	0	0.080000	NM_020693		0	6	6	0	400	397	0		1	0		0	0	59	0	0	0.964437	1.955125e-03	0	0	0	4	0	6	400
GRIK4	2900	broad.mit.edu	37	11	120769305	120769305	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr11:120769305C>T	ENST00000527524.2	+	12	1516	c.1229C>T	c.(1228-1230)tCg>tTg	p.S410L	GRIK4_ENST00000438375.2_Missense_Mutation_p.S410L	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	410					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TCCAACATCTCGGACACTCTC	0.612																																						ENST00000527524.2	1.000000	0.530000	1.000000	0.790000	0.990000	0.926943	0.990000	1.000000																										0				69						c.(1228-1230)tCg>tTg		glutamate receptor, ionotropic, kainate 4							214.0	141.0	166.0					11																	120769305		2203	4299	6502	SO:0001583	missense	2900	1	121412	27				g.chr11:120769305C>T	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1229C>T	chr11.hg19:g.120769305C>T	ENSP00000435648:p.Ser410Leu	0					GRIK4_ENST00000438375.2_Missense_Mutation_p.S410L	p.S410L	NM_001282470.1	NP_001269399.1	0	1	1	1.991255	Q16099	GRIK4_HUMAN		12	1516	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	1	1	hg19	c.1229C>T	CCDS8433.1	1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523560	0.44866	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.13657	2.57;2.57	5.03	5.03	0.67393	5.030000	5.030000	0.673930	.	0.297347	0.40385	N	0.001116	T	0.17195	0.0413	M	0.62723	1.935	0.51767	D	0.99993	B;P	0.39376	0.239;0.67	B;B	0.31869	0.078;0.137	T	0.04360	-1.0957	10	0.72032	D	0.01	.	18.3623	0.90379	0.0:1.0:0.0:0.0	.	410;410	A6H8K8;Q16099	.;GRIK4_HUMAN	L	410	ENSP00000435648:S410L;ENSP00000404063:S410L	ENSP00000404063:S410L	S	+	2	0	0	GRIK4	120274515	120274515	1.000000	0.71417	0.907000	0.35723	0.018000	0.09664	7.480000	0.81109	2.323000	0.78572	0.462000	0.41574	TCG	0.071457		TCGA-IB-AAUM-01A-11D-A377-08	0.612	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	2.040000	-3.017763	1	0.080000	NM_014619		0	7	7	0	139	139	0		1			0	0	29	0	0	0.981434	0	0	0	0	0	0	7	139
CDON	50937	broad.mit.edu	37	11	125871630	125871630	+	Silent	SNP	G	G	C			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr11:125871630G>C	ENST00000392693.3	-	11	2269	c.2142C>G	c.(2140-2142)tcC>tcG	p.S714S	CDON_ENST00000531738.1_Silent_p.S91S|CDON_ENST00000263577.7_Silent_p.S714S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	714					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TGTGCCTAGAGGAATCTGTAA	0.433																																						ENST00000392693.3	1.000000	0.700000	1.000000	0.910000	0.990000	0.964896	0.990000	1.000000																										0				61						c.(2140-2142)tcC>tcG		cell adhesion associated, oncogene regulated							93.0	91.0	92.0					11																	125871630		2201	4299	6500	SO:0001819	synonymous_variant	50937	0	0					g.chr11:125871630G>C	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.2142C>G	chr11.hg19:g.125871630G>C		0					CDON_ENST00000531738.1_Silent_p.S91S|CDON_ENST00000263577.7_Silent_p.S714S	p.S714S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	0	1	1	1.991255	Q4KMG0	CDON_HUMAN		11	2269	-	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	O14631	Silent	SNP	ENST00000392693.3	1	1	hg19	c.2142C>G	CCDS58192.1	1																																																																																								0.071457		TCGA-IB-AAUM-01A-11D-A377-08	0.433	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	1	0	1	2	2	2	2	0	0	0	0	81	81	81	78	1	2.040000	-2.725401	1	0.080000	NM_016952		0	17	17	0	343	341	0		1	0		0	0	81	0	0	0.999966	1.441973e-02	0	0	0	4	0	17	343
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.930000	1.000000	0.990000	0.990000	0.995854	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.001720	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.088387		TCGA-IB-AAUM-01A-11D-A377-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	7	0	0	0	0	86	86	86	85	1	2.040000	-5.925615	1	0.080000	NM_033360		462	19	19	7563	308	308	0	1	1	0	1	0	1	86	346	1	0.999992	1.649818e-01	9.999007e-01	1	21	11	477	19	308
NUP107	57122	broad.mit.edu	37	12	69082833	69082833	+	Splice_Site	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr12:69082833C>T	ENST00000229179.4	+	2	432	c.100C>T	c.(100-102)Ctt>Ttt	p.L34F	RP11-637A17.2_ENST00000500695.2_lincRNA|NUP107_ENST00000539906.1_5'UTR|NUP107_ENST00000378905.2_5'UTR	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	34					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			AAGAGTTTTACGTATCCTTTG	0.378																																						ENST00000229179.4	1.000000	0.660000	1.000000	0.950000	0.990000	0.967084	0.990000	1.000000																									NUP107/LGR5(2)	0				39						c.(100-102)Ctt>Ttt		nucleoporin 107kDa							124.0	116.0	119.0					12																	69082833		2203	4300	6503	SO:0001630	splice_region_variant	57122	7	121412	37				g.chr12:69082833C>T	AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.100+1C>T	chr12.hg19:g.69082833C>T		0					RP11-637A17.2_ENST00000500695.2_lincRNA|NUP107_ENST00000539906.1_5'UTR|NUP107_ENST00000378905.2_5'UTR	p.L34F	NM_020401.2	NP_065134.1	1	2	3	2.001720	P57740	NU107_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	2	432	+	Breast(13;6.25e-06)		B4DZ67|Q6PJE1	Splice_Site	SNP	ENST00000229179.4	0	1	hg19	c.100C>T	CCDS8985.1	1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.583042	0.28268	.	.	ENSG00000111581	ENST00000229179	.	.	.	5.45	1.62	0.23740	5.450000	1.620000	0.237400	.	0.364773	0.29515	N	0.011933	T	0.28764	0.0713	N	0.19112	0.55	0.80722	D	1	B	0.33288	0.406	B	0.26614	0.071	T	0.03875	-1.0996	8	.	.	.	-14.2674	7.3035	0.26434	0.4774:0.4454:0.0772:0.0	.	34	P57740	NU107_HUMAN	F	34	.	.	L	+	1	0	0	NUP107	67369100	67369100	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	0.680000	0.25306	0.084000	0.17077	-0.541000	0.04245	CTT	0.088387		TCGA-IB-AAUM-01A-11D-A377-08	0.378	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403195.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	2.040000	-4.353979	1	0.080000	NM_020401	Missense_Mutation	0	9	9	0	170	169	0		1	0		0	0	33	0	0	0.994443	1.437079e-01	0	0	0	12	0	9	170
HERC2	8924	broad.mit.edu	37	15	28518096	28518096	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr15:28518096G>C	ENST00000261609.7	-	8	963	c.855C>G	c.(853-855)gaC>gaG	p.D285E		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCAAGTGCTGGTCCTGCAGGG	0.612																																						ENST00000261609.7	1.000000	0.680000	1.000000	0.920000	0.990000	0.965227	0.990000	1.000000																										0				204						c.(853-855)gaC>gaG		HECT and RLD domain containing E3 ubiquitin protein ligase 2							52.0	50.0	51.0					15																	28518096		2203	4300	6503	SO:0001583	missense	8924	7	121412	23				g.chr15:28518096G>C	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.855C>G	chr15.hg19:g.28518096G>C	ENSP00000261609:p.Asp285Glu	0						p.D285E	NM_004667.5	NP_004658.3	0	1	1	1.978553				8	963	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		Missense_Mutation	SNP	ENST00000261609.7	0	1	hg19	c.855C>G	CCDS10021.1	1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875355	0.91664	.	.	ENSG00000128731	ENST00000261609	T	0.56611	0.45	5.23	4.3	0.51218	5.230000	4.300000	0.512180	.	0.000000	0.85682	D	0.000000	T	0.70491	0.3230	M	0.75615	2.305	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.73902	-0.3836	10	0.54805	T	0.06	.	14.4241	0.67202	0.0718:0.0:0.9282:0.0	.	285	O95714	HERC2_HUMAN	E	285	ENSP00000261609:D285E	ENSP00000261609:D285E	D	-	3	2	2	HERC2	26191691	26191691	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.274000	0.51631	1.424000	0.47217	0.644000	0.83932	GAC	0.068449		TCGA-IB-AAUM-01A-11D-A377-08	0.612	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	0	0	0	2	19	3	2	1	1	1	1	37	37	37	37	1	2.040000	-2.117427	0	0.080000	NM_004667		0	12	12	0	221	217	0		0	1		1	0	37	0	0	0.119264	3.598134e-02	0	4	0	9	0	12	221
KLHL25	64410	broad.mit.edu	37	15	86311613	86311613	+	Missense_Mutation	SNP	C	C	T	rs369625056		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr15:86311613C>T	ENST00000337975.5	-	2	1703	c.1429G>A	c.(1429-1431)Gag>Aag	p.E477K	KLHL25_ENST00000559131.1_Intron|MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000536947.1_Missense_Mutation_p.E477K	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	477					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)				breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						TGGGGGCACTCGGCCTTGATC	0.612																																						ENST00000337975.5	1.000000	0.730000	1.000000	0.910000	0.990000	0.967363	0.990000	1.000000																										0				25						c.(1429-1431)Gag>Aag		kelch-like family member 25		C	LYS/GLU	0,4404		0,0,2202	84.0	77.0	80.0		1429	5.7	1.0	15		80	1,8597	1.2+/-3.3	0,1,4298	no	missense	KLHL25	NM_022480.3	56	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign	477/590	86311613	1,13001	2202	4299	6501	SO:0001583	missense	64410	0	0					g.chr15:86311613C>T		CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1429G>A	chr15.hg19:g.86311613C>T	ENSP00000336800:p.Glu477Lys	0					KLHL25_ENST00000536947.1_Missense_Mutation_p.E477K|KLHL25_ENST00000559131.1_Intron|MIR1276_ENST00000408707.1_RNA	p.E477K	NM_022480.3	NP_071925.2	0	1	1	1.983979	Q9H0H3	KLH25_HUMAN		2	1703	-			B2RDH2|B3KRT7	Missense_Mutation	SNP	ENST00000337975.5	1	1	hg19	c.1429G>A	CCDS10339.1	1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745761	0.30955	0.0	1.16E-4	ENSG00000183655	ENST00000337975;ENST00000538153;ENST00000536947	T;T	0.78003	-1.14;-1.14	5.71	5.71	0.89125	5.710000	5.710000	0.891250	Kelch-type beta propeller (1);	0.056938	0.64402	D	0.000002	T	0.73877	0.3643	L	0.39147	1.195	0.44852	D	0.997868	B	0.28470	0.213	B	0.29862	0.108	T	0.71991	-0.4425	10	0.59425	D	0.04	.	18.8314	0.92141	0.0:1.0:0.0:0.0	.	477	Q9H0H3	ENC2_HUMAN	K	477;446;477	ENSP00000336800:E477K;ENSP00000444739:E477K	ENSP00000336800:E477K	E	-	1	0	0	KLHL25	84112617	84112617	0.990000	0.36364	0.993000	0.49108	0.257000	0.26127	3.248000	0.51430	2.700000	0.92200	0.462000	0.41574	GAG	0.069579		TCGA-IB-AAUM-01A-11D-A377-08	0.612	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309023.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	88	1	2.040000	-2.907014	1	0.080000	NM_022480		0	23	23	0	479	471	0		1	0		0	0	93	0	0	0.999999	8.073680e-02	0	1	0	9	0	23	479
