#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ANKRD30A	91074	broad.mit.edu	37	10	37431076	37431076	+	Silent	SNP	C	C	T	rs267602478		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr10:37431076C>T	ENST00000602533.1	+	7	1182	c.1083C>T	c.(1081-1083)atC>atT	p.I361I	ANKRD30A_ENST00000361713.1_Silent_p.I361I|ANKRD30A_ENST00000374660.1_Silent_p.I361I			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	417					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTAGGAAGATCGCATGGGAGA	0.393																																						ENST00000602533.1	1.000000	0.310000	0.920000	0.410000	0.540000	0.601863	0.540000	0.500000																										0				158						c.(1081-1083)atC>atT		ankyrin repeat domain 30A							98.0	98.0	98.0					10																	37431076		1844	4093	5937	SO:0001819	synonymous_variant	91074	0	0					g.chr10:37431076C>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1083C>T	chr10.hg19:g.37431076C>T		0					ANKRD30A_ENST00000374660.1_Silent_p.I361I|ANKRD30A_ENST00000361713.1_Silent_p.I361I	p.I361I			1	2	3	2.030868	Q9BXX3	AN30A_HUMAN		7	1182	+			Q5W025	Silent	SNP	ENST00000602533.1	1	1	hg19	c.1083C>T		0																																																																																								0.163180		TCGA-IB-AAUP-01A-11D-A377-08	0.393	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	125	1	2.100000	-3.473536	1	0.150000	NM_052997		0	17	17	0	438	430	0		1			0	0	125	0	0	0.999961	0	0	0	0	0	0	17	438
FAM35A	54537	broad.mit.edu	37	10	88930319	88930319	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr10:88930319C>T	ENST00000298784.1	+	5	1832	c.1718C>T	c.(1717-1719)cCg>cTg	p.P573L	FAM35A_ENST00000298786.4_Missense_Mutation_p.P573L	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	573										endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						GATCTTCCTCCGAGGCAGCCT	0.418																																					Ovarian(175;703 2004 25460 32514 43441)	ENST00000298784.1	1.000000	0.150000	0.430000	0.210000	0.290000	0.363687	0.290000	0.280000																										0				16						c.(1717-1719)cCg>cTg		family with sequence similarity 35, member A							82.0	79.0	80.0					10																	88930319		2203	4298	6501	SO:0001583	missense	54537	4	121412	37				g.chr10:88930319C>T	BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.1718C>T	chr10.hg19:g.88930319C>T	ENSP00000298784:p.Pro573Leu	0					FAM35A_ENST00000298786.4_Missense_Mutation_p.P573L	p.P573L	NM_019054.2	NP_061927.2	1	2	3	2.002328	Q86V20	FA35A_HUMAN		5	1832	+			O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	1	1	hg19	c.1718C>T	CCDS7383.1	0	.	.	.	.	.	.	.	.	.	.	c	0.300	-0.974237	0.02215	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	T;T;T	0.62105	0.05;0.05;0.05	4.26	-3.33	0.04958	4.26	-3.33	0.04958	.	1.405890	0.04709	N	0.417233	T	0.38480	0.1042	N	0.14661	0.345	0.25539	N	0.987192	B	0.09022	0.002	B	0.08055	0.003	T	0.13098	-1.0522	10	0.35671	T	0.21	-0.6937	2.3797	0.04351	0.5404:0.1118:0.2298:0.1179	.	573	Q86V20	FA35A_HUMAN	L	573	ENSP00000298786:P573L;ENSP00000298784:P573L;ENSP00000351064:P573L	ENSP00000298784:P573L	P	+	2	0	0	FAM35A	88920299	88920299	0.000000	0.05858	0.326000	0.25389	0.352000	0.29268	-1.271000	0.02828	-0.356000	0.08187	-1.268000	0.01426	CCG	0.156955		TCGA-IB-AAUP-01A-11D-A377-08	0.418	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	0	0	1	2	2	2	2	0	0	0	0	127	127	127	127	1	2.100000	-2.413725	0	0.150000	NM_019054		0	12	12	0	560	545	0		1	1		0	0	127	0	0	0.998976	4.034835e-01	0	3	0	59	0	12	560
PPAPDC1A	196051	broad.mit.edu	37	10	122334762	122334762	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr10:122334762G>A	ENST00000398250.1	+	6	917	c.565G>A	c.(565-567)Gcc>Acc	p.A189T	PPAPDC1A_ENST00000439221.1_Missense_Mutation_p.A126T|PPAPDC1A_ENST00000398248.1_Intron|PPAPDC1A_ENST00000369073.3_Missense_Mutation_p.A179T|PPAPDC1A_ENST00000541332.1_Missense_Mutation_p.A189T|PPAPDC1A_ENST00000496437.1_3'UTR	NM_001030059.1	NP_001025230.1	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1A	189					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phospholipid dephosphorylation (GO:0046839)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	20		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		CTTGTACTGCGCCATGATGAT	0.607																																						ENST00000398250.1	1.000000	0.360000	0.850000	0.470000	0.620000	0.658450	0.620000	0.590000																										0				20						c.(565-567)Gcc>Acc		phosphatidic acid phosphatase type 2 domain containing 1A							82.0	83.0	83.0					10																	122334762		2137	4242	6379	SO:0001583	missense	196051	0	0					g.chr10:122334762G>A	AK098668	CCDS41573.1	10q26.13	2008-02-05		2005-07-15	ENSG00000203805	ENSG00000203805			23531	protein-coding gene	gene with protein product			"""phosphatidic acid phosphatase type 2 domain containing 1"""	PPAPDC1			Standard	XM_005269592		Approved		uc001lev.1	Q5VZY2	OTTHUMG00000019168	ENST00000398250.1:c.565G>A	chr10.hg19:g.122334762G>A	ENSP00000381302:p.Ala189Thr	0					PPAPDC1A_ENST00000541332.1_Missense_Mutation_p.A189T|PPAPDC1A_ENST00000398248.1_Intron|PPAPDC1A_ENST00000496437.1_3'UTR|PPAPDC1A_ENST00000439221.1_Missense_Mutation_p.A126T|PPAPDC1A_ENST00000369073.3_Missense_Mutation_p.A179T	p.A189T	NM_001030059.1	NP_001025230.1	1	2	3	2.002328	Q5VZY2	PPC1A_HUMAN		6	917	+		Lung NSC(174;0.1)|all_lung(145;0.132)	A2RU82|Q08EQ2|Q0IIP2|Q495B4|Q5VZY1	Missense_Mutation	SNP	ENST00000398250.1	1	1	hg19	c.565G>A	CCDS41573.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.703959	0.96812	.	.	ENSG00000203805	ENST00000439221;ENST00000398250;ENST00000427079;ENST00000541332;ENST00000369073	T;D;D;D;D	0.82619	-1.34;-1.63;-1.63;-1.63;-1.63	5.76	5.76	0.90799	5.76	5.76	0.90799	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93638	0.7968	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.994	D	0.94162	0.7415	10	0.62326	D	0.03	-16.6314	19.9694	0.97278	0.0:0.0:1.0:0.0	.	189;126;189	B7Z3R3;Q5VZY2-2;Q5VZY2	.;.;PPC1A_HUMAN	T	126;189;189;189;179	ENSP00000403508:A126T;ENSP00000381302:A189T;ENSP00000407979:A189T;ENSP00000440493:A189T;ENSP00000358069:A179T	ENSP00000358069:A179T	A	+	1	0	0	PPAPDC1A	122324752	122324752	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.785000	0.99042	2.719000	0.93026	0.655000	0.94253	GCC	0.156955		TCGA-IB-AAUP-01A-11D-A377-08	0.607	PPAPDC1A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	2.100000	-3.318794	1	0.150000	XM_113641		0	15	15	0	321	319	0		1	0		0	0	77	0	0	0.999875	8.665036e-01	0	1	0	78	0	15	321
DSCAML1	57453	broad.mit.edu	37	11	117651364	117651364	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr11:117651364C>T	ENST00000321322.6	-	2	389	c.388G>A	c.(388-390)Gtg>Atg	p.V130M	DSCAML1_ENST00000527706.1_Intron	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	70	Ig-like C2-type 2.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ATGTGCGGCACGTCGTAGATG	0.652																																						ENST00000321322.6	0.550000	0.200000	0.460000	0.270000	0.350000	0.369447	0.350000	0.350000																										0				110						c.(388-390)Gtg>Atg		Down syndrome cell adhesion molecule like 1							114.0	116.0	115.0					11																	117651364		2200	4296	6496	SO:0001583	missense	57453	0	0					g.chr11:117651364C>T		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.388G>A	chr11.hg19:g.117651364C>T	ENSP00000315465:p.Val130Met	0					DSCAML1_ENST00000527706.1_Intron	p.V130M	NM_020693.2	NP_065744.2	0	1	1	1.979190	Q8TD84	DSCL1_HUMAN		2	389	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	0	1	hg19	c.388G>A	CCDS8384.1	0	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613460	0.87359	.	.	ENSG00000177103	ENST00000321322	T	0.62105	0.05	5.1	5.1	0.69264	5.1	5.1	0.69264	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78761	0.4334	M	0.65677	2.01	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.80674	-0.1277	9	0.72032	D	0.01	.	18.9124	0.92491	0.0:1.0:0.0:0.0	.	70	Q8TD84	DSCL1_HUMAN	M	130	ENSP00000315465:V130M	ENSP00000315465:V130M	V	-	1	0	0	DSCAML1	117156574	117156574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.880000	0.69698	2.536000	0.85505	0.563000	0.77884	GTG	0.144869		TCGA-IB-AAUP-01A-11D-A377-08	0.652	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	0	0	1	2	2	2	2	0	0	0	0	123	123	123	123	1	2.100000	-12.886290	1	0.150000	NM_020693		0	15	15	0	551	545	0		1	0		0	0	123	0	0	0.999863	0	0	0	0	1	0	15	551
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.300000	0.840000	0.410000	0.550000	0.605844	0.550000	0.520000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.017654	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.160701		TCGA-IB-AAUP-01A-11D-A377-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	68	1	2.100000	-4.150761	1	0.150000	NM_033360		695	13	13	7323	326	322	0	1	1	1	1	0	0	70	284	1	0.999522	1.700908e-01	9.999231e-01	4	25	14	409	13	326
CNTN1	1272	broad.mit.edu	37	12	41419082	41419082	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr12:41419082A>G	ENST00000551295.2	+	21	2771	c.2654A>G	c.(2653-2655)aAt>aGt	p.N885S	CNTN1_ENST00000347616.1_Missense_Mutation_p.N885S|CNTN1_ENST00000550305.1_3'UTR|CNTN1_ENST00000348761.2_Missense_Mutation_p.N874S	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	885	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GGGGCCTGCAATAGTGCAGGG	0.483																																						ENST00000551295.2	1.000000	0.690000	1.000000	0.790000	0.900000	0.898520	0.900000	1.000000																										0				90						c.(2653-2655)aAt>aGt		contactin 1							174.0	190.0	184.0					12																	41419082		2203	4300	6503	SO:0001583	missense	1272	1	121412	36				g.chr12:41419082A>G	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2654A>G	chr12.hg19:g.41419082A>G	ENSP00000447006:p.Asn885Ser	0					CNTN1_ENST00000347616.1_Missense_Mutation_p.N885S|CNTN1_ENST00000348761.2_Missense_Mutation_p.N874S|CNTN1_ENST00000550305.1_3'UTR	p.N885S	NM_001843.3	NP_001834.2	1	2	3	2.017654	Q12860	CNTN1_HUMAN		21	2771	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	1	1	hg19	c.2654A>G	CCDS8737.1	1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.499418	0.85069	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.61392	0.11;0.11;0.11	4.88	4.88	0.63580	4.88	4.88	0.63580	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.77618	0.4157	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.81844	-0.0746	10	0.87932	D	0	.	15.2111	0.73225	1.0:0.0:0.0:0.0	.	874;885	Q12860-2;Q12860	.;CNTN1_HUMAN	S	885;885;874	ENSP00000447006:N885S;ENSP00000325660:N885S;ENSP00000261160:N874S	ENSP00000325660:N885S	N	+	2	0	0	CNTN1	39705349	39705349	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.581000	0.90788	2.127000	0.65507	0.533000	0.62120	AAT	0.160701		TCGA-IB-AAUP-01A-11D-A377-08	0.483	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	1	0	1	2	2	2	2	0	0	0	0	230	230	230	228	1	2.100000	-20.000000	1	0.150000	NM_001843		0	67	66	0	955	941	0		1	0		0	0	230	0	0	1.000000	5.588657e-01	0	0	0	28	0	67	955
CSNK1A1L	122011	broad.mit.edu	37	13	37678736	37678736	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr13:37678736G>A	ENST00000379800.3	-	1	1067	c.658C>T	c.(658-660)Ccg>Tcg	p.P220S		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in dbSNP:rs56252856). {ECO:0000269|PubMed:17344846}.		cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		CCTTGCCACGGCAGGCTGGTT	0.418																																						ENST00000379800.3	1.000000	0.050000	1.000000	0.100000	0.180000	0.352981	0.180000	0.140000																										0				37						c.(658-660)Ccg>Tcg		casein kinase 1, alpha 1-like							103.0	102.0	103.0					13																	37678736		2203	4300	6503	SO:0001583	missense	122011	0	0					g.chr13:37678736G>A	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.658C>T	chr13.hg19:g.37678736G>A	ENSP00000369126:p.Pro220Ser	0						p.P220S	NM_145203.5	NP_660204.2	1	2	3	2.073259	Q8N752	KC1AL_HUMAN		1	1067	-		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	0	1	hg19	c.658C>T	CCDS9363.1	0	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854424	0.32791	.	.	ENSG00000180138	ENST00000379800	T	0.34859	1.34	1.08	1.08	0.20341	1.08	1.08	0.20341	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55401	0.1918	H	0.99042	4.41	0.39701	D	0.971184	P	0.36222	0.544	B	0.38985	0.287	T	0.66089	-0.6010	10	0.87932	D	0	.	7.9927	0.30250	0.0:0.0:1.0:0.0	.	220	Q8N752	KC1AL_HUMAN	S	220	ENSP00000369126:P220S	ENSP00000369126:P220S	P	-	1	0	0	CSNK1A1L	36576736	36576736	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	2.916000	0.48813	0.871000	0.35750	0.561000	0.74099	CCG	0.171742		TCGA-IB-AAUP-01A-11D-A377-08	0.418	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	0	0	1	2	11	2	2	1	1	1	1	171	171	171	170	1	2.100000	-2.633292	1	0.150000	NM_145203		0	5	5	0	469	463	0		0			1	0	171	0	0	0.097821	0	0	0	0	0	0	5	469
FREM2	341640	broad.mit.edu	37	13	39262608	39262608	+	Missense_Mutation	SNP	G	G	A	rs544070855		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr13:39262608G>A	ENST00000280481.7	+	1	1343	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	376					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACCGATGATCGCAGCCTGCCC	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17293	0.0		0.0	False		,,,				2504	0.0					ENST00000280481.7	1.000000	0.420000	1.000000	0.540000	0.710000	0.745860	0.710000	0.640000																										0				148						c.(1126-1128)cGc>cAc		FRAS1 related extracellular matrix protein 2							98.0	97.0	97.0					13																	39262608		2203	4300	6503	SO:0001583	missense	341640	6	121412	38				g.chr13:39262608G>A	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1127G>A	chr13.hg19:g.39262608G>A	ENSP00000280481:p.Arg376His	0						p.R376H	NM_207361.4	NP_997244.3	1	2	3	2.073259	Q5SZK8	FREM2_HUMAN		1	1343	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	1	1	hg19	c.1127G>A	CCDS31960.1	0	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394821	0.62066	.	.	ENSG00000150893	ENST00000280481	T	0.17370	2.28	5.94	5.94	0.96194	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	N	0.21583	0.68	0.58432	D	0.999997	D	0.89917	1.0	P	0.60789	0.879	T	0.01004	-1.1484	10	0.28530	T	0.3	.	16.5915	0.84766	0.0:0.13:0.87:0.0	.	376	Q5SZK8	FREM2_HUMAN	H	376	ENSP00000280481:R376H	ENSP00000280481:R376H	R	+	2	0	0	FREM2	38160608	38160608	0.149000	0.22717	0.998000	0.56505	0.996000	0.88848	1.935000	0.40173	2.826000	0.97356	0.561000	0.74099	CGC	0.171742		TCGA-IB-AAUP-01A-11D-A377-08	0.572	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	1	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	2.100000	-2.961105	1	0.150000	NM_207361		0	19	18	0	379	376	0		1			0	0	82	0	0	0.999991	0	0	0	0	0	0	19	379
AKAP11	11215	broad.mit.edu	37	13	42876975	42876975	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr13:42876975G>C	ENST00000025301.2	+	8	4268	c.4093G>C	c.(4093-4095)Gat>Cat	p.D1365H		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1365					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GTTGATAATGGATCAGTATGC	0.413																																						ENST00000025301.2	1.000000	0.240000	1.000000	0.340000	0.500000	0.585665	0.500000	0.430000																										0				56						c.(4093-4095)Gat>Cat		A kinase (PRKA) anchor protein 11							102.0	94.0	96.0					13																	42876975		2203	4300	6503	SO:0001583	missense	11215	0	0					g.chr13:42876975G>C	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.4093G>C	chr13.hg19:g.42876975G>C	ENSP00000025301:p.Asp1365His	0						p.D1365H	NM_016248.3	NP_057332.1	1	2	3	2.073259	Q9UKA4	AKA11_HUMAN		8	4268	+		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	0	1	hg19	c.4093G>C	CCDS9383.1	0	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424553	0.62733	.	.	ENSG00000023516	ENST00000025301	T	0.59906	0.23	6.16	5.31	0.75309	6.16	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.60560	0.2278	M	0.68952	2.095	0.53688	D	0.999979	P	0.36990	0.577	B	0.37508	0.252	T	0.65590	-0.6131	10	0.87932	D	0	.	17.5986	0.88020	0.0:0.1234:0.8766:0.0	.	1365	Q9UKA4	AKA11_HUMAN	H	1365	ENSP00000025301:D1365H	ENSP00000025301:D1365H	D	+	1	0	0	AKAP11	41774975	41774975	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.096000	0.94182	1.605000	0.50152	-0.181000	0.13052	GAT	0.171742		TCGA-IB-AAUP-01A-11D-A377-08	0.413	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	85	1	2.100000	-10.754260	1	0.150000	NM_016248		0	10	10	0	304	298	0		1	0		0	0	87	0	0	0.996640	2.293523e-01	0	1	0	25	0	10	304
SLITRK5	26050	broad.mit.edu	37	13	88328647	88328647	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr13:88328647G>A	ENST00000325089.6	+	2	1223	c.1004G>A	c.(1003-1005)cGc>cAc	p.R335H	SLITRK5_ENST00000400028.3_Missense_Mutation_p.R94H	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	335					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					AAGGGGACTCGCCAACCCAAC	0.582																																						ENST00000325089.6	1.000000	0.080000	1.000000	0.130000	0.220000	0.384425	0.220000	0.190000																										0				81						c.(1003-1005)cGc>cAc		SLIT and NTRK-like family, member 5							63.0	69.0	67.0					13																	88328647		2203	4300	6503	SO:0001583	missense	26050	0	0					g.chr13:88328647G>A	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1004G>A	chr13.hg19:g.88328647G>A	ENSP00000366283:p.Arg335His	0					SLITRK5_ENST00000400028.3_Missense_Mutation_p.R94H	p.R335H	NM_015567.1	NP_056382.1	1	2	3	2.073259	O94991	SLIK5_HUMAN		2	1223	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	0	1	hg19	c.1004G>A	CCDS9465.1	0	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073303	0.76415	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.59906	0.23;0.49	5.85	5.85	0.93711	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.71656	0.974;0.962	T	0.67511	-0.5652	9	.	.	.	-18.5332	17.6713	0.88218	0.0:0.0:1.0:0.0	.	94;335	B4DSH5;O94991	.;SLIK5_HUMAN	H	335;94	ENSP00000366283:R335H;ENSP00000442244:R94H	.	R	+	2	0	0	SLITRK5	87126648	87126648	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.832000	0.99423	2.771000	0.95319	0.561000	0.74099	CGC	0.171742		TCGA-IB-AAUP-01A-11D-A377-08	0.582	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3	0	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	2.100000	-2.315569	0	0.150000			0	6	6	0	441	436	0		1	0		0	0	80	0	0	0.963977	2.747091e-04	0	0	0	2	0	6	441
