#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ANK3	288	broad.mit.edu	37	10	61868601	61868601	+	Missense_Mutation	SNP	C	C	T	rs368218301		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr10:61868601C>T	ENST00000280772.2	-	27	3351	c.3160G>A	c.(3160-3162)Gca>Aca	p.A1054T	ANK3_ENST00000355288.2_Missense_Mutation_p.A188T|ANK3_ENST00000503366.1_Missense_Mutation_p.A1055T|ANK3_ENST00000373827.2_Missense_Mutation_p.A1048T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1054	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AAAAATTGTGCCCCTGCAGGA	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		18456	0.0		0.0	False		,,,				2504	0.001					ENST00000280772.2	1.000000	0.090000	0.530000	0.180000	0.300000	0.375303	0.300000	0.250000																										0				196						c.(3160-3162)Gca>Aca		ankyrin 3, node of Ranvier (ankyrin G)							61.0	65.0	64.0					10																	61868601		2203	4300	6503	SO:0001583	missense	288	2	121410	31				g.chr10:61868601C>T	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3160G>A	chr10.hg19:g.61868601C>T	ENSP00000280772:p.Ala1054Thr	0					ANK3_ENST00000355288.2_Missense_Mutation_p.A188T|ANK3_ENST00000373827.2_Missense_Mutation_p.A1048T|ANK3_ENST00000503366.1_Missense_Mutation_p.A1055T	p.A1054T	NM_020987.3	NP_066267.2	1	2	3	2.000189	Q12955	ANK3_HUMAN		27	3351	-			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	0	1	hg19	c.3160G>A	CCDS7258.1	0	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768023	0.90020	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348;ENST00000373815	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	6.04	6.04	0.98038	6.040000	6.040000	0.980380	ZU5 (3);	0.000000	0.41938	D	0.000798	T	0.58192	0.2105	L	0.39020	1.185	0.80722	D	1	P;D;D;D;D;B;D	0.89917	0.712;0.999;1.0;1.0;1.0;0.286;0.997	P;D;D;D;D;B;D	0.91635	0.592;0.999;0.999;0.996;0.983;0.194;0.957	T	0.51631	-0.8681	10	0.42905	T	0.14	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	1055;188;587;1048;1054;289;188	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	T	1054;1048;188;188;1055;1034;289;689;689;187;587;179	ENSP00000280772:A1054T;ENSP00000362933:A1048T;ENSP00000347436:A188T;ENSP00000425236:A1055T;ENSP00000362921:A179T	ENSP00000280772:A1054T	A	-	1	0	0	ANK3	61538607	61538607	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	GCA	0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.453	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2.010000	-2.728009	1	0.110000	NM_020987		0	4	4	0	277	275	0		1	0		0	0	48	0	0	0.889369	9.413395e-03	0	0	0	8	0	4	277
GRID1	2894	broad.mit.edu	37	10	87487669	87487669	+	Silent	SNP	G	G	A	rs149876378		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr10:87487669G>A	ENST00000327946.7	-	10	1561	c.1476C>T	c.(1474-1476)taC>taT	p.Y492Y	GRID1_ENST00000536331.1_Silent_p.Y63Y	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	492					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.Y492Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GCTGGTGACCGTACCTGCCAT	0.557										Multiple Myeloma(13;0.14)																												ENST00000327946.7	1.000000	0.060000	0.280000	0.110000	0.170000	0.253710	0.170000	0.150000																										1	Substitution - coding silent(1)	p.Y492Y(1)	lung(1)	106						c.(1474-1476)taC>taT		glutamate receptor, ionotropic, delta 1							140.0	131.0	134.0					10																	87487669		2203	4300	6503	SO:0001819	synonymous_variant	2894	4	121412	42				g.chr10:87487669G>A	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1476C>T	chr10.hg19:g.87487669G>A		0	Multiple Myeloma(13;0.14)				GRID1_ENST00000536331.1_Silent_p.Y63Y	p.Y492Y	NM_017551.2	NP_060021.1	1	2	3	2.000189	Q9ULK0	GRID1_HUMAN		10	1561	-			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	0	1	hg19	c.1476C>T	CCDS31236.1	0																																																																																								0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.557	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	0	0	1	2	2	2	2	0	0	0	0	90	90	90	88	1	2.010000	-2.069898	0	0.110000	XM_043613		0	6	6	0	692	685	0		1	0		0	0	90	0	0	0.963968	6.918229e-03	0	0	0	12	0	6	692
SEC31B	25956	broad.mit.edu	37	10	102257434	102257434	+	Silent	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr10:102257434G>A	ENST00000370345.3	-	16	2077	c.1980C>T	c.(1978-1980)ccC>ccT	p.P660P	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	660					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.P660P(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CACAGAGCTCGGGAAATTTCT	0.512																																						ENST00000370345.3	1.000000	0.130000	0.590000	0.220000	0.360000	0.423362	0.360000	0.310000																										1	Substitution - coding silent(1)	p.P660P(1)	kidney(1)	36						c.(1978-1980)ccC>ccT		SEC31 homolog B (S. cerevisiae)							143.0	116.0	125.0					10																	102257434		2203	4300	6503	SO:0001819	synonymous_variant	25956	1	121412	35				g.chr10:102257434G>A	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.1980C>T	chr10.hg19:g.102257434G>A		0					SEC31B_ENST00000494350.1_5'Flank	p.P660P	NM_015490.3	NP_056305.1	1	2	3	2.000189	Q9NQW1	SC31B_HUMAN		16	2077	-		Colorectal(252;0.117)	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	ENST00000370345.3	0	1	hg19	c.1980C>T	CCDS7495.1	0																																																																																								0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.512	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	0	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	2.010000	-2.541933	1	0.110000	NM_015490		0	5	5	0	284	279	0		1	0		0	0	59	0	0	0.934585	2.297087e-02	0	0	0	11	0	5	284
DDX10	1662	broad.mit.edu	37	11	108546412	108546412	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr11:108546412G>A	ENST00000322536.3	+	3	466	c.337G>A	c.(337-339)Gcc>Acc	p.A113T	DDX10_ENST00000526794.1_Missense_Mutation_p.A113T	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	113	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.A113T(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		ACTTGGAGCGGCCAAAACTGG	0.438			T	NUP98	AML*																																	ENST00000322536.3	0.310000	0.050000	0.230000	0.090000	0.150000	0.168033	0.150000	0.140000				Dom	yes			Dom	yes		11	11q22-q23	11q22-q23	1662	T	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10				L	L	NUP98		AML*		1	Substitution - Missense(1)	p.A113T(1)	kidney(1)	27						c.(337-339)Gcc>Acc		DEAD (Asp-Glu-Ala-Asp) box polypeptide 10							157.0	147.0	150.0					11																	108546412		2201	4298	6499	SO:0001583	missense	1662	0	0					g.chr11:108546412G>A	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.337G>A	chr11.hg19:g.108546412G>A	ENSP00000314348:p.Ala113Thr	0					DDX10_ENST00000526794.1_Missense_Mutation_p.A113T	p.A113T	NM_004398.2	NP_004389.2	0	0	0	1.975309	Q13206	DDX10_HUMAN		3	466	+		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)	B2RCQ3|Q5BJD8	Missense_Mutation	SNP	ENST00000322536.3	0	1	hg19	c.337G>A	CCDS8342.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.649371	0.96714	.	.	ENSG00000178105	ENST00000322536;ENST00000456020;ENST00000526794	T;T	0.22539	1.95;1.95	5.82	5.82	0.92795	5.820000	5.820000	0.927950	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.046541	0.85682	N	0.000000	T	0.53302	0.1788	H	0.95679	3.705	0.80722	D	1	P;P	0.48764	0.858;0.915	P;P	0.51055	0.657;0.657	T	0.67921	-0.5545	10	0.87932	D	0	-4.8073	20.1566	0.98115	0.0:0.0:1.0:0.0	.	113;113	Q13206;E9PIF2	DDX10_HUMAN;.	T	113	ENSP00000314348:A113T;ENSP00000432032:A113T	ENSP00000314348:A113T	A	+	1	0	0	DDX10	108051622	108051622	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.413000	0.97351	2.779000	0.95612	0.603000	0.83216	GCC	0.094055		TCGA-IB-AAUT-01A-11D-A377-08	0.438	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	0	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	2.010000	-1.720911	0	0.110000	NM_004398		0	5	5	0	621	615	0		1	0		0	0	90	0	0	0.936173	4.458731e-03	0	0	0	10	0	5	621
ABCG4	64137	broad.mit.edu	37	11	119020905	119020905	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr11:119020905G>A	ENST00000449422.2	+	2	418	c.230G>A	c.(229-231)cGc>cAc	p.R77H	ABCG4_ENST00000531739.1_Missense_Mutation_p.R77H|ABCG4_ENST00000307417.3_Missense_Mutation_p.R77H	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	77	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCCTGCTGGCGCAAAAGGGGT	0.622																																						ENST00000449422.2	0.380000	0.080000	0.290000	0.130000	0.200000	0.217564	0.200000	0.190000																										0				44						c.(229-231)cGc>cAc		ATP-binding cassette, sub-family G (WHITE), member 4							66.0	75.0	72.0					11																	119020905		2200	4295	6495	SO:0001583	missense	64137	0	0					g.chr11:119020905G>A	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.230G>A	chr11.hg19:g.119020905G>A	ENSP00000406874:p.Arg77His	0					ABCG4_ENST00000307417.3_Missense_Mutation_p.R77H|ABCG4_ENST00000531739.1_Missense_Mutation_p.R77H	p.R77H	NM_001142505.1	NP_001135977.1	0	0	0	1.975309	Q9H172	ABCG4_HUMAN		2	418	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	0	1	hg19	c.230G>A	CCDS8415.1	0	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366993	0.82463	.	.	ENSG00000172350	ENST00000307417;ENST00000524604;ENST00000449422;ENST00000531739	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	4.34	4.34	0.51931	4.340000	4.340000	0.519310	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.11281	0.0275	L	0.35487	1.065	0.53688	D	0.999975	D	0.67145	0.996	P	0.47470	0.548	T	0.06807	-1.0806	10	0.51188	T	0.08	-22.516	17.1003	0.86647	0.0:0.0:1.0:0.0	.	77	Q9H172	ABCG4_HUMAN	H	77	ENSP00000304111:R77H;ENSP00000431915:R77H;ENSP00000406874:R77H;ENSP00000434318:R77H	ENSP00000304111:R77H	R	+	2	0	0	ABCG4	118526115	118526115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.502000	0.66956	2.272000	0.75746	0.644000	0.83932	CGC	0.094055		TCGA-IB-AAUT-01A-11D-A377-08	0.622	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	2.010000	-1.879402	0	0.110000	NM_022169		0	7	7	0	638	632	0		1			0	0	68	0	0	0.980026	0	0	0	0	0	0	7	638
