#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TP53	7157	broad.mit.edu	37	17	7579320	7579321	+	Frame_Shift_Ins	INS	-	-	C	rs587780067		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			-	C	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr17:7579320_7579321insC	ENST00000269305.4	-	4	555_556	c.366_367insG	c.(364-369)gtgactfs	p.T123fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.T123fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.T123fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	123	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> I (in a sporadic cancer; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.V122fs*26(5)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACCGTGCAAGTCACAGACTTGG	0.55		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.810000	4.800000e-01	0.730000	0.550000	0.630000	0.647331	0.630000	0.640000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		24	Deletion - Frameshift(14)|Whole gene deletion(8)|Deletion - In frame(2)	p.0?(8)|p.V122fs*26(5)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)	upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|breast(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|stomach(1)|liver(1)|ovary(1)	24185						c.(364-369)gtgactfs	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)																																			SO:0001589	frameshift_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7579320_7579321insC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.367dupG	chr17.hg19:g.7579321_7579321dupC	ENSP00000269305:p.Thr123fs	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.T123fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.T123fs	p.T123fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.363146	P04637	P53_HUMAN		4	555_556	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	0	1	hg19	c.366_367insG	CCDS11118.1	0																																																																																								0.226994		TCGA-IB-AAUU-01A-11D-A377-08	0.550	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0	0	0	0	74	0	74	76	1	3.300000	-3.145735	1	0.370000	NM_000546		0	48	49	0	280	276	0	0	1	0	1	0	0	74	55	0	1	8.504663e-01	9.994585e-01	0	18	22	50	48	280
ZNF566	84924	broad.mit.edu	37	19	36940853	36940853	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr19:36940853delA	ENST00000434377.2	-	5	364	c.283delT	c.(283-285)tatfs	p.Y95fs	ZNF566_ENST00000424129.2_Frame_Shift_Del_p.Y95fs|ZNF566_ENST00000493391.1_5'UTR|ZNF566_ENST00000392170.2_Frame_Shift_Del_p.Y96fs|ZNF566_ENST00000454319.1_Frame_Shift_Del_p.Y96fs	NM_032838.4	NP_116227.1	Q969W8	ZN566_HUMAN	zinc finger protein 566	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24	Esophageal squamous(110;0.162)					TCTATTTCATAAATTTCTTTC	0.348																																						ENST00000434377.2	1.000000	6.300000e-01	1.000000	0.700000	0.790000	0.824389	0.790000	0.760000																										0				24						c.(283-285)tatfs		zinc finger protein 566							71.0	78.0	76.0					19																	36940853		2203	4300	6503	SO:0001589	frameshift_variant	84924	0	0					g.chr19:36940853delA	AK074497	CCDS12494.1, CCDS46061.1, CCDS74346.1	19q13.12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25919	protein-coding gene	gene with protein product						12477932	Standard	NM_001145343		Approved	FLJ14779, MGC12515	uc010xtf.2	Q969W8		ENST00000434377.2:c.283delT	chr19.hg19:g.36940853delA	ENSP00000415520:p.Tyr95fs	1					ZNF566_ENST00000454319.1_Frame_Shift_Del_p.Y96fs|ZNF566_ENST00000493391.1_5'UTR|ZNF566_ENST00000424129.2_Frame_Shift_Del_p.Y95fs|ZNF566_ENST00000392170.2_Frame_Shift_Del_p.Y96fs	p.Y95fs	NM_032838.4	NP_116227.1	2	4	6	2.429890	Q969W8	ZN566_HUMAN		5	364	-	Esophageal squamous(110;0.162)		B7ZL95|Q2M3J1	Frame_Shift_Del	DEL	ENST00000434377.2	1	0	hg19	c.283delT	CCDS12494.1	0																																																																																								0.578821		TCGA-IB-AAUU-01A-11D-A377-08	0.348	ZNF566-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000341054.1	1	0	1		67	2		0	0	0	9	191	0	191	189	1	3.300000	-20.000000	1	0.370000	NM_032838		0	94	132	0	892	880	0	0	1	0		0	0	191	0	0	9.932648e-01	1.072795e-01		1	0	5	0	94	892
HIST1H1B	3009	broad.mit.edu	37	6	27834834	27834845	+	In_Frame_Del	DEL	CTTCTTCGGAGT	CTTCTTCGGAGT	-	rs143393068|rs139479440|rs545007006	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr6:27834834_27834845delCTTCTTCGGAGT	ENST00000331442.3	-	1	514_525	c.463_474delACTCCGAAGAAG	c.(463-474)actccgaagaagdel	p.TPKK155del		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	155					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCTTCTTCGCCTTCTTCGGAGTCTTCTTCACT	0.599														3	0.000599042	0.0	0.0014	5008	,	,		17347	0.0		0.0	False		,,,				2504	0.002					ENST00000331442.3	1.000000	2.600000e-01	0.400000	0.300000	0.340000	0.380840	0.340000	0.350000																										0				24						c.(463-474)actccgaagaagdel		histone cluster 1, H1b																																				SO:0001651	inframe_deletion	3009	0	0					g.chr6:27834834_27834845delCTTCTTCGGAGT	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.463_474delACTCCGAAGAAG	chr6.hg19:g.27834834_27834845delCTTCTTCGGAGT	ENSP00000330074:p.Thr155_Lys158del	0						p.TPKK155del	NM_005322.2	NP_005313.1	1	2	3	1.637296	P16401	H15_HUMAN		1	514_525	-			Q14529|Q3MJ42	In_Frame_Del	DEL	ENST00000331442.3	1	1	hg19	c.463_474delACTCCGAAGAAG	CCDS4635.1	0																																																																																								0.376916		TCGA-IB-AAUU-01A-11D-A377-08	0.599	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	1	0	1		119			0	0	0	16	197	0	197	210	1	3.300000	-11.622140	1	0.370000	NM_005322		0	70	169	0	1034	1124	0	0	1			0	0	197	0	0	5.591003e-03			0	0	0	0	70	1034
PDCD11	22984	broad.mit.edu	37	10	105182763	105182763	+	Missense_Mutation	SNP	C	C	T	rs142899352		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr10:105182763C>T	ENST00000369797.3	+	18	2610	c.2516C>T	c.(2515-2517)aCg>aTg	p.T839M		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	839					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.T839M(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TTGATCCAGACGCTGGCCGAG	0.527																																						ENST00000369797.3	1.000000	7.200000e-01	1.000000	0.840000	0.970000	0.938249	0.970000	1.000000																										1	Substitution - Missense(1)	p.T839M(1)	urinary_tract(1)	64						c.(2515-2517)aCg>aTg		programmed cell death 11		C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	116.0	103.0	107.0		2516	5.0	1.0	10	dbSNP_134	107	0,8600		0,0,4300	no	missense	PDCD11	NM_014976.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	839/1872	105182763	1,13005	2203	4300	6503	SO:0001583	missense	22984	4	121374	39				g.chr10:105182763C>T	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2516C>T	chr10.hg19:g.105182763C>T	ENSP00000358812:p.Thr839Met	1						p.T839M	NM_014976.1	NP_055791.1	2	2	4	2.262088	Q14690	RRP5_HUMAN		18	2610	+		Colorectal(252;0.0747)|Breast(234;0.128)	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	1	1	hg19	c.2516C>T	CCDS31276.1	1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669172	0.47677	2.27E-4	0.0	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.10288	2.89	5.95	5.04	0.67666	5.95	5.04	0.67666	.	0.388932	0.31092	N	0.008272	T	0.12646	0.0307	L	0.51422	1.61	0.35143	D	0.769016	D	0.67145	0.996	B	0.44163	0.443	T	0.07616	-1.0763	10	0.45353	T	0.12	-14.7673	11.5381	0.50651	0.0:0.9178:0.0:0.0822	.	839	Q14690	RRP5_HUMAN	M	839	ENSP00000358812:T839M	ENSP00000358812:T839M	T	+	2	0	0	PDCD11	105172753	105172753	0.029000	0.19370	0.968000	0.41197	0.402000	0.30811	0.122000	0.15687	2.826000	0.97356	0.491000	0.48974	ACG	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.527	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	3.300000	-18.301170	1	0.370000			0	41	40	0	270	267	1		1	1		0	0	48	0	0	1	8.839784e-01	0	5	0	22	0	41	270
SLC18A3	6572	broad.mit.edu	37	10	50819803	50819803	+	Silent	SNP	G	G	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr10:50819803G>T	ENST00000374115.3	+	1	1457	c.1017G>T	c.(1015-1017)gtG>gtT	p.V339V	CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000339797.1_Intron	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	339					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TGCCTCATGTGCTGGGCGTCT	0.667																																						ENST00000374115.3	1.000000	6.900000e-01	0.980000	0.770000	0.870000	0.875944	0.870000	1.000000																										0				43						c.(1015-1017)gtG>gtT		solute carrier family 18 (vesicular acetylcholine transporter), member 3							71.0	70.0	70.0					10																	50819803		2203	4300	6503	SO:0001819	synonymous_variant	6572	0	0					g.chr10:50819803G>T	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1017G>T	chr10.hg19:g.50819803G>T		1					CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000351556.3_5'Flank	p.V339V	NM_003055.2	NP_003046.2	2	2	4	2.262088	Q16572	VACHT_HUMAN		1	1457	+			B2R7S1	Silent	SNP	ENST00000374115.3	1	1	hg19	c.1017G>T	CCDS7231.1	1																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.667	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	1	0	1	2	2	2	2	0	0	0	0	88	88	88	87	1	3.300000	-20.000000	1	0.370000	NM_003055		0	72	69	0	538	529	1		1	0		0	0	88	0	0	1	1.439934e-02	0	0	0	2	0	72	538
CTNNA3	29119	broad.mit.edu	37	10	68940134	68940134	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr10:68940134C>T	ENST00000433211.2	-	7	1162	c.988G>A	c.(988-990)Gca>Aca	p.A330T	CTNNA3_ENST00000373744.4_Missense_Mutation_p.A330T|CTNNA3_ENST00000545309.1_Missense_Mutation_p.A330T	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TTGCATTCTGCGATAATCCGC	0.527																																						ENST00000433211.2	0.410000	1.200000e-01	0.330000	0.170000	0.240000	0.257692	0.240000	0.240000																										0				95						c.(988-990)Gca>Aca		catenin (cadherin-associated protein), alpha 3							140.0	120.0	127.0					10																	68940134		2203	4300	6503	SO:0001583	missense	29119	5	121404	40				g.chr10:68940134C>T	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.988G>A	chr10.hg19:g.68940134C>T	ENSP00000389714:p.Ala330Thr	1					CTNNA3_ENST00000545309.1_Missense_Mutation_p.A330T|CTNNA3_ENST00000373744.4_Missense_Mutation_p.A330T	p.A330T	NM_013266.2	NP_037398.2	2	2	4	2.262088				7	1162	-				Missense_Mutation	SNP	ENST00000433211.2	1	1	hg19	c.988G>A	CCDS7269.1	0	.	.	.	.	.	.	.	.	.	.	C	17.65	3.441070	0.63067	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309	T;T;T	0.44083	1.38;1.38;0.93	5.83	3.75	0.43078	5.83	3.75	0.43078	.	0.123947	0.35349	N	0.003278	T	0.45558	0.1348	M	0.86178	2.8	0.44234	D	0.997079	B;B;B;B	0.21821	0.013;0.033;0.061;0.031	B;B;B;B	0.25759	0.018;0.03;0.063;0.012	T	0.50541	-0.8816	10	0.54805	T	0.06	-7.2666	7.2252	0.26012	0.0:0.7176:0.0:0.2824	.	330;330;330;330	A8K141;F2Z2R0;Q9UI47-2;Q9UI47	.;.;.;CTNA3_HUMAN	T	330	ENSP00000389714:A330T;ENSP00000362849:A330T;ENSP00000441444:A330T	ENSP00000362849:A330T	A	-	1	0	0	CTNNA3	68610140	68610140	0.971000	0.33674	0.957000	0.39632	0.910000	0.53928	2.199000	0.42715	1.458000	0.47871	0.585000	0.79938	GCA	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.527	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	0	0	1	2	2	2	2	0	0	0	0	58	58	58	55	1	3.300000	-2.878262	1	0.370000	NM_013266		0	11	11	0	331	327	0		1	0		0	0	58	0	0	9.982917e-01	3.097623e-02	0	0	0	8	0	11	331
MARCH5	54708	broad.mit.edu	37	10	94110927	94110927	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr10:94110927G>A	ENST00000358935.2	+	6	1132	c.800G>A	c.(799-801)cGc>cAc	p.R267H		NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	267					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CAGGCACACCGCAAAATTCTG	0.353																																						ENST00000358935.2	0.130000	0	0.100000	0.030000	0.060000	0.069162	0.060000	0.080000																										0				9						c.(799-801)cGc>cAc		membrane-associated ring finger (C3HC4) 5							82.0	78.0	79.0					10																	94110927		2203	4300	6503	SO:0001583	missense	54708	0	0					g.chr10:94110927G>A	BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.800G>A	chr10.hg19:g.94110927G>A	ENSP00000351813:p.Arg267His	1						p.R267H	NM_017824.4	NP_060294.1	2	2	4	2.262088	Q9NX47	MARH5_HUMAN		6	1132	+				Missense_Mutation	SNP	ENST00000358935.2	0	1	hg19	c.800G>A	CCDS7420.1	0	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627017	0.87560	.	.	ENSG00000198060	ENST00000358935	T	0.70986	-0.53	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.87067	0.6085	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88657	0.3186	10	0.87932	D	0	-4.1613	19.6604	0.95864	0.0:0.0:1.0:0.0	.	267	Q9NX47	MARH5_HUMAN	H	267	ENSP00000351813:R267H	ENSP00000351813:R267H	R	+	2	0	0	MARCH5	94100907	94100907	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.378000	0.97191	2.648000	0.89879	0.655000	0.94253	CGC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.353	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049388.1	0	0	1	2	2	2	2	0	0	0	0	129	129	129	128	1	3.300000	-2.111543	0	0.370000	NM_017824		0	6	7	0	726	710	0		1	0		0	0	129	0	0	9.627546e-01	2.840820e-01	0	0	0	111	0	6	726
FAM160B1	57700	broad.mit.edu	37	10	116608431	116608431	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr10:116608431G>A	ENST00000369248.4	+	13	2073	c.1738G>A	c.(1738-1740)Gca>Aca	p.A580T	FAM160B1_ENST00000369250.3_Missense_Mutation_p.A580T	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	580										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						ACCGGATGACGCAAAATCCTC	0.403																																						ENST00000369248.4	0.270000	3.000000e-02	0.200000	0.070000	0.120000	0.139136	0.120000	0.120000																										0				25						c.(1738-1740)Gca>Aca		family with sequence similarity 160, member B1							115.0	90.0	98.0					10																	116608431		2203	4300	6503	SO:0001583	missense	57700	0	0					g.chr10:116608431G>A	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1738G>A	chr10.hg19:g.116608431G>A	ENSP00000358251:p.Ala580Thr	1					FAM160B1_ENST00000369250.3_Missense_Mutation_p.A580T	p.A580T	NM_020940.3	NP_065991.3	2	2	4	2.262088	Q5W0V3	F16B1_HUMAN		13	2073	+			Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	0	1	hg19	c.1738G>A	CCDS31290.1	0	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609124	0.87258	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.16457	2.36;2.34	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	L	0.49126	1.545	0.80722	D	1	D;P	0.56287	0.975;0.598	P;B	0.54100	0.742;0.06	T	0.00849	-1.1541	10	0.15952	T	0.53	-23.8406	19.9439	0.97175	0.0:0.0:1.0:0.0	.	580;580	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	T	580	ENSP00000358251:A580T;ENSP00000358253:A580T	ENSP00000358251:A580T	A	+	1	0	0	FAM160B1	116598421	116598421	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.477000	0.97925	2.797000	0.96272	0.561000	0.74099	GCA	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.403	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	0	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	3.300000	-2.936984	1	0.370000	XM_049351		0	4	4	0	259	255	0		1	0		0	0	43	0	0	8.874457e-01	4.961700e-02	0	0	0	18	0	4	259
POU2AF1	5450	broad.mit.edu	37	11	111225288	111225288	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr11:111225288C>T	ENST00000393067.3	-	5	983	c.469G>A	c.(469-471)Gcc>Acc	p.A157T		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	157					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		GCGGGCGTGGCGGAGCTTCTT	0.642			T	BCL6	NHL																																	ENST00000393067.3	1.000000	5.800000e-01	1.000000	0.900000	0.990000	0.954701	0.990000	1.000000				Dom	yes			Dom	yes		11	11q23.1	11q23.1	5450	T	"""POU domain, class 2, associating factor 1 (OBF1)"""				L	L	BCL6		NHL		0				5						c.(469-471)Gcc>Acc		POU class 2 associating factor 1							16.0	23.0	21.0					11																	111225288		2194	4293	6487	SO:0001583	missense	5450	1	120900	25				g.chr11:111225288C>T		CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.469G>A	chr11.hg19:g.111225288C>T	ENSP00000376786:p.Ala157Thr	1						p.A157T	NM_006235.2	NP_006226.2	1	2	3	1.932710	Q16633	OBF1_HUMAN		5	983	-		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)	B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	0	1	hg19	c.469G>A	CCDS31675.1	1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578757	0.65878	.	.	ENSG00000110777	ENST00000393067	T	0.30448	1.53	4.87	1.8	0.24995	4.87	1.8	0.24995	.	0.529845	0.18793	N	0.131018	T	0.26085	0.0636	L	0.56769	1.78	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.23084	-1.0198	10	0.51188	T	0.08	-25.8385	5.1776	0.15143	0.1407:0.6002:0.0:0.259	.	157	Q16633	OBF1_HUMAN	T	157	ENSP00000376786:A157T	ENSP00000376786:A157T	A	-	1	0	0	POU2AF1	110730498	110730498	0.018000	0.18449	0.001000	0.08648	0.845000	0.48019	0.185000	0.16958	0.189000	0.20188	0.563000	0.77884	GCC	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.642	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	17	1	3.300000	-13.682250	1	0.370000	NM_006235		0	6	6	0	24	24	0		1	0		0	0	18	0	0	9.705328e-01	0	0	0	0	1	0	6	24
LRRC55	219527	broad.mit.edu	37	11	56950145	56950145	+	Missense_Mutation	SNP	C	C	T	rs143027441	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr11:56950145C>T	ENST00000497933.1	+	1	925	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	230	LRRCT.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R260C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						CCGGATCCAGCGCTGTACAGC	0.607																																						ENST00000497933.1	1.000000	6.800000e-01	1.000000	0.780000	0.890000	0.893641	0.890000	1.000000																										1	Substitution - Missense(1)	p.R260C(1)	endometrium(1)	25						c.(778-780)Cgc>Tgc		leucine rich repeat containing 55		C	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	67.0	63.0	64.0		778	5.5	1.0	11	dbSNP_134	64	1,8591	1.2+/-3.3	0,1,4295	no	missense	LRRC55	NM_001005210.2	180	0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	260/342	56950145	2,12992	2201	4296	6497	SO:0001583	missense	219527	0	0					g.chr11:56950145C>T		CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.778C>T	chr11.hg19:g.56950145C>T	ENSP00000419542:p.Arg260Cys	1						p.R260C	NM_001005210.2	NP_001005210.1	2	2	4	2.222719	Q6ZSA7	LRC55_HUMAN		1	925	+			A7E2U7|B2RN81	Missense_Mutation	SNP	ENST00000497933.1	1	1	hg19	c.778C>T	CCDS31539.1	1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421766	0.62622	2.27E-4	1.16E-4	ENSG00000183908	ENST00000497933	T	0.22743	1.94	5.53	5.53	0.82687	5.53	5.53	0.82687	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.64402	D	0.000016	T	0.33411	0.0862	L	0.43923	1.385	0.58432	D	0.999998	D	0.89917	1.0	P	0.55871	0.786	T	0.01363	-1.1374	10	0.54805	T	0.06	.	16.3896	0.83531	0.0:1.0:0.0:0.0	.	230	Q6ZSA7	LRC55_HUMAN	C	260	ENSP00000419542:R260C	ENSP00000419542:R260C	R	+	1	0	0	LRRC55	56706721	56706721	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	1.663000	0.37429	2.608000	0.88229	0.561000	0.74099	CGC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.607	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	3.300000	-19.878260	1	0.370000	NM_001005210		0	53	52	0	384	375	1		1	0		0	0	67	0	0	1	7.739058e-02	0	0	0	4	0	53	384
