#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
NFKBIZ	64332	broad.mit.edu	37	3	101575980	101575980	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr3:101575980delC	ENST00000326172.5	+	10	2003	c.1888delC	c.(1888-1890)cgcfs	p.R630fs	NFKBIZ_ENST00000394054.2_Frame_Shift_Del_p.R530fs|NFKBIZ_ENST00000326151.5_Frame_Shift_Del_p.R508fs	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	630	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						GGAACTCATTCGCCTCTTTTT	0.463																																						ENST00000326172.5	0.550000	0.320000	0.490000	0.370000	0.420000	0.437665	0.420000	0.430000																										0				24						c.(1888-1890)cgcfs		nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta							118.0	134.0	128.0					3																	101575980		2203	4300	6503	SO:0001589	frameshift_variant	64332	0	0					g.chr3:101575980delC	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1888delC	chr3.hg19:g.101575980delC	ENSP00000325663:p.Arg630fs	1					NFKBIZ_ENST00000394054.2_Frame_Shift_Del_p.R530fs|NFKBIZ_ENST00000326151.5_Frame_Shift_Del_p.R508fs	p.R630fs	NM_031419.3	NP_113607.1	0	1	1	1.716026	Q9BYH8	IKBZ_HUMAN		10	2003	+			B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Frame_Shift_Del	DEL	ENST00000326172.5	1	1	hg19	c.1888delC	CCDS2946.1	0																																																																																								0.234568		TCGA-IB-AAUO-01A-12D-A38G-08	0.463	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	1	0	1		10	2		0	0	0	1	202	0	202	208	1	1.860000	-15.511920	1	0.380000	NM_031419		0	48	58	0	424	431	0	0	1	1	0	0	0	202	0	0	1.000000	9.999883e-01	0	45	0	103	0	48	424
PKD2L1	9033	broad.mit.edu	37	10	102057186	102057186	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr10:102057186G>A	ENST00000318222.3	-	5	1291	c.909C>T	c.(907-909)atC>atT	p.I303I	PKD2L1_ENST00000338519.3_Intron|PKD2L1_ENST00000353274.3_Silent_p.I303I	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	303					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CTGAGAAGTCGATGAACACCA	0.567																																						ENST00000318222.3	0.820000	0.440000	0.720000	0.520000	0.610000	0.624935	0.610000	0.620000																										0				43						c.(907-909)atC>atT		polycystic kidney disease 2-like 1							85.0	86.0	85.0					10																	102057186		2203	4300	6503	SO:0001819	synonymous_variant	9033	1	121412	35				g.chr10:102057186G>A	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.909C>T	chr10.hg19:g.102057186G>A		0					PKD2L1_ENST00000353274.3_Silent_p.I303I|PKD2L1_ENST00000338519.3_Intron	p.I303I	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	1	2	3	2.064821	Q9P0L9	PK2L1_HUMAN		5	1291	-		Colorectal(252;0.117)	O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	ENST00000318222.3	1	1	hg19	c.909C>T	CCDS7492.1	0																																																																																								0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.567	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	0	0	1	2	11	2	2	1	1	1	1	118	118	118	118	1	1.860000	-15.167500	1	0.380000	NM_016112		0	37	37	0	280	275	1		1			1	0	118	0	0	0.999979	0	0	0	0	0	0	37	280
DIP2C	22982	broad.mit.edu	37	10	410376	410376	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr10:410376G>A	ENST00000280886.6	-	20	2502	c.2415C>T	c.(2413-2415)aaC>aaT	p.N805N	DIP2C_ENST00000381496.3_3'UTR|DIP2C_ENST00000540204.1_Silent_p.N126N	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	805						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGTCGTCGGCGTTGTGCCTGC	0.602																																						ENST00000280886.6	1.000000	0.740000	1.000000	0.830000	0.940000	0.929680	0.940000	1.000000																										0				81						c.(2413-2415)aaC>aaT		DIP2 disco-interacting protein 2 homolog C (Drosophila)							78.0	76.0	76.0					10																	410376		2203	4300	6503	SO:0001819	synonymous_variant	22982	18	121412	44				g.chr10:410376G>A	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.2415C>T	chr10.hg19:g.410376G>A		0					DIP2C_ENST00000381496.3_3'UTR|DIP2C_ENST00000540204.1_Silent_p.N126N	p.N805N	NM_014974.2	NP_055789.1	0	1	1	2.049863	Q9Y2E4	DIP2C_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.136)	20	2502	-		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	B4DPI5|Q5SS78	Silent	SNP	ENST00000280886.6	1	1	hg19	c.2415C>T	CCDS7054.1	1																																																																																								0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.602	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	1	0	1	2	11	2	2	1	1	1	1	120	120	120	119	1	1.860000	-20.000000	1	0.380000	NM_014974		0	59	59	0	267	262	1		1	0		1	0	120	0	0	1.000000	2.289787e-01	0	0	0	5	0	59	267
KIAA1217	56243	broad.mit.edu	37	10	24831899	24831899	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr10:24831899G>T	ENST00000376454.3	+	19	3730	c.3700G>T	c.(3700-3702)Gaa>Taa	p.E1234*	KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376451.2_Nonsense_Mutation_p.E917*|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376462.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1234					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AAGAACATCAGAATATAAAAC	0.413																																						ENST00000376454.3	0.990000	0.650000	0.950000	0.750000	0.850000	0.855220	0.850000	0.890000																										0				70						c.(3700-3702)Gaa>Taa		KIAA1217							41.0	41.0	41.0					10																	24831899		2203	4300	6503	SO:0001587	stop_gained	56243	0	0					g.chr10:24831899G>T	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.3700G>T	chr10.hg19:g.24831899G>T	ENSP00000365637:p.Glu1234*	1					KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376451.2_Nonsense_Mutation_p.E917*|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376452.3_Intron	p.E1234*	NM_019590.3	NP_062536.2	0	1	1	1.666965	Q5T5P2	SKT_HUMAN		19	3730	+			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Nonsense_Mutation	SNP	ENST00000376454.3	0	1	hg19	c.3700G>T	CCDS31165.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.260198	0.99117	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	.	.	.	5.42	4.5	0.54988	5.42	4.5	0.54988	.	0.360938	0.28062	N	0.016754	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	15.1525	0.72713	0.0:0.1417:0.8583:0.0	.	.	.	.	X	917;1234;917;917	.	ENSP00000365634:E917X	E	+	1	0	0	KIAA1217	24871905	24871905	0.993000	0.37304	0.790000	0.31976	0.868000	0.49771	2.681000	0.46926	1.264000	0.44198	0.561000	0.74099	GAA	0.234568		TCGA-IB-AAUO-01A-12D-A38G-08	0.413	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	1	0	1	2	2	2	2	0	0	0	0	105	105	105	106	1	1.860000	-20.000000	1	0.380000	NM_019590		0	41	41	0	153	150	1		1	1		0	0	105	0	0	1.000000	7.549167e-01	0	4	0	8	0	41	153
ALOX5	240	broad.mit.edu	37	10	45878098	45878098	+	Silent	SNP	C	C	T	rs150281723	byFrequency	TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr10:45878098C>T	ENST00000374391.2	+	2	371	c.318C>T	c.(316-318)ggC>ggT	p.G106G	ALOX5_ENST00000542434.1_Silent_p.G106G	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	106	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)	p.G106G(1)		breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GGATCACCGGCGATGTCGAGG	0.592													C|||	12	0.00239617	0.0	0.0	5008	,	,		20608	0.0109		0.0	False		,,,				2504	0.001					ENST00000374391.2	1.000000	0.430000	0.910000	0.560000	0.720000	0.738615	0.720000	1.000000																										1	Substitution - coding silent(1)	p.G106G(1)	large_intestine(1)	37						c.(316-318)ggC>ggT		arachidonate 5-lipoxygenase	Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	C		0,4406		0,0,2203	61.0	50.0	54.0		318	-7.7	0.1	10	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous	ALOX5	NM_000698.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		106/675	45878098	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	240	109	121412	48				g.chr10:45878098C>T	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.318C>T	chr10.hg19:g.45878098C>T		0					ALOX5_ENST00000542434.1_Silent_p.G106G	p.G106G	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	0	1	1	2.051288	P09917	LOX5_HUMAN		2	371	+		Lung SC(717;0.0257)	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Silent	SNP	ENST00000374391.2	1	1	hg19	c.318C>T	CCDS7212.1	0																																																																																								0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.592	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.860000	-4.328109	1	0.380000			0	15	13	0	94	92	1		1	1		0	0	53	0	0	0.999883	1	0	119	0	191	0	15	94
C10orf82	143379	broad.mit.edu	37	10	118425205	118425205	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr10:118425205G>C	ENST00000369210.3	-	3	242	c.188C>G	c.(187-189)gCc>gGc	p.A63G	C10orf82_ENST00000588184.1_Missense_Mutation_p.A63G	NM_144661.2	NP_653262.1	Q8WW14	CJ082_HUMAN	chromosome 10 open reading frame 82	63										endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7				all cancers(201;0.0143)		CAGTTTCGGGGCAGTGGCCAC	0.562																																						ENST00000369210.3	1.000000	0.660000	0.990000	0.760000	0.860000	0.868711	0.860000	1.000000																										0				7						c.(187-189)gCc>gGc		chromosome 10 open reading frame 82							116.0	106.0	109.0					10																	118425205		2203	4300	6503	SO:0001583	missense	143379	0	0					g.chr10:118425205G>C	BC021737	CCDS7596.1	10q26.12	2012-05-31			ENSG00000165863	ENSG00000165863			28500	protein-coding gene	gene with protein product						12477932	Standard	NM_144661		Approved	MGC33547, Em:AC016825.4	uc001lcr.3	Q8WW14	OTTHUMG00000019105	ENST00000369210.3:c.188C>G	chr10.hg19:g.118425205G>C	ENSP00000358212:p.Ala63Gly	0					C10orf82_ENST00000588184.1_Missense_Mutation_p.A63G	p.A63G	NM_144661.2	NP_653262.1	1	2	3	2.064821	Q8WW14	CJ082_HUMAN		3	242	-			B3KUM9|D3DRC3	Missense_Mutation	SNP	ENST00000369210.3	1	1	hg19	c.188C>G	CCDS7596.1	1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146601	0.57044	.	.	ENSG00000165863	ENST00000369210;ENST00000388884	T	0.64260	-0.09	5.16	4.25	0.50352	5.16	4.25	0.50352	.	0.715143	0.13142	N	0.410531	T	0.66015	0.2747	M	0.65975	2.015	0.09310	N	1	P;D	0.56521	0.884;0.976	B;P	0.49085	0.42;0.6	T	0.57106	-0.7868	10	0.49607	T	0.09	-4.1516	9.7479	0.40457	0.096:0.0:0.904:0.0	.	63;63	Q8WW14-3;Q8WW14	.;CJ082_HUMAN	G	63	ENSP00000358212:A63G	ENSP00000358212:A63G	A	-	2	0	0	C10orf82	118415195	118415195	0.014000	0.17966	0.010000	0.14722	0.031000	0.12232	1.748000	0.38308	1.161000	0.42604	0.561000	0.74099	GCC	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.562	C10orf82-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000050527.1	1	0	1	2	2	2	2	0	0	0	0	118	118	118	118	1	1.860000	-20.000000	1	0.380000	NM_144661		0	51	51	0	258	250	1		1			0	0	118	0	0	1.000000	0	0	0	0	0	0	51	258
C11orf70	85016	broad.mit.edu	37	11	101953816	101953816	+	Missense_Mutation	SNP	G	G	A	rs181449558		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:101953816G>A	ENST00000434758.2	+	7	718	c.690G>A	c.(688-690)atG>atA	p.M230I		NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	230										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		CTGCTGGTATGTGCTATCCTT	0.294													G|||	1	0.000199681	0.0	0.0	5008	,	,		12078	0.0		0.001	False		,,,				2504	0.0					ENST00000434758.2	1.000000	0.910000	1.000000	0.990000	0.990000	0.992752	0.990000	1.000000																										0				12						c.(688-690)atG>atA		chromosome 11 open reading frame 70		G	ILE/MET	0,4406		0,0,2203	147.0	137.0	141.0		690	4.0	1.0	11		141	8,8590	6.4+/-24.3	0,8,4291	yes	missense	C11orf70	NM_032930.2	10	0,8,6494	AA,AG,GG		0.093,0.0,0.0615	benign	230/268	101953816	8,12996	2203	4299	6502	SO:0001583	missense	85016	50	121410	50				g.chr11:101953816G>A	AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.690G>A	chr11.hg19:g.101953816G>A	ENSP00000414390:p.Met230Ile	0						p.M230I	NM_032930.2	NP_116319.2	1	2	3	2.062376	Q9BRQ4	CK070_HUMAN	Lung(13;0.245)	7	718	+	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	E9PJU1	Missense_Mutation	SNP	ENST00000434758.2	1	1	hg19	c.690G>A	CCDS8313.2	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.29	1.310068	0.23821	0.0	9.3E-4	ENSG00000137691	ENST00000434758;ENST00000423732	.	.	.	5.85	3.99	0.46301	5.85	3.99	0.46301	.	0.448291	0.26062	N	0.026578	T	0.46600	0.1401	L	0.50333	1.59	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.36578	-0.9742	9	0.23891	T	0.37	0.0275	7.5577	0.27833	0.1437:0.0:0.7203:0.1361	.	230	Q9BRQ4	CK070_HUMAN	I	230;192	.	ENSP00000392150:M192I	M	+	3	0	0	C11orf70	101459026	101459026	0.991000	0.36638	0.996000	0.52242	0.588000	0.36517	0.758000	0.26447	1.487000	0.48415	0.585000	0.79938	ATG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.294	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394144.1	0	0	1	2	2	2	2	0	0	0	0	186	186	186	184	1	1.860000	-2.958174	1	0.380000	NM_032930		0	115	112	0	443	435	0		1	0		0	0	186	0	0	1.000000	1.114614e-01	0	1	0	2	0	115	443
DYNC2H1	79659	broad.mit.edu	37	11	103027117	103027117	+	Splice_Site	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:103027117G>T	ENST00000375735.2	+	26	3889	c.3745G>T	c.(3745-3747)Gat>Tat	p.D1249Y	DYNC2H1_ENST00000398093.3_Splice_Site_p.D1249Y|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1249	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGTTAAATAGGATTTAAATAG	0.284																																						ENST00000375735.2	1.000000	0.590000	1.000000	0.730000	0.900000	0.878325	0.900000	1.000000																										0				33						c.(3745-3747)Gat>Tat		dynein, cytoplasmic 2, heavy chain 1							29.0	29.0	29.0					11																	103027117		1811	4071	5882	SO:0001630	splice_region_variant	79659	0	0					g.chr11:103027117G>T	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3745-1G>T	chr11.hg19:g.103027117G>T		0					DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Splice_Site_p.D1249Y	p.D1249Y	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	1	2	3	2.062376	Q8NCM8	DYHC2_HUMAN		26	3889	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Splice_Site	SNP	ENST00000375735.2	1	0	hg19	c.3745G>T	CCDS53701.1	1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300875	0.60195	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.62639	0.01;0.01	5.27	5.27	0.74061	5.27	5.27	0.74061	Dynein heavy chain, domain-2 (1);	0.197764	0.33895	N	0.004459	T	0.76140	0.3946	M	0.88181	2.935	0.80722	D	1	B;B	0.33171	0.4;0.348	B;B	0.43123	0.409;0.301	T	0.76817	-0.2819	9	.	.	.	.	18.8855	0.92376	0.0:0.0:1.0:0.0	.	1249;1249	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	Y	1249	ENSP00000364887:D1249Y;ENSP00000381167:D1249Y	.	D	+	1	0	0	DYNC2H1	102532327	102532327	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.376000	0.79658	2.472000	0.83506	0.563000	0.77884	GAT	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.284	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.860000	-20.000000	1	0.380000	XM_370652	Missense_Mutation	0	21	20	0	102	102	1		1			0	0	54	0	0	0.999999	0	0	0	0	0	0	21	102
ARHGAP20	57569	broad.mit.edu	37	11	110451075	110451075	+	Silent	SNP	T	T	C			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:110451075T>C	ENST00000260283.4	-	16	2879	c.2595A>G	c.(2593-2595)tcA>tcG	p.S865S	ARHGAP20_ENST00000524756.1_Silent_p.S842S|ARHGAP20_ENST00000533353.1_Silent_p.S839S|ARHGAP20_ENST00000357139.3_Silent_p.S839S|ARHGAP20_ENST00000529591.1_Silent_p.S408S|ARHGAP20_ENST00000527598.1_Silent_p.S829S|ARHGAP20_ENST00000528829.1_Silent_p.S829S	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	865					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GTTGTTTCTTTGAATAAATTC	0.493																																						ENST00000260283.4	1.000000	0.800000	1.000000	0.880000	0.960000	0.951003	0.960000	1.000000																										0				60						c.(2593-2595)tcA>tcG		Rho GTPase activating protein 20							108.0	107.0	107.0					11																	110451075		2201	4298	6499	SO:0001819	synonymous_variant	57569	0	0					g.chr11:110451075T>C	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2595A>G	chr11.hg19:g.110451075T>C		0					ARHGAP20_ENST00000528829.1_Silent_p.S829S|ARHGAP20_ENST00000527598.1_Silent_p.S829S|ARHGAP20_ENST00000529591.1_Silent_p.S408S|ARHGAP20_ENST00000533353.1_Silent_p.S839S|ARHGAP20_ENST00000524756.1_Silent_p.S842S|ARHGAP20_ENST00000357139.3_Silent_p.S839S	p.S865S	NM_020809.3	NP_065860.2	1	2	3	2.062376	Q9P2F6	RHG20_HUMAN		16	2879	-		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Silent	SNP	ENST00000260283.4	1	1	hg19	c.2595A>G	CCDS31673.1	1																																																																																								0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.493	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	1	0	1	2	2	2	2	0	0	0	0	214	214	214	213	1	1.860000	-20.000000	1	0.380000	NM_020809		0	108	108	0	479	468	1		1	0		0	0	214	0	0	1.000000	0	0	0	0	1	0	108	479
ZBTB16	7704	broad.mit.edu	37	11	114027126	114027126	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:114027126C>T	ENST00000335953.4	+	3	1716	c.1336C>T	c.(1336-1338)Cgg>Tgg	p.R446W	ZBTB16_ENST00000392996.2_Missense_Mutation_p.R446W	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	446					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GGATAGTTTGCGGCTGAGAAT	0.547																																						ENST00000335953.4	0.240000	0.030000	0.170000	0.060000	0.100000	0.117887	0.100000	0.100000																										0				6						c.(1336-1338)Cgg>Tgg		zinc finger and BTB domain containing 16							163.0	122.0	136.0					11																	114027126		2201	4296	6497	SO:0001583	missense	7704	0	0					g.chr11:114027126C>T	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1336C>T	chr11.hg19:g.114027126C>T	ENSP00000338157:p.Arg446Trp	0					ZBTB16_ENST00000392996.2_Missense_Mutation_p.R446W	p.R446W	NM_006006.4	NP_005997.2	1	2	3	2.062376	Q05516	ZBT16_HUMAN		3	1716	+		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	0	1	hg19	c.1336C>T	CCDS8367.1	0	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389876	0.82902	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.15372	2.43;2.43	4.81	4.81	0.61882	4.81	4.81	0.61882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.38134	0.1029	M	0.62723	1.935	0.51767	D	0.999937	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.10245	-1.0638	10	0.72032	D	0.01	-2.7332	13.0927	0.59174	0.1603:0.8397:0.0:0.0	.	446;451	Q05516;Q59H43	ZBT16_HUMAN;.	W	446;446;323	ENSP00000338157:R446W;ENSP00000376721:R446W	ENSP00000309507:R323W	R	+	1	2	2	ZBTB16	113532336	113532336	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.419000	0.66435	2.500000	0.84329	0.655000	0.94253	CGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.547	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	0	0	1	2	2	2	2	0	0	0	0	81	81	81	80	1	1.860000	-2.672181	1	0.380000	NM_006006		0	4	4	0	216	211	0		1	0		0	0	81	0	0	0.885690	6.059872e-04	0	0	0	2	0	4	216
DPAGT1	1798	broad.mit.edu	37	11	118972344	118972344	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:118972344G>A	ENST00000409993.2	-	3	1573	c.22C>T	c.(22-24)Ccc>Tcc	p.P8S	DPAGT1_ENST00000432443.2_5'UTR|DPAGT1_ENST00000445653.1_5'UTR|DPAGT1_ENST00000354202.4_Missense_Mutation_p.P8S			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	8					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AGCGGCATGGGCAATTCCGAG	0.632											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000409993.2	0.210000	0.030000	0.150000	0.050000	0.090000	0.106304	0.090000	0.090000																										0				17						c.(22-24)Ccc>Tcc		dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)							63.0	65.0	64.0					11																	118972344		2200	4295	6495	SO:0001583	missense	1798	0	0					g.chr11:118972344G>A	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.22C>T	chr11.hg19:g.118972344G>A	ENSP00000386597:p.Pro8Ser	0		OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1492	DPAGT1_ENST00000432443.2_5'UTR|DPAGT1_ENST00000445653.1_5'UTR|DPAGT1_ENST00000354202.4_Missense_Mutation_p.P8S	p.P8S			1	2	3	2.062376	Q9H3H5	GPT_HUMAN		3	1573	-	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	0	1	hg19	c.22C>T	CCDS8411.1	0	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884783	0.51908	.	.	ENSG00000172269	ENST00000409993;ENST00000354202	D;D	0.91011	-2.77;-2.77	4.79	3.87	0.44632	4.79	3.87	0.44632	.	0.000000	0.85682	D	0.000000	T	0.80628	0.4659	N	0.19112	0.55	0.80722	D	1	P	0.35174	0.488	B	0.27380	0.079	T	0.78725	-0.2092	10	0.27082	T	0.32	-2.6285	12.3966	0.55389	0.0:0.0:0.8312:0.1688	.	8	Q9H3H5	GPT_HUMAN	S	8	ENSP00000386597:P8S;ENSP00000346142:P8S	ENSP00000346142:P8S	P	-	1	0	0	DPAGT1	118477554	118477554	.	.	0.973000	0.42090	0.691000	0.40173	.	.	1.602000	0.50124	0.655000	0.94253	CCC	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.632	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	0	0	1	2	2	2	2	0	0	0	0	112	112	112	110	1	1.860000	-2.631334	1	0.380000	NM_001382		0	5	5	0	289	284	0		1	0		0	0	112	0	0	0.935214	2.477637e-01	0	0	0	47	0	5	289