CHD4	1108	broad.mit.edu	37	12	6710455	6710455	+	Splice_Site	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr12:6710455C>T	ENST00000357008.2	-	6	962	c.799G>A	c.(799-801)Ggt>Agt	p.G267S	CHD4_ENST00000544040.1_Splice_Site_p.G260S|CHD4_ENST00000544484.1_Splice_Site_p.G264S|CHD4_ENST00000309577.6_Splice_Site_p.G267S	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	267					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CCCATTTCACCTTTGCCCTCC	0.557																																					Colon(32;586 792 4568 16848 45314)	ENST00000357008.2	1.000000	0.300000	1.000000	0.380000	0.490000	0.584152	0.490000	0.460000																										0				2						c.(799-801)Ggt>Agt		chromodomain helicase DNA binding protein 4							111.0	114.0	113.0					12																	6710455		2203	4300	6503	SO:0001630	splice_region_variant	1108	0	0					g.chr12:6710455C>T	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.799+1G>A	chr12.hg19:g.6710455C>T		0					CHD4_ENST00000544484.1_Splice_Site_p.G264S|CHD4_ENST00000309577.6_Splice_Site_p.G267S|CHD4_ENST00000544040.1_Splice_Site_p.G260S	p.G267S	NM_001273.2	NP_001264.2	1	2	3	2.044309	Q14839	CHD4_HUMAN		6	962	-			Q8IXZ5	Splice_Site	SNP	ENST00000357008.2	0	1	hg19	c.799G>A	CCDS8552.1	0	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527638	0.85706	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90069	-2.59;-2.61;-2.59;-2.61;0.5	5.73	5.73	0.89815	5.730000	5.730000	0.898150	.	0.000000	0.85682	D	0.000000	D	0.94732	0.8300	M	0.82323	2.585	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.61	D;D;B	0.91635	0.999;0.999;0.256	D	0.94514	0.7721	9	.	.	.	-5.4851	16.8611	0.86018	0.0:0.872:0.128:0.0	.	267;267;260	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	S	264;260;267;267;241;267	ENSP00000440392:G264S;ENSP00000440542:G260S;ENSP00000312419:G267S;ENSP00000349508:G267S;ENSP00000437506:G267S	.	G	-	1	0	0	CHD4	6580716	6580716	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.612000	0.54142	2.705000	0.92388	0.555000	0.69702	GGT	0.124920		TCGA-IB-AAUT-01A-11D-A377-08	0.557	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	172	172	172	172	1	2.010000	-2.442273	0	0.110000	NM_001273	Missense_Mutation	0	22	21	0	862	843	0		1	0	1	0	0	172	364	0	0.999998	4.903196e-01	9.983159e-01	1	12	63	378	22	862
TMEM106C	79022	broad.mit.edu	37	12	48359115	48359115	+	Missense_Mutation	SNP	C	C	T	rs146483924	byFrequency	TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr12:48359115C>T	ENST00000429772.2	+	3	351	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	TMEM106C_ENST00000550552.1_Missense_Mutation_p.R80C|TMEM106C_ENST00000552546.1_Intron|TMEM106C_ENST00000552561.1_Missense_Mutation_p.R80C|TMEM106C_ENST00000549288.1_Intron|TMEM106C_ENST00000256686.6_Missense_Mutation_p.R80C|TMEM106C_ENST00000449758.2_Missense_Mutation_p.R80C	NM_001143842.1	NP_001137314.1	Q9BVX2	T106C_HUMAN	transmembrane protein 106C	80						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.R80C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(13;0.11)		GBM - Glioblastoma multiforme(48;0.241)		TCAGAGATTGCGCCCTCAGCG	0.408																																						ENST00000429772.2	0.420000	0.070000	0.310000	0.130000	0.200000	0.225255	0.200000	0.190000																										1	Substitution - Missense(1)	p.R80C(1)	large_intestine(1)	14						c.(238-240)Cgc>Tgc		transmembrane protein 106C		C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	137.0	119.0	125.0		238,238,238,238	4.4	1.0	12	dbSNP_134	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	TMEM106C	NM_001143841.1,NM_001143842.1,NM_001143843.1,NM_024056.3	180,180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	80/232,80/251,80/232,80/251	48359115	1,13005	2203	4300	6503	SO:0001583	missense	79022	14	121412	43				g.chr12:48359115C>T	BC000854	CCDS8758.1, CCDS44867.1	12q13.1	2005-12-19				ENSG00000134291			28775	protein-coding gene	gene with protein product							Standard	NM_024056		Approved	MGC5576	uc001rqr.3	Q9BVX2	OTTHUMG00000169892	ENST00000429772.2:c.238C>T	chr12.hg19:g.48359115C>T	ENSP00000400471:p.Arg80Cys	0					TMEM106C_ENST00000550552.1_Missense_Mutation_p.R80C|TMEM106C_ENST00000449758.2_Missense_Mutation_p.R80C|TMEM106C_ENST00000256686.6_Missense_Mutation_p.R80C|TMEM106C_ENST00000552546.1_Intron|TMEM106C_ENST00000549288.1_Intron|TMEM106C_ENST00000552561.1_Missense_Mutation_p.R80C	p.R80C	NM_001143842.1	NP_001137314.1	0	1	1	1.993607	Q9BVX2	T106C_HUMAN		3	351	+		Acute lymphoblastic leukemia(13;0.11)	B2R998|B7Z5M4|Q3B761	Missense_Mutation	SNP	ENST00000429772.2	0	1	hg19	c.238C>T	CCDS8758.1	0	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928501	0.92389	0.0	1.16E-4	ENSG00000134291	ENST00000256686;ENST00000552561;ENST00000550552;ENST00000429772;ENST00000449758	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	4.37	4.37	0.52481	4.370000	4.370000	0.524810	.	0.156867	0.48767	D	0.000163	T	0.51975	0.1706	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.63597	0.916;0.862	T	0.55976	-0.8055	10	0.87932	D	0	0.1116	16.7328	0.85439	0.0:1.0:0.0:0.0	.	80;80	Q9BVX2;Q9BVX2-2	T106C_HUMAN;.	C	80	ENSP00000256686:R80C;ENSP00000446657:R80C;ENSP00000449737:R80C;ENSP00000400471:R80C;ENSP00000402705:R80C	ENSP00000256686:R80C	R	+	1	0	0	TMEM106C	46645382	46645382	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.039000	0.64185	2.727000	0.93392	0.655000	0.94253	CGC	0.103591		TCGA-IB-AAUT-01A-11D-A377-08	0.408	TMEM106C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406452.1	0	0	1	2	21	9	2	1	1	1	1	70	70	70	70	1	2.010000	-1.994015	0	0.110000	NM_024056		0	5	5	0	465	457	0		0	0		1	0	70	0	0	0.000923	1.643590e-03	0	0	0	152	0	5	465
SLC17A8	246213	broad.mit.edu	37	12	100795569	100795569	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr12:100795569G>A	ENST00000323346.5	+	6	1004	c.691G>A	c.(691-693)Gca>Aca	p.A231T	snoU13_ENST00000459038.1_RNA|SLC17A8_ENST00000392989.3_Missense_Mutation_p.A231T	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	231					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						CTATGCAGGGGCAGTGGTTGC	0.443																																						ENST00000323346.5	0.410000	0.090000	0.310000	0.140000	0.220000	0.235665	0.220000	0.210000																										0				44						c.(691-693)Gca>Aca		solute carrier family 17 (vesicular glutamate transporter), member 8							265.0	252.0	256.0					12																	100795569		2203	4300	6503	SO:0001583	missense	246213	0	0					g.chr12:100795569G>A	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.691G>A	chr12.hg19:g.100795569G>A	ENSP00000316909:p.Ala231Thr	0					snoU13_ENST00000459038.1_RNA|SLC17A8_ENST00000392989.3_Missense_Mutation_p.A231T	p.A231T	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	0	1	1	1.993607	Q8NDX2	VGLU3_HUMAN		6	1004	+			B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	0	1	hg19	c.691G>A	CCDS9077.1	0	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219505	0.58560	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.58060	0.36;0.36	5.45	5.45	0.79879	5.450000	5.450000	0.798790	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.56366	0.1980	N	0.20986	0.625	0.80722	D	1	D;D	0.67145	0.996;0.984	D;D	0.72625	0.978;0.939	T	0.44298	-0.9337	10	0.02654	T	1	.	19.661	0.95871	0.0:0.0:1.0:0.0	.	231;231	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	T	231	ENSP00000316909:A231T;ENSP00000376715:A231T	ENSP00000316909:A231T	A	+	1	0	0	SLC17A8	99319700	99319700	1.000000	0.71417	0.978000	0.43139	0.427000	0.31564	9.796000	0.99103	2.714000	0.92807	0.563000	0.77884	GCA	0.103591		TCGA-IB-AAUT-01A-11D-A377-08	0.443	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	0	0	1	2	2	2	2	0	0	0	0	71	71	71	68	1	2.010000	-2.559966	1	0.110000	NM_139319		0	7	7	0	595	589	0		1			0	0	71	0	0	0.979994	0	0	0	0	0	0	7	595
LAMP1	3916	broad.mit.edu	37	13	113964111	113964111	+	Missense_Mutation	SNP	G	G	A	rs374537669		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr13:113964111G>A	ENST00000332556.4	+	3	531	c.337G>A	c.(337-339)Gtc>Atc	p.V113I	LAMP1_ENST00000397181.3_Missense_Mutation_p.V113I	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	113	First lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)	p.V113I(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			ACGTTACAGCGTCCAGCTCAT	0.438																																						ENST00000332556.4	0.440000	0.130000	0.350000	0.190000	0.260000	0.278160	0.260000	0.260000																										1	Substitution - Missense(1)	p.V113I(1)	endometrium(1)	16						c.(337-339)Gtc>Atc		lysosomal-associated membrane protein 1		G	ILE/VAL	0,3914		0,0,1957	169.0	164.0	166.0		337	5.3	0.3	13		166	1,8291		0,1,4145	no	missense	LAMP1	NM_005561.3	29	0,1,6102	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	113/418	113964111	1,12205	1957	4146	6103	SO:0001583	missense	3916	4	120888	41				g.chr13:113964111G>A	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.337G>A	chr13.hg19:g.113964111G>A	ENSP00000333298:p.Val113Ile	0					LAMP1_ENST00000397181.3_Missense_Mutation_p.V113I	p.V113I	NM_005561.3	NP_005552.3	0	1	1	1.994124	P11279	LAMP1_HUMAN	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)	3	531	+	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	ENST00000332556.4	0	1	hg19	c.337G>A	CCDS41909.1	0	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831290	0.50845	0.0	1.21E-4	ENSG00000185896	ENST00000332556;ENST00000397181	T;T	0.35973	1.28;1.46	5.29	5.29	0.74685	5.290000	5.290000	0.746850	.	0.000000	0.85682	D	0.000000	T	0.52451	0.1735	L	0.52573	1.65	0.31429	N	0.67331	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.54146	-0.8337	10	0.29301	T	0.29	-52.2082	14.4649	0.67477	0.0:0.0:1.0:0.0	.	113;113	B4DWL3;P11279	.;LAMP1_HUMAN	I	113	ENSP00000333298:V113I;ENSP00000415354:V113I	ENSP00000333298:V113I	V	+	1	0	0	LAMP1	113012112	113012112	0.991000	0.36638	0.335000	0.25508	0.087000	0.18053	4.848000	0.62874	2.473000	0.83533	0.557000	0.71058	GTC	0.103591		TCGA-IB-AAUT-01A-11D-A377-08	0.438	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2	0	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	2.010000	-2.843333	1	0.110000			0	11	11	0	757	750	0		1	1		0	0	102	0	0	0.998253	9.793033e-01	0	6	0	445	0	11	757