F7	2155	broad.mit.edu	37	13	113772782	113772782	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr13:113772782G>A	ENST00000375581.3	+	9	896	c.861G>A	c.(859-861)caG>caA	p.Q287Q	F7_ENST00000541084.1_Silent_p.Q218Q|F7_ENST00000346342.3_Silent_p.Q265Q	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	287	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	GGGTGGCGCAGGTCATCATCC	0.682																																						ENST00000375581.3	1.000000	0.820000	1.000000	0.990000	0.990000	0.987128	0.990000	1.000000																										0				16						c.(859-861)caG>caA		coagulation factor VII (serum prothrombin conversion accelerator)	Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)						80.0	71.0	74.0					13																	113772782		2202	4297	6499	SO:0001819	synonymous_variant	2155	0	0					g.chr13:113772782G>A		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.861G>A	chr13.hg19:g.113772782G>A		0					F7_ENST00000541084.1_Silent_p.Q218Q|F7_ENST00000346342.3_Silent_p.Q265Q	p.Q287Q	NM_000131.4	NP_000122.1	1	2	3	2.073259	P08709	FA7_HUMAN	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)	9	896	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Silent	SNP	ENST00000375581.3	1	1	hg19	c.861G>A	CCDS9528.1	1																																																																																								0.171742		TCGA-IB-AAUP-01A-11D-A377-08	0.682	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4	1	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	2.100000	-20.000000	1	0.150000	NM_000131		0	25	25	0	259	247	0		1			0	0	36	0	0	1.000000	0	0	0	0	0	0	25	259
SLC35F4	341880	broad.mit.edu	37	14	58063541	58063541	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr14:58063541G>A	ENST00000339762.6	-	1	74	c.75C>T	c.(73-75)tgC>tgT	p.C25C	SLC35F4_ENST00000554729.1_5'UTR|SLC35F4_ENST00000556826.1_Intron|SLC35F4_ENST00000557430.1_Intron			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	25					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTGATATACCGCAAAGCCCAT	0.418																																						ENST00000339762.6	1.000000	0.160000	1.000000	0.280000	0.470000	0.563542	0.470000	0.380000																										0				24						c.(73-75)tgC>tgT		solute carrier family 35, member F4							82.0	82.0	82.0					14																	58063541		2013	4188	6201	SO:0001819	synonymous_variant	341880	1	120968	30				g.chr14:58063541G>A			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.75C>T	chr14.hg19:g.58063541G>A		0					SLC35F4_ENST00000556826.1_Intron|SLC35F4_ENST00000554729.1_5'UTR|SLC35F4_ENST00000557430.1_Intron	p.C25C			1	2	3	2.011548	A4IF30	S35F4_HUMAN		1	74	-			A6NDQ3	Silent	SNP	ENST00000339762.6	0	1	hg19	c.75C>T		0																																																																																								0.171136		TCGA-IB-AAUP-01A-11D-A377-08	0.418	SLC35F4-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	2.100000	-2.899738	1	0.150000	XM_292260		0	5	5	0	173	171	0		1			0	0	41	0	0	0.936573	0	0	0	0	0	0	5	173
HERC2	8924	broad.mit.edu	37	15	28391388	28391388	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr15:28391388C>T	ENST00000261609.7	-	71	11111	c.11003G>A	c.(11002-11004)cGg>cAg	p.R3668Q		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTTACCTGACCGCACGGAGAC	0.557																																						ENST00000261609.7	0.840000	0.240000	0.670000	0.350000	0.490000	0.519463	0.490000	0.470000																										0				204						c.(11002-11004)cGg>cAg		HECT and RLD domain containing E3 ubiquitin protein ligase 2							141.0	92.0	109.0					15																	28391388		2203	4300	6503	SO:0001583	missense	8924	0	0					g.chr15:28391388C>T	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11003G>A	chr15.hg19:g.28391388C>T	ENSP00000261609:p.Arg3668Gln	0						p.R3668Q	NM_004667.5	NP_004658.3	0	0	0	1.912962				71	11111	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		Missense_Mutation	SNP	ENST00000261609.7	1	1	hg19	c.11003G>A	CCDS10021.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.958751	0.97145	.	.	ENSG00000128731	ENST00000261609	T	0.39229	1.09	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.65606	0.2707	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.66497	0.944	T	0.68172	-0.5479	10	0.66056	D	0.02	.	19.4151	0.94690	0.0:1.0:0.0:0.0	.	3668	O95714	HERC2_HUMAN	Q	3668	ENSP00000261609:R3668Q	ENSP00000261609:R3668Q	R	-	2	0	0	HERC2	26064983	26064983	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.818000	0.86416	2.601000	0.87937	0.644000	0.83932	CGG	0.114122		TCGA-IB-AAUP-01A-11D-A377-08	0.557	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	0	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	2.100000	-2.859748	1	0.150000	NM_004667		0	9	9	0	227	223	0		1	0		0	0	32	0	0	0.994027	3.399735e-01	0	1	0	28	0	9	227
RYR3	6263	broad.mit.edu	37	15	33858937	33858937	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr15:33858937G>A	ENST00000389232.4	+	12	1275	c.1205G>A	c.(1204-1206)cGt>cAt	p.R402H	RYR3_ENST00000415757.3_Missense_Mutation_p.R402H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	402					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGATGCCAGCGTGAGGAGTCC	0.507																																						ENST00000389232.4	0.670000	0.250000	0.560000	0.330000	0.430000	0.451941	0.430000	0.420000																										0				311						c.(1204-1206)cGt>cAt		ryanodine receptor 3							179.0	182.0	181.0					15																	33858937		2124	4240	6364	SO:0001583	missense	6263	2	121128	40				g.chr15:33858937G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1205G>A	chr15.hg19:g.33858937G>A	ENSP00000373884:p.Arg402His	0					RYR3_ENST00000415757.3_Missense_Mutation_p.R402H	p.R402H	NM_001036.3	NP_001027.3	0	0	0	1.912962	Q15413	RYR3_HUMAN		12	1275	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.1205G>A	CCDS45210.1	0	.	.	.	.	.	.	.	.	.	.	G	7.760	0.705268	0.15172	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96554	-4.05;-4.05	4.58	-3.34	0.04943	4.58	-3.34	0.04943	.	0.429405	0.25050	N	0.033529	D	0.84547	0.5496	N	0.02286	-0.61	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.77117	-0.2706	10	0.34782	T	0.22	.	6.8124	0.23812	0.5544:0.0:0.3254:0.1202	.	402;402	Q15413-2;Q15413	.;RYR3_HUMAN	H	402	ENSP00000373884:R402H;ENSP00000399610:R402H	ENSP00000354735:R402H	R	+	2	0	0	RYR3	31646229	31646229	0.042000	0.20092	0.048000	0.18961	0.734000	0.41952	0.520000	0.22878	-0.521000	0.06426	-0.133000	0.14855	CGT	0.114122		TCGA-IB-AAUP-01A-11D-A377-08	0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	0	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	2.100000	-3.500932	1	0.150000			0	15	15	0	428	421	0		1			0	0	96	0	0	0.999858	0	0	0	0	0	0	15	428
CBLN1	869	broad.mit.edu	37	16	49315201	49315201	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr16:49315201C>A	ENST00000219197.6	-	1	541	c.176G>T	c.(175-177)aGc>aTc	p.S59I	CBLN1_ENST00000536749.1_Missense_Mutation_p.S59I	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	59	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				CACCTTGGCGCTGCCAGAGCG	0.617																																						ENST00000219197.6	1.000000	0.610000	1.000000	0.800000	0.990000	0.929970	0.990000	1.000000																										0				9						c.(175-177)aGc>aTc		cerebellin 1 precursor							52.0	53.0	53.0					16																	49315201		2200	4300	6500	SO:0001583	missense	869	0	0					g.chr16:49315201C>A	M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.176G>T	chr16.hg19:g.49315201C>A	ENSP00000219197:p.Ser59Ile	0					CBLN1_ENST00000536749.1_Missense_Mutation_p.S59I	p.S59I	NM_004352.3	NP_004343.1	1	2	3	2.048254	P23435	CBLN1_HUMAN		1	541	-		all_cancers(37;0.0766)|all_lung(18;0.24)	B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	ENST00000219197.6	1	1	hg19	c.176G>T	CCDS10736.1	1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867934	0.51588	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	D;D	0.82711	-1.64;-1.64	3.88	3.88	0.44766	3.88	3.88	0.44766	Complement C1q protein (2);	0.044975	0.85682	D	0.000000	T	0.78585	0.4306	L	0.39147	1.195	0.53005	D	0.999969	P	0.43973	0.823	B	0.42062	0.374	T	0.81931	-0.0707	10	0.56958	D	0.05	-20.1966	15.6102	0.76710	0.0:1.0:0.0:0.0	.	59	P23435	CBLN1_HUMAN	I	59	ENSP00000219197:S59I;ENSP00000444651:S59I	ENSP00000219197:S59I	S	-	2	0	0	CBLN1	47872702	47872702	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.991000	0.29654	1.994000	0.58287	0.462000	0.41574	AGC	0.166871		TCGA-IB-AAUP-01A-11D-A377-08	0.617	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256845.4	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	2.100000	-19.885630	1	0.150000	NM_004352		0	16	15	0	205	199	0		1	0		0	0	37	0	0	0.999926	7.315678e-02	0	0	0	6	0	16	205
SLC6A2	6530	broad.mit.edu	37	16	55690874	55690874	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr16:55690874G>A	ENST00000379906.2	+	1	523	c.268G>A	c.(268-270)Ggc>Agc	p.G90S	SLC6A2_ENST00000219833.8_Missense_Mutation_p.G90S|SLC6A2_ENST00000414754.3_Missense_Mutation_p.G90S|SLC6A2_ENST00000568943.1_Missense_Mutation_p.G90S|SLC6A2_ENST00000561820.1_Missense_Mutation_p.G90S|SLC6A2_ENST00000566163.1_Missense_Mutation_p.G90S	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	90					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CTACAAGAACGGCGGCGGTGA	0.622																																						ENST00000379906.2	1.000000	0.330000	1.000000	0.420000	0.550000	0.622459	0.550000	0.520000																										0				41						c.(268-270)Ggc>Agc		solute carrier family 6 (neurotransmitter transporter), member 2	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)						69.0	74.0	72.0					16																	55690874		2198	4300	6498	SO:0001583	missense	6530	0	0					g.chr16:55690874G>A		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.268G>A	chr16.hg19:g.55690874G>A	ENSP00000369237:p.Gly90Ser	0					SLC6A2_ENST00000414754.3_Missense_Mutation_p.G90S|SLC6A2_ENST00000219833.8_Missense_Mutation_p.G90S|SLC6A2_ENST00000568943.1_Missense_Mutation_p.G90S|SLC6A2_ENST00000561820.1_Missense_Mutation_p.G90S|SLC6A2_ENST00000566163.1_Missense_Mutation_p.G90S	p.G90S	NM_001043.3	NP_001034.1	1	2	3	2.048254	P23975	SC6A2_HUMAN		1	523	+			B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	1	1	hg19	c.268G>A	CCDS10754.1	0	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879435	0.72294	.	.	ENSG00000103546	ENST00000414754;ENST00000379906;ENST00000219833	D;D;D	0.87491	-2.26;-2.26;-2.26	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.96775	0.8947	H	0.99169	4.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98465	1.0598	10	0.87932	D	0	.	19.2658	0.93984	0.0:0.0:1.0:0.0	.	90;90	Q96KH8;P23975	.;SC6A2_HUMAN	S	90	ENSP00000394956:G90S;ENSP00000369237:G90S;ENSP00000219833:G90S	ENSP00000219833:G90S	G	+	1	0	0	SLC6A2	54248375	54248375	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.728000	0.98792	2.620000	0.88729	0.563000	0.77884	GGC	0.166871		TCGA-IB-AAUP-01A-11D-A377-08	0.622	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2	0	0	1	2	2	2	2	0	0	0	0	98	98	98	94	1	2.100000	-3.090989	1	0.150000			0	19	19	0	483	478	0		1			0	0	98	0	0	0.999990	0	0	0	0	0	0	19	483
HERPUD1	9709	broad.mit.edu	37	16	56973916	56973916	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr16:56973916G>T	ENST00000439977.2	+	6	861	c.664G>T	c.(664-666)Gaa>Taa	p.E222*	HERPUD1_ENST00000379792.2_Nonsense_Mutation_p.E197*|RP11-325K4.2_ENST00000570210.1_RNA|RP11-325K4.3_ENST00000565861.1_RNA|HERPUD1_ENST00000300302.5_Nonsense_Mutation_p.E221*|HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000344114.4_Intron	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	222					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						GTTTCCAGCTGAAAACCAGCC	0.507			T	ERG	prostate																																	ENST00000439977.2	1.000000	0.160000	1.000000	0.260000	0.420000	0.505694	0.420000	0.360000				Dom	yes			Dom	yes		16	16q12.2-q13	16q12.2-q13	9709	T	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""				E	E	ERG		prostate		0				11						c.(664-666)Gaa>Taa		homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1							74.0	68.0	70.0					16																	56973916		2198	4300	6498	SO:0001587	stop_gained	9709	0	0					g.chr16:56973916G>T	AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.664G>T	chr16.hg19:g.56973916G>T	ENSP00000409555:p.Glu222*	0					RP11-325K4.2_ENST00000570210.1_RNA|HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000379792.2_Nonsense_Mutation_p.E197*|RP11-325K4.3_ENST00000565861.1_RNA|HERPUD1_ENST00000300302.5_Nonsense_Mutation_p.E221*|HERPUD1_ENST00000344114.4_Intron	p.E222*	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	1	2	3	2.037184	Q15011	HERP1_HUMAN		6	861	+			E9PGD1|O60644|Q6IAN8|Q96D92	Nonsense_Mutation	SNP	ENST00000439977.2	0	1	hg19	c.664G>T	CCDS10771.1	0	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763994	0.69878	.	.	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302	.	.	.	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.211534	0.49916	D	0.000125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-11.2101	8.4918	0.33104	0.0816:0.1675:0.7509:0.0	.	.	.	.	X	221;197;222	.	ENSP00000300302:E222X	E	+	1	0	0	HERPUD1	55531417	55531417	0.998000	0.40836	0.992000	0.48379	0.992000	0.81027	2.676000	0.46883	2.668000	0.90789	0.655000	0.94253	GAA	0.164414		TCGA-IB-AAUP-01A-11D-A377-08	0.507	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257056.5	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	2.100000	-7.404558	1	0.150000			0	6	6	0	221	215	0		1	1		0	0	73	0	0	0.962584	9.996746e-01	0	8	0	689	0	6	221
EFTUD2	9343	broad.mit.edu	37	17	42937897	42937897	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr17:42937897A>G	ENST00000426333.2	-	17	1919	c.1622T>C	c.(1621-1623)gTg>gCg	p.V541A	EFTUD2_ENST00000402521.3_Missense_Mutation_p.V506A|EFTUD2_ENST00000592576.1_Missense_Mutation_p.V531A|EFTUD2_ENST00000591382.1_Missense_Mutation_p.V541A	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	541					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				AACACGGTTCACCTCGATGTG	0.433																																					Ovarian(10;65 485 10258 29980 30707)	ENST00000426333.2	1.000000	0.870000	1.000000	0.990000	0.990000	0.991819	0.990000	1.000000																										0				32						c.(1621-1623)gTg>gCg		elongation factor Tu GTP binding domain containing 2							133.0	110.0	118.0					17																	42937897		2203	4300	6503	SO:0001583	missense	9343	0	0					g.chr17:42937897A>G	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1622T>C	chr17.hg19:g.42937897A>G	ENSP00000392094:p.Val541Ala	1					EFTUD2_ENST00000591382.1_Missense_Mutation_p.V541A|EFTUD2_ENST00000402521.3_Missense_Mutation_p.V506A|EFTUD2_ENST00000592576.1_Missense_Mutation_p.V531A	p.V541A	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	1	2	3	1.989555	Q15029	U5S1_HUMAN		17	1919	-		Prostate(33;0.109)	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	1	1	hg19	c.1622T>C	CCDS11489.1	1	.	.	.	.	.	.	.	.	.	.	A	19.36	3.813251	0.70912	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.68903	-0.36;-0.36	5.34	5.34	0.76211	5.34	5.34	0.76211	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.78604	0.4309	M	0.91354	3.2	0.80722	D	1	P;P	0.38535	0.635;0.635	P;P	0.44811	0.461;0.461	T	0.82112	-0.0618	10	0.51188	T	0.08	-18.7055	15.129	0.72507	1.0:0.0:0.0:0.0	.	531;541	B4DMC0;Q15029	.;U5S1_HUMAN	A	541;531;506	ENSP00000392094:V541A;ENSP00000385873:V506A	ENSP00000262414:V531A	V	-	2	0	0	EFTUD2	40293423	40293423	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.055000	0.93873	2.240000	0.73641	0.528000	0.53228	GTG	0.197545		TCGA-IB-AAUP-01A-11D-A377-08	0.433	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	1	0	1	2	2	2	2	0	0	0	0	90	90	90	89	1	2.100000	-10.951140	1	0.150000	NM_004247		0	35	35	0	374	372	1		1	1		0	0	90	0	0	1.000000	9.998765e-01	0	30	0	115	0	35	374
PITPNC1	26207	broad.mit.edu	37	17	65688807	65688807	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr17:65688807G>A	ENST00000581322.1	+	9	802	c.802G>A	c.(802-804)Gtc>Atc	p.V268I	PITPNC1_ENST00000580974.1_3'UTR|PITPNC1_ENST00000299954.9_3'UTR|PITPNC1_ENST00000335257.6_Missense_Mutation_p.V268I			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	268					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)	p.V268I(2)		breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			GCCTTCTTCCGTCCGCAGTGC	0.557																																						ENST00000581322.1	1.000000	0.290000	0.860000	0.380000	0.500000	0.570918	0.500000	0.470000																										2	Substitution - Missense(2)	p.V268I(2)	prostate(1)|lung(1)	17						c.(802-804)Gtc>Atc		phosphatidylinositol transfer protein, cytoplasmic 1							121.0	127.0	125.0					17																	65688807		1991	4162	6153	SO:0001583	missense	26207	7	120950	43				g.chr17:65688807G>A	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.802G>A	chr17.hg19:g.65688807G>A	ENSP00000464006:p.Val268Ile	1					PITPNC1_ENST00000299954.9_3'UTR|PITPNC1_ENST00000335257.6_Missense_Mutation_p.V268I|PITPNC1_ENST00000580974.1_3'UTR	p.V268I			1	2	3	1.989555	Q9UKF7	PITC1_HUMAN	BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)	9	802	+	all_cancers(12;3.03e-10)		A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	ENST00000581322.1	1	1	hg19	c.802G>A	CCDS58588.1	0	.	.	.	.	.	.	.	.	.	.	G	8.254	0.809691	0.16537	.	.	ENSG00000154217	ENST00000335257	T	0.44083	0.93	5.75	3.59	0.41128	5.75	3.59	0.41128	.	0.222920	0.47455	D	0.000223	T	0.16811	0.0404	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05257	-1.0896	10	0.34782	T	0.22	-1.2887	4.3035	0.10935	0.3704:0.0:0.6296:0.0	.	268	Q9UKF7	PITC1_HUMAN	I	268	ENSP00000335618:V268I	ENSP00000335618:V268I	V	+	1	0	0	PITPNC1	63119269	63119269	1.000000	0.71417	0.882000	0.34594	0.097000	0.18754	4.034000	0.57289	1.451000	0.47736	-0.136000	0.14681	GTC	0.197545		TCGA-IB-AAUP-01A-11D-A377-08	0.557	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	104	1	2.100000	-3.089164	1	0.150000	NM_012417		0	17	17	0	495	484	0		1	1		0	0	108	0	0	0.999959	9.139164e-01	0	6	0	119	0	17	495