MUC5B	727897	broad.mit.edu	37	11	1268340	1268340	+	Silent	SNP	A	A	T	rs368194612		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:1268340A>T	ENST00000529681.1	+	31	10288	c.10230A>T	c.(10228-10230)ccA>ccT	p.P3410P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P3413P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3410	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		cctcaactccagggacaactc	0.637																																						ENST00000529681.1	1.000000	0.160000	0.840000	0.310000	0.540000	0.573597	0.540000	1.000000																										0				137						c.(10228-10230)ccA>ccT		mucin 5B, oligomeric mucus/gel-forming							148.0	179.0	169.0					11																	1268340		2112	4168	6280	SO:0001819	synonymous_variant	727897	183	114872	46				g.chr11:1268340A>T	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10230A>T	chr11.hg19:g.1268340A>T		0					MUC5B_ENST00000447027.1_Silent_p.P3413P|RP11-532E4.2_ENST00000532061.2_RNA	p.P3410P	NM_002458.2	NP_002449.2	0	1	1	2.051225	Q9HC84	MUC5B_HUMAN		31	10288	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	0	1	hg19	c.10230A>T	CCDS44515.2	0																																																																																								0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	0	0	1	2	2	2	2	0	0	0	0	14	14	14	13	1	1.860000	-0.923199	0	0.380000	XM_001126093		0	3	3	0	29	26	0		1	0		0	0	14	0	0	0.779939	4.481793e-02	0	0	0	3	0	3	29
KIRREL3	84623	broad.mit.edu	37	11	126432761	126432761	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr11:126432761C>T	ENST00000525144.2	-	2	351	c.102G>A	c.(100-102)atG>atA	p.M34I	KIRREL3_ENST00000529097.2_Missense_Mutation_p.M34I|KIRREL3_ENST00000533026.2_5'UTR|KIRREL3-AS1_ENST00000548204.1_RNA|KIRREL3_ENST00000525704.2_Missense_Mutation_p.M34I	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	34					hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TGTCCTTGGCCATGTAGCCCA	0.547																																						ENST00000525144.2	0.940000	0.480000	0.810000	0.570000	0.680000	0.697943	0.680000	0.680000																										0				29						c.(100-102)atG>atA		kin of IRRE like 3 (Drosophila)							122.0	116.0	118.0					11																	126432761		1947	4141	6088	SO:0001583	missense	84623	0	0					g.chr11:126432761C>T	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.102G>A	chr11.hg19:g.126432761C>T	ENSP00000435466:p.Met34Ile	0					KIRREL3_ENST00000533026.2_5'UTR|KIRREL3_ENST00000525704.2_Missense_Mutation_p.M34I|KIRREL3-AS1_ENST00000548204.1_RNA|KIRREL3_ENST00000529097.2_Missense_Mutation_p.M34I	p.M34I	NM_032531.3	NP_115920.1	1	2	3	2.062376	Q8IZU9	KIRR3_HUMAN		2	351	-	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	1	1	hg19	c.102G>A	CCDS53723.1	0	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017523	0.54576	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.70516	-0.49;-0.26;-0.35	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.078542	0.53938	D	0.000046	T	0.54255	0.1847	N	0.08118	0	0.80722	D	1	B;B;B	0.26547	0.048;0.152;0.077	B;B;B	0.26614	0.025;0.071;0.019	T	0.52719	-0.8538	10	0.37606	T	0.19	.	17.8583	0.88773	0.0:1.0:0.0:0.0	.	34;34;34	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	I	34	ENSP00000435466:M34I;ENSP00000434081:M34I;ENSP00000435094:M34I	ENSP00000435466:M34I	M	-	3	0	0	KIRREL3	125937971	125937971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.770000	0.62309	2.645000	0.89757	0.650000	0.86243	ATG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.547	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	1.860000	-3.320078	1	0.380000	NM_032531		0	31	31	0	207	203	1		1	0		0	0	72	0	0	1.000000	0	0	0	0	1	0	31	207
SSH1	54434	broad.mit.edu	37	12	109186420	109186420	+	Missense_Mutation	SNP	C	C	T	rs146699038	byFrequency	TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr12:109186420C>T	ENST00000326495.5	-	14	1628	c.1535G>A	c.(1534-1536)cGg>cAg	p.R512Q	SSH1_ENST00000551165.1_Missense_Mutation_p.R512Q|SSH1_ENST00000360239.3_Missense_Mutation_p.R200Q|SSH1_ENST00000326470.5_Missense_Mutation_p.R523Q	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	512					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGAGAGTCGCCGGAAACAGCA	0.637													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15695	0.0		0.0	False		,,,				2504	0.0					ENST00000326495.5	0.270000	0.060000	0.200000	0.090000	0.140000	0.154241	0.140000	0.130000																										0				38						c.(1534-1536)cGg>cAg		slingshot protein phosphatase 1		C	GLN/ARG,GLN/ARG,GLN/ARG	8,4394		0,8,2193	31.0	38.0	36.0		1535,1568,1535	4.6	0.8	12	dbSNP_134	36	0,8594		0,0,4297	yes	missense,missense,missense	SSH1	NM_001161330.1,NM_001161331.1,NM_018984.3	43,43,43	0,8,6490	TT,TC,CC		0.0,0.1817,0.0616	probably-damaging,probably-damaging,probably-damaging	512/693,523/704,512/1050	109186420	8,12988	2201	4297	6498	SO:0001583	missense	54434	22	121338	43				g.chr12:109186420C>T	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1535G>A	chr12.hg19:g.109186420C>T	ENSP00000315713:p.Arg512Gln	0					SSH1_ENST00000551165.1_Missense_Mutation_p.R512Q|SSH1_ENST00000326470.5_Missense_Mutation_p.R523Q|SSH1_ENST00000360239.3_Missense_Mutation_p.R200Q	p.R512Q	NM_018984.3	NP_061857.3	0	0	0	2.013098	Q8WYL5	SSH1_HUMAN		14	1628	-			Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	0	1	hg19	c.1535G>A	CCDS9121.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.68	2.607225	0.46527	0.001817	0.0	ENSG00000084112	ENST00000360239;ENST00000326495;ENST00000551165;ENST00000326470	T;T;T;T	0.15834	2.39;2.4;2.49;2.46	5.48	4.6	0.57074	5.48	4.6	0.57074	.	3.113600	0.01024	N	0.004037	T	0.23054	0.0557	M	0.71581	2.175	0.39015	D	0.959636	P;B;P;P	0.39624	0.681;0.218;0.569;0.681	B;B;B;B	0.26614	0.071;0.016;0.07;0.071	T	0.39563	-0.9608	10	0.37606	T	0.19	-25.6956	12.894	0.58089	0.0:0.9248:0.0:0.0752	.	523;512;512;200	Q8WYL5-5;Q8WYL5-2;Q8WYL5;Q8WYL5-4	.;.;SSH1_HUMAN;.	Q	200;512;512;523	ENSP00000353374:R200Q;ENSP00000315713:R512Q;ENSP00000448824:R512Q;ENSP00000326107:R523Q	ENSP00000326107:R523Q	R	-	2	0	0	SSH1	107710549	107710549	0.990000	0.36364	0.815000	0.32552	0.069000	0.16628	2.653000	0.46691	1.460000	0.47911	-0.136000	0.14681	CGG	0.365534		TCGA-IB-AAUO-01A-12D-A38G-08	0.637	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	117	1	1.860000	-3.215354	1	0.380000	NM_018984		0	7	7	0	256	249	0		1	0		0	0	119	0	0	0.979070	8.719772e-02	0	1	0	15	0	7	256
ACSM4	341392	broad.mit.edu	37	12	7469871	7469871	+	Silent	SNP	C	C	T	rs200562081		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr12:7469871C>T	ENST00000399422.4	+	4	807	c.759C>T	c.(757-759)tgC>tgT	p.C253C		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	253					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						TCACCCTCTGCGGAAGGTAGG	0.463													C|||	1	0.000199681	0.0	0.0014	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0					ENST00000399422.4	1.000000	0.520000	1.000000	0.760000	0.990000	0.916676	0.990000	1.000000																										0				21						c.(757-759)tgC>tgT		acyl-CoA synthetase medium-chain family member 4		C		0,3840		0,0,1920	31.0	33.0	32.0		759	-0.3	1.0	12		32	1,8221		0,1,4110	no	coding-synonymous	ACSM4	NM_001080454.1		0,1,6030	TT,TC,CC		0.0122,0.0,0.0083		253/581	7469871	1,12061	1920	4111	6031	SO:0001819	synonymous_variant	341392	9	116028	32				g.chr12:7469871C>T		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.759C>T	chr12.hg19:g.7469871C>T		0						p.C253C	NM_001080454.1	NP_001073923.1	0	0	0	2.013098	P0C7M7	ACSM4_HUMAN		4	807	+			A8MTI6	Silent	SNP	ENST00000399422.4	0	1	hg19	c.759C>T	CCDS44825.1	1																																																																																								0.365534		TCGA-IB-AAUO-01A-12D-A38G-08	0.463	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	0	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.860000	-15.874150	1	0.380000	NM_001080454		0	7	7	0	26	26	0		1			0	0	9	0	0	0.984761	0	0	0	0	0	0	7	26
RECQL	5965	broad.mit.edu	37	12	21644543	21644543	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr12:21644543G>T	ENST00000444129.2	-	3	592	c.124C>A	c.(124-126)Ctg>Atg	p.L42M	RECQL_ENST00000421138.2_Missense_Mutation_p.L42M	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	42					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TTCTTTGTCAGGACTTTTTTT	0.378								Other identified genes with known or suspected DNA repair function																														ENST00000444129.2	0.940000	0.600000	0.860000	0.680000	0.760000	0.774454	0.760000	0.770000																										0				17						c.(124-126)Ctg>Atg	Other identified genes with known or suspected DNA repair function	RecQ helicase-like							53.0	52.0	52.0					12																	21644543		2203	4300	6503	SO:0001583	missense	5965	0	0					g.chr12:21644543G>T	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.124C>A	chr12.hg19:g.21644543G>T	ENSP00000416739:p.Leu42Met	0					RECQL_ENST00000421138.2_Missense_Mutation_p.L42M	p.L42M	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	0	0	0	2.013098	P46063	RECQ1_HUMAN		3	592	-			A8K6G2	Missense_Mutation	SNP	ENST00000444129.2	1	0	hg19	c.124C>A	CCDS31756.1	0	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704990	0.30232	.	.	ENSG00000004700	ENST00000444129;ENST00000421138;ENST00000396093;ENST00000314748;ENST00000542432;ENST00000536240;ENST00000536964;ENST00000539672	T;T;T;T;D;D;D;D	0.87256	0.29;0.29;0.55;0.54;-2.23;-2.23;-2.23;-1.68	4.33	3.42	0.39159	4.33	3.42	0.39159	.	0.087041	0.48767	D	0.000177	D	0.92195	0.7525	M	0.83953	2.67	0.24809	N	0.992651	D	0.89917	1.0	D	0.73380	0.98	D	0.84614	0.0680	10	0.72032	D	0.01	-4.8901	8.4221	0.32707	0.0843:0.0:0.7589:0.1568	.	42	P46063	RECQ1_HUMAN	M	42	ENSP00000416739:L42M;ENSP00000395449:L42M;ENSP00000379400:L42M;ENSP00000318727:L42M;ENSP00000445555:L42M;ENSP00000439069:L42M;ENSP00000446036:L42M;ENSP00000440700:L42M	ENSP00000318727:L42M	L	-	1	2	2	RECQL	21535810	21535810	0.652000	0.27349	0.372000	0.25991	0.193000	0.23685	0.781000	0.26774	1.123000	0.41961	0.655000	0.94253	CTG	0.365534		TCGA-IB-AAUO-01A-12D-A38G-08	0.378	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	1	0	1	2	2	2	2	0	0	0	0	174	174	174	172	1	1.860000	-2.922170	1	0.380000	NM_002907		0	69	67	0	392	382	1		1	1		0	0	174	0	0	1.000000	8.603249e-01	0	5	0	17	0	69	392
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.720000	1.000000	0.820000	0.930000	0.922427	0.930000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.013098	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.365534		TCGA-IB-AAUO-01A-12D-A38G-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	1.860000	-20.000000	1	0.380000	NM_033360		1697	51	50	6340	227	221	1	1	1	1	1	0	0	107	333	1	1.000000	4.524297e-01	1	2	59	6	312	51	227
GPR133	283383	broad.mit.edu	37	12	131476784	131476784	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr12:131476784G>A	ENST00000261654.5	+	8	1372	c.813G>A	c.(811-813)atG>atA	p.M271I	RP11-76C10.5_ENST00000542980.1_lincRNA|GPR133_ENST00000535015.1_Missense_Mutation_p.M303I	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	271					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCTTTCAGATGCCCACAGATG	0.393																																						ENST00000261654.5	0.180000	0.070000	0.160000	0.090000	0.120000	0.131366	0.120000	0.130000																										0				67						c.(811-813)atG>atA		G protein-coupled receptor 133							176.0	194.0	188.0					12																	131476784		2203	4300	6503	SO:0001583	missense	283383	0	0					g.chr12:131476784G>A	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.813G>A	chr12.hg19:g.131476784G>A	ENSP00000261654:p.Met271Ile	0					RP11-76C10.5_ENST00000542980.1_lincRNA|GPR133_ENST00000535015.1_Missense_Mutation_p.M303I	p.M271I	NM_198827.3	NP_942122.2	0	0	0	2.013098	Q6QNK2	GP133_HUMAN		8	1372	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	1	1	hg19	c.813G>A	CCDS9272.1	0	.	.	.	.	.	.	.	.	.	.	G	2.052	-0.417574	0.04766	.	.	ENSG00000111452	ENST00000261654;ENST00000542091;ENST00000535015;ENST00000537600	T;T	0.38887	1.11;1.11	5.62	2.61	0.31194	5.62	2.61	0.31194	.	1.491050	0.03428	N	0.207351	T	0.30727	0.0774	L	0.29908	0.895	0.22081	N	0.999377	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16512	-1.0400	10	0.27785	T	0.31	.	3.881	0.09079	0.1601:0.1364:0.5778:0.1257	.	303;271	B7ZLF7;Q6QNK2	.;GP133_HUMAN	I	271;211;303;30	ENSP00000261654:M271I;ENSP00000444425:M303I	ENSP00000261654:M271I	M	+	3	0	0	GPR133	130042737	130042737	0.174000	0.23070	0.228000	0.23943	0.043000	0.13939	0.405000	0.21015	1.350000	0.45770	0.655000	0.94253	ATG	0.365534		TCGA-IB-AAUO-01A-12D-A38G-08	0.393	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	0	0	1	2	2	2	2	0	0	0	0	356	356	356	355	1	1.860000	-2.688130	1	0.380000	NM_198827		0	24	24	0	951	930	0		1			0	0	356	0	0	1.000000	0	0	0	0	0	0	24	951
SEL1L	6400	broad.mit.edu	37	14	81950645	81950645	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr14:81950645G>A	ENST00000336735.4	-	19	2086	c.1970C>T	c.(1969-1971)gCt>gTt	p.A657V		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	657	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CTGCTCAGAAGCCAGACGGTA	0.428																																						ENST00000336735.4	0.250000	0.130000	0.220000	0.150000	0.180000	0.191390	0.180000	0.190000																										0				28						c.(1969-1971)gCt>gTt		sel-1 suppressor of lin-12-like (C. elegans)							253.0	246.0	249.0					14																	81950645		2203	4300	6503	SO:0001583	missense	6400	0	0					g.chr14:81950645G>A		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.1970C>T	chr14.hg19:g.81950645G>A	ENSP00000337053:p.Ala657Val	0						p.A657V	NM_005065.5	NP_005056.3	0	0	0	2.033170	Q9UBV2	SE1L1_HUMAN		19	2086	-			Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	1	1	hg19	c.1970C>T	CCDS9876.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.610409	0.96637	.	.	ENSG00000071537	ENST00000336735;ENST00000261258	T	0.65178	-0.14	5.92	5.92	0.95590	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.85191	0.5640	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87620	0.2509	10	0.87932	D	0	.	20.3167	0.98654	0.0:0.0:1.0:0.0	.	657	Q9UBV2	SE1L1_HUMAN	V	657;18	ENSP00000337053:A657V	ENSP00000261258:A18V	A	-	2	0	0	SEL1L	81020398	81020398	1.000000	0.71417	0.916000	0.36221	0.980000	0.70556	9.335000	0.96500	2.809000	0.96659	0.557000	0.71058	GCT	0.375252		TCGA-IB-AAUO-01A-12D-A38G-08	0.428	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	0	0	1	2	2	2	2	0	0	0	0	514	514	514	512	1	1.860000	-3.687732	1	0.380000	NM_005065		0	46	45	0	1233	1208	0		1	0		0	0	514	0	0	1.000000	6.003873e-02	0	1	0	10	0	46	1233
CHGA	1113	broad.mit.edu	37	14	93396099	93396099	+	Missense_Mutation	SNP	C	C	A	rs150929444	byFrequency	TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr14:93396099C>A	ENST00000216492.5	+	5	574	c.294C>A	c.(292-294)agC>agA	p.S98R	CHGA_ENST00000553866.1_3'UTR|CHGA_ENST00000334654.4_Missense_Mutation_p.S98R	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	98					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		AGAAACACAGCGGTTTTGAAG	0.542																																					Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)	ENST00000216492.5	0.670000	0.290000	0.570000	0.360000	0.460000	0.475512	0.460000	0.450000																										0				8						c.(292-294)agC>agA		chromogranin A (parathyroid secretory protein 1)							73.0	73.0	73.0					14																	93396099		2203	4300	6503	SO:0001583	missense	1113	0	0					g.chr14:93396099C>A		CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.294C>A	chr14.hg19:g.93396099C>A	ENSP00000216492:p.Ser98Arg	0					CHGA_ENST00000334654.4_Missense_Mutation_p.S98R|CHGA_ENST00000553866.1_3'UTR	p.S98R	NM_001275.3	NP_001266.1	0	0	0	2.033170	P10645	CMGA_HUMAN		5	574	+		all_cancers(154;0.0843)	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	1	1	hg19	c.294C>A	CCDS9906.1	0	.	.	.	.	.	.	.	.	.	.	C	8.843	0.942786	0.18281	.	.	ENSG00000100604	ENST00000216492;ENST00000334654	T;T	0.07021	4.56;3.23	4.78	1.53	0.23141	4.78	1.53	0.23141	.	0.334049	0.33382	N	0.004968	T	0.09468	0.0233	L	0.53249	1.67	0.09310	N	0.999998	B;P	0.36162	0.057;0.54	B;B	0.40677	0.028;0.337	T	0.14392	-1.0474	10	0.41790	T	0.15	-6.3264	5.9182	0.19067	0.1371:0.545:0.0:0.3179	.	98;98	G5E968;P10645	.;CMGA_HUMAN	R	98	ENSP00000216492:S98R;ENSP00000334023:S98R	ENSP00000216492:S98R	S	+	3	2	2	CHGA	92465852	92465852	0.008000	0.16893	0.012000	0.15200	0.675000	0.39556	0.091000	0.15046	0.466000	0.27193	-0.221000	0.12465	AGC	0.375252		TCGA-IB-AAUO-01A-12D-A38G-08	0.542	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412411.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	1.860000	-3.017770	1	0.380000	NM_001275		0	19	19	0	197	193	0		1	0		0	0	77	0	0	0.999991	4.318480e-01	0	0	0	16	0	19	197
PLCB2	5330	broad.mit.edu	37	15	40581489	40581489	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr15:40581489C>G	ENST00000260402.3	-	31	3587	c.3338G>C	c.(3337-3339)cGg>cCg	p.R1113P	PLCB2_ENST00000456256.2_Missense_Mutation_p.R1098P|PLCB2_ENST00000557821.1_Missense_Mutation_p.R1109P	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1113					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TTCCATCTCCCGTATCTGTTC	0.582																																						ENST00000260402.3	0.270000	0.080000	0.210000	0.110000	0.150000	0.168167	0.150000	0.160000																										0				39						c.(3337-3339)cGg>cCg		phospholipase C, beta 2							143.0	152.0	149.0					15																	40581489		1956	4138	6094	SO:0001583	missense	5330	0	0					g.chr15:40581489C>G		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.3338G>C	chr15.hg19:g.40581489C>G	ENSP00000260402:p.Arg1113Pro	0					PLCB2_ENST00000557821.1_Missense_Mutation_p.R1109P|PLCB2_ENST00000456256.2_Missense_Mutation_p.R1098P	p.R1113P	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	1	2	3	2.055270	Q00722	PLCB2_HUMAN		31	3587	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	1	1	hg19	c.3338G>C	CCDS42020.1	0	.	.	.	.	.	.	.	.	.	.	C	15.50	2.852673	0.51270	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.45668	0.89;0.89	5.05	-0.161	0.13371	5.05	-0.161	0.13371	PLC-beta, C-terminal (1);	0.561271	0.17537	N	0.170673	T	0.33177	0.0854	N	0.22421	0.69	0.80722	D	1	P;B;P	0.37122	0.523;0.451;0.583	P;B;P	0.46299	0.509;0.333;0.511	T	0.06180	-1.0841	10	0.33141	T	0.24	.	8.7765	0.34765	0.0:0.4418:0.0:0.5582	.	1098;1109;1113	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	P	1113;1098	ENSP00000260402:R1113P;ENSP00000411991:R1098P	ENSP00000260402:R1113P	R	-	2	0	0	PLCB2	38368781	38368781	0.889000	0.30405	0.991000	0.47740	0.983000	0.72400	-0.086000	0.11233	-0.207000	0.10187	0.561000	0.74099	CGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.582	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1	0	0	1	2	2	2	2	0	0	0	0	173	173	173	170	1	1.860000	-2.211676	0	0.380000			0	12	11	0	392	383	0		1	0		0	0	173	0	0	0.999005	8.674163e-01	0	0	0	118	0	12	392