STIP1	10963	broad.mit.edu	37	11	63971050	63971050	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr11:63971050C>T	ENST00000305218.4	+	13	1662	c.1515C>T	c.(1513-1515)cgC>cgT	p.R505R	STIP1_ENST00000358794.5_Silent_p.R552R|STIP1_ENST00000538945.1_Silent_p.R481R	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	505	STI1 2.				response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						CAGCCATGCGCCTTATCCTGG	0.582																																						ENST00000305218.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				27						c.(1513-1515)cgC>cgT		stress-induced phosphoprotein 1							64.0	49.0	54.0					11																	63971050		2201	4297	6498	SO:0001819	synonymous_variant	10963	0	0					g.chr11:63971050C>T	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1515C>T	chr11.hg19:g.63971050C>T		1					STIP1_ENST00000358794.5_Silent_p.R552R|STIP1_ENST00000538945.1_Silent_p.R481R	p.R505R	NM_006819.2	NP_006810.1	1	2	3	1.932710	P31948	STIP1_HUMAN		13	1662	+			B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Silent	SNP	ENST00000305218.4	1	1	hg19	c.1515C>T	CCDS8058.1	1																																																																																								0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.582	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	3.300000	-20.000000	1	0.370000	NM_006819		0	54	54	0	135	131	1		1	1		0	0	28	0	0	1	1	0	220	0	227	0	54	135
MUS81	80198	broad.mit.edu	37	11	65630663	65630663	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr11:65630663G>A	ENST00000308110.4	+	7	1082	c.733G>A	c.(733-735)Gct>Act	p.A245T	CFL1_ENST00000534769.1_5'Flank|MUS81_ENST00000533035.1_Missense_Mutation_p.A170T	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	245					DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		GCCAGGAGCAGCTTCAGCAGA	0.637								Homologous recombination																														ENST00000308110.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999992	0.990000	1.000000																										0				13						c.(733-735)Gct>Act	Homologous recombination	MUS81 structure-specific endonuclease subunit							46.0	41.0	42.0					11																	65630663		2200	4296	6496	SO:0001583	missense	80198	0	0					g.chr11:65630663G>A		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.733G>A	chr11.hg19:g.65630663G>A	ENSP00000307853:p.Ala245Thr	1					MUS81_ENST00000533035.1_Missense_Mutation_p.A170T|CFL1_ENST00000534769.1_5'Flank	p.A245T	NM_025128.4	NP_079404.3	1	2	3	1.932710	Q96NY9	MUS81_HUMAN		7	1082	+			Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	1	1	hg19	c.733G>A	CCDS8115.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.761|9.761	1.170193|1.170193	0.21621|0.21621	.|.	.|.	ENSG00000172732|ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855|ENST00000529374;ENST00000530111	T;T|.	0.14766|.	2.48;2.72|.	5.11|5.11	1.93|1.93	0.25924|0.25924	5.11|5.11	1.93|1.93	0.25924|0.25924	.|.	0.824135|.	0.11566|.	N|.	0.551224|.	T|T	0.34571|0.34571	0.0902|0.0902	L|L	0.41236|0.41236	1.265|1.265	0.09310|0.09310	N|N	1|1	B|.	0.10296|.	0.003|.	B|.	0.06405|.	0.002|.	T|T	0.21655|0.21655	-1.0239|-1.0239	10|5	0.08599|.	T|.	0.76|.	-6.8355|-6.8355	5.7461|5.7461	0.18120|0.18120	0.1806:0.0:0.6625:0.1569|0.1806:0.0:0.6625:0.1569	.|.	245|.	Q96NY9|.	MUS81_HUMAN|.	T|N	170;245;245|169;140	ENSP00000432287:A170T;ENSP00000307853:A245T|.	ENSP00000307853:A245T|.	A|S	+|+	1|2	0|0	0|0	MUS81|MUS81	65387239|65387239	65387239|65387239	0.107000|0.107000	0.21998|0.21998	0.073000|0.073000	0.20177|0.20177	0.212000|0.212000	0.24457|0.24457	1.083000|1.083000	0.30815|0.30815	1.138000|1.138000	0.42230|0.42230	0.556000|0.556000	0.70494|0.70494	GCT|AGC	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.637	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	1	0	1	2	2	2	2	0	0	0	0	40	40	40	38	1	3.300000	-20.000000	1	0.370000	NM_025128		0	42	42	0	116	112	1		1	1		0	0	40	0	0	1	1	0	43	0	49	0	42	116
PCSK7	9159	broad.mit.edu	37	11	117090363	117090363	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr11:117090363G>A	ENST00000320934.3	-	10	1897	c.1267C>T	c.(1267-1269)Cgg>Tgg	p.R423W	PCSK7_ENST00000540028.1_Missense_Mutation_p.R64W	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	423	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		AGGCAGGGCCGCACCTGCAGC	0.627			T	IGH@	MLCLS																																	ENST00000320934.3	0.270000	3.000000e-02	0.200000	0.070000	0.120000	0.139730	0.120000	0.120000				Dom	yes			Dom	yes		11	11q23.3	11q23.3	9159	T	proprotein convertase subtilisin/kexin type 7				L	L	IGH@		MLCLS		0				16						c.(1267-1269)Cgg>Tgg		proprotein convertase subtilisin/kexin type 7							57.0	46.0	50.0					11																	117090363		2201	4296	6497	SO:0001583	missense	9159	0	0					g.chr11:117090363G>A	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1267C>T	chr11.hg19:g.117090363G>A	ENSP00000325917:p.Arg423Trp	1					PCSK7_ENST00000540028.1_Missense_Mutation_p.R64W	p.R423W	NM_004716.2	NP_004707.2	1	2	3	1.932710	Q16549	PCSK7_HUMAN		10	1897	-	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	ENST00000320934.3	0	1	hg19	c.1267C>T	CCDS8382.1	0	.	.	.	.	.	.	.	.	.	.	G	27.1	4.802841	0.90623	.	.	ENSG00000160613	ENST00000320934;ENST00000540028;ENST00000543900	D;D	0.87887	-2.31;-2.31	5.69	4.7	0.59300	5.69	4.7	0.59300	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.94305	0.8170	M	0.88979	2.995	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94972	0.8118	10	0.72032	D	0.01	-34.1224	16.525	0.84328	0.0:0.0:0.8607:0.1393	.	423	Q16549	PCSK7_HUMAN	W	423;64;423	ENSP00000325917:R423W;ENSP00000441944:R64W	ENSP00000325917:R423W	R	-	1	2	2	PCSK7	116595573	116595573	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.085000	0.71343	2.696000	0.92011	0.557000	0.71058	CGG	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.627	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	0	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	3.300000	-2.995169	1	0.370000	NM_004716		0	4	4	0	222	220	0		1	0		0	0	34	0	0	8.890555e-01	5.459129e-01	0	0	0	90	0	4	222
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	2	5	7	2.124773	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.520730		TCGA-IB-AAUU-01A-11D-A377-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	3.300000	-20.000000	1	0.370000	NM_033360		2913	70	69	5108	233	232	1	1	1	1	1	0	0	67	347	1	1	9.967793e-01	1	17	93	15	272	70	233
MYF5	4617	broad.mit.edu	37	12	81110965	81110965	+	Silent	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr12:81110965G>A	ENST00000228644.3	+	1	275	c.123G>A	c.(121-123)gcG>gcA	p.A41A		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	41					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CCTTCGGAGCGCACAAAGCAG	0.617																																						ENST00000228644.3	1.000000	5.000000e-02	1.000000	0.100000	0.180000	0.329815	0.180000	0.140000																										0				30						c.(121-123)gcG>gcA		myogenic factor 5							37.0	34.0	35.0					12																	81110965		2203	4300	6503	SO:0001819	synonymous_variant	4617	0	0					g.chr12:81110965G>A		CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.123G>A	chr12.hg19:g.81110965G>A		1						p.A41A	NM_005593.2	NP_005584.2	0	3	3	1.750386	P13349	MYF5_HUMAN		1	275	+			Q6ISR9	Silent	SNP	ENST00000228644.3	0	1	hg19	c.123G>A	CCDS9020.1	0																																																																																								0.445862		TCGA-IB-AAUU-01A-11D-A377-08	0.617	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	0	0	1	2	2	2	2	0	0	0	0	38	38	38	36	1	3.300000	-3.516685	1	0.370000	NM_005593		0	4	4	0	165	164	0		1			0	0	38	0	0	8.899358e-01	0	0	0	0	0	0	4	165
DDX55	57696	broad.mit.edu	37	12	124090516	124090516	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr12:124090516C>T	ENST00000238146.4	+	2	197	c.147C>T	c.(145-147)gtC>gtT	p.V49V	DDX55_ENST00000538744.1_Silent_p.V49V	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	49	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		ACAAAGATGTCGCTGCAGAAG	0.498																																						ENST00000238146.4	1.000000	1.000000e-02	1.000000	0.040000	0.070000	0.244820	0.070000	0.060000																										0				14						c.(145-147)gtC>gtT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 55							180.0	147.0	158.0					12																	124090516		2203	4300	6503	SO:0001819	synonymous_variant	57696	6	121412	41				g.chr12:124090516C>T	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.147C>T	chr12.hg19:g.124090516C>T		1					DDX55_ENST00000538744.1_Silent_p.V49V	p.V49V	NM_020936.1	NP_065987.1	0	3	3	1.750386	Q8NHQ9	DDX55_HUMAN		2	197	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		Q658L6|Q8IYH0|Q9HCH7	Silent	SNP	ENST00000238146.4	0	1	hg19	c.147C>T	CCDS9251.1	0																																																																																								0.445862		TCGA-IB-AAUU-01A-11D-A377-08	0.498	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2	0	0	1	2	2	2	2	0	0	0	0	108	108	108	108	1	3.300000	-2.425857	0	0.370000			0	5	5	0	488	480	0		1	0		0	0	108	0	0	9.351190e-01	2.436109e-02	0	0	0	19	0	5	488
MYO16	23026	broad.mit.edu	37	13	109779791	109779791	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr13:109779791G>A	ENST00000357550.2	+	30	3919	c.3878G>A	c.(3877-3879)cGg>cAg	p.R1293Q	MYO16_ENST00000457511.2_Missense_Mutation_p.R805Q|MYO16_ENST00000356711.2_Missense_Mutation_p.R1293Q	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCGTCTCCACGGAAACAGCCC	0.662																																						ENST00000357550.2	1.000000	6.400000e-01	1.000000	0.800000	0.980000	0.923909	0.980000	1.000000																										0				121						c.(3877-3879)cGg>cAg		myosin XVI							36.0	36.0	36.0					13																	109779791		2203	4300	6503	SO:0001583	missense	23026	1	121410	28				g.chr13:109779791G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3878G>A	chr13.hg19:g.109779791G>A	ENSP00000350160:p.Arg1293Gln	1					MYO16_ENST00000356711.2_Missense_Mutation_p.R1293Q|MYO16_ENST00000457511.2_Missense_Mutation_p.R805Q	p.R1293Q	NM_001198950.1	NP_001185879.1	2	2	4	2.202007			BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)	30	3919	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)			Missense_Mutation	SNP	ENST00000357550.2	0	1	hg19	c.3878G>A	CCDS32008.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.064283	0.93898	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	T;T;T	0.50277	0.75;0.75;0.75	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.37178	U	0.002219	T	0.70684	0.3252	M	0.79258	2.445	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.71441	-0.4592	9	.	.	.	.	18.4132	0.90559	0.0:0.0:1.0:0.0	.	805;1293	F8W883;Q9Y6X6	.;MYO16_HUMAN	Q	1293;1293;805	ENSP00000349145:R1293Q;ENSP00000350160:R1293Q;ENSP00000401633:R805Q	.	R	+	2	0	0	MYO16	108577792	108577792	1.000000	0.71417	0.998000	0.56505	0.874000	0.50279	8.813000	0.91963	2.584000	0.87258	0.563000	0.77884	CGG	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.662	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	3.300000	-20.000000	1	0.370000	NM_015011		0	21	21	0	138	136	1		1	0		0	0	22	0	0	9.999983e-01	0	0	1	0	0	0	21	138
TFDP1	7027	broad.mit.edu	37	13	114277494	114277494	+	Splice_Site	SNP	G	G	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr13:114277494G>T	ENST00000375370.5	+	4	291		c.e4-1		TFDP1_ENST00000538138.1_Splice_Site|TFDP1_ENST00000465174.1_Splice_Site|TFDP1_ENST00000544902.1_Splice_Site	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1						anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			TTGTGTTGCAGGCGTGGTGTC	0.532										TSP Lung(29;0.18)																												ENST00000375370.5	0.850000	1.400000e-01	0.630000	0.250000	0.410000	0.445690	0.410000	0.360000																										0				26						c.e4-1		transcription factor Dp-1							108.0	84.0	92.0					13																	114277494		2203	4300	6503	SO:0001630	splice_region_variant	7027	0	0					g.chr13:114277494G>T	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.80-1G>T	chr13.hg19:g.114277494G>T		1	TSP Lung(29;0.18)				TFDP1_ENST00000544902.1_Splice_Site|TFDP1_ENST00000465174.1_Splice_Site|TFDP1_ENST00000538138.1_Splice_Site		NM_007111.4	NP_009042.1	2	2	4	2.202007	Q14186	TFDP1_HUMAN	all cancers(43;0.0576)	4	291	+	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	B4DLQ9|Q5JSB4|Q8IZL5	Splice_Site	SNP	ENST00000375370.5	0	1	hg19		CCDS9538.1	0	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235800	0.39498	.	.	ENSG00000198176	ENST00000375370;ENST00000408980;ENST00000453989	.	.	.	4.65	4.65	0.58169	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5431	0.87853	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	TFDP1	113325495	113325495	1.000000	0.71417	0.997000	0.53966	0.174000	0.22865	8.046000	0.89438	2.125000	0.65367	0.491000	0.48974	.	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.532	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045918.3	0	0	0	2	2	2	2	0	0	0	0	11	11	11	11	1	3.300000	-7.858123	1	0.370000	NM_007111	Intron	0	4	0	0	76	74	0		0		0	0	0	11	0	0	8.728445e-01	0	0	0	0	0	1	4	76
TOX4	9878	broad.mit.edu	37	14	21961173	21961173	+	Silent	SNP	T	T	C			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr14:21961173T>C	ENST00000405508.1	+	8	1674	c.1398T>C	c.(1396-1398)ccT>ccC	p.P466P	TOX4_ENST00000262709.3_Silent_p.P466P|TOX4_ENST00000448790.2_Silent_p.P443P			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	466	Gln/Pro-rich.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)			large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		TGCAGCAGCCTCCTCCACTCC	0.552																																						ENST00000405508.1	0.810000	4.800000e-01	0.730000	0.550000	0.630000	0.646191	0.630000	0.640000																										0				18						c.(1396-1398)ccT>ccC		TOX high mobility group box family member 4							90.0	80.0	83.0					14																	21961173		2203	4300	6503	SO:0001819	synonymous_variant	9878	0	0					g.chr14:21961173T>C	AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1398T>C	chr14.hg19:g.21961173T>C		1					TOX4_ENST00000448790.2_Silent_p.P443P|TOX4_ENST00000262709.3_Silent_p.P466P	p.P466P			2	2	4	2.205976	O94842	TOX4_HUMAN	Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	8	1674	+	all_cancers(95;0.000465)		B4DPY8|B4DSM0|E7EV69	Silent	SNP	ENST00000405508.1	1	1	hg19	c.1398T>C	CCDS32043.1	0																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.552	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	1	0	1	2	2	2	2	0	0	0	0	106	106	106	103	1	3.300000	-14.466900	1	0.370000	NM_014828		0	53	52	0	563	552	1		1	1		0	0	106	0	0	1	9.999993e-01	0	29	0	189	0	53	563
LTB4R2	56413	broad.mit.edu	37	14	24780173	24780173	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr14:24780173C>T	ENST00000528054.1	+	1	2013	c.396C>T	c.(394-396)tgC>tgT	p.C132C	CIDEB_ENST00000555817.1_5'UTR|LTB4R_ENST00000396789.4_5'Flank|LTB4R2_ENST00000543919.1_Silent_p.C101C|LTB4R2_ENST00000533293.1_Silent_p.C101C|CIDEB_ENST00000554411.1_5'Flank|CIDEB_ENST00000336557.5_5'UTR|LTB4R_ENST00000345363.3_5'Flank|CIDEB_ENST00000258807.5_5'UTR			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	132					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		ACTACGTGTGCGCGCTCAGCA	0.721																																						ENST00000528054.1	1.000000	6.400000e-01	1.000000	0.760000	0.890000	0.886137	0.890000	1.000000																										0				3						c.(394-396)tgC>tgT		leukotriene B4 receptor 2							18.0	18.0	18.0					14																	24780173		1966	3908	5874	SO:0001819	synonymous_variant	56413	1	117548	29				g.chr14:24780173C>T	AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.396C>T	chr14.hg19:g.24780173C>T		1					CIDEB_ENST00000336557.5_5'UTR|CIDEB_ENST00000555817.1_5'UTR|LTB4R2_ENST00000533293.1_Silent_p.C101C|LTB4R_ENST00000345363.3_5'Flank|CIDEB_ENST00000554411.1_5'Flank|LTB4R_ENST00000396789.4_5'Flank|CIDEB_ENST00000258807.5_5'UTR|LTB4R2_ENST00000543919.1_Silent_p.C101C	p.C132C			2	2	4	2.205976	Q9NPC1	LT4R2_HUMAN		1	2013	+			Q5KU28|Q9NPE5	Silent	SNP	ENST00000528054.1	0	1	hg19	c.396C>T		1																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.721	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000073194.4	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	3.300000	-20.000000	1	0.370000			0	35	35	0	255	254	0		1	0		0	0	20	0	0	1	7.811230e-02	0	1	0	3	0	35	255
L2HGDH	79944	broad.mit.edu	37	14	50704423	50704423	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr14:50704423G>A	ENST00000261699.4	-	10	1234	c.1217C>T	c.(1216-1218)cCg>cTg	p.P406L				Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	401					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)			kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					TAGCCAGCTCGGTCCTCTCAC	0.517																																						ENST00000261699.4	1.000000	4.700000e-01	1.000000	0.630000	0.830000	0.821978	0.830000	1.000000																										0				10						c.(1216-1218)cCg>cTg		L-2-hydroxyglutarate dehydrogenase							35.0	31.0	32.0					14																	50704423		876	1991	2867	SO:0001583	missense	79944	1	116142	29				g.chr14:50704423G>A		CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000261699.4:c.1217C>T	chr14.hg19:g.50704423G>A	ENSP00000261699:p.Pro406Leu	1						p.P406L			2	2	4	2.205976	Q9H9P8	L2HDH_HUMAN		10	1234	-	all_epithelial(31;0.000599)|Breast(41;0.0102)		Q9BRR1	Missense_Mutation	SNP	ENST00000261699.4	0	1	hg19	c.1217C>T		0	.	.	.	.	.	.	.	.	.	.	G	15.45	2.835940	0.50951	.	.	ENSG00000087299	ENST00000261699	D	0.92699	-3.09	4.54	-1.11	0.09840	4.54	-1.11	0.09840	.	.	.	.	.	D	0.93946	0.8062	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	D	0.85113	0.0964	8	0.87932	D	0	.	4.3647	0.11218	0.4596:0.1691:0.3713:0.0	.	406	C9JVN9	.	L	406	ENSP00000261699:P406L	ENSP00000261699:P406L	P	-	2	0	0	L2HGDH	49774173	49774173	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	-0.086000	0.11233	-0.302000	0.08869	-1.446000	0.01064	CCG	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.517	L2HGDH-002	KNOWN	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000276871.1	0	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	3.300000	-3.321531	1	0.370000	NM_024884		0	13	13	0	105	104	1		1			0	0	23	0	0	9.996151e-01	0	0	0	0	0	0	13	105
MAP3K9	4293	broad.mit.edu	37	14	71209085	71209085	+	Missense_Mutation	SNP	C	C	T	rs200816838		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr14:71209085C>T	ENST00000554752.2	-	6	1549	c.1550G>A	c.(1549-1551)cGc>cAc	p.R517H	MAP3K9_ENST00000555993.2_Missense_Mutation_p.R517H|MAP3K9_ENST00000381250.4_Missense_Mutation_p.R517H|MAP3K9_ENST00000553414.1_Missense_Mutation_p.R211H|MAP3K9_ENST00000554146.1_Missense_Mutation_p.R254H	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	517				KLKDGNRISLPSDFQHKFTVQASPT -> AQPVLPFPHGHS RCPGGTGSSWGGQ (in Ref. 4). {ECO:0000305}.	activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GAGGCTGATGCGGTTGCCATC	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		18722	0.001		0.0	False		,,,				2504	0.0				GBM(114;411 1587 13539 28235 50070)	ENST00000554752.2	0.180000	1.000000e-02	0.130000	0.040000	0.080000	0.093949	0.080000	0.080000																										0				46						c.(1549-1551)cGc>cAc		mitogen-activated protein kinase kinase kinase 9							100.0	94.0	96.0					14																	71209085		2203	4300	6503	SO:0001583	missense	4293	8	121412	42				g.chr14:71209085C>T	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1550G>A	chr14.hg19:g.71209085C>T	ENSP00000451612:p.Arg517His	1					MAP3K9_ENST00000553414.1_Missense_Mutation_p.R211H|MAP3K9_ENST00000554146.1_Missense_Mutation_p.R254H|MAP3K9_ENST00000381250.4_Missense_Mutation_p.R517H|MAP3K9_ENST00000555993.2_Missense_Mutation_p.R517H	p.R517H	NM_001284230.1	NP_001271159.1	2	2	4	2.205976	P80192	M3K9_HUMAN		6	1549	-			A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	0	1	hg19	c.1550G>A		0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.47	1.947067	0.34377	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	6.06	5.17	0.71159	6.06	5.17	0.71159	Protein kinase-like domain (1);	0.211843	0.49305	D	0.000141	T	0.07413	0.0187	N	0.25245	0.725	0.50171	D	0.999854	B;B;B;B	0.20261	0.001;0.025;0.043;0.005	B;B;B;B	0.20577	0.005;0.009;0.03;0.013	T	0.28332	-1.0047	10	0.35671	T	0.21	.	7.1057	0.25362	0.1401:0.71:0.0:0.1499	.	254;517;517;211	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	H	517;517;211;517;254;245	ENSP00000451612:R517H;ENSP00000451038:R211H;ENSP00000370649:R517H;ENSP00000451921:R254H	ENSP00000005198:R517H	R	-	2	0	0	MAP3K9	70278838	70278838	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	3.617000	0.54181	1.577000	0.49804	-0.150000	0.13652	CGC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.602	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2	0	0	1	2	29	2	2	2	2	2	2	69	69	69	66	1	3.300000	-2.178743	0	0.370000			0	5	5	0	463	448	0		0	0		2	0	69	0	0	9.027197e-06	1.112823e-03	0	0	0	4	0	5	463
