#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
FBXW7	55294	broad.mit.edu	37	4	153253860	153253861	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			AT	-	AT	AT		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:153253860_153253861delAT	ENST00000281708.4	-	6	2101_2102	c.872_873delAT	c.(871-873)tatfs	p.Y291fs	FBXW7_ENST00000603548.1_Frame_Shift_Del_p.Y291fs|FBXW7_ENST00000263981.5_Frame_Shift_Del_p.Y211fs|FBXW7_ENST00000393956.3_Frame_Shift_Del_p.Y115fs|FBXW7_ENST00000603841.1_Frame_Shift_Del_p.Y291fs|FBXW7_ENST00000296555.5_Frame_Shift_Del_p.Y173fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	291	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGAAAGCACATAGAGTGCCAA	0.347			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	ENST00000281708.4	0.830000	5.500000e-01	7.700000e-01	6.100000e-01	0.680000	0.697328	0.680000	0.690000				Rec	yes			Rec	yes		4	4q31.3	4q31.3	55294	Mis, N, D, F	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""				"""E, L"""	E, L			colorectal, endometrial, T-ALL		1	Unknown(1)	p.?(1)	haematopoietic_and_lymphoid_tissue(1)	462						c.(871-873)tatfs		F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase																																				SO:0001589	frameshift_variant	55294	0	0					g.chr4:153253860_153253861delAT	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.872_873delAT	chr4.hg19:g.153253860_153253861delAT	ENSP00000281708:p.Tyr291fs	1					FBXW7_ENST00000296555.5_Frame_Shift_Del_p.Y173fs|FBXW7_ENST00000263981.5_Frame_Shift_Del_p.Y211fs|FBXW7_ENST00000603841.1_Frame_Shift_Del_p.Y291fs|FBXW7_ENST00000393956.3_Frame_Shift_Del_p.Y115fs|FBXW7_ENST00000603548.1_Frame_Shift_Del_p.Y291fs	p.Y291fs	NM_033632.3	NP_361014.1	0	1	1	2.052406	Q969H0	FBXW7_HUMAN		6	2101_2102	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Del	DEL	ENST00000281708.4	1	1	hg19	c.872_873delAT	CCDS3777.1	0																																																																																								0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.347	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1	1	0	1		2	2	2	0	0	0	0	46	0	46	46	1	1.650000	-20.000000	1	0.640000			0	67	68	0	197	196	0	0	1	0	1	0	0	46	179	0	1.000000	7.085031e-01	1	1	90	8	234	67	197
XPNPEP1	7511	broad.mit.edu	37	10	111635301	111635301	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:111635301G>A	ENST00000502935.1	-	15	1495	c.1376C>T	c.(1375-1377)tCg>tTg	p.S459L	XPNPEP1_ENST00000369683.1_Missense_Mutation_p.S345L|XPNPEP1_ENST00000322238.8_Intron|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.S416L					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TTGAGCACCCGAGTCAATAAG	0.448																																						ENST00000502935.1	1.000000	6.000000e-02	2.100000e-01	9.000000e-02	0.130000	0.241806	0.130000	0.130000																										0				31						c.(1375-1377)tCg>tTg		X-prolyl aminopeptidase (aminopeptidase P) 1, soluble							123.0	100.0	108.0					10																	111635301		2203	4300	6503	SO:0001583	missense	7511	1	121412	25				g.chr10:111635301G>A		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1376C>T	chr10.hg19:g.111635301G>A	ENSP00000421566:p.Ser459Leu	1					XPNPEP1_ENST00000322238.8_Intron|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.S416L|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.S345L	p.S459L			0	2	2	2.265393				15	1495	-		Breast(234;0.174)		Missense_Mutation	SNP	ENST00000502935.1	1	1	hg19	c.1376C>T	CCDS7560.2	0	.	.	.	.	.	.	.	.	.	.	G	31	5.070360	0.93950	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000369680	T;T;T	0.74737	-0.87;-0.87;-0.87	5.43	5.43	0.79202	5.43	5.43	0.79202	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.88640	0.6491	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90341	0.4359	10	0.87932	D	0	-11.0405	17.7889	0.88547	0.0:0.0:1.0:0.0	.	416	Q9NQW7	XPP1_HUMAN	L	459;345;416	ENSP00000421566:S459L;ENSP00000358697:S345L;ENSP00000358694:S416L	ENSP00000358694:S416L	S	-	2	0	0	XPNPEP1	111625291	111625291	1.000000	0.71417	0.977000	0.42913	0.987000	0.75469	9.101000	0.94219	2.698000	0.92095	0.655000	0.94253	TCG	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.448	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2	0	0	1		2	2	2	0	0	0	0	27	0	27	26	1	1.650000	-3.192990	1	0.640000			0	11	10	0	255	252	0	0	1	1		0	0	27	0	0	0.998292	9.861251e-01	0	11	0	160	0	11	255
GDI2	2665	broad.mit.edu	37	10	5810230	5810230	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:5810230C>T	ENST00000380191.4	-	8	1227	c.937G>A	c.(937-939)Gat>Aat	p.D313N	GDI2_ENST00000479928.1_5'UTR|GDI2_ENST00000380132.4_Missense_Mutation_p.D317N|GDI2_ENST00000380181.3_Missense_Mutation_p.D268N	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	313					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						GAGTTGGCATCATTGGTGTTC	0.453																																						ENST00000380191.4	0.760000	5.200000e-01	7.000000e-01	5.800000e-01	0.630000	0.644723	0.630000	0.640000																										0				10						c.(937-939)Gat>Aat		GDP dissociation inhibitor 2							141.0	134.0	137.0					10																	5810230		2203	4297	6500	SO:0001583	missense	2665	0	0					g.chr10:5810230C>T	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.937G>A	chr10.hg19:g.5810230C>T	ENSP00000369538:p.Asp313Asn	0					GDI2_ENST00000479928.1_5'UTR|GDI2_ENST00000380132.4_Missense_Mutation_p.D317N|GDI2_ENST00000380181.3_Missense_Mutation_p.D268N	p.D313N	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	0	0	0	2.208544	P50395	GDIB_HUMAN		8	1227	-			O43928|Q5SX88|Q9UQM6	Missense_Mutation	SNP	ENST00000380191.4	0	1	hg19	c.937G>A	CCDS7071.1	0	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583007	0.46006	.	.	ENSG00000057608	ENST00000380191;ENST00000380153;ENST00000447751;ENST00000380132;ENST00000380181	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.042131	0.85682	D	0.000000	T	0.81079	0.4748	N	0.17922	0.545	0.80722	D	1	B;B;B	0.14805	0.001;0.011;0.0	B;B;B	0.24269	0.012;0.052;0.008	T	0.73675	-0.3908	10	0.22109	T	0.4	-34.1661	19.7341	0.96195	0.0:1.0:0.0:0.0	.	317;268;313	E7EU23;Q5SX88;P50395	.;.;GDIB_HUMAN	N	313;146;141;317;268	ENSP00000369538:D313N;ENSP00000387565:D141N;ENSP00000369475:D317N;ENSP00000369528:D268N	ENSP00000369475:D317N	D	-	1	0	0	GDI2	5850236	5850236	1.000000	0.71417	0.969000	0.41365	0.856000	0.48823	6.019000	0.70818	2.764000	0.94973	0.655000	0.94253	GAT	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.453	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	1	0	1		2	2	2	0	0	0	0	42	0	42	45	1	1.650000	-20.000000	1	0.640000	NM_001494		0	94	94	0	358	354	1	0	1	1		0	0	42	0	0	1.000000	1	0	161	0	329	0	94	358
CUBN	8029	broad.mit.edu	37	10	16918924	16918924	+	Silent	SNP	G	G	A	rs140524729	byFrequency	TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:16918924G>A	ENST00000377833.4	-	57	9143	c.9078C>T	c.(9076-9078)ttC>ttT	p.F3026F		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3026	CUB 22. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACTTGAATCCGAAGTCTGTGA	0.443													G|||	7	0.00139776	0.0045	0.0	5008	,	,		17296	0.0		0.001	False		,,,				2504	0.0					ENST00000377833.4	0.710000	4.800000e-01	6.600000e-01	5.300000e-01	0.590000	0.601341	0.590000	0.600000																										0				241						c.(9076-9078)ttC>ttT		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	G		6,4400	11.4+/-27.6	0,6,2197	90.0	85.0	87.0		9078	-11.6	0.0	10	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CUBN	NM_001081.3		0,7,6496	AA,AG,GG		0.0116,0.1362,0.0538		3026/3624	16918924	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	8029	32	121412	50				g.chr10:16918924G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9078C>T	chr10.hg19:g.16918924G>A		0						p.F3026F	NM_001081.3	NP_001072.2	0	1	1	2.243644	O60494	CUBN_HUMAN		57	9143	-			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	1	0	hg19	c.9078C>T	CCDS7113.1	0																																																																																								0.638844		TCGA-LB-A7SX-01A-11D-A33T-08	0.443	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	1	0	1		2	2	2	0	0	0	0	57	0	57	57	1	1.650000	-20.000000	1	0.640000	NM_001081		0	91	91	0	383	379	0	0	1	0		0	0	57	0	0	1.000000	0	0	0	0	1	0	91	383
KIF5B	3799	broad.mit.edu	37	10	32310006	32310006	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:32310006G>A	ENST00000302418.4	-	19	2605	c.2148C>T	c.(2146-2148)atC>atT	p.I716I	KIF5B_ENST00000493889.1_5'UTR	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	716					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				TCAAACTACTGATCTGTTTTT	0.358			T	"""RET, ALK"""	NSCLC																																	ENST00000302418.4	0.160000	5.000000e-02	1.400000e-01	7.000000e-02	0.100000	0.110924	0.100000	0.100000				Dom	yes			Dom	yes		10	10p11.22	10p11.22	3799	T	kinesin family member 5B				E	E	RET, ALK		NSCLC	KIF5B/ALK(8)|KIF5B/RET(79)	0				35						c.(2146-2148)atC>atT		kinesin family member 5B							175.0	168.0	171.0					10																	32310006		2202	4299	6501	SO:0001819	synonymous_variant	3799	0	0					g.chr10:32310006G>A	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.2148C>T	chr10.hg19:g.32310006G>A		0					KIF5B_ENST00000493889.1_5'UTR	p.I716I	NM_004521.2	NP_004512.1	0	1	1	2.243644	P33176	KINH_HUMAN		19	2605	-		Prostate(175;0.0137)	A0AVB2|Q5VZ85	Silent	SNP	ENST00000302418.4	1	1	hg19	c.2148C>T	CCDS7171.1	0																																																																																								0.638844		TCGA-LB-A7SX-01A-11D-A33T-08	0.358	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	0	0	1		2	2	2	0	0	0	0	50	0	50	50	1	1.650000	-3.405940	1	0.640000	NM_004521		0	18	18	0	513	511	0	0	1	1		0	0	50	0	0	0.999982	9.527299e-01	0	2	0	145	0	18	513
C10orf71	118461	broad.mit.edu	37	10	50531971	50531971	+	Missense_Mutation	SNP	G	G	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:50531971G>C	ENST00000374144.3	+	3	1669	c.1381G>C	c.(1381-1383)Gac>Cac	p.D461H	C10orf71_ENST00000323868.4_Missense_Mutation_p.D461H			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	461			D -> A (in dbSNP:rs45554335). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.							endometrium(1)	1						GGATTCAGCAGACAGCCAGCC	0.542																																						ENST00000374144.3	0.900000	6.100000e-01	8.300000e-01	6.800000e-01	0.750000	0.762476	0.750000	0.760000																										0				1						c.(1381-1383)Gac>Cac		chromosome 10 open reading frame 71							50.0	53.0	52.0					10																	50531971		2082	4233	6315	SO:0001583	missense	118461	0	0					g.chr10:50531971G>C	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1381G>C	chr10.hg19:g.50531971G>C	ENSP00000363259:p.Asp461His	0					C10orf71_ENST00000323868.4_Missense_Mutation_p.D461H	p.D461H			0	0	0	2.209438	Q711Q0	CJ071_HUMAN		3	1669	+			A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	1	1	hg19	c.1381G>C	CCDS44387.1	0	.	.	.	.	.	.	.	.	.	.	G	1.808	-0.475281	0.04414	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.16897	2.31;3.44	5.3	0.937	0.19494	5.3	0.937	0.19494	.	1.161450	0.06649	N	0.762440	T	0.18882	0.0453	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.34601	-0.9822	10	0.72032	D	0.01	.	6.9192	0.24378	0.2294:0.1223:0.6483:0.0	.	461	Q711Q0-3	.	H	461	ENSP00000318713:D461H;ENSP00000363259:D461H	ENSP00000318713:D461H	D	+	1	0	0	C10orf71	50201977	50201977	0.884000	0.30299	0.000000	0.03702	0.001000	0.01503	3.496000	0.53288	-0.096000	0.12329	0.650000	0.86243	GAC	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.542	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	0	0	1		2	2	2	0	0	0	0	49	0	49	49	1	1.650000	-20.000000	1	0.640000	NM_199459		0	77	76	0	236	235	1	0	1			0	0	49	0	0	1.000000	0	0	0	0	0	0	77	236