DUOX1	53905	broad.mit.edu	37	15	45433521	45433521	+	Nonsense_Mutation	SNP	C	C	T	rs564683577		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr15:45433521C>T	ENST00000321429.4	+	15	2004	c.1597C>T	c.(1597-1599)Cga>Tga	p.R533*	DUOX1_ENST00000561166.1_Nonsense_Mutation_p.R179*|DUOX1_ENST00000389037.3_Nonsense_Mutation_p.R533*	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	533	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		TGAAGAAATCCGAAATACCAC	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20235	0.0		0.0	False		,,,				2504	0.0					ENST00000321429.4	0.360000	0.100000	0.280000	0.150000	0.200000	0.219229	0.200000	0.200000																										0				57						c.(1597-1599)Cga>Tga		dual oxidase 1							115.0	106.0	109.0					15																	45433521		2198	4298	6496	SO:0001587	stop_gained	53905	3	121412	37				g.chr15:45433521C>T	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.1597C>T	chr15.hg19:g.45433521C>T	ENSP00000317997:p.Arg533*	0					DUOX1_ENST00000389037.3_Nonsense_Mutation_p.R533*|DUOX1_ENST00000561166.1_Nonsense_Mutation_p.R179*	p.R533*	NM_017434.3	NP_059130.2	1	2	3	2.055270	Q9NRD9	DUOX1_HUMAN		15	2004	+		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Nonsense_Mutation	SNP	ENST00000321429.4	0	1	hg19	c.1597C>T	CCDS32221.1	0	.	.	.	.	.	.	.	.	.	.	C	37	6.140306	0.97320	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	.	.	.	4.53	2.15	0.27550	4.53	2.15	0.27550	.	0.095326	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.0907	10.5604	0.45142	0.4411:0.5589:0.0:0.0	.	.	.	.	X	533	.	ENSP00000317997:R533X	R	+	1	2	2	DUOX1	43220813	43220813	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	2.572000	0.45999	0.336000	0.23639	-0.271000	0.10264	CGA	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.527	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	0	0	1	2	2	2	2	0	0	0	0	120	120	120	118	1	1.860000	-2.927638	1	0.380000	NM_017434		0	11	11	0	274	269	0		1	1		0	0	120	0	0	0.998258	7.740379e-02	0	2	0	9	0	11	274
IDH2	3418	broad.mit.edu	37	15	90630448	90630448	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr15:90630448C>A	ENST00000330062.3	-	7	976	c.863G>T	c.(862-864)cGg>cTg	p.R288L	IDH2_ENST00000559482.1_Missense_Mutation_p.R179L|IDH2_ENST00000539790.1_Missense_Mutation_p.R158L|IDH2_ENST00000540499.2_Missense_Mutation_p.R236L	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	288					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			ATCAATGAGCCGGTGCTCATA	0.527			M		GBM						OREG0023466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000330062.3	0.280000	0.050000	0.210000	0.090000	0.130000	0.150883	0.130000	0.130000				Dom	yes			Dom	yes		15	15q26.1	15q26.1	3418	M	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """				M	M			GBM		0				1109						c.(862-864)cGg>cTg		isocitrate dehydrogenase 2 (NADP+), mitochondrial							131.0	124.0	126.0					15																	90630448		2200	4298	6498	SO:0001583	missense	3418	0	0					g.chr15:90630448C>A		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.863G>T	chr15.hg19:g.90630448C>A	ENSP00000331897:p.Arg288Leu	0		OREG0023466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1276	IDH2_ENST00000539790.1_Missense_Mutation_p.R158L|IDH2_ENST00000540499.2_Missense_Mutation_p.R236L|IDH2_ENST00000559482.1_Missense_Mutation_p.R179L	p.R288L	NM_002168.2	NP_002159.2	1	2	3	2.061161	P48735	IDHP_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)	7	976	-	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	0	1	hg19	c.863G>T	CCDS10359.1	0	.	.	.	.	.	.	.	.	.	.	C	24.0	4.476860	0.84640	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	T;T;T	0.76316	-1.01;-1.01;-1.01	5.73	5.73	0.89815	5.73	5.73	0.89815	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.90995	0.7168	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	D	0.92661	0.6141	10	0.87932	D	0	.	17.3795	0.87401	0.0:1.0:0.0:0.0	.	288;288	Q53GL5;P48735	.;IDHP_HUMAN	L	288;158;236	ENSP00000331897:R288L;ENSP00000438457:R158L;ENSP00000446147:R236L	ENSP00000331897:R288L	R	-	2	0	0	IDH2	88431452	88431452	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	7.786000	0.85741	2.709000	0.92574	0.491000	0.48974	CGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.527	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1	0	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	1.860000	-3.142651	1	0.380000			0	6	6	0	235	232	0		1	1		0	0	113	0	0	0.964155	9.815272e-01	0	10	0	281	0	6	235
WWP2	11060	broad.mit.edu	37	16	69969883	69969883	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr16:69969883G>A	ENST00000359154.2	+	18	2071	c.1970G>A	c.(1969-1971)tGg>tAg	p.W657*	WWP2_ENST00000356003.2_Nonsense_Mutation_p.W657*|WWP2_ENST00000448661.1_Nonsense_Mutation_p.W657*|MIR140_ENST00000385282.1_RNA|WWP2_ENST00000568684.1_Nonsense_Mutation_p.W218*|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000542271.1_Nonsense_Mutation_p.W541*	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	657	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCCATTGTCTGGATCAAGTGA	0.542																																						ENST00000359154.2	1.000000	0.810000	1.000000	0.900000	0.990000	0.964804	0.990000	1.000000																										0				42						c.(1969-1971)tGg>tAg		WW domain containing E3 ubiquitin protein ligase 2							143.0	130.0	134.0					16																	69969883		2198	4300	6498	SO:0001587	stop_gained	11060	0	0					g.chr16:69969883G>A	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1970G>A	chr16.hg19:g.69969883G>A	ENSP00000352069:p.Trp657*	0					MIR140_ENST00000385282.1_RNA|WWP2_ENST00000542271.1_Nonsense_Mutation_p.W541*|WWP2_ENST00000356003.2_Nonsense_Mutation_p.W657*|WWP2_ENST00000568684.1_Nonsense_Mutation_p.W218*|WWP2_ENST00000448661.1_Nonsense_Mutation_p.W657*|WWP2_ENST00000544162.1_3'UTR	p.W657*	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	1	2	3	2.056115	O00308	WWP2_HUMAN		18	2071	+			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Nonsense_Mutation	SNP	ENST00000359154.2	0	1	hg19	c.1970G>A	CCDS10885.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.554393	0.98355	.	.	ENSG00000198373	ENST00000359154;ENST00000545099;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	.	.	.	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.105878	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.843	0.96697	0.0:0.0:1.0:0.0	.	.	.	.	X	657;218;657;657;544;541	.	.	W	+	2	0	0	WWP2	68527384	68527384	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.679000	0.91253	0.655000	0.94253	TGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.542	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	1	0	1	2	2	2	2	0	0	0	0	157	157	157	152	1	1.860000	-2.865302	1	0.380000	NM_007014		0	82	82	0	348	344	0		1	1	1	0	0	157	358	0	1.000000	9.988206e-01	1	7	85	38	333	82	348
ADAMTS18	170692	broad.mit.edu	37	16	77317969	77317969	+	Splice_Site	SNP	C	C	G			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr16:77317969C>G	ENST00000282849.5	-	23	3969		c.e23-1		RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18						eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GATGGATCCTCTAAAATAAGA	0.398																																						ENST00000282849.5	0.910000	0.480000	0.790000	0.570000	0.670000	0.686066	0.670000	0.670000																										0				118						c.e23-1		ADAM metallopeptidase with thrombospondin type 1 motif, 18							106.0	100.0	102.0					16																	77317969		2198	4300	6498	SO:0001630	splice_region_variant	170692	1	121408	30				g.chr16:77317969C>G	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3551-1G>C	chr16.hg19:g.77317969C>G		0					RP11-538I12.3_ENST00000561672.1_RNA		NM_199355.2	NP_955387.1	1	2	3	2.056115	Q8TE60	ATS18_HUMAN		23	3969	-			Q6P4R5|Q6ZWJ9	Splice_Site	SNP	ENST00000282849.5	1	1	hg19		CCDS10926.1	0	.	.	.	.	.	.	.	.	.	.	C	19.80	3.894540	0.72639	.	.	ENSG00000140873	ENST00000282849	.	.	.	5.93	5.93	0.95920	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3291	0.94278	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	ADAMTS18	75875470	75875470	1.000000	0.71417	0.997000	0.53966	0.888000	0.51559	7.188000	0.77739	2.814000	0.96858	0.655000	0.94253	.	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.398	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1	1	0	1	2	2	2	2	0	0	0	0	117	117	117	117	1	1.860000	-2.842164	1	0.380000		Intron	0	35	35	0	238	236	0		1			0	0	117	0	0	1.000000	0	0	0	0	0	0	35	238
PRPF8	10594	broad.mit.edu	37	17	1564593	1564593	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:1564593C>T	ENST00000572621.1	-	26	4575	c.4310G>A	c.(4309-4311)cGt>cAt	p.R1437H	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1437H			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1437	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGTTCTGACACGCCAGCCCTT	0.483																																						ENST00000572621.1	0.970000	0.660000	0.900000	0.730000	0.810000	0.819632	0.810000	0.820000																										0				77						c.(4309-4311)cGt>cAt		pre-mRNA processing factor 8							154.0	138.0	144.0					17																	1564593		2203	4300	6503	SO:0001583	missense	10594	0	0					g.chr17:1564593C>T	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4310G>A	chr17.hg19:g.1564593C>T	ENSP00000460348:p.Arg1437His	0					PRPF8_ENST00000304992.6_Missense_Mutation_p.R1437H	p.R1437H			0	1	1	2.050195	Q6P2Q9	PRP8_HUMAN		26	4575	-			O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	1	0	hg19	c.4310G>A	CCDS11010.1	0	.	.	.	.	.	.	.	.	.	.	c	29.7	5.028120	0.93518	.	.	ENSG00000174231	ENST00000304992	D	0.85484	-1.99	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.94971	0.8373	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95043	0.8180	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1437	Q6P2Q9	PRP8_HUMAN	H	1437	ENSP00000304350:R1437H	ENSP00000304350:R1437H	R	-	2	0	0	PRPF8	1511343	1511343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.792000	0.85828	2.941000	0.99782	0.655000	0.94253	CGT	0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.483	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2	0	0	0	2	13	3	2	2	2	2	2	239	239	239	239	1	1.860000	-20.000000	1	0.380000			0	87	87	0	473	465	1		1	0		2	0	239	0	0	1.000000	9.811253e-01	0	0	0	47	0	87	473
SLC47A1	55244	broad.mit.edu	37	17	19458922	19458922	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:19458922A>G	ENST00000270570.4	+	8	744	c.658A>G	c.(658-660)Aac>Gac	p.N220D	SLC47A1_ENST00000571335.1_Intron|SLC47A1_ENST00000436810.2_Missense_Mutation_p.N197D|SNORA59B_ENST00000458926.1_RNA|SLC47A1_ENST00000457293.1_Missense_Mutation_p.N220D|SLC47A1_ENST00000542886.1_Missense_Mutation_p.K187R|SLC47A1_ENST00000395585.1_Missense_Mutation_p.N220D|SLC47A1_ENST00000575023.1_Intron	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	220					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	TGCACTGGCAAACTTGATTTC	0.527																																						ENST00000270570.4	1.000000	0.820000	0.990000	0.890000	0.950000	0.948216	0.950000	0.990000																										0				23						c.(658-660)Aac>Gac		solute carrier family 47 (multidrug and toxin extrusion), member 1	Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)						119.0	112.0	115.0					17																	19458922		2203	4300	6503	SO:0001583	missense	55244	0	0					g.chr17:19458922A>G		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.658A>G	chr17.hg19:g.19458922A>G	ENSP00000270570:p.Asn220Asp	1					SLC47A1_ENST00000395585.1_Missense_Mutation_p.N220D|SNORA59B_ENST00000458926.1_RNA|SLC47A1_ENST00000542886.1_Missense_Mutation_p.K187R|SLC47A1_ENST00000457293.1_Missense_Mutation_p.N220D|SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000436810.2_Missense_Mutation_p.N197D|SLC47A1_ENST00000571335.1_Intron	p.N220D	NM_018242.2	NP_060712.2	0	1	1	1.676844	Q96FL8	S47A1_HUMAN		8	744	+	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)		Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	1	1	hg19	c.658A>G	CCDS11209.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.34|14.34	2.506537|2.506537	0.44558|0.44558	.|.	.|.	ENSG00000142494|ENSG00000142494	ENST00000542886|ENST00000436810;ENST00000270570;ENST00000457293;ENST00000395585	.|T;T;T;T	.|0.32272	.|1.51;1.46;1.46;1.46	5.34|5.34	5.34|5.34	0.76211|0.76211	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|0.082064	.|0.85682	.|D	.|0.000000	T|T	0.50257|0.50257	0.1605|0.1605	H|H	0.95260|0.95260	3.645|3.645	0.32301|0.32301	N|N	0.565074|0.565074	.|B;B;B	.|0.33238	.|0.403;0.059;0.04	.|B;B;B	.|0.34873	.|0.191;0.067;0.078	T|T	0.69109|0.69109	-0.5232|-0.5232	6|10	0.14656|0.66056	T|D	0.56|0.02	-5.1336|-5.1336	14.5405|14.5405	0.67990|0.67990	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|197;220;220	.|E7EX57;Q96FL8;Q96FL8-3	.|.;S47A1_HUMAN;.	R|D	187|197;220;220;220	.|ENSP00000407155:N197D;ENSP00000270570:N220D;ENSP00000415586:N220D;ENSP00000378951:N220D	ENSP00000440435:K187R|ENSP00000270570:N220D	K|N	+|+	2|1	0|0	0|0	SLC47A1|SLC47A1	19399514|19399514	19399514|19399514	1.000000|1.000000	0.71417|0.71417	0.729000|0.729000	0.30791|0.30791	0.302000|0.302000	0.27658|0.27658	6.624000|6.624000	0.74243|0.74243	2.036000|2.036000	0.60181|0.60181	0.529000|0.529000	0.55759|0.55759	AAA|AAC	0.234568		TCGA-IB-AAUO-01A-12D-A38G-08	0.527	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	1	0	1	2	2	2	2	0	0	0	0	134	134	134	130	1	1.860000	-20.000000	1	0.380000	NM_018242		0	71	69	0	200	195	1		1			0	0	134	0	0	1.000000	0	0	0	0	0	0	71	200
KRT24	192666	broad.mit.edu	37	17	38857493	38857493	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:38857493G>A	ENST00000264651.2	-	3	810	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	252	Coil 1B.|Rod.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				AGGACTTTCCGCAGGCCATTG	0.547																																					GBM(61;380 1051 14702 23642 31441)	ENST00000264651.2	1.000000	0.110000	0.310000	0.160000	0.220000	0.269596	0.220000	0.210000																										0				29						c.(754-756)Cgg>Tgg		keratin 24							99.0	86.0	90.0					17																	38857493		2203	4300	6503	SO:0001583	missense	192666	0	0					g.chr17:38857493G>A		CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.754C>T	chr17.hg19:g.38857493G>A	ENSP00000264651:p.Arg252Trp	0						p.R252W	NM_019016.2	NP_061889.2	1	2	3	2.100635	Q2M2I5	K1C24_HUMAN		3	810	-		Breast(137;0.00526)	Q9NXG7	Missense_Mutation	SNP	ENST00000264651.2	1	1	hg19	c.754C>T	CCDS11372.1	0	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282977	0.40394	.	.	ENSG00000167916	ENST00000264651	D	0.92545	-3.06	5.82	1.51	0.23008	5.82	1.51	0.23008	Filament (1);	.	.	.	.	D	0.97145	0.9067	H	0.96175	3.78	0.38355	D	0.944446	D	0.89917	1.0	D	0.78314	0.991	D	0.98696	1.0698	9	0.87932	D	0	.	15.8909	0.79296	0.0:0.0:0.5363:0.4637	.	252	Q2M2I5	K1C24_HUMAN	W	252	ENSP00000264651:R252W	ENSP00000264651:R252W	R	-	1	2	2	KRT24	36111019	36111019	0.000000	0.05858	0.001000	0.08648	0.108000	0.19459	0.336000	0.19823	0.078000	0.16900	-1.227000	0.01581	CGG	0.388138		TCGA-IB-AAUO-01A-12D-A38G-08	0.547	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1	0	0	1	2	2	2	2	0	0	0	0	86	86	86	83	1	1.860000	-3.186940	1	0.380000	NM_019016		0	11	11	0	268	262	0		1			0	0	86	0	0	0.998221	0	0	0	0	0	0	11	268
VPS25	84313	broad.mit.edu	37	17	40925498	40925498	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:40925498C>A	ENST00000253794.2	+	1	45	c.5C>A	c.(4-6)gCg>gAg	p.A2E		NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)	2					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		ACTACGATGGCGATGAGTTTC	0.612																																						ENST00000253794.2	1.000000	0.600000	0.830000	0.660000	0.740000	0.756694	0.740000	0.740000																										0				5						c.(4-6)gCg>gAg		vacuolar protein sorting 25 homolog (S. cerevisiae)							185.0	159.0	168.0					17																	40925498		2203	4300	6503	SO:0001583	missense	84313	1	121412	27				g.chr17:40925498C>A	AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1		ENST00000253794.2:c.5C>A	chr17.hg19:g.40925498C>A	ENSP00000253794:p.Ala2Glu	0						p.A2E	NM_032353.2	NP_115729.1	1	2	3	2.100635	Q9BRG1	VPS25_HUMAN		1	45	+		Breast(137;0.00104)	B2R581	Missense_Mutation	SNP	ENST00000253794.2	1	1	hg19	c.5C>A	CCDS11438.1	0	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496557	0.64186	.	.	ENSG00000131475	ENST00000253794	T	0.47869	0.83	4.95	4.95	0.65309	4.95	4.95	0.65309	.	0.067954	0.56097	D	0.000024	T	0.35799	0.0944	N	0.24115	0.695	0.48341	D	0.999631	B	0.11235	0.004	B	0.11329	0.006	T	0.19811	-1.0294	10	0.62326	D	0.03	-16.8888	13.689	0.62533	0.0:1.0:0.0:0.0	.	2	Q9BRG1	VPS25_HUMAN	E	2	ENSP00000253794:A2E	ENSP00000253794:A2E	A	+	2	0	0	VPS25	38179024	38179024	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.300000	0.43620	2.292000	0.77174	0.491000	0.48974	GCG	0.388138		TCGA-IB-AAUO-01A-12D-A38G-08	0.612	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452383.1	1	0	1	2	2	2	2	0	0	0	0	251	251	251	249	1	1.860000	-20.000000	1	0.380000	NM_032353		0	89	86	0	554	547	1		1	1		0	0	251	0	0	1.000000	9.999971e-01	0	27	0	86	0	89	554
BRCA1	672	broad.mit.edu	37	17	41245612	41245612	+	Missense_Mutation	SNP	T	T	C	rs397508919		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:41245612T>C	ENST00000357654.3	-	10	2054	c.1936A>G	c.(1936-1938)Agc>Ggc	p.S646G	BRCA1_ENST00000471181.2_Missense_Mutation_p.S646G|BRCA1_ENST00000309486.4_Missense_Mutation_p.S350G|BRCA1_ENST00000493795.1_Missense_Mutation_p.S599G|BRCA1_ENST00000346315.3_Missense_Mutation_p.S646G|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.S646G|BRCA1_ENST00000586385.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	646					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCTTCACTGCTAGAACAACTA	0.408			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												ENST00000357654.3	1.000000	0.400000	0.620000	0.460000	0.530000	0.564082	0.530000	0.540000			yes	Rec	yes	Hereditary breast/ovarian cancer	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	17q21	672	D, Mis, N, F, S	familial breast/ovarian cancer gene 1				E	E		breast, ovarian	ovarian		0				120						c.(1936-1938)Agc>Ggc	Homologous recombination	breast cancer 1, early onset							96.0	91.0	93.0					17																	41245612		2203	4300	6503	SO:0001583	missense	672	0	0		Hereditary Breast-Ovarian Cancer, BRCA1 type	Familial Cancer Database		g.chr17:41245612T>C	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1936A>G	chr17.hg19:g.41245612T>C	ENSP00000350283:p.Ser646Gly	0	TCGA Ovarian(2;0.000030)				BRCA1_ENST00000346315.3_Missense_Mutation_p.S646G|BRCA1_ENST00000493795.1_Missense_Mutation_p.S599G|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.S646G|BRCA1_ENST00000309486.4_Missense_Mutation_p.S350G|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.S646G|BRCA1_ENST00000491747.2_Intron	p.S646G	NM_007294.3	NP_009225.1	1	2	3	2.100635	P38398	BRCA1_HUMAN		10	2054	-		Breast(137;0.000717)	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	1	1	hg19	c.1936A>G	CCDS11453.1	0	.	.	.	.	.	.	.	.	.	.	T	14.99	2.701528	0.48307	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795;ENST00000470026;ENST00000477152	D;D;D;D;D;D;D;D	0.99032	-3.64;-3.72;-3.69;-3.57;-3.66;-3.78;-3.99;-5.35	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000002	D	0.99318	0.9761	M	0.93594	3.435	0.32644	N	0.52031	D;D;P;P;D;P	0.89917	1.0;1.0;0.751;0.849;0.984;0.808	D;D;B;P;P;P	0.71414	0.973;0.973;0.318;0.561;0.799;0.614	D	0.99886	1.1122	10	0.72032	D	0.01	-12.2956	9.02	0.36193	0.0:0.0823:0.0:0.9177	.	646;605;646;646;646;646	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	G	646;646;646;646;350;646;599;646;620	ENSP00000350283:S646G;ENSP00000326002:S646G;ENSP00000246907:S646G;ENSP00000310938:S350G;ENSP00000418960:S646G;ENSP00000418775:S599G;ENSP00000419274:S646G;ENSP00000419988:S620G	ENSP00000310938:S350G	S	-	1	0	0	BRCA1	38499138	38499138	1.000000	0.71417	0.987000	0.45799	0.844000	0.47949	3.457000	0.53007	2.170000	0.68504	0.459000	0.35465	AGC	0.388138		TCGA-IB-AAUO-01A-12D-A38G-08	0.408	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	1	0	1	2	2	2	2	0	0	0	0	203	203	203	202	1	1.860000	-17.872030	1	0.380000	NM_007294		0	57	56	0	514	503	1		1	0	1	0	0	203	240	0	1.000000	0	1	0	28	1	295	57	514