YLPM1	56252	broad.mit.edu	37	14	75276279	75276279	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr14:75276279G>A	ENST00000552421.1	+	6	2724	c.2600G>A	c.(2599-2601)cGa>cAa	p.R867Q	YLPM1_ENST00000238571.3_Missense_Mutation_p.R1378Q|YLPM1_ENST00000325680.7_Missense_Mutation_p.R1573Q			P49750	YLPM1_HUMAN	YLP motif containing 1	1378	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GAACAGGAACGATGGGATGAA	0.478																																						ENST00000552421.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999938	0.990000	1.000000																										0				62						c.(2599-2601)cGa>cAa		YLP motif containing 1							90.0	86.0	87.0					14																	75276279		1940	4159	6099	SO:0001583	missense	56252	0	0					g.chr14:75276279G>A	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.2600G>A	chr14.hg19:g.75276279G>A	ENSP00000447921:p.Arg867Gln	1					YLPM1_ENST00000325680.7_Missense_Mutation_p.R1573Q|YLPM1_ENST00000238571.3_Missense_Mutation_p.R1378Q	p.R867Q			2	2	4	2.205976	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	6	2724	+			P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	1	1	hg19	c.2600G>A		1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492754	0.84962	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.54	5.54	0.83059	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000008	T	0.66386	0.2784	L	0.27053	0.805	0.42961	D	0.994407	D;D	0.89917	0.997;1.0	D;D	0.81914	0.964;0.995	T	0.70139	-0.4954	9	0.72032	D	0.01	-5.0092	17.6519	0.88167	0.0:0.0:1.0:0.0	.	1378;1573	P49750-3;P49750-4	.;.	Q	867;1573;1378;1286	.	ENSP00000238571:R1378Q	R	+	2	0	0	YLPM1	74346032	74346032	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.826000	0.75298	2.588000	0.87417	0.591000	0.81541	CGA	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.478	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	3.300000	-20.000000	1	0.370000	NM_019589		0	27	26	0	85	85	1		1	1		0	0	20	0	0	1	9.997534e-01	0	19	0	27	0	27	85
OCA2	4948	broad.mit.edu	37	15	28211955	28211955	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr15:28211955G>A	ENST00000354638.3	-	15	1672	c.1517C>T	c.(1516-1518)gCc>gTc	p.A506V	OCA2_ENST00000382996.2_Missense_Mutation_p.A506V|OCA2_ENST00000353809.5_Missense_Mutation_p.A482V	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	506					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AGTGAATCCGGCAAAGTCCAG	0.507									Oculocutaneous Albinism																													ENST00000354638.3	0.480000	7.000000e-02	0.350000	0.130000	0.220000	0.250411	0.220000	0.200000																										0				85						c.(1516-1518)gCc>gTc		oculocutaneous albinism II							67.0	56.0	60.0					15																	28211955		2203	4300	6503	SO:0001583	missense	4948	0	0		Oculocutaneous Albinism	Familial Cancer Database		g.chr15:28211955G>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1517C>T	chr15.hg19:g.28211955G>A	ENSP00000346659:p.Ala506Val	1					OCA2_ENST00000382996.2_Missense_Mutation_p.A506V|OCA2_ENST00000353809.5_Missense_Mutation_p.A482V	p.A506V	NM_000275.2	NP_000266.2	2	2	4	2.224059	Q04671	P_HUMAN		15	1672	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	0	1	hg19	c.1517C>T	CCDS10020.1	0	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907629	0.72868	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	T;T;T	0.80480	-1.38;-1.38;-1.38	5.05	5.05	0.67936	5.05	5.05	0.67936	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	N	0.16862	0.45	0.58432	D	0.999997	B;P	0.46621	0.196;0.881	B;P	0.51516	0.098;0.672	T	0.77451	-0.2583	10	0.38643	T	0.18	-19.0275	16.249	0.82472	0.0:0.0:1.0:0.0	.	482;506	Q04671-2;Q04671	.;P_HUMAN	V	506;482;506	ENSP00000346659:A506V;ENSP00000261276:A482V;ENSP00000372457:A506V	ENSP00000261276:A482V	A	-	2	0	0	OCA2	25885550	25885550	1.000000	0.71417	0.942000	0.38095	0.482000	0.33219	6.969000	0.76092	2.494000	0.84150	0.555000	0.69702	GCC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.507	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	0	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	3.300000	-6.256168	1	0.370000	NM_000275		0	4	4	0	141	138	0		1	0		0	0	34	0	0	8.864814e-01	1.378930e-03	0	0	0	2	0	4	141
HERC2	8924	broad.mit.edu	37	15	28517442	28517442	+	Silent	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr15:28517442G>A	ENST00000261609.7	-	9	1110	c.1002C>T	c.(1000-1002)agC>agT	p.S334S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAAGTGGGGCGCTGGTGCCCT	0.567																																						ENST00000261609.7	0.350000	9.000000e-02	0.280000	0.140000	0.200000	0.219657	0.200000	0.200000																										0				204						c.(1000-1002)agC>agT		HECT and RLD domain containing E3 ubiquitin protein ligase 2							72.0	57.0	62.0					15																	28517442		2203	4300	6503	SO:0001819	synonymous_variant	8924	8	121412	36				g.chr15:28517442G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1002C>T	chr15.hg19:g.28517442G>A		1						p.S334S	NM_004667.5	NP_004658.3	2	2	4	2.224059				9	1110	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		Silent	SNP	ENST00000261609.7	0	1	hg19	c.1002C>T	CCDS10021.1	0																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.567	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	44	1	3.300000	-3.272530	1	0.370000	NM_004667		0	10	10	0	358	349	0		1	0		0	0	46	0	0	9.965739e-01	1.018579e-01	0	0	0	18	0	10	358
CHRNA7	1139	broad.mit.edu	37	15	32460285	32460285	+	Missense_Mutation	SNP	G	G	A	rs573369306		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr15:32460285G>A	ENST00000306901.3	+	10	1232	c.1135G>A	c.(1135-1137)Gcc>Acc	p.A379T	CHRNA7_ENST00000455693.2_Missense_Mutation_p.A198T|CHRNA7_ENST00000454250.3_Missense_Mutation_p.A408T	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	379					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GCCGCCGCCCGCCAGCAACGG	0.716																																					Esophageal Squamous(193;529 2900 40232 43193)	ENST00000306901.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999918	0.990000	1.000000																										0				12						c.(1135-1137)Gcc>Acc		cholinergic receptor, nicotinic, alpha 7 (neuronal)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)						16.0	24.0	21.0					15																	32460285		2179	4281	6460	SO:0001583	missense	1139	8	120386	36				g.chr15:32460285G>A	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.1135G>A	chr15.hg19:g.32460285G>A	ENSP00000303727:p.Ala379Thr	1					CHRNA7_ENST00000455693.2_Missense_Mutation_p.A198T|CHRNA7_ENST00000454250.3_Missense_Mutation_p.A408T	p.A379T	NM_000746.5	NP_000737.1	2	2	4	2.203689	P36544	ACHA7_HUMAN		10	1232	+		all_lung(180;6.35e-11)	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	ENST00000306901.3	1	1	hg19	c.1135G>A	CCDS10027.1	1	.	.	.	.	.	.	.	.	.	.	g	3.425	-0.117298	0.06838	.	.	ENSG00000175344	ENST00000437966;ENST00000454250;ENST00000306901;ENST00000455693	T;T;T	0.19669	2.13;2.13;2.13	3.84	-0.555	0.11807	3.84	-0.555	0.11807	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.523290	0.01582	N	0.021155	T	0.08179	0.0204	N	0.03000	-0.44	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.20505	-1.0273	10	0.12766	T	0.61	.	3.6481	0.08192	0.494:0.0:0.3237:0.1823	.	408;379	B4DFS0;P36544	.;ACHA7_HUMAN	T	289;408;379;198	ENSP00000407546:A408T;ENSP00000303727:A379T;ENSP00000405989:A198T	ENSP00000303727:A379T	A	+	1	0	0	CHRNA7	30247577	30247577	0.000000	0.05858	0.001000	0.08648	0.477000	0.33069	-0.094000	0.11094	-0.091000	0.12440	0.650000	0.86243	GCC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.716	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2	0	0	1	2	2	2	2	0	0	0	0	41	41	41	44	1	3.300000	-3.045821	1	0.370000			0	55	54	0	225	194	0		1			0	0	41	0	0	1	0	0	0	0	0	0	55	225
DET1	55070	broad.mit.edu	37	15	89070834	89070834	+	Missense_Mutation	SNP	G	G	A	rs569976232		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr15:89070834G>A	ENST00000268148.8	-	3	1412	c.1267C>T	c.(1267-1269)Cgc>Tgc	p.R423C	DET1_ENST00000564406.1_Missense_Mutation_p.R434C|DET1_ENST00000444300.1_Missense_Mutation_p.R434C	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	423						nucleus (GO:0005634)		p.R434C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GCTTACCGGCGCTGGATCTGC	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19718	0.0		0.0	False		,,,				2504	0.0					ENST00000268148.8	0.310000	4.000000e-02	0.220000	0.080000	0.140000	0.156907	0.140000	0.120000																										1	Substitution - Missense(1)	p.R434C(1)	kidney(1)	23						c.(1267-1269)Cgc>Tgc		de-etiolated homolog 1 (Arabidopsis)							69.0	65.0	67.0					15																	89070834		1874	4112	5986	SO:0001583	missense	55070	5	120828	35				g.chr15:89070834G>A	BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.1267C>T	chr15.hg19:g.89070834G>A	ENSP00000268148:p.Arg423Cys	1					DET1_ENST00000564406.1_Missense_Mutation_p.R434C|DET1_ENST00000444300.1_Missense_Mutation_p.R434C	p.R423C	NM_001144074.1	NP_001137546.1	2	2	4	2.228833	Q7L5Y6	DET1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.188)	3	1412	-	Lung NSC(78;0.105)|all_lung(78;0.182)		B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	ENST00000268148.8	0	1	hg19	c.1267C>T	CCDS45344.1	0	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014609	0.75161	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.049043	0.85682	D	0.000000	T	0.78953	0.4365	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.64506	0.926;0.926	T	0.80725	-0.1254	9	0.87932	D	0	.	18.8293	0.92132	0.0:0.0:1.0:0.0	.	423;434	Q7L5Y6;B3KNN6	DET1_HUMAN;.	C	434;423	.	ENSP00000268148:R423C	R	-	1	0	0	DET1	86871838	86871838	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.036000	0.76524	2.683000	0.91414	0.655000	0.94253	CGC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.443	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2	0	0	0	2	18	3	2	1	1	1	1	41	41	41	41	1	3.300000	-4.053565	1	0.370000	NM_017996		0	4	4	0	229	225	0		0	0		1	0	41	0	0	1.489449e-03	2.156863e-03	0	0	0	11	0	4	229
LRRK1	79705	broad.mit.edu	37	15	101586241	101586241	+	Missense_Mutation	SNP	C	C	T	rs370459525		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr15:101586241C>T	ENST00000388948.3	+	21	3378	c.3019C>T	c.(3019-3021)Cgg>Tgg	p.R1007W	LRRK1_ENST00000284395.5_Missense_Mutation_p.R1004W|RP11-505E24.3_ENST00000558979.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCACGGTATGCGGCACCCCAC	0.562																																						ENST00000388948.3	0.180000	1.000000e-02	0.130000	0.040000	0.080000	0.093135	0.080000	0.080000																										0				72						c.(3019-3021)Cgg>Tgg		leucine-rich repeat kinase 1		C	TRP/ARG	5,4081		0,5,2038	114.0	122.0	119.0		3019	5.6	1.0	15		119	0,8356		0,0,4178	no	missense	LRRK1	NM_024652.3	101	0,5,6216	TT,TC,CC		0.0,0.1224,0.0402	probably-damaging	1007/2016	101586241	5,12437	2043	4178	6221	SO:0001583	missense	79705	11	120976	45				g.chr15:101586241C>T	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3019C>T	chr15.hg19:g.101586241C>T	ENSP00000373600:p.Arg1007Trp	1					LRRK1_ENST00000284395.5_Missense_Mutation_p.R1004W|RP11-505E24.3_ENST00000558979.1_RNA	p.R1007W	NM_024652.3	NP_078928.3	2	2	4	2.228833			OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)	21	3378	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)			Missense_Mutation	SNP	ENST00000388948.3	0	1	hg19	c.3019C>T	CCDS42086.1	0	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952657	0.92660	0.001224	0.0	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.73152	-0.69;-0.72	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.060599	0.64402	D	0.000003	T	0.72969	0.3527	L	0.55481	1.735	0.46185	D	0.998919	D	0.76494	0.999	P	0.50490	0.642	T	0.75634	-0.3250	10	0.66056	D	0.02	.	13.6371	0.62229	0.0:0.9197:0.0:0.0803	.	1007	Q38SD2	LRRK1_HUMAN	W	1007;1004	ENSP00000373600:R1007W;ENSP00000284395:R1004W	ENSP00000284395:R1004W	R	+	1	2	2	LRRK1	99403764	99403764	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.715000	0.54897	2.769000	0.95229	0.655000	0.94253	CGG	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.562	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	0	0	1	2	2	2	2	0	0	0	0	76	76	76	71	1	3.300000	-1.878379	0	0.370000	NM_024652		0	5	5	0	467	459	0		1	0		0	0	76	0	0	9.350053e-01	3.750867e-02	0	0	0	23	0	5	467
SLC12A3	6559	broad.mit.edu	37	16	56920974	56920974	+	Missense_Mutation	SNP	A	A	G			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr16:56920974A>G	ENST00000563236.1	+	17	2172	c.2147A>G	c.(2146-2148)gAc>gGc	p.D716G	SLC12A3_ENST00000566786.1_Missense_Mutation_p.D715G|SLC12A3_ENST00000262502.5_Missense_Mutation_p.D715G|SLC12A3_ENST00000438926.2_Missense_Mutation_p.D716G			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	716					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	ATTGCCGAGGACCTCCGCAGA	0.582																																						ENST00000563236.1	0.900000	4.200000e-01	0.770000	0.520000	0.630000	0.651889	0.630000	0.640000																										0				50						c.(2146-2148)gAc>gGc		solute carrier family 12 (sodium/chloride transporter), member 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)						92.0	80.0	84.0					16																	56920974		2198	4300	6498	SO:0001583	missense	6559	0	0					g.chr16:56920974A>G		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2147A>G	chr16.hg19:g.56920974A>G	ENSP00000456149:p.Asp716Gly	1					SLC12A3_ENST00000262502.5_Missense_Mutation_p.D715G|SLC12A3_ENST00000438926.2_Missense_Mutation_p.D716G|SLC12A3_ENST00000566786.1_Missense_Mutation_p.D715G	p.D716G			2	2	4	2.208062	P55017	S12A3_HUMAN		17	2172	+			A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	1	1	hg19	c.2147A>G	CCDS58464.1	0	.	.	.	.	.	.	.	.	.	.	A	14.91	2.675396	0.47781	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.153400	0.56097	D	0.000024	T	0.65575	0.2704	M	0.68317	2.08	0.80722	D	1	B;B;B	0.27910	0.193;0.006;0.011	B;B;B	0.34346	0.18;0.017;0.034	T	0.65598	-0.6129	9	0.52906	T	0.07	.	15.9025	0.79392	1.0:0.0:0.0:0.0	.	715;716;716	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	G	715;716	.	ENSP00000262502:D716G	D	+	2	0	0	SLC12A3	55478475	55478475	1.000000	0.71417	1.000000	0.80357	0.524000	0.34500	6.121000	0.71602	2.155000	0.67459	0.450000	0.29827	GAC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.582	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	27	1	3.300000	-20.000000	1	0.370000			0	24	24	0	257	253	0		1			0	0	28	0	0	9.999997e-01	0	0	0	0	0	0	24	257
HYDIN	54768	broad.mit.edu	37	16	70908762	70908762	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr16:70908762C>T	ENST00000393567.2	-	63	10768	c.10618G>A	c.(10618-10620)Gcg>Acg	p.A3540T	AC027281.1_ENST00000411384.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3540					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TAGATATACGCGGTGGTGGGC	0.507																																						ENST00000393567.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999983	0.990000	1.000000																										0				43						c.(10618-10620)Gcg>Acg		HYDIN, axonemal central pair apparatus protein							60.0	56.0	57.0					16																	70908762		1869	4102	5971	SO:0001583	missense	54768	5	120804	34				g.chr16:70908762C>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10618G>A	chr16.hg19:g.70908762C>T	ENSP00000377197:p.Ala3540Thr	1					AC027281.1_ENST00000411384.1_RNA	p.A3540T	NM_001270974.1	NP_001257903.1	2	2	4	2.208062	Q4G0P3	HYDIN_HUMAN		63	10768	-		Ovarian(137;0.0654)	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	1	1	hg19	c.10618G>A	CCDS59269.1	1	.	.	.	.	.	.	.	.	.	.	C	2.768	-0.256259	0.05829	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00882	5.58	4.66	0.836	0.18891	4.66	0.836	0.18891	.	0.563128	0.13263	U	0.401146	T	0.00440	0.0014	N	0.03608	-0.345	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.51028	-0.8757	10	0.17832	T	0.49	.	0.1104	0.00055	0.365:0.2089:0.1834:0.2427	.	3539	F8WD23	.	T	3540;3539	ENSP00000377197:A3540T	ENSP00000313052:A3539T	A	-	1	0	0	HYDIN	69466263	69466263	0.999000	0.42202	0.992000	0.48379	0.039000	0.13416	0.722000	0.25925	0.614000	0.30107	-0.463000	0.05309	GCG	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.507	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3	1	0	1	2	2	2	2	0	0	0	0	23	23	23	27	1	3.300000	-19.998650	1	0.370000			0	30	29	0	90	87	0		1			0	0	23	0	0	1	0	0	0	0	0	0	30	90
IRF8	3394	broad.mit.edu	37	16	85946826	85946826	+	Silent	SNP	G	G	A	rs146360039		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr16:85946826G>A	ENST00000268638.5	+	5	959	c.537G>A	c.(535-537)gcG>gcA	p.A179A	IRF8_ENST00000562492.1_5'Flank	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	179					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				ACTGGTGGGCGCAGCAGCCCA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18026	0.0		0.0	False		,,,				2504	0.0					ENST00000268638.5	0.230000	3.000000e-02	0.170000	0.070000	0.110000	0.126837	0.110000	0.120000																										0				24						c.(535-537)gcG>gcA		interferon regulatory factor 8		G		8,4388	14.3+/-33.2	0,8,2190	65.0	69.0	68.0		537	-3.1	0.1	16	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	IRF8	NM_002163.2		0,9,6489	AA,AG,GG		0.0116,0.182,0.0693		179/427	85946826	9,12987	2198	4300	6498	SO:0001819	synonymous_variant	3394	17	121412	45				g.chr16:85946826G>A	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.537G>A	chr16.hg19:g.85946826G>A		1					IRF8_ENST00000562492.1_5'Flank	p.A179A	NM_002163.2	NP_002154.1	2	2	4	2.208062	Q02556	IRF8_HUMAN		5	959	+		Prostate(104;0.0771)	A0AV82	Silent	SNP	ENST00000268638.5	0	1	hg19	c.537G>A	CCDS10956.1	0																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.617	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	0	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	3.300000	-2.531501	1	0.370000	NM_002163		0	6	6	0	400	395	0		1	0		0	0	49	0	0	9.638836e-01	5.519594e-01	0	0	0	113	0	6	400