MAN2A2	4122	broad.mit.edu	37	15	91454724	91454724	+	Missense_Mutation	SNP	G	G	A	rs146632780	byFrequency	TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr15:91454724G>A	ENST00000559717.1	+	14	2512	c.2053G>A	c.(2053-2055)Gtg>Atg	p.V685M	MAN2A2_ENST00000360468.3_Missense_Mutation_p.V685M|MAN2A2_ENST00000430376.2_5'Flank|MAN2A2_ENST00000431652.2_Missense_Mutation_p.V193M			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	685					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCCCCTGGCCGTGCAGATCAG	0.647																																						ENST00000559717.1	0.930000	0.150000	0.680000	0.270000	0.440000	0.481573	0.440000	1.000000																										0				47						c.(2053-2055)Gtg>Atg		mannosidase, alpha, class 2A, member 2		G	MET/VAL	8,4388	14.3+/-33.2	0,8,2190	91.0	80.0	84.0		2053	5.5	1.0	15	dbSNP_134	84	0,8596		0,0,4298	yes	missense	MAN2A2	NM_006122.2	21	0,8,6488	AA,AG,GG		0.0,0.182,0.0616	benign	685/1151	91454724	8,12984	2198	4298	6496	SO:0001583	missense	4122	20	121412	45				g.chr15:91454724G>A	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2053G>A	chr15.hg19:g.91454724G>A	ENSP00000452948:p.Val685Met	0					MAN2A2_ENST00000360468.3_Missense_Mutation_p.V685M|MAN2A2_ENST00000431652.2_Missense_Mutation_p.V193M|MAN2A2_ENST00000430376.2_5'Flank	p.V685M			0	1	1	1.983979	P49641	MA2A2_HUMAN	Lung(145;0.229)	14	2512	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	0	1	hg19	c.2053G>A	CCDS32332.1	0	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595953	0.46318	0.00182	0.0	ENSG00000196547	ENST00000360468;ENST00000431652	T;T	0.79247	-1.25;-1.25	5.49	5.49	0.81192	5.490000	5.490000	0.811920	Glycosyl hydrolases 38, C-terminal (1);Glycosyl hydrolase, family 13, all-beta (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.112697	0.64402	D	0.000012	D	0.83899	0.5354	M	0.81942	2.565	0.80722	D	1	P;P;P	0.41848	0.577;0.763;0.763	B;P;P	0.48901	0.278;0.594;0.594	D	0.83927	0.0304	10	0.41790	T	0.15	-8.4381	15.8566	0.78983	0.0:0.0:0.8639:0.1361	.	193;313;685	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	M	685;193	ENSP00000353655:V685M;ENSP00000388221:V193M	ENSP00000353655:V685M	V	+	1	0	0	MAN2A2	89255728	89255728	1.000000	0.71417	0.959000	0.39883	0.039000	0.13416	4.364000	0.59479	2.622000	0.88805	0.549000	0.68633	GTG	0.069579		TCGA-IB-AAUM-01A-11D-A377-08	0.647	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	0	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	2.040000	-2.946643	1	0.080000	NM_006122		0	4	4	0	235	229	0		1	0		0	0	39	0	0	0.885054	2.412919e-01	0	0	0	45	0	4	235
ADCY9	115	broad.mit.edu	37	16	4163864	4163864	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr16:4163864C>T	ENST00000294016.3	-	2	2118	c.1580G>A	c.(1579-1581)gGc>gAc	p.G527D		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	527					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTGAACTTTGCCGGCCACTCC	0.522																																						ENST00000294016.3	1.000000	0.090000	1.000000	0.170000	0.280000	0.413484	0.280000	0.230000																										0				47						c.(1579-1581)gGc>gAc		adenylate cyclase 9							99.0	101.0	100.0					16																	4163864		2197	4300	6497	SO:0001583	missense	115	0	0					g.chr16:4163864C>T	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1580G>A	chr16.hg19:g.4163864C>T	ENSP00000294016:p.Gly527Asp	0						p.G527D	NM_001116.3	NP_001107.2	1	2	3	2.010337	O60503	ADCY9_HUMAN		2	2118	-			A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	0	1	hg19	c.1580G>A	CCDS32382.1	0	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018606	0.75275	.	.	ENSG00000162104	ENST00000294016	D	0.86562	-2.14	5.39	5.39	0.77823	5.390000	5.390000	0.778230	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.85682	D	0.000000	D	0.93713	0.7991	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94090	0.7352	10	0.72032	D	0.01	.	19.2017	0.93713	0.0:1.0:0.0:0.0	.	527	O60503	ADCY9_HUMAN	D	527	ENSP00000294016:G527D	ENSP00000294016:G527D	G	-	2	0	0	ADCY9	4103865	4103865	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	7.818000	0.86416	2.552000	0.86080	0.555000	0.69702	GGC	0.090190		TCGA-IB-AAUM-01A-11D-A377-08	0.522	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1	0	0	1	2	2	2	2	0	0	0	0	129	129	129	128	1	2.040000	-2.130388	0	0.080000			0	5	5	0	539	528	0		1	0		0	0	129	0	0	0.934392	2.249191e-02	0	0	0	20	0	5	539
PIGQ	9091	broad.mit.edu	37	16	633162	633162	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr16:633162G>A	ENST00000026218.5	+	10	1899	c.1811G>A	c.(1810-1812)gGc>gAc	p.G604D	PIGQ_ENST00000321878.5_3'UTR	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	604					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				CCTGAACACGGCAGGCCCTGC	0.642																																						ENST00000026218.5	1.000000	0.080000	1.000000	0.140000	0.230000	0.375018	0.230000	0.180000																										0				13						c.(1810-1812)gGc>gAc		phosphatidylinositol glycan anchor biosynthesis, class Q							113.0	113.0	113.0					16																	633162		2201	4300	6501	SO:0001583	missense	9091	0	0					g.chr16:633162G>A	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1811G>A	chr16.hg19:g.633162G>A	ENSP00000026218:p.Gly604Asp	0					PIGQ_ENST00000321878.5_3'UTR	p.G604D	NM_148920.2	NP_683721.1	1	2	3	2.010337	Q9BRB3	PIGQ_HUMAN		10	1899	+		Hepatocellular(780;0.00335)	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	0	1	hg19	c.1811G>A	CCDS10411.1	0	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379045	0.24944	.	.	ENSG00000007541	ENST00000026218	T	0.25912	1.77	3.18	-0.83	0.10792	3.180000	-0.830000	0.107920	.	.	.	.	.	T	0.09686	0.0238	N	0.08118	0	0.19300	N	0.999972	B;B	0.18013	0.025;0.001	B;B	0.15870	0.014;0.001	T	0.34725	-0.9817	8	.	.	.	0.0578	3.0773	0.06251	0.4718:0.0:0.3279:0.2004	.	174;604	B3KRR7;Q9BRB3	.;PIGQ_HUMAN	D	604	ENSP00000026218:G604D	.	G	+	2	0	0	PIGQ	573163	573163	0.000000	0.05858	0.102000	0.21198	0.028000	0.11728	-0.042000	0.12063	-0.023000	0.13963	-0.481000	0.04817	GGC	0.090190		TCGA-IB-AAUM-01A-11D-A377-08	0.642	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	0	0	1	2	2	2	2	0	0	0	0	138	138	138	138	1	2.040000	-1.963791	0	0.080000	NM_004204		0	5	5	0	657	644	0		1	0		0	0	138	0	0	0.934447	4.413348e-01	0	0	0	173	0	5	657
ITFG1	81533	broad.mit.edu	37	16	47195677	47195677	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr16:47195677G>A	ENST00000320640.6	-	16	1873	c.1645C>T	c.(1645-1647)Cac>Tac	p.H549Y	RP11-329J18.2_ENST00000564705.1_RNA|ITFG1_ENST00000544001.2_Missense_Mutation_p.H436Y|RP11-329J18.2_ENST00000565694.1_RNA|ITFG1_ENST00000568047.1_5'UTR	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	549						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				GGGACATTGTGAGGGTATGGA	0.373																																						ENST00000320640.6	1.000000	0.890000	1.000000	0.990000	0.990000	0.993929	0.990000	1.000000																										0				19						c.(1645-1647)Cac>Tac		integrin alpha FG-GAP repeat containing 1							206.0	184.0	191.0					16																	47195677		2202	4300	6502	SO:0001583	missense	81533	0	0					g.chr16:47195677G>A	AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.1645C>T	chr16.hg19:g.47195677G>A	ENSP00000319918:p.His549Tyr	0					ITFG1_ENST00000568047.1_5'UTR|RP11-329J18.2_ENST00000564705.1_RNA|RP11-329J18.2_ENST00000565694.1_RNA|ITFG1_ENST00000544001.2_Missense_Mutation_p.H436Y	p.H549Y	NM_030790.3	NP_110417.2	1	2	3	1.998329	Q8TB96	TIP_HUMAN		16	1873	-		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)	Q96SR4|Q9BRE2|Q9H2V9	Missense_Mutation	SNP	ENST00000320640.6	1	1	hg19	c.1645C>T	CCDS10728.1	1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474395	0.63737	.	.	ENSG00000129636	ENST00000320640;ENST00000537184;ENST00000542691;ENST00000544001	.	.	.	5.59	5.59	0.84812	5.590000	5.590000	0.848120	.	0.050252	0.85682	D	0.000000	T	0.52948	0.1766	L	0.44542	1.39	0.80722	D	1	P;B	0.35612	0.512;0.225	B;B	0.37047	0.24;0.158	T	0.46247	-0.9205	9	0.16420	T	0.52	-18.2506	19.5992	0.95552	0.0:0.0:1.0:0.0	.	436;549	F5GXC5;Q8TB96	.;TIP_HUMAN	Y	549;209;294;436	.	ENSP00000319918:H549Y	H	-	1	0	0	ITFG1	45753178	45753178	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	7.229000	0.78088	2.640000	0.89533	0.467000	0.42956	CAC	0.087664		TCGA-IB-AAUM-01A-11D-A377-08	0.373	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256768.3	1	0	1	2	2	2	2	0	0	0	0	101	101	101	101	1	2.040000	-3.316108	1	0.080000	NM_030790		0	24	24	0	429	428	0		1	1		0	0	101	0	0	1.000000	9.939297e-01	0	10	0	135	0	24	429
TP53I13	90313	broad.mit.edu	37	17	27898646	27898646	+	Missense_Mutation	SNP	A	A	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr17:27898646A>T	ENST00000301057.7	+	4	336	c.221A>T	c.(220-222)cAt>cTt	p.H74L	RP11-68I3.2_ENST00000581474.1_RNA|RP11-68I3.4_ENST00000579050.1_RNA	NM_138349.2	NP_612358.3	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	74						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(3;0.236)		CCCTGTGCCCATCCCTGGCTG	0.577																																						ENST00000301057.7	1.000000	0.410000	1.000000	0.610000	0.880000	0.831743	0.880000	1.000000																										0				4						c.(220-222)cAt>cTt		tumor protein p53 inducible protein 13							117.0	125.0	122.0					17																	27898646		2090	4234	6324	SO:0001583	missense	90313	0	0					g.chr17:27898646A>T	AK075341	CCDS42289.1	17q11.2	2006-01-16				ENSG00000167543			25102	protein-coding gene	gene with protein product						14767535	Standard	NM_138349		Approved	DSCP1	uc002hee.3	Q8NBR0		ENST00000301057.7:c.221A>T	chr17.hg19:g.27898646A>T	ENSP00000301057:p.His74Leu	0					RP11-68I3.2_ENST00000581474.1_RNA|RP11-68I3.4_ENST00000579050.1_RNA	p.H74L	NM_138349.2	NP_612358.3	1	2	3	2.004719	Q8NBR0	P5I13_HUMAN		4	336	+			Q7L5U3	Missense_Mutation	SNP	ENST00000301057.7	1	1	hg19	c.221A>T	CCDS42289.1	1	.	.	.	.	.	.	.	.	.	.	A	12.34	1.907199	0.33628	.	.	ENSG00000167543	ENST00000301057	.	.	.	4.62	4.62	0.57501	4.620000	4.620000	0.575010	.	0.078468	0.51477	D	0.000094	T	0.71264	0.3319	M	0.72118	2.19	0.40065	D	0.97594	D	0.71674	0.998	D	0.68943	0.961	T	0.74127	-0.3765	9	0.52906	T	0.07	-16.3851	10.7236	0.46055	1.0:0.0:0.0:0.0	.	74	Q8NBR0	P5I13_HUMAN	L	74	.	ENSP00000301057:H74L	H	+	2	0	0	TP53I13	24922772	24922772	0.985000	0.35326	1.000000	0.80357	0.915000	0.54546	2.593000	0.46180	1.844000	0.53588	0.374000	0.22700	CAT	0.089109		TCGA-IB-AAUM-01A-11D-A377-08	0.577	TP53I13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447804.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	2.040000	-10.282210	1	0.080000	NM_138349		0	9	9	0	278	270	1		1	1		0	0	70	0	0	0.993648	7.623299e-01	0	10	0	76	0	9	278