RNF213	57674	broad.mit.edu	37	17	78351573	78351573	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr17:78351573G>A	ENST00000582970.1	+	54	13665	c.13522G>A	c.(13522-13524)Ggc>Agc	p.G4508S	RNF213_ENST00000508628.2_Missense_Mutation_p.G4557S|RNF213_ENST00000336301.6_Missense_Mutation_p.G2581S|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4508					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTGTCCCAACGGCCATCCTTG	0.532																																						ENST00000582970.1	1.000000	0.630000	0.980000	0.730000	0.850000	0.855120	0.850000	1.000000																										0				130						c.(13522-13524)Ggc>Agc		ring finger protein 213							315.0	266.0	282.0					17																	78351573		2203	4300	6503	SO:0001583	missense	57674	1	121412	36				g.chr17:78351573G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13522G>A	chr17.hg19:g.78351573G>A	ENSP00000464087:p.Gly4508Ser	0					CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.G4557S|RNF213_ENST00000336301.6_Missense_Mutation_p.G2581S|CTD-2047H16.4_ENST00000572151.1_RNA	p.G4508S	NM_001256071.1	NP_001243000.1	0	0	0	1.901542	Q63HN8	RN213_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)	54	13665	+	all_neural(118;0.0538)		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	1	1	hg19	c.13522G>A	CCDS58606.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.113576	0.94339	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.55413	0.52	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.73281	0.3567	M	0.75777	2.31	0.44587	D	0.997552	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.987	T	0.76154	-0.3063	10	0.72032	D	0.01	.	17.3883	0.87423	0.0:0.0:1.0:0.0	.	4557;2581	C9JCP4;Q63HN8	.;RN213_HUMAN	S	4508;4557;2581	ENSP00000338218:G2581S	ENSP00000338218:G2581S	G	+	1	0	0	RNF213	75966168	75966168	0.997000	0.39634	0.349000	0.25694	0.985000	0.73830	5.094000	0.64523	2.529000	0.85273	0.655000	0.94253	GGC	0.108547		TCGA-IB-AAUP-01A-11D-A377-08	0.532	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	1	0	1	2	2	2	2	0	0	0	0	123	123	123	123	1	2.100000	-3.221882	1	0.150000	NM_020914		0	45	45	0	621	616	0		1	1	1	0	0	123	601	0	1.000000	9.995478e-01	1	28	39	129	672	45	621
GALNT1	2589	broad.mit.edu	37	18	33243666	33243666	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr18:33243666C>G	ENST00000269195.5	+	2	317	c.214C>G	c.(214-216)Caa>Gaa	p.Q72E	GALNT1_ENST00000537549.1_Missense_Mutation_p.Q12E|GALNT1_ENST00000591081.1_Missense_Mutation_p.Q72E	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	72					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						TAAAGAGGATCAAGAAAAGAT	0.373																																						ENST00000269195.5	0.660000	0.160000	0.510000	0.250000	0.360000	0.388190	0.360000	0.340000																										0				21						c.(214-216)Caa>Gaa		polypeptide N-acetylgalactosaminyltransferase 1							110.0	105.0	107.0					18																	33243666		2203	4300	6503	SO:0001583	missense	2589	0	0					g.chr18:33243666C>G		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.214C>G	chr18.hg19:g.33243666C>G	ENSP00000269195:p.Gln72Glu	1					GALNT1_ENST00000591081.1_Missense_Mutation_p.Q72E|GALNT1_ENST00000537549.1_Missense_Mutation_p.Q12E	p.Q72E	NM_020474.3	NP_065207.2	0	0	0	1.877492	Q10472	GALT1_HUMAN		2	317	+			Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	1	1	hg19	c.214C>G	CCDS11915.1	0	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589022	0.46110	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.54279	0.62;0.58	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.43122	0.1233	L	0.35854	1.095	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26395	-1.0104	10	0.19147	T	0.46	.	16.026	0.80545	0.0:1.0:0.0:0.0	.	72	Q10472	GALT1_HUMAN	E	72;72;12	ENSP00000269195:Q72E;ENSP00000440910:Q12E	ENSP00000269195:Q72E	Q	+	1	0	0	GALNT1	31497664	31497664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.399000	0.81585	0.655000	0.94253	CAA	0.097185		TCGA-IB-AAUP-01A-11D-A377-08	0.373	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	0	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	2.100000	-3.347942	1	0.150000	NM_020474		0	7	7	0	240	238	0		1	1		0	0	72	0	0	0.980473	6.186573e-01	0	3	0	66	0	7	240
NCAN	1463	broad.mit.edu	37	19	19330065	19330065	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr19:19330065C>T	ENST00000252575.6	+	3	514	c.415C>T	c.(415-417)Cgc>Tgc	p.R139C		NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	139	Ig-like V-type.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	TGGGCTGTACCGCTGCCAGGT	0.677																																						ENST00000252575.6	1.000000	0.290000	1.000000	0.510000	0.820000	0.778932	0.820000	1.000000																										0				64						c.(415-417)Cgc>Tgc		neurocan	Hyaluronan(DB08818)																																			SO:0001583	missense	1463	2	121308	30				g.chr19:19330065C>T	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.415C>T	chr19.hg19:g.19330065C>T	ENSP00000252575:p.Arg139Cys	0						p.R139C	NM_004386.2	NP_004377.2	0	0	0	1.970823	O14594	NCAN_HUMAN	Epithelial(12;0.00544)	3	514	+			Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	0	1	hg19	c.415C>T	CCDS12397.1	0	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226025	0.79576	.	.	ENSG00000130287	ENST00000539499;ENST00000252575	T	0.65916	-0.18	4.59	4.59	0.56863	4.59	4.59	0.56863	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40640	N	0.001055	T	0.81772	0.4893	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85912	0.1441	10	0.87932	D	0	.	14.9149	0.70789	0.0:1.0:0.0:0.0	.	139	O14594	NCAN_HUMAN	C	153;139	ENSP00000252575:R139C	ENSP00000252575:R139C	R	+	1	0	0	NCAN	19191065	19191065	1.000000	0.71417	0.990000	0.47175	0.763000	0.43281	4.576000	0.60915	2.113000	0.64589	0.491000	0.48974	CGC	0.139676		TCGA-IB-AAUP-01A-11D-A377-08	0.677	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	1	0	0	2	2	2	2	0	0	0	0	19	19	19	17	1	2.100000	-8.274500	1	0.150000	NM_004386		0	4	4	0	62	60	0		1			0	0	19	0	0	0.885132	0	0	0	0	0	0	4	62
ZFP82	284406	broad.mit.edu	37	19	36884959	36884959	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr19:36884959C>T	ENST00000392161.3	-	5	525	c.283G>A	c.(283-285)Gaa>Aaa	p.E95K	ZFP82_ENST00000392171.1_Missense_Mutation_p.E95K	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAATTTATTTCATAAATGTCA	0.303																																						ENST00000392161.3	1.000000	0.080000	1.000000	0.140000	0.240000	0.405357	0.240000	0.190000																										0				25						c.(283-285)Gaa>Aaa		ZFP82 zinc finger protein							56.0	63.0	61.0					19																	36884959		2165	4276	6441	SO:0001583	missense	284406	0	0					g.chr19:36884959C>T	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.283G>A	chr19.hg19:g.36884959C>T	ENSP00000431265:p.Glu95Lys	1					ZFP82_ENST00000392171.1_Missense_Mutation_p.E95K	p.E95K	NM_133466.2	NP_597723.1	0	9	9	2.621824	Q8N141	ZFP82_HUMAN		5	525	-			Q8NC63|Q8TF53	Missense_Mutation	SNP	ENST00000392161.3	0	1	hg19	c.283G>A	CCDS12493.1	0	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728610	0.30593	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	T;T	0.07908	3.25;3.15	4.4	1.97	0.26223	4.4	1.97	0.26223	.	0.193575	0.25397	N	0.030976	T	0.06554	0.0168	N	0.25992	0.78	0.25084	N	0.99091	P	0.38788	0.647	B	0.40982	0.345	T	0.23833	-1.0177	10	0.51188	T	0.08	.	6.6527	0.22971	0.0:0.6709:0.0:0.329	.	95	Q8N141	ZFP82_HUMAN	K	95	ENSP00000431265:E95K;ENSP00000446080:E95K	ENSP00000431265:E95K	E	-	1	0	0	ZFP82	41576799	41576799	0.005000	0.15991	0.999000	0.59377	0.924000	0.55760	-0.052000	0.11865	0.477000	0.27464	0.650000	0.86243	GAA	0.353612		TCGA-IB-AAUP-01A-11D-A377-08	0.303	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	0	0	1	2	2	2	2	0	0	0	0	124	124	124	124	1	2.100000	-5.183528	1	0.150000	NM_133466		0	6	6	0	535	532	0		1	0		0	0	124	0	0	0.964539	1.827409e-03	0	0	0	5	0	6	535
RYR1	6261	broad.mit.edu	37	19	38989876	38989876	+	Silent	SNP	C	C	T	rs199993301		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr19:38989876C>T	ENST00000359596.3	+	43	7020	c.7020C>T	c.(7018-7020)ttC>ttT	p.F2340F	RYR1_ENST00000360985.3_Silent_p.F2340F|RYR1_ENST00000355481.4_Silent_p.F2340F			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2340	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTGCTGTCTTCGTCAACGGTG	0.602													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19955	0.0		0.0	False		,,,				2504	0.0					ENST00000359596.3	1.000000	0.270000	1.000000	0.380000	0.540000	0.622110	0.540000	0.490000																										0				285						c.(7018-7020)ttC>ttT		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						90.0	69.0	76.0					19																	38989876		2203	4300	6503	SO:0001819	synonymous_variant	6261	57	121412	49				g.chr19:38989876C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7020C>T	chr19.hg19:g.38989876C>T		1					RYR1_ENST00000360985.3_Silent_p.F2340F|RYR1_ENST00000355481.4_Silent_p.F2340F	p.F2340F			0	9	9	2.621824	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	43	7020	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	1	1	hg19	c.7020C>T	CCDS33011.1	0																																																																																								0.353612		TCGA-IB-AAUP-01A-11D-A377-08	0.602	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	0	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	2.100000	-3.221883	1	0.150000			0	12	12	0	433	426	0		1			0	0	47	0	0	0.999053	0	0	0	0	0	0	12	433
CLEC4M	10332	broad.mit.edu	37	19	7832511	7832511	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr19:7832511C>T	ENST00000327325.5	+	6	1164	c.1046C>T	c.(1045-1047)cCc>cTc	p.P349L	CLEC4M_ENST00000394122.2_Missense_Mutation_p.P337L|CLEC4M_ENST00000597522.1_Intron|CLEC4M_ENST00000248228.4_Missense_Mutation_p.P327L|CLEC4M_ENST00000596707.1_Missense_Mutation_p.P282L|CLEC4M_ENST00000595496.1_Missense_Mutation_p.P213L|CLEC4M_ENST00000359059.5_Missense_Mutation_p.P282L|CLEC4M_ENST00000596363.1_Intron|CLEC4M_ENST00000357361.2_Intron|CLEC4M_ENST00000334806.5_Missense_Mutation_p.P298L	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	349	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						CCTCTGTCACCCAGGTAGATT	0.577																																						ENST00000327325.5	0.560000	0.120000	0.420000	0.190000	0.290000	0.315022	0.290000	0.280000																										0				26						c.(1045-1047)cCc>cTc		C-type lectin domain family 4, member M							86.0	75.0	79.0					19																	7832511		2203	4300	6503	SO:0001583	missense	10332	0	0					g.chr19:7832511C>T	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.1046C>T	chr19.hg19:g.7832511C>T	ENSP00000316228:p.Pro349Leu	0					CLEC4M_ENST00000597522.1_Intron|CLEC4M_ENST00000248228.4_Missense_Mutation_p.P327L|CLEC4M_ENST00000595496.1_Missense_Mutation_p.P213L|CLEC4M_ENST00000596363.1_Intron|CLEC4M_ENST00000596707.1_Missense_Mutation_p.P282L|CLEC4M_ENST00000357361.2_Intron|CLEC4M_ENST00000359059.5_Missense_Mutation_p.P282L|CLEC4M_ENST00000334806.5_Missense_Mutation_p.P298L|CLEC4M_ENST00000394122.2_Missense_Mutation_p.P337L	p.P349L	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	0	0	0	1.902604	Q9H2X3	CLC4M_HUMAN		6	1164	+			A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	0	1	hg19	c.1046C>T	CCDS12187.1	0	.	.	.	.	.	.	.	.	.	.	C	1.249	-0.619258	0.03663	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000248228;ENST00000334806;ENST00000359059	T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36	2.23	-1.48	0.08745	2.23	-1.48	0.08745	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.11922	0.0290	N	0.11892	0.195	0.21527	N	0.999659	B;B;P;B;B;B	0.51057	0.032;0.33;0.941;0.074;0.006;0.029	B;B;P;B;B;B	0.51266	0.021;0.133;0.664;0.185;0.002;0.016	T	0.20806	-1.0264	9	0.40728	T	0.16	.	5.2004	0.15260	0.0:0.3984:0.0:0.6016	.	298;282;349;337;326;213	B4E2Z5;Q9H2X3-5;Q9H2X3;E7ENS9;Q9H2X3-8;Q9H2X3-7	.;.;CLC4M_HUMAN;.;.;.	L	349;337;327;298;282	ENSP00000316228:P349L;ENSP00000377680:P337L;ENSP00000248228:P327L;ENSP00000335228:P298L;ENSP00000351954:P282L	ENSP00000248228:P327L	P	+	2	0	0	CLEC4M	7738511	7738511	0.005000	0.15991	0.066000	0.19879	0.030000	0.12068	-0.702000	0.05069	-0.281000	0.09141	0.556000	0.70494	CCC	0.108547		TCGA-IB-AAUP-01A-11D-A377-08	0.577	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	0	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	2.100000	-3.559837	1	0.150000	NM_014257		0	6	6	0	266	263	0		1	0		0	0	43	0	0	0.964234	1.021713e-02	0	0	0	6	0	6	266
MUC16	94025	broad.mit.edu	37	19	9056276	9056276	+	Silent	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr19:9056276C>T	ENST00000397910.4	-	3	31373	c.31170G>A	c.(31168-31170)agG>agA	p.R10390R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10392	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGAAGATGTCCTGCCTGGTT	0.488																																						ENST00000397910.4	0.640000	0.300000	0.550000	0.370000	0.450000	0.470014	0.450000	0.460000																										0				590						c.(31168-31170)agG>agA		mucin 16, cell surface associated							188.0	186.0	186.0					19																	9056276		2067	4218	6285	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9056276C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31170G>A	chr19.hg19:g.9056276C>T		0						p.R10390R	NM_024690.2	NP_078966.2	0	0	0	1.902604	Q8WXI7	MUC16_HUMAN		3	31373	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	1	1	hg19	c.31170G>A	CCDS54212.1	0																																																																																								0.108547		TCGA-IB-AAUP-01A-11D-A377-08	0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	155	155	155	153	1	2.100000	-3.482625	1	0.150000	NM_024690		0	26	26	0	694	683	0		1			0	0	155	0	0	1.000000	0	0	0	0	0	0	26	694
ZNF526	116115	broad.mit.edu	37	19	42730124	42730124	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr19:42730124G>A	ENST00000301215.3	+	3	1794	c.1569G>A	c.(1567-1569)acG>acA	p.T523T		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				TGACCCATACGGGTGCACGTC	0.617																																						ENST00000301215.3	1.000000	0.800000	1.000000	0.970000	0.990000	0.981628	0.990000	1.000000																										0				22						c.(1567-1569)acG>acA		zinc finger protein 526							70.0	65.0	67.0					19																	42730124		2203	4300	6503	SO:0001819	synonymous_variant	116115	0	0					g.chr19:42730124G>A	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1569G>A	chr19.hg19:g.42730124G>A		0						p.T523T	NM_133444.1	NP_597701.1	0	0	0	1.903512	Q8TF50	ZN526_HUMAN		3	1794	+		Prostate(69;0.0704)	B3KV29|Q69YI2|Q96E24	Silent	SNP	ENST00000301215.3	1	1	hg19	c.1569G>A	CCDS12598.1	1																																																																																								0.109948		TCGA-IB-AAUP-01A-11D-A377-08	0.617	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	1	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	2.100000	-2.341072	0	0.150000	XM_057401		0	25	25	0	232	229	0		1	1		0	0	57	0	0	1.000000	5.444555e-01	0	3	0	15	0	25	232
LCE2B	26239	broad.mit.edu	37	1	152659492	152659492	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:152659492C>T	ENST00000368780.3	+	2	227	c.173C>T	c.(172-174)cCc>cTc	p.P58L	LCE2B_ENST00000417924.2_Missense_Mutation_p.P58L	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	58	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCTGTGGTCCCAGCTCTGGG	0.667																																						ENST00000368780.3	0.620000	0.330000	0.540000	0.390000	0.460000	0.473305	0.460000	0.460000																										0				11						c.(172-174)cCc>cTc		late cornified envelope 2B							103.0	119.0	113.0					1																	152659492		2203	4300	6503	SO:0001583	missense	26239	0	0					g.chr1:152659492C>T	BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.173C>T	chr1.hg19:g.152659492C>T	ENSP00000357769:p.Pro58Leu	0					LCE2B_ENST00000417924.2_Missense_Mutation_p.P58L	p.P58L	NM_014357.4	NP_055172.1	0	1	1	1.980726	O14633	LCE2B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	2	227	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Q5TA80	Missense_Mutation	SNP	ENST00000368780.3	1	1	hg19	c.173C>T	CCDS1020.1	0	.	.	.	.	.	.	.	.	.	.	C	0.706	-0.789106	0.02884	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	T;T	0.03982	3.74;3.74	2.49	0.482	0.16815	2.49	0.482	0.16815	.	.	.	.	.	T	0.01189	0.0039	L	0.29908	0.895	0.26615	N	0.972753	B	0.06786	0.001	B	0.01281	0.0	T	0.46541	-0.9184	9	0.87932	D	0	.	4.5339	0.12019	0.0:0.6472:0.0:0.3528	.	58	O14633	LCE2B_HUMAN	L	58	ENSP00000414043:P58L;ENSP00000357769:P58L	ENSP00000357769:P58L	P	+	2	0	0	LCE2B	150926116	150926116	0.030000	0.19436	0.139000	0.22197	0.053000	0.15095	0.161000	0.16481	-0.140000	0.11394	0.313000	0.20887	CCC	0.145514		TCGA-IB-AAUP-01A-11D-A377-08	0.667	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034524.1	0	0	1	2	2	2	2	0	0	0	0	186	186	186	185	1	2.100000	-3.151703	1	0.150000	NM_014357		0	39	37	0	1074	1060	0		1			0	0	186	0	0	1.000000	0	0	0	0	0	0	39	1074