PCDH15	65217	broad.mit.edu	37	10	56128948	56128948	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:56128948C>A	ENST00000320301.6	-	5	800	c.406G>T	c.(406-408)Gtg>Ttg	p.V136L	PCDH15_ENST00000373957.3_Missense_Mutation_p.V114L|PCDH15_ENST00000395432.2_Missense_Mutation_p.V136L|PCDH15_ENST00000395440.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395430.1_Missense_Mutation_p.V136L|PCDH15_ENST00000414778.1_Missense_Mutation_p.V141L|PCDH15_ENST00000361849.3_Missense_Mutation_p.V136L|PCDH15_ENST00000395442.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395438.1_Missense_Mutation_p.V136L|PCDH15_ENST00000373965.2_Missense_Mutation_p.V136L|PCDH15_ENST00000395433.1_Missense_Mutation_p.V114L|PCDH15_ENST00000395445.1_Missense_Mutation_p.V136L|PCDH15_ENST00000373955.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395446.1_Missense_Mutation_p.V136L|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.V136L	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	136	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTCTCACCACTATTCGCACT	0.438										HNSCC(58;0.16)																												ENST00000320301.6	1.000000	7.500000e-01	1	8.300000e-01	0.910000	0.912666	0.910000	1.000000																										0				237						c.(406-408)Gtg>Ttg		protocadherin-related 15							168.0	127.0	141.0					10																	56128948		2203	4300	6503	SO:0001583	missense	65217	0	0					g.chr10:56128948C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.406G>T	chr10.hg19:g.56128948C>A	ENSP00000322604:p.Val136Leu	0	HNSCC(58;0.16)				PCDH15_ENST00000395433.1_Missense_Mutation_p.V114L|PCDH15_ENST00000373965.2_Missense_Mutation_p.V136L|PCDH15_ENST00000395430.1_Missense_Mutation_p.V136L|PCDH15_ENST00000373957.3_Missense_Mutation_p.V114L|PCDH15_ENST00000395440.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395446.1_Missense_Mutation_p.V136L|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.V136L|PCDH15_ENST00000361849.3_Missense_Mutation_p.V136L|PCDH15_ENST00000437009.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395445.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395442.1_Missense_Mutation_p.V136L|PCDH15_ENST00000395432.2_Missense_Mutation_p.V136L|PCDH15_ENST00000373955.1_Missense_Mutation_p.V136L|PCDH15_ENST00000414778.1_Missense_Mutation_p.V141L	p.V136L	NM_033056.3	NP_149045.3	1	2	3	2.279394	Q96QU1	PCD15_HUMAN		5	800	-		Melanoma(3;0.117)|Lung SC(717;0.238)	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	1	1	hg19	c.406G>T	CCDS7248.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386402	0.82902	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57436	0.5;0.55;0.5;0.48;0.5;0.78;0.68;0.4;0.42;0.47;0.41;0.42;0.42;0.48;0.56	5.52	5.52	0.82312	5.52	5.52	0.82312	Cadherin (1);Cadherin conserved site (1);	.	.	.	.	T	0.60792	0.2296	N	0.20986	0.625	0.45118	D	0.998131	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.992;0.999;0.998;0.974;0.992;0.998;0.992;0.996;0.994;0.989;0.999;0.999;1.0;1.0;0.999	D;D;D;P;D;D;D;D;D;P;D;D;D;D;D	0.87578	0.989;0.954;0.928;0.809;0.992;0.928;0.989;0.992;0.928;0.874;0.954;0.954;0.998;0.995;0.97	T	0.57207	-0.7851	9	0.27785	T	0.31	.	19.0325	0.92963	0.0:1.0:0.0:0.0	.	114;136;136;141;136;136;136;136;136;136;136;141;136;114;136	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	L	136;141;136;136;136;136;136;136;136;136;114;114;136;136;141;136;136	ENSP00000363076:V136L;ENSP00000410304:V141L;ENSP00000378826:V136L;ENSP00000378832:V136L;ENSP00000378833:V136L;ENSP00000378829:V136L;ENSP00000378827:V136L;ENSP00000378820:V136L;ENSP00000354950:V136L;ENSP00000378821:V114L;ENSP00000363068:V114L;ENSP00000322604:V136L;ENSP00000378818:V136L;ENSP00000412628:V136L;ENSP00000363066:V136L	ENSP00000322604:V136L	V	-	1	0	0	PCDH15	55798954	55798954	1.000000	0.71417	0.960000	0.40013	0.977000	0.68977	4.754000	0.62191	2.590000	0.87494	0.585000	0.79938	GTG	0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.438	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	1	0	1		2	2	2	0	0	0	0	29	0	29	29	1	1.650000	-20.000000	1	0.640000	NM_033056		0	80	79	0	193	192	1	0	1			0	0	29	0	0	1.000000	0	0	0	0	0	0	80	193
TACR2	6865	broad.mit.edu	37	10	71164771	71164771	+	Silent	SNP	G	G	C	rs200509825		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:71164771G>C	ENST00000373306.4	-	5	1551	c.1008C>G	c.(1006-1008)ctC>ctG	p.L336L	TACR2_ENST00000373307.1_Silent_p.L124L	NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	336					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						GAGTCAGCTCGAGCTTATCTT	0.612																																						ENST00000373306.4	0.130000	3.000000e-02	1.000000e-01	5.000000e-02	0.070000	0.081075	0.070000	0.080000																										0				11						c.(1006-1008)ctC>ctG		tachykinin receptor 2							152.0	132.0	139.0					10																	71164771		2203	4300	6503	SO:0001819	synonymous_variant	6865	0	0					g.chr10:71164771G>C		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.1008C>G	chr10.hg19:g.71164771G>C		0					TACR2_ENST00000373307.1_Silent_p.L124L	p.L336L	NM_001057.2	NP_001048.2	0	0	0	2.160179	P21452	NK2R_HUMAN		5	1551	-			A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Silent	SNP	ENST00000373306.4	1	1	hg19	c.1008C>G	CCDS7293.1	0																																																																																								0.623116		TCGA-LB-A7SX-01A-11D-A33T-08	0.612	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1	0	0	1		2	2	2	0	0	0	0	67	0	67	66	1	1.650000	-2.864965	1	0.640000			0	12	12	0	464	462	0	0	1	0		0	0	67	0	0	0.999114	1.964199e-02	0	0	0	8	0	12	464
H2AFY2	55506	broad.mit.edu	37	10	71859992	71859992	+	Missense_Mutation	SNP	A	A	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:71859992A>C	ENST00000373255.4	+	7	981	c.717A>C	c.(715-717)aaA>aaC	p.K239N	AIFM2_ENST00000373248.1_Intron	NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	239	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						CTGGGGGAAAAGAGTTCTTGG	0.478																																						ENST00000373255.4	1.000000	6.400000e-01	9.500000e-01	7.300000e-01	0.840000	0.844914	0.840000	1.000000																										0				15						c.(715-717)aaA>aaC		H2A histone family, member Y2							51.0	49.0	50.0					10																	71859992		2203	4300	6503	SO:0001583	missense	55506	0	0					g.chr10:71859992A>C	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.717A>C	chr10.hg19:g.71859992A>C	ENSP00000362352:p.Lys239Asn	0					AIFM2_ENST00000373248.1_Intron	p.K239N	NM_018649.2	NP_061119.1	0	0	0	2.160179	Q9P0M6	H2AW_HUMAN		7	981	+			Q5SQT2	Missense_Mutation	SNP	ENST00000373255.4	1	1	hg19	c.717A>C	CCDS7296.1	0	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124489	0.77436	.	.	ENSG00000099284	ENST00000373255;ENST00000395046;ENST00000455786	T;T	0.24908	1.83;1.83	5.8	-2.77	0.05877	5.8	-2.77	0.05877	Appr-1-p processing (2);	0.099386	0.64402	D	0.000002	T	0.32164	0.0820	M	0.73372	2.23	0.80722	D	1	P	0.45348	0.856	P	0.48166	0.569	T	0.36407	-0.9749	10	0.87932	D	0	.	11.8874	0.52610	0.612:0.0:0.388:0.0	.	239	Q9P0M6	H2AW_HUMAN	N	239;173;173	ENSP00000362352:K239N;ENSP00000404584:K173N	ENSP00000362352:K239N	K	+	3	2	2	H2AFY2	71529998	71529998	0.598000	0.26882	0.903000	0.35520	0.992000	0.81027	-0.087000	0.11215	-0.424000	0.07382	0.533000	0.62120	AAA	0.623116		TCGA-LB-A7SX-01A-11D-A33T-08	0.478	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	1	0	1		2	2	2	0	0	0	0	12	0	12	12	1	1.650000	-20.000000	1	0.640000	NM_018649		0	43	43	0	109	108	1	0	1	1		0	0	12	0	0	1.000000	9.999999e-01	0	27	0	43	0	43	109
ABLIM1	3983	broad.mit.edu	37	10	116331054	116331054	+	Splice_Site	SNP	A	A	C	rs573606552	byFrequency	TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr10:116331054A>C	ENST00000277895.5	-	4	771		c.e4+1		ABLIM1_ENST00000369252.4_Splice_Site|ABLIM1_ENST00000533213.2_Splice_Site	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1						axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CGGGGCACTTACTGCTGGAGA	0.527																																						ENST00000277895.5			0	0																														0				30						c.e4+1		actin binding LIM protein 1							131.0	127.0	128.0					10																	116331054		2203	4300	6503	SO:0001630	splice_region_variant	3983	0	0					g.chr10:116331054A>C	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.673+1T>G	chr10.hg19:g.116331054A>C							ABLIM1_ENST00000533213.2_Splice_Site|ABLIM1_ENST00000369252.4_Splice_Site		NM_002313.5	NP_002304.3					O14639	ABLM1_HUMAN		4	771	-		Colorectal(252;0.0373)|Breast(234;0.231)	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Splice_Site	SNP	ENST00000277895.5	1	0	hg19		CCDS7590.1		.	.	.	.	.	.	.	.	.	.	A	26.1	4.702615	0.88924	.	.	ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000392955;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369256;ENST00000369260;ENST00000277895	.	.	.	5.97	5.97	0.96955	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0319	0.71713	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	ABLIM1	116321044	116321044	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.069000	0.93967	2.288000	0.76882	0.533000	0.62120	.			TCGA-LB-A7SX-01A-11D-A33T-08	0.527	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3	1	0	1		2	2	2	0	0	0	0	29	0	29	28	1	1.650000	-2.976506	1	0.640000		Intron	0	77	76	0	338	338	1	0	1	1		0	0	29	0	0	1.000000	4.569672e-01	0	7	0	1	0	77	338
RNF26	79102	broad.mit.edu	37	11	119206987	119206987	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:119206987C>T	ENST00000311413.4	+	1	1751	c.1155C>T	c.(1153-1155)gaC>gaT	p.D385D	C1QTNF5_ENST00000525657.1_5'Flank|RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	385						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		TCTGCCAGGACCAGAGCAAGA	0.597																																						ENST00000311413.4	0.180000	6.000000e-02	1.500000e-01	8.000000e-02	0.110000	0.119040	0.110000	0.120000																										0				12						c.(1153-1155)gaC>gaT		ring finger protein 26							105.0	88.0	94.0					11																	119206987		2199	4295	6494	SO:0001819	synonymous_variant	79102	0	0					g.chr11:119206987C>T	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.1155C>T	chr11.hg19:g.119206987C>T		0					RP11-334E6.10_ENST00000501918.2_RNA|C1QTNF5_ENST00000525657.1_5'Flank	p.D385D	NM_032015.4	NP_114404.1	0	0	0	2.216782	Q9BY78	RNF26_HUMAN		1	1751	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	Q542Y8	Silent	SNP	ENST00000311413.4	1	1	hg19	c.1155C>T	CCDS8419.1	0																																																																																								0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.597	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388220.1	0	0	1		2	2	2	0	0	0	0	44	0	44	43	1	1.650000	-15.793170	1	0.640000	NM_032015		0	16	16	0	422	415	0	0	1	1		0	0	44	0	0	0.999927	8.805467e-01	0	3	0	98	0	16	422