DVL2	1856	broad.mit.edu	37	17	7137472	7137472	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr17:7137472C>T	ENST00000005340.5	-	1	392	c.110G>A	c.(109-111)cGc>cAc	p.R37H	DVL2_ENST00000575458.1_Missense_Mutation_p.R37H|PHF23_ENST00000570753.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	37	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GAGGGTGATGCGCTCGGCGGG	0.602																																						ENST00000005340.5	1.000000	0.080000	0.500000	0.130000	0.210000	0.337202	0.210000	0.180000																										0				25						c.(109-111)cGc>cAc		dishevelled segment polarity protein 2							103.0	110.0	108.0					17																	7137472		2203	4300	6503	SO:0001583	missense	1856	0	0					g.chr17:7137472C>T	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.110G>A	chr17.hg19:g.7137472C>T	ENSP00000005340:p.Arg37His	0					DVL2_ENST00000575458.1_Missense_Mutation_p.R37H|PHF23_ENST00000570753.1_5'Flank	p.R37H	NM_004422.2	NP_004413.1	1	2	3	1.998392	O14641	DVL2_HUMAN		1	392	-			D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	0	1	hg19	c.110G>A	CCDS11091.1	0	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821401	0.90873	.	.	ENSG00000004975	ENST00000005340	T	0.43294	0.95	4.51	4.51	0.55191	4.510000	4.510000	0.551910	DIX (3);	0.287347	0.32640	N	0.005840	T	0.51652	0.1687	L	0.53249	1.67	0.36170	D	0.848736	D;D;D	0.69078	0.997;0.996;0.997	P;P;P	0.60789	0.879;0.703;0.879	T	0.61787	-0.6991	10	0.56958	D	0.05	-13.7627	8.5504	0.33449	0.0:0.8922:0.0:0.1078	.	37;37;37	B4DLQ0;B4E2D6;O14641	.;.;DVL2_HUMAN	H	37	ENSP00000005340:R37H	ENSP00000005340:R37H	R	-	2	0	0	DVL2	7078196	7078196	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.334000	0.52097	2.055000	0.61198	0.484000	0.47621	CGC	0.087664		TCGA-IB-AAUM-01A-11D-A377-08	0.602	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	0	0	1	2	2	2	2	0	0	0	0	147	147	147	142	1	2.040000	-1.929403	0	0.080000	NM_004422		0	6	6	0	809	801	0		1	0		0	0	147	0	0	0.963820	2.621717e-02	0	0	0	28	0	6	809
RHOT1	55288	broad.mit.edu	37	17	30521098	30521098	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr17:30521098G>A	ENST00000333942.6	+	11	1080	c.841G>A	c.(841-843)Gat>Aat	p.D281N	RHOT1_ENST00000394692.2_Missense_Mutation_p.D281N|RHOT1_ENST00000581094.1_Missense_Mutation_p.D281N|RHOT1_ENST00000583994.1_Missense_Mutation_p.D154N|RHOT1_ENST00000354266.3_Missense_Mutation_p.D260N|RHOT1_ENST00000545287.2_Missense_Mutation_p.D281N|RHOT1_ENST00000358365.3_Missense_Mutation_p.D281N|RHOT1_ENST00000580976.1_3'UTR	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	281					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TGATGACCTGGATTTGACACC	0.363																																						ENST00000333942.6	1.000000	0.190000	1.000000	0.250000	0.320000	0.440418	0.320000	0.310000																										0				28						c.(841-843)Gat>Aat		ras homolog family member T1							493.0	481.0	485.0					17																	30521098		2203	4300	6503	SO:0001583	missense	55288	0	0					g.chr17:30521098G>A	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.841G>A	chr17.hg19:g.30521098G>A	ENSP00000334724:p.Asp281Asn	0					RHOT1_ENST00000545287.2_Missense_Mutation_p.D281N|RHOT1_ENST00000358365.3_Missense_Mutation_p.D281N|RHOT1_ENST00000580976.1_3'UTR|RHOT1_ENST00000354266.3_Missense_Mutation_p.D260N|RHOT1_ENST00000583994.1_Missense_Mutation_p.D154N|RHOT1_ENST00000581094.1_Missense_Mutation_p.D281N|RHOT1_ENST00000394692.2_Missense_Mutation_p.D281N	p.D281N	NM_018307.3	NP_060777.3	1	2	3	2.004719	Q8IXI2	MIRO1_HUMAN		11	1080	+		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	0	1	hg19	c.841G>A	CCDS32612.1	0	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743488	0.69418	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942	T;T;T	0.42131	0.98;0.98;0.98	5.97	5.97	0.96955	5.970000	5.970000	0.969550	EF hand associated, type-2 (1);	0.088643	0.85682	D	0.000000	T	0.22166	0.0534	N	0.01352	-0.895	0.80722	D	1	B;B;B;B	0.24317	0.101;0.0;0.0;0.0	B;B;B;B	0.24394	0.053;0.002;0.006;0.002	T	0.18745	-1.0327	10	0.38643	T	0.18	-6.5042	20.4135	0.99023	0.0:0.0:1.0:0.0	.	281;281;281;281	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	N	281	ENSP00000351132:D281N;ENSP00000378184:D281N;ENSP00000334724:D281N	ENSP00000334724:D281N	D	+	1	0	0	RHOT1	27545211	27545211	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.835000	0.97688	0.591000	0.81541	GAT	0.089109		TCGA-IB-AAUM-01A-11D-A377-08	0.363	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	0	0	1	2	2	2	2	0	0	0	0	477	477	477	475	1	2.040000	-3.017764	1	0.080000	NM_018307		0	21	22	0	1713	1664	0		1	0		0	0	477	0	0	0.999996	4.385822e-02	0	1	0	25	0	21	1713
SMAD4	4089	broad.mit.edu	37	18	48604703	48604703	+	Missense_Mutation	SNP	T	T	G	rs377767369		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr18:48604703T>G	ENST00000342988.3	+	12	2063	c.1525T>G	c.(1525-1527)Tgg>Ggg	p.W509G	SMAD4_ENST00000398417.2_Missense_Mutation_p.W509G|SMAD4_ENST00000588745.1_Missense_Mutation_p.W413G|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	509	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGTGAAAGGCTGGGGACCGGA	0.473																																						ENST00000342988.3	1.000000	0.400000	0.520000	0.450000	0.490000	0.520576	0.490000	0.510000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1525-1527)Tgg>Ggg		SMAD family member 4							114.0	103.0	107.0					18																	48604703		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48604703T>G	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1525T>G	chr18.hg19:g.48604703T>G	ENSP00000341551:p.Trp509Gly	1					SMAD4_ENST00000588745.1_Missense_Mutation_p.W413G|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.W509G	p.W509G	NM_005359.5	NP_005350.1	0	0	0	1.895056	Q13485	SMAD4_HUMAN		12	2063	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1525T>G	CCDS11950.1	0	.	.	.	.	.	.	.	.	.	.	T	17.73	3.460910	0.63513	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.99113	-5.44;-5.44	6.08	6.08	0.98989	6.080000	6.080000	0.989890	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98200	1.0467	10	0.87932	D	0	.	15.6255	0.76851	0.0:0.0:0.0:1.0	.	509	Q13485	SMAD4_HUMAN	G	509	ENSP00000341551:W509G;ENSP00000381452:W509G	ENSP00000341551:W509G	W	+	1	0	0	SMAD4	46858701	46858701	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.819000	0.86621	2.330000	0.79161	0.533000	0.62120	TGG	0.022109		TCGA-IB-AAUM-01A-11D-A377-08	0.473	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	2.040000	-19.999990	1	0.080000	NM_005359		0	20	20	0	253	248	1		1	1	1	0	0	56	898	0	0.999995	9.830782e-01	1	15	58	71	1111	20	253
TSHZ1	10194	broad.mit.edu	37	18	72998573	72998573	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr18:72998573A>G	ENST00000580243.1	+	2	1559	c.1211A>G	c.(1210-1212)tAc>tGc	p.Y404C	TSHZ1_ENST00000322038.5_Missense_Mutation_p.Y359C			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	404					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GGCGCCAGCTACACCTGGCAG	0.612																																						ENST00000580243.1	0.510000	0.130000	0.470000	0.230000	0.350000	0.354990	0.350000	0.400000																										0				42						c.(1210-1212)tAc>tGc		teashirt zinc finger homeobox 1							74.0	77.0	76.0					18																	72998573		2203	4300	6503	SO:0001583	missense	10194	0	0					g.chr18:72998573A>G	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1211A>G	chr18.hg19:g.72998573A>G	ENSP00000464391:p.Tyr404Cys	1					TSHZ1_ENST00000322038.5_Missense_Mutation_p.Y359C	p.Y404C			0	0	0	1.895056	Q6ZSZ6	TSH1_HUMAN		2	1559	+		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	0	1	hg19	c.1211A>G		0	.	.	.	.	.	.	.	.	.	.	A	10.70	1.424041	0.25639	.	.	ENSG00000179981	ENST00000322038	T	0.20463	2.07	5.12	5.12	0.69794	5.120000	5.120000	0.697940	.	0.000000	0.85682	D	0.000000	T	0.47229	0.1434	M	0.74647	2.275	0.45216	D	0.998227	D	0.89917	1.0	D	0.85130	0.997	T	0.49570	-0.8926	10	0.87932	D	0	-30.001	14.9402	0.70989	1.0:0.0:0.0:0.0	.	404	Q6ZSZ6	TSH1_HUMAN	C	359	ENSP00000323584:Y359C	ENSP00000323584:Y359C	Y	+	2	0	0	TSHZ1	71127561	71127561	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.794000	0.91867	2.371000	0.80710	0.561000	0.74099	TAC	0.022109		TCGA-IB-AAUM-01A-11D-A377-08	0.612	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	2.040000	-6.245539	1	0.080000	NM_005786		0	4	4	0	197	196	0		1	0		0	0	39	0	0	0.890045	4.421781e-02	0	0	0	13	0	4	197
KRI1	65095	broad.mit.edu	37	19	10671101	10671101	+	Silent	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr19:10671101G>A	ENST00000312962.6	-	9	724	c.705C>T	c.(703-705)aaC>aaT	p.N235N	KRI1_ENST00000361821.5_Silent_p.N231N|KRI1_ENST00000537964.1_5'Flank	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	229	Glu-rich.					nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			ACTCAGGGTCGTTCCAGTATT	0.552																																						ENST00000312962.6	1.000000	0.990000	1.000000	0.990000	0.990000	0.999994	0.990000	1.000000																										0				26						c.(703-705)aaC>aaT		KRI1 homolog (S. cerevisiae)							112.0	92.0	98.0					19																	10671101		2203	4300	6503	SO:0001819	synonymous_variant	65095	3	121412	35				g.chr19:10671101G>A		CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.705C>T	chr19.hg19:g.10671101G>A		0					KRI1_ENST00000361821.5_Silent_p.N231N|KRI1_ENST00000537964.1_5'Flank	p.N235N	NM_023008.3	NP_075384.3	1	2	3	2.007831	Q8N9T8	KRI1_HUMAN	Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)	9	724	-			Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Silent	SNP	ENST00000312962.6	1	1	hg19	c.705C>T	CCDS12242.1	1	.	.	.	.	.	.	.	.	.	.	G	9.792	1.178289	0.21787	.	.	ENSG00000129347	ENST00000543682	.	.	.	5.36	3.24	0.37175	5.360000	3.240000	0.371750	.	.	.	.	.	T	0.56001	0.1956	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49133	-0.8971	4	.	.	.	-58.2916	7.2862	0.26340	0.3358:0.0:0.6642:0.0	.	.	.	.	M	173	.	.	T	-	2	0	0	KRI1	10532101	10532101	0.144000	0.22641	0.993000	0.49108	0.925000	0.55904	0.275000	0.18698	0.652000	0.30806	0.563000	0.77884	ACG	0.089830		TCGA-IB-AAUM-01A-11D-A377-08	0.552	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1	0	0	1	2	18	4	2	1	1	1	1	98	98	98	96	1	2.040000	-9.896644	1	0.080000	NM_023008		0	39	37	0	492	481	0		1	1		1	0	98	0	0	0.998288	6.788818e-01	0	7	0	55	0	39	492