BCAN	63827	broad.mit.edu	37	1	156626767	156626767	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:156626767G>A	ENST00000329117.5	+	10	2424	c.2088G>A	c.(2086-2088)caG>caA	p.Q696Q	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	696	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACGCCTTCCAGGGCGCCTGCT	0.657																																						ENST00000329117.5	0.720000	0.190000	0.570000	0.280000	0.410000	0.433968	0.410000	0.390000																										0				55						c.(2086-2088)caG>caA		brevican							39.0	41.0	40.0					1																	156626767		2203	4300	6503	SO:0001819	synonymous_variant	63827	0	0					g.chr1:156626767G>A	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2088G>A	chr1.hg19:g.156626767G>A		0					RP11-284F21.7_ENST00000448869.1_RNA	p.Q696Q	NM_021948.4	NP_068767.3	0	1	1	1.980726	Q96GW7	PGCB_HUMAN		10	2424	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	1	1	hg19	c.2088G>A	CCDS1149.1	0																																																																																								0.145514		TCGA-IB-AAUP-01A-11D-A377-08	0.657	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	2.100000	-2.877779	1	0.150000	NM_021948		0	8	7	0	259	256	0		1			0	0	46	0	0	0.989009	0	0	0	0	0	0	8	259
ITLN1	55600	broad.mit.edu	37	1	160850421	160850421	+	Silent	SNP	G	G	A	rs201111955		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:160850421G>A	ENST00000326245.3	-	6	757	c.642C>T	c.(640-642)ggC>ggT	p.G214G	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	214	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TCTGGGCGTCGCCAAAATCAT	0.443																																						ENST00000326245.3	0.240000	0.060000	0.190000	0.090000	0.130000	0.142783	0.130000	0.130000																										0				21						c.(640-642)ggC>ggT		intelectin 1 (galactofuranose binding)							181.0	181.0	181.0					1																	160850421		2203	4300	6503	SO:0001819	synonymous_variant	55600	3	121412	42				g.chr1:160850421G>A	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.642C>T	chr1.hg19:g.160850421G>A		0					ITLN1_ENST00000487531.1_5'UTR	p.G214G	NM_017625.2	NP_060095.2	0	1	1	1.980726	Q8WWA0	ITLN1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)	6	757	-	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Silent	SNP	ENST00000326245.3	0	1	hg19	c.642C>T	CCDS1211.1	0																																																																																								0.145514		TCGA-IB-AAUP-01A-11D-A377-08	0.443	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	0	0	1	2	2	2	2	0	0	0	0	223	223	223	221	1	2.100000	-1.626438	0	0.150000	NM_017625		0	9	8	0	912	903	0		1	0		0	0	223	0	0	0.993902	3.819416e-04	0	0	0	3	0	9	912
GPA33	10223	broad.mit.edu	37	1	167024256	167024256	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:167024256G>A	ENST00000367868.3	-	6	1127	c.784C>T	c.(784-786)Cga>Tga	p.R262*	RP11-102C16.3_ENST00000417644.1_RNA|GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	262						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TCCTTCCCTCGGCAGCAGCAG	0.562																																						ENST00000367868.3	0.900000	0.320000	0.740000	0.430000	0.570000	0.592427	0.570000	0.560000																										0				15						c.(784-786)Cga>Tga		glycoprotein A33 (transmembrane)							157.0	119.0	132.0					1																	167024256		2203	4300	6503	SO:0001587	stop_gained	10223	4	121412	38				g.chr1:167024256G>A	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.784C>T	chr1.hg19:g.167024256G>A	ENSP00000356842:p.Arg262*	0					RP11-102C16.3_ENST00000417644.1_RNA|GPA33_ENST00000527955.1_5'UTR	p.R262*	NM_005814.1	NP_005805.1	0	1	1	1.980726	Q99795	GPA33_HUMAN		6	1127	-			Q5VZP6	Nonsense_Mutation	SNP	ENST00000367868.3	0	1	hg19	c.784C>T	CCDS1258.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.857738	0.97030	.	.	ENSG00000143167	ENST00000367868	.	.	.	4.67	3.64	0.41730	4.67	3.64	0.41730	.	0.451102	0.20825	N	0.084995	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.7064	0.45958	0.0:0.0:0.7959:0.2041	.	.	.	.	X	262	.	ENSP00000356842:R262X	R	-	1	2	2	GPA33	165290880	165290880	0.983000	0.35010	0.792000	0.32020	0.425000	0.31504	2.725000	0.47294	2.135000	0.66039	0.484000	0.47621	CGA	0.145514		TCGA-IB-AAUP-01A-11D-A377-08	0.562	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	0	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	2.100000	-2.816329	1	0.150000	NM_005814		0	13	12	0	292	289	0		1	0		0	0	61	0	0	0.999523	8.981780e-02	0	0	0	11	0	13	292
SMPDL3B	27293	broad.mit.edu	37	1	28261707	28261707	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:28261707G>C	ENST00000373894.3	+	1	204	c.13G>C	c.(13-15)Gcc>Ccc	p.A5P	SMPDL3B_ENST00000373888.4_Missense_Mutation_p.A5P|SMPDL3B_ENST00000549094.1_Missense_Mutation_p.A5P|SMPDL3B_ENST00000466793.1_3'UTR	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	5					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		GAGGCTGCTCGCCTGGCTGAT	0.547																																						ENST00000373894.3	1.000000	0.320000	1.000000	0.470000	0.690000	0.708248	0.690000	1.000000																										0				16						c.(13-15)Gcc>Ccc		sphingomyelin phosphodiesterase, acid-like 3B							76.0	69.0	72.0					1																	28261707		2203	4300	6503	SO:0001583	missense	27293	0	0					g.chr1:28261707G>C	Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.13G>C	chr1.hg19:g.28261707G>C	ENSP00000363001:p.Ala5Pro	0					SMPDL3B_ENST00000466793.1_3'UTR|SMPDL3B_ENST00000549094.1_Missense_Mutation_p.A5P|SMPDL3B_ENST00000373888.4_Missense_Mutation_p.A5P	p.A5P	NM_014474.2	NP_055289.2	1	2	3	2.008329	Q92485	ASM3B_HUMAN		1	204	+		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	B7ZB35|Q5T0Z0|Q96CB7	Missense_Mutation	SNP	ENST00000373894.3	0	1	hg19	c.13G>C	CCDS30655.1	0	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051591	0.36181	.	.	ENSG00000130768	ENST00000373894;ENST00000373890;ENST00000411604;ENST00000373888;ENST00000549094;ENST00000412515	D;T;D;D	0.90004	-2.6;1.73;-2.6;-2.6	3.79	-6.63	0.01807	3.79	-6.63	0.01807	.	3.314520	0.01170	U	0.006848	T	0.80899	0.4712	L	0.39898	1.24	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.63800	-0.6555	10	0.41790	T	0.15	1.2634	3.014	0.06053	0.2355:0.1489:0.4691:0.1465	.	5;5;5	F8VWW8;Q92485;Q92485-2	.;ASM3B_HUMAN;.	P	5	ENSP00000363001:A5P;ENSP00000388092:A5P;ENSP00000362995:A5P;ENSP00000449450:A5P	ENSP00000362995:A5P	A	+	1	0	0	SMPDL3B	28134294	28134294	0.000000	0.05858	0.001000	0.08648	0.213000	0.24496	-1.654000	0.01984	-1.170000	0.02769	-1.336000	0.01259	GCC	0.158207		TCGA-IB-AAUP-01A-11D-A377-08	0.547	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011170.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	17	1	2.100000	-10.741290	1	0.150000	NM_014474		0	8	8	0	161	159	0		1	1		0	0	18	0	0	0.989397	3.392040e-01	0	4	0	19	0	8	161
PUM1	9698	broad.mit.edu	37	1	31447601	31447601	+	Missense_Mutation	SNP	A	A	C			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:31447601A>C	ENST00000257075.5	-	10	1496	c.1403T>G	c.(1402-1404)gTc>gGc	p.V468G	PUM1_ENST00000424085.2_Missense_Mutation_p.V226G|PUM1_ENST00000426105.2_Missense_Mutation_p.V468G|PUM1_ENST00000440538.2_Missense_Mutation_p.V469G|PUM1_ENST00000373747.3_Missense_Mutation_p.V469G|PUM1_ENST00000423018.2_Missense_Mutation_p.V372G|PUM1_ENST00000373741.4_Missense_Mutation_p.V504G|PUM1_ENST00000373742.2_Missense_Mutation_p.V409G|PUM1_ENST00000490546.1_5'UTR	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	468	Ala-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GGCAGGGTAGACTCCCCAGGG	0.512																																						ENST00000257075.5	1.000000	0.140000	0.760000	0.250000	0.430000	0.495966	0.430000	0.360000																										0				48						c.(1402-1404)gTc>gGc		pumilio RNA-binding family member 1							49.0	49.0	49.0					1																	31447601		2203	4300	6503	SO:0001583	missense	9698	0	0					g.chr1:31447601A>C	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1403T>G	chr1.hg19:g.31447601A>C	ENSP00000257075:p.Val468Gly	0					PUM1_ENST00000423018.2_Missense_Mutation_p.V372G|PUM1_ENST00000424085.2_Missense_Mutation_p.V226G|PUM1_ENST00000373747.3_Missense_Mutation_p.V469G|PUM1_ENST00000373741.4_Missense_Mutation_p.V504G|PUM1_ENST00000440538.2_Missense_Mutation_p.V469G|PUM1_ENST00000426105.2_Missense_Mutation_p.V468G|PUM1_ENST00000490546.1_5'UTR|PUM1_ENST00000373742.2_Missense_Mutation_p.V409G	p.V468G	NM_014676.2	NP_055491.1	1	2	3	2.008329	Q14671	PUM1_HUMAN		10	1496	-		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	0	1	hg19	c.1403T>G	CCDS338.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.2|24.2	4.506990|4.506990	0.85282|0.85282	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000525843;ENST00000498419;ENST00000532678|ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000543952	.|T;T;T;T;T;T;T;T	.|0.32753	.|1.73;1.44;1.74;1.73;1.69;1.7;1.6;1.56	6.16|6.16	6.16|6.16	0.99307|0.99307	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54319|0.54319	0.1851|0.1851	M|M	0.71036|0.71036	2.16|2.16	0.80722|0.80722	D|D	1|1	.|D;P;D;P;D;D;D;D	.|0.89917	.|1.0;0.608;1.0;0.728;1.0;1.0;1.0;1.0	.|D;B;D;B;D;D;D;D	.|0.83275	.|0.996;0.202;0.996;0.366;0.996;0.996;0.996;0.996	T|T	0.57642|0.57642	-0.7776|-0.7776	5|10	.|0.87932	.|D	.|0	-9.606|-9.606	12.5418|12.5418	0.56174|0.56174	0.9342:0.0:0.0658:0.0|0.9342:0.0:0.0658:0.0	.|.	.|409;372;504;469;468;468;469;468	.|B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.|.;.;.;.;PUM1_HUMAN;.;.;.	R|G	485;179;155|226;468;469;206;468;469;504;372;409;468	.|ENSP00000400141:V226G;ENSP00000257075:V468G;ENSP00000362852:V469G;ENSP00000391723:V468G;ENSP00000401777:V469G;ENSP00000362846:V504G;ENSP00000399440:V372G;ENSP00000362847:V409G	.|ENSP00000257075:V468G	S|V	-|-	3|2	2|0	2|0	PUM1|PUM1	31220188|31220188	31220188|31220188	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.442000|7.442000	0.80503|0.80503	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	AGT|GTC	0.158207		TCGA-IB-AAUP-01A-11D-A377-08	0.512	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1	0	0	0	2	2	2	2	0	0	0	0	25	25	25	25	1	2.100000	-6.902537	1	0.150000			0	4	4	0	142	137	1		1	1		0	0	25	0	0	0.883076	6.104544e-01	0	9	0	58	0	4	142
CSMD2	114784	broad.mit.edu	37	1	34164425	34164425	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:34164425G>A	ENST00000373380.1	-	3	692	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.R1285W			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1245	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R1245W(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCACTACCCCGCAGGCTGTAT	0.602																																						ENST00000373380.1	1.000000	0.160000	0.540000	0.240000	0.350000	0.422931	0.350000	0.320000																										1	Substitution - Missense(1)	p.R1245W(1)	large_intestine(1)	246						c.(472-474)Cgg>Tgg		CUB and Sushi multiple domains 2							81.0	78.0	79.0					1																	34164425		2203	4300	6503	SO:0001583	missense	114784	4	121412	38				g.chr1:34164425G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.472C>T	chr1.hg19:g.34164425G>A	ENSP00000362478:p.Arg158Trp	0					CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.R1285W	p.R158W			1	2	3	2.008329	Q7Z408	CSMD2_HUMAN		3	692	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	1	1	hg19	c.472C>T		0	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847745	0.71603	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.65732	-0.17;-0.17	5.76	4.83	0.62350	5.76	4.83	0.62350	Complement control module (2);Sushi/SCR/CCP (3);	0.064952	0.64402	D	0.000009	T	0.75398	0.3844	M	0.62266	1.93	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;P;P	0.69307	0.963;0.892;0.892	T	0.78157	-0.2313	10	0.66056	D	0.02	.	14.5371	0.67969	0.0:0.0:0.735:0.265	.	158;1245;1285	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	W	1285;158	ENSP00000362479:R1285W;ENSP00000362478:R158W	ENSP00000241312:R1245W	R	-	1	2	2	CSMD2	33937012	33937012	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.128000	0.42045	1.522000	0.49001	0.650000	0.86243	CGG	0.158207		TCGA-IB-AAUP-01A-11D-A377-08	0.602	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	0	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	2.100000	-2.745877	1	0.150000	NM_052896		0	9	9	0	362	358	0		1	0		0	0	58	0	0	0.994068	0	0	0	0	1	0	9	362
LPHN2	23266	broad.mit.edu	37	1	82372825	82372825	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:82372825G>A	ENST00000370728.1	+	6	842	c.197G>A	c.(196-198)cGg>cAg	p.R66Q	LPHN2_ENST00000335786.5_Missense_Mutation_p.R66Q|LPHN2_ENST00000370715.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370713.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000319517.6_Missense_Mutation_p.R66Q|LPHN2_ENST00000370717.2_Missense_Mutation_p.R66Q|LPHN2_ENST00000370725.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000271029.4_Missense_Mutation_p.R66Q|LPHN2_ENST00000370727.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370723.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000359929.3_Missense_Mutation_p.R66Q|LPHN2_ENST00000370721.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000394879.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370730.1_Missense_Mutation_p.R66Q			O95490	LPHN2_HUMAN	latrophilin 2	66	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		AACTATGGTCGGACGGATGAC	0.453																																						ENST00000370728.1	1.000000	0.240000	0.590000	0.320000	0.420000	0.485748	0.420000	0.400000																										0				119						c.(196-198)cGg>cAg		latrophilin 2							168.0	154.0	159.0					1																	82372825		2203	4300	6503	SO:0001583	missense	23266	0	0					g.chr1:82372825G>A	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.197G>A	chr1.hg19:g.82372825G>A	ENSP00000359763:p.Arg66Gln	0					LPHN2_ENST00000370717.2_Missense_Mutation_p.R66Q|LPHN2_ENST00000359929.3_Missense_Mutation_p.R66Q|LPHN2_ENST00000370721.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000335786.5_Missense_Mutation_p.R66Q|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370725.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000271029.4_Missense_Mutation_p.R66Q|LPHN2_ENST00000394879.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370723.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370715.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370713.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000370727.1_Missense_Mutation_p.R66Q|LPHN2_ENST00000319517.6_Missense_Mutation_p.R66Q|LPHN2_ENST00000370730.1_Missense_Mutation_p.R66Q	p.R66Q			1	2	3	2.008329	O95490	LPHN2_HUMAN		6	842	+			A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	1	1	hg19	c.197G>A		0	.	.	.	.	.	.	.	.	.	.	G	36	5.681143	0.96774	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000001	T	0.52306	0.1726	M	0.92169	3.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;1.0	T	0.65709	-0.6102	10	0.87932	D	0	.	18.8804	0.92353	0.0:0.0:1.0:0.0	.	66;66;66;66	O95490-3;O95490-4;O95490-2;B3KVU1	.;.;.;.	Q	66	ENSP00000359756:R66Q;ENSP00000359763:R66Q;ENSP00000359765:R66Q;ENSP00000359762:R66Q;ENSP00000359760:R66Q;ENSP00000359758:R66Q;ENSP00000353006:R66Q;ENSP00000359750:R66Q;ENSP00000359748:R66Q;ENSP00000322270:R66Q;ENSP00000359752:R66Q;ENSP00000378344:R66Q;ENSP00000271029:R66Q;ENSP00000337306:R66Q	ENSP00000271029:R66Q	R	+	2	0	0	LPHN2	82145413	82145413	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.695000	0.98691	2.527000	0.85204	0.557000	0.71058	CGG	0.158207		TCGA-IB-AAUP-01A-11D-A377-08	0.453	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	0	0	1	2	2	2	2	0	0	0	0	118	118	118	116	1	2.100000	-2.471780	0	0.150000	NM_012302		0	16	16	0	514	503	0		1	0		0	0	118	0	0	0.999922	2.377610e-01	0	0	0	29	0	16	514
PAPPA2	60676	broad.mit.edu	37	1	176640105	176640105	+	Splice_Site	SNP	G	G	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr1:176640105G>T	ENST00000367662.3	+	4	3155		c.e4-1		PAPPA2_ENST00000367661.3_Splice_Site	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2						bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ATGCTCTCTAGGGCATACATG	0.483																																						ENST00000367662.3	0.480000	0.200000	0.400000	0.250000	0.320000	0.334401	0.320000	0.320000																										0				226						c.e4-1		pappalysin 2							167.0	165.0	166.0					1																	176640105		1967	4159	6126	SO:0001630	splice_region_variant	60676	0	0					g.chr1:176640105G>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1992-1G>T	chr1.hg19:g.176640105G>T		0					PAPPA2_ENST00000367661.3_Splice_Site		NM_020318.2	NP_064714.2	0	1	1	1.980726	Q9BXP8	PAPP2_HUMAN		4	3155	+			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Splice_Site	SNP	ENST00000367662.3	1	1	hg19		CCDS41438.1	0	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567297	0.86439	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	.	.	.	5.4	5.4	0.78164	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7796	0.91926	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	PAPPA2	174906728	174906728	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.613000	0.98350	2.509000	0.84616	0.655000	0.94253	.	0.145514		TCGA-IB-AAUP-01A-11D-A377-08	0.483	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1	0	0	1	2	17	2	2	1	1	1	1	176	176	176	174	1	2.100000	-1.878673	0	0.150000		Intron	0	20	19	0	805	798	0		1			1	0	176	0	0	0.735779	0	0	0	0	0	0	20	805