EFTUD2	9343	broad.mit.edu	37	17	42928694	42928694	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:42928694G>T	ENST00000426333.2	-	28	3164	c.2867C>A	c.(2866-2868)cCt>cAt	p.P956H	EFTUD2_ENST00000402521.3_Missense_Mutation_p.P921H|EFTUD2_ENST00000591382.1_Missense_Mutation_p.P956H|EFTUD2_ENST00000592576.1_Missense_Mutation_p.P946H	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	956					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				CAGCAACATAGGATCATCGAA	0.522																																					Ovarian(10;65 485 10258 29980 30707)	ENST00000426333.2	1.000000	0.600000	0.850000	0.670000	0.750000	0.767346	0.750000	0.750000																										0				32						c.(2866-2868)cCt>cAt		elongation factor Tu GTP binding domain containing 2							197.0	171.0	180.0					17																	42928694		2203	4300	6503	SO:0001583	missense	9343	0	0					g.chr17:42928694G>T	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.2867C>A	chr17.hg19:g.42928694G>T	ENSP00000392094:p.Pro956His	0					EFTUD2_ENST00000591382.1_Missense_Mutation_p.P956H|EFTUD2_ENST00000402521.3_Missense_Mutation_p.P921H|EFTUD2_ENST00000592576.1_Missense_Mutation_p.P946H	p.P956H	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	1	2	3	2.100635	Q15029	U5S1_HUMAN		28	3164	-		Prostate(33;0.109)	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	1	1	hg19	c.2867C>A	CCDS11489.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.195069	0.94960	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.71103	-0.53;-0.54	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.86293	0.5898	M	0.87758	2.905	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.65773	0.938;0.938	D	0.87972	0.2737	10	0.72032	D	0.01	-13.7718	19.7014	0.96054	0.0:0.0:1.0:0.0	.	946;956	B4DMC0;Q15029	.;U5S1_HUMAN	H	956;946;921	ENSP00000392094:P956H;ENSP00000385873:P921H	ENSP00000262414:P946H	P	-	2	0	0	EFTUD2	40284220	40284220	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.277000	0.95755	2.660000	0.90430	0.563000	0.77884	CCT	0.388138		TCGA-IB-AAUO-01A-12D-A38G-08	0.522	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	1	0	1	2	2	2	2	0	0	0	0	234	234	234	231	1	1.860000	-3.318829	1	0.380000	NM_004247		0	85	85	0	520	504	1		1	1		0	0	234	0	0	1.000000	1	0	70	0	262	0	85	520
WSCD1	23302	broad.mit.edu	37	17	6023840	6023840	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:6023840G>A	ENST00000574946.1	+	9	1977	c.1587G>A	c.(1585-1587)cgG>cgA	p.R529R	WSCD1_ENST00000573634.1_Silent_p.R413R|WSCD1_ENST00000317744.5_Silent_p.R529R|WSCD1_ENST00000539421.1_Silent_p.R529R|WSCD1_ENST00000574232.1_Silent_p.R529R			Q658N2	WSCD1_HUMAN	WSC domain containing 1	529						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						GCAGCTTCCGGCGGCGCGGCC	0.647																																						ENST00000574946.1	1.000000	0.870000	1.000000	0.950000	0.990000	0.982674	0.990000	1.000000																										0				35						c.(1585-1587)cgG>cgA		WSC domain containing 1							58.0	60.0	59.0					17																	6023840		2202	4300	6502	SO:0001819	synonymous_variant	23302	0	0					g.chr17:6023840G>A		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1587G>A	chr17.hg19:g.6023840G>A		1					WSCD1_ENST00000573634.1_Silent_p.R413R|WSCD1_ENST00000539421.1_Silent_p.R529R|WSCD1_ENST00000317744.5_Silent_p.R529R|WSCD1_ENST00000574232.1_Silent_p.R529R	p.R529R			0	1	1	1.701426	Q658N2	WSCD1_HUMAN		9	1977	+			A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	1	1	hg19	c.1587G>A	CCDS32538.1	1																																																																																								0.246933		TCGA-IB-AAUO-01A-12D-A38G-08	0.647	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	1	0	1	2	2	2	2	0	0	0	0	102	102	102	98	1	1.860000	-20.000000	1	0.380000	NM_015253		0	65	64	0	173	166	1		1			0	0	102	0	0	1.000000	0	0	0	0	0	0	65	173
LPO	4025	broad.mit.edu	37	17	56345237	56345237	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:56345237C>T	ENST00000262290.4	+	13	2337	c.2021C>T	c.(2020-2022)aCc>aTc	p.T674I	LPO_ENST00000543544.1_Missense_Mutation_p.T615I|LPO_ENST00000421678.2_Missense_Mutation_p.T591I|LPO_ENST00000582328.1_Missense_Mutation_p.T591I	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	674					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TGTGACAACACCCGCATCACC	0.557																																						ENST00000262290.4	1.000000	0.820000	1.000000	0.920000	0.990000	0.973526	0.990000	1.000000																										0				30						c.(2020-2022)aCc>aTc		lactoperoxidase							114.0	99.0	104.0					17																	56345237		2203	4300	6503	SO:0001583	missense	4025	0	0					g.chr17:56345237C>T	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.2021C>T	chr17.hg19:g.56345237C>T	ENSP00000262290:p.Thr674Ile	0					LPO_ENST00000543544.1_Missense_Mutation_p.T615I|LPO_ENST00000582328.1_Missense_Mutation_p.T591I|LPO_ENST00000421678.2_Missense_Mutation_p.T591I	p.T674I	NM_006151.2	NP_006142.1	1	2	3	2.114584	P22079	PERL_HUMAN		13	2337	+			A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	ENST00000262290.4	1	1	hg19	c.2021C>T	CCDS32689.1	1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992253	0.93167	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.71817	-0.6;-0.6;-0.6	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.046101	0.85682	D	0.000000	D	0.86994	0.6067	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.89017	0.3432	10	0.72032	D	0.01	-33.3127	17.9786	0.89133	0.0:1.0:0.0:0.0	.	591;674	E7EMJ3;P22079	.;PERL_HUMAN	I	674;591;615;419	ENSP00000262290:T674I;ENSP00000400245:T591I;ENSP00000445344:T615I	ENSP00000262290:T674I	T	+	2	0	0	LPO	53700236	53700236	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.267000	0.78462	2.591000	0.87537	0.655000	0.94253	ACC	0.389283		TCGA-IB-AAUO-01A-12D-A38G-08	0.557	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1	1	0	1	2	2	2	2	0	0	0	0	148	148	148	147	1	1.860000	-20.000000	1	0.380000			0	68	66	0	284	279	1		1			0	0	148	0	0	1.000000	0	0	0	0	0	0	68	284
ENPP7	339221	broad.mit.edu	37	17	77709028	77709028	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr17:77709028G>A	ENST00000328313.5	+	3	807	c.586G>A	c.(586-588)Ggg>Agg	p.G196R		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			ACTCTACTTCGGGGAGCCGGA	0.627																																						ENST00000328313.5	1.000000	0.060000	0.290000	0.110000	0.180000	0.243320	0.180000	0.160000																										0				34						c.(586-588)Ggg>Agg		ectonucleotide pyrophosphatase/phosphodiesterase 7							63.0	52.0	56.0					17																	77709028		2203	4300	6503	SO:0001583	missense	339221	0	0					g.chr17:77709028G>A	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.586G>A	chr17.hg19:g.77709028G>A	ENSP00000332656:p.Gly196Arg	0						p.G196R	NM_178543.3	NP_848638.3	1	2	3	2.114584			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)	3	807	+				Missense_Mutation	SNP	ENST00000328313.5	1	1	hg19	c.586G>A	CCDS11763.1	0	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179033	0.57692	.	.	ENSG00000182156	ENST00000328313	T	0.71698	-0.59	4.75	3.76	0.43208	4.75	3.76	0.43208	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.058821	0.64402	D	0.000002	T	0.72350	0.3449	L	0.60845	1.875	0.80722	D	1	D	0.58620	0.983	P	0.49451	0.611	T	0.72950	-0.4136	10	0.42905	T	0.14	-33.0178	14.1159	0.65154	0.0:0.0:0.8483:0.1517	.	196	Q6UWV6	ENPP7_HUMAN	R	196	ENSP00000332656:G196R	ENSP00000332656:G196R	G	+	1	0	0	ENPP7	75323623	75323623	1.000000	0.71417	0.978000	0.43139	0.346000	0.29079	7.909000	0.87444	0.962000	0.38057	0.591000	0.81541	GGG	0.389283		TCGA-IB-AAUO-01A-12D-A38G-08	0.627	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	1.860000	-3.522876	1	0.380000	NM_178543		0	5	5	0	159	155	0		1			0	0	66	0	0	0.934398	0	0	0	0	0	0	5	159
SERPINB10	5273	broad.mit.edu	37	18	61602106	61602106	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr18:61602106A>C	ENST00000238508.3	+	8	883	c.824A>C	c.(823-825)gAg>gCg	p.E275A	AC009802.1_ENST00000599868.1_Intron	NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	275					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				AAGCTGAATGAGTGGACCAGT	0.438																																						ENST00000238508.3	1.000000	0.710000	1.000000	0.820000	0.930000	0.918748	0.930000	1.000000																										0				24						c.(823-825)gAg>gCg		serpin peptidase inhibitor, clade B (ovalbumin), member 10							122.0	117.0	119.0					18																	61602106		2203	4300	6503	SO:0001583	missense	5273	0	0					g.chr18:61602106A>C	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.824A>C	chr18.hg19:g.61602106A>C	ENSP00000238508:p.Glu275Ala	0					AC009802.1_ENST00000599868.1_Intron	p.E275A	NM_005024.1	NP_005015.1	0	0	0	2.047911	P48595	SPB10_HUMAN		8	883	+		Esophageal squamous(42;0.131)	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	1	1	hg19	c.824A>C	CCDS11990.1	1	.	.	.	.	.	.	.	.	.	.	A	4.321	0.059004	0.08339	.	.	ENSG00000242550	ENST00000238508	D	0.84589	-1.87	5.53	3.07	0.35406	5.53	3.07	0.35406	Serpin domain (3);	0.291996	0.37623	N	0.002012	T	0.75649	0.3878	L	0.43701	1.375	0.36153	D	0.847574	B	0.28419	0.211	B	0.28465	0.09	T	0.66976	-0.5787	10	0.12766	T	0.61	.	7.9103	0.29787	0.7907:0.1376:0.0717:0.0	.	275	P48595	SPB10_HUMAN	A	275	ENSP00000238508:E275A	ENSP00000238508:E275A	E	+	2	0	0	SERPINB10	59753086	59753086	0.078000	0.21339	0.629000	0.29254	0.699000	0.40488	1.977000	0.40589	0.446000	0.26666	0.533000	0.62120	GAG	0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.438	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	1	0	1	2	2	2	2	0	0	0	0	120	120	120	120	1	1.860000	-20.000000	1	0.380000	NM_005024		0	52	51	0	239	232	1		1			0	0	120	0	0	1.000000	0	0	0	0	0	0	52	239
DAPK3	1613	broad.mit.edu	37	19	3964300	3964300	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr19:3964300C>T	ENST00000545797.2	-	4	738	c.495G>A	c.(493-495)gcG>gcA	p.A165A	DAPK3_ENST00000301264.3_Silent_p.A165A|MIR637_ENST00000385000.1_RNA			O43293	DAPK3_HUMAN	death-associated protein kinase 3	165	Activation segment. {ECO:0000250|UniProtKB:O96017}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|chromatin modification (GO:0016568)|cytokinesis (GO:0000910)|intracellular signal transduction (GO:0035556)|negative regulation of translation (GO:0017148)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of cell motility (GO:2000145)|regulation of focal adhesion assembly (GO:0051893)|regulation of mitosis (GO:0007088)|regulation of mitotic cell cycle (GO:0007346)|regulation of smooth muscle contraction (GO:0006940)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|leucine zipper domain binding (GO:0043522)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CGATCTTGTGCGCGATGCCGA	0.622																																						ENST00000545797.2	1.000000	0.040000	0.230000	0.080000	0.130000	0.181860	0.130000	0.120000																										0				21						c.(493-495)gcG>gcA		death-associated protein kinase 3							213.0	133.0	160.0					19																	3964300		2203	4300	6503	SO:0001819	synonymous_variant	1613	6	121392	30				g.chr19:3964300C>T	AB007144	CCDS12116.1	19p13.3	2008-02-05				ENSG00000167657			2676	protein-coding gene	gene with protein product		603289				9488481	Standard	XM_005259508		Approved	ZIP, ZIPK	uc002lzc.1	O43293		ENST00000545797.2:c.495G>A	chr19.hg19:g.3964300C>T		0					MIR637_ENST00000385000.1_RNA|DAPK3_ENST00000301264.3_Silent_p.A165A	p.A165A			1	2	3	2.086690	O43293	DAPK3_HUMAN		4	738	-		Hepatocellular(1079;0.137)	A0AVN4|B3KQE2|Q05JY4	Silent	SNP	ENST00000545797.2	0	1	hg19	c.495G>A	CCDS12116.1	0																																																																																								0.385835		TCGA-IB-AAUO-01A-12D-A38G-08	0.622	DAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457817.2	0	0	1	2	2	2	2	0	0	0	0	49	49	49	46	1	1.860000	-2.691923	1	0.380000	NM_001348		0	4	4	0	170	165	0		1	0		0	0	49	0	0	0.884336	9.785343e-01	0	1	0	325	0	4	170
ZNF653	115950	broad.mit.edu	37	19	11596490	11596490	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr19:11596490C>T	ENST00000293771.5	-	7	1687	c.1551G>A	c.(1549-1551)cgG>cgA	p.R517R	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						TGATCATGTGCCGCCGCAGGT	0.592																																					Pancreas(83;980 1446 4542 6441 43352)	ENST00000293771.5	1.000000	0.040000	0.170000	0.070000	0.110000	0.153914	0.110000	0.100000																										0				17						c.(1549-1551)cgG>cgA		zinc finger protein 653							156.0	137.0	143.0					19																	11596490		2203	4300	6503	SO:0001819	synonymous_variant	115950	0	0					g.chr19:11596490C>T	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1551G>A	chr19.hg19:g.11596490C>T		0					CTC-398G3.6_ENST00000585656.1_Intron	p.R517R	NM_138783.3	NP_620138.2	1	2	3	2.086690	Q96CK0	ZN653_HUMAN		7	1687	-			Q96AS7	Silent	SNP	ENST00000293771.5	0	1	hg19	c.1551G>A	CCDS12261.1	0																																																																																								0.385835		TCGA-IB-AAUO-01A-12D-A38G-08	0.592	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	0	0	1	2	2	2	2	0	0	0	0	133	133	133	133	1	1.860000	-2.527964	1	0.380000	NM_138783		0	6	5	0	299	290	0		1	0		0	0	133	0	0	0.961623	2.334933e-01	0	0	0	40	0	6	299
PSG3	5671	broad.mit.edu	37	19	43237204	43237204	+	Silent	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr19:43237204G>T	ENST00000327495.5	-	3	625	c.441C>A	c.(439-441)ccC>ccA	p.P147P	PSG3_ENST00000490592.1_5'Flank|PSG3_ENST00000595140.1_Silent_p.P147P	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	147	Ig-like C2-type 1.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TGGAGGGCTTGGGAGTCTCCA	0.522																																						ENST00000327495.5	1.000000	0.800000	1.000000	0.870000	0.940000	0.937454	0.940000	1.000000																										0				36						c.(439-441)ccC>ccA		pregnancy specific beta-1-glycoprotein 3							136.0	138.0	137.0					19																	43237204		2203	4300	6503	SO:0001819	synonymous_variant	5671	0	0					g.chr19:43237204G>T		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.441C>A	chr19.hg19:g.43237204G>T		0					PSG3_ENST00000490592.1_5'Flank|PSG3_ENST00000595140.1_Silent_p.P147P	p.P147P	NM_021016.3	NP_066296.2	1	2	3	2.077877	Q16557	PSG3_HUMAN		3	625	-		Prostate(69;0.00682)	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Silent	SNP	ENST00000327495.5	1	1	hg19	c.441C>A	CCDS12611.1	1																																																																																								0.384676		TCGA-IB-AAUO-01A-12D-A38G-08	0.522	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	1	0	1	2	2	2	2	0	0	0	0	380	380	380	417	1	1.860000	-2.689206	1	0.380000	NM_021016		0	151	141	0	699	676	0		1			0	0	380	0	0	1.000000	0	0	0	0	0	0	151	699
MBD3L1	85509	broad.mit.edu	37	19	8953738	8953738	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr19:8953738G>A	ENST00000595891.1	+	3	615	c.384G>A	c.(382-384)gcG>gcA	p.A128A	MBD3L1_ENST00000305625.2_Silent_p.A128A			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						CTTCAGATGCGGTGGAGATAA	0.522																																						ENST00000595891.1	1.000000	0.510000	0.980000	0.640000	0.790000	0.796399	0.790000	1.000000																										0				12						c.(382-384)gcG>gcA		methyl-CpG binding domain protein 3-like 1							56.0	46.0	50.0					19																	8953738		2203	4300	6503	SO:0001819	synonymous_variant	85509	1	121412	29				g.chr19:8953738G>A	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.384G>A	chr19.hg19:g.8953738G>A		0					MBD3L1_ENST00000305625.2_Silent_p.A128A	p.A128A			1	2	3	2.086690	Q8WWY6	MB3L1_HUMAN		3	615	+			B5BUM6|Q2M291	Silent	SNP	ENST00000595891.1	1	1	hg19	c.384G>A	CCDS12209.1	0																																																																																								0.385835		TCGA-IB-AAUO-01A-12D-A38G-08	0.522	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459973.1	0	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.860000	-3.169665	1	0.380000	NM_145208		0	21	21	0	122	119	1		1			0	0	44	0	0	0.999998	0	0	0	0	0	0	21	122
MUC16	94025	broad.mit.edu	37	19	9074660	9074660	+	Silent	SNP	G	G	T	rs377588927		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr19:9074660G>T	ENST00000397910.4	-	3	12989	c.12786C>A	c.(12784-12786)atC>atA	p.I4262I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4264	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TATGGCCTGGGATAGGAGAAT	0.468																																						ENST00000397910.4	1.000000	0.060000	0.220000	0.090000	0.140000	0.190207	0.140000	0.140000																										0				590						c.(12784-12786)atC>atA		mucin 16, cell surface associated							126.0	125.0	125.0					19																	9074660		2010	4166	6176	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9074660G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12786C>A	chr19.hg19:g.9074660G>T		0						p.I4262I	NM_024690.2	NP_078966.2	1	2	3	2.086690	Q8WXI7	MUC16_HUMAN		3	12989	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.12786C>A	CCDS54212.1	0																																																																																								0.385835		TCGA-IB-AAUO-01A-12D-A38G-08	0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	114	114	114	113	1	1.860000	-7.963883	1	0.380000	NM_024690		0	7	7	0	258	252	0		1	0		0	0	114	0	0	0.979368	0	0	0	0	1	0	7	258
ZNF667	63934	broad.mit.edu	37	19	56953041	56953041	+	Silent	SNP	T	T	C			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr19:56953041T>C	ENST00000504904.3	-	7	2042	c.1323A>G	c.(1321-1323)aaA>aaG	p.K441K	ZNF667_ENST00000292069.6_Silent_p.K441K|ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000342634.3_Silent_p.K569K			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		ATTTGAAAGGTTTCTCTTCAG	0.338																																						ENST00000504904.3	1.000000	0.070000	0.200000	0.100000	0.140000	0.179382	0.140000	0.140000																										0				38						c.(1321-1323)aaA>aaG		zinc finger protein 667							47.0	48.0	48.0					19																	56953041		2203	4300	6503	SO:0001819	synonymous_variant	63934	0	0					g.chr19:56953041T>C		CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1323A>G	chr19.hg19:g.56953041T>C		0					ZNF667_ENST00000292069.6_Silent_p.K441K|ZNF667_ENST00000342634.3_Silent_p.K569K|ZNF667_ENST00000591790.1_3'UTR	p.K441K			1	2	3	2.081337	Q5HYK9	ZN667_HUMAN		7	2042	-		Colorectal(82;0.000256)|Ovarian(87;0.243)	B2RMS6|B9EK36|Q6B093|Q9H807	Silent	SNP	ENST00000504904.3	1	1	hg19	c.1323A>G	CCDS12944.1	0																																																																																								0.384676		TCGA-IB-AAUO-01A-12D-A38G-08	0.338	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458394.1	0	0	1	2	2	2	2	0	0	0	0	164	164	164	163	1	1.860000	-3.468115	1	0.380000	NM_022103		0	12	12	0	429	420	0		1			0	0	164	0	0	0.999026	0	0	0	0	0	0	12	429
CLCNKB	1188	broad.mit.edu	37	1	16374889	16374889	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr1:16374889C>T	ENST00000375679.4	+	6	661	c.550C>T	c.(550-552)Cgc>Tgc	p.R184C	CLCNKB_ENST00000375667.3_5'Flank	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	184					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCGTGTGCGCACCACGAC	0.662																																						ENST00000375679.4	0.270000	0.040000	0.200000	0.070000	0.120000	0.140263	0.120000	0.110000																										0				21						c.(550-552)Cgc>Tgc		chloride channel, voltage-sensitive Kb							57.0	57.0	57.0					1																	16374889		2203	4300	6503	SO:0001583	missense	1188	0	0					g.chr1:16374889C>T	AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.550C>T	chr1.hg19:g.16374889C>T	ENSP00000364831:p.Arg184Cys	1					CLCNKB_ENST00000375667.3_5'Flank	p.R184C	NM_000085.4	NP_000076.2	0	1	1	1.708494	P51801	CLCKB_HUMAN		6	661	+		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	B3KUY3|Q5T5Q7|Q5T5Q8	Missense_Mutation	SNP	ENST00000375679.4	0	1	hg19	c.550C>T	CCDS168.1	0	.	.	.	.	.	.	.	.	.	.	c	18.37	3.608384	0.66558	.	.	ENSG00000184908	ENST00000375679;ENST00000331579	D	0.92911	-3.13	4.68	3.69	0.42338	4.68	3.69	0.42338	Chloride channel, core (2);	0.349083	0.30649	N	0.009166	D	0.86456	0.5937	L	0.38649	1.16	0.80722	D	1	B	0.20052	0.041	B	0.21151	0.033	D	0.84245	0.0474	10	0.87932	D	0	.	8.4362	0.32789	0.2762:0.5817:0.1421:0.0	.	184	P51801	CLCKB_HUMAN	C	184	ENSP00000364831:R184C	ENSP00000332055:R184C	R	+	1	0	0	CLCNKB	16247476	16247476	1.000000	0.71417	0.627000	0.29227	0.928000	0.56348	2.311000	0.43717	2.139000	0.66308	0.655000	0.94253	CGC	0.236359		TCGA-IB-AAUO-01A-12D-A38G-08	0.662	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	96	1	1.860000	-2.811024	1	0.380000	NM_000085		0	4	4	0	143	138	0		1			0	0	84	0	0	0.883130	0	0	0	0	0	0	4	143