ZNF781	163115	broad.mit.edu	37	19	38160168	38160168	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr19:38160168C>A	ENST00000590008.1	-	5	1734	c.882G>T	c.(880-882)ttG>ttT	p.L294F	ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000358582.4_Missense_Mutation_p.L294F|ZNF781_ENST00000593040.1_5'Flank			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						GGACAGGAGACAAAAACCTTC	0.383																																						ENST00000590008.1	1.000000	0.960000	1.000000	0.990000	0.990000	0.997019	0.990000	1.000000																										0				24						c.(880-882)ttG>ttT		zinc finger protein 781							116.0	113.0	114.0					19																	38160168		2203	4300	6503	SO:0001583	missense	163115	1	121410	34				g.chr19:38160168C>A	AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.882G>T	chr19.hg19:g.38160168C>A	ENSP00000466370:p.Leu294Phe	0					ZNF781_ENST00000593040.1_5'Flank|ZNF781_ENST00000358582.4_Missense_Mutation_p.L294F|ZFP30_ENST00000586732.1_Intron	p.L294F			1	2	3	2.007831	Q8N8C0	ZN781_HUMAN		5	1734	-			Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	1	1	hg19	c.882G>T	CCDS12507.1	1	.	.	.	.	.	.	.	.	.	.	C	8.075	0.771033	0.16051	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.06142	3.34	2.07	-4.15	0.03881	2.070000	-4.150000	0.038810	.	.	.	.	.	T	0.03305	0.0096	L	0.35341	1.055	0.09310	N	1	B	0.14805	0.011	B	0.13407	0.009	T	0.48305	-0.9047	9	0.02654	T	1	-0.7011	4.0507	0.09793	0.4516:0.3457:0.0:0.2027	.	294	Q8N8C0	ZN781_HUMAN	F	294	ENSP00000351391:L294F	ENSP00000351391:L294F	L	-	3	2	2	ZNF781	42852008	42852008	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.780000	0.01775	-1.890000	0.01111	-1.760000	0.00671	TTG	0.089830		TCGA-IB-AAUM-01A-11D-A377-08	0.383	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	0	0	1	2	2	2	2	0	0	0	0	145	145	145	143	1	2.040000	-20.000000	1	0.080000	NM_152605		0	25	25	0	422	419	0		1	0	0	0	0	145	0	0	1.000000	0	0	0	1	1	0	25	422
IZUMO1	284359	broad.mit.edu	37	19	49248495	49248495	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr19:49248495G>A	ENST00000332955.2	-	3	833	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C		NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	96					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		TCTGTGATGCGTTTCAGATCC	0.507																																						ENST00000332955.2	1.000000	0.650000	1.000000	0.880000	0.990000	0.956904	0.990000	1.000000																										0				17						c.(286-288)Cgc>Tgc		izumo sperm-egg fusion 1							162.0	130.0	141.0					19																	49248495		2203	4300	6503	SO:0001583	missense	284359	0	0					g.chr19:49248495G>A	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.286C>T	chr19.hg19:g.49248495G>A	ENSP00000327786:p.Arg96Cys	0						p.R96C	NM_182575.2	NP_872381.2	1	2	3	2.016145	Q8IYV9	IZUM1_HUMAN		3	833	-		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	ENST00000332955.2	1	1	hg19	c.286C>T	CCDS12732.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951427	0.73787	.	.	ENSG00000182264	ENST00000332955	T	0.25749	1.78	5.1	2.88	0.33553	5.100000	2.880000	0.335530	.	0.237333	0.30101	N	0.010409	T	0.42720	0.1215	L	0.59436	1.845	0.39381	D	0.966252	D	0.89917	1.0	D	0.97110	1.0	T	0.33727	-0.9857	10	0.87932	D	0	-9.5316	8.5236	0.33291	0.0:0.1681:0.6575:0.1744	.	96	Q8IYV9	IZUM1_HUMAN	C	96	ENSP00000327786:R96C	ENSP00000327786:R96C	R	-	1	0	0	IZUMO1	53940307	53940307	0.994000	0.37717	0.996000	0.52242	0.994000	0.84299	2.965000	0.49200	0.624000	0.30286	0.491000	0.48974	CGC	0.091627		TCGA-IB-AAUM-01A-11D-A377-08	0.507	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	50	1	2.040000	-3.221883	1	0.080000	NM_182575		0	13	13	0	284	284	0		1	0		0	0	51	0	0	0.999564	6.774520e-03	0	0	0	3	0	13	284
ZNF544	27300	broad.mit.edu	37	19	58773981	58773981	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr19:58773981C>G	ENST00000596652.1	+	6	2243	c.2009C>G	c.(2008-2010)tCa>tGa	p.S670*	ZNF544_ENST00000269829.4_Nonsense_Mutation_p.S670*|ZNF544_ENST00000600044.1_Nonsense_Mutation_p.S642*|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000599953.1_Nonsense_Mutation_p.S528*|ZNF544_ENST00000596825.1_3'UTR|CTD-3138B18.5_ENST00000597230.1_RNA|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600220.1_Nonsense_Mutation_p.S642*|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000415203.2_Nonsense_Mutation_p.S642*			Q6NX49	ZN544_HUMAN	zinc finger protein 544	670					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AAAGCCTTTTCAGGGAGCTCT	0.453																																						ENST00000596652.1	1.000000	0.190000	1.000000	0.280000	0.410000	0.513031	0.410000	0.350000																										0				18						c.(2008-2010)tCa>tGa		zinc finger protein 544							113.0	116.0	115.0					19																	58773981		2203	4300	6503	SO:0001587	stop_gained	27300	0	0					g.chr19:58773981C>G	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.2009C>G	chr19.hg19:g.58773981C>G	ENSP00000469635:p.Ser670*	0					ZNF544_ENST00000600220.1_Nonsense_Mutation_p.S642*|ZNF544_ENST00000596929.1_Intron|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000600044.1_Nonsense_Mutation_p.S642*|ZNF544_ENST00000269829.4_Nonsense_Mutation_p.S670*|ZNF544_ENST00000415203.2_Nonsense_Mutation_p.S642*|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000599953.1_Nonsense_Mutation_p.S528*|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000595981.1_Intron	p.S670*			1	2	3	2.012541	Q6NX49	ZN544_HUMAN		6	2243	+		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)	A8K6J1|Q9UEX4	Nonsense_Mutation	SNP	ENST00000596652.1	0	1	hg19	c.2009C>G	CCDS12973.1	0	.	.	.	.	.	.	.	.	.	.	C	37	6.545208	0.97654	.	.	ENSG00000198131	ENST00000269829;ENST00000415203;ENST00000441758	.	.	.	2.94	-1.63	0.08345	2.940000	-1.630000	0.083450	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	8.0565	0.30608	0.1591:0.4408:0.4:0.0	.	.	.	.	X	670;642;222	.	ENSP00000269829:S670X	S	+	2	0	0	ZNF544	63465793	63465793	0.000000	0.05858	0.000000	0.03702	0.392000	0.30506	-2.916000	0.00696	-0.330000	0.08514	0.563000	0.77884	TCA	0.090909		TCGA-IB-AAUM-01A-11D-A377-08	0.453	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	0	0	1	2	2	2	2	0	0	0	0	237	237	237	237	1	2.040000	-3.078061	1	0.080000	NM_014480		0	10	9	0	692	686	0		1	1		0	0	237	0	0	0.996745	4.828061e-02	0	2	0	20	0	10	692
AMPD1	270	broad.mit.edu	37	1	115217379	115217379	+	Missense_Mutation	SNP	T	T	A	rs200717164		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr1:115217379T>A	ENST00000520113.2	-	13	1908	c.1893A>T	c.(1891-1893)ttA>ttT	p.L631F	AMPD1_ENST00000369538.3_Missense_Mutation_p.L627F|AMPD1_ENST00000353928.6_Missense_Mutation_p.L598F			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	631					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.L598F(2)|p.L631F(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TCACCTTTTTTAAATTTAGGC	0.418																																						ENST00000520113.2	1.000000	0.400000	1.000000	0.560000	0.770000	0.776424	0.770000	1.000000																										3	Substitution - Missense(3)	p.L598F(2)|p.L631F(1)	endometrium(2)|pancreas(1)	45						c.(1891-1893)ttA>ttT		adenosine monophosphate deaminase 1	Adenosine monophosphate(DB00131)	T	PHE/LEU,PHE/LEU	1,4405	2.1+/-5.4	0,1,2202	85.0	85.0	85.0		1893,1881	3.7	1.0	1		85	0,8600		0,0,4300	yes	missense,missense	AMPD1	NM_000036.2,NM_001172626.1	22,22	0,1,6502	AA,AT,TT		0.0,0.0227,0.0077	probably-damaging,probably-damaging	631/781,627/777	115217379	1,13005	2203	4300	6503	SO:0001583	missense	270	19	121412	46				g.chr1:115217379T>A	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1893A>T	chr1.hg19:g.115217379T>A	ENSP00000430075:p.Leu631Phe	0					AMPD1_ENST00000353928.6_Missense_Mutation_p.L598F|AMPD1_ENST00000369538.3_Missense_Mutation_p.L627F	p.L631F			0	1	1	1.983845	P23109	AMPD1_HUMAN		13	1908	-	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	1	1	hg19	c.1893A>T	CCDS876.2	0	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552218	0.65311	2.27E-4	0.0	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.88046	-2.33;-2.33;-2.33	5.99	3.68	0.42216	5.990000	3.680000	0.422160	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.92964	0.7761	H	0.95224	3.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92592	0.6084	10	0.87932	D	0	-11.4622	6.2611	0.20901	0.0:0.2024:0.1353:0.6624	.	627;598	Q5TF02;P23109	.;AMPD1_HUMAN	F	631;627;598	ENSP00000430075:L631F;ENSP00000358551:L627F;ENSP00000316520:L598F	ENSP00000316520:L598F	L	-	3	2	2	AMPD1	115018902	115018902	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	0.599000	0.24089	1.100000	0.41517	0.533000	0.62120	TTA	0.069579		TCGA-IB-AAUM-01A-11D-A377-08	0.418	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	2.040000	-10.785210	1	0.080000			0	10	10	0	310	310	0		1			0	0	69	0	0	0.997000	0	0	0	0	0	0	10	310
FLG	2312	broad.mit.edu	37	1	152282688	152282688	+	Silent	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr1:152282688C>T	ENST00000368799.1	-	3	4709	c.4674G>A	c.(4672-4674)ggG>ggA	p.G1558G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1558	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGTGACGTGACCCTGAGTGCC	0.592									Ichthyosis																													ENST00000368799.1	1.000000	0.940000	1.000000	0.990000	0.990000	0.996667	0.990000	1.000000																										0				424						c.(4672-4674)ggG>ggA		filaggrin							235.0	235.0	235.0					1																	152282688		2203	4300	6503	SO:0001819	synonymous_variant	2312	0	0		Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152282688C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4674G>A	chr1.hg19:g.152282688C>T		1					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.G1558G	NM_002016.1	NP_002007.1	1	3	4	2.186804	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	4709	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	1	1	hg19	c.4674G>A	CCDS30860.1	1																																																																																								0.148148		TCGA-IB-AAUM-01A-11D-A377-08	0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	1	0	1	2	2	2	2	0	0	0	0	365	365	365	364	1	2.040000	-6.047627	1	0.080000	NM_002016		0	60	58	0	1268	1241	0		1			0	0	365	0	0	1.000000	0	0	0	0	0	0	60	1268