PCNX	22990	broad.mit.edu	37	14	71429026	71429026	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr14:71429026C>T	ENST00000304743.2	+	3	892	c.446C>T	c.(445-447)gCc>gTc	p.A149V	PCNX_ENST00000439984.3_Missense_Mutation_p.A149V|PCNX_ENST00000238570.5_Missense_Mutation_p.A149V	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	149						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AATTCTTATGCCGGTCTAGAT	0.478																																						ENST00000304743.2	1.000000	0.070000	0.320000	0.120000	0.190000	0.278124	0.190000	0.170000																										0				87						c.(445-447)gCc>gTc		pecanex homolog (Drosophila)							161.0	159.0	160.0					14																	71429026		2203	4300	6503	SO:0001583	missense	22990	0	0					g.chr14:71429026C>T	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.446C>T	chr14.hg19:g.71429026C>T	ENSP00000304192:p.Ala149Val	0					PCNX_ENST00000439984.3_Missense_Mutation_p.A149V|PCNX_ENST00000238570.5_Missense_Mutation_p.A149V	p.A149V	NM_014982.2	NP_055797.2	1	2	3	2.002115	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	3	892	+			B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	0	1	hg19	c.446C>T	CCDS9806.1	0	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320630	0.41096	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.42513	0.97;0.97;0.97	5.29	5.29	0.74685	5.290000	5.290000	0.746850	.	0.213882	0.41001	D	0.000977	T	0.28333	0.0700	N	0.08118	0	0.43355	D	0.99542	P;P;B	0.40970	0.734;0.734;0.208	B;B;B	0.40165	0.321;0.321;0.047	T	0.08046	-1.0741	10	0.25751	T	0.34	.	19.2883	0.94087	0.0:1.0:0.0:0.0	.	149;149;149	B2RTR6;Q96RV3;Q96RV3-2	.;PCX1_HUMAN;.	V	149	ENSP00000304192:A149V;ENSP00000238570:A149V;ENSP00000396617:A149V	ENSP00000238570:A149V	A	+	2	0	0	PCNX	70498779	70498779	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	3.448000	0.52943	2.646000	0.89796	0.591000	0.81541	GCC	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.478	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	2.010000	-1.882139	0	0.110000	NM_014982		0	6	6	0	622	611	0		1	0		0	0	87	0	0	0.963140	9.905619e-03	0	0	0	13	0	6	622
GPR65	8477	broad.mit.edu	37	14	88477517	88477517	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr14:88477517C>T	ENST00000267549.3	+	2	884	c.326C>T	c.(325-327)gCc>gTc	p.A109V	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	109					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A109V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						ACCTGCATTGCCGTTGATCGG	0.428																																						ENST00000267549.3	1.000000	0.060000	0.240000	0.100000	0.150000	0.236279	0.150000	0.130000																										1	Substitution - Missense(1)	p.A109V(1)	central_nervous_system(1)	16						c.(325-327)gCc>gTc		G protein-coupled receptor 65							211.0	201.0	204.0					14																	88477517		2203	4300	6503	SO:0001583	missense	8477	0	0					g.chr14:88477517C>T	U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.326C>T	chr14.hg19:g.88477517C>T	ENSP00000267549:p.Ala109Val	0					RP11-300J18.2_ENST00000554433.1_RNA	p.A109V	NM_003608.3	NP_003599.2	1	2	3	2.002115	Q8IYL9	PSYR_HUMAN		2	884	+			O75819	Missense_Mutation	SNP	ENST00000267549.3	0	1	hg19	c.326C>T	CCDS9879.1	0	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300635	0.60195	.	.	ENSG00000140030	ENST00000267549	T	0.77620	-1.11	5.82	5.82	0.92795	5.820000	5.820000	0.927950	GPCR, rhodopsin-like superfamily (1);	0.229512	0.30584	N	0.009304	D	0.85961	0.5819	M	0.76170	2.325	0.53688	D	0.999978	D	0.54601	0.967	P	0.54759	0.76	D	0.86921	0.2067	10	0.87932	D	0	.	20.0966	0.97849	0.0:1.0:0.0:0.0	.	109	Q8IYL9	PSYR_HUMAN	V	109	ENSP00000267549:A109V	ENSP00000267549:A109V	A	+	2	0	0	GPR65	87547270	87547270	0.039000	0.19947	0.086000	0.20670	0.281000	0.26958	3.193000	0.50997	2.751000	0.94390	0.650000	0.86243	GCC	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.428	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4	0	0	1	2	2	2	2	0	0	0	0	243	243	243	243	1	2.010000	-2.306438	0	0.110000			0	8	9	0	1048	1033	0		1	0		0	0	243	0	0	0.988766	1.629494e-03	0	0	0	7	0	8	1048
GFER	2671	broad.mit.edu	37	16	2035947	2035947	+	Missense_Mutation	SNP	G	G	A	rs199541169		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr16:2035947G>A	ENST00000248114.6	+	3	542	c.536G>A	c.(535-537)cGc>cAc	p.R179H	GFER_ENST00000567719.1_Missense_Mutation_p.R104H|AC005606.14_ENST00000564438.1_lincRNA|GFER_ENST00000569451.1_3'UTR	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	179	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	GAAGTGAACCGCAAGCTGGGC	0.607																																						ENST00000248114.6	0.450000	0.080000	0.340000	0.140000	0.220000	0.244415	0.220000	0.210000																										0				5						c.(535-537)cGc>cAc		growth factor, augmenter of liver regeneration	Flavin adenine dinucleotide(DB03147)	G	HIS/ARG	0,4396		0,0,2198	94.0	90.0	91.0		536	1.1	1.0	16		91	2,8598	2.2+/-6.3	0,2,4298	no	missense	GFER	NM_005262.2	29	0,2,6496	AA,AG,GG		0.0233,0.0,0.0154	benign	179/206	2035947	2,12994	2198	4300	6498	SO:0001583	missense	2671	15	121396	46				g.chr16:2035947G>A	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.536G>A	chr16.hg19:g.2035947G>A	ENSP00000248114:p.Arg179His	0					AC005606.14_ENST00000564438.1_lincRNA|GFER_ENST00000569451.1_3'UTR|GFER_ENST00000567719.1_Missense_Mutation_p.R104H	p.R179H	NM_005262.2	NP_005253.3	0	1	1	1.990535	P55789	ALR_HUMAN		3	542	+			Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	0	1	hg19	c.536G>A	CCDS32368.1	0	.	.	.	.	.	.	.	.	.	.	g	14.92	2.680098	0.47886	0.0	2.33E-4	ENSG00000127554	ENST00000248114	T	0.55234	0.53	4.43	1.06	0.20224	4.430000	1.060000	0.202240	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.442657	0.21663	N	0.070988	T	0.54775	0.1879	M	0.89601	3.045	0.43304	D	0.995307	B;B	0.17667	0.023;0.01	B;B	0.13407	0.009;0.009	T	0.56038	-0.8045	10	0.66056	D	0.02	-13.2452	6.6271	0.22837	0.1669:0.0:0.6913:0.1418	.	105;179	Q9UQK8;P55789	.;ALR_HUMAN	H	179	ENSP00000248114:R179H	ENSP00000248114:R179H	R	+	2	0	0	GFER	1975948	1975948	0.135000	0.22499	0.986000	0.45419	0.823000	0.46562	0.436000	0.21526	0.420000	0.25954	0.511000	0.50034	CGC	0.103094		TCGA-IB-AAUT-01A-11D-A377-08	0.607	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2.010000	-2.375604	0	0.110000	NM_005262		0	5	5	0	427	419	0		1	0		0	0	48	0	0	0.935167	2.998877e-01	0	1	0	79	0	5	427
FOXN1	8456	broad.mit.edu	37	17	26861380	26861380	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr17:26861380G>A	ENST00000226247.2	+	6	988	c.959G>A	c.(958-960)cGg>cAg	p.R320Q	FOXN1_ENST00000579795.1_Missense_Mutation_p.R320Q	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	320					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R320Q(1)		endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					AATTCTGTCCGGCACAACCTA	0.577																																						ENST00000226247.2	1.000000	0.120000	0.530000	0.200000	0.320000	0.394351	0.320000	0.280000																										1	Substitution - Missense(1)	p.R320Q(1)	large_intestine(1)	19						c.(958-960)cGg>cAg		forkhead box N1							81.0	79.0	80.0					17																	26861380		2203	4300	6503	SO:0001583	missense	8456	0	0					g.chr17:26861380G>A	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.959G>A	chr17.hg19:g.26861380G>A	ENSP00000226247:p.Arg320Gln	0					FOXN1_ENST00000579795.1_Missense_Mutation_p.R320Q	p.R320Q	NM_003593.2	NP_003584.2	1	2	3	2.004325	O15353	FOXN1_HUMAN		6	988	+	Lung NSC(42;0.00431)		B2R9Q7|O15352	Missense_Mutation	SNP	ENST00000226247.2	0	1	hg19	c.959G>A	CCDS11232.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.679260	0.96774	.	.	ENSG00000109101	ENST00000226247	D	0.98060	-4.69	5.73	5.73	0.89815	5.730000	5.730000	0.898150	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.99225	4.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98166	1.0449	10	0.87932	D	0	.	19.8853	0.96910	0.0:0.0:1.0:0.0	.	320	O15353	FOXN1_HUMAN	Q	320	ENSP00000226247:R320Q	ENSP00000226247:R320Q	R	+	2	0	0	FOXN1	23885507	23885507	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.869000	0.99810	2.701000	0.92244	0.655000	0.94253	CGG	0.116318		TCGA-IB-AAUT-01A-11D-A377-08	0.577	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1	0	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	2.010000	-2.767441	1	0.110000			0	6	6	0	380	374	0		1	0		0	0	47	0	0	0.963538	0	0	0	0	1	0	6	380
DHRS13	147015	broad.mit.edu	37	17	27228119	27228119	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr17:27228119G>A	ENST00000378895.4	-	4	697	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	DHRS13_ENST00000426464.2_Missense_Mutation_p.R110W|DHRS13_ENST00000394901.3_Missense_Mutation_p.R141W|RP11-20B24.4_ENST00000580603.1_RNA|DHRS13_ENST00000581974.1_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	191			R -> Q (in dbSNP:rs2277666).			extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			AGCTCCTGCCGCCAGCCCACC	0.632																																						ENST00000378895.4	1.000000	0.090000	0.430000	0.150000	0.250000	0.332180	0.250000	0.210000																										0				9						c.(571-573)Cgg>Tgg		dehydrogenase/reductase (SDR family) member 13							56.0	63.0	61.0					17																	27228119		2203	4300	6503	SO:0001583	missense	147015	0	0					g.chr17:27228119G>A	BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.571C>T	chr17.hg19:g.27228119G>A	ENSP00000368173:p.Arg191Trp	0					RP11-20B24.4_ENST00000580603.1_RNA|RP11-20B24.4_ENST00000579187.1_RNA|DHRS13_ENST00000426464.2_Missense_Mutation_p.R110W|DHRS13_ENST00000581974.1_5'Flank|DHRS13_ENST00000394901.3_Missense_Mutation_p.R141W	p.R191W	NM_144683.3	NP_653284.2	1	2	3	2.004325	Q6UX07	DHR13_HUMAN	Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)	4	697	-	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Q96BH7	Missense_Mutation	SNP	ENST00000378895.4	0	1	hg19	c.571C>T	CCDS11246.2	0	.	.	.	.	.	.	.	.	.	.	G	18.06	3.538454	0.65085	.	.	ENSG00000167536	ENST00000378895;ENST00000394901;ENST00000426464	D;D;D	0.89617	-2.54;-2.54;-2.54	5.18	4.15	0.48705	5.180000	4.150000	0.487050	NAD(P)-binding domain (1);	1.760290	0.02250	N	0.066486	D	0.85531	0.5718	L	0.40543	1.245	0.24342	N	0.994955	D;D	0.62365	0.991;0.964	B;B	0.43123	0.409;0.232	T	0.75042	-0.3457	10	0.51188	T	0.08	.	5.2688	0.15613	0.0981:0.0:0.5511:0.3509	.	110;191	B4DJC5;Q6UX07	.;DHR13_HUMAN	W	191;141;110	ENSP00000368173:R191W;ENSP00000378361:R141W;ENSP00000412826:R110W	ENSP00000368173:R191W	R	-	1	2	2	DHRS13	24252245	24252245	0.994000	0.37717	0.968000	0.41197	0.978000	0.69477	2.452000	0.44961	2.406000	0.81754	0.462000	0.41574	CGG	0.116318		TCGA-IB-AAUT-01A-11D-A377-08	0.632	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255952.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	2.010000	-2.521009	1	0.110000	NM_144683		0	5	5	0	417	413	0		1	0		0	0	63	0	0	0.936319	1.112826e-01	0	0	0	39	0	5	417