KIF16B	55614	broad.mit.edu	37	20	16360516	16360516	+	Nonsense_Mutation	SNP	G	G	A	rs201140090		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr20:16360516G>A	ENST00000354981.2	-	19	2288	c.2131C>T	c.(2131-2133)Cga>Tga	p.R711*	KIF16B_ENST00000408042.1_Nonsense_Mutation_p.R711*|KIF16B_ENST00000378003.2_De_novo_Start_OutOfFrame|KIF16B_ENST00000355755.3_Nonsense_Mutation_p.R711*	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	711	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TCTTTGAGTCGTTGGAGTTCT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		21064	0.001		0.0	False		,,,				2504	0.0					ENST00000354981.2	0.530000	0.180000	0.430000	0.240000	0.330000	0.344815	0.330000	0.320000																										0				74						c.(2131-2133)Cga>Tga		kinesin family member 16B							155.0	140.0	146.0					20																	16360516		2203	4300	6503	SO:0001587	stop_gained	55614	12	121412	45				g.chr20:16360516G>A	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2131C>T	chr20.hg19:g.16360516G>A	ENSP00000347076:p.Arg711*	0					KIF16B_ENST00000355755.3_Nonsense_Mutation_p.R711*|KIF16B_ENST00000378003.2_De_novo_Start_OutOfFrame|KIF16B_ENST00000408042.1_Nonsense_Mutation_p.R711*	p.R711*	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	0	1	1	1.983559	Q96L93	KI16B_HUMAN		19	2288	-			A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Nonsense_Mutation	SNP	ENST00000354981.2	0	1	hg19	c.2131C>T	CCDS13122.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.79	3.698839	0.68501	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000408042	.	.	.	5.39	-2.5	0.06384	5.39	-2.5	0.06384	.	0.267875	0.35585	N	0.003112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.9842	0.09507	0.3095:0.0:0.3307:0.3598	.	.	.	.	X	711	.	ENSP00000347076:R711X	R	-	1	2	2	KIF16B	16308516	16308516	0.637000	0.27216	0.033000	0.17914	0.004000	0.04260	0.491000	0.22419	-0.381000	0.07882	0.655000	0.94253	CGA	0.146158		TCGA-IB-AAUP-01A-11D-A377-08	0.443	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	0	0	1	2	2	2	2	0	0	0	0	169	169	169	168	1	2.100000	-2.913835	1	0.150000	NM_017683		0	13	13	0	518	510	0		1	1		0	0	169	0	0	0.999493	1.602418e-01	0	2	0	25	0	13	518
RBM12	10137	broad.mit.edu	37	20	34241168	34241168	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr20:34241168G>A	ENST00000374114.3	-	3	2340	c.2077C>T	c.(2077-2079)Ccc>Tcc	p.P693S	CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P693S|RBM12_ENST00000359646.1_Missense_Mutation_p.P693S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	693	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CCTGCACTGGGCATTCCCGCA	0.557																																						ENST00000374114.3	0.280000	0.060000	0.210000	0.090000	0.140000	0.159944	0.140000	0.140000																										0				36						c.(2077-2079)Ccc>Tcc		RNA binding motif protein 12							49.0	47.0	48.0					20																	34241168		2199	4292	6491	SO:0001583	missense	10137	0	0					g.chr20:34241168G>A	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2077C>T	chr20.hg19:g.34241168G>A	ENSP00000363228:p.Pro693Ser	0					CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P693S|RBM12_ENST00000359646.1_Missense_Mutation_p.P693S|CPNE1_ENST00000397445.1_Intron	p.P693S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	0	1	1	1.983559	Q9NTZ6	RBM12_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00953)	3	2340	-	Lung NSC(9;0.00608)|all_lung(11;0.00918)		B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	0	1	hg19	c.2077C>T	CCDS13261.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.653504	0.96724	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.22336	1.96;1.96;1.96	4.03	4.03	0.46877	4.03	4.03	0.46877	.	0.000000	0.64402	D	0.000018	T	0.27663	0.0680	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.02365	-1.1170	10	0.19590	T	0.45	-3.377	14.4866	0.67622	0.0:0.0:1.0:0.0	.	693	Q9NTZ6	RBM12_HUMAN	S	693;693;693;492	ENSP00000363228:P693S;ENSP00000352668:P693S;ENSP00000363217:P693S	ENSP00000339879:P492S	P	-	1	0	0	RBM12	33704582	33704582	0.002000	0.14202	0.997000	0.53966	0.903000	0.53119	-0.160000	0.10041	2.528000	0.85240	0.563000	0.77884	CCC	0.146158		TCGA-IB-AAUP-01A-11D-A377-08	0.557	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	0	0	1	2	2	2	2	0	0	0	0	132	132	132	132	1	2.100000	-2.179201	0	0.150000	NM_006047		0	7	7	0	649	641	0		1	0		0	0	132	0	0	0.979812	1.736922e-01	0	0	0	61	0	7	649
IL10RB	3588	broad.mit.edu	37	21	34648943	34648943	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr21:34648943G>A	ENST00000290200.2	+	3	324	c.216G>A	c.(214-216)acG>acA	p.T72T	AP000295.9_ENST00000433395.2_Missense_Mutation_p.R200Q	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	72	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						CTACCTTGACGGAATGTGATT	0.423																																					Melanoma(67;315 1275 21667 21943 44564)	ENST00000290200.2	0.610000	0.230000	0.500000	0.300000	0.390000	0.408734	0.390000	0.390000																										0				14						c.(214-216)acG>acA		interleukin 10 receptor, beta							219.0	197.0	204.0					21																	34648943		2203	4300	6503	SO:0001819	synonymous_variant	3588	0	0					g.chr21:34648943G>A	U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.216G>A	chr21.hg19:g.34648943G>A		0					AP000295.9_ENST00000433395.2_Missense_Mutation_p.R200Q	p.T72T	NM_000628.4	NP_000619.3	0	0	0	1.911145	Q08334	I10R2_HUMAN		3	324	+			Q9BUU4	Silent	SNP	ENST00000290200.2	0	1	hg19	c.216G>A	CCDS13623.1	0	.	.	.	.	.	.	.	.	.	.	G	6.016	0.371328	0.11409	.	.	ENSG00000249624	ENST00000433395	.	.	.	5.73	-6.28	0.02020	5.73	-6.28	0.02020	.	.	.	.	.	T	0.15696	0.0378	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.25293	-1.0136	4	.	.	.	-4.5826	1.0173	0.01510	0.3828:0.0988:0.2184:0.3001	.	.	.	.	Q	200	.	.	R	+	2	0	0	AP000295.9	33570813	33570813	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	-2.065000	0.01386	-1.134000	0.02899	-0.136000	0.14681	CGG	0.112735		TCGA-IB-AAUP-01A-11D-A377-08	0.423	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139831.3	0	0	1	2	2	2	2	0	0	0	0	111	111	111	110	1	2.100000	-2.386193	0	0.150000			0	15	15	0	475	470	0		1	1		0	0	111	0	0	0.999865	6.266995e-01	0	2	0	65	0	15	475
DIP2A	23181	broad.mit.edu	37	21	47918690	47918690	+	Missense_Mutation	SNP	C	C	T	rs202158653		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr21:47918690C>T	ENST00000417564.2	+	5	620	c.599C>T	c.(598-600)aCg>aTg	p.T200M	DIP2A_ENST00000318711.7_Missense_Mutation_p.T200M|DIP2A_ENST00000457905.3_Missense_Mutation_p.T200M|DIP2A_ENST00000435722.3_Missense_Mutation_p.T200M|DIP2A_ENST00000427143.2_Missense_Mutation_p.T136M|DIP2A_ENST00000466639.1_Missense_Mutation_p.T200M|DIP2A_ENST00000400274.1_Missense_Mutation_p.T200M			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	200					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GCTGCAGCCACGCCGGGGGCC	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13854	0.0		0.0	False		,,,				2504	0.0					ENST00000417564.2	1.000000	0.410000	0.920000	0.550000	0.720000	0.732492	0.720000	1.000000																										0				43						c.(598-600)aCg>aTg		DIP2 disco-interacting protein 2 homolog A (Drosophila)							21.0	30.0	27.0					21																	47918690		2012	4154	6166	SO:0001583	missense	23181	2	119628	29				g.chr21:47918690C>T	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.599C>T	chr21.hg19:g.47918690C>T	ENSP00000392066:p.Thr200Met	0					DIP2A_ENST00000466639.1_Missense_Mutation_p.T200M|DIP2A_ENST00000400274.1_Missense_Mutation_p.T200M|DIP2A_ENST00000457905.3_Missense_Mutation_p.T200M|DIP2A_ENST00000435722.3_Missense_Mutation_p.T200M|DIP2A_ENST00000427143.2_Missense_Mutation_p.T136M|DIP2A_ENST00000318711.7_Missense_Mutation_p.T200M	p.T200M			0	0	0	1.911145	Q14689	DIP2A_HUMAN		5	620	+	Breast(49;0.0933)		A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	1	1	hg19	c.599C>T	CCDS46655.1	0	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	4.503	0.093291	0.08632	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.23754	1.9;1.89;1.93;1.89;1.92;1.91;1.9	1.13	1.13	0.20643	1.13	1.13	0.20643	.	1.142920	0.07083	U	0.837442	T	0.24736	0.0600	N	0.08118	0	0.09310	N	1	P;P;D;P;D;P	0.64830	0.819;0.927;0.994;0.819;0.966;0.871	B;B;P;B;B;B	0.62014	0.118;0.322;0.897;0.118;0.176;0.157	T	0.31138	-0.9954	10	0.51188	T	0.08	.	5.6389	0.17552	0.0:1.0:0.0:0.0	.	200;136;200;200;200;200	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	M	200;136;200;200;200;200;200;200	ENSP00000383133:T200M;ENSP00000400528:T136M;ENSP00000323633:T200M;ENSP00000393434:T200M;ENSP00000430249:T200M;ENSP00000415089:T200M;ENSP00000392066:T200M	ENSP00000323633:T200M	T	+	2	0	0	DIP2A	46743118	46743118	0.014000	0.17966	0.061000	0.19648	0.039000	0.13416	1.503000	0.35715	0.922000	0.37019	0.650000	0.86243	ACG	0.112735		TCGA-IB-AAUP-01A-11D-A377-08	0.667	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	47	1	2.100000	-17.205370	1	0.150000	NM_015151		0	14	11	0	234	217	0		1	1		0	0	54	0	0	0.999602	1.622713e-01	0	2	0	10	0	14	234
MYO18B	84700	broad.mit.edu	37	22	26423121	26423121	+	Missense_Mutation	SNP	C	C	T	rs375762858		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr22:26423121C>T	ENST00000407587.2	+	43	7353	c.7184C>T	c.(7183-7185)gCg>gTg	p.A2395V	MYO18B_ENST00000335473.7_Missense_Mutation_p.A2394V|MYO18B_ENST00000536101.1_Missense_Mutation_p.A2394V			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2394			G -> A (in dbSNP:rs6004901).			cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTGGACGATGCGGGCTGTCCA	0.587																																						ENST00000407587.2	0.870000	0.330000	0.720000	0.440000	0.570000	0.587770	0.570000	0.560000																										0				146						c.(7183-7185)gCg>gTg		myosin XVIIIB		C	VAL/ALA	0,3954		0,0,1977	66.0	72.0	70.0		7181	0.5	0.0	22		70	1,8283		0,1,4141	no	missense	MYO18B	NM_032608.5	64	0,1,6118	TT,TC,CC		0.0121,0.0,0.0082	benign	2394/2568	26423121	1,12237	1977	4142	6119	SO:0001583	missense	84700	0	0					g.chr22:26423121C>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7184C>T	chr22.hg19:g.26423121C>T	ENSP00000386096:p.Ala2395Val	0					MYO18B_ENST00000335473.7_Missense_Mutation_p.A2394V|MYO18B_ENST00000536101.1_Missense_Mutation_p.A2394V	p.A2395V			0	0	0	1.922106	Q8IUG5	MY18B_HUMAN		43	7353	+			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	1	1	hg19	c.7184C>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.414|4.414	0.076583|0.076583	0.08485|0.08485	0.0|0.0	1.21E-4|1.21E-4	ENSG00000133454|ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587|ENST00000543971	D;D;D|.	0.86769|.	-2.15;-2.15;-2.17|.	5.12|5.12	0.465|0.465	0.16711|0.16711	5.12|5.12	0.465|0.465	0.16711|0.16711	.|.	0.612932|.	0.14443|.	N|.	0.319248|.	T|T	0.40815|0.40815	0.1132|0.1132	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.32968|.	0.266;0.272;0.272;0.392;0.392|.	B;B;B;B;B|.	0.21151|.	0.033;0.015;0.015;0.033;0.033|.	T|T	0.33343|0.33343	-0.9872|-0.9872	10|5	0.51188|.	T|.	0.08|.	.|.	5.895|5.895	0.18935|0.18935	0.1315:0.6423:0.0:0.2262|0.1315:0.6423:0.0:0.2262	.|.	1907;2396;2394;2395;2394|.	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7|.	.;.;MY18B_HUMAN;.;.|.	V|W	2394;2394;2395|344	ENSP00000441229:A2394V;ENSP00000334563:A2394V;ENSP00000386096:A2395V|.	ENSP00000334563:A2394V|.	A|R	+|+	2|1	0|2	0|2	MYO18B|MYO18B	24753121|24753121	24753121|24753121	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.006000|0.006000	0.05464|0.05464	-0.144000|-0.144000	0.10280|0.10280	0.180000|0.180000	0.19960|0.19960	-0.969000|-0.969000	0.02612|0.02612	GCG|CGG	0.118257		TCGA-IB-AAUP-01A-11D-A377-08	0.587	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	2.100000	-2.969244	1	0.150000	NM_032608		0	15	14	0	325	318	0		1	0		0	0	71	0	0	0.999856	0	0	0	0	1	0	15	325
HMGXB4	10042	broad.mit.edu	37	22	35661554	35661554	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr22:35661554G>A	ENST00000216106.5	+	5	1301	c.1173G>A	c.(1171-1173)aaG>aaA	p.K391K	HMGXB4_ENST00000444518.2_Silent_p.K282K	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	391					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						Aaaaaaaaaagaaaaaagaag	0.493																																						ENST00000216106.5	1.000000	0.360000	0.980000	0.520000	0.730000	0.738220	0.730000	1.000000																										0				19						c.(1171-1173)aaG>aaA		HMG box domain containing 4							24.0	27.0	26.0					22																	35661554		2191	4290	6481	SO:0001819	synonymous_variant	10042	0	0					g.chr22:35661554G>A	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1173G>A	chr22.hg19:g.35661554G>A		0					HMGXB4_ENST00000444518.2_Silent_p.K282K	p.K391K	NM_001003681.2	NP_001003681.1	0	0	0	1.922106	Q9UGU5	HMGX4_HUMAN		5	1301	+			O75672|O75673|Q9UMT5	Silent	SNP	ENST00000216106.5	1	0	hg19	c.1173G>A	CCDS33641.1	0																																																																																								0.118257		TCGA-IB-AAUP-01A-11D-A377-08	0.493	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	1	0	0	2	2	2	2	0	0	0	0	38	38	38	35	1	2.100000	-1.686778	0	0.150000	NM_005487		0	9	0	0	150	147	0		0	1		0	0	38	0	0	0.992344	3.074785e-01	0	6	0	12	0	9	150
ACMSD	130013	broad.mit.edu	37	2	135621024	135621024	+	Silent	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr2:135621024C>T	ENST00000356140.5	+	5	445	c.309C>T	c.(307-309)acC>acT	p.T103T	ACMSD_ENST00000392928.1_Silent_p.T45T|AC016725.4_ENST00000392929.2_RNA|ACMSD_ENST00000283054.4_Silent_p.T45T	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	103					cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		TTGCCAGCACCGTTGTGAGCT	0.562																																						ENST00000356140.5	1.000000	0.800000	1.000000	0.950000	0.990000	0.978729	0.990000	1.000000																										0				14						c.(307-309)acC>acT		aminocarboxymuconate semialdehyde decarboxylase							89.0	83.0	85.0					2																	135621024		2203	4300	6503	SO:0001819	synonymous_variant	130013	0	0					g.chr2:135621024C>T	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.309C>T	chr2.hg19:g.135621024C>T		0					ACMSD_ENST00000283054.4_Silent_p.T45T|ACMSD_ENST00000392928.1_Silent_p.T45T|AC016725.4_ENST00000392929.2_RNA	p.T103T	NM_138326.2	NP_612199.2	1	2	3	2.006085	Q8TDX5	ACMSD_HUMAN		5	445	+			Q3B7X3|Q53SR5|Q96KY2	Silent	SNP	ENST00000356140.5	1	1	hg19	c.309C>T	CCDS2173.2	1																																																																																								0.158207		TCGA-IB-AAUP-01A-11D-A377-08	0.562	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254627.1	1	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	2.100000	-2.329789	0	0.150000			0	36	36	0	401	395	0		1	1		0	0	80	0	0	1.000000	6.076734e-02	0	3	0	2	0	36	401
TTN	7273	broad.mit.edu	37	2	179600638	179600638	+	Silent	SNP	G	G	A	rs184307461	byFrequency	TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr2:179600638G>A	ENST00000591111.1	-	48	13808	c.13584C>T	c.(13582-13584)gaC>gaT	p.D4528D	TTN_ENST00000589042.1_Silent_p.D4845D|TTN_ENST00000342992.6_Silent_p.D3601D|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12284	Ig-like 25.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTTTCTGCGTCGGAAATCC	0.443													G|||	3	0.000599042	0.0	0.0043	5008	,	,		20196	0.0		0.0	False		,,,				2504	0.0					ENST00000591111.1	1.000000	0.160000	0.580000	0.250000	0.360000	0.436666	0.360000	0.320000																										0				1448						c.(13582-13584)gaC>gaT		titin		G	,,,	0,3874		0,0,1937	135.0	131.0	132.0		,10803,,	-0.5	0.5	2		132	2,8284		0,2,4141	no	intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,2,6078	AA,AG,GG		0.0241,0.0,0.0164	,,,	,3601/33424,,	179600638	2,12158	1937	4143	6080	SO:0001819	synonymous_variant	7273	23	120846	47				g.chr2:179600638G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13584C>T	chr2.hg19:g.179600638G>A		0					TTN_ENST00000342992.6_Silent_p.D3601D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.D4845D|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron	p.D4528D			1	2	3	2.009461	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	48	13808	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	0	1	hg19	c.13584C>T		0																																																																																								0.158832		TCGA-IB-AAUP-01A-11D-A377-08	0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	2.100000	-3.335503	1	0.150000	NM_133378		0	8	7	0	316	314	0		1			0	0	103	0	0	0.989053	0	0	0	0	0	0	8	316
OTOF	9381	broad.mit.edu	37	2	26703112	26703112	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr2:26703112C>T	ENST00000272371.2	-	16	1997	c.1871G>A	c.(1870-1872)cGg>cAg	p.R624Q	OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000403946.3_Missense_Mutation_p.R624Q|OTOF_ENST00000339598.3_5'Flank	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	624					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.R624L(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCGTTTCTCCGGTCGATCAT	0.577																																					GBM(102;732 1451 20652 24062 31372)	ENST00000272371.2	1.000000	0.220000	1.000000	0.320000	0.460000	0.544136	0.460000	0.400000																										1	Substitution - Missense(1)	p.R624L(1)	large_intestine(1)	106						c.(1870-1872)cGg>cAg		otoferlin							98.0	96.0	97.0					2																	26703112		2203	4300	6503	SO:0001583	missense	9381	4	121396	38				g.chr2:26703112C>T	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1871G>A	chr2.hg19:g.26703112C>T	ENSP00000272371:p.Arg624Gln	0					OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000339598.3_5'Flank|OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000403946.3_Missense_Mutation_p.R624Q	p.R624Q	NM_194248.2	NP_919224.1	1	2	3	2.043854	Q9HC10	OTOF_HUMAN		16	1997	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	1	1	hg19	c.1871G>A	CCDS1725.1	0	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377006	0.82682	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	D;D	0.82255	-1.59;-1.59	4.68	4.68	0.58851	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.91496	0.7315	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.91054	0.4880	10	0.34782	T	0.22	-26.7423	17.5382	0.87840	0.0:1.0:0.0:0.0	.	624	Q9HC10	OTOF_HUMAN	Q	624	ENSP00000272371:R624Q;ENSP00000385255:R624Q	ENSP00000272371:R624Q	R	-	2	0	0	OTOF	26556616	26556616	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	7.698000	0.84413	2.315000	0.78130	0.561000	0.74099	CGG	0.165644		TCGA-IB-AAUP-01A-11D-A377-08	0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3	0	0	1	2	21	2	2	1	1	1	1	50	50	50	48	1	2.100000	-2.589923	1	0.150000			0	10	9	0	319	317	0		0			1	0	50	0	0	0.029663	0	0	0	0	0	0	10	319