LPHN2	23266	broad.mit.edu	37	1	82421570	82421570	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr1:82421570G>A	ENST00000370728.1	+	13	2476	c.1831G>A	c.(1831-1833)Gac>Aac	p.D611N	LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370723.1_Missense_Mutation_p.D598N|LPHN2_ENST00000370721.1_Missense_Mutation_p.D536N|LPHN2_ENST00000319517.6_Missense_Mutation_p.D598N|LPHN2_ENST00000370730.1_Missense_Mutation_p.D611N|LPHN2_ENST00000370715.1_Missense_Mutation_p.D598N|LPHN2_ENST00000271029.4_Missense_Mutation_p.D611N|LPHN2_ENST00000370713.1_Missense_Mutation_p.D598N|LPHN2_ENST00000359929.3_Missense_Mutation_p.D598N|LPHN2_ENST00000394879.1_Missense_Mutation_p.D598N|LPHN2_ENST00000370727.1_Missense_Mutation_p.D611N|LPHN2_ENST00000335786.5_Missense_Mutation_p.D611N|LPHN2_ENST00000370725.1_Missense_Mutation_p.D611N|LPHN2_ENST00000370717.2_Missense_Mutation_p.D611N			O95490	LPHN2_HUMAN	latrophilin 2	611					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GGCAATTGTTGACACAGTGGA	0.358																																						ENST00000370728.1	1.000000	0.880000	1.000000	0.990000	0.990000	0.993056	0.990000	1.000000																										0				119						c.(1831-1833)Gac>Aac		latrophilin 2							109.0	106.0	107.0					1																	82421570		2203	4300	6503	SO:0001583	missense	23266	0	0					g.chr1:82421570G>A	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1831G>A	chr1.hg19:g.82421570G>A	ENSP00000359763:p.Asp611Asn	0					LPHN2_ENST00000370717.2_Missense_Mutation_p.D611N|LPHN2_ENST00000359929.3_Missense_Mutation_p.D598N|LPHN2_ENST00000370721.1_Missense_Mutation_p.D536N|LPHN2_ENST00000335786.5_Missense_Mutation_p.D611N|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Missense_Mutation_p.D611N|LPHN2_ENST00000271029.4_Missense_Mutation_p.D611N|LPHN2_ENST00000394879.1_Missense_Mutation_p.D598N|LPHN2_ENST00000370723.1_Missense_Mutation_p.D598N|LPHN2_ENST00000370715.1_Missense_Mutation_p.D598N|LPHN2_ENST00000370713.1_Missense_Mutation_p.D598N|LPHN2_ENST00000370727.1_Missense_Mutation_p.D611N|LPHN2_ENST00000319517.6_Missense_Mutation_p.D598N|LPHN2_ENST00000370730.1_Missense_Mutation_p.D611N	p.D611N			0	1	1	1.974596	O95490	LPHN2_HUMAN		13	2476	+			A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	1	1	hg19	c.1831G>A		1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761933	0.69763	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.08984	3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03;3.03	5.62	5.62	0.85841	5.620000	5.620000	0.858410	.	0.000000	0.85682	D	0.000000	T	0.18173	0.0436	L	0.60455	1.87	0.80722	D	1	P;D;D	0.71674	0.837;0.998;0.969	P;D;P	0.65987	0.535;0.94;0.709	T	0.00394	-1.1767	10	0.45353	T	0.12	.	19.6548	0.95832	0.0:0.0:1.0:0.0	.	598;598;598	O95490-3;O95490-4;O95490-2	.;.;.	N	536;611;611;611;611;598;598;598;598;598;611;598;611;611	ENSP00000359756:D536N;ENSP00000359763:D611N;ENSP00000359765:D611N;ENSP00000359762:D611N;ENSP00000359760:D611N;ENSP00000359758:D598N;ENSP00000353006:D598N;ENSP00000359750:D598N;ENSP00000359748:D598N;ENSP00000322270:D598N;ENSP00000359752:D611N;ENSP00000378344:D598N;ENSP00000271029:D611N;ENSP00000337306:D611N	ENSP00000271029:D611N	D	+	1	0	0	LPHN2	82194158	82194158	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.476000	0.97823	2.648000	0.89879	0.467000	0.42956	GAC	0.067315		TCGA-IB-AAUM-01A-11D-A377-08	0.358	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	1	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	2.040000	-3.222668	1	0.080000	NM_012302		0	20	20	0	321	315	0		1	0		0	0	105	0	0	0.999995	4.704669e-01	0	0	0	26	0	20	321
SNRPE	6635	broad.mit.edu	37	1	203831342	203831342	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr1:203831342T>A	ENST00000414487.2	+	2	118	c.73T>A	c.(73-75)Tta>Ata	p.L25I	SNRPE_ENST00000483099.1_3'UTR|SNRPE_ENST00000367208.1_5'Flank	NM_003094.2	NP_003085.1	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E	25					gene expression (GO:0010467)|hair cycle (GO:0042633)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	RNA binding (GO:0003723)			breast(1)|large_intestine(2)|lung(1)|skin(1)	5	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTTCAGATACTTACAAAATGT	0.403																																					Ovarian(83;324 1318 17952 32395 39614)	ENST00000414487.2	1.000000	0.620000	1.000000	0.830000	0.990000	0.940842	0.990000	1.000000																										0				5						c.(73-75)Tta>Ata		small nuclear ribonucleoprotein polypeptide E							140.0	128.0	132.0					1																	203831342		2203	4300	6503	SO:0001583	missense	6635	0	0					g.chr1:203831342T>A	M37716	CCDS30979.1	1q32	2011-10-11			ENSG00000182004	ENSG00000182004			11161	protein-coding gene	gene with protein product		128260				1835977, 2143747	Standard	NM_003094		Approved	Sm-E	uc001hai.3	P62304	OTTHUMG00000035985	ENST00000414487.2:c.73T>A	chr1.hg19:g.203831342T>A	ENSP00000400591:p.Leu25Ile	1					SNRPE_ENST00000483099.1_3'UTR|SNRPE_ENST00000367208.1_5'Flank	p.L25I	NM_003094.2	NP_003085.1	1	4	5	2.190197	P62304	RUXE_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)	2	118	+	all_cancers(21;0.103)		B2R5B9|P08578|Q15498|Q5BKT2	Missense_Mutation	SNP	ENST00000414487.2	1	1	hg19	c.73T>A	CCDS30979.1	1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501065	0.85176	.	.	ENSG00000182004	ENST00000414487	T	0.59772	0.24	5.25	1.23	0.21249	5.250000	1.230000	0.212490	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.64402	D	0.000001	T	0.68044	0.2958	.	.	.	0.80722	D	1	D	0.63880	0.993	D	0.64506	0.926	T	0.66917	-0.5802	9	0.87932	D	0	.	6.6436	0.22923	0.0:0.5457:0.0:0.4543	.	25	P62304	RUXE_HUMAN	I	25	ENSP00000400591:L25I	ENSP00000400591:L25I	L	+	1	2	2	SNRPE	202097965	202097965	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.606000	0.36826	0.394000	0.25230	0.402000	0.26972	TTA	0.162418		TCGA-IB-AAUM-01A-11D-A377-08	0.403	SNRPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087703.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	2.040000	-3.725384	1	0.080000	NM_003094		0	14	13	0	358	357	0		1	1		0	0	80	0	0	0.999758	9.946299e-01	0	22	0	201	0	14	358
JAM2	58494	broad.mit.edu	37	21	27066110	27066110	+	Missense_Mutation	SNP	G	G	T	rs375256412		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr21:27066110G>T	ENST00000480456.1	+	4	834	c.284G>T	c.(283-285)cGg>cTg	p.R95L	JAM2_ENST00000312957.5_Missense_Mutation_p.R95L|JAM2_ENST00000400532.1_Missense_Mutation_p.R95L|JAM2_ENST00000425221.2_Missense_Mutation_p.R59L	NM_001270407.1|NM_021219.3	NP_001257336.1|NP_067042.1	P57087	JAM2_HUMAN	junctional adhesion molecule 2	95	Ig-like V-type.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|urinary_tract(1)	19						TTCAATATCCGGATCAAAAAT	0.378																																						ENST00000480456.1	1.000000	0.460000	1.000000	0.660000	0.920000	0.863201	0.920000	1.000000																										0				19						c.(283-285)cGg>cTg		junctional adhesion molecule 2							133.0	130.0	131.0					21																	27066110		1880	4109	5989	SO:0001583	missense	58494	0	0					g.chr21:27066110G>T	AF255910	CCDS42911.1, CCDS58787.1, CCDS58788.1	21q21.2	2013-01-11			ENSG00000154721	ENSG00000154721		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	14686	protein-coding gene	gene with protein product		606870		C21orf43		10779521, 10945976	Standard	NM_021219		Approved	VE-JAM, JAM-B, JAMB, CD322	uc031rvc.1	P57087	OTTHUMG00000078441	ENST00000480456.1:c.284G>T	chr21.hg19:g.27066110G>T	ENSP00000420419:p.Arg95Leu	0					JAM2_ENST00000400532.1_Missense_Mutation_p.R95L|JAM2_ENST00000425221.2_Missense_Mutation_p.R59L|JAM2_ENST00000312957.5_Missense_Mutation_p.R95L	p.R95L	NM_001270407.1|NM_021219.3	NP_001257336.1|NP_067042.1	0	1	1	1.980546	P57087	JAM2_HUMAN		4	834	+			B2R6T9|B4DGT9|Q6UXG6|Q6YNC1	Missense_Mutation	SNP	ENST00000480456.1	1	1	hg19	c.284G>T	CCDS42911.1	1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802133	0.70682	.	.	ENSG00000154721	ENST00000480456;ENST00000400533;ENST00000400532;ENST00000400537;ENST00000312957;ENST00000425221	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.56	5.56	0.83823	5.560000	5.560000	0.838230	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.122923	0.52532	D	0.000074	T	0.69115	0.3075	L	0.47716	1.5	0.36013	D	0.838181	D;D;D;D;D	0.64830	0.983;0.994;0.994;0.992;0.987	P;D;D;P;P	0.65233	0.866;0.933;0.933;0.9;0.9	T	0.73078	-0.4096	10	0.44086	T	0.13	.	10.2808	0.43539	0.0869:0.0:0.9131:0.0	.	59;95;95;95;95	B4DGT9;A8MQ45;A8MXS1;A8MTB0;P57087	.;.;.;.;JAM2_HUMAN	L	95;95;95;95;95;59	ENSP00000420419:R95L;ENSP00000383376:R95L;ENSP00000318416:R95L;ENSP00000392611:R59L	ENSP00000318416:R95L	R	+	2	0	0	JAM2	25987981	25987981	0.978000	0.34361	1.000000	0.80357	0.870000	0.49936	4.018000	0.57174	2.890000	0.99128	0.655000	0.94253	CGG	0.068826		TCGA-IB-AAUM-01A-11D-A377-08	0.378	JAM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171347.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	2.040000	-2.725326	1	0.080000			0	9	9	0	230	228	0		1	0		0	0	66	0	0	0.994256	4.709052e-01	0	0	0	39	0	9	230