KCNH4	23415	broad.mit.edu	37	17	40328179	40328179	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr17:40328179G>A	ENST00000264661.3	-	5	1054	c.722C>T	c.(721-723)gCg>gTg	p.A241V	KCNH4_ENST00000607371.1_Missense_Mutation_p.A241V	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	241					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GACGGTGACCGCAACGTAGAA	0.602																																					NSCLC(117;707 1703 2300 21308 31858)	ENST00000264661.3	1.000000	0.070000	0.370000	0.130000	0.210000	0.298453	0.210000	0.190000																										0				32						c.(721-723)gCg>gTg		potassium voltage-gated channel, subfamily H (eag-related), member 4							141.0	114.0	123.0					17																	40328179		2203	4300	6503	SO:0001583	missense	23415	0	0					g.chr17:40328179G>A	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.722C>T	chr17.hg19:g.40328179G>A	ENSP00000264661:p.Ala241Val	0					KCNH4_ENST00000607371.1_Missense_Mutation_p.A241V	p.A241V	NM_012285.2	NP_036417.1	1	2	3	2.004325	Q9UQ05	KCNH4_HUMAN		5	1054	-		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		Missense_Mutation	SNP	ENST00000264661.3	0	1	hg19	c.722C>T	CCDS11420.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.891215	0.97074	.	.	ENSG00000089558	ENST00000264661	D	0.97256	-4.31	5.45	5.45	0.79879	5.450000	5.450000	0.798790	.	0.000000	0.40554	N	0.001070	D	0.98454	0.9485	M	0.88450	2.955	0.80722	D	1	D	0.67145	0.996	P	0.58970	0.849	D	0.99170	1.0864	10	0.87932	D	0	.	19.4711	0.94963	0.0:0.0:1.0:0.0	.	241	Q9UQ05	KCNH4_HUMAN	V	241	ENSP00000264661:A241V	ENSP00000264661:A241V	A	-	2	0	0	KCNH4	37581705	37581705	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.611000	0.98342	2.840000	0.97914	0.655000	0.94253	GCG	0.116318		TCGA-IB-AAUT-01A-11D-A377-08	0.602	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	0	0	1	2	20	2	2	1	1	1	1	80	80	80	78	1	2.010000	-2.177124	0	0.110000	NM_012285		0	5	5	0	492	482	0		0			1	0	80	0	0	0.001474	0	0	0	0	0	0	5	492
DNAH2	146754	broad.mit.edu	37	17	7734509	7734509	+	Silent	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr17:7734509C>T	ENST00000572933.1	+	80	13796	c.12336C>T	c.(12334-12336)ggC>ggT	p.G4112G	DNAH2_ENST00000389173.2_Silent_p.G4112G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	4112					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGGCCTTTGGCCAGCACCCCA	0.527																																						ENST00000572933.1	1.000000	0.060000	0.230000	0.100000	0.140000	0.240170	0.140000	0.130000																										0				189						c.(12334-12336)ggC>ggT		dynein, axonemal, heavy chain 2							154.0	160.0	158.0					17																	7734509		2203	4300	6503	SO:0001819	synonymous_variant	146754	0	0					g.chr17:7734509C>T	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.12336C>T	chr17.hg19:g.7734509C>T		0					DNAH2_ENST00000389173.2_Silent_p.G4112G	p.G4112G			1	2	3	2.004325	Q9P225	DYH2_HUMAN		80	13796	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	0	1	hg19	c.12336C>T	CCDS32551.1	0																																																																																								0.116318		TCGA-IB-AAUT-01A-11D-A377-08	0.527	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	0	0	1	2	2	2	2	0	0	0	0	161	161	161	159	1	2.010000	-1.880188	0	0.110000	NM_020877		0	9	9	0	1188	1178	0		1	0		0	0	161	0	0	0.993981	0	0	0	0	1	0	9	1188
CACNA1G	8913	broad.mit.edu	37	17	48650204	48650204	+	Missense_Mutation	SNP	G	G	A	rs542038781		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr17:48650204G>A	ENST00000359106.5	+	6	1036	c.1036G>A	c.(1036-1038)Gcc>Acc	p.A346T	CACNA1G_ENST00000515165.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000507896.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000352832.5_Missense_Mutation_p.A346T|CACNA1G_ENST00000354983.4_Missense_Mutation_p.A346T|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000429973.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000505165.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000442258.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000507336.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000510115.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000358244.5_Missense_Mutation_p.A346T|CACNA1G_ENST00000416767.4_Missense_Mutation_p.A346T|CACNA1G_ENST00000510366.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000515411.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000514181.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000512389.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000515765.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000513964.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A346T|CACNA1G_ENST00000513689.2_Missense_Mutation_p.A346T	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	346					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGCCTGGATCGCCATCTTCCA	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17055	0.0		0.0	False		,,,				2504	0.0					ENST00000359106.5	0.730000	0.140000	0.550000	0.230000	0.370000	0.398045	0.370000	0.340000																										0				47						c.(1036-1038)Gcc>Acc		calcium channel, voltage-dependent, T type, alpha 1G subunit	Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						59.0	64.0	63.0					17																	48650204		2027	4158	6185	SO:0001583	missense	8913	1	120900	29				g.chr17:48650204G>A	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.1036G>A	chr17.hg19:g.48650204G>A	ENSP00000352011:p.Ala346Thr	0					CACNA1G_ENST00000515411.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000354983.4_Missense_Mutation_p.A346T|CACNA1G_ENST00000507896.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000513689.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000352832.5_Missense_Mutation_p.A346T|CACNA1G_ENST00000515765.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000429973.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000507336.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000505165.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000510115.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000512389.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000514181.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A346T|CACNA1G_ENST00000515165.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000416767.4_Missense_Mutation_p.A346T|CACNA1G_ENST00000510366.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000358244.5_Missense_Mutation_p.A346T|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A346T|CACNA1G_ENST00000442258.2_Missense_Mutation_p.A346T|CACNA1G_ENST00000513964.1_Missense_Mutation_p.A346T	p.A346T	NM_018896.4	NP_061496.2	0	1	1	1.994069	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)	6	1036	+	Breast(11;6.7e-17)		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	0	1	hg19	c.1036G>A	CCDS45730.1	0	.	.	.	.	.	.	.	.	.	.	g	35	5.424914	0.96131	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	5.82	5.82	0.92795	5.820000	5.820000	0.927950	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97399	0.9149	L	0.31664	0.95	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.992;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.993;1.0;1.0;0.998;0.998;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;P;D	0.97110	0.997;0.999;1.0;0.998;1.0;0.999;0.998;1.0;0.998;0.947;1.0;0.999;1.0;1.0;0.998;0.998;0.958;0.999;1.0;0.996;0.861;1.0;0.994;0.961;0.906;0.929	D	0.98459	1.0595	10	0.87932	D	0	.	20.0852	0.97797	0.0:0.0:1.0:0.0	.	346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346;346	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	T	346	ENSP00000353990:A346T;ENSP00000339302:A346T;ENSP00000392390:A346T;ENSP00000347078:A346T;ENSP00000409759:A346T;ENSP00000425522:A346T;ENSP00000426261:A346T;ENSP00000425451:A346T;ENSP00000422407:A346T;ENSP00000426814:A346T;ENSP00000427238:A346T;ENSP00000423112:A346T;ENSP00000420918:A346T;ENSP00000426172:A346T;ENSP00000423045:A346T;ENSP00000427173:A346T;ENSP00000426098:A346T;ENSP00000425698:A346T;ENSP00000426232:A346T;ENSP00000423317:A346T;ENSP00000350979:A346T;ENSP00000352011:A346T;ENSP00000414388:A346T;ENSP00000423155:A346T;ENSP00000422268:A346T;ENSP00000421518:A346T	ENSP00000339302:A346T	A	+	1	0	0	CACNA1G	46005203	46005203	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.408000	0.97327	2.756000	0.94617	0.561000	0.74099	GCC	0.103591		TCGA-IB-AAUT-01A-11D-A377-08	0.612	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	2.010000	-3.141457	1	0.110000	NM_018896		0	5	5	0	256	254	0		1			0	0	30	0	0	0.936869	0	0	0	0	0	0	5	256