THY1	7070	broad.mit.edu	37	11	119290857	119290857	+	Missense_Mutation	SNP	C	C	T	rs142564004		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:119290857C>T	ENST00000284240.5	-	3	1316	c.277G>A	c.(277-279)Gcc>Acc	p.A93T	THY1_ENST00000528522.1_Missense_Mutation_p.A93T|THY1_ENST00000527590.1_5'UTR|USP2-AS1_ENST00000578923.1_RNA|RP11-334E6.12_ENST00000578216.1_RNA|USP2-AS1_ENST00000498979.2_RNA|USP2-AS1_ENST00000530002.1_RNA|USP2-AS1_ENST00000500970.1_RNA|THY1_ENST00000580275.1_Missense_Mutation_p.A76T	NM_006288.3	NP_006279.2	P04216	THY1_HUMAN	Thy-1 cell surface antigen	93	Ig-like V-type.				angiogenesis (GO:0001525)|cytoskeleton organization (GO:0007010)|focal adhesion assembly (GO:0048041)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of GTPase activity (GO:0043547)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell activation (GO:0050870)|retinal cone cell development (GO:0046549)|single organismal cell-cell adhesion (GO:0016337)|T cell receptor signaling pathway (GO:0050852)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|integrin binding (GO:0005178)|Rho GTPase activator activity (GO:0005100)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		CTAGTGAAGGCGGATAAGTAG	0.562																																						ENST00000284240.5	0.160000	5.000000e-02	1.300000e-01	7.000000e-02	0.100000	0.108550	0.100000	0.100000																										0				12						c.(277-279)Gcc>Acc		Thy-1 cell surface antigen		C	THR/ALA	1,4397	2.1+/-5.4	0,1,2198	275.0	215.0	235.0		277	-3.7	0.0	11	dbSNP_134	235	1,8589	1.2+/-3.3	0,1,4294	no	missense	THY1	NM_006288.3	58	0,2,6492	TT,TC,CC		0.0116,0.0227,0.0154	benign	93/162	119290857	2,12986	2199	4295	6494	SO:0001583	missense	7070	4	121412	39				g.chr11:119290857C>T	M11749	CCDS8424.1	11q23.3	2013-01-14				ENSG00000154096		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11801	protein-coding gene	gene with protein product		188230				2864690	Standard	NM_006288		Approved	CD90	uc001pwr.3	P04216		ENST00000284240.5:c.277G>A	chr11.hg19:g.119290857C>T	ENSP00000284240:p.Ala93Thr	0					THY1_ENST00000527590.1_5'UTR|USP2-AS1_ENST00000498979.2_RNA|THY1_ENST00000580275.1_Missense_Mutation_p.A76T|USP2-AS1_ENST00000500970.1_RNA|RP11-334E6.12_ENST00000578216.1_RNA|THY1_ENST00000528522.1_Missense_Mutation_p.A93T|USP2-AS1_ENST00000530002.1_RNA|USP2-AS1_ENST00000578923.1_RNA	p.A93T	NM_006288.3	NP_006279.2	0	0	0	2.216782	P04216	THY1_HUMAN		3	1316	-		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)	Q16008|Q9NSP1	Missense_Mutation	SNP	ENST00000284240.5	1	1	hg19	c.277G>A	CCDS8424.1	0	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945019	0.34283	2.27E-4	1.16E-4	ENSG00000154096	ENST00000284240;ENST00000528522;ENST00000524970;ENST00000524659	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	4.94	-3.71	0.04424	4.94	-3.71	0.04424	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.566810	0.03175	N	0.171259	T	0.10637	0.0260	N	0.08118	0	0.09310	N	1	B	0.25441	0.126	B	0.23275	0.045	T	0.28138	-1.0053	10	0.42905	T	0.14	-7.3332	7.1224	0.25453	0.1288:0.2015:0.0:0.6697	.	93	P04216	THY1_HUMAN	T	93	ENSP00000284240:A93T;ENSP00000431301:A93T;ENSP00000432808:A93T;ENSP00000435753:A93T	ENSP00000284240:A93T	A	-	1	0	0	THY1	118796067	118796067	0.000000	0.05858	0.028000	0.17463	0.953000	0.61014	-0.396000	0.07278	-0.677000	0.05231	0.591000	0.81541	GCC	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.562	THY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388370.2	0	0	1		2	2	2	0	0	0	0	70	0	70	68	1	1.650000	-3.041657	1	0.640000	NM_006288		0	17	17	0	492	490	0	0	1	0		0	0	70	0	0	0.999965	9.834774e-01	0	0	0	195	0	17	492
OR6X1	390260	broad.mit.edu	37	11	123625215	123625215	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:123625215G>A	ENST00000327930.2	-	1	38	c.12C>T	c.(10-12)ggC>ggT	p.G4G		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGATTACTGTGCCATTTCTCA	0.398																																						ENST00000327930.2	0.740000	5.500000e-01	7.000000e-01	5.900000e-01	0.640000	0.650911	0.640000	0.650000																										0				23						c.(10-12)ggC>ggT		olfactory receptor, family 6, subfamily X, member 1							89.0	82.0	85.0					11																	123625215		2196	4274	6470	SO:0001819	synonymous_variant	390260	0	0					g.chr11:123625215G>A	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.12C>T	chr11.hg19:g.123625215G>A		0						p.G4G	NM_001005188.1	NP_001005188.1	0	0	0	2.222305	Q8NH79	OR6X1_HUMAN		1	38	-		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	B9EGW9|Q6IFA0	Silent	SNP	ENST00000327930.2	1	1	hg19	c.12C>T	CCDS31695.1	0																																																																																								0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.398	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	1	0	1		2	2	2	0	0	0	0	81	0	81	80	1	1.650000	-20.000000	1	0.640000	NM_001005188		0	135	134	0	507	504	1	0	1			0	0	81	0	0	1.000000	0	0	0	0	0	0	135	507
OR8B12	219858	broad.mit.edu	37	11	124413456	124413456	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:124413456C>T	ENST00000306842.2	-	1	119	c.95G>A	c.(94-96)gGt>gAt	p.G32D		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		CGTGTAGAAACCCAGAAACAG	0.512																																						ENST00000306842.2	0.150000	5.000000e-02	1.200000e-01	7.000000e-02	0.090000	0.100746	0.090000	0.100000																										0				31						c.(94-96)gGt>gAt		olfactory receptor, family 8, subfamily B, member 12							58.0	62.0	61.0					11																	124413456		2201	4299	6500	SO:0001583	missense	219858	0	0					g.chr11:124413456C>T		CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.95G>A	chr11.hg19:g.124413456C>T	ENSP00000307159:p.Gly32Asp	0						p.G32D	NM_001005195.1	NP_001005195.1	0	0	0	2.222305	Q8NGG6	OR8BC_HUMAN		1	119	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	B2RNF6|Q6IEW8|Q96RC7	Missense_Mutation	SNP	ENST00000306842.2	1	1	hg19	c.95G>A	CCDS31711.1	0	.	.	.	.	.	.	.	.	.	.	C	8.799	0.932336	0.18131	.	.	ENSG00000170953	ENST00000306842	T	0.00441	7.41	3.89	1.92	0.25849	3.89	1.92	0.25849	.	0.739643	0.12351	N	0.476555	T	0.00412	0.0013	M	0.64676	1.99	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.34104	-0.9842	10	0.35671	T	0.21	.	9.0627	0.36444	0.2929:0.5648:0.1422:0.0	.	32	Q8NGG6	OR8BC_HUMAN	D	32	ENSP00000307159:G32D	ENSP00000307159:G32D	G	-	2	0	0	OR8B12	123918666	123918666	0.000000	0.05858	0.075000	0.20258	0.874000	0.50279	0.248000	0.18198	0.550000	0.28991	0.650000	0.86243	GGT	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.512	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387061.1	0	0	1		2	2	2	0	0	0	0	68	0	68	67	1	1.650000	-14.378900	1	0.640000			0	16	16	0	502	493	0	0	1			0	0	68	0	0	0.999925	0	0	0	0	0	0	16	502
ARHGAP32	9743	broad.mit.edu	37	11	128844270	128844270	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:128844270G>A	ENST00000310343.9	-	20	2779	c.2780C>T	c.(2779-2781)tCa>tTa	p.S927L	ARHGAP32_ENST00000527272.1_Missense_Mutation_p.S578L|ARHGAP32_ENST00000524655.1_Missense_Mutation_p.S853L|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.S578L	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	927					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TGTGGTATTTGAGACTGTACC	0.438																																						ENST00000310343.9	0.760000	5.200000e-01	7.100000e-01	5.800000e-01	0.640000	0.647141	0.640000	0.640000																										0				60						c.(2779-2781)tCa>tTa		Rho GTPase activating protein 32							198.0	181.0	187.0					11																	128844270		2201	4297	6498	SO:0001583	missense	9743	0	0					g.chr11:128844270G>A	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2780C>T	chr11.hg19:g.128844270G>A	ENSP00000310561:p.Ser927Leu	0					ARHGAP32_ENST00000524655.1_Missense_Mutation_p.S853L|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.S578L|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.S578L	p.S927L	NM_001142685.1	NP_001136157.1	0	0	0	2.222305	A7KAX9	RHG32_HUMAN		20	2779	-			I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	1	1	hg19	c.2780C>T	CCDS44769.1	0	.	.	.	.	.	.	.	.	.	.	G	1.539	-0.542366	0.04053	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.19532	2.14;2.14;2.14;2.14	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.685457	0.14496	N	0.316057	T	0.19005	0.0456	L	0.47716	1.5	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.09422	-1.0675	10	0.27082	T	0.32	.	9.239	0.37484	0.0747:0.0:0.7798:0.1455	.	861;927	Q86T64;A7KAX9	.;RHG32_HUMAN	L	927;578;853;861;578	ENSP00000310561:S927L;ENSP00000376425:S578L;ENSP00000432468:S853L;ENSP00000432862:S578L	ENSP00000310561:S927L	S	-	2	0	0	ARHGAP32	128349480	128349480	0.439000	0.25610	0.010000	0.14722	0.962000	0.63368	3.889000	0.56212	2.745000	0.94114	0.655000	0.94253	TCA	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.438	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	1	0	1		2	2	2	0	0	0	0	67	0	67	67	1	1.650000	-3.653061	1	0.640000	NM_014715		0	91	91	0	345	343	1	0	1	1		0	0	67	0	0	1.000000	9.938018e-01	0	11	0	21	0	91	345
BARX2	8538	broad.mit.edu	37	11	129321169	129321169	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:129321169C>T	ENST00000281437.4	+	4	808	c.712C>T	c.(712-714)Cag>Tag	p.Q238*	BARX2_ENST00000531946.1_Nonsense_Mutation_p.Q116*|BARX2_ENST00000526127.1_Nonsense_Mutation_p.Q93*	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	238					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		GGAGCCCTCTCAGGGGCAGGA	0.582																																						ENST00000281437.4	0.110000	2.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.065222	0.050000	0.060000																										0				20						c.(712-714)Cag>Tag		BARX homeobox 2							68.0	62.0	64.0					11																	129321169		2201	4297	6498	SO:0001587	stop_gained	8538	0	0					g.chr11:129321169C>T	AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.712C>T	chr11.hg19:g.129321169C>T	ENSP00000281437:p.Gln238*	0					BARX2_ENST00000526127.1_Nonsense_Mutation_p.Q93*|BARX2_ENST00000531946.1_Nonsense_Mutation_p.Q116*	p.Q238*	NM_003658.4	NP_003649.2	0	0	0	2.222305	Q9UMQ3	BARX2_HUMAN		4	808	+	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	O43518|Q6NT51	Nonsense_Mutation	SNP	ENST00000281437.4	0	1	hg19	c.712C>T	CCDS8481.1	0	.	.	.	.	.	.	.	.	.	.	C	37	6.365625	0.97507	.	.	ENSG00000043039	ENST00000281437;ENST00000526127;ENST00000531946	.	.	.	5.51	-0.263	0.12954	5.51	-0.263	0.12954	.	1.403330	0.03992	N	0.294986	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	7.0817	0.25235	0.1156:0.3683:0.445:0.0712	.	.	.	.	X	238;93;116	.	ENSP00000281437:Q238X	Q	+	1	0	0	BARX2	128826379	128826379	0.053000	0.20554	0.001000	0.08648	0.008000	0.06430	0.707000	0.25704	0.268000	0.21939	0.655000	0.94253	CAG	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.582	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386153.1	0	0	1		2	2	2	0	0	0	0	55	0	55	55	1	1.650000	-3.277555	1	0.640000	NM_003658		0	7	7	0	369	367	0	0	1	1		0	0	55	0	0	0.980471	8.707947e-01	0	7	0	187	0	7	369
OR51B2	79345	broad.mit.edu	37	11	5344684	5344684	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:5344684G>A	ENST00000328813.2	-	1	898	c.844C>T	c.(844-846)Cct>Tct	p.P282S	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATTAAAGGAGGAAAGAGGAAG	0.373																																						ENST00000328813.2	0.400000	2.300000e-01	3.600000e-01	2.600000e-01	0.300000	0.316791	0.300000	0.310000																										0				35						c.(844-846)Cct>Tct		olfactory receptor, family 51, subfamily B, member 2							115.0	107.0	110.0					11																	5344684		2201	4297	6498	SO:0001583	missense	79345	0	0					g.chr11:5344684G>A	AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.844C>T	chr11.hg19:g.5344684G>A	ENSP00000327540:p.Pro282Ser	1					HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	p.P282S	NM_033180.4	NP_149420.4	0	1	1	1.757469	Q9Y5P1	O51B2_HUMAN		1	898	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	Q96RD4	Missense_Mutation	SNP	ENST00000328813.2	1	1	hg19	c.844C>T	CCDS31377.1	0	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185866	0.78789	.	.	ENSG00000184881	ENST00000328813	T	0.35048	1.33	4.38	4.38	0.52667	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	U	0.001743	T	0.66636	0.2809	M	0.90252	3.1	0.45118	D	0.998133	D	0.89917	1.0	D	0.79784	0.993	T	0.75720	-0.3219	10	0.87932	D	0	.	15.8595	0.79012	0.0:0.0:1.0:0.0	.	282	Q9Y5P1	O51B2_HUMAN	S	282	ENSP00000327540:P282S	ENSP00000327540:P282S	P	-	1	0	0	OR51B2	5301260	5301260	1.000000	0.71417	0.897000	0.35233	0.988000	0.76386	5.480000	0.66820	2.306000	0.77630	0.638000	0.83543	CCT	0.530271		TCGA-LB-A7SX-01A-11D-A33T-08	0.373	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	1	0	1		2	2	2	0	0	0	0	73	0	73	73	1	1.650000	-20.000000	1	0.640000	NM_033180		0	47	47	0	313	308	1	0	1			0	0	73	0	0	1.000000	0	0	0	0	0	0	47	313