COASY	80347	broad.mit.edu	37	17	40714771	40714771	+	Missense_Mutation	SNP	G	G	A	rs368532520		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr17:40714771G>A	ENST00000393818.2	+	1	587	c.131G>A	c.(130-132)gGc>gAc	p.G44D	RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000449624.1_Intron|COASY_ENST00000420359.1_Missense_Mutation_p.G44D|COASY_ENST00000590958.1_Missense_Mutation_p.G73D|COASY_ENST00000421097.2_Missense_Mutation_p.G44D	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	44					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CTGCAGCCGGGCATGAGCCTG	0.662																																						ENST00000393818.2	0.180000	2.000000e-02	0.140000	0.050000	0.090000	0.100443	0.090000	0.080000																										0				21						c.(130-132)gGc>gAc		CoA synthase		G	ASP/GLY,ASP/GLY,ASP/GLY,ASP/GLY,	2,4402		0,2,2200	37.0	47.0	44.0		131,131,218,131,	4.9	1.0	17		44	0,8592		0,0,4296	no	missense,missense,missense,missense,intron	COASY	NM_001042529.1,NM_001042530.1,NM_001042532.2,NM_025233.5,NM_001042531.1	94,94,94,94,	0,2,6496	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,	44/565,44/565,73/594,44/565,	40714771	2,12994	2202	4296	6498	SO:0001583	missense	80347	3	121388	39				g.chr17:40714771G>A	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.131G>A	chr17.hg19:g.40714771G>A	ENSP00000377406:p.Gly44Asp	1					COASY_ENST00000420359.1_Missense_Mutation_p.G44D|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000590958.1_Missense_Mutation_p.G73D|COASY_ENST00000449624.1_Intron|COASY_ENST00000421097.2_Missense_Mutation_p.G44D	p.G44D	NM_025233.6	NP_079509.5	2	2	4	2.240639	Q13057	COASY_HUMAN		1	587	+		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	0	1	hg19	c.131G>A	CCDS11429.1	0	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783426	0.70222	4.54E-4	0.0	ENSG00000068120	ENST00000421097;ENST00000420359;ENST00000393818;ENST00000426807	T;T	0.33438	1.41;1.41	5.84	4.88	0.63580	5.84	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.24736	0.0600	L	0.32530	0.975	0.80722	D	1	P;B	0.41041	0.736;0.043	B;B	0.38500	0.275;0.024	T	0.03068	-1.1076	10	0.48119	T	0.1	-18.0729	12.532	0.56120	0.0803:0.0:0.9197:0.0	.	73;44	Q13057-2;Q13057	.;COASY_HUMAN	D	73;44;44;44	ENSP00000413338:G44D;ENSP00000377406:G44D	ENSP00000377406:G44D	G	+	2	0	0	COASY	37968297	37968297	1.000000	0.71417	0.997000	0.53966	0.854000	0.48673	6.902000	0.75699	1.483000	0.48342	0.561000	0.74099	GGC	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.662	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	3.300000	-1.930375	0	0.370000	NM_025233		0	6	6	0	507	498	0		1	0		0	0	69	0	0	9.631976e-01	4.133932e-01	0	0	0	107	0	6	507
DHX8	1659	broad.mit.edu	37	17	41570293	41570293	+	Missense_Mutation	SNP	C	C	T	rs146727331	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr17:41570293C>T	ENST00000262415.3	+	6	820	c.748C>T	c.(748-750)Cgg>Tgg	p.R250W	DHX8_ENST00000540306.1_Missense_Mutation_p.R250W	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	250					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GGATAGATGGCGGGATAAGCA	0.507																																					NSCLC(56;1548 1661 49258 49987)	ENST00000262415.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				42						c.(748-750)Cgg>Tgg		DEAH (Asp-Glu-Ala-His) box polypeptide 8		C	TRP/ARG	0,4406		0,0,2203	106.0	107.0	107.0		748	0.8	1.0	17	dbSNP_134	107	1,8599	1.2+/-3.3	0,1,4299	yes	missense	DHX8	NM_004941.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	250/1221	41570293	1,13005	2203	4300	6503	SO:0001583	missense	1659	7	121412	42				g.chr17:41570293C>T	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.748C>T	chr17.hg19:g.41570293C>T	ENSP00000262415:p.Arg250Trp	1					DHX8_ENST00000540306.1_Missense_Mutation_p.R250W	p.R250W	NM_004941.1	NP_004932.1	2	2	4	2.240639	Q14562	DHX8_HUMAN		6	820	+		Breast(137;0.00908)		Missense_Mutation	SNP	ENST00000262415.3	1	1	hg19	c.748C>T	CCDS11464.1	1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901639	0.52227	0.0	1.16E-4	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.56611	0.45;0.45	5.33	0.831	0.18860	5.33	0.831	0.18860	.	0.131203	0.50627	D	0.000103	T	0.35128	0.0921	N	0.08118	0	0.47183	D	0.999343	D;D	0.69078	0.997;0.995	P;P	0.51657	0.627;0.676	T	0.20672	-1.0268	10	0.59425	D	0.04	.	4.9162	0.13847	0.4807:0.3354:0.1111:0.0729	.	250;250	F5H658;Q14562	.;DHX8_HUMAN	W	250	ENSP00000437886:R250W;ENSP00000262415:R250W	ENSP00000262415:R250W	R	+	1	2	2	DHX8	38925819	38925819	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	3.269000	0.51592	0.205000	0.20568	-0.293000	0.09583	CGG	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.507	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	107	1	3.300000	-20.000000	1	0.370000			0	117	114	0	339	333	1		1	1		0	0	109	0	0	1	9.958452e-01	0	5	0	21	0	117	339
DNAH2	146754	broad.mit.edu	37	17	7727588	7727588	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr17:7727588C>T	ENST00000572933.1	+	76	13088	c.11628C>T	c.(11626-11628)atC>atT	p.I3876I	DNAH2_ENST00000389173.2_Silent_p.I3876I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3876	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGGCCCCCATCGCTGCTCGGC	0.652																																						ENST00000572933.1	0.950000	4.800000e-01	0.860000	0.590000	0.720000	0.729876	0.720000	0.720000																										0				189						c.(11626-11628)atC>atT		dynein, axonemal, heavy chain 2							36.0	35.0	35.0					17																	7727588		2203	4299	6502	SO:0001819	synonymous_variant	146754	3	121196	38				g.chr17:7727588C>T	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11628C>T	chr17.hg19:g.7727588C>T		1					DNAH2_ENST00000389173.2_Silent_p.I3876I	p.I3876I			0	1	1	1.363146	Q9P225	DYH2_HUMAN		76	13088	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	1	1	hg19	c.11628C>T	CCDS32551.1	0																																																																																								0.226994		TCGA-IB-AAUU-01A-11D-A377-08	0.652	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	42	1	3.300000	-20.000000	1	0.370000	NM_020877		0	23	23	0	114	111	1		1	1		0	0	44	0	0	9.999996e-01	6.289709e-01	0	8	0	4	0	23	114
TANC2	26115	broad.mit.edu	37	17	61483573	61483573	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr17:61483573G>A	ENST00000424789.2	+	19	3306	c.3302G>A	c.(3301-3303)cGc>cAc	p.R1101H	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.R1101H|AC015923.1_ENST00000431604.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1101					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AAGCAGGGCCGCACTCCCCTG	0.512											OREG0024637	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000424789.2	0.150000	1.000000e-02	0.110000	0.040000	0.070000	0.079379	0.070000	0.060000																										0				44						c.(3301-3303)cGc>cAc		tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2							114.0	112.0	113.0					17																	61483573		1972	4167	6139	SO:0001583	missense	26115	0	0					g.chr17:61483573G>A	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3302G>A	chr17.hg19:g.61483573G>A	ENSP00000387593:p.Arg1101His	1		OREG0024637	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1054	AC015923.1_ENST00000431604.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.R1101H|RP11-269G24.3_ENST00000583552.1_RNA	p.R1101H	NM_025185.3	NP_079461.2	1	2	3	1.969332	Q9HCD6	TANC2_HUMAN		19	3306	+			Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	0	1	hg19	c.3302G>A	CCDS45754.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.398436	0.96030	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.66280	-0.2;-0.2	5.48	5.48	0.80851	5.48	5.48	0.80851	Ankyrin repeat-containing domain (4);	0.055575	0.64402	D	0.000001	T	0.76357	0.3976	L	0.50919	1.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.77368	-0.2614	10	0.66056	D	0.02	.	19.3674	0.94469	0.0:0.0:1.0:0.0	.	1101;1101	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	H	1101	ENSP00000374171:R1101H;ENSP00000387593:R1101H	ENSP00000374171:R1101H	R	+	2	0	0	TANC2	58837305	58837305	1.000000	0.71417	0.966000	0.40874	0.973000	0.67179	9.810000	0.99221	2.587000	0.87381	0.462000	0.41574	CGC	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.512	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	102	1	3.300000	-2.083755	0	0.370000			0	5	5	0	475	472	0		1	0		0	0	104	0	0	9.368114e-01	1.804077e-04	0	0	0	2	0	5	475
HMG20B	10362	broad.mit.edu	37	19	3574395	3574395	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr19:3574395C>T	ENST00000333651.6	+	4	237	c.162C>T	c.(160-162)cgC>cgT	p.R54R	MFSD12_ENST00000591878.1_5'Flank	NM_006339.2	NP_006330.2	Q9P0W2	HM20B_HUMAN	high mobility group 20B	54					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of protein sumoylation (GO:0033234)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAAGAAACGCGGCTGGCCCA	0.672																																						ENST00000333651.6	1.000000	8.900000e-01	1.000000	0.990000	0.990000	0.993476	0.990000	1.000000																										0				1						c.(160-162)cgC>cgT		high mobility group 20B							11.0	12.0	12.0					19																	3574395		1887	4075	5962	SO:0001819	synonymous_variant	10362	0	0					g.chr19:3574395C>T	BC003505	CCDS45919.1	19p13.3	2011-07-01	2011-04-05		ENSG00000064961	ENSG00000064961		"""High mobility group / Non-canonical"""	5002	protein-coding gene	gene with protein product	"""HMG box domain containing 2"""	605535	"""high-mobility group 20B"""			10773667	Standard	NM_006339		Approved	SOXL, HMGX2, BRAF35, SMARCE1r, BRAF25, HMGXB2	uc002lya.3	Q9P0W2	OTTHUMG00000150437	ENST00000333651.6:c.162C>T	chr19.hg19:g.3574395C>T		1					MFSD12_ENST00000591878.1_5'Flank	p.R54R	NM_006339.2	NP_006330.2	0	3	3	1.729192	Q9P0W2	HM20B_HUMAN		4	237	+		Hepatocellular(1079;0.137)	A6NMS5|D6W616|Q6IBP8|Q8NBD5|Q9HD21|Q9Y491|Q9Y4A2	Silent	SNP	ENST00000333651.6	0	1	hg19	c.162C>T	CCDS45919.1	1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159407	0.38119	.	.	ENSG00000064961	ENST00000262949	.	.	.	4.03	-8.05	0.01106	4.03	-8.05	0.01106	.	0.000000	0.64402	U	0.000001	T	0.49745	0.1575	.	.	.	0.58432	D	0.999991	.	.	.	.	.	.	T	0.62067	-0.6932	6	0.72032	D	0.01	-7.5678	2.2814	0.04115	0.4628:0.0954:0.2597:0.182	.	.	.	.	W	59	.	ENSP00000262949:R59W	R	+	1	2	2	HMG20B	3525395	3525395	0.000000	0.05858	0.325000	0.25375	0.925000	0.55904	-2.871000	0.00720	-3.088000	0.00248	0.491000	0.48974	CGG	0.441316		TCGA-IB-AAUU-01A-11D-A377-08	0.672	HMG20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318088.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	3.300000	-19.998840	1	0.370000	NM_006339		0	11	10	0	33	32	0		1	1		0	0	12	0	0	9.987482e-01	9.999996e-01	0	34	0	90	0	11	33
ZNF700	90592	broad.mit.edu	37	19	12060731	12060731	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr19:12060731C>T	ENST00000254321.5	+	4	2035	c.1892C>T	c.(1891-1893)tCt>tTt	p.S631F	CTD-2006C1.12_ENST00000586394.1_RNA|ZNF700_ENST00000482090.1_Missense_Mutation_p.S613F|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	631					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						GCCTTCAGATCTGCCTCAAAC	0.438																																						ENST00000254321.5	1.000000	9.500000e-01	1.000000	0.990000	0.990000	0.997413	0.990000	1.000000																									ZNF700/MAST1_ENST00000251472(2)	0				33						c.(1891-1893)tCt>tTt		zinc finger protein 700							84.0	83.0	83.0					19																	12060731		2203	4300	6503	SO:0001583	missense	90592	0	0					g.chr19:12060731C>T	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1892C>T	chr19.hg19:g.12060731C>T	ENSP00000254321:p.Ser631Phe	1					ZNF700_ENST00000482090.1_Missense_Mutation_p.S613F|ZNF763_ENST00000538752.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000590798.1_Intron	p.S631F	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	1	3	4	1.989907	Q9H0M5	ZN700_HUMAN		4	2035	+			B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	1	0	hg19	c.1892C>T	CCDS32915.1	1	.	.	.	.	.	.	.	.	.	.	c	0.399	-0.919390	0.02396	.	.	ENSG00000196757	ENST00000254321	T	0.03580	3.88	0.563	-1.13	0.09775	0.563	-1.13	0.09775	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09024	0.0223	M	0.62723	1.935	0.09310	N	1	D	0.67145	0.996	D	0.64877	0.93	T	0.24512	-1.0158	9	0.10636	T	0.68	.	7.1331	0.25512	0.0:0.7162:0.2837:0.0	.	631	Q9H0M5	ZN700_HUMAN	F	631	ENSP00000254321:S631F	ENSP00000254321:S631F	S	+	2	0	0	ZNF700	11921731	11921731	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.497000	0.02289	-0.437000	0.07243	0.313000	0.20887	TCT	0.486008		TCGA-IB-AAUU-01A-11D-A377-08	0.438	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	1	0	1	2	2	2	2	0	0	0	0	148	148	148	146	1	3.300000	-3.201776	1	0.370000	NM_144566		0	74	71	0	344	340	1		1	1		0	0	148	0	0	1	9.956576e-01	0	13	0	28	0	74	344
PSG6	5675	broad.mit.edu	37	19	43420517	43420517	+	Missense_Mutation	SNP	T	T	C	rs140507212		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr19:43420517T>C	ENST00000292125.2	-	2	231	c.187A>G	c.(187-189)Act>Gct	p.T63A	PSG6_ENST00000402603.4_Missense_Mutation_p.T63A|PSG6_ENST00000601833.1_5'UTR|PSG6_ENST00000187910.2_Missense_Mutation_p.T63A	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	63	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				ATGTAGCCAGTAAGATTCTGG	0.463																																						ENST00000292125.2	1.000000	0	1.000000	0.010000	0.030000	0.197100	0.030000	0.040000																										0				44						c.(187-189)Act>Gct		pregnancy specific beta-1-glycoprotein 6							216.0	215.0	215.0					19																	43420517		2202	4299	6501	SO:0001583	missense	5675	16	121316	48				g.chr19:43420517T>C		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.187A>G	chr19.hg19:g.43420517T>C	ENSP00000292125:p.Thr63Ala	1					PSG6_ENST00000187910.2_Missense_Mutation_p.T63A|PSG6_ENST00000601833.1_5'UTR|PSG6_ENST00000402603.4_Missense_Mutation_p.T63A	p.T63A	NM_002782.4	NP_002773.1	1	3	4	2.057851	Q00889	PSG6_HUMAN		2	231	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	0	1	hg19	c.187A>G	CCDS12613.1	0	.	.	.	.	.	.	.	.	.	.	N	0.008	-1.914902	0.00503	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.01464	4.86;4.86;4.86	1.58	-3.16	0.05217	1.58	-3.16	0.05217	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00784	0.0026	N	0.11651	0.15	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.002;0.001;0.006	T	0.46020	-0.9221	9	0.05959	T	0.93	.	0.9301	0.01333	0.2963:0.2272:0.3254:0.1511	.	63;63;63	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	A	63	ENSP00000187910:T63A;ENSP00000385736:T63A;ENSP00000292125:T63A	ENSP00000187910:T63A	T	-	1	0	0	PSG6	48112357	48112357	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.985000	0.00163	-2.639000	0.00430	-1.366000	0.01203	ACT	0.511097		TCGA-IB-AAUU-01A-11D-A377-08	0.463	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	0	0	0	2	2	2	2	0	0	0	0	353	353	353	348	1	3.300000	-4.032797	1	0.370000	NM_002782		0	7	6	0	1311	1283	0		1			0	0	353	0	0	9.789671e-01	0	0	0	0	0	0	7	1311
ERCC2	2068	broad.mit.edu	37	19	45867502	45867502	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr19:45867502G>A	ENST00000391945.4	-	9	883	c.806C>T	c.(805-807)aCg>aTg	p.T269M	ERCC2_ENST00000391944.3_Missense_Mutation_p.T191M|ERCC2_ENST00000485403.2_Missense_Mutation_p.T245M|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391940.4_Missense_Mutation_p.T245M	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	269	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCTGAGCACCGTCTTCTGCAG	0.692			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													ENST00000391945.4	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.997505	0.990000	1.000000			yes	Rec		Xeroderma pigmentosum (D)	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	19q13.2-q13.3	2068	Mis, N, F, S	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""				E	E		skin basal cell, skin squamous cell, melanoma			0				9						c.(805-807)aCg>aTg	Nucleotide excision repair (NER)	excision repair cross-complementation group 2							34.0	36.0	36.0					19																	45867502		2202	4298	6500	SO:0001583	missense	2068	0	0		Xeroderma Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	g.chr19:45867502G>A		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.806C>T	chr19.hg19:g.45867502G>A	ENSP00000375809:p.Thr269Met	1					ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391944.3_Missense_Mutation_p.T191M|ERCC2_ENST00000391940.4_Missense_Mutation_p.T245M|ERCC2_ENST00000485403.2_Missense_Mutation_p.T245M	p.T269M	NM_000400.3	NP_000391.1	4	6	10	2.664688	P18074	ERCC2_HUMAN		9	883	-		Ovarian(192;0.0728)|all_neural(266;0.112)	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	1	1	hg19	c.806C>T	CCDS33049.1	1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485655	0.63962	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.63913	-0.07;-0.07;-0.07	4.72	4.72	0.59763	4.72	4.72	0.59763	Helicase-like, DEXD box c2 type (1);Domain of unknown function DUF1227 (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.359147	0.31071	N	0.008304	T	0.71091	0.3299	M	0.72118	2.19	0.80722	D	1	P;P;B	0.47841	0.468;0.901;0.04	B;P;B	0.51487	0.376;0.671;0.264	T	0.74748	-0.3560	10	0.59425	D	0.04	-24.3907	15.5543	0.76180	0.0:0.0:1.0:0.0	.	191;245;269	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	M	219;245;269;191;245	ENSP00000375809:T269M;ENSP00000375808:T191M;ENSP00000375804:T245M	ENSP00000375804:T245M	T	-	2	0	0	ERCC2	50559342	50559342	1.000000	0.71417	0.997000	0.53966	0.662000	0.39071	4.390000	0.59646	2.601000	0.87937	0.561000	0.74099	ACG	0.618459		TCGA-IB-AAUU-01A-11D-A377-08	0.692	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	3.300000	-20.000000	1	0.370000	NM_000400		0	45	45	0	275	270	0		1	1		0	0	30	0	0	1	9.791805e-01	0	7	0	33	0	45	275
KLK4	9622	broad.mit.edu	37	19	51411880	51411880	+	Missense_Mutation	SNP	C	C	T	rs530069905	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr19:51411880C>T	ENST00000324041.1	-	3	429	c.430G>A	c.(430-432)Gcg>Acg	p.A144T	KLK4_ENST00000431178.2_Missense_Mutation_p.A95T|KLK4_ENST00000597441.1_5'Flank	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	144	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		GAGTTCCCCGCGGTAGGGCAC	0.602																																						ENST00000324041.1	0.260000	4.000000e-02	0.190000	0.070000	0.120000	0.139946	0.120000	0.120000																										0				19						c.(430-432)Gcg>Acg		kallikrein-related peptidase 4							102.0	79.0	87.0					19																	51411880		2203	4300	6503	SO:0001583	missense	9622	0	0					g.chr19:51411880C>T	AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.430G>A	chr19.hg19:g.51411880C>T	ENSP00000326159:p.Ala144Thr	1					KLK4_ENST00000597441.1_5'Flank|KLK4_ENST00000431178.2_Missense_Mutation_p.A95T	p.A144T	NM_004917.3	NP_004908.3	0	2	2	1.683231	Q9Y5K2	KLK4_HUMAN		3	429	-		all_neural(266;0.026)	Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Missense_Mutation	SNP	ENST00000324041.1	0	1	hg19	c.430G>A	CCDS12809.1	0	.	.	.	.	.	.	.	.	.	.	c	6.881	0.532035	0.13127	.	.	ENSG00000167749	ENST00000324041;ENST00000431178	D;D	0.89415	-2.51;-2.51	3.99	-7.97	0.01139	3.99	-7.97	0.01139	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.234540	0.06113	N	0.667494	T	0.76307	0.3969	N	0.25201	0.72	0.09310	N	1	B;B	0.33964	0.434;0.248	B;B	0.27076	0.076;0.012	T	0.68296	-0.5446	10	0.41790	T	0.15	.	8.5105	0.33215	0.171:0.1988:0.5598:0.0703	.	95;144	Q96JD7;Q9Y5K2	.;KLK4_HUMAN	T	144;95	ENSP00000326159:A144T;ENSP00000399448:A95T	ENSP00000326159:A144T	A	-	1	0	0	KLK4	56103692	56103692	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.743000	0.00797	-2.474000	0.00527	-1.157000	0.01802	GCG	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.602	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464449.1	0	0	1	2	13	2	2	1	1	1	1	63	63	63	63	1	3.300000	-3.084110	1	0.370000	NM_004917		0	5	5	0	223	219	0		0	0		1	0	63	0	0	4.049618e-02	7.905138e-04	0	0	0	2	0	5	223