RNF103	7844	broad.mit.edu	37	2	86839366	86839366	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr2:86839366C>T	ENST00000237455.4	-	3	1366	c.398G>A	c.(397-399)gGc>gAc	p.G133D	AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000439077.1_RNA|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000424788.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	133					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						GTGAATTTTGCCCACCAAGGG	0.388																																						ENST00000237455.4	1.000000	0.070000	1.000000	0.120000	0.210000	0.349073	0.210000	0.180000																										0				25						c.(397-399)gGc>gAc		ring finger protein 103							105.0	102.0	103.0					2																	86839366		2203	4300	6503	SO:0001583	missense	7844	0	0					g.chr2:86839366C>T	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.398G>A	chr2.hg19:g.86839366C>T	ENSP00000237455:p.Gly133Asp	0					AC015971.2_ENST00000439077.1_RNA|RNF103_ENST00000477307.1_5'UTR|RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron|AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA	p.G133D	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	1	2	3	2.043854	O00237	RN103_HUMAN		3	1366	-			A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	0	1	hg19	c.398G>A	CCDS33237.1	0	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003290	0.54254	.	.	ENSG00000239305	ENST00000237455	T	0.44881	0.91	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.048876	0.85682	D	0.000000	T	0.40979	0.1139	L	0.47716	1.5	0.52099	D	0.999943	P	0.37525	0.598	B	0.34722	0.188	T	0.36890	-0.9729	10	0.56958	D	0.05	-12.7616	19.5655	0.95391	0.0:1.0:0.0:0.0	.	133	O00237	RN103_HUMAN	D	133	ENSP00000237455:G133D	ENSP00000237455:G133D	G	-	2	0	0	RNF103	86692877	86692877	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.656000	0.61483	2.639000	0.89480	0.591000	0.81541	GGC	0.165644		TCGA-IB-AAUP-01A-11D-A377-08	0.388	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	0	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	2.100000	-1.950919	0	0.150000	NM_005667		0	5	5	0	382	380	0		1	0		0	0	76	0	0	0.937075	5.133286e-01	0	0	0	118	0	5	382
STARD7	56910	broad.mit.edu	37	2	96873900	96873900	+	Silent	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr2:96873900C>T	ENST00000337288.5	-	1	656	c.273G>A	c.(271-273)caG>caA	p.Q91Q	AC012307.3_ENST00000446816.1_RNA	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	91						mitochondrion (GO:0005739)	lipid binding (GO:0008289)			endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						ACTCCTCCTCCTGGATCCTCT	0.697																																						ENST00000337288.5	1.000000	0.560000	1.000000	0.750000	0.990000	0.906095	0.990000	1.000000																										0				14						c.(271-273)caG>caA		StAR-related lipid transfer (START) domain containing 7							29.0	28.0	28.0					2																	96873900		2203	4300	6503	SO:0001819	synonymous_variant	56910	0	0					g.chr2:96873900C>T	AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.273G>A	chr2.hg19:g.96873900C>T		0					AC012307.3_ENST00000446816.1_RNA	p.Q91Q	NM_020151.3	NP_064536.2	1	2	3	2.043854	Q9NQZ5	STAR7_HUMAN		1	656	-			D3DXG9|Q53T44|Q6GU43|Q969M6	Silent	SNP	ENST00000337288.5	0	1	hg19	c.273G>A	CCDS2017.2	1																																																																																								0.165644		TCGA-IB-AAUP-01A-11D-A377-08	0.697	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252848.2	1	0	1	2	2	2	2	0	0	0	0	23	23	23	21	1	2.100000	-3.319431	1	0.150000			0	14	14	0	190	185	0		1	1		0	0	23	0	0	0.999746	9.970386e-01	0	17	0	118	0	14	190
SPHKAP	80309	broad.mit.edu	37	2	228884216	228884216	+	Missense_Mutation	SNP	C	C	T	rs200812632		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr2:228884216C>T	ENST00000392056.3	-	7	1400	c.1354G>A	c.(1354-1356)Gtt>Att	p.V452I	SPHKAP_ENST00000344657.5_Missense_Mutation_p.V452I	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	452						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.V452I(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTCTGAACAACGACGATTTTG	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		20681	0.0		0.001	False		,,,				2504	0.0					ENST00000392056.3	1.000000	0.250000	0.710000	0.350000	0.480000	0.540949	0.480000	0.450000																										2	Substitution - Missense(2)	p.V452I(2)	endometrium(2)	185						c.(1354-1356)Gtt>Att		SPHK1 interactor, AKAP domain containing							99.0	97.0	98.0					2																	228884216		2203	4300	6503	SO:0001583	missense	80309	25	121412	44				g.chr2:228884216C>T		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1354G>A	chr2.hg19:g.228884216C>T	ENSP00000375909:p.Val452Ile	0					SPHKAP_ENST00000344657.5_Missense_Mutation_p.V452I	p.V452I	NM_001142644.1	NP_001136116.1	1	2	3	2.009461	Q2M3C7	SPKAP_HUMAN		7	1400	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	1	1	hg19	c.1354G>A	CCDS46537.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	4.730	0.135652	0.09032	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.05717	3.41;3.4	6.03	2.42	0.29668	6.03	2.42	0.29668	.	0.043547	0.85682	N	0.000000	T	0.01353	0.0044	N	0.00332	-1.63	0.23440	N	0.997673	B;B	0.17465	0.002;0.022	B;B	0.08055	0.0;0.003	T	0.47674	-0.9099	10	0.02654	T	1	.	8.9785	0.35950	0.0:0.2142:0.0:0.7858	.	452;452	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	I	452	ENSP00000375909:V452I;ENSP00000339886:V452I	ENSP00000339886:V452I	V	-	1	0	0	SPHKAP	228592460	228592460	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	3.744000	0.55112	0.179000	0.19938	-0.302000	0.09304	GTT	0.158832		TCGA-IB-AAUP-01A-11D-A377-08	0.507	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	2.100000	-3.783025	1	0.150000	NM_030623		0	12	12	0	343	337	0		1			0	0	84	0	0	0.999045	0	0	0	0	0	0	12	343
KPNA4	3840	broad.mit.edu	37	3	160233331	160233331	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr3:160233331C>G	ENST00000334256.4	-	12	1246	c.941G>C	c.(940-942)gGa>gCa	p.G314A	SCARNA7_ENST00000458797.1_RNA	NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	314	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CTCATCAGTTCCAGTAACAAT	0.383																																						ENST00000334256.4	1.000000	0.390000	0.830000	0.510000	0.640000	0.669284	0.640000	0.630000																										0				22						c.(940-942)gGa>gCa		karyopherin alpha 4 (importin alpha 3)							114.0	97.0	103.0					3																	160233331		2203	4300	6503	SO:0001583	missense	3840	0	0					g.chr3:160233331C>G	AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.941G>C	chr3.hg19:g.160233331C>G	ENSP00000334373:p.Gly314Ala	1					SCARNA7_ENST00000458797.1_RNA	p.G314A	NM_002268.4	NP_002259.1	1	4	5	2.440650	O00629	IMA3_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)	12	1246	-			A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	ENST00000334256.4	1	1	hg19	c.941G>C	CCDS3191.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.102219	0.94245	.	.	ENSG00000186432	ENST00000334256;ENST00000483437	T;T	0.32515	1.45;1.45	5.55	5.55	0.83447	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68320	0.2988	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76586	-0.2905	10	0.87932	D	0	-4.4791	19.8667	0.96806	0.0:1.0:0.0:0.0	.	314	O00629	IMA4_HUMAN	A	314;19	ENSP00000334373:G314A;ENSP00000417172:G19A	ENSP00000334373:G314A	G	-	2	0	0	KPNA4	161716025	161716025	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.668000	0.83897	2.773000	0.95371	0.655000	0.94253	GGA	0.299691		TCGA-IB-AAUP-01A-11D-A377-08	0.383	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	2.100000	-4.302401	1	0.150000	NM_002268		0	19	19	0	469	461	0		1	0		0	0	73	0	0	0.999989	9.773725e-01	0	0	0	154	0	19	469
CSPG5	10675	broad.mit.edu	37	3	47618423	47618423	+	Missense_Mutation	SNP	G	G	A	rs372995316		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr3:47618423G>A	ENST00000383738.2	-	2	3191	c.1093C>T	c.(1093-1095)Cgg>Tgg	p.R365W	CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000264723.4_Missense_Mutation_p.R365W|CSPG5_ENST00000456150.1_Missense_Mutation_p.R227W	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	365					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCGTTATGCCGCACAAAGCCA	0.632																																						ENST00000383738.2	0.280000	0.050000	0.210000	0.090000	0.140000	0.157924	0.140000	0.130000																										0				22						c.(1093-1095)Cgg>Tgg		chondroitin sulfate proteoglycan 5 (neuroglycan C)							93.0	96.0	95.0					3																	47618423		2203	4299	6502	SO:0001583	missense	10675	0	0					g.chr3:47618423G>A	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1093C>T	chr3.hg19:g.47618423G>A	ENSP00000373244:p.Arg365Trp	0					CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000456150.1_Missense_Mutation_p.R227W|CSPG5_ENST00000264723.4_Missense_Mutation_p.R365W	p.R365W	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	0	1	1	1.975898	O95196	CSPG5_HUMAN		2	3191	-			Q71M39|Q71M40	Missense_Mutation	SNP	ENST00000383738.2	0	1	hg19	c.1093C>T	CCDS56253.1	0	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587159	0.66105	.	.	ENSG00000114646	ENST00000456150;ENST00000383738;ENST00000264723	T;T;T	0.26810	1.76;1.73;1.71	4.63	-0.0101	0.13998	4.63	-0.0101	0.13998	.	0.137586	0.46442	D	0.000299	T	0.39064	0.1064	L	0.44542	1.39	0.22581	N	0.998964	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.976	T	0.34725	-0.9817	10	0.72032	D	0.01	-10.6519	13.8559	0.63527	0.0:0.0:0.4812:0.5187	.	365;365	O95196;O95196-2	CSPG5_HUMAN;.	W	227;365;365	ENSP00000392096:R227W;ENSP00000373244:R365W;ENSP00000264723:R365W	ENSP00000264723:R365W	R	-	1	2	2	CSPG5	47593427	47593427	0.029000	0.19370	0.546000	0.28166	0.984000	0.73092	0.680000	0.25306	0.127000	0.18452	-0.182000	0.12963	CGG	0.144224		TCGA-IB-AAUP-01A-11D-A377-08	0.632	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	0	0	1	2	18	2	2	1	1	1	1	112	112	112	108	1	2.100000	-1.732903	0	0.150000	NM_006574		0	6	6	0	573	557	0		0			1	0	112	0	0	0.008650	0	0	0	0	0	0	6	573
WNT5A	7474	broad.mit.edu	37	3	55504238	55504238	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr3:55504238C>T	ENST00000474267.1	-	6	1546	c.1025G>A	c.(1024-1026)cGt>cAt	p.R342H	WNT5A_ENST00000264634.4_Missense_Mutation_p.R342H|WNT5A_ENST00000497027.1_Missense_Mutation_p.R327H|WNT5A_ENST00000493406.1_5'Flank			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	342					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		GTCGTAGCCACGGCCGCAGCA	0.632																																						ENST00000474267.1	0.550000	0.170000	0.440000	0.240000	0.330000	0.348488	0.330000	0.320000																										0				13						c.(1024-1026)cGt>cAt		wingless-type MMTV integration site family, member 5A							77.0	82.0	80.0					3																	55504238		2203	4300	6503	SO:0001583	missense	7474	0	0					g.chr3:55504238C>T	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.1025G>A	chr3.hg19:g.55504238C>T	ENSP00000417310:p.Arg342His	0					WNT5A_ENST00000264634.4_Missense_Mutation_p.R342H|WNT5A_ENST00000497027.1_Missense_Mutation_p.R327H|WNT5A_ENST00000493406.1_5'Flank	p.R342H			0	1	1	1.975898	P41221	WNT5A_HUMAN		6	1546	-			A8K4A4|Q6P278	Missense_Mutation	SNP	ENST00000474267.1	1	1	hg19	c.1025G>A	CCDS46850.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.549874	0.96501	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000536765;ENST00000497027	T;T;T	0.80033	-1.33;-1.33;-1.33	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.93973	0.8070	H	0.97291	3.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95589	0.8653	10	0.87932	D	0	.	19.7728	0.96373	0.0:1.0:0.0:0.0	.	342	P41221	WNT5A_HUMAN	H	342;342;253;327	ENSP00000417310:R342H;ENSP00000264634:R342H;ENSP00000420104:R327H	ENSP00000264634:R342H	R	-	2	0	0	WNT5A	55479278	55479278	1.000000	0.71417	0.975000	0.42487	0.997000	0.91878	7.813000	0.86123	2.687000	0.91594	0.655000	0.94253	CGT	0.144224		TCGA-IB-AAUP-01A-11D-A377-08	0.632	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350793.3	0	0	1	2	2	2	2	0	0	0	0	83	83	83	78	1	2.100000	-3.476012	1	0.150000	NM_003392		0	11	11	0	437	434	0		1	0		0	0	83	0	0	0.998313	1.731822e-01	0	0	0	28	0	11	437
SLC7A14	57709	broad.mit.edu	37	3	170198388	170198388	+	Silent	SNP	C	C	T	rs373511991		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr3:170198388C>T	ENST00000231706.5	-	7	1998	c.1683G>A	c.(1681-1683)acG>acA	p.T561T	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	561					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CCGTGTGCCCCGTCGCTGCTG	0.507																																						ENST00000231706.5	1.000000	0.090000	0.420000	0.160000	0.260000	0.309241	0.260000	0.240000																										0				53						c.(1681-1683)acG>acA		solute carrier family 7, member 14							87.0	80.0	83.0					3																	170198388		2203	4300	6503	SO:0001819	synonymous_variant	57709	2	121412	34				g.chr3:170198388C>T	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1683G>A	chr3.hg19:g.170198388C>T		1					CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	p.T561T	NM_020949.2	NP_066000.2	1	4	5	2.440650	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)	7	1998	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	0	1	hg19	c.1683G>A	CCDS33892.1	0																																																																																								0.299691		TCGA-IB-AAUP-01A-11D-A377-08	0.507	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	0	0	1	2	2	2	2	0	0	0	0	108	108	108	108	1	2.100000	-3.165705	1	0.150000	NM_020949		0	5	5	0	335	333	0		1			0	0	108	0	0	0.937016	0	0	0	0	0	0	5	335
HSPA4	3308	broad.mit.edu	37	5	132432935	132432935	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr5:132432935G>A	ENST00000304858.2	+	15	2175	c.1886G>A	c.(1885-1887)aGa>aAa	p.R629K		NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	629					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TATGAAATGAGAGACAAGCTT	0.393																																					Colon(114;1299 1588 6063 12302 48757)	ENST00000304858.2	1.000000	0.210000	0.510000	0.280000	0.370000	0.417667	0.370000	0.350000																										0				32						c.(1885-1887)aGa>aAa		heat shock 70kDa protein 4							249.0	230.0	236.0					5																	132432935		2203	4300	6503	SO:0001583	missense	3308	0	0					g.chr5:132432935G>A	AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.1886G>A	chr5.hg19:g.132432935G>A	ENSP00000302961:p.Arg629Lys	0						p.R629K	NM_002154.3	NP_002145.3	1	2	3	1.988579	P34932	HSP74_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	15	2175	+			O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	ENST00000304858.2	1	1	hg19	c.1886G>A	CCDS4166.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.308483	0.95629	.	.	ENSG00000170606	ENST00000304858	T	0.12879	2.64	5.8	4.93	0.64822	5.8	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.23532	0.0569	M	0.83953	2.67	0.80722	D	1	B	0.21071	0.051	B	0.23150	0.044	T	0.03684	-1.1013	10	0.66056	D	0.02	-17.85	14.6068	0.68486	0.0695:0.0:0.9305:0.0	.	629	P34932	HSP74_HUMAN	K	629	ENSP00000302961:R629K	ENSP00000302961:R629K	R	+	2	0	0	HSPA4	132460834	132460834	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	1.455000	0.47813	0.579000	0.79373	AGA	0.154439		TCGA-IB-AAUP-01A-11D-A377-08	0.393	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1	0	0	1	2	2	2	2	0	0	0	0	100	100	100	99	1	2.100000	-3.043198	1	0.150000	NM_002154, NM_198431		0	14	14	0	503	503	0		1	1		0	0	100	0	0	0.999760	9.935335e-01	0	17	0	283	0	14	503
FAM105A	54491	broad.mit.edu	37	5	14608915	14608915	+	Missense_Mutation	SNP	T	T	C			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr5:14608915T>C	ENST00000274217.3	+	7	806	c.686T>C	c.(685-687)cTt>cCt	p.L229P		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	229	OTU.							p.S231fs*13(1)		large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TGCAACACCCTTTTTTCAGAT	0.328																																						ENST00000274217.3	1.000000	0.080000	1.000000	0.140000	0.240000	0.376539	0.240000	0.200000																										1	Deletion - Frameshift(1)	p.S231fs*13(1)	large_intestine(1)	11						c.(685-687)cTt>cCt		family with sequence similarity 105, member A							77.0	77.0	77.0					5																	14608915		2203	4300	6503	SO:0001583	missense	54491	0	0					g.chr5:14608915T>C		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.686T>C	chr5.hg19:g.14608915T>C	ENSP00000274217:p.Leu229Pro	0						p.L229P	NM_019018.2	NP_061891.1	1	2	3	2.044957	Q9NUU6	F105A_HUMAN		7	806	+	Lung NSC(4;0.00592)		Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	0	1	hg19	c.686T>C	CCDS3884.1	0	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162069	0.57368	.	.	ENSG00000145569	ENST00000274217	T	0.16597	2.33	4.89	4.89	0.63831	4.89	4.89	0.63831	.	0.109676	0.40064	N	0.001185	T	0.41213	0.1149	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.37454	-0.9705	10	0.87932	D	0	-8.3487	14.4858	0.67616	0.0:0.0:0.0:1.0	.	229	Q9NUU6	F105A_HUMAN	P	229	ENSP00000274217:L229P	ENSP00000274217:L229P	L	+	2	0	0	FAM105A	14661915	14661915	0.991000	0.36638	0.996000	0.52242	0.879000	0.50718	4.189000	0.58358	1.819000	0.53055	0.477000	0.44152	CTT	0.166258		TCGA-IB-AAUP-01A-11D-A377-08	0.328	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	0	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	2.100000	-2.966388	1	0.150000	NM_019018		0	5	4	0	334	329	0		1	0		0	0	99	0	0	0.935017	2.041238e-01	0	0	0	47	0	5	334