OR52N5	390075	broad.mit.edu	37	11	5799446	5799446	+	Missense_Mutation	SNP	C	C	T	rs144845456	byFrequency	TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:5799446C>T	ENST00000317093.2	-	1	451	c.419G>A	c.(418-420)cGt>cAt	p.R140H	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GGTAGCATAACGCAAAGGGTA	0.502																																						ENST00000317093.2	0.820000	4.500000e-01	7.300000e-01	5.400000e-01	0.630000	0.643078	0.630000	0.630000																										0				33						c.(418-420)cGt>cAt		olfactory receptor, family 52, subfamily N, member 5		C	HIS/ARG	0,4256		0,0,2128	137.0	110.0	119.0		419	0.6	0.0	11	dbSNP_134	119	1,8179		0,1,4089	no	missense	OR52N5	NM_001001922.2	29	0,1,6217	TT,TC,CC		0.0122,0.0,0.0080	possibly-damaging	140/325	5799446	1,12435	2128	4090	6218	SO:0001583	missense	390075	1	115844	39				g.chr11:5799446C>T	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.419G>A	chr11.hg19:g.5799446C>T	ENSP00000322866:p.Arg140His	1					TRIM5_ENST00000380027.1_Intron	p.R140H	NM_001001922.2	NP_001001922.2	0	1	1	1.757469	Q8NH56	O52N5_HUMAN		1	451	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	B9EH12|Q6IFG2	Missense_Mutation	SNP	ENST00000317093.2	1	1	hg19	c.419G>A	CCDS31397.1	0	.	.	.	.	.	.	.	.	.	.	C	8.537	0.872434	0.17322	0.0	1.22E-4	ENSG00000181009	ENST00000317093	T	0.00669	5.9	3.7	0.61	0.17580	3.7	0.61	0.17580	GPCR, rhodopsin-like superfamily (1);	0.000000	0.27294	U	0.020040	T	0.00608	0.0020	N	0.21508	0.67	0.23966	N	0.996326	B	0.16166	0.016	B	0.10450	0.005	T	0.47971	-0.9075	10	0.34782	T	0.22	.	5.9492	0.19235	0.0:0.6557:0.1568:0.1875	.	140	Q8NH56	O52N5_HUMAN	H	140	ENSP00000322866:R140H	ENSP00000322866:R140H	R	-	2	0	0	OR52N5	5756022	5756022	0.000000	0.05858	0.025000	0.17156	0.722000	0.41435	-0.692000	0.05127	0.025000	0.15241	0.494000	0.49563	CGT	0.530271		TCGA-LB-A7SX-01A-11D-A33T-08	0.502	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	1	0	1		2	2	2	0	0	0	0	38	0	38	38	1	1.650000	-19.999990	1	0.640000	NM_001001922		0	32	31	0	88	88	0	0	1			0	0	38	0	0	1.000000	0	0	0	0	0	0	32	88
CYP2R1	120227	broad.mit.edu	37	11	14913531	14913531	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:14913531C>G	ENST00000334636.5	-	1	267	c.221G>C	c.(220-222)gGa>gCa	p.G74A	CYP2R1_ENST00000526489.1_5'Flank|CYP2R1_ENST00000532378.1_5'Flank	NM_024514.4	NP_078790.2	Q6VVX0	CP2R1_HUMAN	cytochrome P450, family 2, subfamily R, polypeptide 1	74					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14					Cholecalciferol(DB00169)|Ergocalciferol(DB00153)	CTGTACCTCTCCGTACACCTG	0.682																																					NSCLC(173;1584 2058 26117 29365 41534)	ENST00000334636.5	1.000000	7.500000e-01	1	8.400000e-01	0.930000	0.925546	0.930000	1.000000																										0				14						c.(220-222)gGa>gCa		cytochrome P450, family 2, subfamily R, polypeptide 1	Cholecalciferol(DB00169)|Ergocalciferol(DB00153)						23.0	25.0	24.0					11																	14913531		2200	4294	6494	SO:0001583	missense	120227	0	0					g.chr11:14913531C>G	AY323817	CCDS7818.1	11p15.2	2008-02-05			ENSG00000186104	ENSG00000186104		"""Cytochrome P450s"""	20580	protein-coding gene	gene with protein product		608713				12464240, 12867411	Standard	XM_005252788		Approved		uc001mlr.3	Q6VVX0	OTTHUMG00000165900	ENST00000334636.5:c.221G>C	chr11.hg19:g.14913531C>G	ENSP00000334592:p.Gly74Ala	1					CYP2R1_ENST00000532378.1_5'Flank|CYP2R1_ENST00000526489.1_5'Flank	p.G74A	NM_024514.4	NP_078790.2	0	1	1	1.757469	Q6VVX0	CP2R1_HUMAN		1	267	-			Q2M3H3|Q5RT65	Missense_Mutation	SNP	ENST00000334636.5	1	1	hg19	c.221G>C	CCDS7818.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.301978	0.95601	.	.	ENSG00000186104	ENST00000334636	D	0.86230	-2.09	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.053179	0.85682	D	0.000000	D	0.95730	0.8611	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96785	0.9578	10	0.87932	D	0	.	18.7483	0.91802	0.0:1.0:0.0:0.0	.	74	Q6VVX0	CP2R1_HUMAN	A	74	ENSP00000334592:G74A	ENSP00000334592:G74A	G	-	2	0	0	CYP2R1	14870107	14870107	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.224000	0.65288	2.665000	0.90641	0.462000	0.41574	GGA	0.530271		TCGA-LB-A7SX-01A-11D-A33T-08	0.682	CYP2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386985.1	1	0	1		2	2	2	0	0	0	0	34	0	34	34	1	1.650000	-20.000000	1	0.640000	NM_024514		0	56	56	0	86	86	0	0	1	1		0	0	34	0	0	1.000000	3.470320e-01	0	2	0	1	0	56	86
ABTB2	25841	broad.mit.edu	37	11	34182562	34182562	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:34182562G>A	ENST00000435224.2	-	11	2709	c.2285C>T	c.(2284-2286)tCg>tTg	p.S762L	ABTB2_ENST00000298992.2_Missense_Mutation_p.S576L	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	762					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CTGCACCACCGAGTACCGCGA	0.612																																						ENST00000435224.2	0.180000	3.000000e-02	1.300000e-01	5.000000e-02	0.080000	0.097824	0.080000	0.080000																										0				25						c.(2284-2286)tCg>tTg		ankyrin repeat and BTB (POZ) domain containing 2							76.0	65.0	69.0					11																	34182562		2202	4298	6500	SO:0001583	missense	25841	0	0					g.chr11:34182562G>A	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2285C>T	chr11.hg19:g.34182562G>A	ENSP00000410157:p.Ser762Leu	1					ABTB2_ENST00000298992.2_Missense_Mutation_p.S576L	p.S762L	NM_145804.2	NP_665803.2	0	1	1	1.757469	Q8N961	ABTB2_HUMAN		11	2709	-		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	ENST00000435224.2	0	1	hg19	c.2285C>T	CCDS7890.2	0	.	.	.	.	.	.	.	.	.	.	G	17.15	3.314888	0.60524	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.60424	0.19;0.19	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.192066	0.46442	D	0.000289	T	0.50514	0.1620	L	0.53249	1.67	0.45852	D	0.998714	P	0.45672	0.864	B	0.31495	0.131	T	0.60652	-0.7221	10	0.54805	T	0.06	-16.6682	18.6197	0.91317	0.0:0.0:1.0:0.0	.	576	Q8N961	ABTB2_HUMAN	L	762;576	ENSP00000410157:S762L;ENSP00000298992:S576L	ENSP00000298992:S576L	S	-	2	0	0	ABTB2	34139138	34139138	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	4.222000	0.58580	2.401000	0.81631	0.561000	0.74099	TCG	0.530271		TCGA-LB-A7SX-01A-11D-A33T-08	0.612	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	0	0	1		2	2	2	0	0	0	0	30	0	30	30	1	1.650000	-7.661898	1	0.640000	NM_145804		0	5	5	0	139	136	0	0	1	0		0	0	30	0	0	0.935165	5.489195e-02	0	0	0	9	0	5	139
AGBL2	79841	broad.mit.edu	37	11	47721004	47721004	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:47721004C>A	ENST00000525123.1	-	8	973	c.688G>T	c.(688-690)Gat>Tat	p.D230Y	AGBL2_ENST00000298861.4_Missense_Mutation_p.D230Y|AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000528244.1_Missense_Mutation_p.D192Y|AGBL2_ENST00000357610.3_Missense_Mutation_p.D230Y	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	230						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						ATACCTGAATCTAATTGATAG	0.323																																						ENST00000525123.1	0.150000	3.000000e-02	1.200000e-01	5.000000e-02	0.080000	0.091800	0.080000	0.080000																										0				34						c.(688-690)Gat>Tat		ATP/GTP binding protein-like 2							180.0	168.0	172.0					11																	47721004		2201	4298	6499	SO:0001583	missense	79841	0	0					g.chr11:47721004C>A		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.688G>T	chr11.hg19:g.47721004C>A	ENSP00000435582:p.Asp230Tyr	1					AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000298861.4_Missense_Mutation_p.D230Y|AGBL2_ENST00000528244.1_Missense_Mutation_p.D192Y|AGBL2_ENST00000357610.3_Missense_Mutation_p.D230Y	p.D230Y	NM_024783.3	NP_079059.2	0	1	1	1.757469	Q5U5Z8	CBPC2_HUMAN		8	973	-			A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	1	1	hg19	c.688G>T	CCDS7944.1	0	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240985	0.39598	.	.	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244;ENST00000532595;ENST00000420784	T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65	5.22	4.28	0.50868	5.22	4.28	0.50868	.	0.515698	0.23114	N	0.051766	T	0.27419	0.0673	L	0.59436	1.845	0.32047	N	0.597485	B;B;B	0.28208	0.203;0.129;0.129	B;B;B	0.28784	0.094;0.043;0.043	T	0.38887	-0.9640	10	0.72032	D	0.01	-14.9865	4.6077	0.12385	0.0:0.606:0.1987:0.1952	.	192;192;230	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	Y	230;230;230;192;174;174	ENSP00000435582:D230Y;ENSP00000350228:D230Y;ENSP00000298861:D230Y;ENSP00000436630:D192Y;ENSP00000436063:D174Y	ENSP00000298861:D230Y	D	-	1	0	0	AGBL2	47677580	47677580	0.997000	0.39634	1.000000	0.80357	0.930000	0.56654	0.984000	0.29565	1.168000	0.42723	0.393000	0.25936	GAT	0.530271		TCGA-LB-A7SX-01A-11D-A33T-08	0.323	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	0	0	1		2	2	2	0	0	0	0	43	0	43	43	1	1.650000	-10.428710	1	0.640000	NM_024783		0	9	9	0	249	246	0	0	1	0		0	0	43	0	0	0.994143	1.620984e-03	0	1	0	1	0	9	249
ASRGL1	80150	broad.mit.edu	37	11	62159721	62159721	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:62159721G>A	ENST00000415229.2	+	7	1107	c.892G>A	c.(892-894)Gat>Aat	p.D298N	ASRGL1_ENST00000301776.5_Missense_Mutation_p.D298N|CTD-2531D15.5_ENST00000526045.1_RNA	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	298					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	CTTCGGAATTGATCCTGACGA	0.527											OREG0021023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000415229.2	0.670000	4.300000e-01	6.100000e-01	4.900000e-01	0.540000	0.556645	0.540000	0.550000																										0				7						c.(892-894)Gat>Aat		asparaginase like 1	L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)						99.0	85.0	90.0					11																	62159721		2202	4299	6501	SO:0001583	missense	80150	0	0					g.chr11:62159721G>A		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.892G>A	chr11.hg19:g.62159721G>A	ENSP00000400057:p.Asp298Asn	0		OREG0021023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1059	CTD-2531D15.5_ENST00000526045.1_RNA|ASRGL1_ENST00000301776.5_Missense_Mutation_p.D298N	p.D298N	NM_001083926.1	NP_001077395.1	0	0	0	2.219709	Q7L266	ASGL1_HUMAN		7	1107	+			B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	ENST00000415229.2	1	1	hg19	c.892G>A	CCDS8019.1	0	.	.	.	.	.	.	.	.	.	.	G	7.665	0.685751	0.14973	.	.	ENSG00000162174	ENST00000415229;ENST00000301776	D;D	0.94650	-3.48;-3.48	5.24	0.102	0.14522	5.24	0.102	0.14522	.	0.502864	0.23382	N	0.048795	D	0.86781	0.6015	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.73733	-0.3890	10	0.31617	T	0.26	-12.1929	3.3361	0.07102	0.3163:0.0:0.3911:0.2926	.	298	Q7L266	ASGL1_HUMAN	N	298	ENSP00000400057:D298N;ENSP00000301776:D298N	ENSP00000301776:D298N	D	+	1	0	0	ASRGL1	61916297	61916297	0.065000	0.20965	0.001000	0.08648	0.066000	0.16364	0.483000	0.22292	0.210000	0.20664	0.655000	0.94253	GAT	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.527	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394865.1	1	0	1		2	2	2	0	0	0	0	55	0	55	54	1	1.650000	-20.000000	1	0.640000	NM_001083926		0	72	70	0	330	329	1	0	1	1		0	0	55	0	0	1.000000	9.999915e-01	0	6	0	74	0	72	330
SIPA1	6494	broad.mit.edu	37	11	65413984	65413984	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:65413984C>T	ENST00000394224.3	+	8	1775	c.1479C>T	c.(1477-1479)ggC>ggT	p.G493G	MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000534313.1_Silent_p.G493G|SIPA1_ENST00000527525.1_Silent_p.G493G|SIPA1_ENST00000394227.3_Silent_p.G493G	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	493	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						TGCCTGCTGGCGGAGGCCCCT	0.716																																						ENST00000394224.3	0.620000	1.900000e-01	5.000000e-01	2.800000e-01	0.380000	0.396507	0.380000	0.370000																										0				10						c.(1477-1479)ggC>ggT		signal-induced proliferation-associated 1							9.0	8.0	8.0					11																	65413984		2172	4265	6437	SO:0001819	synonymous_variant	6494	2	118984	22				g.chr11:65413984C>T	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.1479C>T	chr11.hg19:g.65413984C>T		0					MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000394227.3_Silent_p.G493G|SIPA1_ENST00000534313.1_Silent_p.G493G|SIPA1_ENST00000527525.1_Silent_p.G493G	p.G493G	NM_153253.29	NP_694985.29	0	0	0	2.218506	Q96FS4	SIPA1_HUMAN		8	1775	+			O14518|O60484|O60618|Q2YD83	Silent	SNP	ENST00000394224.3	0	1	hg19	c.1479C>T	CCDS8108.1	0																																																																																								0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.716	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	1	0	1		2	2	2	0	0	0	0	10	0	10	10	1	1.650000	-17.535090	1	0.640000	NM_006747		0	10	10	0	73	70	1	0	1	1		0	0	10	0	0	0.996945	9.637290e-01	0	5	0	40	0	10	73