ADAMTSL4	54507	broad.mit.edu	37	1	150530955	150530955	+	Missense_Mutation	SNP	G	G	A	rs138636937		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr1:150530955G>A	ENST00000369038.2	+	13	2590	c.2389G>A	c.(2389-2391)Gtg>Atg	p.V797M	ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.V820M|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.V797M|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.V797M			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	797	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TCAGTGCTCCGTGCGGTGCGG	0.647																																						ENST00000369038.2	1.000000	0.920000	1.000000	0.990000	0.990000	0.995769	0.990000	1.000000																										0				32						c.(2389-2391)Gtg>Atg		ADAMTS-like 4		G	MET/VAL,MET/VAL	0,4404		0,0,2202	27.0	30.0	29.0		2389,2389	4.9	0.8	1	dbSNP_134	29	1,8593		0,1,4296	no	missense,missense	ADAMTSL4	NM_019032.4,NM_025008.3	21,21	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	797/1075,797/878	150530955	1,12997	2202	4297	6499	SO:0001583	missense	54507	7	121388	37				g.chr1:150530955G>A	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2389G>A	chr1.hg19:g.150530955G>A	ENSP00000358034:p.Val797Met	0					ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.V820M|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.V797M|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.V797M	p.V797M			0	0	0	2.041409	Q6UY14	ATL4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)	13	2590	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	1	1	hg19	c.2389G>A	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516530	0.64634	0.0	1.16E-4	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	4.91	4.91	0.64330	4.91	4.91	0.64330	.	.	.	.	.	T	0.79924	0.4530	M	0.90198	3.095	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.996;0.997;0.992	D	0.83613	0.0135	9	0.66056	D	0.02	.	15.633	0.76926	0.0:0.0:1.0:0.0	.	758;820;797;797	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	M	797;797;335;820;797	ENSP00000358037:V797M;ENSP00000271643:V797M;ENSP00000358035:V820M;ENSP00000358034:V797M	ENSP00000271643:V797M	V	+	1	0	0	ADAMTSL4	148797579	148797579	1.000000	0.71417	0.776000	0.31678	0.216000	0.24613	9.034000	0.93747	2.549000	0.85964	0.462000	0.41574	GTG	0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.647	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	1	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.860000	-20.000000	1	0.380000	NM_019032		0	37	36	0	117	109	1		1	1		0	0	68	0	0	1.000000	9.996079e-01	0	16	0	26	0	37	117
TDRD5	163589	broad.mit.edu	37	1	179604922	179604922	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr1:179604922G>T	ENST00000367614.1	+	9	1779	c.1420G>T	c.(1420-1422)Ggg>Tgg	p.G474W	TDRD5_ENST00000444136.1_Missense_Mutation_p.G474W|TDRD5_ENST00000294848.8_Missense_Mutation_p.G474W	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	474					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TTCCCTCATAGGGGTCTTTGT	0.463																																						ENST00000367614.1	0.840000	0.440000	0.730000	0.520000	0.620000	0.632074	0.620000	0.620000																										0				77						c.(1420-1422)Ggg>Tgg		tudor domain containing 5							100.0	94.0	96.0					1																	179604922		2203	4300	6503	SO:0001583	missense	163589	0	0					g.chr1:179604922G>T	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1420G>T	chr1.hg19:g.179604922G>T	ENSP00000356586:p.Gly474Trp	0					TDRD5_ENST00000294848.8_Missense_Mutation_p.G474W|TDRD5_ENST00000444136.1_Missense_Mutation_p.G474W	p.G474W	NM_001199091.1	NP_001186020.1	1	2	3	2.057212	Q8NAT2	TDRD5_HUMAN		9	1779	+			A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	1	1	hg19	c.1420G>T	CCDS1332.1	0	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058568	0.76074	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.09723	2.95;2.95;2.95	4.94	4.94	0.65067	4.94	4.94	0.65067	Maternal tudor protein (1);	0.299142	0.33272	N	0.005083	T	0.28797	0.0714	L	0.52011	1.625	0.46203	D	0.998927	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01309	-1.1389	10	0.72032	D	0.01	-19.4684	16.7233	0.85415	0.0:0.0:1.0:0.0	.	474;474	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	W	474	ENSP00000356586:G474W;ENSP00000294848:G474W;ENSP00000406052:G474W	ENSP00000294848:G474W	G	+	1	0	0	TDRD5	177871545	177871545	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.639000	0.74314	2.279000	0.76181	0.585000	0.79938	GGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.463	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	1.860000	-2.879535	1	0.380000	NM_173533		0	33	32	0	247	242	1		1			0	0	107	0	0	1.000000	0	0	0	0	0	0	33	247
EXTL1	2134	broad.mit.edu	37	1	26359784	26359784	+	Missense_Mutation	SNP	G	G	A	rs376982523		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr1:26359784G>A	ENST00000374280.3	+	8	2363	c.1496G>A	c.(1495-1497)cGc>cAc	p.R499H		NM_004455.2	NP_004446.2	Q92935	EXTL1_HUMAN	exostosin-like glycosyltransferase 1	499					protein glycosylation (GO:0006486)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|stomach(1)|urinary_tract(1)	23		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		CTCGATGCCCGCAGCAGTCTT	0.597																																						ENST00000374280.3	0.250000	0.030000	0.180000	0.060000	0.110000	0.128130	0.110000	0.100000																										0				23						c.(1495-1497)cGc>cAc		exostosin-like glycosyltransferase 1		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	69.0	71.0		1496	3.9	1.0	1		71	0,8600		0,0,4300	no	missense	EXTL1	NM_004455.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	499/677	26359784	1,13005	2203	4300	6503	SO:0001583	missense	2134	3	121412	38				g.chr1:26359784G>A	U67191	CCDS271.1	1p36.1	2013-03-01	2013-03-01		ENSG00000158008	ENSG00000158008	2.4.1.224	"""Exostosin glycosyltransferase family"""	3515	protein-coding gene	gene with protein product	"""glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""alpha-N-acetylglucosaminyltransferase II"", ""glucuronyl-N-acetylglucosaminylproteoglycan alpha-1,4-N- acetylglucosaminyltransferase"", ""exostosin-L"""	601738	"""exostoses (multiple)-like 1"""			9037597	Standard	NM_004455		Approved	EXTL, MGC70794	uc001blf.3	Q92935	OTTHUMG00000007509	ENST00000374280.3:c.1496G>A	chr1.hg19:g.26359784G>A	ENSP00000363398:p.Arg499His	1						p.R499H	NM_004455.2	NP_004446.2	0	1	1	1.713541	Q92935	EXTL1_HUMAN		8	2363	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	Q6GSC1	Missense_Mutation	SNP	ENST00000374280.3	0	1	hg19	c.1496G>A	CCDS271.1	0	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464549	0.43736	2.27E-4	0.0	ENSG00000158008	ENST00000374280	T	0.75704	-0.96	5.06	3.93	0.45458	5.06	3.93	0.45458	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.323633	0.33092	N	0.005297	T	0.36496	0.0969	N	0.00237	-1.79	0.27362	N	0.955932	B	0.09022	0.002	B	0.09377	0.004	T	0.37686	-0.9695	10	0.51188	T	0.08	-12.2433	7.0466	0.25048	0.8869:0.0:0.1131:0.0	.	499	Q92935	EXTL1_HUMAN	H	499	ENSP00000363398:R499H	ENSP00000363398:R499H	R	+	2	0	0	EXTL1	26232371	26232371	1.000000	0.71417	0.991000	0.47740	0.940000	0.58332	6.140000	0.71738	0.950000	0.37743	0.561000	0.74099	CGC	0.234568		TCGA-IB-AAUO-01A-12D-A38G-08	0.597	EXTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019749.1	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.860000	-3.108916	1	0.380000	NM_004455		0	4	4	0	157	156	0		1	0		0	0	87	0	0	0.889902	3.271530e-03	0	0	0	3	0	4	157
OPRD1	4985	broad.mit.edu	37	1	29185499	29185499	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr1:29185499C>T	ENST00000234961.2	+	2	503	c.261C>T	c.(259-261)taC>taT	p.Y87Y		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	87					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCAACATCTACATCTTCAACC	0.493																																						ENST00000234961.2	0.170000	0.040000	0.130000	0.060000	0.090000	0.101666	0.090000	0.090000																										0				15						c.(259-261)taC>taT		opioid receptor, delta 1	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)						114.0	115.0	114.0					1																	29185499		2203	4300	6503	SO:0001819	synonymous_variant	4985	0	0					g.chr1:29185499C>T	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.261C>T	chr1.hg19:g.29185499C>T		1						p.Y87Y	NM_000911.3	NP_000902.3	0	1	1	1.713541	P41143	OPRD_HUMAN		2	503	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	B5B0B8	Silent	SNP	ENST00000234961.2	0	1	hg19	c.261C>T	CCDS329.1	0																																																																																								0.234568		TCGA-IB-AAUO-01A-12D-A38G-08	0.493	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	0	0	1	2	2	2	2	0	0	0	0	189	189	189	186	1	1.860000	-3.115331	1	0.380000	NM_000911		0	9	9	0	405	397	0		1			0	0	189	0	0	0.993805	0	0	0	0	0	0	9	405
PLXNA2	5362	broad.mit.edu	37	1	208276511	208276511	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr1:208276511A>G	ENST00000367033.3	-	5	2345	c.1588T>C	c.(1588-1590)Tgg>Cgg	p.W530R		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	530					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGGGCACACCAGCCACAGTGA	0.547																																						ENST00000367033.3	1.000000	0.630000	1.000000	0.800000	0.990000	0.925065	0.990000	1.000000																										0				80						c.(1588-1590)Tgg>Cgg		plexin A2							68.0	60.0	63.0					1																	208276511		2203	4300	6503	SO:0001583	missense	5362	0	0					g.chr1:208276511A>G	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1588T>C	chr1.hg19:g.208276511A>G	ENSP00000356000:p.Trp530Arg	0						p.W530R	NM_025179.3	NP_079455.3	1	2	3	2.063294	O75051	PLXA2_HUMAN		5	2345	-			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	1	1	hg19	c.1588T>C	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220286	0.79464	.	.	ENSG00000076356	ENST00000367033	D	0.92249	-3.0	4.8	4.8	0.61643	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.97263	0.9105	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98485	1.0607	10	0.87932	D	0	.	14.5136	0.67804	1.0:0.0:0.0:0.0	.	530	O75051	PLXA2_HUMAN	R	530	ENSP00000356000:W530R	ENSP00000356000:W530R	W	-	1	0	0	PLXNA2	206343134	206343134	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.798000	0.91888	2.025000	0.59659	0.533000	0.62120	TGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.547	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.860000	-20.000000	1	0.380000	NM_025179		0	18	17	0	77	75	1		1	1		0	0	41	0	0	0.999988	6.513763e-01	0	6	0	5	0	18	77
PATZ1	23598	broad.mit.edu	37	22	31740473	31740473	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr22:31740473C>T	ENST00000266269.5	-	1	1745	c.1116G>A	c.(1114-1116)cgG>cgA	p.R372R	AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000351933.4_Silent_p.R372R|PATZ1_ENST00000405309.3_Silent_p.R372R|PATZ1_ENST00000215919.3_Silent_p.R372R	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	372					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R372R(2)	EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						ACAGCTTGTGCCGGTTAAGAT	0.582																																						ENST00000266269.5	0.160000	0.020000	0.120000	0.040000	0.070000	0.085161	0.070000	0.070000																									EWSR1/PATZ1(2)	2	Substitution - coding silent(2)	p.R372R(2)	kidney(2)	12						c.(1114-1116)cgG>cgA		POZ (BTB) and AT hook containing zinc finger 1							113.0	108.0	110.0					22																	31740473		2203	4300	6503	SO:0001819	synonymous_variant	23598	1	121412	32				g.chr22:31740473C>T	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1116G>A	chr22.hg19:g.31740473C>T		1					PATZ1_ENST00000215919.3_Silent_p.R372R|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000405309.3_Silent_p.R372R|PATZ1_ENST00000351933.4_Silent_p.R372R	p.R372R	NM_014323.2	NP_055138.2	0	1	1	1.836368	Q9HBE1	PATZ1_HUMAN		1	1745	-			Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Silent	SNP	ENST00000266269.5	0	1	hg19	c.1116G>A	CCDS13894.1	0																																																																																								0.295695		TCGA-IB-AAUO-01A-12D-A38G-08	0.582	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	0	0	1	2	2	2	2	0	0	0	0	143	143	143	141	1	1.860000	-1.974263	0	0.380000	NM_032052		0	5	5	0	317	313	0		1	0		0	0	143	0	0	0.935946	3.387003e-01	0	0	0	66	0	5	317
GREB1	9687	broad.mit.edu	37	2	11780565	11780565	+	Silent	SNP	G	G	A	rs376089071		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:11780565G>A	ENST00000381486.2	+	33	6135	c.5835G>A	c.(5833-5835)acG>acA	p.T1945T	GREB1_ENST00000396123.1_Silent_p.T943T|GREB1_ENST00000234142.5_Silent_p.T1945T	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1945						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TTTTTCTGACGGGACGACACA	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18022	0.0		0.001	False		,,,				2504	0.0				Ovarian(39;850 945 2785 23371 33093)	ENST00000381486.2	0.630000	0.310000	0.550000	0.380000	0.450000	0.469598	0.450000	0.450000																										0				30						c.(5833-5835)acG>acA		growth regulation by estrogen in breast cancer 1		G		1,3893		0,1,1946	78.0	83.0	82.0		5835	-6.8	0.6	2		82	2,8252		0,2,4125	no	coding-synonymous	GREB1	NM_014668.3		0,3,6071	AA,AG,GG		0.0242,0.0257,0.0247		1945/1950	11780565	3,12145	1947	4127	6074	SO:0001819	synonymous_variant	9687	14	120886	45				g.chr2:11780565G>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5835G>A	chr2.hg19:g.11780565G>A		0					GREB1_ENST00000234142.5_Silent_p.T1945T|GREB1_ENST00000396123.1_Silent_p.T943T	p.T1945T	NM_014668.3	NP_055483.2	0	1	1	2.052975	Q4ZG55	GREB1_HUMAN		33	6135	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	ENST00000381486.2	1	1	hg19	c.5835G>A	CCDS42655.1	0																																																																																								0.375252		TCGA-IB-AAUO-01A-12D-A38G-08	0.607	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	1	0	1	2	2	2	2	0	0	0	0	125	125	125	125	1	1.860000	-2.429492	0	0.380000	NM_014668		0	29	29	0	301	296	0		1	0		0	0	125	0	0	1.000000	0	0	0	0	1	0	29	301
IL1RL2	8808	broad.mit.edu	37	2	102851439	102851439	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:102851439C>T	ENST00000264257.2	+	11	1506	c.1380C>T	c.(1378-1380)ggC>ggT	p.G460G	IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000539491.1_Silent_p.G460G|IL1RL2_ENST00000441515.2_Silent_p.G342G	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	460	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TGGGCTTTGGCCTGTTGAAGA	0.488																																						ENST00000264257.2	0.240000	0.030000	0.170000	0.060000	0.110000	0.121860	0.110000	0.100000																										0				26						c.(1378-1380)ggC>ggT		interleukin 1 receptor-like 2							110.0	106.0	107.0					2																	102851439		2203	4300	6503	SO:0001819	synonymous_variant	8808	0	0					g.chr2:102851439C>T	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.1380C>T	chr2.hg19:g.102851439C>T		0					IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000441515.2_Silent_p.G342G|IL1RL2_ENST00000539491.1_Silent_p.G460G	p.G460G	NM_003854.2	NP_003845.2	1	2	3	2.055032	Q9HB29	ILRL2_HUMAN		11	1506	+			A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Silent	SNP	ENST00000264257.2	0	1	hg19	c.1380C>T	CCDS2056.1	0																																																																																								0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.488	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	107	1	1.860000	-2.633924	1	0.380000	NM_003854		0	5	5	0	251	246	0		1	0		0	0	108	0	0	0.934211	3.564281e-03	0	0	0	4	0	5	251
ZDBF2	57683	broad.mit.edu	37	2	207171284	207171284	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:207171284G>T	ENST00000374423.3	+	5	2418	c.2032G>T	c.(2032-2034)Gac>Tac	p.D678Y		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	678							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TCAATTAGCTGACCAGTCTCA	0.428																																						ENST00000374423.3	1.000000	0.590000	0.990000	0.700000	0.840000	0.841017	0.840000	1.000000																										0				95						c.(2032-2034)Gac>Tac		zinc finger, DBF-type containing 2							71.0	70.0	71.0					2																	207171284		1895	4132	6027	SO:0001583	missense	57683	0	0					g.chr2:207171284G>T	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2032G>T	chr2.hg19:g.207171284G>T	ENSP00000363545:p.Asp678Tyr	0						p.D678Y	NM_020923.1	NP_065974.1	1	2	3	2.055032	Q9HCK1	ZDBF2_HUMAN		5	2418	+			Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	1	1	hg19	c.2032G>T	CCDS46501.1	0	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287181	0.40494	.	.	ENSG00000204186	ENST00000374423	T	0.54675	0.56	4.24	3.33	0.38152	4.24	3.33	0.38152	.	0.943578	0.08666	N	0.911684	T	0.57330	0.2046	L	0.34521	1.04	0.09310	N	1	D	0.69078	0.997	P	0.58577	0.841	T	0.47156	-0.9139	10	0.66056	D	0.02	.	9.9562	0.41668	0.0:0.2064:0.7936:0.0	.	678	Q9HCK1	ZDBF2_HUMAN	Y	678	ENSP00000363545:D678Y	ENSP00000363545:D678Y	D	+	1	0	0	ZDBF2	206879529	206879529	0.012000	0.17670	0.014000	0.15608	0.007000	0.05969	1.571000	0.36450	1.318000	0.45170	0.655000	0.94253	GAC	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.428	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.860000	-20.000000	1	0.380000	NM_020923		0	30	29	0	158	155	1		1	0		0	0	54	0	0	1.000000	2.733535e-02	0	0	0	2	0	30	158
PREPL	9581	broad.mit.edu	37	2	44586652	44586652	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:44586652C>T	ENST00000409936.1	-	2	640	c.203G>A	c.(202-204)cGg>cAg	p.R68Q	PREPL_ENST00000409272.1_Missense_Mutation_p.R68Q|PREPL_ENST00000410081.1_Missense_Mutation_p.R68Q|PREPL_ENST00000260648.6_Missense_Mutation_p.R68Q|CAMKMT_ENST00000407131.1_5'Flank|PREPL_ENST00000378511.3_Missense_Mutation_p.R68Q|PREPL_ENST00000409411.1_Intron|CAMKMT_ENST00000402247.1_5'Flank|PREPL_ENST00000409957.1_Intron|PREPL_ENST00000541738.1_Intron|CAMKMT_ENST00000403853.3_5'Flank|PREPL_ENST00000540817.1_Intron|PREPL_ENST00000378520.3_Missense_Mutation_p.R68Q|CAMKMT_ENST00000378494.3_5'Flank	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	68						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGAGAAGCTCCGACTTGGGAT	0.308																																						ENST00000409936.1	1.000000	0.700000	0.920000	0.770000	0.840000	0.849203	0.840000	0.840000																										0				33						c.(202-204)cGg>cAg		prolyl endopeptidase-like							137.0	138.0	137.0					2																	44586652		2203	4300	6503	SO:0001583	missense	9581	1	121412	34				g.chr2:44586652C>T	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.203G>A	chr2.hg19:g.44586652C>T	ENSP00000386543:p.Arg68Gln	0					CAMKMT_ENST00000403853.3_5'Flank|PREPL_ENST00000410081.1_Missense_Mutation_p.R68Q|PREPL_ENST00000540817.1_Intron|PREPL_ENST00000260648.6_Missense_Mutation_p.R68Q|PREPL_ENST00000541738.1_Intron|CAMKMT_ENST00000402247.1_5'Flank|PREPL_ENST00000378520.3_Missense_Mutation_p.R68Q|CAMKMT_ENST00000407131.1_5'Flank|PREPL_ENST00000409411.1_Intron|PREPL_ENST00000409957.1_Intron|PREPL_ENST00000409272.1_Missense_Mutation_p.R68Q|PREPL_ENST00000378511.3_Missense_Mutation_p.R68Q|CAMKMT_ENST00000378494.3_5'Flank	p.R68Q	NM_001171606.1	NP_001165077.1	1	2	3	2.055032	Q4J6C6	PPCEL_HUMAN		2	640	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	1	1	hg19	c.203G>A	CCDS33190.1	0	.	.	.	.	.	.	.	.	.	.	C	23.3	4.400937	0.83120	.	.	ENSG00000138078	ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511;ENST00000438314	.	.	.	5.27	4.38	0.52667	5.27	4.38	0.52667	.	0.251803	0.28409	N	0.015459	T	0.48370	0.1496	N	0.08118	0	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;P	0.77557	0.975;0.99;0.846	T	0.42085	-0.9472	9	0.30854	T	0.27	-13.6207	10.0499	0.42210	0.0:0.907:0.0:0.093	.	68;68;68	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	Q	68	.	ENSP00000260648:R68Q	R	-	2	0	0	PREPL	44440156	44440156	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.885000	0.39678	2.735000	0.93741	0.655000	0.94253	CGG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.308	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	1	0	1	2	2	2	2	0	0	0	0	254	254	254	253	1	1.860000	-2.808899	1	0.380000	NM_006036		0	110	108	0	575	565	1		1	0		0	0	254	0	0	1.000000	4.378813e-01	0	0	0	9	0	110	575