CYP2F1	1572	broad.mit.edu	37	19	41626275	41626275	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr19:41626275C>T	ENST00000331105.2	+	4	430	c.358C>T	c.(358-360)Cga>Tga	p.R120*		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	120					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.R120*(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						CAGTGGGGATCGATGGAAGGT	0.562																																						ENST00000331105.2	1.000000	0.120000	0.500000	0.190000	0.290000	0.381463	0.290000	0.260000																										1	Substitution - Nonsense(1)	p.R120*(1)	large_intestine(1)	29						c.(358-360)Cga>Tga		cytochrome P450, family 2, subfamily F, polypeptide 1							97.0	92.0	94.0					19																	41626275		2203	4300	6503	SO:0001587	stop_gained	1572	0	0					g.chr19:41626275C>T	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.358C>T	chr19.hg19:g.41626275C>T	ENSP00000333534:p.Arg120*	0						p.R120*	NM_000774.3	NP_000765.2	1	2	3	2.013016	P24903	CP2F1_HUMAN		4	430	+			A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Nonsense_Mutation	SNP	ENST00000331105.2	0	1	hg19	c.358C>T	CCDS12572.1	0	.	.	.	.	.	.	.	.	.	.	C	13.18	2.158827	0.38119	.	.	ENSG00000197446	ENST00000331105	.	.	.	4.25	0.388	0.16264	4.250000	0.388000	0.162640	.	0.214943	0.38058	U	0.001821	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.2291	0.03992	0.3239:0.2949:0.2842:0.0969	.	.	.	.	X	120	.	ENSP00000333534:R120X	R	+	1	2	2	CYP2F1	46318115	46318115	0.000000	0.05858	0.189000	0.23252	0.189000	0.23516	-0.842000	0.04354	0.413000	0.25759	-0.335000	0.08231	CGA	0.118244		TCGA-IB-AAUT-01A-11D-A377-08	0.562	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2	0	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	2.010000	-2.694996	1	0.110000			0	7	7	0	495	489	0		1			0	0	84	0	0	0.979898	0	0	0	0	0	0	7	495
CLCN6	1185	broad.mit.edu	37	1	11883815	11883815	+	Missense_Mutation	SNP	G	G	A	rs199676414	byFrequency	TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr1:11883815G>A	ENST00000346436.6	+	7	557	c.505G>A	c.(505-507)Gta>Ata	p.V169I	CLCN6_ENST00000312413.6_Missense_Mutation_p.V169I|CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000376496.3_Missense_Mutation_p.V169I|CLCN6_ENST00000376487.3_Missense_Mutation_p.V147I	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	169					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGAATGGCGTAAAGGTGCC	0.552													G|||	2	0.000399361	0.0	0.0	5008	,	,		20245	0.002		0.0	False		,,,				2504	0.0					ENST00000346436.6	1.000000	0.100000	0.520000	0.180000	0.290000	0.378140	0.290000	0.250000																										0				36						c.(505-507)Gta>Ata		chloride channel, voltage-sensitive 6							128.0	110.0	116.0					1																	11883815		2203	4300	6503	SO:0001583	missense	1185	4	121412	38				g.chr1:11883815G>A	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.505G>A	chr1.hg19:g.11883815G>A	ENSP00000234488:p.Val169Ile	0					CLCN6_ENST00000376487.3_Missense_Mutation_p.V147I|CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000312413.6_Missense_Mutation_p.V169I|CLCN6_ENST00000376496.3_Missense_Mutation_p.V169I	p.V169I	NM_001286.3	NP_001277	1	2	3	2.010080	P51797	CLCN6_HUMAN		7	557	+	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	0	1	hg19	c.505G>A	CCDS138.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.13	3.555826	0.65425	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376487;ENST00000376496;ENST00000376490;ENST00000376491;ENST00000376492	D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47	5.97	5.97	0.96955	5.970000	5.970000	0.969550	Chloride channel, core (2);	0.053524	0.85682	D	0.000000	D	0.89100	0.6619	N	0.25647	0.755	0.58432	D	0.99999	B;B;P;P;B	0.48503	0.105;0.442;0.911;0.823;0.128	B;B;B;B;B	0.36989	0.016;0.098;0.238;0.181;0.027	D	0.87899	0.2689	10	0.21014	T	0.42	-32.7531	17.5798	0.87963	0.0:0.0:1.0:0.0	.	147;169;169;169;169	F8W9R3;P51797-3;P51797-4;P51797-2;P51797	.;.;.;.;CLCN6_HUMAN	I	169;169;147;169;169;169;169	ENSP00000308367:V169I;ENSP00000234488:V169I;ENSP00000365670:V147I;ENSP00000365679:V169I	ENSP00000308367:V169I	V	+	1	0	0	CLCN6	11806402	11806402	1.000000	0.71417	0.979000	0.43373	0.847000	0.48162	9.459000	0.97638	2.828000	0.97474	0.655000	0.94253	GTA	0.117282		TCGA-IB-AAUT-01A-11D-A377-08	0.552	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	2.010000	-2.923862	1	0.110000	NM_001286		0	5	5	0	359	357	0		1	0		0	0	46	0	0	0.937048	3.074063e-02	0	0	0	16	0	5	359
EPB41	2035	broad.mit.edu	37	1	29365900	29365900	+	Missense_Mutation	SNP	G	G	A	rs372946232		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr1:29365900G>A	ENST00000343067.4	+	11	1725	c.1598G>A	c.(1597-1599)cGt>cAt	p.R533H	EPB41_ENST00000349460.4_Missense_Mutation_p.R324H|EPB41_ENST00000373800.3_Missense_Mutation_p.R324H|EPB41_ENST00000373798.1_Missense_Mutation_p.R533H|EPB41_ENST00000347529.3_Missense_Mutation_p.R498H|EPB41_ENST00000373797.1_Missense_Mutation_p.R533H|EPB41_ENST00000398863.2_Missense_Mutation_p.R533H|EPB41_ENST00000356093.2_Missense_Mutation_p.R533H	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	533	Hydrophilic.				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		CACTTCGAGCGTACAGCAAGT	0.463																																						ENST00000343067.4	1.000000	0.090000	0.440000	0.150000	0.250000	0.338874	0.250000	0.210000																										0				14						c.(1597-1599)cGt>cAt		erythrocyte membrane protein band 4.1		G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	88.0	89.0	89.0		1598,1598,971,971,971,1493	4.8	1.0	1		89	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	EPB41	NM_001166005.1,NM_001166006.1,NM_001166007.1,NM_004437.3,NM_203342.2,NM_203343.2	29,29,29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	533/865,533/721,324/602,324/589,324/642,498/776	29365900	1,13005	2203	4300	6503	SO:0001583	missense	2035	3	121412	37				g.chr1:29365900G>A	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.1598G>A	chr1.hg19:g.29365900G>A	ENSP00000345259:p.Arg533His	0					EPB41_ENST00000398863.2_Missense_Mutation_p.R533H|EPB41_ENST00000373797.1_Missense_Mutation_p.R533H|EPB41_ENST00000349460.4_Missense_Mutation_p.R324H|EPB41_ENST00000356093.2_Missense_Mutation_p.R533H|EPB41_ENST00000347529.3_Missense_Mutation_p.R498H|EPB41_ENST00000373798.1_Missense_Mutation_p.R533H|EPB41_ENST00000373800.3_Missense_Mutation_p.R324H	p.R533H	NM_001166005.1	NP_001159477.1	1	2	3	2.006758	P11171	41_HUMAN		11	1725	+		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	0	1	hg19	c.1598G>A	CCDS53288.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.271858	0.95429	0.0	1.16E-4	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000349460;ENST00000373800;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.69	4.77	0.60923	5.690000	4.770000	0.609230	FERM adjacent (FA) (1);	0.000000	0.85682	D	0.000000	D	0.97958	0.9328	M	0.84082	2.675	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.997;0.998;0.998;0.997;0.995;0.993	D	0.98254	1.0495	10	0.87932	D	0	.	14.1812	0.65577	0.0731:0.0:0.9269:0.0	.	427;533;533;533;533;533;550;498;324;324	E9PEX0;E9PEW9;C9JTS2;P11171;P11171-2;P11171-7;Q59F12;P11171-5;P11171-4;P11171-3	.;.;.;41_HUMAN;.;.;.;.;.;.	H	550;533;533;533;427;533;324;324;498;533;533	ENSP00000345259:R533H;ENSP00000348397:R533H;ENSP00000381839:R533H;ENSP00000317597:R324H;ENSP00000362906:R324H;ENSP00000290100:R498H;ENSP00000362904:R533H;ENSP00000362903:R533H	ENSP00000345259:R533H	R	+	2	0	0	EPB41	29238487	29238487	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.013000	0.88655	2.687000	0.91594	0.650000	0.86243	CGT	0.116801		TCGA-IB-AAUT-01A-11D-A377-08	0.463	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	0	0	1	2	22	3	2	1	1	1	1	59	59	59	59	1	2.010000	-2.800977	1	0.110000	NM_203342		0	5	5	0	415	407	0		0	0		1	0	59	0	0	0.000523	1.672003e-03	0	0	0	15	0	5	415
USH2A	7399	broad.mit.edu	37	1	216011345	216011345	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr1:216011345C>T	ENST00000307340.3	-	47	9745	c.9359G>A	c.(9358-9360)gGc>gAc	p.G3120D	USH2A_ENST00000366943.2_Missense_Mutation_p.G3120D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3120	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAAGTGATGCCACGAATTGT	0.388										HNSCC(13;0.011)																												ENST00000307340.3	1.000000	0.120000	1.000000	0.190000	0.290000	0.415644	0.290000	0.250000																										0				527						c.(9358-9360)gGc>gAc		Usher syndrome 2A (autosomal recessive, mild)							226.0	203.0	210.0					1																	216011345		2203	4300	6503	SO:0001583	missense	7399	0	0					g.chr1:216011345C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9359G>A	chr1.hg19:g.216011345C>T	ENSP00000305941:p.Gly3120Asp	0	HNSCC(13;0.011)				USH2A_ENST00000366943.2_Missense_Mutation_p.G3120D	p.G3120D	NM_206933.2	NP_996816	1	2	3	2.033065	O75445	USH2A_HUMAN		47	9745	-			Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	0	1	hg19	c.9359G>A	CCDS31025.1	0	.	.	.	.	.	.	.	.	.	.	C	0.050	-1.254532	0.01457	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52983	0.64;0.64	5.01	-2.38	0.06622	5.010000	-2.380000	0.066220	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.448360	0.04862	N	0.444315	T	0.29190	0.0726	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16482	-1.0401	10	0.12103	T	0.63	.	7.0786	0.25219	0.1833:0.544:0.0:0.2727	.	3120	O75445	USH2A_HUMAN	D	3120	ENSP00000305941:G3120D;ENSP00000355910:G3120D	ENSP00000305941:G3120D	G	-	2	0	0	USH2A	214077968	214077968	0.000000	0.05858	0.006000	0.13384	0.043000	0.13939	0.059000	0.14322	-0.217000	0.10033	-0.302000	0.09304	GGC	0.122548		TCGA-IB-AAUT-01A-11D-A377-08	0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	2.010000	-2.176526	0	0.110000	NM_007123		0	8	8	0	568	565	0		1			0	0	76	0	0	0.989220	0	0	0	0	0	0	8	568
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371085.3	1.000000	0.480000	1.000000	0.640000	0.850000	0.832095	0.850000	1.000000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		88	Substitution - Missense(88)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)	441						c.(601-603)cGt>cAt		GNAS complex locus							80.0	78.0	79.0					20																	57484421		2203	4300	6503	SO:0001583	missense	2778	10	121412	32				g.chr20:57484421G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	chr20.hg19:g.57484421G>A	ENSP00000360126:p.Arg201His	0	TSP Lung(22;0.16)				GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H	p.R201H	NM_000516.4	NP_000507.1	1	2	3	2.017628	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	8	1026	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	1	1	hg19	c.602G>A	CCDS13472.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	5.530000	5.530000	0.826870	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	0	GNAS	56917816	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT	0.119204		TCGA-IB-AAUT-01A-11D-A377-08	0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	1	0	1	2	2	2	2	0	0	0	0	102	102	102	100	1	2.010000	-2.728346	1	0.110000	NM_000516		0	15	15	0	330	325	0		1	1	1	0	0	102	457	0	0.999866	1	9.999953e-01	95	23	2663	483	15	330