ADORA3	140	broad.mit.edu	37	1	112042946	112042946	+	Missense_Mutation	SNP	C	C	T	rs143962803	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr1:112042946C>T	ENST00000241356.4	-	2	988	c.583G>A	c.(583-585)Gcc>Acc	p.A195T	ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Intron	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	195					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.A195T(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	AGATAGATGGCGCACATGACA	0.433													C|||	3	0.000599042	0.0023	0.0	5008	,	,		25187	0.0		0.0	False		,,,				2504	0.0					ENST00000241356.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.A195T(1)	lung(1)	12						c.(583-585)Gcc>Acc		adenosine A3 receptor	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	C	THR/ALA,,	24,4382	32.6+/-62.9	0,24,2179	145.0	136.0	139.0		583,,	2.1	0.2	1	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	yes	missense,intron,intron	ADORA3	NM_000677.3,NM_001081976.1,NM_020683.6	58,,	0,25,6478	TT,TC,CC		0.0116,0.5447,0.1922	benign,,	195/319,,	112042946	25,12981	2203	4300	6503	SO:0001583	missense	140	56	121412	51				g.chr1:112042946C>T	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.583G>A	chr1.hg19:g.112042946C>T	ENSP00000241356:p.Ala195Thr	1					ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Intron|ADORA3_ENST00000369717.4_Intron	p.A195T	NM_000677.3	NP_000668.1	1	2	3	1.940352	P33765	AA3R_HUMAN		2	988	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000241356.4	1	1	hg19	c.583G>A	CCDS839.1	1	.	.	.	.	.	.	.	.	.	.	C	9.584	1.124357	0.20959	0.005447	1.16E-4	ENSG00000121933	ENST00000241356	T	0.37058	1.22	5.01	2.07	0.26955	5.01	2.07	0.26955	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.10852	0.0265	L	0.39467	1.215	0.23174	N	0.998173	P	0.41784	0.762	B	0.36534	0.227	T	0.11717	-1.0576	9	0.27785	T	0.31	.	8.8535	0.35214	0.0:0.6997:0.0:0.3003	.	195	P33765	AA3R_HUMAN	T	195	ENSP00000241356:A195T	ENSP00000241356:A195T	A	-	1	0	0	ADORA3	111844469	111844469	0.077000	0.21312	0.173000	0.22940	0.021000	0.10359	1.197000	0.32211	0.227000	0.20999	0.655000	0.94253	GCC	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.433	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	105	1	3.300000	-3.017764	1	0.370000	NM_000677, NM_020683		0	139	136	0	321	312	1		1	0		0	0	107	0	0	1	6.737607e-01	0	0	0	7	0	139	321
SPTA1	6708	broad.mit.edu	37	1	158585164	158585164	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr1:158585164C>T	ENST00000368147.4	-	48	6810	c.6630G>A	c.(6628-6630)aaG>aaA	p.K2210K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2210					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTAGTTGACGCTTCATCGCCT	0.483																																						ENST00000368147.4	0.140000	0	0.100000	0.030000	0.060000	0.071525	0.060000	0.080000																										0				307						c.(6628-6630)aaG>aaA		spectrin, alpha, erythrocytic 1							166.0	161.0	162.0					1																	158585164		1934	4147	6081	SO:0001819	synonymous_variant	6708	0	0					g.chr1:158585164C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6630G>A	chr1.hg19:g.158585164C>T		1						p.K2210K	NM_003126.2	NP_003117.2	2	2	4	2.208983	P02549	SPTA1_HUMAN		48	6810	-	all_hematologic(112;0.0378)		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	0	1	hg19	c.6630G>A	CCDS41423.1	0																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	0	0	1	2	2	2	2	0	0	0	0	119	119	119	116	1	3.300000	-2.960638	1	0.370000	NM_003126		0	6	6	0	704	688	0		1			0	0	119	0	0	9.625253e-01	0	0	0	0	0	0	6	704
DCAF6	55827	broad.mit.edu	37	1	167960489	167960489	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr1:167960489C>T	ENST00000312263.6	+	6	804	c.600C>T	c.(598-600)tgC>tgT	p.C200C	DCAF6_ENST00000367840.3_Silent_p.C200C|DCAF6_ENST00000470919.1_3'UTR|DCAF6_ENST00000367843.3_Silent_p.C200C|DCAF6_ENST00000432587.2_Silent_p.C169C	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	200					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						TTGCTATTTGCCCACCAATAC	0.393																																						ENST00000312263.6	0.160000	1.000000e-02	0.120000	0.030000	0.070000	0.083120	0.070000	0.080000																										0				36						c.(598-600)tgC>tgT		DDB1 and CUL4 associated factor 6							147.0	132.0	137.0					1																	167960489		2203	4300	6503	SO:0001819	synonymous_variant	55827	0	0					g.chr1:167960489C>T	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.600C>T	chr1.hg19:g.167960489C>T		1					DCAF6_ENST00000367843.3_Silent_p.C200C|DCAF6_ENST00000432587.2_Silent_p.C169C|DCAF6_ENST00000470919.1_3'UTR|DCAF6_ENST00000367840.3_Silent_p.C200C	p.C200C	NM_001017977.2	NP_001017977.1	2	2	4	2.208983	Q58WW2	DCAF6_HUMAN		6	804	+			A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Silent	SNP	ENST00000312263.6	0	1	hg19	c.600C>T	CCDS30933.1	0																																																																																								0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.393	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	0	0	1	2	16	4	2	1	1	1	1	114	114	114	114	1	3.300000	-2.291945	0	0.370000	NM_018442		0	5	5	0	522	514	0		0	0		1	0	114	0	0	1.133879e-02	1.034541e-02	0	0	0	64	0	5	522
ZNF362	149076	broad.mit.edu	37	1	33745956	33745956	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr1:33745956G>A	ENST00000539719.1	+	5	751	c.581G>A	c.(580-582)cGc>cAc	p.R194H	ZNF362_ENST00000373428.5_Missense_Mutation_p.R194H	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	194				R -> L (in Ref. 1; AAL55863). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAACGCGGCCGCAAAAAGATC	0.647																																					Pancreas(162;1431 2676 35353 38425)	ENST00000539719.1	1.000000	7.000000e-02	1.000000	0.130000	0.220000	0.395069	0.220000	0.180000																										0				10						c.(580-582)cGc>cAc		zinc finger protein 362							24.0	26.0	25.0					1																	33745956		2203	4300	6503	SO:0001583	missense	149076	0	0					g.chr1:33745956G>A		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.581G>A	chr1.hg19:g.33745956G>A	ENSP00000446335:p.Arg194His	1					ZNF362_ENST00000373428.5_Missense_Mutation_p.R194H	p.R194H	NM_152493.2	NP_689706.2	1	3	4	1.977741	Q5T0B9	ZN362_HUMAN		5	751	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	Q8WYU4	Missense_Mutation	SNP	ENST00000539719.1	0	1	hg19	c.581G>A	CCDS377.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.713649	0.96830	.	.	ENSG00000160094	ENST00000483388;ENST00000539719;ENST00000373428	T;T	0.09163	3.01;3.01	5.99	5.99	0.97316	5.99	5.99	0.97316	.	0.468737	0.18085	N	0.152172	T	0.37404	0.1002	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.02512	-1.1148	10	0.87932	D	0	-36.2752	18.0311	0.89285	0.0:0.0:1.0:0.0	.	194	Q5T0B9	ZN362_HUMAN	H	181;194;194	ENSP00000446335:R194H;ENSP00000362527:R194H	ENSP00000362527:R194H	R	+	2	0	0	ZNF362	33518543	33518543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.314000	0.96306	2.857000	0.98124	0.650000	0.86243	CGC	0.479726		TCGA-IB-AAUU-01A-11D-A377-08	0.647	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	0	0	1	2	2	2	2	0	0	0	0	21	21	21	19	1	3.300000	-2.743451	1	0.370000	NM_152493		0	5	5	0	182	179	0		1	0		0	0	21	0	0	9.357119e-01	2.145633e-01	0	0	0	27	0	5	182
GLMN	11146	broad.mit.edu	37	1	92755861	92755861	+	Missense_Mutation	SNP	T	T	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr1:92755861T>A	ENST00000370360.3	-	5	369	c.288A>T	c.(286-288)ttA>ttT	p.L96F	GLMN_ENST00000534881.1_Missense_Mutation_p.L96F	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	96					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TTGGATTGCATAACTATAAAA	0.308									Multiple Glomus Tumors (of the Skin), Familial																													ENST00000370360.3	1.000000	8.300000e-01	1.000000	0.960000	0.990000	0.982261	0.990000	1.000000																										0				17						c.(286-288)ttA>ttT		glomulin, FKBP associated protein							63.0	65.0	64.0					1																	92755861		2202	4299	6501	SO:0001583	missense	11146	1	121394	28	Multiple Glomus Tumors (of the Skin), Familial	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	g.chr1:92755861T>A	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.288A>T	chr1.hg19:g.92755861T>A	ENSP00000359385:p.Leu96Phe	1					GLMN_ENST00000534881.1_Missense_Mutation_p.L96F	p.L96F	NM_053274.2	NP_444504.1	1	3	4	1.977741	Q92990	GLMN_HUMAN		5	369	-		all_lung(203;0.00827)|Lung NSC(277;0.0295)	Q5VVC3|Q9BVE8	Missense_Mutation	SNP	ENST00000370360.3	1	1	hg19	c.288A>T	CCDS738.1	1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543108	0.65198	.	.	ENSG00000174842	ENST00000370360;ENST00000534881	T;T	0.50548	0.74;0.74	5.65	1.87	0.25490	5.65	1.87	0.25490	.	0.418315	0.26231	N	0.025566	T	0.40067	0.1102	L	0.56769	1.78	0.47737	D	0.9995	D;D	0.59767	0.986;0.982	P;P	0.62813	0.907;0.875	T	0.50338	-0.8840	10	0.66056	D	0.02	-2.3571	0.2648	0.00223	0.2109:0.2274:0.2068:0.3549	.	96;96	B4DJ85;Q92990	.;GLMN_HUMAN	F	96	ENSP00000359385:L96F;ENSP00000440156:L96F	ENSP00000359385:L96F	L	-	3	2	2	GLMN	92528449	92528449	0.519000	0.26242	1.000000	0.80357	0.995000	0.86356	-0.704000	0.05058	1.033000	0.39918	0.533000	0.62120	TTA	0.479726		TCGA-IB-AAUU-01A-11D-A377-08	0.308	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028358.1	0	0	1	2	2	2	2	0	0	0	0	98	98	98	99	1	3.300000	-20.000000	1	0.370000	NM_007070		0	50	50	0	256	252	1		1	0		0	0	98	0	0	1	2.786534e-02	0	0	0	2	0	50	256
HEATR1	55127	broad.mit.edu	37	1	236762848	236762848	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr1:236762848G>A	ENST00000366582.3	-	4	550	c.436C>T	c.(436-438)Cga>Tga	p.R146*	HEATR1_ENST00000366581.2_Nonsense_Mutation_p.R146*|HEATR1_ENST00000483073.1_5'UTR	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	146					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGTATGACTCGCACAAATATT	0.368																																						ENST00000366582.3	0.200000	2.000000e-02	0.150000	0.060000	0.100000	0.109884	0.100000	0.090000																										0				87						c.(436-438)Cga>Tga		HEAT repeat containing 1							129.0	130.0	129.0					1																	236762848		2203	4300	6503	SO:0001587	stop_gained	55127	0	0					g.chr1:236762848G>A	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.436C>T	chr1.hg19:g.236762848G>A	ENSP00000355541:p.Arg146*	1					HEATR1_ENST00000483073.1_5'UTR|HEATR1_ENST00000366581.2_Nonsense_Mutation_p.R146*	p.R146*	NM_018072.5	NP_060542.4	2	2	4	2.206397	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)	4	550	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	Q5T3Q8|Q6P197|Q9NW23	Nonsense_Mutation	SNP	ENST00000366582.3	0	1	hg19	c.436C>T	CCDS31066.1	0	.	.	.	.	.	.	.	.	.	.	G	38	7.045839	0.98025	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	.	.	.	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6914	0.77457	0.0:0.0:0.855:0.145	.	.	.	.	X	146	.	ENSP00000355540:R146X	R	-	1	2	2	HEATR1	234829471	234829471	1.000000	0.71417	0.945000	0.38365	0.991000	0.79684	1.649000	0.37281	2.812000	0.96745	0.561000	0.74099	CGA	0.540146		TCGA-IB-AAUU-01A-11D-A377-08	0.368	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	0	0	1	2	2	2	2	0	0	0	0	90	90	90	87	1	3.300000	-2.380664	0	0.370000	XM_375853		0	6	6	0	463	458	0		1	0		0	0	90	0	0	9.640146e-01	1.024651e-02	0	0	0	10	0	6	463
PREX1	57580	broad.mit.edu	37	20	47262580	47262580	+	Silent	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr20:47262580G>A	ENST00000371941.3	-	26	3343	c.3321C>T	c.(3319-3321)atC>atT	p.I1107I	PREX1_ENST00000396220.1_Silent_p.I1107I	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1107					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGGGCTCTGTGATGGTGGACA	0.597																																						ENST00000371941.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				110						c.(3319-3321)atC>atT		phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1							58.0	55.0	56.0					20																	47262580		2203	4300	6503	SO:0001819	synonymous_variant	57580	0	0					g.chr20:47262580G>A	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3321C>T	chr20.hg19:g.47262580G>A		1					PREX1_ENST00000396220.1_Silent_p.I1107I	p.I1107I	NM_020820.3	NP_065871	2	2	4	2.168958	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)	26	3343	-			E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	1	1	hg19	c.3321C>T	CCDS13410.1	1																																																																																								0.532572		TCGA-IB-AAUU-01A-11D-A377-08	0.597	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	34	1	3.300000	-20.000000	1	0.370000	NM_020820		0	73	71	0	182	181	1		1	1		0	0	36	0	0	1	9.996427e-01	0	2	0	31	0	73	182
BACH1	571	broad.mit.edu	37	21	30699086	30699086	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr21:30699086C>T	ENST00000399921.1	+	3	1184	c.941C>T	c.(940-942)tCc>tTc	p.S314F	BACH1_ENST00000286800.3_Missense_Mutation_p.S314F	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						CACAATTCTTCCATAGACCCT	0.388																																						ENST00000399921.1	1.000000	7.600000e-01	1.000000	0.830000	0.910000	0.917420	0.910000	1.000000																										0				27						c.(940-942)tCc>tTc		BTB and CNC homology 1, basic leucine zipper transcription factor 1							121.0	127.0	125.0					21																	30699086		2203	4299	6502	SO:0001583	missense	571	0	0					g.chr21:30699086C>T	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.941C>T	chr21.hg19:g.30699086C>T	ENSP00000382805:p.Ser314Phe	0					BACH1_ENST00000286800.3_Missense_Mutation_p.S314F	p.S314F	NM_206866.1	NP_996749.1	0	1	1	1.607975	Q9BX63	FANCJ_HUMAN		3	1184	+			Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000399921.1	1	1	hg19	c.941C>T	CCDS13585.1	1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077636	0.36662	.	.	ENSG00000156273	ENST00000286800;ENST00000399921	T;T	0.72167	-0.63;-0.63	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.248068	0.36034	N	0.002837	T	0.54695	0.1874	N	0.14661	0.345	0.09310	N	1	B	0.34372	0.451	B	0.26517	0.07	T	0.58233	-0.7672	10	0.72032	D	0.01	-16.0467	18.0715	0.89408	0.0:1.0:0.0:0.0	.	314	O14867	BACH1_HUMAN	F	314	ENSP00000286800:S314F;ENSP00000382805:S314F	ENSP00000286800:S314F	S	+	2	0	0	BACH1	29620957	29620957	0.098000	0.21812	0.093000	0.20910	0.624000	0.37722	4.125000	0.57931	2.813000	0.96785	0.655000	0.94253	TCC	0.368832		TCGA-IB-AAUU-01A-11D-A377-08	0.388	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	1	0	1	2	2	2	2	0	0	0	0	212	212	212	207	1	3.300000	-20.000000	1	0.370000	NM_206866		0	103	102	0	499	493	1		1	1		0	0	212	0	0	1	9.872332e-01	0	12	0	23	0	103	499
DIP2A	23181	broad.mit.edu	37	21	47976980	47976980	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr21:47976980C>T	ENST00000417564.2	+	30	3648	c.3627C>T	c.(3625-3627)tgC>tgT	p.C1209C	DIP2A_ENST00000318711.7_Silent_p.C1210C|DIP2A_ENST00000400274.1_Silent_p.C1205C			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1209					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGTGTCTGTGCAGGTGAGTGC	0.612																																						ENST00000417564.2	1.000000	3.600000e-01	0.950000	0.510000	0.710000	0.726181	0.710000	1.000000																										0				43						c.(3625-3627)tgC>tgT		DIP2 disco-interacting protein 2 homolog A (Drosophila)							27.0	30.0	29.0					21																	47976980		2125	4257	6382	SO:0001819	synonymous_variant	23181	0	0					g.chr21:47976980C>T	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3627C>T	chr21.hg19:g.47976980C>T		0					DIP2A_ENST00000400274.1_Silent_p.C1205C|DIP2A_ENST00000318711.7_Silent_p.C1210C	p.C1209C			1	2	3	1.942018	Q14689	DIP2A_HUMAN		30	3648	+	Breast(49;0.0933)		A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	ENST00000417564.2	0	1	hg19	c.3627C>T	CCDS46655.1	0																																																																																								0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.612	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	3.300000	-15.453780	1	0.370000	NM_015151		0	9	9	0	74	71	1		1	1		0	0	10	0	0	9.941661e-01	5.240832e-01	0	2	0	13	0	9	74
ACR	49	broad.mit.edu	37	22	51182600	51182600	+	Missense_Mutation	SNP	C	C	T	rs541083098		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr22:51182600C>T	ENST00000216139.5	+	4	717	c.677C>T	c.(676-678)gCg>gTg	p.A226V	AC002056.5_ENST00000532913.1_RNA|ACR_ENST00000527761.1_3'UTR	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			A -> V (in Ref. 3). {ECO:0000305}.	acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		AATGTGTGCGCGGGGTATCCT	0.577													c|||	1	0.000199681	0.0	0.0	5008	,	,		20862	0.001		0.0	False		,,,				2504	0.0					ENST00000216139.5	0.210000	4.000000e-02	0.160000	0.070000	0.110000	0.122303	0.110000	0.110000																										0				7						c.(676-678)gCg>gTg		acrosin							139.0	122.0	128.0					22																	51182600		2203	4300	6503	SO:0001583	missense	49	13	121412	43				g.chr22:51182600C>T	CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.677C>T	chr22.hg19:g.51182600C>T	ENSP00000216139:p.Ala226Val	1					ACR_ENST00000527761.1_3'UTR|AC002056.5_ENST00000532913.1_RNA	p.A226V	NM_001097.2	NP_001088.2	0	2	2	1.681803	P10323	ACRO_HUMAN		4	717	+		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	Q6ICK2	Missense_Mutation	SNP	ENST00000216139.5	0	1	hg19	c.677C>T	CCDS14101.1	0	.	.	.	.	.	.	.	.	.	.	N	13.55	2.272141	0.40194	.	.	ENSG00000100312	ENST00000216139	D	0.91124	-2.79	4.48	3.44	0.39384	4.48	3.44	0.39384	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.43416	D	0.000561	D	0.93455	0.7912	M	0.75884	2.315	0.32305	N	0.564555	D	0.89917	1.0	D	0.91635	0.999	D	0.92392	0.5922	10	0.66056	D	0.02	-19.6881	7.0808	0.25229	0.0:0.7985:0.0:0.2014	.	226	P10323	ACRO_HUMAN	V	226	ENSP00000216139:A226V	ENSP00000216139:A226V	A	+	2	0	0	ACR	49529466	49529466	0.988000	0.35896	0.865000	0.33974	0.031000	0.12232	3.250000	0.51445	2.335000	0.79485	0.450000	0.29827	GCG	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.577	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000316605.2	0	0	1	2	2	2	2	0	0	0	0	78	78	78	84	1	3.300000	-3.042878	1	0.370000	NM_001097		0	8	7	0	386	377	0		1	0		0	0	78	0	0	9.883788e-01	5.724754e-04	0	0	0	2	0	8	386
SCN2A	6326	broad.mit.edu	37	2	166201198	166201198	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr2:166201198G>A	ENST00000375437.2	+	16	2986	c.2696G>A	c.(2695-2697)gGc>gAc	p.G899D	SCN2A_ENST00000357398.3_Missense_Mutation_p.G899D|SCN2A_ENST00000375427.2_Missense_Mutation_p.G899D|SCN2A_ENST00000283256.6_Missense_Mutation_p.G899D	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	899					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGTGGTCGGCATGCAGCTC	0.443																																						ENST00000375437.2	1.000000	1.000000e-02	0.110000	0.030000	0.060000	0.124319	0.060000	0.080000																										0				118						c.(2695-2697)gGc>gAc		sodium channel, voltage-gated, type II, alpha subunit	Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)						169.0	160.0	163.0					2																	166201198		2203	4300	6503	SO:0001583	missense	6326	0	0					g.chr2:166201198G>A	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2696G>A	chr2.hg19:g.166201198G>A	ENSP00000364586:p.Gly899Asp	1					SCN2A_ENST00000357398.3_Missense_Mutation_p.G899D|SCN2A_ENST00000375427.2_Missense_Mutation_p.G899D|SCN2A_ENST00000283256.6_Missense_Mutation_p.G899D	p.G899D	NM_001040142.1	NP_001035232.1	2	2	4	2.162446	Q99250	SCN2A_HUMAN		16	2986	+			A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	0	1	hg19	c.2696G>A	CCDS33314.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.064264	0.93898	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97688	-4.49;-4.49;-4.49;-4.49	5.74	5.74	0.90152	5.74	5.74	0.90152	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99444	0.9803	H	0.99391	4.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98030	1.0376	10	0.87932	D	0	.	19.9329	0.97127	0.0:0.0:1.0:0.0	.	899;899	Q99250-2;Q99250	.;SCN2A_HUMAN	D	899	ENSP00000364586:G899D;ENSP00000349973:G899D;ENSP00000283256:G899D;ENSP00000364576:G899D	ENSP00000283256:G899D	G	+	2	0	0	SCN2A	165909444	165909444	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.735000	0.98825	2.714000	0.92807	0.650000	0.86243	GGC	0.531285		TCGA-IB-AAUU-01A-11D-A377-08	0.443	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	0	0	1	2	2	2	2	0	0	0	0	170	170	170	169	1	3.300000	-1.741427	0	0.370000	NM_021007		0	7	7	0	784	764	0		1			0	0	170	0	0	9.785993e-01	0	0	0	0	0	0	7	784