BCL11A	53335	broad.mit.edu	37	2	60688929	60688929	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:60688929G>A	ENST00000335712.6	-	4	1345	c.1118C>T	c.(1117-1119)cCg>cTg	p.P373L	BCL11A_ENST00000356842.4_Missense_Mutation_p.P373L|BCL11A_ENST00000538214.1_Missense_Mutation_p.P339L|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000358510.4_Missense_Mutation_p.P339L|BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000359629.5_Intron	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	373	Pro-rich.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GGACTTGACCGGGGGCTGGGA	0.627			T	IGH@	B-CLL																																	ENST00000335712.6	1.000000	0.690000	1.000000	0.800000	0.910000	0.906756	0.910000	1.000000				Dom	yes			Dom	yes		2	2p13	2p13	53335	T	B-cell CLL/lymphoma 11A				L	L	IGH@		B-CLL		0				59						c.(1117-1119)cCg>cTg		B-cell CLL/lymphoma 11A (zinc finger protein)							45.0	53.0	51.0					2																	60688929		2200	4295	6495	SO:0001583	missense	53335	1	121362	32				g.chr2:60688929G>A	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1118C>T	chr2.hg19:g.60688929G>A	ENSP00000338774:p.Pro373Leu	0					BCL11A_ENST00000538214.1_Missense_Mutation_p.P339L|BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.P339L|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.P373L	p.P373L	NM_022893.3	NP_075044.2	1	2	3	2.055032	Q9H165	BC11A_HUMAN	LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)	4	1345	-			D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	1	1	hg19	c.1118C>T	CCDS1862.1	1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.783620	0.31593	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000335712;ENST00000358510	T;T;T;T	0.10288	2.89;3.11;3.12;3.03	5.74	4.84	0.62591	5.74	4.84	0.62591	.	0.186906	0.46442	D	0.000293	T	0.16471	0.0396	M	0.61703	1.905	0.80722	D	1	B;D;B;P	0.56746	0.334;0.977;0.226;0.652	B;B;B;B	0.43194	0.063;0.411;0.017;0.044	T	0.02126	-1.1209	10	0.54805	T	0.06	-1.7699	16.5742	0.84633	0.0:0.1305:0.8695:0.0	.	339;339;373;373	F5H2Y4;Q9H165-6;Q9H165;D9YZV9	.;.;BC11A_HUMAN;.	L	373;409;339;373;339	ENSP00000349300:P373L;ENSP00000438303:P339L;ENSP00000338774:P373L;ENSP00000351307:P339L	ENSP00000338774:P373L	P	-	2	0	0	BCL11A	60542433	60542433	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.309000	0.65774	1.392000	0.46585	0.655000	0.94253	CCG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.627	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	1	0	1	2	11	2	2	1	1	1	1	99	99	99	96	1	1.860000	-2.492123	0	0.380000	NM_022893		0	47	44	0	222	208	1		1			1	0	99	0	0	1.000000	0	0	0	0	0	0	47	222
DYSF	8291	broad.mit.edu	37	2	71742844	71742844	+	Missense_Mutation	SNP	C	C	T	rs398123802		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:71742844C>T	ENST00000258104.3	+	7	1032	c.755C>T	c.(754-756)aCg>aTg	p.T252M	DYSF_ENST00000409762.1_Missense_Mutation_p.T283M|DYSF_ENST00000409744.1_Missense_Mutation_p.T253M|DYSF_ENST00000409651.1_Missense_Mutation_p.T284M|DYSF_ENST00000410020.3_Missense_Mutation_p.T284M|DYSF_ENST00000410041.1_Missense_Mutation_p.T284M|DYSF_ENST00000413539.2_Missense_Mutation_p.T283M|DYSF_ENST00000429174.2_Missense_Mutation_p.T252M|DYSF_ENST00000409366.1_Missense_Mutation_p.T253M|DYSF_ENST00000394120.2_Missense_Mutation_p.T253M|DYSF_ENST00000409582.3_Missense_Mutation_p.T283M	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	252	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ACCAAGCGGACGCGGATCCAC	0.612																																						ENST00000258104.3	0.400000	0.120000	0.320000	0.170000	0.230000	0.246563	0.230000	0.220000																										0				111						c.(754-756)aCg>aTg		dysferlin							101.0	95.0	97.0					2																	71742844		2203	4300	6503	SO:0001583	missense	8291	0	0					g.chr2:71742844C>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.755C>T	chr2.hg19:g.71742844C>T	ENSP00000258104:p.Thr252Met	0					DYSF_ENST00000429174.2_Missense_Mutation_p.T252M|DYSF_ENST00000410020.3_Missense_Mutation_p.T284M|DYSF_ENST00000413539.2_Missense_Mutation_p.T283M|DYSF_ENST00000409762.1_Missense_Mutation_p.T283M|DYSF_ENST00000409651.1_Missense_Mutation_p.T284M|DYSF_ENST00000409744.1_Missense_Mutation_p.T253M|DYSF_ENST00000409582.3_Missense_Mutation_p.T283M|DYSF_ENST00000409366.1_Missense_Mutation_p.T253M|DYSF_ENST00000394120.2_Missense_Mutation_p.T253M|DYSF_ENST00000410041.1_Missense_Mutation_p.T284M	p.T252M	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	1	2	3	2.055032	O75923	DYSF_HUMAN		7	1032	+			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	1	1	hg19	c.755C>T	CCDS1918.1	0	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899610	0.72754	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57	5.0	5.0	0.66597	5.0	5.0	0.66597	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.98086	0.9369	H	0.95470	3.675	0.53688	D	0.99997	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0;1.0	D	0.99274	1.0894	10	0.87932	D	0	-14.9292	16.1703	0.81808	0.0:1.0:0.0:0.0	.	284;284;253;253;284;253;283;252;283;283;252;252;253;252	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	M	283;283;283;252;252;284;253;253;253;284;284	ENSP00000407046:T283M;ENSP00000387137:T283M;ENSP00000386547:T283M;ENSP00000398305:T252M;ENSP00000258104:T252M;ENSP00000386683:T284M;ENSP00000377678:T253M;ENSP00000386285:T253M;ENSP00000386512:T253M;ENSP00000386881:T284M;ENSP00000386617:T284M	ENSP00000258104:T252M	T	+	2	0	0	DYSF	71596352	71596352	1.000000	0.71417	0.934000	0.37439	0.374000	0.29953	7.351000	0.79395	2.475000	0.83589	0.549000	0.68633	ACG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.612	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	1	0	1	2	2	2	2	0	0	0	0	112	112	112	111	1	1.860000	-12.760410	1	0.380000	NM_003494		0	11	11	0	242	238	0		1	0		0	0	112	0	0	0.998292	1.331951e-02	0	0	0	4	0	11	242
CTNNA2	1496	broad.mit.edu	37	2	79971679	79971679	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:79971679T>G	ENST00000402739.4	+	2	274	c.269T>G	c.(268-270)gTg>gGg	p.V90G	CTNNA2_ENST00000496558.1_Missense_Mutation_p.V90G|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V124G|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V90G|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V90G|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V90G	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	90					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GAAGAGTTGGTGGCTGCTGTA	0.443																																						ENST00000402739.4	0.360000	0.060000	0.260000	0.100000	0.170000	0.185404	0.170000	0.160000																										0				78						c.(268-270)gTg>gGg		catenin (cadherin-associated protein), alpha 2							91.0	96.0	94.0					2																	79971679		2026	4202	6228	SO:0001583	missense	1496	0	0					g.chr2:79971679T>G		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.269T>G	chr2.hg19:g.79971679T>G	ENSP00000384638:p.Val90Gly	0					CTNNA2_ENST00000496558.1_Missense_Mutation_p.V90G|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V90G|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V124G|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V90G|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V90G	p.V90G	NM_001282597.1	NP_001269526.1	1	2	3	2.055032	P26232	CTNA2_HUMAN		2	274	+			B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	0	1	hg19	c.269T>G		0	.	.	.	.	.	.	.	.	.	.	T	16.78	3.219037	0.58560	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000409971;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.140504	0.47852	D	0.000201	T	0.19406	0.0466	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.10497	-1.0627	10	0.15066	T	0.55	.	13.5514	0.61734	0.0:0.0:0.0:1.0	.	90;90;90	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	G	90;90;90;124;90;90;90	ENSP00000418191:V90G;ENSP00000419295:V90G;ENSP00000387073:V90G;ENSP00000355398:V124G;ENSP00000384638:V90G;ENSP00000444675:V90G;ENSP00000441705:V90G	ENSP00000355398:V124G	V	+	2	0	0	CTNNA2	79825187	79825187	1.000000	0.71417	0.964000	0.40570	0.951000	0.60555	6.280000	0.72626	2.091000	0.63221	0.383000	0.25322	GTG	0.381176		TCGA-IB-AAUO-01A-12D-A38G-08	0.443	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	0	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	1.860000	-7.333867	1	0.380000	NM_004389		0	5	5	0	162	156	0		1			0	0	71	0	0	0.932324	0	0	0	0	0	0	5	162
ASB18	401036	broad.mit.edu	37	2	237172977	237172977	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr2:237172977C>T	ENST00000409749.3	-	1	11	c.12G>A	c.(10-12)tcG>tcA	p.S4S	AC079135.1_ENST00000415226.1_RNA	NM_212556.2	NP_997721.2	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box containing 18	4					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					large_intestine(1)|lung(3)|ovary(1)|prostate(1)	6		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		GAAGGTAATCCGAGTTGGACA	0.493																																						ENST00000409749.3	1.000000	0.040000	0.210000	0.080000	0.130000	0.175124	0.130000	0.120000																										0				6						c.(10-12)tcG>tcA		ankyrin repeat and SOCS box containing 18							108.0	102.0	104.0					2																	237172977		1994	4170	6164	SO:0001819	synonymous_variant	401036	1	120908	37				g.chr2:237172977C>T	AK123854	CCDS46548.1	2q37.2	2013-01-10	2011-01-25		ENSG00000182177	ENSG00000182177		"""Ankyrin repeat domain containing"""	19770	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 18"""			12076535	Standard	NM_212556		Approved		uc010znh.2	Q6ZVZ8	OTTHUMG00000153086	ENST00000409749.3:c.12G>A	chr2.hg19:g.237172977C>T		0					AC079135.1_ENST00000415226.1_RNA	p.S4S	NM_212556.2	NP_997721.2	1	2	3	2.084111	Q6ZVZ8	ASB18_HUMAN		1	11	-		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)	B6ZDL7	Silent	SNP	ENST00000409749.3	0	1	hg19	c.12G>A	CCDS46548.1	0																																																																																								0.385835		TCGA-IB-AAUO-01A-12D-A38G-08	0.493	ASB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329436.1	0	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	1.860000	-2.769569	1	0.380000	NM_212556		0	5	5	0	215	213	0		1			0	0	83	0	0	0.936751	0	0	0	0	0	0	5	215
PHLDB2	90102	broad.mit.edu	37	3	111603672	111603672	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr3:111603672G>A	ENST00000431670.2	+	2	1159	c.748G>A	c.(748-750)Gga>Aga	p.G250R	PHLDB2_ENST00000477695.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000412622.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000393923.3_Missense_Mutation_p.G277R|PHLDB2_ENST00000478922.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000481953.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000393925.3_Missense_Mutation_p.G250R	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	250						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						GAGTCACATGGGAGCCTACAG	0.507																																						ENST00000431670.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				55						c.(748-750)Gga>Aga		pleckstrin homology-like domain, family B, member 2							65.0	68.0	67.0					3																	111603672		2203	4300	6503	SO:0001583	missense	90102	0	0					g.chr3:111603672G>A		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.748G>A	chr3.hg19:g.111603672G>A	ENSP00000405405:p.Gly250Arg	1					PHLDB2_ENST00000481953.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000393923.3_Missense_Mutation_p.G277R|PHLDB2_ENST00000393925.3_Missense_Mutation_p.G250R|PHLDB2_ENST00000478922.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000477695.1_Missense_Mutation_p.G250R|PHLDB2_ENST00000412622.1_Missense_Mutation_p.G250R	p.G250R	NM_001134438.1	NP_001127910.1	1	3	4	2.744515	Q86SQ0	PHLB2_HUMAN		2	1159	+			A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	1	1	hg19	c.748G>A	CCDS46886.1	1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815029	0.70912	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.57273	0.44;0.62;0.46;0.41;0.62;0.46	5.4	5.4	0.78164	5.4	5.4	0.78164	.	0.241259	0.41823	D	0.000803	T	0.67988	0.2952	L	0.51422	1.61	0.48185	D	0.999601	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.998;1.0	D;D;D;D;D	0.97110	0.942;1.0;1.0;0.962;0.995	T	0.69320	-0.5176	10	0.72032	D	0.01	.	16.4564	0.84019	0.0:0.0:1.0:0.0	.	250;250;250;250;277	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	R	277;277;250;250;250;250;250;250;250	ENSP00000377500:G277R;ENSP00000405405:G250R;ENSP00000405292:G250R;ENSP00000418296:G250R;ENSP00000377502:G250R;ENSP00000418319:G250R	ENSP00000352764:G277R	G	+	1	0	0	PHLDB2	113086362	113086362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.291000	0.65667	2.703000	0.92315	0.655000	0.94253	GGA	0.530018		TCGA-IB-AAUO-01A-12D-A38G-08	0.507	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	1	0	1	2	2	2	2	0	0	0	0	113	113	113	112	1	1.860000	-17.212780	1	0.380000	NM_145753		0	152	150	0	269	265	1		1	1		0	0	113	0	0	1.000000	9.227752e-01	0	5	0	5	0	152	269
MBD4	8930	broad.mit.edu	37	3	129151965	129151965	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr3:129151965C>T	ENST00000249910.1	-	6	1712	c.1537G>A	c.(1537-1539)Gca>Aca	p.A513T	MBD4_ENST00000429544.2_Missense_Mutation_p.A507T|MBD4_ENST00000503197.1_Missense_Mutation_p.A513T|MBD4_ENST00000507208.1_Missense_Mutation_p.A513T|MBD4_ENST00000509587.1_5'Flank|MBD4_ENST00000393278.2_Missense_Mutation_p.A195T	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	513					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						ATGGTTTTTGCCCGAAGATCG	0.403								Base excision repair (BER), DNA glycosylases																														ENST00000249910.1	1.000000	0.020000	0.160000	0.050000	0.090000	0.203991	0.090000	0.080000																										0				22						c.(1537-1539)Gca>Aca	Base excision repair (BER), DNA glycosylases	methyl-CpG binding domain protein 4							139.0	141.0	140.0					3																	129151965		2203	4300	6503	SO:0001583	missense	8930	0	0					g.chr3:129151965C>T	AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1537G>A	chr3.hg19:g.129151965C>T	ENSP00000249910:p.Ala513Thr	1					MBD4_ENST00000507208.1_Missense_Mutation_p.A513T|MBD4_ENST00000429544.2_Missense_Mutation_p.A507T|MBD4_ENST00000503197.1_Missense_Mutation_p.A513T|MBD4_ENST00000509587.1_5'Flank|MBD4_ENST00000393278.2_Missense_Mutation_p.A195T	p.A513T	NM_003925.1	NP_003916.1	1	3	4	2.765071	O95243	MBD4_HUMAN		6	1712	-			B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	0	1	hg19	c.1537G>A	CCDS3058.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.273592	0.95459	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000393278;ENST00000507208	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	6.14	6.14	0.99180	6.14	6.14	0.99180	HhH-GPD domain (1);DNA glycosylase (2);	0.000000	0.85682	D	0.000000	T	0.81293	0.4792	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D	0.89917	0.996;0.994;0.995;1.0;0.998	D;D;D;D;D	0.91635	0.968;0.945;0.945;0.999;0.98	T	0.80353	-0.1418	10	0.56958	D	0.05	-21.0242	20.4701	0.99162	0.0:1.0:0.0:0.0	.	513;195;507;513;513	E9PEE4;Q2MD36;O95243-2;O95243-3;O95243	.;.;.;.;MBD4_HUMAN	T	507;513;513;195;513	ENSP00000394080:A507T;ENSP00000249910:A513T;ENSP00000424873:A513T;ENSP00000376959:A195T;ENSP00000422327:A513T	ENSP00000249910:A513T	A	-	1	0	0	MBD4	130634655	130634655	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.291000	0.78721	2.937000	0.99478	0.650000	0.86243	GCA	0.531368		TCGA-IB-AAUO-01A-12D-A38G-08	0.403	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	0	0	1	2	2	2	2	0	0	0	0	153	153	153	152	1	1.860000	-2.231298	0	0.380000	NM_003925		0	7	7	0	567	554	0		1	0		0	0	153	0	0	0.979063	7.789249e-01	0	1	0	229	0	7	567
WDR48	57599	broad.mit.edu	37	3	39118643	39118643	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr3:39118643G>A	ENST00000302313.5	+	9	939	c.911G>A	c.(910-912)aGa>aAa	p.R304K	WDR48_ENST00000396258.3_Missense_Mutation_p.R222K|WDR48_ENST00000544962.1_Missense_Mutation_p.R96K|WDR48_ENST00000418020.1_5'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	304					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GAGCTTGATAGATCAGCTGAT	0.373																																						ENST00000302313.5	1.000000	0.650000	0.960000	0.730000	0.830000	0.845776	0.830000	1.000000																										0				15						c.(910-912)aGa>aAa		WD repeat domain 48							110.0	111.0	110.0					3																	39118643		2203	4300	6503	SO:0001583	missense	57599	0	0					g.chr3:39118643G>A	AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.911G>A	chr3.hg19:g.39118643G>A	ENSP00000307491:p.Arg304Lys	0					WDR48_ENST00000418020.1_5'UTR|WDR48_ENST00000396258.3_Missense_Mutation_p.R222K|WDR48_ENST00000544962.1_Missense_Mutation_p.R96K	p.R304K	NM_020839.2	NP_065890.1	1	2	3	2.099036	Q8TAF3	WDR48_HUMAN		9	939	+			B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	ENST00000302313.5	1	1	hg19	c.911G>A	CCDS33738.1	0	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948961	0.53186	.	.	ENSG00000114742	ENST00000302313;ENST00000544962;ENST00000396258	T;D;T	0.87809	2.28;-2.3;2.25	6.16	6.16	0.99307	6.16	6.16	0.99307	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88489	0.6450	N	0.22421	0.69	0.80722	D	1	P;B;B;B	0.47910	0.902;0.046;0.003;0.024	P;B;B;B	0.60173	0.87;0.007;0.001;0.002	D	0.84664	0.0708	10	0.22706	T	0.39	-0.2443	20.8598	0.99761	0.0:0.0:1.0:0.0	.	96;222;295;304	Q8TAF3-5;Q8TAF3-4;Q8TAF3-3;Q8TAF3	.;.;.;WDR48_HUMAN	K	304;96;222	ENSP00000307491:R304K;ENSP00000445187:R96K;ENSP00000379557:R222K	ENSP00000307491:R304K	R	+	2	0	0	WDR48	39093647	39093647	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	9.771000	0.98977	2.937000	0.99478	0.650000	0.86243	AGA	0.388138		TCGA-IB-AAUO-01A-12D-A38G-08	0.373	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342529.1	0	0	1	2	12	2	2	1	1	1	1	122	122	122	122	1	1.860000	-20.000000	1	0.380000	NM_020839		0	60	59	0	324	318	1		1	1		1	0	122	0	0	1.000000	5.352718e-01	0	4	0	7	0	60	324
TRIM42	287015	broad.mit.edu	37	3	140407107	140407107	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr3:140407107G>A	ENST00000286349.3	+	3	1774	c.1583G>A	c.(1582-1584)gGc>gAc	p.G528D		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	528						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CACAGCCTCGGCAACCAGCAC	0.577																																						ENST00000286349.3	1.000000	0.030000	0.190000	0.060000	0.100000	0.216902	0.100000	0.110000																										0				69						c.(1582-1584)gGc>gAc		tripartite motif containing 42							96.0	89.0	91.0					3																	140407107		2203	4300	6503	SO:0001583	missense	287015	0	0					g.chr3:140407107G>A	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1583G>A	chr3.hg19:g.140407107G>A	ENSP00000286349:p.Gly528Asp	1						p.G528D	NM_152616.4	NP_689829.3	1	3	4	2.765071	Q8IWZ5	TRI42_HUMAN		3	1774	+			A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	0	1	hg19	c.1583G>A	CCDS3113.1	0	.	.	.	.	.	.	.	.	.	.	G	6.665	0.491250	0.12702	.	.	ENSG00000155890	ENST00000286349	T	0.36699	1.24	5.52	-4.17	0.03857	5.52	-4.17	0.03857	.	0.998540	0.08106	N	0.996959	T	0.15998	0.0385	N	0.24115	0.695	0.09310	N	0.999991	B	0.02656	0.0	B	0.04013	0.001	T	0.30736	-0.9968	10	0.10111	T	0.7	-11.6821	1.9929	0.03450	0.3788:0.1671:0.3411:0.113	.	528	Q8IWZ5	TRI42_HUMAN	D	528	ENSP00000286349:G528D	ENSP00000286349:G528D	G	+	2	0	0	TRIM42	141889797	141889797	0.000000	0.05858	0.007000	0.13788	0.846000	0.48090	-0.386000	0.07370	-0.646000	0.05452	0.655000	0.94253	GGC	0.531368		TCGA-IB-AAUO-01A-12D-A38G-08	0.577	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	0	0	1	2	11	2	2	1	1	1	1	157	157	157	156	1	1.860000	-2.975212	1	0.380000	NM_152616		0	6	6	0	429	424	0		0		1	1	0	157	892	0	0.156637	0	9.996380e-01	0	19	0	1294	6	429