HMGXB4	10042	broad.mit.edu	37	22	35660888	35660888	+	Silent	SNP	G	G	A	rs148445726		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr22:35660888G>A	ENST00000216106.5	+	5	635	c.507G>A	c.(505-507)tcG>tcA	p.S169S	HMGXB4_ENST00000444518.2_Silent_p.S60S	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	169					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCCACAAATCGAAAAAAATGA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		18777	0.0		0.001	False		,,,				2504	0.0					ENST00000216106.5	1.000000	0.550000	1.000000	0.720000	0.920000	0.883516	0.920000	1.000000																										0				19						c.(505-507)tcG>tcA		HMG box domain containing 4		G		1,4405		0,1,2202	84.0	85.0	85.0		507	1.3	1.0	22	dbSNP_134	85	0,8600		0,0,4300	no	coding-synonymous	HMGXB4	NM_001003681.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		169/602	35660888	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10042	3	121412	37				g.chr22:35660888G>A	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.507G>A	chr22.hg19:g.35660888G>A		0					HMGXB4_ENST00000444518.2_Silent_p.S60S	p.S169S	NM_001003681.2	NP_001003681.1	0	1	1	1.992321	Q9UGU5	HMGX4_HUMAN		5	635	+			O75672|O75673|Q9UMT5	Silent	SNP	ENST00000216106.5	1	1	hg19	c.507G>A	CCDS33641.1	1																																																																																								0.071832		TCGA-IB-AAUM-01A-11D-A377-08	0.463	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	0	0	1	2	2	2	2	0	0	0	0	133	133	133	133	1	2.040000	-3.073026	1	0.080000	NM_005487		0	16	16	0	411	403	0		1	1		0	0	133	0	0	0.999926	1.197135e-01	0	2	0	13	0	16	411
ZAP70	7535	broad.mit.edu	37	2	98349783	98349783	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr2:98349783G>A	ENST00000264972.5	+	7	1029	c.814G>A	c.(814-816)Gcc>Acc	p.A272T	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000451498.2_5'Flank|ZAP70_ENST00000442208.1_Missense_Mutation_p.A146T	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	272	Interdomain B.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CACACTCCCAGCCCACCCATC	0.706																																						ENST00000264972.5	1.000000	0.920000	1.000000	0.990000	0.990000	0.994581	0.990000	1.000000																										0				29						c.(814-816)Gcc>Acc		zeta-chain (TCR) associated protein kinase 70kDa							18.0	18.0	18.0					2																	98349783		2202	4298	6500	SO:0001583	missense	7535	0	0					g.chr2:98349783G>A	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.814G>A	chr2.hg19:g.98349783G>A	ENSP00000264972:p.Ala272Thr	0					ZAP70_ENST00000451498.2_5'Flank|ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.A146T	p.A272T	NM_001079.3	NP_001070.2	1	2	3	2.005760	P43403	ZAP70_HUMAN		7	1029	+			A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	0	1	hg19	c.814G>A	CCDS33254.1	1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504992	0.26949	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	T;T	0.72615	-0.67;-0.67	5.36	4.47	0.54385	5.360000	4.470000	0.543850	.	0.582850	0.15303	N	0.269546	T	0.55130	0.1901	N	0.21448	0.665	0.34249	D	0.678521	B;B	0.13145	0.007;0.003	B;B	0.17433	0.018;0.002	T	0.58222	-0.7674	10	0.23891	T	0.37	.	10.2192	0.43188	0.0926:0.0:0.9074:0.0	.	146;272	P43403-3;P43403	.;ZAP70_HUMAN	T	272;146	ENSP00000264972:A272T;ENSP00000411141:A146T	ENSP00000264972:A272T	A	+	1	0	0	ZAP70	97716215	97716215	0.952000	0.32445	0.997000	0.53966	0.487000	0.33371	2.503000	0.45407	1.384000	0.46424	0.655000	0.94253	GCC	0.089109		TCGA-IB-AAUM-01A-11D-A377-08	0.706	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	2.040000	-13.692320	1	0.080000			0	9	9	0	113	110	0		1	0		0	0	19	0	0	0.994152	1.916094e-01	0	0	0	10	0	9	113
CNTN6	27255	broad.mit.edu	37	3	1415695	1415695	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr3:1415695G>A	ENST00000446702.2	+	16	2660	c.2033G>A	c.(2032-2034)gGc>gAc	p.G678D	CNTN6_ENST00000350110.2_Missense_Mutation_p.G678D|CNTN6_ENST00000539053.1_Missense_Mutation_p.G606D			Q9UQ52	CNTN6_HUMAN	contactin 6	678	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.G678D(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GTTGTTGCCGGCAACAGCATT	0.383																																						ENST00000446702.2	0.680000	0.120000	0.500000	0.210000	0.340000	0.366685	0.340000	0.310000																										1	Substitution - Missense(1)	p.G678D(1)	kidney(1)	90						c.(2032-2034)gGc>gAc		contactin 6							137.0	131.0	133.0					3																	1415695		2203	4300	6503	SO:0001583	missense	27255	1	121412	28				g.chr3:1415695G>A	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2033G>A	chr3.hg19:g.1415695G>A	ENSP00000407822:p.Gly678Asp	0					CNTN6_ENST00000350110.2_Missense_Mutation_p.G678D|CNTN6_ENST00000539053.1_Missense_Mutation_p.G606D	p.G678D			0	1	1	1.992217	Q9UQ52	CNTN6_HUMAN		16	2660	+		all_cancers(2;0.000164)|all_epithelial(2;0.107)	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	0	1	hg19	c.2033G>A	CCDS2557.1	0	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535149	0.45073	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.56776	0.44;0.44;0.44	4.84	3.89	0.44902	4.840000	3.890000	0.449020	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.107766	0.41823	D	0.000811	T	0.50017	0.1591	L	0.29908	0.895	0.19300	N	0.999973	D	0.54772	0.968	P	0.54629	0.757	T	0.36432	-0.9748	10	0.42905	T	0.14	.	10.0485	0.42201	0.0:0.1484:0.6981:0.1535	.	678	Q9UQ52	CNTN6_HUMAN	D	678;606;678	ENSP00000407822:G678D;ENSP00000442791:G606D;ENSP00000341882:G678D	ENSP00000341882:G678D	G	+	2	0	0	CNTN6	1390695	1390695	0.938000	0.31826	0.999000	0.59377	0.985000	0.73830	2.160000	0.42348	2.379000	0.81126	0.655000	0.94253	GGC	0.071832		TCGA-IB-AAUM-01A-11D-A377-08	0.383	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	0	0	1	2	15	2	2	0	0	0	1	94	94	94	94	1	2.040000	-2.718292	1	0.080000	NM_014461		0	5	5	0	385	377	0		0			0	0	94	0	0	0.017065	0	0	0	0	0	0	5	385
XIRP1	165904	broad.mit.edu	37	3	39227663	39227663	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr3:39227663C>T	ENST00000340369.3	-	2	3502	c.3274G>A	c.(3274-3276)Ggt>Agt	p.G1092S	XIRP1_ENST00000396251.1_Missense_Mutation_p.G1092S|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1092					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TTCCGAAGACCGTCCTGGATG	0.602																																						ENST00000340369.3	1.000000	0.570000	1.000000	0.760000	0.990000	0.911982	0.990000	1.000000																										0				71						c.(3274-3276)Ggt>Agt		xin actin-binding repeat containing 1							59.0	57.0	58.0					3																	39227663		2203	4299	6502	SO:0001583	missense	165904	1	121412	28				g.chr3:39227663C>T	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3274G>A	chr3.hg19:g.39227663C>T	ENSP00000343140:p.Gly1092Ser	0					XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.G1092S	p.G1092S	NM_194293.2	NP_919269.2	0	1	1	1.992217	Q702N8	XIRP1_HUMAN		2	3502	-			A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	1	1	hg19	c.3274G>A	CCDS2683.1	1	.	.	.	.	.	.	.	.	.	.	C	1.886	-0.456684	0.04540	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05580	3.42;3.74	4.72	0.745	0.18359	4.720000	0.745000	0.183590	.	7.244150	0.01698	U	0.027049	T	0.06050	0.0157	L	0.47716	1.5	0.09310	N	1	B;B	0.24882	0.113;0.062	B;B	0.13407	0.004;0.009	T	0.37709	-0.9694	10	0.09084	T	0.74	.	3.123	0.06397	0.1423:0.557:0.1381:0.1626	.	1092;1092	Q702N8;Q702N8-2	XIRP1_HUMAN;.	S	1092	ENSP00000379550:G1092S;ENSP00000343140:G1092S	ENSP00000343140:G1092S	G	-	1	0	0	XIRP1	39202667	39202667	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	0.016000	0.13377	0.030000	0.15379	0.650000	0.86243	GGT	0.071832		TCGA-IB-AAUM-01A-11D-A377-08	0.602	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	71	1	2.040000	-2.985372	1	0.080000	XM_093522		0	14	14	0	332	328	0		1			0	0	73	0	0	0.999749	0	0	0	0	0	0	14	332
CCDC80	151887	broad.mit.edu	37	3	112324383	112324383	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr3:112324383G>A	ENST00000206423.3	-	8	3687	c.2734C>T	c.(2734-2736)Cgc>Tgc	p.R912C	CCDC80_ENST00000439685.2_Missense_Mutation_p.R912C	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	912					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TCTGGGCAGCGCATCCCCAGT	0.473																																						ENST00000206423.3	0.900000	0.170000	0.680000	0.290000	0.450000	0.490193	0.450000	0.420000																										0				51						c.(2734-2736)Cgc>Tgc		coiled-coil domain containing 80							122.0	101.0	108.0					3																	112324383		2203	4300	6503	SO:0001583	missense	151887	1	121412	36				g.chr3:112324383G>A	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2734C>T	chr3.hg19:g.112324383G>A	ENSP00000206423:p.Arg912Cys	0					CCDC80_ENST00000439685.2_Missense_Mutation_p.R912C	p.R912C	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	0	1	1	1.987942	Q76M96	CCD80_HUMAN		8	3687	-			D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	0	1	hg19	c.2734C>T	CCDS2968.1	0	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003686	0.74932	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594;ENST00000479368	T;T;T	0.52754	0.65;0.65;0.81	5.83	4.87	0.63330	5.830000	4.870000	0.633300	.	0.099290	0.64402	D	0.000001	T	0.56978	0.2022	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.973	T	0.61038	-0.7143	10	0.87932	D	0	-11.0485	16.8142	0.85729	0.0:0.0:0.8076:0.1924	.	923;912	Q76M96-2;Q76M96	.;CCD80_HUMAN	C	912;912;513;190	ENSP00000206423:R912C;ENSP00000411814:R912C;ENSP00000418188:R190C	ENSP00000206423:R912C	R	-	1	0	0	CCDC80	113807073	113807073	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.439000	0.66556	2.753000	0.94483	0.585000	0.79938	CGC	0.070707		TCGA-IB-AAUM-01A-11D-A377-08	0.473	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	0	0	1	2	13	17	2	1	1	1	1	81	81	81	81	1	2.040000	-2.608490	1	0.080000	NM_199511		0	5	5	0	281	278	0		0	0		1	0	81	0	0	0.042690	5.793511e-02	0	0	0	414	0	5	281