PPP2R2B	5521	broad.mit.edu	37	5	145979904	145979904	+	Missense_Mutation	SNP	C	C	T	rs369931023		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr5:145979904C>T	ENST00000394413.3	-	7	1480	c.910G>A	c.(910-912)Gtc>Atc	p.V304I	PPP2R2B_ENST00000394409.3_Missense_Mutation_p.V362I|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.V304I|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.V310I|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.V304I|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.V307I|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.V304I|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.V293I|PPP2R2B_ENST00000394414.1_Missense_Mutation_p.V370I|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.V293I			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	304					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGACTTTGACGGTCAAGTAG	0.458													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19514	0.0		0.0	False		,,,				2504	0.0					ENST00000394413.3	1.000000	0.250000	0.570000	0.330000	0.430000	0.467492	0.430000	0.410000																										0				32						c.(910-912)Gtc>Atc		protein phosphatase 2, regulatory subunit B, beta		C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	162.0	158.0	159.0		877,850,919,910,910,910,910	4.0	0.9	5		159	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	PPP2R2B	NM_181678.2,NM_181677.2,NM_181676.2,NM_181675.2,NM_181674.2,NM_004576.2,NM_001127381.1	29,29,29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign	293/433,284/424,307/447,304/444,304/444,304/444,304/444	145979904	1,13005	2203	4300	6503	SO:0001583	missense	5521	7	121412	41				g.chr5:145979904C>T	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.910G>A	chr5.hg19:g.145979904C>T	ENSP00000377935:p.Val304Ile	0					PPP2R2B_ENST00000394414.1_Missense_Mutation_p.V370I|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.V307I|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.V304I|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.V362I|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.V310I|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.V293I|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.V293I|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.V304I|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.V304I	p.V304I			1	2	3	1.988579	Q00005	2ABB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	7	1480	-			A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	ENST00000394413.3	1	1	hg19	c.910G>A	CCDS4284.1	0	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450488	0.63290	0.0	1.16E-4	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63	5.8	4.03	0.46877	5.8	4.03	0.46877	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.058449	0.64402	D	0.000002	T	0.26412	0.0645	L	0.43152	1.355	0.80722	D	1	B;B;B;B;B;B	0.28998	0.23;0.063;0.036;0.23;0.119;0.036	B;B;B;B;B;B	0.23852	0.049;0.029;0.029;0.04;0.029;0.029	T	0.03784	-1.1004	10	0.52906	T	0.07	-6.6079	12.7697	0.57412	0.0:0.8663:0.0:0.1337	.	362;310;293;370;307;304	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	I	304;293;370;304;304;304;293;307;310;362	ENSP00000377935:V304I;ENSP00000431320:V293I;ENSP00000377936:V370I;ENSP00000377933:V304I;ENSP00000349283:V304I;ENSP00000398779:V304I;ENSP00000377932:V293I;ENSP00000336591:V307I;ENSP00000421396:V310I;ENSP00000377931:V362I	ENSP00000336591:V307I	V	-	1	0	0	AC011357.1	145960097	145960097	1.000000	0.71417	0.912000	0.35992	0.976000	0.68499	6.088000	0.71371	0.805000	0.34159	0.655000	0.94253	GTC	0.154439		TCGA-IB-AAUP-01A-11D-A377-08	0.458	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	2.100000	-2.781561	1	0.150000	NM_181678		0	16	15	0	499	487	0		1	0		0	0	115	0	0	0.999920	6.833688e-02	0	0	0	13	0	16	499
NMBR	4829	broad.mit.edu	37	6	142409703	142409703	+	Silent	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr6:142409703C>T	ENST00000258042.1	-	1	233	c.93G>A	c.(91-93)ccG>ccA	p.P31P	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	31					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		CGTCCGAGGCCGGCAGGAAAT	0.607																																						ENST00000258042.1	1.000000	0.150000	0.640000	0.260000	0.410000	0.456751	0.410000	0.370000																										0				23						c.(91-93)ccG>ccA		neuromedin B receptor							46.0	45.0	46.0					6																	142409703		2203	4300	6503	SO:0001819	synonymous_variant	4829	0	0					g.chr6:142409703C>T		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.93G>A	chr6.hg19:g.142409703C>T		0					RP11-137J7.2_ENST00000454401.1_RNA	p.P31P	NM_002511.2	NP_002502.2	1	2	3	1.986500	P28336	NMBR_HUMAN		1	233	-	Breast(32;0.155)		E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	0	1	hg19	c.93G>A	CCDS5196.1	0																																																																																								0.153808		TCGA-IB-AAUP-01A-11D-A377-08	0.607	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1	0	0	1	2	2	2	2	0	0	0	0	29	29	29	27	1	2.100000	-7.207952	1	0.150000			0	5	4	0	174	170	0		1			0	0	29	0	0	0.933685	0	0	0	0	0	0	5	174
LRFN2	57497	broad.mit.edu	37	6	40359728	40359728	+	Missense_Mutation	SNP	C	C	T	rs146316351	byFrequency	TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr6:40359728C>T	ENST00000338305.6	-	3	2866	c.2324G>A	c.(2323-2325)cGg>cAg	p.R775Q		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	775						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					AAAAGTCCCCCGGGCCCCCAC	0.607													C|||	3	0.000599042	0.0023	0.0	5008	,	,		13249	0.0		0.0	False		,,,				2504	0.0					ENST00000338305.6	1.000000	0.150000	0.560000	0.240000	0.370000	0.416654	0.370000	0.330000																										0				58						c.(2323-2325)cGg>cAg		leucine rich repeat and fibronectin type III domain containing 2		C	GLN/ARG	4,4402	8.1+/-20.4	0,4,2199	42.0	44.0	44.0		2324	4.4	1.0	6	dbSNP_134	44	0,8600		0,0,4300	yes	missense	LRFN2	NM_020737.1	43	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	775/790	40359728	4,13002	2203	4300	6503	SO:0001583	missense	57497	17	121388	43				g.chr6:40359728C>T	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.2324G>A	chr6.hg19:g.40359728C>T	ENSP00000345985:p.Arg775Gln	0						p.R775Q	NM_020737.1	NP_065788.1	1	2	3	1.986500	Q9ULH4	LRFN2_HUMAN		3	2866	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	0	1	hg19	c.2324G>A	CCDS34443.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.74	1.728986	0.30684	9.08E-4	0.0	ENSG00000156564	ENST00000338305	T	0.58060	0.36	5.27	4.39	0.52855	5.27	4.39	0.52855	.	0.100654	0.64402	D	0.000004	T	0.13030	0.0316	N	0.14661	0.345	0.22489	N	0.999054	B	0.33857	0.429	B	0.20184	0.028	T	0.02471	-1.1154	10	0.44086	T	0.13	.	6.092	0.19999	0.0:0.7541:0.0:0.2459	.	775	Q9ULH4	LRFN2_HUMAN	Q	775	ENSP00000345985:R775Q	ENSP00000345985:R775Q	R	-	2	0	0	LRFN2	40467706	40467706	0.997000	0.39634	0.964000	0.40570	0.675000	0.39556	2.529000	0.45632	2.466000	0.83321	0.555000	0.69702	CGG	0.153808		TCGA-IB-AAUP-01A-11D-A377-08	0.607	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	0	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	2.100000	-2.772230	1	0.150000	XM_166372		0	6	6	0	228	224	0		1			0	0	37	0	0	0.963649	0	0	0	0	0	0	6	228
TCTE1	202500	broad.mit.edu	37	6	44254126	44254126	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr6:44254126C>T	ENST00000371505.4	-	3	543	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	TCTE1_ENST00000371504.1_5'Flank|TCTE1_ENST00000371503.3_De_novo_Start_InFrame|RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	141										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACGTGGCACACGGGCCAGCGA	0.607																																						ENST00000371505.4	1.000000	0.080000	0.350000	0.130000	0.220000	0.271156	0.220000	0.190000																										0				34						c.(421-423)Gtg>Atg		t-complex-associated-testis-expressed 1							83.0	78.0	79.0					6																	44254126		2203	4300	6503	SO:0001583	missense	202500	0	0					g.chr6:44254126C>T	BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.421G>A	chr6.hg19:g.44254126C>T	ENSP00000360560:p.Val141Met	0					RP11-444E17.6_ENST00000505802.1_Intron|TCTE1_ENST00000371503.3_De_novo_Start_InFrame|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371504.1_5'Flank	p.V141M	NM_182539.3	NP_872345.2	1	2	3	1.986500	Q5JU00	TCTE1_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)	3	543	-	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		B4DX59|Q8IYS6	Missense_Mutation	SNP	ENST00000371505.4	0	1	hg19	c.421G>A	CCDS4910.1	0	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205486	0.58234	.	.	ENSG00000146221	ENST00000371505	T	0.56103	0.48	4.95	4.08	0.47627	4.95	4.08	0.47627	.	0.130007	0.53938	D	0.000059	T	0.45438	0.1342	M	0.78801	2.425	0.80722	D	1	D	0.57257	0.979	P	0.44518	0.452	T	0.56601	-0.7952	10	0.72032	D	0.01	-28.4028	13.2188	0.59875	0.0:0.9224:0.0:0.0776	.	141	Q5JU00	TCTE1_HUMAN	M	141	ENSP00000360560:V141M	ENSP00000360560:V141M	V	-	1	0	0	TCTE1	44362104	44362104	0.355000	0.24921	0.987000	0.45799	0.989000	0.77384	0.902000	0.28459	1.079000	0.41038	-0.251000	0.11542	GTG	0.153808		TCGA-IB-AAUP-01A-11D-A377-08	0.607	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	0	0	1	2	14	2	2	1	1	1	1	83	83	83	83	1	2.100000	-3.166722	1	0.150000	NM_182539		0	5	5	0	329	324	0		0			1	0	83	0	0	0.027311	0	0	0	0	0	0	5	329
MDN1	23195	broad.mit.edu	37	6	90453401	90453401	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr6:90453401G>A	ENST00000369393.3	-	30	4326	c.4211C>T	c.(4210-4212)gCa>gTa	p.A1404V	MDN1_ENST00000428876.1_Missense_Mutation_p.A1404V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1404					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGCCAAGGCTGCAAATACCTG	0.463																																						ENST00000369393.3	1.000000	0.050000	0.210000	0.080000	0.130000	0.183053	0.130000	0.120000																										0				218						c.(4210-4212)gCa>gTa		MDN1, midasin homolog (yeast)							119.0	113.0	115.0					6																	90453401		2203	4300	6503	SO:0001583	missense	23195	0	0					g.chr6:90453401G>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4211C>T	chr6.hg19:g.90453401G>A	ENSP00000358400:p.Ala1404Val	0					MDN1_ENST00000428876.1_Missense_Mutation_p.A1404V	p.A1404V			1	2	3	1.986500	Q9NU22	MDN1_HUMAN		30	4326	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	0	1	hg19	c.4211C>T	CCDS5024.1	0	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299744	0.81136	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.60548	0.18;0.18	5.48	5.48	0.80851	5.48	5.48	0.80851	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.054981	0.64402	D	0.000001	D	0.84754	0.5542	H	0.98646	4.29	0.58432	D	0.999992	D	0.76494	0.999	D	0.80764	0.994	D	0.90653	0.4584	10	0.87932	D	0	.	19.3403	0.94337	0.0:0.0:1.0:0.0	.	1404	Q9NU22	MDN1_HUMAN	V	1404	ENSP00000358400:A1404V;ENSP00000413970:A1404V	ENSP00000358400:A1404V	A	-	2	0	0	MDN1	90510122	90510122	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.689000	0.98673	2.562000	0.86427	0.563000	0.77884	GCA	0.153808		TCGA-IB-AAUP-01A-11D-A377-08	0.463	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2	0	0	1	2	19	2	2	1	1	1	1	118	118	118	118	1	2.100000	-2.569556	1	0.150000			0	6	6	0	643	637	0		0	0		1	0	118	0	0	0.006357	0	0	0	0	1	0	6	643
LPA	4018	broad.mit.edu	37	6	161020531	161020531	+	Splice_Site	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr6:161020531C>T	ENST00000316300.5	-	20	3332		c.e20+1		LPA_ENST00000447678.1_Splice_Site			P08519	APOA_HUMAN	lipoprotein, Lp(a)						blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAAAGACGTACGCATTTGGGT	0.483																																						ENST00000316300.5	1.000000	0.330000	0.510000	0.380000	0.430000	0.467719	0.430000	0.430000																										0				107						c.e20+1		lipoprotein, Lp(a)	Aminocaproic Acid(DB00513)						287.0	311.0	303.0					6																	161020531		2200	4299	6499	SO:0001630	splice_region_variant	4018	1	121386	40				g.chr6:161020531C>T	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3287+1G>A	chr6.hg19:g.161020531C>T		0					LPA_ENST00000447678.1_Splice_Site				1	2	3	1.986500	P08519	APOA_HUMAN		20	3332	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	Q5VTD7|Q9UD88	Splice_Site	SNP	ENST00000316300.5	1	1	hg19		CCDS43523.1	0	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446431	0.25987	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.48	2.48	0.30137	2.48	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.4117	0.32646	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	LPA	160940521	160940521	1.000000	0.71417	0.930000	0.37139	0.007000	0.05969	3.793000	0.55484	1.361000	0.45981	0.436000	0.28706	.	0.153808		TCGA-IB-AAUP-01A-11D-A377-08	0.483	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	0	0	1	2	2	2	2	0	0	0	0	430	430	430	426	1	2.100000	-3.495209	1	0.150000	NM_005577	Intron	0	57	57	0	1695	1680	0		1			0	0	430	0	0	1.000000	0	0	0	0	0	0	57	1695
RELN	5649	broad.mit.edu	37	7	103629732	103629732	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr7:103629732G>A	ENST00000428762.1	-	1	231	c.72C>T	c.(70-72)cgC>cgT	p.R24R	RELN_ENST00000424685.2_Silent_p.R24R|RELN_ENST00000343529.5_Silent_p.R24R	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	24					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGCCGCCGCGCGCGCCCTCA	0.711																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	1.000000	0.180000	0.780000	0.300000	0.480000	0.532044	0.480000	0.420000																										0				227						c.(70-72)cgC>cgT		reelin							18.0	21.0	20.0					7																	103629732		2202	4298	6500	SO:0001819	synonymous_variant	5649	0	0					g.chr7:103629732G>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.72C>T	chr7.hg19:g.103629732G>A		0					RELN_ENST00000343529.5_Silent_p.R24R|RELN_ENST00000424685.2_Silent_p.R24R	p.R24R	NM_005045.3	NP_005036.2	1	2	3	1.998802	P78509	RELN_HUMAN		1	231	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	0	1	hg19	c.72C>T	CCDS47680.1	0																																																																																								0.156328		TCGA-IB-AAUP-01A-11D-A377-08	0.711	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	0	0	1	2	2	2	2	0	0	0	0	31	31	31	30	1	2.100000	-7.666080	1	0.150000	NM_005045		0	5	5	0	151	149	0		1			0	0	31	0	0	0.936442	0	0	0	0	0	0	5	151
PAPOLB	56903	broad.mit.edu	37	7	4899881	4899881	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr7:4899881C>T	ENST00000404991.1	-	1	1744	c.1558G>A	c.(1558-1560)Gac>Aac	p.D520N	RADIL_ENST00000399583.3_Intron|RADIL_ENST00000536091.1_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	520					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		AAGCTGCTGTCGTTCAAATCT	0.458																																						ENST00000404991.1	1.000000	0.370000	1.000000	0.490000	0.660000	0.710275	0.660000	0.580000																										0				14						c.(1558-1560)Gac>Aac		poly(A) polymerase beta (testis specific)							89.0	82.0	84.0					7																	4899881		1989	4207	6196	SO:0001583	missense	56903	0	0					g.chr7:4899881C>T	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1558G>A	chr7.hg19:g.4899881C>T	ENSP00000384700:p.Asp520Asn	0					RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	p.D520N	NM_020144.4	NP_064529.4	1	2	3	2.087839	Q9NRJ5	PAPOB_HUMAN		1	1744	-		Ovarian(82;0.0175)	Q75LH1|Q8NE14	Missense_Mutation	SNP	ENST00000404991.1	1	1	hg19	c.1558G>A		0	.	.	.	.	.	.	.	.	.	.	C	4.337	0.061936	0.08339	.	.	ENSG00000218823	ENST00000404991	.	.	.	4.24	4.24	0.50183	4.24	4.24	0.50183	.	.	.	.	.	T	0.49609	0.1567	L	0.34521	1.04	0.52501	D	0.999953	B	0.10296	0.003	B	0.09377	0.004	T	0.39057	-0.9632	8	0.17369	T	0.5	.	14.9342	0.70941	0.0:1.0:0.0:0.0	.	521	A4D1Z6	.	N	520	.	ENSP00000384700:D520N	D	-	1	0	0	PAPOLB	4866407	4866407	1.000000	0.71417	0.119000	0.21687	0.038000	0.13279	6.480000	0.73604	2.662000	0.90505	0.591000	0.81541	GAC	0.178942		TCGA-IB-AAUP-01A-11D-A377-08	0.458	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	0	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	2.100000	-3.026924	1	0.150000	NM_020144		0	17	17	0	378	371	0		1			0	0	90	0	0	0.999961	0	0	0	0	0	0	17	378
NOBOX	135935	broad.mit.edu	37	7	144097345	144097345	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr7:144097345C>T	ENST00000467773.1	-	5	904	c.905G>A	c.(904-906)cGc>cAc	p.R302H	NOBOX_ENST00000483238.1_Missense_Mutation_p.R302H|NOBOX_ENST00000223140.5_Missense_Mutation_p.R217H	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	302					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					AATCTCTCGGCGTTTATCACT	0.557																																						ENST00000467773.1	1.000000	0.260000	0.770000	0.370000	0.530000	0.572250	0.530000	0.490000																										0				26						c.(904-906)cGc>cAc		NOBOX oogenesis homeobox							87.0	80.0	83.0					7																	144097345		1892	4124	6016	SO:0001583	missense	135935	0	0					g.chr7:144097345C>T			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.905G>A	chr7.hg19:g.144097345C>T	ENSP00000419457:p.Arg302His	0					NOBOX_ENST00000483238.1_Missense_Mutation_p.R302H|NOBOX_ENST00000223140.5_Missense_Mutation_p.R217H	p.R302H	NM_001080413.3	NP_001073882.3	1	2	3	2.000634	O60393	NOBOX_HUMAN		5	904	-	Melanoma(164;0.14)		A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	1	1	hg19	c.905G>A		0	.	.	.	.	.	.	.	.	.	.	C	19.76	3.888183	0.72524	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.97505	-4.41;-4.41;-4.41	5.79	4.91	0.64330	5.79	4.91	0.64330	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.139728	0.38778	N	0.001576	D	0.99010	0.9662	H	0.98111	4.15	0.36943	D	0.892459	D	0.89917	1.0	D	0.97110	1.0	D	0.99947	1.1488	10	0.87932	D	0	-29.743	12.7537	0.57321	0.0:0.9207:0.0:0.0793	.	302	O60393	NOBOX_HUMAN	H	302;302;217;91	ENSP00000419565:R302H;ENSP00000419457:R302H;ENSP00000223140:R217H	ENSP00000223140:R217H	R	-	2	0	0	NOBOX	143728278	143728278	1.000000	0.71417	0.745000	0.31077	0.663000	0.39108	5.277000	0.65586	1.450000	0.47717	0.650000	0.86243	CGC	0.156955		TCGA-IB-AAUP-01A-11D-A377-08	0.557	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	2.100000	-3.847369	1	0.150000	XM_001134420		0	10	10	0	261	259	0		1			0	0	60	0	0	0.996917	0	0	0	0	0	0	10	261