SYCP2	10388	broad.mit.edu	37	20	58443596	58443596	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr20:58443596C>G	ENST00000357552.3	-	38	4085	c.3860G>C	c.(3859-3861)aGa>aCa	p.R1287T	SYCP2_ENST00000371001.2_Missense_Mutation_p.R1287T			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1287					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TATATATATTCTTTTGCGACT	0.323																																						ENST00000357552.3	1.000000	0.080000	0.490000	0.140000	0.240000	0.351777	0.240000	0.200000																										0				53						c.(3859-3861)aGa>aCa		synaptonemal complex protein 2							87.0	86.0	86.0					20																	58443596		2203	4299	6502	SO:0001583	missense	10388	0	0					g.chr20:58443596C>G	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3860G>C	chr20.hg19:g.58443596C>G	ENSP00000350162:p.Arg1287Thr	0					SYCP2_ENST00000371001.2_Missense_Mutation_p.R1287T	p.R1287T			1	2	3	2.017628	Q9BX26	SYCP2_HUMAN	BRCA - Breast invasive adenocarcinoma(7;1.19e-09)	38	4085	-	all_lung(29;0.00344)		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	0	1	hg19	c.3860G>C	CCDS13482.1	0	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605911	0.46527	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.43294	0.95;0.95	5.77	4.83	0.62350	5.770000	4.830000	0.623500	.	0.000000	0.53938	D	0.000049	T	0.60261	0.2255	M	0.66939	2.045	0.30863	N	0.733263	D	0.76494	0.999	D	0.74023	0.982	T	0.65668	-0.6112	10	0.59425	D	0.04	-7.4813	11.8305	0.52293	0.0:0.9185:0.0:0.0815	.	1287	Q9BX26	SYCP2_HUMAN	T	1287	ENSP00000360040:R1287T;ENSP00000350162:R1287T	ENSP00000350162:R1287T	R	-	2	0	0	SYCP2	57876991	57876991	0.985000	0.35326	0.874000	0.34290	0.211000	0.24417	1.642000	0.37207	1.450000	0.47717	0.591000	0.81541	AGA	0.119204		TCGA-IB-AAUT-01A-11D-A377-08	0.323	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	0	0	1	2	2	2	2	0	0	0	0	112	112	112	111	1	2.010000	-4.747903	1	0.110000	NM_014258		0	5	5	0	442	432	0		1	0		0	0	112	0	0	0.933701	2.069475e-04	0	0	0	2	0	5	442
TTN	7273	broad.mit.edu	37	2	179414500	179414500	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr2:179414500G>A	ENST00000591111.1	-	288	87250	c.87026C>T	c.(87025-87027)gCt>gTt	p.A29009V	TTN_ENST00000589042.1_Missense_Mutation_p.A30650V|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A21710V|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A21777V|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A28082V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A21585V			Q8WZ42	TITIN_HUMAN	titin	29009	Fibronectin type-III 111. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTATGGGAGCACAACCGTC	0.448																																						ENST00000591111.1	1.000000	0.090000	0.430000	0.160000	0.250000	0.334654	0.250000	0.220000																										0				1448						c.(87025-87027)gCt>gTt		titin							136.0	123.0	127.0					2																	179414500		1897	4115	6012	SO:0001583	missense	7273	0	0					g.chr2:179414500G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.87026C>T	chr2.hg19:g.179414500G>A	ENSP00000465570:p.Ala29009Val	0					RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A28082V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A21585V|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A30650V|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A21777V|TTN_ENST00000359218.5_Missense_Mutation_p.A21710V|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.A29009V			1	2	3	2.002200	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	288	87250	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.87026C>T		0	.	.	.	.	.	.	.	.	.	.	G	25.6	4.660003	0.88154	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.32	5.32	0.75619	5.320000	5.320000	0.756190	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68952	0.3057	M	0.81802	2.56	0.51482	D	0.999925	P;P;P;P	0.44380	0.581;0.581;0.581;0.834	B;B;B;P	0.50896	0.29;0.29;0.442;0.653	T	0.73652	-0.3915	9	0.87932	D	0	.	19.3786	0.94521	0.0:0.0:1.0:0.0	.	21585;21710;21777;29009	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	28082;21585;21777;21710;21582	ENSP00000343764:A28082V;ENSP00000434586:A21585V;ENSP00000340554:A21777V;ENSP00000352154:A21710V	ENSP00000340554:A21777V	A	-	2	0	0	TTN	179122746	179122746	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.813000	0.99286	2.648000	0.89879	0.563000	0.77884	GCT	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	2.010000	-3.016174	1	0.110000	NM_133378		0	5	5	0	402	397	0		1	0		0	0	70	0	0	0.935859	0	0	0	0	1	0	5	402
ZNF513	130557	broad.mit.edu	37	2	27600645	27600645	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr2:27600645G>A	ENST00000323703.6	-	4	1591	c.1393C>T	c.(1393-1395)Cgg>Tgg	p.R465W	ZNF513_ENST00000407879.1_Missense_Mutation_p.R403W|ZNF513_ENST00000491924.1_5'UTR	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	465					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGTGTGCCGCAGCATGTGA	0.582																																						ENST00000323703.6	1.000000	0.050000	0.230000	0.090000	0.140000	0.226619	0.140000	0.130000																										0				17						c.(1393-1395)Cgg>Tgg		zinc finger protein 513							162.0	158.0	160.0					2																	27600645		2203	4300	6503	SO:0001583	missense	130557	0	0					g.chr2:27600645G>A	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1393C>T	chr2.hg19:g.27600645G>A	ENSP00000318373:p.Arg465Trp	0					ZNF513_ENST00000407879.1_Missense_Mutation_p.R403W|ZNF513_ENST00000491924.1_5'UTR	p.R465W	NM_144631.5	NP_653232.3	1	2	3	2.002200	Q8N8E2	ZN513_HUMAN		4	1591	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	ENST00000323703.6	0	1	hg19	c.1393C>T	CCDS1751.1	0	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540370	0.27563	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.18502	2.21;2.21	4.77	3.82	0.43975	4.770000	3.820000	0.439750	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40640	N	0.001058	T	0.40171	0.1106	M	0.70595	2.14	0.39759	D	0.972004	D	0.89917	1.0	D	0.83275	0.996	T	0.40776	-0.9545	10	0.87932	D	0	-7.6818	14.0998	0.65046	0.0:0.0:0.8392:0.1608	.	465	Q8N8E2	ZN513_HUMAN	W	465;403	ENSP00000318373:R465W;ENSP00000384874:R403W	ENSP00000318373:R465W	R	-	1	2	2	ZNF513	27454149	27454149	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	4.501000	0.60393	2.490000	0.84030	0.655000	0.94253	CGG	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.582	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	0	0	1	2	2	2	2	0	0	0	0	148	148	148	146	1	2.010000	-1.976003	0	0.110000	NM_144631		0	7	7	0	1001	995	0		1	0		0	0	148	0	0	0.980045	5.080265e-02	0	1	0	43	0	7	1001
OTX1	5013	broad.mit.edu	37	2	63280157	63280157	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr2:63280157G>A	ENST00000282549.2	+	3	308	c.32G>A	c.(31-33)gGc>gAc	p.G11D	OTX1_ENST00000366671.3_Missense_Mutation_p.G11D	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	11					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					CCCCCATACGGCATGAACGGG	0.697																																						ENST00000282549.2	1.000000	0.080000	0.400000	0.140000	0.240000	0.318183	0.240000	0.200000																										0				20						c.(31-33)gGc>gAc		orthodenticle homeobox 1							69.0	81.0	77.0					2																	63280157		2203	4299	6502	SO:0001583	missense	5013	0	0					g.chr2:63280157G>A		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.32G>A	chr2.hg19:g.63280157G>A	ENSP00000282549:p.Gly11Asp	0					OTX1_ENST00000366671.3_Missense_Mutation_p.G11D	p.G11D	NM_014562.3	NP_055377.1	1	2	3	2.002200	P32242	OTX1_HUMAN		3	308	+	Lung NSC(7;0.121)|all_lung(7;0.211)		A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	ENST00000282549.2	0	1	hg19	c.32G>A	CCDS1873.1	0	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977675	0.74360	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.91011	-2.77;-2.77	5.5	5.5	0.81552	5.500000	5.500000	0.815520	.	0.059634	0.64402	D	0.000003	D	0.93344	0.7878	L	0.56769	1.78	0.58432	D	0.999995	D	0.57257	0.979	P	0.58130	0.833	D	0.93676	0.6994	10	0.66056	D	0.02	.	18.1537	0.89684	0.0:0.0:1.0:0.0	.	11	P32242	OTX1_HUMAN	D	11	ENSP00000355631:G11D;ENSP00000282549:G11D	ENSP00000282549:G11D	G	+	2	0	0	OTX1	63133661	63133661	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.988000	0.63863	2.596000	0.87737	0.561000	0.74099	GGC	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.697	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1	0	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	2.010000	-2.182224	0	0.110000			0	5	5	0	433	424	0		1			0	0	38	0	0	0.934411	0	0	0	0	0	0	5	433