RPP40	10799	broad.mit.edu	37	6	5004223	5004223	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr6:5004223C>G	ENST00000380051.2	-	1	58	c.14G>C	c.(13-15)cGc>cCc	p.R5P	RPP40_ENST00000464646.1_5'Flank|RPP40_ENST00000319533.5_Missense_Mutation_p.R5P	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	5					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				CCGAAGCCGGCGCAGCGTGGC	0.697											OREG0017160	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000380051.2	1.000000	0.940000	1.000000	0.990000	0.990000	0.996132	0.990000	1.000000																										0				14						c.(13-15)cGc>cCc		ribonuclease P/MRP 40kDa subunit							48.0	49.0	48.0					6																	5004223		2202	4300	6502	SO:0001583	missense	10799	0	0					g.chr6:5004223C>G	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.14G>C	chr6.hg19:g.5004223C>G	ENSP00000369391:p.Arg5Pro	0		OREG0017160	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	623	RPP40_ENST00000464646.1_5'Flank|RPP40_ENST00000319533.5_Missense_Mutation_p.R5P	p.R5P	NM_006638.2	NP_006629.2	0	1	1	1.979522	O75818	RPP40_HUMAN		1	58	-	Ovarian(93;0.11)	all_hematologic(90;0.0895)	Q5VX97|Q8WVK8	Missense_Mutation	SNP	ENST00000380051.2	1	1	hg19	c.14G>C	CCDS34333.1	1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984604	0.53934	.	.	ENSG00000124787	ENST00000380051;ENST00000319533	T;T	0.51071	0.81;0.72	4.53	4.53	0.55603	4.530000	4.530000	0.556030	.	0.509013	0.19657	N	0.109065	T	0.41026	0.1141	L	0.37630	1.12	0.80722	D	1	D;P	0.53885	0.963;0.938	P;B	0.52454	0.699;0.422	T	0.36016	-0.9765	10	0.52906	T	0.07	-11.2996	16.0024	0.80306	0.0:1.0:0.0:0.0	.	5;5	O75818-2;O75818	.;RPP40_HUMAN	P	5	ENSP00000369391:R5P;ENSP00000317998:R5P	ENSP00000317998:R5P	R	-	2	0	0	RPP40	4949222	4949222	0.846000	0.29590	0.089000	0.20774	0.009000	0.06853	1.435000	0.34969	2.338000	0.79540	0.557000	0.71058	CGC	0.068826		TCGA-IB-AAUM-01A-11D-A377-08	0.697	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	1	0	1	2	2	2	2	0	0	0	0	31	31	31	29	1	2.040000	-3.221823	1	0.080000	NM_006638		0	16	16	0	214	210	0		1	1		0	0	31	0	0	0.999934	1.397310e-01	0	3	0	6	0	16	214
PI16	221476	broad.mit.edu	37	6	36930968	36930968	+	Missense_Mutation	SNP	G	G	A	rs199875004		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr6:36930968G>A	ENST00000373674.3	+	5	1178	c.850G>A	c.(850-852)Gta>Ata	p.V284I	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	284					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)	p.V284I(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCCACCTTGCGTAACAACTGA	0.567																																						ENST00000373674.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999701	0.990000	1.000000																										2	Substitution - Missense(2)	p.V284I(2)	large_intestine(1)|kidney(1)	30						c.(850-852)Gta>Ata		peptidase inhibitor 16							86.0	71.0	76.0					6																	36930968		2203	4300	6503	SO:0001583	missense	221476	5	121412	46				g.chr6:36930968G>A		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.850G>A	chr6.hg19:g.36930968G>A	ENSP00000362778:p.Val284Ile	0					PI16_ENST00000491324.1_Intron	p.V284I	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	0	1	1	1.986508	Q6UXB8	PI16_HUMAN		5	1178	+			Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	1	1	hg19	c.850G>A	CCDS34440.1	1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235618	0.22626	.	.	ENSG00000164530	ENST00000373674;ENST00000539035	T	0.06933	3.24	5.8	-7.55	0.01327	5.800000	-7.550000	0.013270	.	1.505140	0.04117	N	0.315674	T	0.00875	0.0029	N	0.08118	0	0.09310	N	0.999999	B	0.30211	0.273	B	0.17722	0.019	T	0.41052	-0.9530	10	0.66056	D	0.02	.	1.6949	0.02859	0.1826:0.2985:0.3241:0.1948	.	284	Q6UXB8	PI16_HUMAN	I	284;136	ENSP00000362778:V284I	ENSP00000362778:V284I	V	+	1	0	0	PI16	37038946	37038946	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.569000	0.05902	-1.245000	0.02513	-0.127000	0.14921	GTA	0.070331		TCGA-IB-AAUM-01A-11D-A377-08	0.567	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1	1	0	1	2	2	2	2	0	0	0	0	85	85	85	83	1	2.040000	-3.318783	1	0.080000	NM_153370		0	24	24	0	286	285	0		1	0		0	0	85	0	0	1.000000	2.198886e-01	0	0	0	11	0	24	286
PDE1C	5137	broad.mit.edu	37	7	31793127	31793127	+	Silent	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr7:31793127G>A	ENST00000396191.1	-	18	2456	c.2001C>T	c.(1999-2001)taC>taT	p.Y667Y	PDE1C_ENST00000321453.7_Silent_p.Y667Y|PDE1C_ENST00000396193.1_Silent_p.Y727Y	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	667					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	AGCTAGATGCGTAAGCAGGGC	0.478																																						ENST00000396191.1	1.000000	0.140000	1.000000	0.240000	0.400000	0.489206	0.400000	0.320000																										0				81						c.(1999-2001)taC>taT		phosphodiesterase 1C, calmodulin-dependent 70kDa	Caffeine(DB00201)						158.0	152.0	154.0					7																	31793127		876	1991	2867	SO:0001819	synonymous_variant	5137	15	116166	44				g.chr7:31793127G>A	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.2001C>T	chr7.hg19:g.31793127G>A		0					PDE1C_ENST00000396193.1_Silent_p.Y727Y|PDE1C_ENST00000321453.7_Silent_p.Y667Y	p.Y667Y	NM_001191057.1	NP_001177986.1	1	2	3	2.002752	Q14123	PDE1C_HUMAN	GBM - Glioblastoma multiforme(11;0.216)	18	2456	-			B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	ENST00000396191.1	0	1	hg19	c.2001C>T	CCDS55099.1	0																																																																																								0.088387		TCGA-IB-AAUM-01A-11D-A377-08	0.478	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1	0	0	1	2	2	2	2	0	0	0	0	132	132	132	132	1	2.040000	-2.550590	1	0.080000			0	5	5	0	375	372	0		1			0	0	132	0	0	0.936628	0	0	0	0	0	0	5	375
TYW1	55253	broad.mit.edu	37	7	66479413	66479413	+	Silent	SNP	T	T	C			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr7:66479413T>C	ENST00000359626.5	+	5	599	c.435T>C	c.(433-435)acT>acC	p.T145T		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	145	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.T145T(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				GCCTACCAACTGAAAGTGCAG	0.428																																						ENST00000359626.5	1.000000	0.110000	1.000000	0.180000	0.290000	0.410555	0.290000	0.250000																										1	Substitution - coding silent(1)	p.T145T(1)	urinary_tract(1)	46						c.(433-435)acT>acC		tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)																																				SO:0001819	synonymous_variant	55253	80	121412	43				g.chr7:66479413T>C	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.435T>C	chr7.hg19:g.66479413T>C		0						p.T145T	NM_018264.2	NP_060734.2	1	2	3	2.004904	Q9NV66	TYW1_HUMAN		5	599	+		Lung NSC(55;0.0846)|all_lung(88;0.183)	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Silent	SNP	ENST00000359626.5	0	1	hg19	c.435T>C	CCDS5538.1	0																																																																																								0.089109		TCGA-IB-AAUM-01A-11D-A377-08	0.428	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	0	0	1	2	2	2	2	0	0	0	0	148	148	148	148	1	2.040000	-1.819237	0	0.080000	NM_018264		0	6	6	0	609	597	0		1	0		0	0	148	0	0	0.962914	2.134904e-02	0	0	0	19	0	6	609
AZGP1	563	broad.mit.edu	37	7	99565782	99565782	+	Silent	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr7:99565782C>T	ENST00000292401.4	-	3	745	c.609G>A	c.(607-609)cgG>cgA	p.R203R	AZGP1_ENST00000483612.1_5'Flank|AZGP1_ENST00000411734.1_Silent_p.R200R	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	203					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GAGTACCTTGCCGGTCCAGGA	0.532																																						ENST00000292401.4	1.000000	0.190000	1.000000	0.320000	0.530000	0.596286	0.530000	1.000000																										0				16						c.(607-609)cgG>cgA		alpha-2-glycoprotein 1, zinc-binding							76.0	75.0	75.0					7																	99565782		2203	4300	6503	SO:0001819	synonymous_variant	563	3	121412	35				g.chr7:99565782C>T	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.609G>A	chr7.hg19:g.99565782C>T		0					AZGP1_ENST00000411734.1_Silent_p.R200R|AZGP1_ENST00000483612.1_5'Flank	p.R203R	NM_001185.3	NP_001176.1	1	2	3	2.004904	P25311	ZA2G_HUMAN		3	745	-	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)		D6W5T8|O60386|Q5XKQ4|Q8N4N0	Silent	SNP	ENST00000292401.4	0	1	hg19	c.609G>A	CCDS5680.1	0																																																																																								0.089109		TCGA-IB-AAUM-01A-11D-A377-08	0.532	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059387.4	0	0	1	2	2	2	2	0	0	0	0	83	83	83	81	1	2.040000	-2.624971	1	0.080000	NM_001185		0	5	5	0	279	278	0		1	0		0	0	83	0	0	0.937504	9.996924e-01	0	1	0	1173	0	5	279
KEL	3792	broad.mit.edu	37	7	142641797	142641797	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr7:142641797G>A	ENST00000355265.2	-	12	1820	c.1346C>T	c.(1345-1347)gCc>gTc	p.A449V	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	449					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AGTGATGAGGGCATCCCGGAT	0.617																																						ENST00000355265.2	1.000000	0.200000	1.000000	0.360000	0.640000	0.668295	0.640000	1.000000																										0				60						c.(1345-1347)gCc>gTc		Kell blood group, metallo-endopeptidase							80.0	69.0	73.0					7																	142641797		2203	4300	6503	SO:0001583	missense	3792	0	0					g.chr7:142641797G>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1346C>T	chr7.hg19:g.142641797G>A	ENSP00000347409:p.Ala449Val	0					KEL_ENST00000479768.2_5'Flank	p.A449V	NM_000420.2	NP_000411.1	1	2	3	2.014320	P23276	KELL_HUMAN		12	1820	-	Melanoma(164;0.059)		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	0	1	hg19	c.1346C>T	CCDS34766.1	0	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648408	0.29336	.	.	ENSG00000197993	ENST00000355265	T	0.78924	-1.22	4.87	3.99	0.46301	4.870000	3.990000	0.463010	Peptidase M13 (1);	0.518330	0.17628	N	0.167488	T	0.75162	0.3812	M	0.76328	2.33	0.29659	N	0.843357	P	0.38617	0.64	B	0.38616	0.277	T	0.71137	-0.4680	10	0.34782	T	0.22	-7.2386	8.9486	0.35773	0.1008:0.0:0.8992:0.0	.	449	P23276	KELL_HUMAN	V	449	ENSP00000347409:A449V	ENSP00000347409:A449V	A	-	2	0	0	KEL	142351919	142351919	0.721000	0.28007	0.700000	0.30305	0.042000	0.13812	3.694000	0.54742	1.297000	0.44761	-0.373000	0.07131	GCC	0.091268		TCGA-IB-AAUM-01A-11D-A377-08	0.617	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	2.040000	-3.218095	1	0.080000	NM_000420		0	4	4	0	196	190	0		1			0	0	45	0	0	0.883926	0	0	0	0	0	0	4	196