ANKRD42	338699	broad.mit.edu	37	11	82921451	82921451	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:82921451G>A	ENST00000393392.2	+	4	518	c.356G>A	c.(355-357)cGa>cAa	p.R119Q	ANKRD42_ENST00000533342.1_Missense_Mutation_p.R147Q|ANKRD42_ENST00000393389.3_Missense_Mutation_p.R147Q|ANKRD42_ENST00000260047.6_Missense_Mutation_p.R147Q|ANKRD42_ENST00000528722.1_Missense_Mutation_p.R34Q|ANKRD42_ENST00000531895.1_Missense_Mutation_p.R147Q|RP11-727A23.7_ENST00000531869.1_RNA|ANKRD42_ENST00000526731.1_Missense_Mutation_p.R147Q	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	119					positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						ATAATGCTCCGAAGTGGAGTG	0.408																																						ENST00000393392.2	0.100000	2.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.062964	0.050000	0.060000																										0				18						c.(355-357)cGa>cAa		ankyrin repeat domain 42							147.0	143.0	145.0					11																	82921451		2203	4300	6503	SO:0001583	missense	338699	1	121412	31				g.chr11:82921451G>A	AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.356G>A	chr11.hg19:g.82921451G>A	ENSP00000377051:p.Arg119Gln	0					ANKRD42_ENST00000260047.6_Missense_Mutation_p.R147Q|ANKRD42_ENST00000526731.1_Missense_Mutation_p.R147Q|ANKRD42_ENST00000533342.1_Missense_Mutation_p.R147Q|RP11-727A23.7_ENST00000531869.1_RNA|ANKRD42_ENST00000393389.3_Missense_Mutation_p.R147Q|ANKRD42_ENST00000531895.1_Missense_Mutation_p.R147Q|ANKRD42_ENST00000528722.1_Missense_Mutation_p.R34Q	p.R119Q	NM_182603.2	NP_872409.2	0	0	0	2.218506	Q8N9B4	ANR42_HUMAN		4	518	+			Q49A49	Missense_Mutation	SNP	ENST00000393392.2	0	1	hg19	c.356G>A	CCDS8265.1	0	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806293	0.70682	.	.	ENSG00000137494	ENST00000545672;ENST00000393389;ENST00000528722;ENST00000260047;ENST00000526731;ENST00000531895;ENST00000393392;ENST00000533342	T;D;T;T;T;T;T	0.81996	-0.06;-1.56;-0.06;-0.06;-0.06;-0.06;-0.06	5.89	4.98	0.66077	5.89	4.98	0.66077	Ankyrin repeat-containing domain (4);	0.112713	0.39615	N	0.001304	T	0.71298	0.3323	N	0.13272	0.32	0.36543	D	0.871416	P;P;P;P;D	0.53745	0.838;0.88;0.927;0.906;0.962	B;B;B;B;B	0.43103	0.319;0.213;0.36;0.408;0.319	T	0.75274	-0.3375	9	.	.	.	-0.8612	14.0266	0.64590	0.0734:0.0:0.9266:0.0	.	147;147;412;238;119	E9PIL2;Q8N9B4-2;A1DRY3;A1XPJ0;Q8N9B4	.;.;.;.;ANR42_HUMAN	Q	466;147;34;147;147;147;119;147	ENSP00000377049:R147Q;ENSP00000432375:R34Q;ENSP00000260047:R147Q;ENSP00000433585:R147Q;ENSP00000434666:R147Q;ENSP00000377051:R119Q;ENSP00000435790:R147Q	.	R	+	2	0	0	ANKRD42	82599099	82599099	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	4.787000	0.62432	1.501000	0.48654	0.655000	0.94253	CGA	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.408	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000392934.1	0	0	1		2	2	2	0	0	0	0	77	0	77	76	1	1.650000	-2.463851	0	0.640000	NM_182603		0	12	12	0	622	618	0	0	1	0		0	0	77	0	0	0.999089	7.047108e-02	0	1	0	20	0	12	622
ADAMTS15	170689	broad.mit.edu	37	11	130332572	130332572	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr11:130332572G>T	ENST00000299164.2	+	4	1439	c.1439G>T	c.(1438-1440)tGc>tTc	p.C480F		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	480	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CAGATGGTGTGCCAGACCCGC	0.627																																						ENST00000299164.2	0.100000	2.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.063348	0.050000	0.060000																										0				36						c.(1438-1440)tGc>tTc		ADAM metallopeptidase with thrombospondin type 1 motif, 15							75.0	72.0	73.0					11																	130332572		2201	4297	6498	SO:0001583	missense	170689	0	0					g.chr11:130332572G>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.1439G>T	chr11.hg19:g.130332572G>T	ENSP00000299164:p.Cys480Phe	0						p.C480F	NM_139055.2	NP_620686.1	0	0	0	2.222305	Q8TE58	ATS15_HUMAN		4	1439	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	0	1	hg19	c.1439G>T	CCDS8488.1	0	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754975	0.89843	.	.	ENSG00000166106	ENST00000299164	T	0.68765	-0.35	5.48	5.48	0.80851	5.48	5.48	0.80851	.	.	.	.	.	D	0.87962	0.6310	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91263	0.5038	9	0.87932	D	0	.	19.3471	0.94367	0.0:0.0:1.0:0.0	.	480	Q8TE58	ATS15_HUMAN	F	480	ENSP00000299164:C480F	ENSP00000299164:C480F	C	+	2	0	0	ADAMTS15	129837782	129837782	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.566000	0.86566	0.655000	0.94253	TGC	0.635332		TCGA-LB-A7SX-01A-11D-A33T-08	0.627	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	0	0	1		2	2	2	0	0	0	0	69	0	69	69	1	1.650000	-3.352012	1	0.640000	NM_139055		0	10	10	0	523	512	0	0	1	0		0	0	69	0	0	0.996557	0	0	0	0	1	0	10	523
STAC3	246329	broad.mit.edu	37	12	57642585	57642585	+	Splice_Site	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr12:57642585G>A	ENST00000332782.2	-	4	537	c.336C>T	c.(334-336)ctC>ctT	p.L112L	STAC3_ENST00000554578.1_Splice_Site_p.L73L|STAC3_ENST00000546246.2_Intron	NM_145064.1	NP_659501.1	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	112					intracellular signal transduction (GO:0035556)|neuromuscular synaptic transmission (GO:0007274)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)		identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(2)|skin(1)	18						ACTTGTTGTTGACTTGGGAAA	0.463																																						ENST00000332782.2	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				18						c.(334-336)ctC>ctT		SH3 and cysteine rich domain 3							266.0	238.0	247.0					12																	57642585		2203	4300	6503	SO:0001630	splice_region_variant	246329	0	0					g.chr12:57642585G>A	AK057013	CCDS8936.1, CCDS66405.1, CCDS66406.1	12q13.3	2014-08-12			ENSG00000185482	ENSG00000185482			28423	protein-coding gene	gene with protein product		615521				12477932	Standard	NM_001286257		Approved	MGC2793	uc009zpl.2	Q96MF2	OTTHUMG00000171271	ENST00000332782.2:c.335-1C>T	chr12.hg19:g.57642585G>A		1					STAC3_ENST00000554578.1_Splice_Site_p.L73L|STAC3_ENST00000546246.2_Intron	p.L112L	NM_145064.1	NP_659501.1	0	2	2	1.902695	Q96MF2	STAC3_HUMAN		4	537	-			B4DUK9|Q96HU5	Splice_Site	SNP	ENST00000332782.2	1	0	hg19	c.336C>T	CCDS8936.1	1																																																																																								0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.463	STAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412724.2	1	0	1		2	2	2	0	0	0	0	179	0	179	178	1	1.650000	-20.000000	1	0.640000	NM_145064	Silent	0	443	436	0	456	450	0	0	1	1		0	0	179	0	0	1.000000	9.609328e-01	0	4	0	4	0	443	456
SRGAP1	57522	broad.mit.edu	37	12	64536271	64536271	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr12:64536271G>A	ENST00000355086.3	+	22	3601	c.3077G>A	c.(3076-3078)cGt>cAt	p.R1026H	SRGAP1_ENST00000543397.1_Missense_Mutation_p.R963H|SRGAP1_ENST00000357825.3_Missense_Mutation_p.R1003H	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	1026					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CAGATTCGACGTAGCACGAGC	0.562																																						ENST00000355086.3	1.000000	1.100000e-01	1	1.400000e-01	0.190000	0.365736	0.190000	0.180000																										0				65						c.(3076-3078)cGt>cAt		SLIT-ROBO Rho GTPase activating protein 1							129.0	107.0	114.0					12																	64536271		2203	4300	6503	SO:0001583	missense	57522	5	121412	42				g.chr12:64536271G>A	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.3077G>A	chr12.hg19:g.64536271G>A	ENSP00000347198:p.Arg1026His	1					SRGAP1_ENST00000357825.3_Missense_Mutation_p.R1003H|SRGAP1_ENST00000543397.1_Missense_Mutation_p.R963H	p.R1026H	NM_020762.2	NP_065813.1	0	2	2	1.902695	Q7Z6B7	SRGP1_HUMAN	GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	22	3601	+			Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	1	1	hg19	c.3077G>A	CCDS8967.1	0	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412989	0.83449	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.34667	1.35;1.35;1.35	6.04	6.04	0.98038	6.04	6.04	0.98038	.	0.000000	0.34002	U	0.004357	T	0.50667	0.1629	M	0.62723	1.935	0.80722	D	1	P;D	0.64830	0.757;0.994	B;P	0.51415	0.095;0.669	T	0.37220	-0.9715	9	.	.	.	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1026;963	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	H	1026;1003;963	ENSP00000347198:R1026H;ENSP00000350480:R1003H;ENSP00000437948:R963H	.	R	+	2	0	0	SRGAP1	62822538	62822538	1.000000	0.71417	0.527000	0.27925	0.080000	0.17528	6.584000	0.74057	2.873000	0.98535	0.563000	0.77884	CGT	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.562	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1	1	0	1		2	2	2	0	0	0	0	76	0	76	76	1	1.650000	-6.053502	1	0.640000			0	22	22	0	366	359	0	0	1	0		0	0	76	0	0	0.999999	3.180678e-02	0	1	0	4	0	22	366
WIF1	11197	broad.mit.edu	37	12	65471603	65471603	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr12:65471603C>G	ENST00000286574.4	-	3	694	c.320G>C	c.(319-321)cGc>cCc	p.R107P		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	107	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		ATCCAGGGAGCGCAAGGACAG	0.498			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)	ENST00000286574.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999876	0.990000	1.000000				Dom	yes			Dom	yes		12	12q14.3	12q14.3	11197	T	WNT inhibitory factor 1				E	E	HMGA2		pleomorphic salivary gland adenoma		0				21						c.(319-321)cGc>cCc		WNT inhibitory factor 1							120.0	101.0	108.0					12																	65471603		2203	4300	6503	SO:0001583	missense	11197	0	0					g.chr12:65471603C>G	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.320G>C	chr12.hg19:g.65471603C>G	ENSP00000286574:p.Arg107Pro	1						p.R107P	NM_007191.4	NP_009122.2	0	2	2	1.902695	Q9Y5W5	WIF1_HUMAN	LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	3	694	-			Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	1	1	hg19	c.320G>C	CCDS8971.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383858	0.82792	.	.	ENSG00000156076	ENST00000286574;ENST00000546001	T;T	0.45276	0.9;0.9	5.35	5.35	0.76521	5.35	5.35	0.76521	WIF domain (4);	0.000000	0.85682	D	0.000000	T	0.50769	0.1635	L	0.36672	1.1	0.80722	D	1	D	0.67145	0.996	D	0.63283	0.913	T	0.37407	-0.9707	9	.	.	.	.	14.6498	0.68789	0.0:0.928:0.0:0.072	.	107	Q9Y5W5	WIF1_HUMAN	P	107;45	ENSP00000286574:R107P;ENSP00000442063:R45P	.	R	-	2	0	0	WIF1	63757870	63757870	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.581000	0.46077	2.689000	0.91719	0.650000	0.86243	CGC	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.498	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2	1	0	1		2	2	2	0	0	0	0	28	0	28	28	1	1.650000	-12.366650	1	0.640000			0	56	56	0	74	73	1	0	1	1		0	0	28	0	0	1.000000	9.651849e-01	0	10	0	0	0	56	74