PPARGC1A	10891	broad.mit.edu	37	4	23830129	23830129	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr4:23830129G>A	ENST00000264867.2	-	5	770	c.651C>T	c.(649-651)aaC>aaT	p.N217N	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	217					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GAGGGTCATCGTTTGTGGTCA	0.468																																					Esophageal Squamous(29;694 744 13796 34866 44181)	ENST00000264867.2	0.160000	0.040000	0.130000	0.070000	0.090000	0.104767	0.090000	0.100000																										0				51						c.(649-651)aaC>aaT		peroxisome proliferator-activated receptor gamma, coactivator 1 alpha							381.0	346.0	357.0					4																	23830129		2203	4300	6503	SO:0001819	synonymous_variant	10891	1	121412	41				g.chr4:23830129G>A	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.651C>T	chr4.hg19:g.23830129G>A		1					PPARGC1A_ENST00000509702.1_5'UTR	p.N217N	NM_013261.3	NP_037393.1	0	1	1	1.801955	Q9UBK2	PRGC1_HUMAN		5	770	-		Breast(46;0.0503)	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Silent	SNP	ENST00000264867.2	1	1	hg19	c.651C>T	CCDS3429.1	0																																																																																								0.292641		TCGA-IB-AAUO-01A-12D-A38G-08	0.468	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	0	0	1	2	2	2	2	0	0	0	0	234	234	234	232	1	1.860000	-2.701458	1	0.380000	NM_013261		0	12	12	0	556	544	0		1			0	0	234	0	0	0.999008	0	0	0	0	0	0	12	556
GRID2	2895	broad.mit.edu	37	4	94376915	94376915	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr4:94376915C>T	ENST00000282020.4	+	11	1906	c.1648C>T	c.(1648-1650)Cga>Tga	p.R550*	GRID2_ENST00000510992.1_Nonsense_Mutation_p.R455*	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	550					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGTACTACTTCGAAGGGCTGA	0.478																																						ENST00000282020.4	0.250000	0.080000	0.210000	0.110000	0.150000	0.164518	0.150000	0.150000																										0				100						c.(1648-1650)Cga>Tga		glutamate receptor, ionotropic, delta 2							196.0	171.0	180.0					4																	94376915		2203	4300	6503	SO:0001587	stop_gained	2895	0	0					g.chr4:94376915C>T	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1648C>T	chr4.hg19:g.94376915C>T	ENSP00000282020:p.Arg550*	1					GRID2_ENST00000510992.1_Nonsense_Mutation_p.R455*	p.R550*	NM_001510.2	NP_001501.2	0	1	1	1.819567	O43424	GRID2_HUMAN		11	1906	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Nonsense_Mutation	SNP	ENST00000282020.4	0	1	hg19	c.1648C>T	CCDS3637.1	0	.	.	.	.	.	.	.	.	.	.	C	41	9.088102	0.99061	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	.	.	.	5.97	5.97	0.96955	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1877	0.73016	0.1408:0.8592:0.0:0.0	.	.	.	.	X	550;455	.	ENSP00000282020:R550X	R	+	1	2	2	GRID2	94595938	94595938	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.461000	0.53035	2.836000	0.97738	0.655000	0.94253	CGA	0.294171		TCGA-IB-AAUO-01A-12D-A38G-08	0.478	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2	0	0	1	2	2	2	2	0	0	0	0	189	189	189	188	1	1.860000	-2.960591	1	0.380000			0	13	12	0	376	367	0		1			0	0	189	0	0	0.999468	0	0	0	0	0	0	13	376
GRID2	2895	broad.mit.edu	37	4	94547520	94547520	+	Missense_Mutation	SNP	T	T	G			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr4:94547520T>G	ENST00000282020.4	+	14	2552	c.2294T>G	c.(2293-2295)gTt>gGt	p.V765G	GRID2_ENST00000510992.1_Missense_Mutation_p.V670G	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	765					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGAAATACTGTTGCTGATCGG	0.388																																						ENST00000282020.4	0.260000	0.100000	0.220000	0.130000	0.170000	0.180657	0.170000	0.170000																										0				100						c.(2293-2295)gTt>gGt		glutamate receptor, ionotropic, delta 2							200.0	177.0	185.0					4																	94547520		2203	4300	6503	SO:0001583	missense	2895	0	0					g.chr4:94547520T>G	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2294T>G	chr4.hg19:g.94547520T>G	ENSP00000282020:p.Val765Gly	1					GRID2_ENST00000510992.1_Missense_Mutation_p.V670G	p.V765G	NM_001510.2	NP_001501.2	0	1	1	1.819567	O43424	GRID2_HUMAN		14	2552	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	1	1	hg19	c.2294T>G	CCDS3637.1	0	.	.	.	.	.	.	.	.	.	.	T	15.69	2.906796	0.52333	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.11604	2.76;2.76	5.13	5.13	0.70059	5.13	5.13	0.70059	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.109275	0.64402	D	0.000006	T	0.11281	0.0275	L	0.34521	1.04	0.80722	D	1	B;B	0.20459	0.045;0.045	B;B	0.21917	0.037;0.037	T	0.05305	-1.0893	10	0.87932	D	0	.	15.2141	0.73250	0.0:0.0:0.0:1.0	.	670;765	E9PH24;O43424	.;GRID2_HUMAN	G	765;670	ENSP00000282020:V765G;ENSP00000421257:V670G	ENSP00000282020:V765G	V	+	2	0	0	GRID2	94766543	94766543	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	4.456000	0.60081	2.055000	0.61198	0.397000	0.26171	GTT	0.294171		TCGA-IB-AAUO-01A-12D-A38G-08	0.388	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2	0	0	1	2	2	2	2	1	1	1	0	224	224	224	223	1	1.860000	-3.854210	1	0.380000			0	20	20	0	513	502	0		1	0		1	0	224	0	0	0.999994	0	0	0	0	1	0	20	513
FAT1	2195	broad.mit.edu	37	4	187510153	187510153	+	Missense_Mutation	SNP	C	C	T	rs367799188		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr4:187510153C>T	ENST00000441802.2	-	27	13569	c.13360G>A	c.(13360-13362)Gaa>Aaa	p.E4454K		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4454					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E4454K(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTGCTGAATTCGGGCGGTAAC	0.527										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	ENST00000441802.2	0.190000	0.080000	0.160000	0.100000	0.120000	0.134470	0.120000	0.130000																										1	Substitution - Missense(1)	p.E4454K(1)	large_intestine(1)	228						c.(13360-13362)Gaa>Aaa		FAT atypical cadherin 1		C	LYS/GLU	0,3870		0,0,1935	237.0	239.0	238.0		13360	5.4	0.2	4		238	1,8265		0,1,4132	no	missense	FAT1	NM_005245.3	56	0,1,6067	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	4454/4589	187510153	1,12135	1935	4133	6068	SO:0001583	missense	2195	1	120870	31				g.chr4:187510153C>T	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.13360G>A	chr4.hg19:g.187510153C>T	ENSP00000406229:p.Glu4454Lys	1	HNSCC(5;0.00058)					p.E4454K	NM_005245.3	NP_005236.2	0	1	1	1.887815	Q14517	FAT1_HUMAN		27	13569	-				Missense_Mutation	SNP	ENST00000441802.2	1	1	hg19	c.13360G>A	CCDS47177.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.74|18.74	3.688735|3.688735	0.68271|0.68271	0.0|0.0	1.21E-4|1.21E-4	ENSG00000083857|ENSG00000083857	ENST00000441802;ENST00000260147|ENST00000512772;ENST00000507105	T|.	0.41400|.	1.0|.	5.37|5.37	5.37|5.37	0.77165|0.77165	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74107|0.74107	0.3673|0.3673	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.70999|0.70999	-0.4719|-0.4719	10|5	0.42905|.	T|.	0.14|.	.|.	19.3098|19.3098	0.94182|0.94182	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4454|.	Q14517|.	FAT1_HUMAN|.	K|Q	4454;4456|233;221	ENSP00000406229:E4454K|.	ENSP00000260147:E4456K|.	E|R	-|-	1|2	0|0	0|0	FAT1|FAT1	187747147|187747147	187747147|187747147	1.000000|1.000000	0.71417|0.71417	0.163000|0.163000	0.22734|0.22734	0.033000|0.033000	0.12548|0.12548	7.111000|7.111000	0.77077|0.77077	2.800000|2.800000	0.96347|0.96347	0.455000|0.455000	0.32223|0.32223	GAA|CGA	0.301723		TCGA-IB-AAUO-01A-12D-A38G-08	0.527	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	0	0	1	2	2	2	2	0	0	0	0	438	438	438	434	1	1.860000	-2.092925	0	0.380000	NM_005245		0	26	25	0	908	883	0		1	1		0	0	438	0	0	1.000000	9.994895e-01	0	29	0	375	0	26	908
ADAMTS12	81792	broad.mit.edu	37	5	33596156	33596156	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr5:33596156C>T	ENST00000504830.1	-	17	2872	c.2537G>A	c.(2536-2538)cGc>cAc	p.R846H	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R761H	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	846	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R846H(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGCAGTTTGGCGGCGGATACC	0.517										HNSCC(64;0.19)																												ENST00000504830.1	0.880000	0.530000	0.800000	0.610000	0.690000	0.709020	0.690000	0.700000																										1	Substitution - Missense(1)	p.R846H(1)	lung(1)	216						c.(2536-2538)cGc>cAc		ADAM metallopeptidase with thrombospondin type 1 motif, 12							120.0	110.0	113.0					5																	33596156		2203	4300	6503	SO:0001583	missense	81792	2	121412	36				g.chr5:33596156C>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2537G>A	chr5.hg19:g.33596156C>T	ENSP00000422554:p.Arg846His	0	HNSCC(64;0.19)				ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R761H|ADAMTS12_ENST00000504582.1_5'UTR	p.R846H	NM_030955.2	NP_112217.2	0	1	1	2.053532	P58397	ATS12_HUMAN		17	2872	-			A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	1	1	hg19	c.2537G>A	CCDS34140.1	0	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010730	0.75046	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.52983	0.64;0.64	5.77	4.9	0.64082	5.77	4.9	0.64082	.	0.196715	0.50627	D	0.000112	T	0.49541	0.1563	L	0.55990	1.75	0.80722	D	1	P;P	0.52577	0.463;0.954	B;P	0.48552	0.067;0.581	T	0.43442	-0.9391	10	0.16420	T	0.52	.	15.3406	0.74293	0.0:0.9327:0.0:0.0673	.	761;846	P58397-3;P58397	.;ATS12_HUMAN	H	846;761	ENSP00000422554:R846H;ENSP00000344847:R761H	ENSP00000344847:R761H	R	-	2	0	0	ADAMTS12	33631913	33631913	0.994000	0.37717	0.987000	0.45799	0.998000	0.95712	2.459000	0.45023	1.582000	0.49881	0.585000	0.79938	CGC	0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.517	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	1	0	1	2	2	2	2	0	0	0	0	133	133	133	131	1	1.860000	-3.222046	1	0.380000	NM_030955		0	52	52	0	337	329	1		1	0		0	0	133	0	0	1.000000	1.867269e-02	0	0	0	2	0	52	337
SGCD	6444	broad.mit.edu	37	5	155771593	155771593	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr5:155771593G>A	ENST00000435422.3	+	2	582	c.95G>A	c.(94-96)cGa>cAa	p.R32Q	SGCD_ENST00000447401.1_Missense_Mutation_p.R33Q|SGCD_ENST00000337851.4_Missense_Mutation_p.R33Q|SGCD_ENST00000517913.1_Missense_Mutation_p.R33Q	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	32					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGCGGAAACGATGCCTGTAT	0.483																																						ENST00000435422.3	0.970000	0.550000	0.860000	0.640000	0.740000	0.758394	0.740000	0.750000																										0				24						c.(94-96)cGa>cAa		sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)							108.0	117.0	114.0					5																	155771593		1959	4133	6092	SO:0001583	missense	6444	0	0					g.chr5:155771593G>A	BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.95G>A	chr5.hg19:g.155771593G>A	ENSP00000403003:p.Arg32Gln	0					SGCD_ENST00000447401.1_Missense_Mutation_p.R33Q|SGCD_ENST00000517913.1_Missense_Mutation_p.R33Q|SGCD_ENST00000337851.4_Missense_Mutation_p.R33Q	p.R32Q	NM_001128209.1	NP_001121681.1	0	1	1	2.049852	Q92629	SGCD_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	2	582	+	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	ENST00000435422.3	1	1	hg19	c.95G>A	CCDS47327.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.719233	0.96839	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.59	5.59	0.84812	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.96981	0.9014	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.83275	0.992;0.986;0.996	D	0.95484	0.8563	10	0.25751	T	0.34	-9.9405	19.6056	0.95580	0.0:0.0:1.0:0.0	.	32;33;33	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	Q	33;32;33;33	ENSP00000429378:R33Q;ENSP00000403003:R32Q;ENSP00000338343:R33Q;ENSP00000408324:R33Q	ENSP00000338343:R33Q	R	+	2	0	0	SGCD	155704171	155704171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.731000	0.98807	2.625000	0.88918	0.655000	0.94253	CGA	0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.483	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3	1	0	1	2	2	2	2	0	0	0	0	95	95	95	94	1	1.860000	-3.322178	1	0.380000			0	40	40	0	240	238	1		1	0		0	0	95	0	0	1.000000	5.781092e-02	0	0	0	3	0	40	240
HIST1H2BF	8343	broad.mit.edu	37	6	26199947	26199947	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr6:26199947G>A	ENST00000359985.1	+	1	200	c.161G>A	c.(160-162)gGc>gAc	p.G54D	HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000377831.5_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	54					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				CCCGACACCGGCATCTCATCC	0.567																																						ENST00000359985.1	0.070000	0.010000	0.050000	0.020000	0.030000	0.040361	0.030000	0.040000																										0				17						c.(160-162)gGc>gAc		histone cluster 1, H2bf							222.0	205.0	211.0					6																	26199947		2203	4300	6503	SO:0001583	missense	8343	0	0					g.chr6:26199947G>A	Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.161G>A	chr6.hg19:g.26199947G>A	ENSP00000353074:p.Gly54Asp	1					HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000377831.5_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank	p.G54D	NM_003522.3	NP_003513.1	0	1	1	1.735691	P62807	H2B1C_HUMAN		1	200	+		all_hematologic(11;0.196)	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000359985.1	0	1	hg19	c.161G>A	CCDS4592.1	0	.	.	.	.	.	.	.	.	.	.	.	16.80	3.222980	0.58668	.	.	ENSG00000197846	ENST00000359985	T	0.69435	-0.4	3.89	3.89	0.44902	3.89	3.89	0.44902	.	0.000000	0.42172	D	0.000755	T	0.73442	0.3587	.	.	.	0.41511	D	0.988346	.	.	.	.	.	.	T	0.78807	-0.2059	7	0.87932	D	0	.	15.7145	0.77658	0.0:0.0:1.0:0.0	.	.	.	.	D	54	ENSP00000353074:G54D	ENSP00000353074:G54D	G	+	2	0	0	HIST1H2BF	26307926	26307926	1.000000	0.71417	0.996000	0.52242	0.014000	0.08584	9.518000	0.98022	2.102000	0.63906	0.650000	0.86243	GGC	0.258905		TCGA-IB-AAUO-01A-12D-A38G-08	0.567	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040108.1	0	0	1	2	2	2	2	0	0	0	0	446	446	446	442	1	1.860000	-1.773335	0	0.380000	NM_003522		0	7	7	0	861	843	0		1	0		0	0	446	0	0	0.979120	5.811399e-03	0	0	0	12	0	7	861
NCR2	9436	broad.mit.edu	37	6	41318497	41318497	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr6:41318497G>A	ENST00000373089.5	+	5	814	c.726G>A	c.(724-726)acG>acA	p.T242T	NCR2_ENST00000373083.4_3'UTR|NCR2_ENST00000373086.3_3'UTR	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	242					cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					aacaggtcacggaccttccct	0.478																																						ENST00000373089.5	0.280000	0.060000	0.210000	0.100000	0.140000	0.161258	0.140000	0.140000																										0				14						c.(724-726)acG>acA		natural cytotoxicity triggering receptor 2							100.0	89.0	93.0					6																	41318497		2203	4300	6503	SO:0001819	synonymous_variant	9436	0	0					g.chr6:41318497G>A	AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.726G>A	chr6.hg19:g.41318497G>A		1					NCR2_ENST00000373086.3_3'UTR|NCR2_ENST00000373083.4_3'UTR	p.T242T	NM_004828.3	NP_004819.2	0	1	1	1.719762	O95944	NCTR2_HUMAN		5	814	+	Ovarian(28;0.0327)|Colorectal(47;0.196)		Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Silent	SNP	ENST00000373089.5	0	1	hg19	c.726G>A	CCDS4855.1	0																																																																																								0.257218		TCGA-IB-AAUO-01A-12D-A38G-08	0.478	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040511.3	0	0	1	2	2	2	2	0	0	0	0	115	115	115	112	1	1.860000	-3.239604	1	0.380000			0	7	7	0	206	204	0		1			0	0	115	0	0	0.980475	0	0	0	0	0	0	7	206
COQ3	51805	broad.mit.edu	37	6	99831606	99831606	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr6:99831606G>A	ENST00000254759.3	-	2	225	c.201C>T	c.(199-201)atC>atT	p.I67I	COQ3_ENST00000369242.1_5'UTR|COQ3_ENST00000479163.1_5'UTR	NM_017421.3	NP_059117.3	Q9NZJ6	COQ3_HUMAN	coenzyme Q3 methyltransferase	67					glycerol metabolic process (GO:0006071)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity (GO:0008425)|3-demethylubiquinone-9 3-O-methyltransferase activity (GO:0008689)|hexaprenyldihydroxybenzoate methyltransferase activity (GO:0004395)|O-methyltransferase activity (GO:0008171)			cervix(1)|lung(5)|upper_aerodigestive_tract(2)	8		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		AACAGGAAAAGATCGTCCTGT	0.338																																						ENST00000254759.3	0.200000	0.080000	0.170000	0.100000	0.130000	0.139851	0.130000	0.130000																										0				8						c.(199-201)atC>atT		coenzyme Q3 methyltransferase							83.0	89.0	87.0					6																	99831606		2203	4299	6502	SO:0001819	synonymous_variant	51805	0	0					g.chr6:99831606G>A	AF193016	CCDS5042.1	6q21	2013-05-01	2013-05-01		ENSG00000132423	ENSG00000132423	2.1.1.114		18175	protein-coding gene	gene with protein product	"""polyprenyldihydroxybenzoate methyltransferase"""	605196	"""coenzyme Q3 homolog, methyltransferase (yeast)"", ""coenzyme Q3 homolog, methyltransferase (S. cerevisiae)"""			10777520	Standard	NM_017421		Approved	bA9819.1	uc003ppk.3	Q9NZJ6	OTTHUMG00000015264	ENST00000254759.3:c.201C>T	chr6.hg19:g.99831606G>A		1					COQ3_ENST00000369242.1_5'UTR|COQ3_ENST00000479163.1_5'UTR	p.I67I	NM_017421.3	NP_059117.3	0	1	1	1.719762	Q9NZJ6	COQ3_HUMAN		2	225	-		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)	B3KPX0|Q5T061|Q6P4F0|Q8IXG6|Q96BG1|Q9H0N1	Silent	SNP	ENST00000254759.3	1	1	hg19	c.201C>T	CCDS5042.1	0																																																																																								0.257218		TCGA-IB-AAUO-01A-12D-A38G-08	0.338	COQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041602.1	0	0	1	2	2	2	2	0	0	0	0	352	352	352	353	1	1.860000	-18.621690	1	0.380000	NM_017421		0	23	23	0	726	712	0		1	0		0	0	352	0	0	0.999999	5.578315e-02	0	1	0	11	0	23	726
TIAM2	26230	broad.mit.edu	37	6	155451469	155451469	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr6:155451469C>T	ENST00000461783.3	+	6	2385	c.1112C>T	c.(1111-1113)gCg>gTg	p.A371V	TIAM2_ENST00000456144.1_Missense_Mutation_p.A371V|TIAM2_ENST00000360366.4_Missense_Mutation_p.A371V|TIAM2_ENST00000318981.5_Missense_Mutation_p.A371V|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000529824.2_Missense_Mutation_p.A371V			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	371					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GAGGATACTGCGAAGAAGGAC	0.547																																						ENST00000461783.3	0.390000	0.130000	0.320000	0.180000	0.240000	0.253837	0.240000	0.240000																										0				65						c.(1111-1113)gCg>gTg		T-cell lymphoma invasion and metastasis 2							72.0	70.0	71.0					6																	155451469		2203	4300	6503	SO:0001583	missense	26230	5	121412	40				g.chr6:155451469C>T		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1112C>T	chr6.hg19:g.155451469C>T	ENSP00000437188:p.Ala371Val	1					TIAM2_ENST00000360366.4_Missense_Mutation_p.A371V|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000318981.5_Missense_Mutation_p.A371V|TIAM2_ENST00000456144.1_Missense_Mutation_p.A371V|TIAM2_ENST00000529824.2_Missense_Mutation_p.A371V	p.A371V			0	1	1	1.683475	Q8IVF5	TIAM2_HUMAN		6	2385	+		Ovarian(120;0.196)	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	1	1	hg19	c.1112C>T	CCDS34558.1	0	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126396	0.37533	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.05382	3.57;3.45;3.51;3.57;3.57;3.51	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.813614	0.11671	N	0.540830	T	0.03608	0.0103	L	0.40543	1.245	0.47407	D	0.999411	B	0.29909	0.261	B	0.19148	0.024	T	0.35276	-0.9795	10	0.59425	D	0.04	.	17.1487	0.86773	0.0:1.0:0.0:0.0	.	371	Q8IVF5	TIAM2_HUMAN	V	371;617;371;371;371;371;371	ENSP00000437188:A371V;ENSP00000434901:A371V;ENSP00000407746:A371V;ENSP00000327315:A371V;ENSP00000353528:A371V;ENSP00000433348:A371V	ENSP00000327315:A371V	A	+	2	0	0	TIAM2	155493161	155493161	0.002000	0.14202	0.364000	0.25888	0.430000	0.31655	1.419000	0.34793	2.489000	0.83994	0.655000	0.94253	GCG	0.234568		TCGA-IB-AAUO-01A-12D-A38G-08	0.547	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	0	0	1	2	10	2	2	1	1	1	1	91	91	91	91	1	1.860000	-4.756731	1	0.380000	NM_012454		0	12	11	0	201	195	0		1			1	0	91	0	0	0.713298	0	0	0	0	0	0	12	201