TTN	7273	broad.mit.edu	37	2	179407109	179407109	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr2:179407109C>T	ENST00000591111.1	-	299	92675	c.92451G>A	c.(92449-92451)acG>acA	p.T30817T	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.T32458T|TTN-AS1_ENST00000590040.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.T23518T|TTN_ENST00000460472.2_Silent_p.T23393T|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.T23585T|TTN_ENST00000342992.6_Silent_p.T29890T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30817	Fibronectin type-III 124. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAACTTAAACGTGGACCTAG	0.502																																						ENST00000591111.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				1448						c.(92449-92451)acG>acA		titin							76.0	73.0	74.0					2																	179407109		2038	4201	6239	SO:0001819	synonymous_variant	7273	0	0					g.chr2:179407109C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92451G>A	chr2.hg19:g.179407109C>T		1					TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Silent_p.T29890T|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.T23393T|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Silent_p.T32458T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Silent_p.T23585T|TTN_ENST00000359218.5_Silent_p.T23518T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.T30817T			2	2	4	2.162446	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	299	92675	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	1	1	hg19	c.92451G>A		1																																																																																								0.531285		TCGA-IB-AAUU-01A-11D-A377-08	0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	3.300000	-20.000000	1	0.370000	NM_133378		0	51	50	0	134	132	1		1	0		0	0	36	0	0	1	0	0	0	0	1	0	51	134
HK2	3099	broad.mit.edu	37	2	75118049	75118049	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr2:75118049G>A	ENST00000290573.2	+	18	3335	c.2735G>A	c.(2734-2736)cGt>cAt	p.R912H	HK2_ENST00000409174.1_Missense_Mutation_p.R884H	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	912	Catalytic.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.R912L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						TGCCGCATCCGTGAGGCTGGA	0.542																																						ENST00000290573.2	1.000000	1.000000e-02	0.150000	0.050000	0.080000	0.138256	0.080000	0.080000																										1	Substitution - Missense(1)	p.R912L(1)	lung(1)	43						c.(2734-2736)cGt>cAt		hexokinase 2							51.0	53.0	53.0					2																	75118049		2203	4300	6503	SO:0001583	missense	3099	1	121412	28				g.chr2:75118049G>A		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2735G>A	chr2.hg19:g.75118049G>A	ENSP00000290573:p.Arg912His	1					HK2_ENST00000409174.1_Missense_Mutation_p.R884H	p.R912H	NM_000189.4	NP_000180.2	2	2	4	2.171339	P52789	HXK2_HUMAN		18	3335	+			D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	0	1	hg19	c.2735G>A	CCDS1956.1	0	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882526	0.72294	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.97553	-4.43;-4.43	4.99	4.99	0.66335	4.99	4.99	0.66335	.	0.056749	0.64402	D	0.000001	D	0.93926	0.8056	L	0.41079	1.255	0.80722	D	1	D	0.61080	0.989	B	0.39027	0.288	D	0.93726	0.7037	10	0.40728	T	0.16	-11.9165	15.8192	0.78626	0.0:0.0:1.0:0.0	.	912	P52789	HXK2_HUMAN	H	912;912;884	ENSP00000290573:R912H;ENSP00000387140:R884H	ENSP00000290573:R912H	R	+	2	0	0	HK2	74971557	74971557	1.000000	0.71417	0.961000	0.40146	0.996000	0.88848	4.459000	0.60102	2.609000	0.88269	0.561000	0.74099	CGT	0.532572		TCGA-IB-AAUU-01A-11D-A377-08	0.542	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	120	1	3.300000	-3.139917	1	0.370000	NM_000189		0	5	5	0	447	438	0		1	0		0	0	125	0	0	9.341313e-01	7.343498e-01	0	0	0	225	0	5	447
HECW2	57520	broad.mit.edu	37	2	197187274	197187274	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr2:197187274C>T	ENST00000260983.3	-	7	994	c.812G>A	c.(811-813)cGt>cAt	p.R271H	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	271	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GATGATGGGACGGCTCTTGGC	0.423																																						ENST00000260983.3	1.000000	7.000000e-01	1.000000	0.770000	0.860000	0.873874	0.860000	1.000000																										0				113						c.(811-813)cGt>cAt		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2							131.0	137.0	135.0					2																	197187274		2203	4300	6503	SO:0001583	missense	57520	0	0					g.chr2:197187274C>T	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.812G>A	chr2.hg19:g.197187274C>T	ENSP00000260983:p.Arg271His	1					HECW2_ENST00000409111.1_5'UTR	p.R271H	NM_020760.1	NP_065811.1	2	2	4	2.117468	Q9P2P5	HECW2_HUMAN		7	994	-			B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	1	1	hg19	c.812G>A	CCDS33354.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.137069	0.94517	.	.	ENSG00000138411	ENST00000260983	T	0.46451	0.87	5.49	4.6	0.57074	5.49	4.6	0.57074	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.191653	0.47455	D	0.000223	T	0.44973	0.1319	M	0.75447	2.3	0.58432	D	0.999998	B	0.29627	0.252	B	0.26614	0.071	T	0.51741	-0.8667	10	0.87932	D	0	.	14.9482	0.71050	0.0:0.9304:0.0:0.0696	.	271	Q9P2P5	HECW2_HUMAN	H	271	ENSP00000260983:R271H	ENSP00000260983:R271H	R	-	2	0	0	HECW2	196895519	196895519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.912000	0.69948	2.878000	0.98634	0.650000	0.86243	CGT	0.520730		TCGA-IB-AAUU-01A-11D-A377-08	0.423	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	1	0	1	2	2	2	2	0	0	0	0	140	140	140	138	1	3.300000	-20.000000	1	0.370000	NM_020760		0	97	94	0	711	706	1		1	0		0	0	140	0	0	1	4.057401e-02	0	0	0	3	0	97	711
EPHB1	2047	broad.mit.edu	37	3	134884864	134884864	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr3:134884864C>T	ENST00000398015.3	+	8	2010	c.1640C>T	c.(1639-1641)gCg>gTg	p.A547V	EPHB1_ENST00000493838.1_Missense_Mutation_p.A108V	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	547					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GGCTCGGCAGCGGCCGGGGTC	0.567																																						ENST00000398015.3	0.250000	6.000000e-02	0.200000	0.100000	0.140000	0.152126	0.140000	0.150000																										0				130						c.(1639-1641)gCg>gTg		EPH receptor B1							115.0	135.0	128.0					3																	134884864		2116	4243	6359	SO:0001583	missense	2047	0	0					g.chr3:134884864C>T	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1640C>T	chr3.hg19:g.134884864C>T	ENSP00000381097:p.Ala547Val	1					EPHB1_ENST00000493838.1_Missense_Mutation_p.A108V	p.A547V	NM_004441.4	NP_004432.1	1	2	3	1.906089	P54762	EPHB1_HUMAN		8	2010	+			A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	0	1	hg19	c.1640C>T	CCDS46921.1	0	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129979	0.56721	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.10477	2.87;2.87	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.056918	0.64402	D	0.000002	T	0.09598	0.0236	L	0.31065	0.9	0.80722	D	1	B	0.14805	0.011	B	0.11329	0.006	T	0.14117	-1.0484	10	0.02654	T	1	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	547	P54762	EPHB1_HUMAN	V	547;108	ENSP00000381097:A547V;ENSP00000419574:A108V	ENSP00000381097:A547V	A	+	2	0	0	EPHB1	136367554	136367554	1.000000	0.71417	0.879000	0.34478	0.743000	0.42351	7.794000	0.85869	2.884000	0.98904	0.655000	0.94253	GCG	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.567	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	0	0	1	2	2	2	2	0	0	0	0	65	65	65	64	1	3.300000	-2.612578	1	0.370000	NM_004441		0	10	10	0	450	427	0		1			0	0	65	0	0	9.960064e-01	0	0	0	0	0	0	10	450
CLSTN2	64084	broad.mit.edu	37	3	140178467	140178467	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr3:140178467G>A	ENST00000458420.3	+	7	1268	c.1078G>A	c.(1078-1080)Ggc>Agc	p.G360S	RP11-68L1.1_ENST00000483759.2_RNA|RP11-68L1.2_ENST00000503357.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	360					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CAAGTTTGACGGCAGGCAGGG	0.572										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	ENST00000458420.3	1.000000	8.900000e-01	1.000000	0.990000	0.990000	0.993423	0.990000	1.000000																										0				87						c.(1078-1080)Ggc>Agc		calsyntenin 2							80.0	69.0	72.0					3																	140178467		2203	4300	6503	SO:0001583	missense	64084	7	121412	40				g.chr3:140178467G>A	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1078G>A	chr3.hg19:g.140178467G>A	ENSP00000402460:p.Gly360Ser	1	HNSCC(16;0.037)				RP11-68L1.2_ENST00000503357.1_RNA|RP11-68L1.1_ENST00000483759.2_RNA	p.G360S	NM_022131.2	NP_071414.2	1	2	3	1.906089	Q9H4D0	CSTN2_HUMAN		7	1268	+			B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	1	1	hg19	c.1078G>A	CCDS3112.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.305899	0.95629	.	.	ENSG00000158258	ENST00000458420	T	0.02863	4.13	5.41	5.41	0.78517	5.41	5.41	0.78517	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.18341	0.0440	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00174	-1.1956	10	0.62326	D	0.03	-35.2726	16.6974	0.85339	0.0:0.0:1.0:0.0	.	360	Q9H4D0	CSTN2_HUMAN	S	360	ENSP00000402460:G360S	ENSP00000402460:G360S	G	+	1	0	0	CLSTN2	141661157	141661157	1.000000	0.71417	0.959000	0.39883	0.923000	0.55619	9.869000	0.99810	2.552000	0.86080	0.655000	0.94253	GGC	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.572	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	1	0	1	2	21	2	2	0	0	0	1	30	30	30	27	1	3.300000	-3.356241	1	0.370000	NM_022131		0	38	38	0	162	160	1		1	0		0	0	30	0	0	9.936295e-01	9.883776e-02	0	0	0	3	0	38	162
GRK7	131890	broad.mit.edu	37	3	141535562	141535562	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr3:141535562G>T	ENST00000264952.2	+	4	1469	c.1332G>T	c.(1330-1332)aaG>aaT	p.K444N		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	444	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						ACAGAGAAAAGTCTGATGATC	0.413																																						ENST00000264952.2	1.000000	6.000000e-01	0.940000	0.700000	0.810000	0.824383	0.810000	1.000000																										0				26						c.(1330-1332)aaG>aaT		G protein-coupled receptor kinase 7							65.0	67.0	66.0					3																	141535562		2203	4300	6503	SO:0001583	missense	131890	2	120062	35				g.chr3:141535562G>T		CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.1332G>T	chr3.hg19:g.141535562G>T	ENSP00000264952:p.Lys444Asn	1						p.K444N	NM_139209.2	NP_631948.1	1	2	3	1.906089	Q8WTQ7	GRK7_HUMAN		4	1469	+				Missense_Mutation	SNP	ENST00000264952.2	1	1	hg19	c.1332G>T	CCDS3120.1	0	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281990	0.23392	.	.	ENSG00000114124	ENST00000264952	T	0.24350	1.86	5.4	-0.397	0.12423	5.4	-0.397	0.12423	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.206992	0.43260	D	0.000593	T	0.07458	0.0188	N	0.03050	-0.425	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17745	-1.0359	10	0.51188	T	0.08	-3.3201	0.3395	0.00331	0.2689:0.2271:0.2739:0.2301	.	444	Q8WTQ7	GRK7_HUMAN	N	444	ENSP00000264952:K444N	ENSP00000264952:K444N	K	+	3	2	2	GRK7	143018252	143018252	0.000000	0.05858	0.992000	0.48379	0.976000	0.68499	-0.314000	0.08092	-0.010000	0.14271	0.467000	0.42956	AAG	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.413	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353168.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	97	1	3.300000	-20.000000	1	0.370000	NM_139209		0	42	41	0	287	286	1		1			0	0	97	0	0	1	0	0	0	0	0	0	42	287
P2RY12	64805	broad.mit.edu	37	3	151055628	151055628	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr3:151055628G>A	ENST00000302632.3	-	3	1305	c.1006C>T	c.(1006-1008)Cca>Tca	p.P336S	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	336					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TCTTCATTTGGGTCACCACCA	0.368																																						ENST00000302632.3	0.150000	2.000000e-02	0.110000	0.040000	0.070000	0.083806	0.070000	0.070000																										0				17						c.(1006-1008)Cca>Tca		purinergic receptor P2Y, G-protein coupled, 12	Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)						124.0	122.0	123.0					3																	151055628		2203	4300	6503	SO:0001583	missense	64805	0	0					g.chr3:151055628G>A	AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.1006C>T	chr3.hg19:g.151055628G>A	ENSP00000307259:p.Pro336Ser	1					MED12L_ENST00000491549.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	p.P336S	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	1	2	3	1.906089	Q9H244	P2Y12_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)	3	1305	-			D3DNJ5|Q546J7	Missense_Mutation	SNP	ENST00000302632.3	0	1	hg19	c.1006C>T	CCDS3159.1	0	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519990	0.27211	.	.	ENSG00000169313	ENST00000302632;ENST00000455408	T	0.59906	0.23	5.48	4.6	0.57074	5.48	4.6	0.57074	.	0.944449	0.08953	N	0.869875	T	0.31734	0.0806	N	0.08118	0	0.09310	N	1	B	0.31026	0.304	B	0.23419	0.046	T	0.18808	-1.0325	10	0.15499	T	0.54	-2.2908	5.6313	0.17512	0.1514:0.0:0.6808:0.1678	.	336	Q9H244	P2Y12_HUMAN	S	336;239	ENSP00000307259:P336S	ENSP00000307259:P336S	P	-	1	0	0	P2RY12	152538318	152538318	0.161000	0.22892	0.037000	0.18230	0.021000	0.10359	0.759000	0.26461	1.435000	0.47434	-0.169000	0.13324	CCA	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.368	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357796.1	0	0	1	2	2	2	2	0	0	0	0	151	151	151	150	1	3.300000	-2.364652	0	0.370000			0	7	7	0	602	595	0		1	0		0	0	151	0	0	9.798811e-01	5.695090e-04	0	0	0	3	0	7	602
PLCL2	23228	broad.mit.edu	37	3	17052241	17052241	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr3:17052241G>A	ENST00000418129.2	+	2	1490	c.1025G>A	c.(1024-1026)cGg>cAg	p.R342Q	PLCL2_ENST00000396755.2_Missense_Mutation_p.R342Q|PLCL2_ENST00000460467.1_Intron|PLCL2_ENST00000432376.1_Missense_Mutation_p.R342Q	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	468					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						ATGGGTTGCCGGAGTGTTGAA	0.423																																						ENST00000418129.2	0.170000	1.000000e-02	0.130000	0.040000	0.080000	0.087270	0.080000	0.100000																										0				43						c.(1024-1026)cGg>cAg		phospholipase C-like 2							110.0	108.0	109.0					3																	17052241		2203	4300	6503	SO:0001583	missense	23228	0	0					g.chr3:17052241G>A	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1025G>A	chr3.hg19:g.17052241G>A	ENSP00000409637:p.Arg342Gln	1					PLCL2_ENST00000432376.1_Missense_Mutation_p.R342Q|PLCL2_ENST00000460467.1_Intron|PLCL2_ENST00000396755.2_Missense_Mutation_p.R342Q	p.R342Q	NM_001144382.1	NP_001137854.1	2	3	5	2.498643	Q9UPR0	PLCL2_HUMAN		2	1490	+			A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	0	1	hg19	c.1025G>A	CCDS33713.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.776979|4.776979	0.90195|0.90195	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000419842|ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	.|T;T;T	.|0.81163	.|-1.46;-1.46;-1.46	5.96|5.96	5.96|5.96	0.96718|0.96718	5.96|5.96	5.96|5.96	0.96718|0.96718	.|PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	.|0.053332	.|0.64402	.|N	.|0.000001	D|D	0.90841|0.90841	0.7123|0.7123	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.90920|0.90920	0.4782|0.4782	4|9	.|0.87932	.|D	.|0	.|.	20.4008|20.4008	0.98991|0.98991	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|468	.|Q9UPR0	.|PLCL2_HUMAN	R|Q	86|342;469;342;342	.|ENSP00000409637:R342Q;ENSP00000379979:R342Q;ENSP00000412836:R342Q	.|ENSP00000285094:R469Q	G|R	+|+	1|2	0|0	0|0	PLCL2|PLCL2	17027245|17027245	17027245|17027245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	9.869000|9.869000	0.99810|0.99810	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GGA|CGG	0.593404		TCGA-IB-AAUU-01A-11D-A377-08	0.423	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3	0	0	1	2	2	2	2	0	0	0	0	131	131	131	130	1	3.300000	-2.288576	0	0.370000			0	6	6	0	651	640	0		1	0		0	0	131	0	0	9.632171e-01	2.082527e-02	0	0	0	20	0	6	651
GPR149	344758	broad.mit.edu	37	3	154055947	154055947	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr3:154055947C>T	ENST00000389740.2	-	4	1836	c.1737G>A	c.(1735-1737)ggG>ggA	p.G579G		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	579					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTATTTTTTGCCCTTCTGCGC	0.458																																						ENST00000389740.2	0.100000	0	0.080000	0.020000	0.040000	0.054652	0.040000	0.060000																										0				47						c.(1735-1737)ggG>ggA		G protein-coupled receptor 149							143.0	143.0	143.0					3																	154055947		1848	4091	5939	SO:0001819	synonymous_variant	344758	0	0					g.chr3:154055947C>T	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1737G>A	chr3.hg19:g.154055947C>T		1						p.G579G	NM_001038705.1	NP_001033794.1	1	2	3	1.906089	Q86SP6	GP149_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)	4	1836	-				Silent	SNP	ENST00000389740.2	0	1	hg19	c.1737G>A	CCDS43162.1	0																																																																																								0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.458	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	0	0	1	2	2	2	2	0	0	0	0	182	182	182	176	1	3.300000	-1.673033	0	0.370000	XM_293580		0	6	6	0	799	788	0		1			0	0	182	0	0	9.633826e-01	0	0	0	0	0	0	6	799
TBC1D1	23216	broad.mit.edu	37	4	38023260	38023260	+	Missense_Mutation	SNP	G	G	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr4:38023260G>T	ENST00000261439.4	+	6	1486	c.1131G>T	c.(1129-1131)caG>caT	p.Q377H	TBC1D1_ENST00000508802.1_Missense_Mutation_p.Q377H	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	377	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CCGCAGTGCAGCAGACAGCTA	0.517																																						ENST00000261439.4	1.000000	2.700000e-01	0.790000	0.400000	0.570000	0.596307	0.570000	1.000000																										0				36						c.(1129-1131)caG>caT		TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1							34.0	33.0	34.0					4																	38023260		2203	4300	6503	SO:0001583	missense	23216	0	0					g.chr4:38023260G>T	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1131G>T	chr4.hg19:g.38023260G>T	ENSP00000261439:p.Gln377His	1					TBC1D1_ENST00000508802.1_Missense_Mutation_p.Q377H	p.Q377H	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	2	2	4	2.192112	Q86TI0	TBCD1_HUMAN		6	1486	+			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	0	1	hg19	c.1131G>T	CCDS33972.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.32|17.32	3.358757|3.358757	0.61403|0.61403	.|.	.|.	ENSG00000065882|ENSG00000065882	ENST00000510573|ENST00000508802;ENST00000261439;ENST00000446803	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.76|5.76	4.01|4.01	0.46588|0.46588	5.76|5.76	4.01|4.01	0.46588|0.46588	.|Phosphotyrosine interaction domain (1);	.|0.112392	.|0.39985	.|N	.|0.001213	T|T	0.26738|0.26738	0.0654|0.0654	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	.|D;D;B;D	.|0.89917	.|1.0;1.0;0.028;1.0	.|D;D;B;D	.|0.81914	.|0.99;0.995;0.018;0.99	T|T	0.02713|0.02713	-1.1120|-1.1120	5|10	.|0.40728	.|T	.|0.16	-24.9276|-24.9276	5.7525|5.7525	0.18154|0.18154	0.1938:0.0:0.6522:0.154|0.1938:0.0:0.6522:0.154	.|.	.|377;377;109;377	.|B9A6J6;E9PGH8;Q6PJJ8;Q86TI0	.|.;.;.;TBCD1_HUMAN	S|H	25|377;377;248	.|ENSP00000423651:Q377H;ENSP00000261439:Q377H;ENSP00000396877:Q248H	.|ENSP00000261439:Q377H	A|Q	+|+	1|3	0|2	0|2	TBC1D1|TBC1D1	37699655|37699655	37699655|37699655	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.671000|0.671000	0.39405|0.39405	6.142000|6.142000	0.71750|0.71750	0.761000|0.761000	0.33130|0.33130	0.591000|0.591000	0.81541|0.81541	GCA|CAG	0.538901		TCGA-IB-AAUU-01A-11D-A377-08	0.517	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	3.300000	-12.812990	1	0.370000	NM_015173		0	8	8	0	100	98	0		1	1		0	0	21	0	0	9.894837e-01	8.613083e-01	0	2	0	45	0	8	100