ATP12A	479	broad.mit.edu	37	13	25272886	25272886	+	Missense_Mutation	SNP	A	A	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr13:25272886A>G	ENST00000381946.3	+	12	1770	c.1603A>G	c.(1603-1605)Acc>Gcc	p.T535A	ATP12A_ENST00000218548.6_Missense_Mutation_p.T541A			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	535					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GAAATGCAGCACCATCATGAT	0.602																																					Pancreas(156;1582 1935 18898 22665 26498)	ENST00000381946.3	0.200000	9.000000e-02	1.700000e-01	1.100000e-01	0.140000	0.149355	0.140000	0.150000																										0				74						c.(1603-1605)Acc>Gcc		ATPase, H+/K+ transporting, nongastric, alpha polypeptide							123.0	116.0	119.0					13																	25272886		2203	4300	6503	SO:0001583	missense	479	0	0					g.chr13:25272886A>G	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1603A>G	chr13.hg19:g.25272886A>G	ENSP00000371372:p.Thr535Ala	1					ATP12A_ENST00000218548.6_Missense_Mutation_p.T541A	p.T535A			0	1	1	1.734799	P54707	AT12A_HUMAN		12	1770	+		Lung SC(185;0.0225)|Breast(139;0.077)	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	1	1	hg19	c.1603A>G	CCDS31948.1	0	.	.	.	.	.	.	.	.	.	.	A	16.15	3.040502	0.55003	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	T;T	0.79845	-1.31;-1.31	6.08	6.08	0.98989	6.08	6.08	0.98989	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.87680	0.6238	L	0.60845	1.875	0.58432	D	0.999993	B;D	0.62365	0.415;0.991	B;D	0.76071	0.271;0.987	D	0.88592	0.3144	10	0.87932	D	0	.	14.5959	0.68407	1.0:0.0:0.0:0.0	.	541;535	P54707-2;P54707	.;AT12A_HUMAN	A	541;535	ENSP00000218548:T541A;ENSP00000371372:T535A	ENSP00000218548:T541A	T	+	1	0	0	ATP12A	24170886	24170886	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	5.917000	0.69989	2.333000	0.79357	0.533000	0.62120	ACC	0.539877		TCGA-LB-A7SX-01A-11D-A33T-08	0.602	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	1	0	1		29	2	2	2	0	2	2	77	0	77	77	1	1.650000	-20.000000	1	0.640000	NM_001676		0	31	31	0	490	487	0	0	1			2	0	77	0	0	0.643472	0	0	0	0	0	0	31	490
LRCH1	23143	broad.mit.edu	37	13	47266759	47266759	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr13:47266759G>A	ENST00000389798.3	+	8	1300	c.1103G>A	c.(1102-1104)cGc>cAc	p.R368H	LRCH1_ENST00000389797.3_Missense_Mutation_p.R368H|LRCH1_ENST00000311191.6_Missense_Mutation_p.R368H	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	368										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		TCGTGCCATCGCCTTAGCCCC	0.408																																						ENST00000389798.3	1.000000	5.900000e-01	8.300000e-01	6.600000e-01	0.730000	0.754951	0.730000	0.740000																										0				26						c.(1102-1104)cGc>cAc		leucine-rich repeats and calponin homology (CH) domain containing 1							129.0	106.0	114.0					13																	47266759		2203	4300	6503	SO:0001583	missense	23143	0	0					g.chr13:47266759G>A	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1103G>A	chr13.hg19:g.47266759G>A	ENSP00000374448:p.Arg368His	0					LRCH1_ENST00000311191.6_Missense_Mutation_p.R368H|LRCH1_ENST00000389797.3_Missense_Mutation_p.R368H	p.R368H	NM_015116.2	NP_055931	1	2	3	2.329466	Q9Y2L9	LRCH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	8	1300	+		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	1	1	hg19	c.1103G>A	CCDS31972.1	0	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771346	0.31320	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.51574	0.7;0.75;0.76	5.93	0.948	0.19561	5.93	0.948	0.19561	.	0.393039	0.29225	N	0.012771	T	0.32406	0.0828	L	0.41961	1.31	0.26342	N	0.977352	B;B;B;B	0.21905	0.037;0.002;0.062;0.006	B;B;B;B	0.17979	0.009;0.002;0.02;0.001	T	0.14727	-1.0462	10	0.33940	T	0.23	-16.3864	4.6171	0.12432	0.4322:0.0:0.4239:0.1439	.	368;368;368;368	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	H	368	ENSP00000308493:R368H;ENSP00000374448:R368H;ENSP00000374447:R368H	ENSP00000308493:R368H	R	+	2	0	0	LRCH1	46164760	46164760	0.001000	0.12720	0.894000	0.35097	0.754000	0.42855	-0.287000	0.08388	-0.140000	0.11394	-0.136000	0.14681	CGC	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.408	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	1	0	1		2	2	2	0	0	0	0	46	0	46	46	1	1.650000	-20.000000	1	0.640000	NM_015116		0	77	77	0	257	254	0	0	1	1		0	0	46	0	0	1.000000	9.603416e-01	0	5	0	15	0	77	257
SUGT1	10910	broad.mit.edu	37	13	53227075	53227075	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr13:53227075G>A	ENST00000343788.6	+	1	102	c.20G>A	c.(19-21)gGa>gAa	p.G7E	SUGT1_ENST00000483074.1_3'UTR|SUGT1_ENST00000535397.1_5'UTR|SUGT1_ENST00000310528.8_Missense_Mutation_p.G7E	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	7					innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		gctgcagcagGAACTGCAACA	0.542											OREG0022432	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000343788.6	1.000000	6.100000e-01	8.800000e-01	6.900000e-01	0.770000	0.790366	0.770000	0.770000																										0				8						c.(19-21)gGa>gAa		SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)							79.0	78.0	79.0					13																	53227075		2203	4300	6503	SO:0001583	missense	10910	1	121412	24				g.chr13:53227075G>A	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.20G>A	chr13.hg19:g.53227075G>A	ENSP00000367208:p.Gly7Glu	0		OREG0022432	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	991	SUGT1_ENST00000310528.8_Missense_Mutation_p.G7E|SUGT1_ENST00000483074.1_3'UTR|SUGT1_ENST00000535397.1_5'UTR	p.G7E	NM_001130912.1	NP_001124384.1	1	2	3	2.329466	Q9Y2Z0	SUGT1_HUMAN		1	102	+		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	ENST00000343788.6	1	1	hg19	c.20G>A	CCDS45050.1	0	.	.	.	.	.	.	.	.	.	.	G	8.714	0.912663	0.17907	.	.	ENSG00000165416	ENST00000343788;ENST00000310528	T;T	0.22134	1.97;1.98	4.02	2.14	0.27477	4.02	2.14	0.27477	.	0.421812	0.21072	N	0.080645	T	0.10252	0.0251	N	0.08118	0	0.27126	N	0.962025	P;B	0.37781	0.608;0.447	B;B	0.34824	0.131;0.19	T	0.14476	-1.0471	10	0.87932	D	0	-3.5695	10.3823	0.44119	0.0:0.3812:0.6188:0.0	.	7;7	Q9Y2Z0;Q9Y2Z0-2	SUGT1_HUMAN;.	E	7	ENSP00000367208:G7E;ENSP00000308067:G7E	ENSP00000308067:G7E	G	+	2	0	0	SUGT1	52125076	52125076	0.135000	0.22499	0.864000	0.33941	0.730000	0.41778	-0.029000	0.12329	0.873000	0.35799	0.467000	0.42956	GGA	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.542	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2	1	0	1		2	2	2	0	0	0	0	36	0	36	35	1	1.650000	-20.000000	1	0.640000			0	61	61	0	191	188	1	0	1	1		0	0	36	0	0	1.000000	1	0	46	0	60	0	61	191
PCDH9	5101	broad.mit.edu	37	13	67799612	67799612	+	Missense_Mutation	SNP	A	A	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr13:67799612A>C	ENST00000377865.2	-	1	3095	c.2961T>G	c.(2959-2961)agT>agG	p.S987R	PCDH9_ENST00000328454.5_Missense_Mutation_p.S987R|PCDH9_ENST00000377861.3_Missense_Mutation_p.S987R|PCDH9_ENST00000456367.1_Missense_Mutation_p.S987R|PCDH9_ENST00000544246.1_Missense_Mutation_p.S987R			Q9HC56	PCDH9_HUMAN	protocadherin 9	987					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AGTGATCTGAACTAGTGGAAG	0.493																																						ENST00000377865.2	1.000000	8.200000e-01	1	8.900000e-01	0.960000	0.955251	0.960000	1.000000																										0				103						c.(2959-2961)agT>agG		protocadherin 9							122.0	115.0	117.0					13																	67799612		2203	4300	6503	SO:0001583	missense	5101	0	0					g.chr13:67799612A>C	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2961T>G	chr13.hg19:g.67799612A>C	ENSP00000367096:p.Ser987Arg	0					PCDH9_ENST00000456367.1_Missense_Mutation_p.S987R|PCDH9_ENST00000544246.1_Missense_Mutation_p.S987R|PCDH9_ENST00000328454.5_Missense_Mutation_p.S987R|PCDH9_ENST00000377861.3_Missense_Mutation_p.S987R	p.S987R			1	2	3	2.329466	Q9HC56	PCDH9_HUMAN		1	3095	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	1	1	hg19	c.2961T>G	CCDS9444.1	1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.258886	0.39896	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28	5.63	5.63	0.86233	5.63	5.63	0.86233	Protocadherin (1);	0.000000	0.85682	D	0.000000	T	0.57417	0.2052	L	0.61218	1.895	0.58432	D	0.999993	D;D;D;D	0.71674	0.998;0.996;0.998;0.998	D;D;D;D	0.74023	0.982;0.955;0.969;0.982	T	0.57797	-0.7749	10	0.49607	T	0.09	.	15.8249	0.78690	1.0:0.0:0.0:0.0	.	987;987;987;987	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	R	987	ENSP00000442186:S987R;ENSP00000367096:S987R;ENSP00000401699:S987R;ENSP00000332060:S987R;ENSP00000367092:S987R	ENSP00000332060:S987R	S	-	3	2	2	PCDH9	66697613	66697613	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.163000	0.50763	2.142000	0.66516	0.533000	0.62120	AGT	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.493	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	1	0	1		2	2	2	0	0	0	0	58	0	58	58	1	1.650000	-20.000000	1	0.640000	NM_203487		0	133	131	0	307	305	1	0	1	0		0	0	58	0	0	1.000000	0	0	0	0	1	0	133	307
KLHL1	57626	broad.mit.edu	37	13	70681816	70681816	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr13:70681816G>A	ENST00000377844.4	-	1	775	c.16C>T	c.(16-18)Cga>Tga	p.R6*	ATXN8OS_ENST00000414504.2_RNA|KLHL1_ENST00000545028.1_5'Flank|ATXN8OS_ENST00000424524.1_RNA	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	6					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		AAGTCTTTTCGCCCAGAGCCT	0.647																																						ENST00000377844.4	1.000000	8.100000e-01	1	9.100000e-01	0.990000	0.969645	0.990000	1.000000																										0				84						c.(16-18)Cga>Tga		kelch-like family member 1							18.0	21.0	20.0					13																	70681816		2201	4295	6496	SO:0001587	stop_gained	57626	0	0					g.chr13:70681816G>A	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.16C>T	chr13.hg19:g.70681816G>A	ENSP00000367075:p.Arg6*	0					KLHL1_ENST00000545028.1_5'Flank|ATXN8OS_ENST00000424524.1_RNA|ATXN8OS_ENST00000414504.2_RNA	p.R6*	NM_020866.2	NP_065917.1	1	2	3	2.329466	Q9NR64	KLHL1_HUMAN		1	775	-		Breast(118;0.000162)	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Nonsense_Mutation	SNP	ENST00000377844.4	0	1	hg19	c.16C>T	CCDS9445.1	1	.	.	.	.	.	.	.	.	.	.	G	44	11.251559	0.99537	.	.	ENSG00000150361	ENST00000377844	.	.	.	5.18	-3.56	0.04626	5.18	-3.56	0.04626	.	0.000000	0.36703	N	0.002455	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8523	0.52417	0.0:0.0873:0.1916:0.7211	.	.	.	.	X	6	.	ENSP00000367075:R6X	R	-	1	2	2	KLHL1	69579817	69579817	0.596000	0.26866	0.966000	0.40874	0.997000	0.91878	0.042000	0.13949	-0.483000	0.06772	0.655000	0.94253	CGA	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.647	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	1	0	1		2	2	2	0	0	0	0	26	0	26	26	1	1.650000	-20.000000	1	0.640000	NM_020866		0	57	57	0	121	120	0	0	1			0	0	26	0	0	1.000000	0	0	0	0	0	0	57	121
DACH1	1602	broad.mit.edu	37	13	72049296	72049296	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr13:72049296G>A	ENST00000359684.2	-	11	2221	c.2222C>T	c.(2221-2223)aCa>aTa	p.T741I	DACH1_ENST00000354591.4_Missense_Mutation_p.T487I|DACH1_ENST00000305425.4_Missense_Mutation_p.T689I|DACH1_ENST00000313174.7_Missense_Mutation_p.T541I			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	741					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TTCAGCATCTGTTCTGCCGCC	0.423																																						ENST00000359684.2	1.000000	6.400000e-01	9.000000e-01	7.200000e-01	0.790000	0.810863	0.790000	0.790000																										0				41						c.(2221-2223)aCa>aTa		dachshund family transcription factor 1							86.0	86.0	86.0					13																	72049296		1872	4111	5983	SO:0001583	missense	1602	0	0					g.chr13:72049296G>A	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2222C>T	chr13.hg19:g.72049296G>A	ENSP00000352712:p.Thr741Ile	0					DACH1_ENST00000305425.4_Missense_Mutation_p.T689I|DACH1_ENST00000354591.4_Missense_Mutation_p.T487I|DACH1_ENST00000313174.7_Missense_Mutation_p.T541I	p.T741I			1	2	3	2.329466	Q9UI36	DACH1_HUMAN		11	2221	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	1	1	hg19	c.2222C>T		0	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172072	0.78452	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.34072	1.41;1.42;1.42;1.38	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.051334	0.85682	D	0.000000	T	0.57975	0.2090	M	0.62723	1.935	0.42123	D	0.991431	D;D;D	0.69078	0.977;0.997;0.978	P;D;P	0.66602	0.787;0.945;0.815	T	0.53968	-0.8363	10	0.40728	T	0.16	-6.4987	19.6611	0.95871	0.0:0.0:1.0:0.0	.	485;539;687	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	I	689;541;487;741;741	ENSP00000304994:T689I;ENSP00000318506:T541I;ENSP00000346604:T487I;ENSP00000352712:T741I	ENSP00000304994:T689I	T	-	2	0	0	DACH1	70947297	70947297	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.229000	0.95273	2.643000	0.89663	0.655000	0.94253	ACA	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.423	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	1	0	1		2	2	2	0	0	0	0	41	0	41	40	1	1.650000	-20.000000	1	0.640000	NM_004392		0	80	80	0	241	241	1	0	1	0		0	0	41	0	0	1.000000	6.346749e-02	0	0	0	2	0	80	241