FASTKD2	22868	broad.mit.edu	37	2	207631976	207631976	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr2:207631976G>A	ENST00000236980.6	+	2	907	c.559G>A	c.(559-561)Gca>Aca	p.A187T	MDH1B_ENST00000454776.2_5'Flank|MDH1B_ENST00000449792.1_5'Flank|MDH1B_ENST00000392214.2_5'Flank|MDH1B_ENST00000374412.3_5'Flank|FASTKD2_ENST00000403094.3_Missense_Mutation_p.A187T|FASTKD2_ENST00000402774.3_Missense_Mutation_p.A187T	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	187					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		CTATTTCACAGCAATGTGGAC	0.408																																						ENST00000236980.6	1.000000	0.050000	0.230000	0.080000	0.130000	0.225718	0.130000	0.130000																										0				21						c.(559-561)Gca>Aca		FAST kinase domains 2							120.0	119.0	119.0					2																	207631976		2203	4300	6503	SO:0001583	missense	22868	0	0					g.chr2:207631976G>A	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.559G>A	chr2.hg19:g.207631976G>A	ENSP00000236980:p.Ala187Thr	0					FASTKD2_ENST00000402774.3_Missense_Mutation_p.A187T|FASTKD2_ENST00000403094.3_Missense_Mutation_p.A187T|MDH1B_ENST00000392214.2_5'Flank|MDH1B_ENST00000374412.3_5'Flank|MDH1B_ENST00000454776.2_5'Flank|MDH1B_ENST00000449792.1_5'Flank	p.A187T	NM_014929.3	NP_055744.2	1	2	3	2.002200	Q9NYY8	FAKD2_HUMAN		2	907	+			Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	0	1	hg19	c.559G>A	CCDS2371.1	0	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470894	0.63625	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.15372	2.43;2.43;2.43	5.31	3.49	0.39957	5.310000	3.490000	0.399570	.	0.429898	0.24048	N	0.042038	T	0.28764	0.0713	L	0.54323	1.7	0.09310	N	1	D;B	0.76494	0.999;0.349	D;B	0.65140	0.932;0.056	T	0.03818	-1.1001	10	0.34782	T	0.22	-3.9259	7.217	0.25965	0.3732:0.0:0.6268:0.0	.	187;187	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	T	187	ENSP00000236980:A187T;ENSP00000385990:A187T;ENSP00000384929:A187T	ENSP00000236980:A187T	A	+	1	0	0	FASTKD2	207340221	207340221	0.008000	0.16893	1.000000	0.80357	0.996000	0.88848	0.848000	0.27710	1.230000	0.43646	0.561000	0.74099	GCA	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.408	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	0	0	1	2	2	2	2	0	0	0	0	164	164	164	164	1	2.010000	-2.628881	1	0.110000	NM_014929		0	6	6	0	881	876	0		1	0		0	0	164	0	0	0.964409	2.252563e-02	0	0	0	28	0	6	881
TACC3	10460	broad.mit.edu	37	4	1725247	1725247	+	Silent	SNP	G	G	A	rs142473170		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr4:1725247G>A	ENST00000313288.4	+	2	205	c.99G>A	c.(97-99)tcG>tcA	p.S33S	TMEM129_ENST00000536901.1_5'Flank|TMEM129_ENST00000382936.3_5'Flank|TMEM129_ENST00000303277.2_5'Flank	NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	33					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CCGGAAGATCGTCTGTTCTTC	0.448													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23238	0.0		0.0	False		,,,				2504	0.0				Ovarian(120;482 2294 11894 35824)	ENST00000313288.4	1.000000	0.180000	0.830000	0.310000	0.500000	0.551734	0.500000	0.430000																										0				25						c.(97-99)tcG>tcA		transforming, acidic coiled-coil containing protein 3		G		3,4403	6.2+/-15.9	0,3,2200	71.0	68.0	69.0		99	-10.7	0.0	4	dbSNP_134	69	0,8596		0,0,4298	no	coding-synonymous	TACC3	NM_006342.1		0,3,6498	AA,AG,GG		0.0,0.0681,0.0231		33/839	1725247	3,12999	2203	4298	6501	SO:0001819	synonymous_variant	10460	50	121410	46				g.chr4:1725247G>A	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.99G>A	chr4.hg19:g.1725247G>A		0					TMEM129_ENST00000382936.3_5'Flank|TMEM129_ENST00000303277.2_5'Flank|TMEM129_ENST00000536901.1_5'Flank	p.S33S	NM_006342.2	NP_006333.1	1	2	3	2.001635	Q9Y6A5	TACC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)	2	205	+		Breast(71;0.212)|all_epithelial(65;0.241)	Q2NKK4|Q3KQS5|Q9UMQ1	Silent	SNP	ENST00000313288.4	0	1	hg19	c.99G>A	CCDS3352.1	0																																																																																								0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.448	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2.010000	-3.243176	1	0.110000			0	5	5	0	202	199	0		1	0		0	0	48	0	0	0.935888	5.684933e-02	0	0	0	13	0	5	202
RHOH	399	broad.mit.edu	37	4	40245187	40245187	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr4:40245187G>A	ENST00000381799.5	+	3	905	c.181G>A	c.(181-183)Ggc>Agc	p.G61S	RHOH_ENST00000505618.1_Missense_Mutation_p.G61S	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	Q15669	RHOH_HUMAN	ras homolog family member H	61					mast cell activation (GO:0045576)|negative regulation of catalytic activity (GO:0043086)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of phosphorylation (GO:0042326)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase inhibitor activity (GO:0005095)|kinase inhibitor activity (GO:0019210)|Rho GTPase binding (GO:0017048)			kidney(1)|large_intestine(3)|lung(7)|ovary(1)	12						GGACACAGCCGGCAATGACGC	0.582																																						ENST00000381799.5	1.000000	0.140000	0.670000	0.250000	0.400000	0.465335	0.400000	0.350000																										0				12						c.(181-183)Ggc>Agc		ras homolog family member H							94.0	86.0	89.0					4																	40245187		2203	4300	6503	SO:0001583	missense	399	0	0					g.chr4:40245187G>A	Z35227	CCDS3458.1	4p13	2014-09-17	2012-02-27	2004-03-24	ENSG00000168421	ENSG00000168421			686	protein-coding gene	gene with protein product		602037	"""ras homolog gene family, member H"""	ARHH		7784061	Standard	NM_001278359		Approved	RhoH, TTF	uc003guz.2	Q15669	OTTHUMG00000099373	ENST00000381799.5:c.181G>A	chr4.hg19:g.40245187G>A	ENSP00000371219:p.Gly61Ser	0					RHOH_ENST00000505618.1_Missense_Mutation_p.G61S	p.G61S	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	1	2	3	2.001635	Q15669	RHOH_HUMAN		3	905	+				Missense_Mutation	SNP	ENST00000381799.5	0	1	hg19	c.181G>A	CCDS3458.1	0	.	.	.	.	.	.	.	.	.	.	g	28.3	4.906906	0.92107	.	.	ENSG00000168421	ENST00000505618;ENST00000507851;ENST00000503941;ENST00000381799	D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24	5.65	5.65	0.86999	5.650000	5.650000	0.869990	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.98099	0.9373	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98994	1.0809	10	0.87932	D	0	.	19.7124	0.96100	0.0:0.0:1.0:0.0	.	61	Q15669	RHOH_HUMAN	S	61	ENSP00000425010:G61S;ENSP00000423384:G61S;ENSP00000426439:G61S;ENSP00000371219:G61S	ENSP00000371219:G61S	G	+	1	0	0	RHOH	39921582	39921582	1.000000	0.71417	0.943000	0.38184	0.617000	0.37484	9.476000	0.97823	2.655000	0.90218	0.591000	0.81541	GGC	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.582	RHOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216820.3	0	0	1	2	2	2	2	0	0	0	0	41	41	41	39	1	2.010000	-3.087691	1	0.110000	NM_004310		0	5	5	0	254	252	0		1	0		0	0	41	0	0	0.936864	1.181472e-01	0	0	0	25	0	5	254
TMPRSS11D	9407	broad.mit.edu	37	4	68688126	68688126	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr4:68688126G>A	ENST00000283916.6	-	10	1284	c.1186C>T	c.(1186-1188)Ccg>Tcg	p.P396S	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.P279S	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	396	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGCTTATCCGGCAGGCCACAC	0.502																																						ENST00000283916.6	1.000000	0.070000	0.280000	0.110000	0.170000	0.255680	0.170000	0.150000																										0				23						c.(1186-1188)Ccg>Tcg		transmembrane protease, serine 11D							144.0	127.0	133.0					4																	68688126		2203	4300	6503	SO:0001583	missense	9407	0	0					g.chr4:68688126G>A	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.1186C>T	chr4.hg19:g.68688126G>A	ENSP00000283916:p.Pro396Ser	0					TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.P279S|UBA6-AS1_ENST00000500538.2_RNA	p.P396S	NM_004262.2	NP_004253.1	1	2	3	2.001635	O60235	TM11D_HUMAN		10	1284	-			Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	0	1	hg19	c.1186C>T	CCDS3518.1	0	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078916	0.36662	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	D;D	0.88896	-2.44;-2.44	5.78	4.04	0.47022	5.780000	4.040000	0.470220	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.119022	0.38217	N	0.001771	D	0.86049	0.5840	L	0.38733	1.17	0.09310	N	1	P	0.45078	0.85	P	0.44696	0.458	T	0.78797	-0.2063	10	0.59425	D	0.04	.	14.5301	0.67920	0.0:0.4672:0.5328:0.0	.	396	O60235	TM11D_HUMAN	S	396;279	ENSP00000283916:P396S;ENSP00000442045:P279S	ENSP00000283916:P396S	P	-	1	0	0	TMPRSS11D	68370721	68370721	0.004000	0.15560	0.806000	0.32338	0.005000	0.04900	0.481000	0.22260	0.756000	0.33013	0.650000	0.86243	CCG	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.502	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	0	0	1	2	2	2	2	0	0	0	0	139	139	139	138	1	2.010000	-2.192850	0	0.110000	NM_004262		0	7	7	0	815	809	0		1			0	0	139	0	0	0.980123	0	0	0	0	0	0	7	815
SEC24B	10427	broad.mit.edu	37	4	110447472	110447472	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr4:110447472C>T	ENST00000265175.5	+	17	2937	c.2882C>T	c.(2881-2883)gCg>gTg	p.A961V	SEC24B_ENST00000504968.2_Missense_Mutation_p.A991V|SEC24B_ENST00000399100.2_Missense_Mutation_p.A926V	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	961					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		GCTGGATTTGCGGTGCAGTTG	0.363																																						ENST00000265175.5	1.000000	0.050000	0.260000	0.090000	0.150000	0.238828	0.150000	0.130000																										0				36						c.(2881-2883)gCg>gTg		SEC24 family member B							174.0	158.0	163.0					4																	110447472		1862	4089	5951	SO:0001583	missense	10427	3	120812	36				g.chr4:110447472C>T	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.2882C>T	chr4.hg19:g.110447472C>T	ENSP00000265175:p.Ala961Val	0					SEC24B_ENST00000504968.2_Missense_Mutation_p.A991V|SEC24B_ENST00000399100.2_Missense_Mutation_p.A926V	p.A961V	NM_006323.2	NP_006314.2	1	2	3	2.001635	O95487	SC24B_HUMAN		17	2937	+		Hepatocellular(203;0.217)	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	0	1	hg19	c.2882C>T	CCDS47124.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.421208	0.96111	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.77098	-1.07;-1.07;-1.07	5.3	5.3	0.74995	5.300000	5.300000	0.749950	Sec23/Sec24 beta-sandwich (1);	0.049795	0.85682	D	0.000000	D	0.84397	0.5463	L	0.46567	1.45	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.66716	0.946;0.942;0.946;0.911;0.946	T	0.82989	-0.0183	10	0.39692	T	0.17	-20.8388	19.3486	0.94374	0.0:1.0:0.0:0.0	.	875;560;991;926;961	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	V	991;926;961	ENSP00000428564:A991V;ENSP00000382051:A926V;ENSP00000265175:A961V	ENSP00000265175:A961V	A	+	2	0	0	SEC24B	110666921	110666921	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.818000	0.86416	2.644000	0.89710	0.655000	0.94253	GCG	0.115835		TCGA-IB-AAUT-01A-11D-A377-08	0.363	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2	0	0	1	2	17	4	2	1	1	1	1	140	140	140	140	1	2.010000	-2.385342	0	0.110000			0	5	5	0	683	676	0		0	0		1	0	140	0	0	0.007445	4.103564e-03	0	0	0	63	0	5	683