SLAIN2	57606	broad.mit.edu	37	4	48379970	48379970	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr4:48379970C>G	ENST00000264313.6	+	3	1014	c.596C>G	c.(595-597)cCt>cGt	p.P199R	SLAIN2_ENST00000512093.1_Missense_Mutation_p.P6R|SLAIN2_ENST00000506375.1_3'UTR	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	199					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						TACACCAGTCCTTACAGTCCA	0.413																																						ENST00000264313.6	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				13						c.(595-597)cCt>cGt		SLAIN motif family, member 2							99.0	97.0	98.0					4																	48379970		1882	4107	5989	SO:0001583	missense	57606	0	0					g.chr4:48379970C>G	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.596C>G	chr4.hg19:g.48379970C>G	ENSP00000264313:p.Pro199Arg	1					SLAIN2_ENST00000512093.1_Missense_Mutation_p.P6R|SLAIN2_ENST00000506375.1_3'UTR	p.P199R	NM_020846.1	NP_065897.1	2	2	4	2.192112	Q9P270	SLAI2_HUMAN		3	1014	+			A8K4P1|Q8N5R3	Missense_Mutation	SNP	ENST00000264313.6	1	1	hg19	c.596C>G	CCDS47051.1	1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377180	0.61735	.	.	ENSG00000109171	ENST00000264313;ENST00000512093	.	.	.	5.76	5.76	0.90799	5.76	5.76	0.90799	.	0.207938	0.42420	D	0.000708	T	0.52613	0.1745	L	0.29908	0.895	0.46131	D	0.998881	B	0.34200	0.441	B	0.36030	0.216	T	0.55866	-0.8073	9	0.87932	D	0	-3.4428	19.9601	0.97247	0.0:1.0:0.0:0.0	.	199	Q9P270	SLAI2_HUMAN	R	199;6	.	ENSP00000264313:P199R	P	+	2	0	0	SLAIN2	48074727	48074727	1.000000	0.71417	1.000000	0.80357	0.598000	0.36846	5.168000	0.64978	2.720000	0.93068	0.655000	0.94253	CCT	0.538901		TCGA-IB-AAUU-01A-11D-A377-08	0.413	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	1	0	1	2	2	2	2	0	0	0	0	101	101	101	101	1	3.300000	-7.211354	1	0.370000	NM_020846		0	132	132	0	351	348	1		1	1		0	0	101	0	0	1	9.999582e-01	0	12	0	30	0	132	351
ZFP42	132625	broad.mit.edu	37	4	188924640	188924640	+	Missense_Mutation	SNP	G	G	A	rs200711766	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr4:188924640G>A	ENST00000326866.4	+	4	1087	c.679G>A	c.(679-681)Gtt>Att	p.V227I	ZFP42_ENST00000509524.1_Missense_Mutation_p.V227I	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	227					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GAAAGCGTTCGTTGAGAGCTC	0.502													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18767	0.0		0.001	False		,,,				2504	0.0					ENST00000326866.4	1.000000	8.000000e-01	1.000000	0.910000	0.990000	0.970440	0.990000	1.000000																										0				27						c.(679-681)Gtt>Att		ZFP42 zinc finger protein							118.0	123.0	122.0					4																	188924640		2203	4300	6503	SO:0001583	missense	132625	2	121412	32				g.chr4:188924640G>A	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.679G>A	chr4.hg19:g.188924640G>A	ENSP00000317686:p.Val227Ile	0					ZFP42_ENST00000509524.1_Missense_Mutation_p.V227I	p.V227I	NM_174900.3	NP_777560.2	1	2	3	1.922928	Q96MM3	ZFP42_HUMAN		4	1087	+		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)	D3DP65|Q8WXE2	Missense_Mutation	SNP	ENST00000326866.4	1	1	hg19	c.679G>A	CCDS3849.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.42	1.345682	0.24426	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.41400	1.0;1.0	4.39	-8.78	0.00824	4.39	-8.78	0.00824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.214960	0.06385	N	0.715986	T	0.16171	0.0389	N	0.16478	0.41	0.09310	N	1	B	0.27316	0.175	B	0.14023	0.01	T	0.08953	-1.0697	10	0.17832	T	0.49	.	1.3926	0.02253	0.1903:0.3391:0.2374:0.2333	.	227	Q96MM3	ZFP42_HUMAN	I	227	ENSP00000317686:V227I;ENSP00000424662:V227I	ENSP00000317686:V227I	V	+	1	0	0	ZFP42	189161634	189161634	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.295000	0.19065	-3.355000	0.00180	-0.892000	0.02923	GTT	0.467523		TCGA-IB-AAUU-01A-11D-A377-08	0.502	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	1	0	1	2	2	2	2	0	0	0	0	98	98	98	96	1	3.300000	-3.162619	1	0.370000	NM_174900		0	55	55	0	283	281	1		1			0	0	98	0	0	1	0	0	0	0	0	0	55	283
ITGA2	3673	broad.mit.edu	37	5	52356793	52356793	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr5:52356793G>A	ENST00000296585.5	+	12	1518	c.1375G>A	c.(1375-1377)Gca>Aca	p.A459T		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	459					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGCTCCTCGGGCAAATTATAC	0.443																																						ENST00000296585.5	1.000000	2.000000e-02	0.140000	0.040000	0.080000	0.141955	0.080000	0.080000																										0				47						c.(1375-1377)Gca>Aca		integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)							111.0	105.0	107.0					5																	52356793		2203	4300	6503	SO:0001583	missense	3673	0	0					g.chr5:52356793G>A		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1375G>A	chr5.hg19:g.52356793G>A	ENSP00000296585:p.Ala459Thr	0						p.A459T	NM_002203.3	NP_002194.2	1	2	3	1.920332	P17301	ITA2_HUMAN		12	1518	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	Q14595	Missense_Mutation	SNP	ENST00000296585.5	0	1	hg19	c.1375G>A	CCDS3957.1	0	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297090	0.60086	.	.	ENSG00000164171	ENST00000296585	T	0.11169	2.8	5.77	3.84	0.44239	5.77	3.84	0.44239	.	0.165528	0.56097	D	0.000037	T	0.07548	0.0190	L	0.46885	1.475	0.38632	D	0.951406	B;P	0.36412	0.104;0.552	B;B	0.27076	0.04;0.076	T	0.11591	-1.0581	10	0.37606	T	0.19	.	5.5765	0.17227	0.1627:0.0:0.5942:0.2431	.	459;459	E7ESP4;P17301	.;ITA2_HUMAN	T	459	ENSP00000296585:A459T	ENSP00000296585:A459T	A	+	1	0	0	ITGA2	52392550	52392550	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.461000	0.53035	2.720000	0.93068	0.650000	0.86243	GCA	0.462480		TCGA-IB-AAUU-01A-11D-A377-08	0.443	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	0	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	3.300000	-2.526493	1	0.370000	NM_002203		0	5	7	0	408	403	0		1	0		0	0	84	0	0	9.367007e-01	1.193541e-01	0	0	0	40	0	5	408
GRM6	2916	broad.mit.edu	37	5	178413350	178413350	+	Silent	SNP	G	G	A	rs200430682	byFrequency	TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr5:178413350G>A	ENST00000517717.1	-	9	1943	c.1905C>T	c.(1903-1905)taC>taT	p.Y635Y	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Silent_p.Y635Y			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	635					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		AGGTGATGGCGTAGATGAGGA	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		18497	0.001		0.0	False		,,,				2504	0.001					ENST00000517717.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				55						c.(1903-1905)taC>taT		glutamate receptor, metabotropic 6		G		0,4406		0,0,2203	52.0	47.0	49.0		1905	-0.2	1.0	5		49	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	GRM6	NM_000843.3		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		635/878	178413350	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	2916	42	121406	44				g.chr5:178413350G>A	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1905C>T	chr5.hg19:g.178413350G>A		0					RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Silent_p.Y635Y	p.Y635Y			1	2	3	1.913234	O15303	GRM6_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	9	1943	-	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)		Silent	SNP	ENST00000517717.1	1	1	hg19	c.1905C>T	CCDS4442.1	1																																																																																								0.465014		TCGA-IB-AAUU-01A-11D-A377-08	0.672	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2	0	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	3.300000	-3.222074	1	0.370000			0	54	54	0	124	124	1		1			0	0	28	0	0	1	0	0	0	0	0	0	54	124
TTBK1	84630	broad.mit.edu	37	6	43222815	43222815	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr6:43222815C>T	ENST00000259750.4	+	7	688	c.605C>T	c.(604-606)aCg>aTg	p.T202M	TTBK1_ENST00000304139.5_Missense_Mutation_p.T151M	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	202	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TTTCGAGGAACGGTTCGCTAT	0.617																																						ENST00000259750.4	1.000000	5.000000e-02	0.320000	0.090000	0.150000	0.278793	0.150000	0.140000																										0				53						c.(604-606)aCg>aTg		tau tubulin kinase 1							143.0	108.0	120.0					6																	43222815		2203	4300	6503	SO:0001583	missense	84630	1	121412	28				g.chr6:43222815C>T	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.605C>T	chr6.hg19:g.43222815C>T	ENSP00000259750:p.Thr202Met	1					TTBK1_ENST00000304139.5_Missense_Mutation_p.T151M	p.T202M	NM_032538.1	NP_115927.1	2	2	4	1.720841	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)	7	688	+			A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	0	1	hg19	c.605C>T	CCDS34455.1	0	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712948	0.89112	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.76839	-1.05	4.83	4.83	0.62350	4.83	4.83	0.62350	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92756	0.7697	H	0.99336	4.52	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.95848	0.8872	10	0.87932	D	0	.	16.6948	0.85332	0.0:1.0:0.0:0.0	.	202	Q5TCY1	TTBK1_HUMAN	M	151;202;151	ENSP00000259750:T202M	ENSP00000259750:T202M	T	+	2	0	0	TTBK1	43330793	43330793	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	7.413000	0.80104	2.242000	0.73789	0.655000	0.94253	ACG	0.411380		TCGA-IB-AAUU-01A-11D-A377-08	0.617	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3	0	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	3.300000	-3.330339	1	0.370000			0	5	5	0	214	212	0		1	0		0	0	39	0	0	9.367475e-01	8.560597e-04	0	0	0	2	0	5	214
ABCB5	340273	broad.mit.edu	37	7	20793112	20793112	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr7:20793112G>A	ENST00000404938.2	+	27	4211	c.3559G>A	c.(3559-3561)Gat>Aat	p.D1187N	ABCB5_ENST00000258738.6_Missense_Mutation_p.D742N	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	1187	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TTCAGCCCTCGATAATGACAG	0.393																																						ENST00000404938.2	1.000000	8.000000e-01	1.000000	0.910000	0.990000	0.969155	0.990000	1.000000																										0				77						c.(3559-3561)Gat>Aat		ATP-binding cassette, sub-family B (MDR/TAP), member 5							93.0	94.0	93.0					7																	20793112		2203	4300	6503	SO:0001583	missense	340273	4	121410	34				g.chr7:20793112G>A	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.3559G>A	chr7.hg19:g.20793112G>A	ENSP00000384881:p.Asp1187Asn	1					ABCB5_ENST00000258738.6_Missense_Mutation_p.D742N	p.D1187N	NM_001163941.1	NP_001157413.1	2	2	4	2.177772	Q2M3G0	ABCB5_HUMAN		27	4211	+			A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	1	1	hg19	c.3559G>A	CCDS55090.1	1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614824	0.87359	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.95756	-3.8;-3.8	5.16	4.26	0.50523	5.16	4.26	0.50523	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.56097	D	0.000024	D	0.98169	0.9395	H	0.96365	3.81	0.54753	D	0.999981	D;D	0.76494	0.999;0.999	D;D	0.65573	0.936;0.913	D	0.98395	1.0565	10	0.87932	D	0	.	13.0851	0.59135	0.0806:0.0:0.9194:0.0	.	1187;742	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	N	1187;742	ENSP00000384881:D1187N;ENSP00000258738:D742N	ENSP00000258738:D742N	D	+	1	0	0	ABCB5	20759637	20759637	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.641000	0.83368	2.683000	0.91414	0.555000	0.69702	GAT	0.535124		TCGA-IB-AAUU-01A-11D-A377-08	0.393	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	1	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	3.300000	-3.075973	1	0.370000	NM_178559		0	64	62	0	393	390	1		1			0	0	88	0	0	1	0	0	0	0	0	0	64	393
CPVL	54504	broad.mit.edu	37	7	29132283	29132283	+	Silent	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr7:29132283G>A	ENST00000409850.1	-	10	1144	c.498C>T	c.(496-498)caC>caT	p.H166H	CPVL_ENST00000265394.5_Silent_p.H166H|CPVL_ENST00000396276.3_Silent_p.H166H			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	166						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						CTGCATATCCGTGGGTATCAT	0.443																																						ENST00000409850.1	1.000000	6.400000e-01	1.000000	0.770000	0.920000	0.897332	0.920000	1.000000																										0				28						c.(496-498)caC>caT		carboxypeptidase, vitellogenic-like							92.0	76.0	81.0					7																	29132283		2203	4300	6503	SO:0001819	synonymous_variant	54504	4	121412	34				g.chr7:29132283G>A	AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.498C>T	chr7.hg19:g.29132283G>A		1					CPVL_ENST00000265394.5_Silent_p.H166H|CPVL_ENST00000396276.3_Silent_p.H166H	p.H166H			2	2	4	2.177772	Q9H3G5	CPVL_HUMAN		10	1144	-			A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Silent	SNP	ENST00000409850.1	1	1	hg19	c.498C>T	CCDS5419.1	1																																																																																								0.535124		TCGA-IB-AAUU-01A-11D-A377-08	0.443	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	41	1	3.300000	-3.018182	1	0.370000	NM_019029		0	31	30	0	219	217	1		1	1		0	0	42	0	0	1	9.999929e-01	0	30	0	104	0	31	219
DGKI	9162	broad.mit.edu	37	7	137263014	137263014	+	Splice_Site	SNP	A	A	C			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr7:137263014A>C	ENST00000288490.5	-	16	1699		c.e16+1		DGKI_ENST00000453654.2_Splice_Site|DGKI_ENST00000446122.1_Splice_Site|DGKI_ENST00000424189.2_Splice_Site	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ATGTATACCTACCCCTGCATA	0.313																																						ENST00000288490.5	1.000000	4.700000e-01	0.910000	0.580000	0.720000	0.742537	0.720000	1.000000																										0				84						c.e16+1		diacylglycerol kinase, iota							58.0	59.0	59.0					7																	137263014		2202	4298	6500	SO:0001630	splice_region_variant	9162	0	0					g.chr7:137263014A>C	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1698+1T>G	chr7.hg19:g.137263014A>C		1					DGKI_ENST00000424189.2_Splice_Site|DGKI_ENST00000446122.1_Splice_Site|DGKI_ENST00000453654.2_Splice_Site		NM_004717.2	NP_004708.1	2	2	4	2.161656	O75912	DGKI_HUMAN		16	1699	-			A4D1Q9|Q9NZ49	Splice_Site	SNP	ENST00000288490.5	1	1	hg19		CCDS5845.1	0	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262490	0.80358	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	.	.	.	5.15	5.15	0.70609	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9475	0.71044	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	DGKI	136913554	136913554	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.096000	0.94182	2.080000	0.62538	0.379000	0.24179	.	0.531285		TCGA-IB-AAUU-01A-11D-A377-08	0.313	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	1	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	3.300000	-20.000000	1	0.370000	NM_004717	Intron	0	23	23	0	213	209	0		1			0	0	45	0	0	9.999994e-01	0	0	0	0	0	0	23	213
PRSS55	203074	broad.mit.edu	37	8	10383123	10383123	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr8:10383123C>T	ENST00000328655.3	+	1	68	c.28C>T	c.(28-30)Ctg>Ttg	p.L10L	PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Silent_p.L10L	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	10						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						GTTGCTGCTCCTGTCCCTGGT	0.672																																						ENST00000328655.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				31						c.(28-30)Ctg>Ttg		protease, serine, 55							101.0	81.0	88.0					8																	10383123		2203	4300	6503	SO:0001819	synonymous_variant	203074	0	0					g.chr8:10383123C>T	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.28C>T	chr8.hg19:g.10383123C>T		1					PRSS55_ENST00000522210.1_Silent_p.L10L|PRSS51_ENST00000523024.1_RNA	p.L10L	NM_198464.3	NP_940866.2	0	2	2	1.672263	Q6UWB4	PRS55_HUMAN		1	68	+			E5RJX5	Silent	SNP	ENST00000328655.3	1	1	hg19	c.28C>T	CCDS5976.1	1																																																																																								0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.672	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	3.300000	-20.000000	1	0.370000	NM_198464		0	99	99	0	161	159	1		1			0	0	42	0	0	1	0	0	0	0	0	0	99	161
WHSC1L1	54904	broad.mit.edu	37	8	38205614	38205614	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr8:38205614C>T	ENST00000317025.8	-	2	593	c.76G>A	c.(76-78)Gcc>Acc	p.A26T	WHSC1L1_ENST00000433384.2_Missense_Mutation_p.A26T|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.A26T|WHSC1L1_ENST00000316985.3_Missense_Mutation_p.A26T	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	26					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CGGATGTTGGCGGAGTCAATG	0.453			T	NUP98	AML																																	ENST00000317025.8	0.140000	1.000000e-02	0.100000	0.030000	0.060000	0.074928	0.060000	0.060000				Dom	yes			Dom	yes		8	8p12	8p12	54904	T	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)				L	L	NUP98		AML		0				24						c.(76-78)Gcc>Acc		Wolf-Hirschhorn syndrome candidate 1-like 1							170.0	151.0	158.0					8																	38205614		2203	4300	6503	SO:0001583	missense	54904	0	0					g.chr8:38205614C>T	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.76G>A	chr8.hg19:g.38205614C>T	ENSP00000313983:p.Ala26Thr	1					WHSC1L1_ENST00000316985.3_Missense_Mutation_p.A26T|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.A26T|WHSC1L1_ENST00000433384.2_Missense_Mutation_p.A26T	p.A26T	NM_023034.1	NP_075447.1	0	2	2	1.672263	Q9BZ95	NSD3_HUMAN	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)	2	593	-	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	ENST00000317025.8	0	1	hg19	c.76G>A	CCDS43729.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.358909	0.95854	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502;ENST00000316985;ENST00000529223	D;D;D;T;T	0.96651	-4.08;-4.02;-4.02;-0.76;0.39	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.000000	0.47852	U	0.000201	D	0.97420	0.9156	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.99;0.996;0.999;0.99	D	0.98006	1.0363	10	0.87932	D	0	.	19.8909	0.96929	0.0:1.0:0.0:0.0	.	26;26;26;26	B7ZL11;Q9BZ95-2;Q9BZ95-3;Q9BZ95	.;.;.;NSD3_HUMAN	T	26	ENSP00000393284:A26T;ENSP00000313983:A26T;ENSP00000434730:A26T;ENSP00000313410:A26T;ENSP00000435422:A26T	ENSP00000313410:A26T	A	-	1	0	0	WHSC1L1	38324771	38324771	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.745000	0.68672	2.765000	0.95021	0.655000	0.94253	GCC	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.453	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	0	0	1	2	2	2	2	0	0	0	0	122	122	122	120	1	3.300000	-2.224503	0	0.370000	NM_023034		0	5	5	0	424	419	0		1	0		0	0	122	0	0	9.359450e-01	1.973842e-01	0	0	0	58	0	5	424