OR4Q3	441669	broad.mit.edu	37	14	20215850	20215850	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr14:20215850G>A	ENST00000331723.1	+	1	264	c.264G>A	c.(262-264)caG>caA	p.Q88Q		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATTTCCTACAGCAGGGCAAGA	0.453																																						ENST00000331723.1	1.000000	6.100000e-01	7.800000e-01	6.600000e-01	0.710000	0.731727	0.710000	0.720000																										0				47						c.(262-264)caG>caA		olfactory receptor, family 4, subfamily Q, member 3							83.0	84.0	84.0					14																	20215850		2203	4300	6503	SO:0001819	synonymous_variant	441669	0	0					g.chr14:20215850G>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.264G>A	chr14.hg19:g.20215850G>A		0						p.Q88Q	NM_172194.1	NP_751944.1	1	2	3	2.329939	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	1	264	+	all_cancers(95;0.00108)		Q6IEX4	Silent	SNP	ENST00000331723.1	1	1	hg19	c.264G>A	CCDS32020.1	0																																																																																								0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.453	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2	1	0	1		2	2	2	0	0	0	0	132	0	132	134	1	1.650000	-20.000000	1	0.640000			0	162	147	0	558	509	1	0	1			0	0	132	0	0	1.000000	0	0	0	0	0	0	162	558
NGDN	25983	broad.mit.edu	37	14	23945486	23945486	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr14:23945486C>T	ENST00000408901.3	+	8	611	c.583C>T	c.(583-585)Cga>Tga	p.R195*	NGDN_ENST00000397154.3_Nonsense_Mutation_p.R195*|NGDN_ENST00000556580.1_5'UTR	NM_001042635.1|NM_015514.1	NP_001036100.1|NP_056329.1	Q8NEJ9	NGDN_HUMAN	neuroguidin, EIF4E binding protein	195					regulation of translation (GO:0006417)	cell projection (GO:0042995)|chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	12	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		GCGTCTAGAACGAGCCAAGAG	0.473																																						ENST00000408901.3	0.230000	8.000000e-02	2.000000e-01	1.100000e-01	0.150000	0.160452	0.150000	0.150000																										0				12						c.(583-585)Cga>Tga		neuroguidin, EIF4E binding protein							72.0	73.0	73.0					14																	23945486		2203	4300	6503	SO:0001587	stop_gained	25983	0	0					g.chr14:23945486C>T	AK022215	CCDS32051.1, CCDS41926.1	14q11.2	2014-06-13	2006-08-02	2006-08-02	ENSG00000129460	ENSG00000129460			20271	protein-coding gene	gene with protein product		610777	"""chromosome 14 open reading frame 120"""	C14orf120		16705177	Standard	NM_001042635		Approved	DKFZP564O092, LCP5, lpd-2, NGD	uc001wjy.3	Q8NEJ9	OTTHUMG00000171501	ENST00000408901.3:c.583C>T	chr14.hg19:g.23945486C>T	ENSP00000386134:p.Arg195*	1					NGDN_ENST00000397154.3_Nonsense_Mutation_p.R195*|NGDN_ENST00000556580.1_5'UTR	p.R195*	NM_001042635.1|NM_015514.1	NP_001036100.1|NP_056329.1	0	1	1	1.663670	Q8NEJ9	NGDN_HUMAN		8	611	+	all_cancers(95;0.000251)		A8K760|Q9Y400	Nonsense_Mutation	SNP	ENST00000408901.3	0	1	hg19	c.583C>T	CCDS41926.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.410545|5.410545	0.96072|0.96072	.|.	.|.	ENSG00000129460|ENSG00000129460	ENST00000408901;ENST00000397154|ENST00000556483	.|.	.|.	.|.	5.89|5.89	4.98|4.98	0.66077|0.66077	5.89|5.89	4.98|4.98	0.66077|0.66077	.|.	0.211551|.	0.40728|.	N|.	0.001026|.	.|T	.|0.70762	.|0.3261	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70103	.|-0.4964	.|4	0.02654|.	T|.	1|.	-19.2174|-19.2174	14.907|14.907	0.70727|0.70727	0.149:0.851:0.0:0.0|0.149:0.851:0.0:0.0	.|.	.|.	.|.	.|.	X|M	195|142	.|.	ENSP00000380340:R195X|.	R|T	+|+	1|2	2|0	2|0	NGDN|NGDN	23015326|23015326	23015326|23015326	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	3.550000|3.550000	0.53691|0.53691	1.440000|1.440000	0.47531|0.47531	0.563000|0.563000	0.77884|0.77884	CGA|ACG	0.470588		TCGA-LB-A7SX-01A-11D-A33T-08	0.473	NGDN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413782.3	1	0	1		2	2	2	0	0	0	0	36	0	36	36	1	1.650000	-3.222086	1	0.640000	NM_001042635		0	16	16	0	206	205	0	0	1	0		0	0	36	0	0	0.999941	9.977730e-01	0	0	0	132	0	16	206
LRRC16B	90668	broad.mit.edu	37	14	24530760	24530760	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr14:24530760C>T	ENST00000342740.5	+	27	2513	c.2359C>T	c.(2359-2361)Cgg>Tgg	p.R787W	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	787						cytoplasm (GO:0005737)		p.R787W(3)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		TGTGGCCATGCGGGTGGCCGA	0.612																																						ENST00000342740.5	0.150000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.083829	0.070000	0.070000																										3	Substitution - Missense(3)	p.R787W(3)	prostate(2)|lung(1)	52						c.(2359-2361)Cgg>Tgg		leucine rich repeat containing 16B							73.0	63.0	67.0					14																	24530760		2203	4300	6503	SO:0001583	missense	90668	0	0					g.chr14:24530760C>T	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2359C>T	chr14.hg19:g.24530760C>T	ENSP00000340467:p.Arg787Trp	1					LRRC16B_ENST00000334420.7_5'UTR	p.R787W	NM_138360.3	NP_612369.3	0	1	1	1.639950	Q8ND23	LR16B_HUMAN		27	2513	+			Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	0	1	hg19	c.2359C>T	CCDS32054.1	0	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955757	0.53293	.	.	ENSG00000186648	ENST00000342740	T	0.15718	2.4	5.27	3.36	0.38483	5.27	3.36	0.38483	.	0.174329	0.40144	N	0.001165	T	0.21962	0.0529	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	P	0.62014	0.897	T	0.03166	-1.1065	10	0.87932	D	0	-14.9968	10.8426	0.46724	0.3396:0.6604:0.0:0.0	.	787	Q8ND23	LR16B_HUMAN	W	787	ENSP00000340467:R787W	ENSP00000340467:R787W	R	+	1	2	2	LRRC16B	23600600	23600600	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.748000	0.26305	1.430000	0.47334	-0.182000	0.12963	CGG	0.475524		TCGA-LB-A7SX-01A-11D-A33T-08	0.612	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	0	0	1		16	2	2	1	0	1	1	35	0	35	35	1	1.650000	-2.835470	1	0.640000	NM_138360		0	6	6	0	170	170	0	0	0			1	0	35	0	0	0.021931	0	0	0	0	0	0	6	170
NID2	22795	broad.mit.edu	37	14	52507535	52507535	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr14:52507535G>A	ENST00000216286.5	-	8	1859	c.1860C>T	c.(1858-1860)ttC>ttT	p.F620F	NID2_ENST00000541773.1_Silent_p.F567F	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	620	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CTCCCGGGTAGAATGTAACTT	0.463																																						ENST00000216286.5	0.860000	6.500000e-01	8.100000e-01	7.000000e-01	0.750000	0.760070	0.750000	0.760000																										0				87						c.(1858-1860)ttC>ttT		nidogen 2 (osteonidogen)							164.0	141.0	149.0					14																	52507535		2203	4300	6503	SO:0001819	synonymous_variant	22795	0	0					g.chr14:52507535G>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1860C>T	chr14.hg19:g.52507535G>A		1					NID2_ENST00000541773.1_Silent_p.F567F	p.F620F	NM_007361.3	NP_031387.3	0	1	1	1.685420	Q14112	NID2_HUMAN		8	1859	-	Breast(41;0.0639)|all_epithelial(31;0.123)		A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	1	1	hg19	c.1860C>T	CCDS9706.1	0																																																																																								0.489796		TCGA-LB-A7SX-01A-11D-A33T-08	0.463	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1	1	0	1		2	2	2	0	0	0	0	71	0	71	71	1	1.650000	-20.000000	1	0.640000			0	140	139	0	266	260	1	0	1	0		0	0	71	0	0	1.000000	5.621700e-01	0	0	0	5	0	140	266
ZFYVE26	23503	broad.mit.edu	37	14	68275942	68275942	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr14:68275942C>G	ENST00000347230.4	-	4	476	c.338G>C	c.(337-339)gGt>gCt	p.G113A	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.G113A	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	113					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TGGAATGTCACCTTGGAGGTC	0.458																																						ENST00000347230.4	0.110000	3.000000e-02	9.000000e-02	4.000000e-02	0.060000	0.073141	0.060000	0.070000																										0				94						c.(337-339)gGt>gCt		zinc finger, FYVE domain containing 26							120.0	116.0	117.0					14																	68275942		2203	4300	6503	SO:0001583	missense	23503	0	0					g.chr14:68275942C>G	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.338G>C	chr14.hg19:g.68275942C>G	ENSP00000251119:p.Gly113Ala	1					ZFYVE26_ENST00000555452.1_Missense_Mutation_p.G113A	p.G113A	NM_015346.3	NP_056161.2	0	1	1	1.685420	Q68DK2	ZFY26_HUMAN		4	476	-			B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	1	1	hg19	c.338G>C	CCDS9788.1	0	.	.	.	.	.	.	.	.	.	.	C	9.232	1.036094	0.19590	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.26373	1.89;1.74	6.06	1.78	0.24846	6.06	1.78	0.24846	.	0.933364	0.09213	N	0.832992	T	0.17831	0.0428	L	0.44542	1.39	0.09310	N	1	B;B;B	0.27068	0.065;0.167;0.022	B;B;B	0.24269	0.036;0.052;0.006	T	0.34279	-0.9835	10	0.09084	T	0.74	-5.0E-4	6.2815	0.21009	0.0:0.5186:0.0:0.4814	.	113;113;113	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	A	113	ENSP00000251119:G113A;ENSP00000450603:G113A	ENSP00000251119:G113A	G	-	2	0	0	ZFYVE26	67345695	67345695	0.064000	0.20934	0.854000	0.33618	0.991000	0.79684	1.535000	0.36061	0.457000	0.26962	0.655000	0.94253	GGT	0.489796		TCGA-LB-A7SX-01A-11D-A33T-08	0.458	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	0	0	1		2	2	2	0	0	0	0	70	0	70	70	1	1.650000	-3.493247	1	0.640000	NM_015346		0	13	13	0	406	404	0	0	1	0		0	0	70	0	0	0.999535	1.182020e-03	0	0	0	2	0	13	406
TRAF3	7187	broad.mit.edu	37	14	103372120	103372120	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr14:103372120G>A	ENST00000560371.1	+	11	1923	c.1706G>A	c.(1705-1707)tGa>tAa	p.*569*	TRAF3_ENST00000347662.4_Silent_p.*544*|TRAF3_ENST00000351691.5_Silent_p.*544*|TRAF3_ENST00000392745.2_Silent_p.*569*|TRAF3_ENST00000539721.1_Silent_p.*486*	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	0					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		CCCGATCCCTGATAAGTAGCT	0.453																																						ENST00000560371.1	0.860000	5.200000e-01	7.800000e-01	6.000000e-01	0.680000	0.696625	0.680000	0.690000																										0				30						c.(1705-1707)tGa>tAa		TNF receptor-associated factor 3							21.0	25.0	24.0					14																	103372120		2146	4273	6419	SO:0001819	synonymous_variant	7187	0	0					g.chr14:103372120G>A	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1706G>A	chr14.hg19:g.103372120G>A		1					TRAF3_ENST00000347662.4_Silent_p.*544*|TRAF3_ENST00000539721.1_Silent_p.*486*|TRAF3_ENST00000351691.5_Silent_p.*544*|TRAF3_ENST00000392745.2_Silent_p.*569*	p.*569*	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	0	1	1	1.688785	Q13114	TRAF3_HUMAN		11	1923	+		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Silent	SNP	ENST00000560371.1	0	1	hg19	c.1706G>A	CCDS9975.1	0																																																																																								0.498886		TCGA-LB-A7SX-01A-11D-A33T-08	0.453	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1	1	0	1		2	2	2	0	0	0	0	32	0	32	32	1	1.650000	-20.000000	1	0.640000	NM_145725		0	44	43	0	98	96	1	0	1	1		0	0	32	0	0	1.000000	8.605275e-01	0	4	0	6	0	44	98