ADAMTS19	171019	broad.mit.edu	37	5	128983576	128983576	+	Missense_Mutation	SNP	G	G	A	rs373980646		TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr5:128983576G>A	ENST00000274487.4	+	12	2118	c.1973G>A	c.(1972-1974)cGc>cAc	p.R658H	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	658	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGTCGAGAGCGCAAATGTCCT	0.507																																						ENST00000274487.4	1.000000	0.060000	0.290000	0.100000	0.170000	0.250220	0.170000	0.150000																										0				91						c.(1972-1974)cGc>cAc		ADAM metallopeptidase with thrombospondin type 1 motif, 19		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	123.0	121.0	122.0		1973	4.6	1.0	5		122	0,8600		0,0,4300	no	missense	ADAMTS19	NM_133638.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	658/1208	128983576	1,13005	2203	4300	6503	SO:0001583	missense	171019	3	121412	41				g.chr5:128983576G>A	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1973G>A	chr5.hg19:g.128983576G>A	ENSP00000274487:p.Arg658His	0					CTC-575N7.1_ENST00000503616.1_RNA	p.R658H	NM_133638.3	NP_598377.3	1	2	3	2.000859	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	12	2118	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)		Missense_Mutation	SNP	ENST00000274487.4	0	1	hg19	c.1973G>A	CCDS4146.1	0	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663990	0.88251	2.27E-4	0.0	ENSG00000145808	ENST00000274487	T	0.65364	-0.15	4.58	4.58	0.56647	4.580000	4.580000	0.566470	.	0.000000	0.64402	D	0.000002	D	0.85613	0.5737	H	0.95043	3.615	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.89721	0.3919	9	.	.	.	.	18.693	0.91590	0.0:0.0:1.0:0.0	.	658	Q8TE59	ATS19_HUMAN	H	658	ENSP00000274487:R658H	.	R	+	2	0	0	ADAMTS19	129011475	129011475	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.292000	0.78731	2.831000	0.97527	0.650000	0.86243	CGC	0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.507	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	0	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	2.010000	-1.993281	0	0.110000	NM_133638		0	5	5	0	605	594	0		1			0	0	74	0	0	0.934737	0	0	0	0	0	0	5	605
PCDHA3	56145	broad.mit.edu	37	5	140181599	140181599	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr5:140181599G>C	ENST00000522353.2	+	1	817	c.817G>C	c.(817-819)Gta>Cta	p.V273L	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.V273L|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	273	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGATGAAGGAGTAAATAAGGA	0.418																																						ENST00000522353.2	1.000000	0.160000	0.580000	0.240000	0.370000	0.432630	0.370000	0.330000																										0				95						c.(817-819)Gta>Cta		protocadherin alpha 3							83.0	79.0	80.0					5																	140181599		2203	4300	6503	SO:0001583	missense	56145	0	0					g.chr5:140181599G>C	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.817G>C	chr5.hg19:g.140181599G>C	ENSP00000429808:p.Val273Leu	0					PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.V273L|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron	p.V273L	NM_018906.2	NP_061729.1	1	2	3	2.000859	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	817	+			O75286	Missense_Mutation	SNP	ENST00000522353.2	0	1	hg19	c.817G>C	CCDS54915.1	0	.	.	.	.	.	.	.	.	.	.	g	0.019	-1.464418	0.01053	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.49432	0.78;0.78	4.79	-3.24	0.05094	4.790000	-3.240000	0.050940	Cadherin (4);Cadherin-like (1);	0.722810	0.11072	U	0.602758	T	0.20981	0.0505	N	0.11106	0.095	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.17979	0.004;0.02	T	0.24297	-1.0164	10	0.17369	T	0.5	.	5.119	0.14851	0.5648:0.0:0.1703:0.2649	.	273;273	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	L	273	ENSP00000429808:V273L;ENSP00000434086:V273L	ENSP00000429808:V273L	V	+	1	0	0	PCDHA3	140161783	140161783	0.000000	0.05858	0.924000	0.36721	0.764000	0.43329	-2.774000	0.00777	-0.298000	0.08921	0.467000	0.42956	GTA	0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.418	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	0	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	2.010000	-6.971346	1	0.110000	NM_018906		0	7	7	0	371	366	0		1	0		0	0	79	0	0	0.979900	0	0	0	0	1	0	7	371
TMEM215	401498	broad.mit.edu	37	9	32784414	32784414	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr9:32784414G>A	ENST00000342743.5	+	2	598	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	78						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CTGTGGGTCCGCAAATTGCCC	0.597																																						ENST00000342743.5	1.000000	0.080000	0.400000	0.150000	0.240000	0.315206	0.240000	0.210000																										0				12						c.(232-234)cGc>cAc		transmembrane protein 215							85.0	76.0	79.0					9																	32784414		2203	4300	6503	SO:0001583	missense	401498	0	0					g.chr9:32784414G>A		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.233G>A	chr9.hg19:g.32784414G>A	ENSP00000345468:p.Arg78His	0						p.R78H	NM_212558.2	NP_997723.2	1	2	3	1.999301	Q68D42	TM215_HUMAN		2	598	+			Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	0	1	hg19	c.233G>A	CCDS6530.1	0	.	.	.	.	.	.	.	.	.	.	G	8.409	0.843700	0.16963	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.18	4.28	0.50868	5.180000	4.280000	0.508680	.	0.113770	0.38326	N	0.001736	T	0.31040	0.0784	N	0.19112	0.55	0.30856	N	0.734062	B	0.25169	0.119	B	0.17433	0.018	T	0.31530	-0.9940	9	0.56958	D	0.05	-16.3167	9.7196	0.40295	0.0963:0.0:0.9037:0.0	.	78	Q68D42	TM215_HUMAN	H	78	.	ENSP00000345468:R78H	R	+	2	0	0	TMEM215	32774414	32774414	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	3.258000	0.51507	1.184000	0.42957	-0.258000	0.10820	CGC	0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.597	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	2.010000	-2.063412	0	0.110000	NM_212558		0	5	5	0	427	422	0		1			0	0	66	0	0	0.935960	0	0	0	0	0	0	5	427
CCIN	881	broad.mit.edu	37	9	36170278	36170278	+	Missense_Mutation	SNP	G	G	A	rs146585082	byFrequency	TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chr9:36170278G>A	ENST00000335119.2	+	1	890	c.779G>A	c.(778-780)cGc>cAc	p.R260H		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	260					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.R260H(1)		breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			CTGATGGACCGCAAGCAGGAG	0.592																																						ENST00000335119.2	1.000000	0.190000	0.980000	0.340000	0.580000	0.615085	0.580000	1.000000																										1	Substitution - Missense(1)	p.R260H(1)	skin(1)	21						c.(778-780)cGc>cAc		calicin		G	HIS/ARG	5,4401	9.9+/-24.2	0,5,2198	45.0	39.0	41.0		779	5.8	1.0	9	dbSNP_134	41	0,8600		0,0,4300	yes	missense	CCIN	NM_005893.2	29	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	probably-damaging	260/589	36170278	5,13001	2203	4300	6503	SO:0001583	missense	881	11	121412	38				g.chr9:36170278G>A	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.779G>A	chr9.hg19:g.36170278G>A	ENSP00000334996:p.Arg260His	0						p.R260H	NM_005893.2	NP_005884.2	1	2	3	1.999301	Q13939	CALI_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	1	890	+			Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	0	1	hg19	c.779G>A	CCDS6599.1	0	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922874	0.52653	0.001135	0.0	ENSG00000185972	ENST00000335119	T	0.66460	-0.21	5.84	5.84	0.93424	5.840000	5.840000	0.934240	.	0.000000	0.51477	D	0.000083	T	0.71693	0.3370	L	0.29908	0.895	0.36921	D	0.891407	D	0.71674	0.998	D	0.72075	0.976	T	0.70872	-0.4754	10	0.25751	T	0.34	.	15.6397	0.76989	0.0:0.0:1.0:0.0	.	260	Q13939	CALI_HUMAN	H	260	ENSP00000334996:R260H	ENSP00000334996:R260H	R	+	2	0	0	CCIN	36160278	36160278	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.667000	0.68067	2.770000	0.95276	0.563000	0.77884	CGC	0.115352		TCGA-IB-AAUT-01A-11D-A377-08	0.592	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	0	0	1	2	13	2	2	1	1	1	1	40	40	40	40	1	2.010000	-3.398341	1	0.110000	NM_005893		0	4	4	0	141	140	0		0			1	0	40	0	0	0.019861	0	0	0	0	0	0	4	141
GPRASP2	114928	broad.mit.edu	37	X	101969855	101969855	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IB-AAUT-01A-11D-A377-08	TCGA-IB-AAUT-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4f69f09-6081-4cf0-9505-2b8a18162658	46c83261-269c-4c59-8c9f-fb7b2d32312d	g.chrX:101969855G>T	ENST00000535209.1	+	4	889	c.58G>T	c.(58-60)Gaa>Taa	p.E20*	GPRASP2_ENST00000543253.1_Nonsense_Mutation_p.E20*|GPRASP2_ENST00000332262.5_Nonsense_Mutation_p.E20*			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	20						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						GAAGGCTGGGGAAGAGGTTAT	0.527																																						ENST00000535209.1	0.430000	0.100000	0.330000	0.150000	0.230000	0.248756	0.230000	0.220000																										0				30						c.(58-60)Gaa>Taa		G protein-coupled receptor associated sorting protein 2							106.0	104.0	105.0					X																	101969855		2203	4300	6503	SO:0001587	stop_gained	114928	0	0					g.chrX:101969855G>T	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.58G>T	chrX.hg19:g.101969855G>T	ENSP00000437394:p.Glu20*						GPRASP2_ENST00000332262.5_Nonsense_Mutation_p.E20*|GPRASP2_ENST00000543253.1_Nonsense_Mutation_p.E20*	p.E20*			0	1	1		Q96D09	GASP2_HUMAN		4	889	+			D3DXA0|Q8NAB4	Nonsense_Mutation	SNP	ENST00000535209.1	0	1	hg19	c.58G>T	CCDS14501.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.822422	0.98966	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	.	.	.	4.43	3.53	0.40419	4.430000	3.530000	0.404190	.	0.173091	0.27946	N	0.017206	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	9.818	0.40865	0.0:0.2057:0.7943:0.0	.	.	.	.	X	20	.	ENSP00000339057:E20X	E	+	1	0	0	GPRASP2	101856511	101856511	0.961000	0.32948	0.994000	0.49952	0.615000	0.37417	1.145000	0.31577	0.921000	0.36994	0.468000	0.43344	GAA	0.110000		TCGA-IB-AAUT-01A-11D-A377-08	0.527	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	0	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	2.010000	-3.432247	1	0.110000	NM_138437		0	7	7	0	275	270	0		1	0		0	0	54	0	0	0.979701	3.326814e-02	0	0	0	10	0	7	275