CDHR3	222256	broad.mit.edu	37	7	105673026	105673026	+	Silent	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr7:105673026G>A	ENST00000317716.9	+	19	2621	c.2541G>A	c.(2539-2541)gcG>gcA	p.A847A	CDHR3_ENST00000478080.1_Silent_p.A759A|CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000542731.1_Silent_p.A847A	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	847					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GTGGCAAAGCGTGGGCTGAGG	0.577																																						ENST00000317716.9	0.480000	0.130000	0.380000	0.200000	0.280000	0.298461	0.280000	0.280000																										0				23						c.(2539-2541)gcG>gcA		cadherin-related family member 3							79.0	86.0	83.0					7																	105673026		2098	4238	6336	SO:0001819	synonymous_variant	222256	0	0					g.chr7:105673026G>A	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2541G>A	chr7.hg19:g.105673026G>A		0					CDHR3_ENST00000478080.1_Silent_p.A759A|CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000542731.1_Silent_p.A847A	p.A847A	NM_152750.4	NP_689963.2	0	0	0	2.043431	Q6ZTQ4	CDHR3_HUMAN		19	2621	+			Q8TCI7	Silent	SNP	ENST00000317716.9	1	1	hg19	c.2541G>A	CCDS47684.1	0																																																																																								0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.577	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	1.860000	-4.752440	1	0.380000	NM_152750		0	9	9	0	163	162	0		1	0		0	0	76	0	0	0.994603	3.612479e-03	0	0	0	2	0	9	163
FLNC	2318	broad.mit.edu	37	7	128480725	128480725	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr7:128480725G>A	ENST00000325888.8	+	10	1934	c.1673G>A	c.(1672-1674)cGc>cAc	p.R558H	FLNC_ENST00000346177.6_Missense_Mutation_p.R558H	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	558					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCCATCCCTCGCAGGTGAGTA	0.637																																						ENST00000325888.8	0.760000	0.430000	0.680000	0.510000	0.590000	0.600882	0.590000	0.590000																										0				128						c.(1672-1674)cGc>cAc		filamin C, gamma							126.0	140.0	135.0					7																	128480725		2108	4216	6324	SO:0001583	missense	2318	5	121074	41				g.chr7:128480725G>A	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1673G>A	chr7.hg19:g.128480725G>A	ENSP00000327145:p.Arg558His	0					FLNC_ENST00000346177.6_Missense_Mutation_p.R558H	p.R558H	NM_001458.4	NP_001449.3	0	0	0	2.043431	Q14315	FLNC_HUMAN		10	1934	+			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	1	1	hg19	c.1673G>A	CCDS43644.1	0	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708659	0.68615	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.91894	-2.93;-2.93	5.02	5.02	0.67125	5.02	5.02	0.67125	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.059561	0.64402	D	0.000004	D	0.94345	0.8182	L	0.53249	1.67	0.47183	D	0.999344	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.953	D	0.94549	0.7752	10	0.87932	D	0	.	12.2416	0.54546	0.0893:0.0:0.9107:0.0	.	558;558	Q14315-2;Q14315	.;FLNC_HUMAN	H	558	ENSP00000327145:R558H;ENSP00000344002:R558H	ENSP00000327145:R558H	R	+	2	0	0	FLNC	128267961	128267961	0.981000	0.34729	1.000000	0.80357	0.037000	0.13140	4.138000	0.58017	2.327000	0.79052	0.491000	0.48974	CGC	0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.637	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3	1	0	1	2	2	2	2	0	0	0	0	158	158	158	158	1	1.860000	-16.205010	1	0.380000			0	44	41	0	345	336	1		1	0		0	0	158	0	0	1.000000	1.350540e-02	0	1	0	1	0	44	345
LIMK1	3984	broad.mit.edu	37	7	73511508	73511508	+	Silent	SNP	C	C	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr7:73511508C>A	ENST00000336180.2	+	4	441	c.390C>A	c.(388-390)tcC>tcA	p.S130S	LIMK1_ENST00000491052.1_3'UTR|LIMK1_ENST00000418310.1_Silent_p.S160S|LIMK1_ENST00000538333.3_Silent_p.S96S	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	130	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	TGGAGCACTCCAAGCTGTACT	0.617																																						ENST00000336180.2	0.530000	0.080000	0.390000	0.150000	0.250000	0.279792	0.250000	0.230000																										0				21						c.(388-390)tcC>tcA		LIM domain kinase 1	Dabrafenib(DB08912)						84.0	53.0	63.0					7																	73511508		2203	4300	6503	SO:0001819	synonymous_variant	3984	0	0					g.chr7:73511508C>A	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.390C>A	chr7.hg19:g.73511508C>A		0					LIMK1_ENST00000418310.1_Silent_p.S160S|LIMK1_ENST00000538333.3_Silent_p.S96S|LIMK1_ENST00000491052.1_3'UTR	p.S130S	NM_002314.3	NP_002305.1	0	0	0	2.043431	P53667	LIMK1_HUMAN		4	441	+		Lung NSC(55;0.137)	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Silent	SNP	ENST00000336180.2	1	0	hg19	c.390C>A	CCDS5563.1	0																																																																																								0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.617	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	1	0	0	2	2	2	2	0	0	0	0	40	40	40	40	1	1.860000	-7.787154	1	0.380000	NM_002314		0	4	3	0	86	84	0		1	0		0	0	40	0	0	0.883922	6.813097e-01	0	0	0	49	0	4	86
MRPS33	51650	broad.mit.edu	37	7	140710243	140710243	+	Missense_Mutation	SNP	G	G	A	rs369862542		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr7:140710243G>A	ENST00000393008.3	-	2	346	c.191C>T	c.(190-192)aCg>aTg	p.T64M	MRPS33_ENST00000324787.5_Missense_Mutation_p.T64M|MRPS33_ENST00000496958.1_Missense_Mutation_p.T64M|MRPS33_ENST00000469351.1_Missense_Mutation_p.T64M|MRPS33_ENST00000472343.1_5'Flank|MRPS33_ENST00000467334.1_Missense_Mutation_p.T54M	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	64					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					AAATCGGAGCGTCTGCATGAG	0.413																																						ENST00000393008.3	1.000000	0.670000	0.970000	0.760000	0.860000	0.864594	0.860000	1.000000																										0				4						c.(190-192)aCg>aTg		mitochondrial ribosomal protein S33		G	MET/THR,MET/THR	0,4406		0,0,2203	158.0	149.0	152.0		191,191	-4.8	0.0	7		152	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	MRPS33	NM_016071.3,NM_053035.2	81,81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	64/107,64/107	140710243	2,13004	2203	4300	6503	SO:0001583	missense	51650	11	121412	43				g.chr7:140710243G>A	AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.191C>T	chr7.hg19:g.140710243G>A	ENSP00000376732:p.Thr64Met	0					MRPS33_ENST00000467334.1_Missense_Mutation_p.T54M|MRPS33_ENST00000324787.5_Missense_Mutation_p.T64M|MRPS33_ENST00000472343.1_5'Flank|MRPS33_ENST00000496958.1_Missense_Mutation_p.T64M|MRPS33_ENST00000469351.1_Missense_Mutation_p.T64M	p.T64M	NM_016071.3	NP_057155.1	0	0	0	2.043431	Q9Y291	RT33_HUMAN		2	346	-	Melanoma(164;0.00956)			Missense_Mutation	SNP	ENST00000393008.3	1	1	hg19	c.191C>T	CCDS5864.1	1	.	.	.	.	.	.	.	.	.	.	G	9.817	1.184686	0.21870	0.0	2.33E-4	ENSG00000090263	ENST00000544013;ENST00000393008;ENST00000324787;ENST00000496958;ENST00000469351;ENST00000467334	.	.	.	5.1	-4.84	0.03151	5.1	-4.84	0.03151	.	0.517024	0.23549	N	0.046999	T	0.20780	0.0500	N	0.16368	0.405	0.09310	N	0.999996	D	0.69078	0.997	P	0.56514	0.8	T	0.25363	-1.0134	9	0.28530	T	0.3	-2.3832	5.3	0.15773	0.4111:0.0:0.2195:0.3694	.	64	Q9Y291	RT33_HUMAN	M	64;64;64;64;64;54	.	ENSP00000320567:T64M	T	-	2	0	0	MRPS33	140356712	140356712	0.093000	0.21703	0.010000	0.14722	0.057000	0.15508	0.429000	0.21412	-0.574000	0.05990	0.467000	0.42956	ACG	0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.413	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348878.1	1	0	1	2	2	2	2	0	0	0	0	124	124	124	124	1	1.860000	-20.000000	1	0.380000	NM_053035		0	61	61	0	309	301	1		1	1		0	0	124	0	0	1.000000	1	0	56	0	151	0	61	309
ZHX2	22882	broad.mit.edu	37	8	123965170	123965170	+	Missense_Mutation	SNP	G	G	A	rs374724083		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr8:123965170G>A	ENST00000314393.4	+	3	2255	c.1420G>A	c.(1420-1422)Gag>Aag	p.E474K		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	474	Required for interaction with NFYA.				mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CCGGCTCATCGAGGTGACTGG	0.557																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	ENST00000314393.4	0.350000	0.070000	0.270000	0.120000	0.180000	0.197672	0.180000	0.170000																										0				45						c.(1420-1422)Gag>Aag		zinc fingers and homeoboxes 2		G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	87.0	86.0	87.0		1420	5.1	1.0	8		87	0,8600		0,0,4300	no	missense	ZHX2	NM_014943.3	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	474/838	123965170	1,13005	2203	4300	6503	SO:0001583	missense	22882	2	121412	36				g.chr8:123965170G>A	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1420G>A	chr8.hg19:g.123965170G>A	ENSP00000314709:p.Glu474Lys	0						p.E474K	NM_014943.3	NP_055758.1	0	0	0	2.045321	Q9Y6X8	ZHX2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)	3	2255	+	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)			Missense_Mutation	SNP	ENST00000314393.4	0	1	hg19	c.1420G>A	CCDS6336.1	0	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765980	0.31228	2.27E-4	0.0	ENSG00000178764	ENST00000314393	D	0.95949	-3.86	5.94	5.07	0.68467	5.94	5.07	0.68467	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.102570	0.64402	D	0.000003	D	0.90106	0.6909	N	0.21448	0.665	0.80722	D	1	B	0.24043	0.096	B	0.20577	0.03	D	0.86463	0.1780	10	0.09843	T	0.71	-24.8951	15.4187	0.74995	0.0667:0.0:0.9333:0.0	.	474	Q9Y6X8	ZHX2_HUMAN	K	474	ENSP00000314709:E474K	ENSP00000314709:E474K	E	+	1	0	0	ZHX2	124034351	124034351	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	7.641000	0.83368	1.531000	0.49152	0.561000	0.74099	GAG	0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.557	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	0	0	1	2	2	2	2	0	0	0	0	69	69	69	68	1	1.860000	-7.954317	1	0.380000	NM_014943		0	6	5	0	176	170	0		1	0		0	0	69	0	0	0.961326	1.405705e-01	0	0	0	17	0	6	176
BAI1	575	broad.mit.edu	37	8	143618425	143618425	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr8:143618425C>T	ENST00000517894.1	+	26	4542	c.3648C>T	c.(3646-3648)aaC>aaT	p.N1216N	BAI1_ENST00000323289.5_Silent_p.N1216N			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1216					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCTTCCAGAACGGCCACGCCC	0.692																																						ENST00000517894.1	0.900000	0.150000	0.670000	0.270000	0.440000	0.477273	0.440000	0.400000																										0				57						c.(3646-3648)aaC>aaT		brain-specific angiogenesis inhibitor 1							26.0	34.0	32.0					8																	143618425		2078	4197	6275	SO:0001819	synonymous_variant	575	2	120508	22				g.chr8:143618425C>T	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3648C>T	chr8.hg19:g.143618425C>T		0					BAI1_ENST00000323289.5_Silent_p.N1216N	p.N1216N			0	0	0	2.045321	O14514	BAI1_HUMAN		26	4542	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)			Silent	SNP	ENST00000517894.1	0	1	hg19	c.3648C>T		0																																																																																								0.377635		TCGA-IB-AAUO-01A-12D-A38G-08	0.692	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	0	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.860000	-8.885540	1	0.380000	NM_001702		0	4	4	0	47	46	0		1	0		0	0	25	0	0	0.888377	0	0	1	0	0	0	4	47
COL5A1	1289	broad.mit.edu	37	9	137709638	137709638	+	Silent	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr9:137709638C>T	ENST00000371817.3	+	54	4605	c.4191C>T	c.(4189-4191)ccC>ccT	p.P1397P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1397	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCCAGGCCCCGCAGGCCCCG	0.657																																						ENST00000371817.3	1.000000	0.560000	1.000000	0.760000	0.990000	0.913558	0.990000	1.000000																										0				115						c.(4189-4191)ccC>ccT		collagen, type V, alpha 1							86.0	76.0	79.0					9																	137709638		2200	4300	6500	SO:0001819	synonymous_variant	1289	0	0					g.chr9:137709638C>T	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4191C>T	chr9.hg19:g.137709638C>T		0						p.P1397P	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	0	1	1	2.053346	P20908	CO5A1_HUMAN		54	4605	+		Myeloproliferative disorder(178;0.0341)	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	1	1	hg19	c.4191C>T	CCDS6982.1	1																																																																																								0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.860000	-19.894380	1	0.380000	NM_000093		0	11	11	0	46	45	1		1	1		0	0	24	0	0	0.998775	9.999994e-01	0	15	0	144	0	11	46
ARID3C	138715	broad.mit.edu	37	9	34622033	34622033	+	Silent	SNP	G	G	A	rs563083593		TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr9:34622033G>A	ENST00000378909.2	-	6	1214	c.1122C>T	c.(1120-1122)aaC>aaT	p.N374N	DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000341694.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	374	Pro-rich.|REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		AGACCACCCCGTTGATCTCTA	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17709	0.0		0.0	False		,,,				2504	0.0					ENST00000378909.2	0.820000	0.460000	0.730000	0.540000	0.630000	0.640969	0.630000	0.630000																										0				14						c.(1120-1122)aaC>aaT		AT rich interactive domain 3C (BRIGHT-like)							153.0	128.0	136.0					9																	34622033		2203	4300	6503	SO:0001819	synonymous_variant	138715	3	121412	41				g.chr9:34622033G>A		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.1122C>T	chr9.hg19:g.34622033G>A		0					DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378913.2_5'Flank	p.N374N	NM_001017363.1	NP_001017363.1	0	0	0	2.022799	A6NKF2	ARI3C_HUMAN	STAD - Stomach adenocarcinoma(86;0.178)	6	1214	-	all_epithelial(49;0.102)			Silent	SNP	ENST00000378909.2	1	1	hg19	c.1122C>T	CCDS35006.1	0																																																																																								0.370431		TCGA-IB-AAUO-01A-12D-A38G-08	0.552	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	1	0	1	2	2	2	2	0	0	0	0	126	126	126	125	1	1.860000	-3.221920	1	0.380000	XM_071061		0	42	42	0	302	293	1		1			0	0	126	0	0	1.000000	0	0	0	0	0	0	42	302
TRPM6	140803	broad.mit.edu	37	9	77390934	77390934	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr9:77390934G>A	ENST00000360774.1	-	24	3505	c.3268C>T	c.(3268-3270)Cgc>Tgc	p.R1090C	TRPM6_ENST00000451710.3_Missense_Mutation_p.R1090C|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1085C|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1090C|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.R1085C	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1090					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATGATGTAGCGATAGCGGTTG	0.493																																						ENST00000360774.1	0.240000	0.070000	0.190000	0.100000	0.140000	0.153237	0.140000	0.140000																										0				126						c.(3268-3270)Cgc>Tgc		transient receptor potential cation channel, subfamily M, member 6							118.0	127.0	124.0					9																	77390934		2203	4300	6503	SO:0001583	missense	140803	0	0					g.chr9:77390934G>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3268C>T	chr9.hg19:g.77390934G>A	ENSP00000354006:p.Arg1090Cys	0					TRPM6_ENST00000451710.3_Missense_Mutation_p.R1090C|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1090C|TRPM6_ENST00000361255.3_Missense_Mutation_p.R1085C|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1085C	p.R1090C	NM_017662.4	NP_060132.3	0	0	0	2.022799	Q9BX84	TRPM6_HUMAN		24	3505	-			Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	1	1	hg19	c.3268C>T	CCDS6647.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.120843	0.94385	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.55588	0.6;0.6;0.6;0.6;0.51	5.76	5.76	0.90799	5.76	5.76	0.90799	.	0.046412	0.85682	D	0.000000	T	0.72779	0.3503	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.67900	0.932;0.931;0.954	T	0.74426	-0.3669	10	0.87932	D	0	.	19.9561	0.97218	0.0:0.0:1.0:0.0	.	1090;1085;1085	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	C	1090;1090;1085;1085;1090;753;753	ENSP00000354006:R1090C;ENSP00000407341:R1090C;ENSP00000396672:R1085C;ENSP00000354962:R1085C;ENSP00000366060:R1090C	ENSP00000309693:R753C	R	-	1	0	0	TRPM6	76580754	76580754	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.827000	0.86722	2.725000	0.93324	0.591000	0.81541	CGC	0.370431		TCGA-IB-AAUO-01A-12D-A38G-08	0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	0	0	1	2	2	2	2	0	0	0	0	147	147	147	143	1	1.860000	-2.818145	1	0.380000	NM_017662		0	12	12	0	424	419	0		1			0	0	147	0	0	0.999078	0	0	0	0	0	0	12	424
SNAPC4	6621	broad.mit.edu	37	9	139289824	139289824	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chr9:139289824C>T	ENST00000298532.2	-	4	765	c.397G>A	c.(397-399)Ggc>Agc	p.G133S		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		AGGCTTTTGCCATCTTTCACC	0.567																																						ENST00000298532.2	0.300000	0.080000	0.240000	0.120000	0.170000	0.182619	0.170000	0.160000																										0				33						c.(397-399)Ggc>Agc		small nuclear RNA activating complex, polypeptide 4, 190kDa							114.0	102.0	106.0					9																	139289824		2203	4300	6503	SO:0001583	missense	6621	1	121380	29				g.chr9:139289824C>T	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.397G>A	chr9.hg19:g.139289824C>T	ENSP00000298532:p.Gly133Ser	0						p.G133S	NM_003086.2	NP_003077.2	0	1	1	2.053346				4	765	-		Myeloproliferative disorder(178;0.0511)		Missense_Mutation	SNP	ENST00000298532.2	1	1	hg19	c.397G>A	CCDS6998.1	0	.	.	.	.	.	.	.	.	.	.	C	6.565	0.472500	0.12461	.	.	ENSG00000165684	ENST00000298532	T	0.28255	1.62	5.35	-2.81	0.05805	5.35	-2.81	0.05805	.	1.072810	0.07153	N	0.849409	T	0.25791	0.0628	L	0.48362	1.52	0.09310	N	0.999994	B	0.28378	0.209	B	0.22880	0.042	T	0.25012	-1.0144	10	0.52906	T	0.07	-3.3704	10.5123	0.44868	0.0:0.4466:0.0:0.5534	.	133	Q5SXM2	SNPC4_HUMAN	S	133	ENSP00000298532:G133S	ENSP00000298532:G133S	G	-	1	0	0	SNAPC4	138409645	138409645	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	-0.062000	0.11674	-0.992000	0.03472	-1.074000	0.02243	GGC	0.378820		TCGA-IB-AAUO-01A-12D-A38G-08	0.567	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	0	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	1.860000	-3.002049	1	0.380000	NM_003086		0	9	9	0	275	269	0		1	0		0	0	103	0	0	0.993849	6.684777e-02	0	0	0	12	0	9	275
DMD	1756	broad.mit.edu	37	X	32663260	32663260	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUO-01A-12D-A38G-08	TCGA-IB-AAUO-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fea1f02f-d937-4ce1-99cc-b1253242f1cf	84813019-93c1-4f1c-8103-a43c6b33b120	g.chrX:32663260C>T	ENST00000357033.4	-	10	1176	c.970G>A	c.(970-972)Gct>Act	p.A324T	DMD_ENST00000288447.4_Missense_Mutation_p.A316T|DMD_ENST00000378677.2_Missense_Mutation_p.A320T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	324					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTTCAGGAGCTTCCAAATGC	0.348																																						ENST00000357033.4	0.180000	0.040000	0.140000	0.060000	0.090000	0.105095	0.090000	0.100000																										0				77						c.(970-972)Gct>Act		dystrophin							119.0	107.0	111.0					X																	32663260		2202	4300	6502	SO:0001583	missense	1756	0	0					g.chrX:32663260C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.970G>A	chrX.hg19:g.32663260C>T	ENSP00000354923:p.Ala324Thr						DMD_ENST00000288447.4_Missense_Mutation_p.A316T|DMD_ENST00000378677.2_Missense_Mutation_p.A320T	p.A324T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	0	1	1		P11532	DMD_HUMAN		10	1176	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	0	1	hg19	c.970G>A	CCDS14233.1	0	.	.	.	.	.	.	.	.	.	.	C	3.513	-0.099324	0.07010	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.72615	0.16;0.16;-0.67	5.67	2.85	0.33270	5.67	2.85	0.33270	.	0.197530	0.24231	U	0.040342	T	0.40815	0.1132	N	0.05078	-0.115	0.80722	D	1	B;B;B;B;B	0.10296	0.0;0.0;0.002;0.003;0.001	B;B;B;B;B	0.10450	0.0;0.0;0.005;0.002;0.002	T	0.32188	-0.9916	10	0.02654	T	1	.	7.4854	0.27429	0.0:0.574:0.0:0.426	.	320;316;316;324;320	B1AK23;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	T	316;320;324;324;201;316	ENSP00000367948:A320T;ENSP00000354923:A324T;ENSP00000288447:A316T	ENSP00000288447:A316T	A	-	1	0	0	DMD	32573181	32573181	0.963000	0.33076	1.000000	0.80357	0.984000	0.73092	-0.020000	0.12525	0.611000	0.30052	0.600000	0.82982	GCT	0.380000		TCGA-IB-AAUO-01A-12D-A38G-08	0.348	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	0	0	1	2	10	2	2	1	1	1	1	205	205	205	202	1	1.860000	-7.139841	1	0.380000	NM_004006		0	8	8	0	439	430	0		0			1	0	205	0	0	0.387457	0	0	0	0	0	0	8	439