FER1L6	654463	broad.mit.edu	37	8	125058136	125058136	+	Silent	SNP	C	C	T	rs532200482		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr8:125058136C>T	ENST00000522917.1	+	21	2924	c.2718C>T	c.(2716-2718)gaC>gaT	p.D906D	FER1L6-AS2_ENST00000601180.1_RNA|FER1L6_ENST00000399018.1_Silent_p.D906D|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	906	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ATGACAGCGACGCTGTGGTGA	0.507																																						ENST00000522917.1	1.000000	0.580000	0.960000	0.690000	0.820000	0.825522	0.820000	1.000000																										0				118						c.(2716-2718)gaC>gaT		fer-1-like family member 6							120.0	125.0	124.0					8																	125058136		1970	4162	6132	SO:0001819	synonymous_variant	654463	4	120910	39				g.chr8:125058136C>T	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2718C>T	chr8.hg19:g.125058136C>T		0					FER1L6-AS2_ENST00000601180.1_RNA|FER1L6_ENST00000399018.1_Silent_p.D906D|FER1L6-AS2_ENST00000520031.1_RNA	p.D906D	NM_001039112.2	NP_001034201.2	0	0	0	1.942478	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)	21	2924	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)			Silent	SNP	ENST00000522917.1	1	1	hg19	c.2718C>T	CCDS43767.1	0																																																																																								0.127758		TCGA-IB-AAUP-01A-11D-A377-08	0.507	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	1	0	1	2	2	2	2	0	0	0	0	134	134	134	132	1	2.100000	-20.000000	1	0.150000	NM_001039112		0	35	35	0	517	513	0		1	0		0	0	134	0	0	1.000000	0	0	0	0	1	0	35	517
PIGO	84720	broad.mit.edu	37	9	35092197	35092197	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr9:35092197C>G	ENST00000378617.3	-	7	2081	c.1687G>C	c.(1687-1689)Gat>Cat	p.D563H	PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000341666.3_Missense_Mutation_p.D563H|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	563					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ACAAAACTATCAGAGAAGAAC	0.597																																						ENST00000378617.3	1.000000	0.590000	1.000000	0.770000	0.990000	0.914849	0.990000	1.000000																										0				38						c.(1687-1689)Gat>Cat		phosphatidylinositol glycan anchor biosynthesis, class O							53.0	56.0	55.0					9																	35092197		2203	4300	6503	SO:0001583	missense	84720	0	0					g.chr9:35092197C>G	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.1687G>C	chr9.hg19:g.35092197C>G	ENSP00000367880:p.Asp563His	1					PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000298004.5_Intron|PIGO_ENST00000341666.3_Missense_Mutation_p.D563H|PIGO_ENST00000361778.2_Intron	p.D563H	NM_032634.3	NP_116023.2	1	7	8	2.815833	Q8TEQ8	PIGO_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)	7	2081	-			B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	ENST00000378617.3	1	1	hg19	c.1687G>C	CCDS6575.1	1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485923	0.63962	.	.	ENSG00000165282	ENST00000378617;ENST00000341666	T;T	0.56444	0.46;0.46	5.55	5.55	0.83447	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.72415	0.3457	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.73461	-0.3975	10	0.87932	D	0	-16.9008	19.6982	0.96039	0.0:1.0:0.0:0.0	.	563	Q8TEQ8	PIGO_HUMAN	H	563	ENSP00000367880:D563H;ENSP00000339382:D563H	ENSP00000339382:D563H	D	-	1	0	0	PIGO	35082197	35082197	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	3.975000	0.56859	2.894000	0.99253	0.655000	0.94253	GAT	0.413793		TCGA-IB-AAUP-01A-11D-A377-08	0.597	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	0	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	2.100000	-5.081362	1	0.150000	NM_032634		0	16	16	0	302	300	0		1	1		0	0	38	0	0	0.999936	8.620962e-01	0	2	0	67	0	16	302
PIGO	84720	broad.mit.edu	37	9	35092359	35092359	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr9:35092359C>G	ENST00000378617.3	-	7	1919	c.1525G>C	c.(1525-1527)Gat>Cat	p.D509H	PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000341666.3_Missense_Mutation_p.D509H|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	509					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGCACTAGATCTAGCTTCAGC	0.587																																						ENST00000378617.3	1.000000	0.910000	1.000000	0.990000	0.990000	0.994862	0.990000	1.000000																										0				38						c.(1525-1527)Gat>Cat		phosphatidylinositol glycan anchor biosynthesis, class O							54.0	56.0	55.0					9																	35092359		2203	4300	6503	SO:0001583	missense	84720	0	0					g.chr9:35092359C>G	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.1525G>C	chr9.hg19:g.35092359C>G	ENSP00000367880:p.Asp509His	1					PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000298004.5_Intron|PIGO_ENST00000341666.3_Missense_Mutation_p.D509H|PIGO_ENST00000361778.2_Intron	p.D509H	NM_032634.3	NP_116023.2	1	7	8	2.815833	Q8TEQ8	PIGO_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)	7	1919	-			B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	ENST00000378617.3	1	1	hg19	c.1525G>C	CCDS6575.1	1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.994626	0.54041	.	.	ENSG00000165282	ENST00000378617;ENST00000341666	T;T	0.56103	0.48;0.48	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.324049	0.36740	N	0.002440	T	0.59238	0.2179	L	0.59436	1.845	0.80722	D	1	D	0.53151	0.958	P	0.50791	0.65	T	0.51616	-0.8683	10	0.15066	T	0.55	-3.8987	19.3311	0.94288	0.0:1.0:0.0:0.0	.	509	Q8TEQ8	PIGO_HUMAN	H	509	ENSP00000367880:D509H;ENSP00000339382:D509H	ENSP00000339382:D509H	D	-	1	0	0	PIGO	35082359	35082359	1.000000	0.71417	0.706000	0.30403	0.701000	0.40568	6.553000	0.73918	2.813000	0.96785	0.655000	0.94253	GAT	0.413793		TCGA-IB-AAUP-01A-11D-A377-08	0.587	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	2.100000	-3.318804	1	0.150000	NM_032634		0	28	28	0	381	376	0		1	0		0	0	58	0	0	1.000000	9.806942e-01	0	0	0	88	0	28	381
GRIN3A	116443	broad.mit.edu	37	9	104385694	104385694	+	Silent	SNP	G	G	A	rs143827340	byFrequency	TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chr9:104385694G>A	ENST00000361820.3	-	5	3120	c.2520C>T	c.(2518-2520)gaC>gaT	p.D840D		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	840					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.D840E(1)|p.D840D(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TGATGAAGGCGTCTAGTTTCT	0.423													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19164	0.0		0.0	False		,,,				2504	0.001					ENST00000361820.3	1.000000	0.430000	1.000000	0.550000	0.720000	0.746821	0.720000	1.000000																										2	Substitution - Missense(1)|Substitution - coding silent(1)	p.D840E(1)|p.D840D(1)	large_intestine(1)|lung(1)	80						c.(2518-2520)gaC>gaT		glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	G		1,4405	2.1+/-5.4	0,1,2202	143.0	128.0	133.0		2520	-1.5	1.0	9	dbSNP_134	133	0,8600		0,0,4300	no	coding-synonymous	GRIN3A	NM_133445.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		840/1116	104385694	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	116443	18	121408	43				g.chr9:104385694G>A		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2520C>T	chr9.hg19:g.104385694G>A		0						p.D840D	NM_133445.2	NP_597702.2	1	2	3	2.030197	Q8TCU5	NMD3A_HUMAN		5	3120	-		Acute lymphoblastic leukemia(62;0.0568)	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	ENST00000361820.3	1	1	hg19	c.2520C>T	CCDS6758.1	0																																																																																								0.163180		TCGA-IB-AAUP-01A-11D-A377-08	0.423	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	2.100000	-3.227833	1	0.150000			0	18	18	0	341	338	0		1	0		0	0	91	0	0	0.999982	0	0	0	0	1	0	18	341
MXRA5	25878	broad.mit.edu	37	X	3239037	3239037	+	Silent	SNP	G	G	A			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chrX:3239037G>A	ENST00000217939.6	-	5	4843	c.4689C>T	c.(4687-4689)tcC>tcT	p.S1563S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1563						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CATCCTGGTCGGAAGAGGGTG	0.453																																						ENST00000217939.6	0.530000	0.250000	0.460000	0.310000	0.380000	0.392362	0.380000	0.380000																										0				157						c.(4687-4689)tcC>tcT		matrix-remodelling associated 5							228.0	201.0	210.0					X																	3239037		2203	4300	6503	SO:0001819	synonymous_variant	25878	0	0					g.chrX:3239037G>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.4689C>T	chrX.hg19:g.3239037G>A								p.S1563S	NM_015419.3	NP_056234.2	0	1	1		Q9NR99	MXRA5_HUMAN		5	4843	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	1	1	hg19	c.4689C>T	CCDS14124.1	0																																																																																								0.150000		TCGA-IB-AAUP-01A-11D-A377-08	0.453	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	1	0	1	2	2	2	2	0	0	0	0	134	134	134	131	1	2.100000	-2.540062	1	0.150000	NM_015419		0	27	26	0	441	435	1		1	1		0	0	134	0	0	1.000000	9.998132e-01	0	40	0	177	0	27	441
OFD1	8481	broad.mit.edu	37	X	13778776	13778776	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chrX:13778776C>T	ENST00000340096.6	+	16	2524	c.2197C>T	c.(2197-2199)Cgc>Tgc	p.R733C	OFD1_ENST00000380550.3_Missense_Mutation_p.R693C|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380567.1_Missense_Mutation_p.R593C	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	733	Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TTCCTCCAGACGCCTCTCTTC	0.567																																						ENST00000340096.6	0.580000	0.190000	0.470000	0.270000	0.360000	0.378716	0.360000	0.350000																										0				25						c.(2197-2199)Cgc>Tgc		oral-facial-digital syndrome 1							37.0	40.0	39.0					X																	13778776		2203	4298	6501	SO:0001583	missense	8481	0	0					g.chrX:13778776C>T	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.2197C>T	chrX.hg19:g.13778776C>T	ENSP00000344314:p.Arg733Cys						OFD1_ENST00000380567.1_Missense_Mutation_p.R593C|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Missense_Mutation_p.R693C	p.R733C	NM_003611.2	NP_003602.1	0	1	1		O75665	OFD1_HUMAN		16	2524	+			B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	1	1	hg19	c.2197C>T	CCDS14157.1	0	.	.	.	.	.	.	.	.	.	.	C	12.30	1.895886	0.33442	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.96802	-4.13;-4.1;-1.96	5.4	3.62	0.41486	5.4	3.62	0.41486	.	0.544069	0.19617	N	0.109994	D	0.92672	0.7671	M	0.62723	1.935	0.24464	N	0.994429	P;P;P;B;P	0.41546	0.647;0.647;0.754;0.238;0.647	B;B;B;B;B	0.31337	0.091;0.091;0.128;0.04;0.091	D	0.86025	0.1509	10	0.51188	T	0.08	-0.794	7.0936	0.25297	0.0:0.7013:0.1382:0.1605	.	733;693;401;593;733	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	C	693;733;593	ENSP00000369923:R693C;ENSP00000344314:R733C;ENSP00000369941:R593C	ENSP00000344314:R733C	R	+	1	0	0	OFD1	13688697	13688697	0.340000	0.24792	0.135000	0.22099	0.844000	0.47949	0.699000	0.25586	0.473000	0.27368	0.529000	0.55759	CGC	0.150000		TCGA-IB-AAUP-01A-11D-A377-08	0.567	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	2.100000	-15.075890	1	0.150000	NM_003611		0	12	12	0	209	206	0		1	1		0	0	57	0	0	0.999123	9.588162e-01	0	7	0	90	0	12	209
ATRX	546	broad.mit.edu	37	X	76938810	76938810	+	Silent	SNP	T	T	C			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chrX:76938810T>C	ENST00000373344.5	-	9	2152	c.1938A>G	c.(1936-1938)ttA>ttG	p.L646L	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Silent_p.L608L	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	646					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CCTCTAAAAGTAATGAAACTT	0.403			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															ENST00000373344.5	0.470000	0.270000	0.420000	0.310000	0.360000	0.373882	0.360000	0.370000				Rec	yes			Rec	yes		X	Xq21.1	Xq21.1	546	Mis, F, N	alpha thalassemia/mental retardation syndrome X-linked	yes	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E	E			Pancreatic neuroendocrine tumors, paediatric GBM		1	Unknown(1)	p.?(1)	bone(1)	145						c.(1936-1938)ttA>ttG		alpha thalassemia/mental retardation syndrome X-linked							137.0	150.0	146.0					X																	76938810		2203	4294	6497	SO:0001819	synonymous_variant	546	0	0					g.chrX:76938810T>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1938A>G	chrX.hg19:g.76938810T>C							ATRX_ENST00000395603.3_Silent_p.L608L|ATRX_ENST00000480283.1_5'UTR	p.L646L	NM_000489.3	NP_000480.3	0	1	1		P46100	ATRX_HUMAN		9	2152	-			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	1	1	hg19	c.1938A>G	CCDS14434.1	0																																																																																								0.150000		TCGA-IB-AAUP-01A-11D-A377-08	0.403	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	1	0	1	2	2	2	2	0	0	0	0	276	276	276	275	1	2.100000	-20.000000	1	0.150000	NM_000489		0	48	48	0	818	811	0		1	1		0	0	276	0	0	1.000000	2.070035e-01	0	3	0	12	0	48	818
RPS6KA6	27330	broad.mit.edu	37	X	83361395	83361395	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chrX:83361395G>T	ENST00000262752.2	-	15	1350	c.1343C>A	c.(1342-1344)aCc>aAc	p.T448N	RPS6KA6_ENST00000495332.1_5'UTR|RPS6KA6_ENST00000543399.1_Missense_Mutation_p.T448N	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	448	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TTCCATGTTGGTAGTTGCATG	0.363																																						ENST00000262752.2	0.970000	0.410000	0.890000	0.550000	0.720000	0.723621	0.720000	0.730000																										0				46						c.(1342-1344)aCc>aAc		ribosomal protein S6 kinase, 90kDa, polypeptide 6							129.0	95.0	106.0					X																	83361395		2203	4300	6503	SO:0001583	missense	27330	0	0					g.chrX:83361395G>T	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1343C>A	chrX.hg19:g.83361395G>T	ENSP00000262752:p.Thr448Asn						RPS6KA6_ENST00000495332.1_5'UTR|RPS6KA6_ENST00000543399.1_Missense_Mutation_p.T448N	p.T448N	NM_014496.4	NP_055311.1	0	1	1		Q9UK32	KS6A6_HUMAN		15	1350	-			B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	0	1	hg19	c.1343C>A	CCDS14451.1	0	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032610	0.75504	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.45276	0.9;0.9	5.45	4.52	0.55395	5.45	4.52	0.55395	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.220899	0.45867	N	0.000332	T	0.49372	0.1553	L	0.51422	1.61	0.53005	D	0.99996	B;B	0.29115	0.233;0.233	B;B	0.42771	0.397;0.345	T	0.51865	-0.8651	10	0.72032	D	0.01	.	14.4183	0.67165	0.0:0.0:0.8326:0.1674	.	448;448	B7ZL90;Q9UK32	.;KS6A6_HUMAN	N	448	ENSP00000262752:T448N;ENSP00000440830:T448N	ENSP00000262752:T448N	T	-	2	0	0	RPS6KA6	83248051	83248051	1.000000	0.71417	0.991000	0.47740	0.875000	0.50365	7.489000	0.81451	0.975000	0.38392	0.422000	0.28245	ACC	0.150000		TCGA-IB-AAUP-01A-11D-A377-08	0.363	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	2.100000	-19.345500	1	0.150000	NM_014496		0	12	12	0	92	91	1		1	0		0	0	24	0	0	0.999265	0	0	0	0	1	0	12	92
NRK	203447	broad.mit.edu	37	X	105167200	105167200	+	Missense_Mutation	SNP	C	C	T	rs376128030		TCGA-IB-AAUP-01A-11D-A377-08	TCGA-IB-AAUP-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e2d7d9a4-fa84-406a-839f-340a37e9d40e	58ea8a9c-cea1-44a7-b388-6112787a0305	g.chrX:105167200C>T	ENST00000243300.9	+	18	3004	c.2701C>T	c.(2701-2703)Cgg>Tgg	p.R901W	NRK_ENST00000428173.2_Missense_Mutation_p.R902W	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	901					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TGAAATCTTCCGGAATGATTG	0.438										HNSCC(51;0.14)																												ENST00000243300.9	0.650000	0.270000	0.550000	0.340000	0.440000	0.454309	0.440000	0.430000																										0				76						c.(2701-2703)Cgg>Tgg		Nik related kinase			TRP/ARG	1,3319		0,1,1374,570	92.0	86.0	88.0		2701	1.8	1.0	X		88	0,6467		0,0,2335,1797	no	missense	NRK	NM_198465.2	101	0,1,3709,2367	TT,TC,CC,C		0.0,0.0301,0.0102	benign	901/1583	105167200	1,9786	1945	4132	6077	SO:0001583	missense	203447	1	120826	41				g.chrX:105167200C>T	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2701C>T	chrX.hg19:g.105167200C>T	ENSP00000434830:p.Arg901Trp		HNSCC(51;0.14)				NRK_ENST00000428173.2_Missense_Mutation_p.R902W	p.R901W	NM_198465.2	NP_940867.2	0	1	1		Q7Z2Y5	NRK_HUMAN		18	3004	+			Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	1	1	hg19	c.2701C>T		0	.	.	.	.	.	.	.	.	.	.	c	9.801	1.180645	0.21787	3.01E-4	0.0	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.76709	-1.03;-1.04	3.58	1.77	0.24775	3.58	1.77	0.24775	.	0.531001	0.14438	N	0.319547	T	0.56455	0.1986	N	0.12182	0.205	0.80722	D	1	B;B	0.17465	0.022;0.005	B;B	0.09377	0.004;0.001	T	0.46541	-0.9184	10	0.49607	T	0.09	.	5.109	0.14800	0.0:0.7318:0.0:0.2682	.	569;901	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	W	901;902	ENSP00000434830:R901W;ENSP00000438378:R902W	ENSP00000434830:R901W	R	+	1	2	2	NRK	105053856	105053856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.938000	0.28965	0.336000	0.23639	0.597000	0.82753	CGG	0.150000		TCGA-IB-AAUP-01A-11D-A377-08	0.438	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	1	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	2.100000	-2.879357	1	0.150000	NM_198465		0	18	17	0	253	248	0		1	0		0	0	57	0	0	0.999981	6.201483e-02	0	0	0	6	0	18	253