ADAM2	2515	broad.mit.edu	37	8	39646232	39646232	+	Missense_Mutation	SNP	C	C	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr8:39646232C>A	ENST00000265708.4	-	8	701	c.598G>T	c.(598-600)Gtt>Ttt	p.V200F	ADAM2_ENST00000379853.2_Intron|ADAM2_ENST00000521880.1_Missense_Mutation_p.V200F|ADAM2_ENST00000347580.4_Missense_Mutation_p.V181F	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	200	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TGAGCGACAACAGTTGTATCA	0.274																																						ENST00000265708.4	1.000000	6.300000e-01	1.000000	0.750000	0.880000	0.877360	0.880000	1.000000																										0				53						c.(598-600)Gtt>Ttt		ADAM metallopeptidase domain 2							92.0	85.0	88.0					8																	39646232		2203	4300	6503	SO:0001583	missense	2515	0	0					g.chr8:39646232C>A	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.598G>T	chr8.hg19:g.39646232C>A	ENSP00000265708:p.Val200Phe	1					ADAM2_ENST00000379853.2_Intron|ADAM2_ENST00000347580.4_Missense_Mutation_p.V181F|ADAM2_ENST00000521880.1_Missense_Mutation_p.V200F	p.V200F	NM_001464.3	NP_001455.3	1	7	8	3.766971	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	8	701	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	1	1	hg19	c.598G>T	CCDS34884.1	1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653517	0.29425	.	.	ENSG00000104755	ENST00000347580;ENST00000265708;ENST00000521880	T;T;T	0.64438	-0.1;-0.1;-0.1	4.7	-5.11	0.02901	4.7	-5.11	0.02901	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.72645	0.3486	M	0.71036	2.16	0.09310	N	1	P;P;P	0.41947	0.766;0.723;0.766	P;P;P	0.60609	0.877;0.73;0.824	T	0.70008	-0.4990	8	.	.	.	.	12.6789	0.56910	0.0:0.1977:0.0:0.8023	.	200;181;200	B4DWY7;Q99965-2;Q99965	.;.;ADAM2_HUMAN	F	181;200;200	ENSP00000343854:V181F;ENSP00000265708:V200F;ENSP00000429352:V200F	.	V	-	1	0	0	ADAM2	39765389	39765389	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.932000	0.00688	-0.905000	0.03871	0.650000	0.86243	GTT	0.701422		TCGA-IB-AAUU-01A-11D-A377-08	0.274	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	3.300000	-20.000000	1	0.370000	NM_001464		0	40	40	0	479	476	0		1			0	0	62	0	0	1	0	0	0	0	0	0	40	479
ZMAT4	79698	broad.mit.edu	37	8	40532370	40532370	+	Missense_Mutation	SNP	C	C	G			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr8:40532370C>G	ENST00000297737.6	-	5	576	c.430G>C	c.(430-432)Gac>Cac	p.D144H	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	144						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CAGTATCTGTCTGAATCTCTT	0.507																																						ENST00000297737.6	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000																										0				18						c.(430-432)Gac>Cac		zinc finger, matrin-type 4							188.0	187.0	188.0					8																	40532370		2203	4300	6503	SO:0001583	missense	79698	0	0					g.chr8:40532370C>G	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.430G>C	chr8.hg19:g.40532370C>G	ENSP00000297737:p.Asp144His	1					ZMAT4_ENST00000315769.7_Intron	p.D144H	NM_024645.2	NP_078921.1	1	15	16	7.312373	Q9H898	ZMAT4_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.00722)	5	576	-	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	Q8WUT8	Missense_Mutation	SNP	ENST00000297737.6	1	1	hg19	c.430G>C	CCDS34885.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.608201	0.87258	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	T;T	0.42513	0.97;0.97	5.88	5.88	0.94601	5.88	5.88	0.94601	Zinc finger, U1-type (1);	0.260803	0.46442	D	0.000283	T	0.34803	0.0910	N	0.24115	0.695	0.58432	D	0.999996	P	0.49961	0.93	P	0.44732	0.459	T	0.03773	-1.1005	10	0.15066	T	0.55	-30.1803	18.7792	0.91925	0.0:1.0:0.0:0.0	.	144	Q9H898	ZMAT4_HUMAN	H	144	ENSP00000297737:D144H;ENSP00000428423:D144H	ENSP00000297737:D144H	D	-	1	0	0	ZMAT4	40651527	40651527	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	7.376000	0.79658	2.782000	0.95742	0.557000	0.71058	GAC	0.824513		TCGA-IB-AAUU-01A-11D-A377-08	0.507	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	1	0	1	2	2	2	2	0	0	0	0	177	177	177	175	1	3.300000	-20.000000	1	0.370000	NM_024645		0	228	226	0	2986	2952	0		1	0		0	0	177	0	0	1	0	0	0	0	1	0	228	2986
CHMP4C	92421	broad.mit.edu	37	8	82670525	82670525	+	Missense_Mutation	SNP	G	G	A	rs562691343		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr8:82670525G>A	ENST00000297265.4	+	4	825	c.632G>A	c.(631-633)cGa>cAa	p.R211Q		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	211	Intramolecular interaction with N- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						CGTCGATCCCGAGCAGGTCTG	0.458													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18270	0.0		0.0	False		,,,				2504	0.0					ENST00000297265.4	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.995640	0.990000	1.000000																										0				10						c.(631-633)cGa>cAa		charged multivesicular body protein 4C							88.0	82.0	85.0					8																	82670525		2203	4300	6503	SO:0001583	missense	92421	2	121402	33				g.chr8:82670525G>A	AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.632G>A	chr8.hg19:g.82670525G>A	ENSP00000297265:p.Arg211Gln	1						p.R211Q	NM_152284.3	NP_689497.1	1	2	3	1.874590	Q96CF2	CHM4C_HUMAN		4	825	+			B2RBZ1	Missense_Mutation	SNP	ENST00000297265.4	1	1	hg19	c.632G>A	CCDS6233.1	1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727483	0.30593	.	.	ENSG00000164695	ENST00000297265	T	0.52526	0.66	6.17	5.3	0.74995	6.17	5.3	0.74995	.	0.268617	0.28908	N	0.013750	T	0.25232	0.0613	N	0.08118	0	0.43334	D	0.995379	B	0.29037	0.231	B	0.17722	0.019	T	0.10497	-1.0627	10	0.15499	T	0.54	-2.4061	13.2245	0.59907	0.0759:0.0:0.9241:0.0	.	211	Q96CF2	CHM4C_HUMAN	Q	211	ENSP00000297265:R211Q	ENSP00000297265:R211Q	R	+	2	0	0	CHMP4C	82833080	82833080	0.991000	0.36638	0.925000	0.36789	0.351000	0.29236	1.321000	0.33678	1.633000	0.50488	0.655000	0.94253	CGA	0.468354		TCGA-IB-AAUU-01A-11D-A377-08	0.458	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379927.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	73	1	3.300000	-2.893999	1	0.370000	NM_152284		0	56	55	0	245	241	1		1	1		0	0	75	0	0	1	9.999999e-01	0	37	0	69	0	56	245
TGFBR1	7046	broad.mit.edu	37	9	101907091	101907091	+	Missense_Mutation	SNP	G	G	C			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr9:101907091G>C	ENST00000374994.4	+	6	1168	c.1051G>C	c.(1051-1053)Gac>Cac	p.D351H	TGFBR1_ENST00000550253.1_Missense_Mutation_p.D282H|TGFBR1_ENST00000552516.1_Missense_Mutation_p.D355H|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000374990.2_Missense_Mutation_p.D274H	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	351	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> G (in LDS1). {ECO:0000269|PubMed:19883511}.		activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CTGTATTGCAGACTTAGGACT	0.358																																						ENST00000374994.4	0.230000	4.000000e-02	0.170000	0.080000	0.120000	0.131135	0.120000	0.120000																										0				27						c.(1051-1053)Gac>Cac		transforming growth factor, beta receptor 1							134.0	128.0	130.0					9																	101907091		2203	4300	6503	SO:0001583	missense	7046	0	0					g.chr9:101907091G>C		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1051G>C	chr9.hg19:g.101907091G>C	ENSP00000364133:p.Asp351His	1					TGFBR1_ENST00000552516.1_Missense_Mutation_p.D355H|TGFBR1_ENST00000374990.2_Missense_Mutation_p.D274H|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000550253.1_Missense_Mutation_p.D282H	p.D351H	NM_004612.2	NP_004603.1	0	2	2	1.610059	P36897	TGFR1_HUMAN		6	1168	+		Acute lymphoblastic leukemia(62;0.0559)	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	0	1	hg19	c.1051G>C	CCDS6738.1	0	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867703	0.91587	.	.	ENSG00000106799	ENST00000374994;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	5.73	5.73	0.89815	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042450	0.85682	N	0.000000	D	0.98726	0.9572	H	0.99964	5.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99063	1.0831	10	0.87932	D	0	.	19.0403	0.92995	0.0:0.0:1.0:0.0	.	274;351	P36897-3;P36897	.;TGFR1_HUMAN	H	351;274;355;282	ENSP00000364133:D351H;ENSP00000364129:D274H;ENSP00000447297:D355H;ENSP00000450052:D282H	ENSP00000364129:D274H	D	+	1	0	0	TGFBR1	100946912	100946912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.796000	0.99103	2.854000	0.98071	0.655000	0.94253	GAC	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.358	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3	0	0	1	2	2	2	2	0	0	0	0	94	94	94	93	1	3.300000	-7.506397	1	0.370000			0	7	7	0	319	317	0		1	0	1	0	0	94	296	0	9.804713e-01	1.613972e-01	9.688136e-01	0	3	29	280	7	319
MUSK	4593	broad.mit.edu	37	9	113547892	113547892	+	Missense_Mutation	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr9:113547892C>T	ENST00000374448.4	+	13	1806	c.1672C>T	c.(1672-1674)Ccg>Tcg	p.P558S	MUSK_ENST00000416899.2_Missense_Mutation_p.P550S|MUSK_ENST00000189978.5_Missense_Mutation_p.P558S|MUSK_ENST00000374438.1_Missense_Mutation_p.P74S	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	558					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CCAGAGGATGCCGCTCCTTCT	0.498																																						ENST00000374448.4	0.090000	0	0.070000	0.020000	0.040000	0.049920	0.040000	0.040000																										0				49						c.(1672-1674)Ccg>Tcg		muscle, skeletal, receptor tyrosine kinase							215.0	207.0	209.0					9																	113547892		1966	4156	6122	SO:0001583	missense	4593	0	0					g.chr9:113547892C>T	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1672C>T	chr9.hg19:g.113547892C>T	ENSP00000363571:p.Pro558Ser	0					MUSK_ENST00000416899.2_Missense_Mutation_p.P550S|MUSK_ENST00000189978.5_Missense_Mutation_p.P558S|MUSK_ENST00000374438.1_Missense_Mutation_p.P74S	p.P558S	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	0	0	0	1.569305	O15146	MUSK_HUMAN		13	1806	+			Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	0	1	hg19	c.1672C>T	CCDS48005.1	0	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084498	0.76642	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000374441;ENST00000416899;ENST00000374438	T;D	0.88664	-0.83;-2.41	5.86	5.86	0.93980	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.92394	0.7586	L	0.45228	1.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90595	0.4540	10	0.33940	T	0.23	.	19.1684	0.93567	0.0:1.0:0.0:0.0	.	558	O15146	MUSK_HUMAN	S	564;558;558;472;472;74;556;74	ENSP00000363571:P558S;ENSP00000363561:P74S	ENSP00000189978:P564S	P	+	1	0	0	MUSK	112587713	112587713	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.777000	0.95525	0.655000	0.94253	CCG	0.348298		TCGA-IB-AAUU-01A-11D-A377-08	0.498	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	165	165	165	163	1	3.300000	-1.857201	0	0.370000			0	6	6	0	723	714	0		1			0	0	165	0	0	9.637002e-01	0	0	0	0	0	0	6	723
PDCD1LG2	80380	broad.mit.edu	37	9	5535034	5535034	+	Silent	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr9:5535034G>A	ENST00000397747.3	+	3	593	c.345G>A	c.(343-345)ctG>ctA	p.L115L	PDCD1LG2_ENST00000397745.2_Silent_p.L115L	NM_025239.3	NP_079515.2	Q9BQ51	PD1L2_HUMAN	programmed cell death 1 ligand 2	115	Ig-like V-type.				immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(2)|lung(4)|prostate(2)	8	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)		ACAAGTACCTGACTCTGAAAG	0.483																																						ENST00000397747.3	0.960000	2.900000e-01	0.770000	0.420000	0.570000	0.600135	0.570000	1.000000																										0				8						c.(343-345)ctG>ctA		programmed cell death 1 ligand 2							49.0	44.0	46.0					9																	5535034		2203	4300	6503	SO:0001819	synonymous_variant	80380	0	0					g.chr9:5535034G>A	AF344424	CCDS6465.1	9p24.2	2014-01-30			ENSG00000197646	ENSG00000197646		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	18731	protein-coding gene	gene with protein product	"""B7 dendritic cell molecule"""	605723				11224527	Standard	NM_025239		Approved	PD-L2, Btdc, PDL2, bA574F11.2, CD273, B7-DC	uc003zjg.4	Q9BQ51	OTTHUMG00000019504	ENST00000397747.3:c.345G>A	chr9.hg19:g.5535034G>A		1					PDCD1LG2_ENST00000397745.2_Silent_p.L115L	p.L115L	NM_025239.3	NP_079515.2	0	2	2	1.586295	Q9BQ51	PD1L2_HUMAN		3	593	+	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)	Q14CN8|Q5T7Z6|Q6JXL8|Q6JXL9	Silent	SNP	ENST00000397747.3	1	1	hg19	c.345G>A	CCDS6465.1	0																																																																																								0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.483	PDCD1LG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051634.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	28	1	3.300000	-15.492490	1	0.370000	NM_025239		0	9	9	0	77	77	1		1	0		0	0	30	0	0	9.950543e-01	1.404494e-02	0	0	0	2	0	9	77
LHX3	8022	broad.mit.edu	37	9	139090879	139090879	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chr9:139090879G>A	ENST00000371748.5	-	4	577	c.481C>T	c.(481-483)Cgc>Tgc	p.R161C	LHX3_ENST00000371746.3_Missense_Mutation_p.R166C	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3	161					inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		ATGGTCGTGCGCGGCCGCTTG	0.761																																						ENST00000371748.5	1.000000	8.700000e-01	1.000000	0.990000	0.990000	0.992339	0.990000	1.000000																										0				8						c.(481-483)Cgc>Tgc		LIM homeobox 3							16.0	18.0	18.0					9																	139090879		2191	4289	6480	SO:0001583	missense	8022	0	0					g.chr9:139090879G>A	AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.481C>T	chr9.hg19:g.139090879G>A	ENSP00000360813:p.Arg161Cys	1					LHX3_ENST00000371746.3_Missense_Mutation_p.R166C	p.R161C	NM_178138.4	NP_835258.1	0	2	2	1.649119	Q9UBR4	LHX3_HUMAN		4	577	-		Myeloproliferative disorder(178;0.0511)	Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Missense_Mutation	SNP	ENST00000371748.5	1	0	hg19	c.481C>T	CCDS6994.1	1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683978	0.88639	.	.	ENSG00000107187	ENST00000371748;ENST00000371746;ENST00000325195	D;D	0.99186	-5.53;-5.53	3.81	3.81	0.43845	3.81	3.81	0.43845	Homeobox (3);Zinc finger, LIM-type (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99576	0.9847	H	0.99425	4.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.97659	1.0159	10	0.87932	D	0	.	10.2927	0.43605	0.0:0.0:0.8028:0.1972	.	161;166	Q9UBR4;F1T0D9	LHX3_HUMAN;.	C	161;166;164	ENSP00000360813:R161C;ENSP00000360811:R166C	ENSP00000319224:R164C	R	-	1	0	0	LHX3	138230700	138230700	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.984000	0.76186	1.959000	0.56917	0.555000	0.69702	CGC	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.761	LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	3.300000	-20.000000	1	0.370000			0	19	19	0	57	57	0		1			0	0	9	0	0	9.999967e-01	0	0	0	0	0	0	19	57
AMOT	154796	broad.mit.edu	37	X	112058796	112058796	+	Silent	SNP	C	C	T			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chrX:112058796C>T	ENST00000524145.1	-	3	1256	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371958.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q			Q4VCS5	AMOT_HUMAN	angiomotin	394					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q394Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gctgctgctgctgttgttggt	0.582																																						ENST00000524145.1	0.200000	2.000000e-02	0.150000	0.050000	0.090000	0.105781	0.090000	0.090000																										1	Substitution - coding silent(1)	p.Q394Q(1)	lung(1)	43						c.(1180-1182)caG>caA		angiomotin							38.0	34.0	36.0					X																	112058796		2203	4300	6503	SO:0001819	synonymous_variant	154796	0	0					g.chrX:112058796C>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1182G>A	chrX.hg19:g.112058796C>T							AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371958.1_Silent_p.Q162Q	p.Q394Q			0	1	1		Q4VCS5	AMOT_HUMAN		3	1256	-			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	0	1	hg19	c.1182G>A	CCDS48154.1	0																																																																																								0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	3.300000	-2.472580	0	0.370000	NM_133265		0	4	3	0	120	119	0		1	0	0	0	0	30	1	0	8.857989e-01	1.029019e-02	0	0	0	4	1	4	120
FAM47C	442444	broad.mit.edu	37	X	37026745	37026745	+	Missense_Mutation	SNP	G	G	A			TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chrX:37026745G>A	ENST00000358047.3	+	1	314	c.262G>A	c.(262-264)Gct>Act	p.A88T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	88										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGGTCCCCAAGCTGACCCCAA	0.532																																						ENST00000358047.3	1.000000	9.400000e-01	1.000000	0.970000	0.980000	0.989971	0.980000	0.990000																										0				120						c.(262-264)Gct>Act		family with sequence similarity 47, member C							75.0	73.0	74.0					X																	37026745		2202	4300	6502	SO:0001583	missense	442444	0	0					g.chrX:37026745G>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.262G>A	chrX.hg19:g.37026745G>A	ENSP00000367913:p.Ala88Thr							p.A88T	NM_001013736.2	NP_001013758.1	0	1	1		Q5HY64	FA47C_HUMAN		1	314	+			Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	1	1	hg19	c.262G>A	CCDS35227.1	1	.	.	.	.	.	.	.	.	.	.	G	8.662	0.900661	0.17686	.	.	ENSG00000198173	ENST00000358047	T	0.20069	2.1	0.502	-0.96	0.10340	0.502	-0.96	0.10340	.	.	.	.	.	T	0.18383	0.0441	L	0.43701	1.375	0.09310	N	1	B	0.28584	0.216	B	0.36959	0.237	T	0.38243	-0.9670	9	0.33940	T	0.23	.	5.7074	0.17915	0.0:0.3376:0.6624:0.0	.	88	Q5HY64	FA47C_HUMAN	T	88	ENSP00000367913:A88T	ENSP00000367913:A88T	A	+	1	0	0	FAM47C	36936666	36936666	0.001000	0.12720	0.002000	0.10522	0.010000	0.07245	0.310000	0.19356	-0.497000	0.06641	0.292000	0.19580	GCT	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.532	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	3.300000	-20.000000	1	0.370000	NM_001013736		0	146	143	0	131	130	1		1			0	0	55	0	0	1	0	0	0	0	0	0	146	131
VGLL1	51442	broad.mit.edu	37	X	135630884	135630884	+	Silent	SNP	G	G	A	rs151216817		TCGA-IB-AAUU-01A-11D-A377-08	TCGA-IB-AAUU-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64433ce6-3172-4d93-97af-a61bc487b4d4	24455824-9f86-49b4-a078-ab7e8fdce629	g.chrX:135630884G>A	ENST00000370634.3	+	3	521	c.351G>A	c.(349-351)ccG>ccA	p.P117P	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					AGTTCTCACCGTCCCTGGCTA	0.592													G|||	1	0.000264901	0.0	0.0	3775	,	,		13992	0.0		0.001	False		,,,				2504	0.0					ENST00000370634.3	0.060000	0	0.040000	0.010000	0.020000	0.032537	0.020000	0.030000																										0				20						c.(349-351)ccG>ccA		vestigial-like family member 1		G		0,3835		0,0,1632,571	250.0	201.0	217.0		351	2.1	0.0	X	dbSNP_134	217	1,6727		0,1,2427,1872	no	coding-synonymous	VGLL1	NM_016267.3		0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095		117/259	135630884	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	51442	9	121410	46				g.chrX:135630884G>A	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.351G>A	chrX.hg19:g.135630884G>A							MIR934_ENST00000401241.1_RNA	p.P117P	NM_016267.3	NP_057351.1	0	1	1		Q99990	VGLL1_HUMAN		3	521	+	Acute lymphoblastic leukemia(192;0.000127)		Q5H915	Silent	SNP	ENST00000370634.3	0	1	hg19	c.351G>A	CCDS14658.1	0	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.672630	0.00758	0.0	1.49E-4	ENSG00000102243	ENST00000440515	.	.	.	5.81	2.14	0.27477	5.81	2.14	0.27477	.	.	.	.	.	T	0.37945	0.1022	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23084	-1.0198	4	.	.	.	1.9921	10.4023	0.44237	0.224:0.0:0.776:0.0	.	.	.	.	I	82	.	.	V	+	1	0	0	VGLL1	135458550	135458550	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.073000	0.14640	0.000000	0.14550	-2.015000	0.00435	GTC	0.370000		TCGA-IB-AAUU-01A-11D-A377-08	0.592	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	0	0	1	2	2	2	2	0	0	0	0	134	134	134	134	1	3.300000	-2.230565	0	0.370000	NM_016267		0	7	7	0	654	649	0		1	0		0	0	134	0	0	9.801466e-01	4.482178e-02	0	0	0	26	0	7	654