RB1CC1	9821	broad.mit.edu	37	8	53555118	53555118	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr8:53555118C>T	ENST00000025008.5	-	18	4653	c.4130G>A	c.(4129-4131)cGt>cAt	p.R1377H	RB1CC1_ENST00000539297.1_Missense_Mutation_p.R1377H|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Missense_Mutation_p.R1377H	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1377					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CTCAAGCAAACGAGCTCGATC	0.358																																					GBM(180;1701 2102 13475 42023 52570)	ENST00000025008.5	1.000000	0.680000	1.000000	0.900000	0.990000	0.962232	0.990000	1.000000																										0				60						c.(4129-4131)cGt>cAt		RB1-inducible coiled-coil 1							80.0	76.0	77.0					8																	53555118		2203	4300	6503	SO:0001583	missense	9821	6	121404	37				g.chr8:53555118C>T	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4130G>A	chr8.hg19:g.53555118C>T	ENSP00000025008:p.Arg1377His	0					RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Missense_Mutation_p.R1377H|RB1CC1_ENST00000435644.2_Missense_Mutation_p.R1377H	p.R1377H	NM_014781.4	NP_055596.3	1	2	3	1.999017	Q8TDY2	RBCC1_HUMAN		18	4653	-		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	1	1	hg19	c.4130G>A	CCDS34892.1	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831119	0.91036	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.15487	2.42;2.42;2.42	5.61	5.61	0.85477	5.610000	5.610000	0.854770	.	0.053357	0.85682	D	0.000000	T	0.30823	0.0777	L	0.32530	0.975	0.44104	D	0.996878	D;D	0.76494	0.999;0.998	P;P	0.61592	0.891;0.781	T	0.01460	-1.1349	10	0.72032	D	0.01	-13.615	18.6201	0.91318	0.0:1.0:0.0:0.0	.	1377;1377	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	H	1377	ENSP00000025008:R1377H;ENSP00000396067:R1377H;ENSP00000445960:R1377H	ENSP00000025008:R1377H	R	-	2	0	0	RB1CC1	53717671	53717671	0.998000	0.40836	0.994000	0.49952	0.998000	0.95712	3.761000	0.55242	2.632000	0.89209	0.655000	0.94253	CGT	0.087664		TCGA-IB-AAUM-01A-11D-A377-08	0.358	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	1	0	1	2	2	2	2	0	0	0	0	121	121	121	119	1	2.040000	-16.928200	1	0.080000	NM_014781		0	16	16	0	344	341	0		1	1		0	0	121	0	0	0.999933	5.132124e-01	0	2	0	35	0	16	344
KCNB2	9312	broad.mit.edu	37	8	73480147	73480147	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr8:73480147C>T	ENST00000523207.1	+	2	766	c.178C>T	c.(178-180)Cgc>Tgc	p.R60C		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	60					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GCCCAGGACGCGCCTGGGGAA	0.542																																						ENST00000523207.1	1.000000	0.870000	1.000000	0.990000	0.990000	0.992103	0.990000	1.000000																										0				85						c.(178-180)Cgc>Tgc		potassium voltage-gated channel, Shab-related subfamily, member 2	Dalfampridine(DB06637)						66.0	68.0	67.0					8																	73480147		2203	4300	6503	SO:0001583	missense	9312	0	0					g.chr8:73480147C>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.178C>T	chr8.hg19:g.73480147C>T	ENSP00000430846:p.Arg60Cys	0						p.R60C	NM_004770.2	NP_004761.2	1	2	3	1.999017	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)	2	766	+	Breast(64;0.137)		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	1	1	hg19	c.178C>T	CCDS6209.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048690	0.75846	.	.	ENSG00000182674	ENST00000523207	T	0.78481	-1.18	5.71	4.84	0.62591	5.710000	4.840000	0.625910	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.	.	.	.	D	0.90703	0.7083	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91904	0.5534	9	0.87932	D	0	.	9.6813	0.40072	0.1398:0.7897:0.0:0.0705	.	60	Q92953	KCNB2_HUMAN	C	60	ENSP00000430846:R60C	ENSP00000430846:R60C	R	+	1	0	0	KCNB2	73642701	73642701	0.996000	0.38824	0.635000	0.29338	0.985000	0.73830	3.471000	0.53107	1.432000	0.47375	0.655000	0.94253	CGC	0.087664		TCGA-IB-AAUM-01A-11D-A377-08	0.542	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	1	0	1	2	2	2	2	0	0	0	0	104	104	104	104	1	2.040000	-3.077950	1	0.080000	NM_004770		0	21	21	0	376	369	0		1			0	0	104	0	0	0.999997	0	0	0	0	0	0	21	376
ZFAT	57623	broad.mit.edu	37	8	135614834	135614834	+	Silent	SNP	C	C	T			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr8:135614834C>T	ENST00000377838.3	-	6	1302	c.1128G>A	c.(1126-1128)gcG>gcA	p.A376A	ZFAT_ENST00000520727.1_Silent_p.A364A|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000520356.1_Silent_p.A364A|ZFAT_ENST00000429442.2_Silent_p.A364A|ZFAT_ENST00000523399.1_Silent_p.A314A|ZFAT_ENST00000520214.1_Silent_p.A364A	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	376					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GTGGGTCATGCGCGTCTCGGA	0.552																																						ENST00000377838.3	1.000000	0.130000	0.930000	0.230000	0.380000	0.475467	0.380000	0.320000																										0				54						c.(1126-1128)gcG>gcA		zinc finger and AT hook domain containing							74.0	75.0	74.0					8																	135614834		2114	4240	6354	SO:0001819	synonymous_variant	57623	2	121082	34				g.chr8:135614834C>T	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1128G>A	chr8.hg19:g.135614834C>T		0					ZFAT_ENST00000520214.1_Silent_p.A364A|ZFAT_ENST00000429442.2_Silent_p.A364A|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000523399.1_Silent_p.A314A|ZFAT_ENST00000520356.1_Silent_p.A364A|ZFAT_ENST00000520727.1_Silent_p.A364A	p.A376A	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	1	2	3	1.999017	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)	6	1302	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Silent	SNP	ENST00000377838.3	0	1	hg19	c.1128G>A	CCDS47924.1	0																																																																																								0.087664		TCGA-IB-AAUM-01A-11D-A377-08	0.552	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	0	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	2.040000	-2.073560	0	0.080000	NM_001029939		0	5	6	0	383	380	0		1	0		0	0	89	0	0	0.937076	2.643777e-03	0	0	0	5	0	5	383
MPDZ	8777	broad.mit.edu	37	9	13140072	13140072	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr9:13140072G>A	ENST00000319217.7	-	28	4164	c.3917C>T	c.(3916-3918)gCc>gTc	p.A1306V	MPDZ_ENST00000447879.1_Missense_Mutation_p.A1273V|MPDZ_ENST00000536827.1_Missense_Mutation_p.A1273V|MPDZ_ENST00000541718.1_Missense_Mutation_p.A1306V|MPDZ_ENST00000540202.1_5'UTR|MPDZ_ENST00000538841.1_Missense_Mutation_p.A165V|MPDZ_ENST00000381022.2_Missense_Mutation_p.A1306V|MPDZ_ENST00000381015.4_Missense_Mutation_p.A1306V|MPDZ_ENST00000546205.1_Missense_Mutation_p.A1320V	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1306					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		ACCCATTTCGGCAAAGGCTGA	0.493																																						ENST00000319217.7	0.490000	0.100000	0.380000	0.170000	0.250000	0.278327	0.250000	0.240000																										0				61						c.(3916-3918)gCc>gTc		multiple PDZ domain protein							154.0	161.0	158.0					9																	13140072		1964	4154	6118	SO:0001583	missense	8777	0	0					g.chr9:13140072G>A	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3917C>T	chr9.hg19:g.13140072G>A	ENSP00000320006:p.Ala1306Val	0					MPDZ_ENST00000540202.1_5'UTR|MPDZ_ENST00000536827.1_Missense_Mutation_p.A1273V|MPDZ_ENST00000546205.1_Missense_Mutation_p.A1320V|MPDZ_ENST00000447879.1_Missense_Mutation_p.A1273V|MPDZ_ENST00000381022.2_Missense_Mutation_p.A1306V|MPDZ_ENST00000381015.4_Missense_Mutation_p.A1306V|MPDZ_ENST00000538841.1_Missense_Mutation_p.A165V|MPDZ_ENST00000541718.1_Missense_Mutation_p.A1306V	p.A1306V	NM_001261406.1	NP_001248335.1	0	1	1	1.992647	O75970	MPDZ_HUMAN		28	4164	-			A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	0	1	hg19	c.3917C>T		0	.	.	.	.	.	.	.	.	.	.	G	10.05	1.244722	0.22796	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359	T;T;T;T;T;T;T;T;T;T	0.45276	2.88;2.83;2.83;2.71;2.73;2.74;2.78;2.88;2.88;0.9	5.9	3.99	0.46301	5.900000	3.990000	0.463010	.	0.701509	0.12341	N	0.477536	T	0.33614	0.0869	L	0.29908	0.895	0.25514	N	0.987437	B;B;B;B;B	0.28055	0.126;0.019;0.199;0.126;0.199	B;B;B;B;B	0.33620	0.055;0.028;0.167;0.08;0.117	T	0.27806	-1.0063	10	0.28530	T	0.3	.	10.1093	0.42552	0.0648:0.0:0.6902:0.245	.	1273;165;1273;1186;1306	B7ZMI4;B7ZB24;O75970-3;E7EPZ1;O75970-2	.;.;.;.;.	V	1306;1306;1306;242;165;1273;1273;1306;1186;1320;128	ENSP00000320006:A1306V;ENSP00000439807:A1306V;ENSP00000370410:A1306V;ENSP00000444230:A242V;ENSP00000444717:A165V;ENSP00000444151:A1273V;ENSP00000415208:A1273V;ENSP00000370403:A1306V;ENSP00000446358:A1320V;ENSP00000389705:A128V	ENSP00000320006:A1306V	A	-	2	0	0	MPDZ	13130072	13130072	0.994000	0.37717	0.239000	0.24122	0.708000	0.40852	1.599000	0.36751	0.765000	0.33221	0.552000	0.68991	GCC	0.071832		TCGA-IB-AAUM-01A-11D-A377-08	0.493	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	0	0	1	2	2	2	2	0	0	0	0	133	133	133	130	1	2.040000	-1.966308	0	0.080000	NM_003829		0	6	6	0	602	594	0		1	0		0	0	133	0	0	0.963649	8.995884e-03	0	0	0	12	0	6	602
DOLK	22845	broad.mit.edu	37	9	131708515	131708515	+	Silent	SNP	C	C	T	rs371490482		TCGA-IB-AAUM-01A-11D-A377-08	TCGA-IB-AAUM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b61630e4-5b3e-455b-b6df-ca8b76a678cd	3323a86b-52b7-46b7-aa03-cdfd4a3bb710	g.chr9:131708515C>T	ENST00000372586.3	-	1	1383	c.1068G>A	c.(1066-1068)cgG>cgA	p.R356R	NUP188_ENST00000372577.2_5'Flank|RP11-101E3.5_ENST00000482796.1_Intron	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	356					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						AGAGCAGTGGCCGGTCAAAGA	0.547																																						ENST00000372586.3	0.500000	0.130000	0.390000	0.190000	0.280000	0.300092	0.280000	0.270000																										0				11						c.(1066-1068)cgG>cgA		dolichol kinase		C		1,4405	2.1+/-5.4	0,1,2202	107.0	121.0	116.0		1068	-0.6	0.9	9		116	0,8600		0,0,4300	no	coding-synonymous	DOLK	NM_014908.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		356/539	131708515	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22845	1	121412	30				g.chr9:131708515C>T	AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1068G>A	chr9.hg19:g.131708515C>T		0					NUP188_ENST00000372577.2_5'Flank|RP11-101E3.5_ENST00000482796.1_Intron	p.R356R	NM_014908.3	NP_055723.1	0	1	1	1.992647	Q9UPQ8	DOLK_HUMAN		1	1383	-			Q5SRE6	Silent	SNP	ENST00000372586.3	0	1	hg19	c.1068G>A	CCDS6915.1	0																																																																																								0.071832		TCGA-IB-AAUM-01A-11D-A377-08	0.547	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	0	0	1	2	2	2	2	0	0	0	0	126	126	126	118	1	2.040000	-2.239572	0	0.080000	NM_014908		0	8	7	0	720	709	0		1	0		0	0	126	0	0	0.988665	6.586118e-02	0	0	0	33	0	8	720