SECISBP2L	9728	broad.mit.edu	37	15	49304939	49304939	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr15:49304939G>A	ENST00000559471.1	-	12	1900	c.1637C>T	c.(1636-1638)aCa>aTa	p.T546I	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.T501I	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	546							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						ATTAAAGGATGTCAAACAGGG	0.348																																						ENST00000559471.1	0.150000	5.000000e-02	1.200000e-01	7.000000e-02	0.090000	0.100609	0.090000	0.100000																										0				46						c.(1636-1638)aCa>aTa		SECIS binding protein 2-like							122.0	128.0	126.0					15																	49304939		2197	4295	6492	SO:0001583	missense	9728	1	121410	35				g.chr15:49304939G>A	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1637C>T	chr15.hg19:g.49304939G>A	ENSP00000453854:p.Thr546Ile	1					SECISBP2L_ENST00000261847.3_Missense_Mutation_p.T501I	p.T546I	NM_001193489.1	NP_001180418.1	0	1	1	1.982783	Q93073	SBP2L_HUMAN		12	1900	-			Q8N767	Missense_Mutation	SNP	ENST00000559471.1	1	1	hg19	c.1637C>T	CCDS53942.1	0	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384582	0.42308	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.72394	-0.65	5.76	4.84	0.62591	5.76	4.84	0.62591	.	0.433340	0.26248	N	0.025473	T	0.60405	0.2266	L	0.39147	1.195	0.30747	N	0.745561	B;B	0.20988	0.012;0.05	B;B	0.18561	0.006;0.022	T	0.62115	-0.6922	10	0.54805	T	0.06	.	9.5017	0.39022	0.0802:0.2533:0.6665:0.0	.	546;501	Q93073;Q93073-2	SBP2L_HUMAN;.	I	501;546	ENSP00000261847:T501I	ENSP00000261847:T501I	T	-	2	0	0	SECISBP2L	47092231	47092231	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.936000	0.48971	1.433000	0.47394	0.650000	0.86243	ACA	0.582560		TCGA-LB-A7SX-01A-11D-A33T-08	0.348	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	0	0	1		2	2	2	0	0	0	0	86	0	86	86	1	1.650000	-3.873308	1	0.640000	NM_014701		0	19	19	0	514	507	0	0	1	0		0	0	86	0	0	0.999990	7.373527e-02	0	1	0	11	0	19	514
MEGF11	84465	broad.mit.edu	37	15	66210374	66210374	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr15:66210374G>A	ENST00000409699.2	-	16	2188	c.2016C>T	c.(2014-2016)aaC>aaT	p.N672N	MEGF11_ENST00000360698.4_Silent_p.N672N|MEGF11_ENST00000288745.3_Silent_p.N597N|MEGF11_ENST00000395625.2_Silent_p.N597N|MEGF11_ENST00000422354.1_Silent_p.N672N|MEGF11_ENST00000395614.1_De_novo_Start_OutOfFrame			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	672	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						TGCAGGTCCCGTTGTTGGCAC	0.612																																						ENST00000409699.2	0.650000	3.900000e-01	5.900000e-01	4.500000e-01	0.510000	0.522531	0.510000	0.520000																										0				19						c.(2014-2016)aaC>aaT		multiple EGF-like-domains 11							94.0	69.0	77.0					15																	66210374		2201	4299	6500	SO:0001819	synonymous_variant	84465	2	121408	31				g.chr15:66210374G>A	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.2016C>T	chr15.hg19:g.66210374G>A		1					MEGF11_ENST00000395614.1_De_novo_Start_OutOfFrame|MEGF11_ENST00000395625.2_Silent_p.N597N|MEGF11_ENST00000360698.4_Silent_p.N672N|MEGF11_ENST00000288745.3_Silent_p.N597N|MEGF11_ENST00000422354.1_Silent_p.N672N	p.N672N			0	1	1	1.982783	A6BM72	MEG11_HUMAN		16	2188	-			Q17R86|Q6UXS5|Q8ND91|Q96KG6	Silent	SNP	ENST00000409699.2	1	0	hg19	c.2016C>T	CCDS10213.2	0																																																																																								0.582560		TCGA-LB-A7SX-01A-11D-A33T-08	0.612	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	1	0	1		2	2	2	0	0	0	0	32	0	32	32	1	1.650000	-20.000000	1	0.640000	NM_032445		0	48	48	0	202	202	1	0	1	0		0	0	32	0	0	1.000000	0	0	0	0	1	0	48	202
LOXL1	4016	broad.mit.edu	37	15	74239478	74239478	+	Missense_Mutation	SNP	G	G	A	rs141057976		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr15:74239478G>A	ENST00000261921.7	+	4	1746	c.1420G>A	c.(1420-1422)Gag>Aag	p.E474K		NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	474	Lysyl-oxidase like.				extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						GAAGGTGGCCGAGGGCCACAA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		22874	0.0		0.001	False		,,,				2504	0.0					ENST00000261921.7	0.640000	3.900000e-01	5.800000e-01	4.500000e-01	0.510000	0.522280	0.510000	0.510000																										0				10						c.(1420-1422)Gag>Aag		lysyl oxidase-like 1		G	LYS/GLU	0,4396		0,0,2198	73.0	65.0	68.0		1420	4.8	1.0	15	dbSNP_134	68	1,8593	1.2+/-3.3	0,1,4296	no	missense	LOXL1	NM_005576.2	56	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	474/575	74239478	1,12989	2198	4297	6495	SO:0001583	missense	4016	19	121412	43				g.chr15:74239478G>A	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.1420G>A	chr15.hg19:g.74239478G>A	ENSP00000261921:p.Glu474Lys	0						p.E474K	NM_005576.2	NP_005567.2	0	1	1	1.966388	Q08397	LOXL1_HUMAN		4	1746	+			Q6NUL3|Q96BW7	Missense_Mutation	SNP	ENST00000261921.7	1	1	hg19	c.1420G>A	CCDS10253.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.372594	0.95923	0.0	1.16E-4	ENSG00000129038	ENST00000261921;ENST00000395162	T	0.40225	1.04	4.81	4.81	0.61882	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79940	-0.1591	10	0.87932	D	0	.	16.4684	0.84092	0.0:0.0:1.0:0.0	.	474	Q08397	LOXL1_HUMAN	K	474;336	ENSP00000261921:E474K	ENSP00000261921:E474K	E	+	1	0	0	LOXL1	72026531	72026531	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	9.569000	0.98170	2.222000	0.72286	0.462000	0.41574	GAG	0.585635		TCGA-LB-A7SX-01A-11D-A33T-08	0.577	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268995.2	1	0	1		2	2	2	0	0	0	0	39	0	39	38	1	1.650000	-20.000000	1	0.640000	NM_005576		0	53	53	0	225	224	1	0	1	1		0	0	39	0	0	1.000000	9.999346e-01	0	3	0	61	0	53	225
ADAMTSL3	57188	broad.mit.edu	37	15	84652038	84652038	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr15:84652038C>T	ENST00000286744.5	+	21	3882	c.3658C>T	c.(3658-3660)Ccc>Tcc	p.P1220S	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.P1220S	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1220	Ig-like C2-type 2.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCTTATTACCCCCAGTGAGGC	0.348																																						ENST00000286744.5	0.110000	3.000000e-02	9.000000e-02	5.000000e-02	0.060000	0.073850	0.060000	0.070000																										0				130						c.(3658-3660)Ccc>Tcc		ADAMTS-like 3							119.0	127.0	125.0					15																	84652038		2203	4300	6503	SO:0001583	missense	57188	0	0					g.chr15:84652038C>T	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3658C>T	chr15.hg19:g.84652038C>T	ENSP00000286744:p.Pro1220Ser	1					ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.P1220S	p.P1220S	NM_207517.2	NP_997400.2	0	1	1	1.960586	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)	21	3882	+			A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	1	1	hg19	c.3658C>T	CCDS10326.1	0	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.748472	0.00669	.	.	ENSG00000156218	ENST00000286744	T	0.11821	2.74	5.13	2.9	0.33743	5.13	2.9	0.33743	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.674572	0.12270	N	0.483872	T	0.05960	0.0155	N	0.11651	0.15	0.09310	N	1	B;B	0.17268	0.004;0.021	B;B	0.16289	0.007;0.015	T	0.39078	-0.9631	10	0.06236	T	0.91	.	7.8817	0.29627	0.244:0.4028:0.3532:0.0	.	1220;1220	P82987-2;P82987	.;ATL3_HUMAN	S	1220	ENSP00000286744:P1220S	ENSP00000286744:P1220S	P	+	1	0	0	ADAMTSL3	82443042	82443042	0.003000	0.15002	0.046000	0.18839	0.277000	0.26821	1.060000	0.30530	1.245000	0.43885	0.557000	0.71058	CCC	0.582560		TCGA-LB-A7SX-01A-11D-A33T-08	0.348	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	0	0	1		23	2	2	1	0	1	1	109	0	109	109	1	1.650000	-2.023224	0	0.640000	NM_207517		0	21	21	0	779	778	0	0	0	0		1	0	109	0	0	0.436028	0	0	0	0	1	0	21	779
XYLT1	64131	broad.mit.edu	37	16	17353277	17353277	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:17353277C>G	ENST00000261381.6	-	3	565	c.481G>C	c.(481-483)Gag>Cag	p.E161Q		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	161					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCGACATTCTCAAAGTCTTTG	0.502																																						ENST00000261381.6	1.000000	6.500000e-01	8.300000e-01	7.000000e-01	0.760000	0.774273	0.760000	0.760000																										0				67						c.(481-483)Gag>Cag		xylosyltransferase I							138.0	126.0	130.0					16																	17353277		2197	4300	6497	SO:0001583	missense	64131	0	0					g.chr16:17353277C>G	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.481G>C	chr16.hg19:g.17353277C>G	ENSP00000261381:p.Glu161Gln	0						p.E161Q	NM_022166.3	NP_071449.1	1	2	3	2.316346	Q86Y38	XYLT1_HUMAN		3	565	-			Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	1	1	hg19	c.481G>C	CCDS10569.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.171543	0.94807	.	.	ENSG00000103489	ENST00000261381	T	0.07688	3.17	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	L	0.59436	1.845	0.80722	D	1	D	0.62365	0.991	P	0.60236	0.871	T	0.00045	-1.2218	10	0.66056	D	0.02	-38.7384	18.8353	0.92159	0.0:1.0:0.0:0.0	.	161	Q86Y38	XYLT1_HUMAN	Q	161	ENSP00000261381:E161Q	ENSP00000261381:E161Q	E	-	1	0	0	XYLT1	17260778	17260778	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	7.328000	0.79160	2.688000	0.91661	0.655000	0.94253	GAG	0.645669		TCGA-LB-A7SX-01A-11D-A33T-08	0.502	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	1	0	1		2	2	2	0	0	0	0	70	0	70	69	1	1.650000	-5.363877	1	0.640000	NM_022166		0	151	150	0	477	475	1	0	1	1		0	0	70	0	0	1.000000	8.213282e-01	0	6	0	6	0	151	477
ITPRIPL2	162073	broad.mit.edu	37	16	19126379	19126379	+	Missense_Mutation	SNP	T	T	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:19126379T>A	ENST00000381440.3	+	1	1126	c.596T>A	c.(595-597)cTg>cAg	p.L199Q	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	199						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GAGCCAGCGCTGGCCCCGGCC	0.701											OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000381440.3	1.000000	5.000000e-02	1.800000e-01	8.000000e-02	0.120000	0.163901	0.120000	0.120000																										0				9						c.(595-597)cTg>cAg		inositol 1,4,5-trisphosphate receptor interacting protein-like 2							11.0	15.0	13.0					16																	19126379		2146	4212	6358	SO:0001583	missense	162073	0	0					g.chr16:19126379T>A		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.596T>A	chr16.hg19:g.19126379T>A	ENSP00000370849:p.Leu199Gln	0		OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	730	CTD-2349B8.1_ENST00000564808.2_Intron	p.L199Q	NM_001034841.3	NP_001030013.1	1	2	3	2.316346	Q3MIP1	IPIL2_HUMAN		1	1126	+				Missense_Mutation	SNP	ENST00000381440.3	0	1	hg19	c.596T>A	CCDS32395.1	0	.	.	.	.	.	.	.	.	.	.	T	8.250	0.808707	0.16467	.	.	ENSG00000205730	ENST00000381440	T	0.19250	2.16	4.91	3.81	0.43845	4.91	3.81	0.43845	.	1.686950	0.05100	U	0.486938	T	0.25158	0.0611	N	0.19112	0.55	0.29438	N	0.859323	D	0.71674	0.998	P	0.61800	0.894	T	0.15292	-1.0442	10	0.11182	T	0.66	-8.1361	6.7379	0.23419	0.0:0.0837:0.1545:0.7618	.	199	Q3MIP1	IPIL2_HUMAN	Q	199	ENSP00000370849:L199Q	ENSP00000370849:L199Q	L	+	2	0	0	ITPRIPL2	19033880	19033880	0.524000	0.26282	0.167000	0.22817	0.046000	0.14306	1.512000	0.35812	1.829000	0.53265	0.533000	0.62120	CTG	0.645669		TCGA-LB-A7SX-01A-11D-A33T-08	0.701	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435827.3	0	0	1		2	2	2	0	0	0	0	27	0	27	27	1	1.650000	-14.936160	1	0.640000	NM_001034841		0	9	9	0	231	227	0	0	1	0		0	0	27	0	0	0.994029	1.581884e-01	0	0	0	16	0	9	231
RAB11FIP3	9727	broad.mit.edu	37	16	476687	476687	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:476687C>T	ENST00000262305.4	+	1	1069	c.681C>T	c.(679-681)ttC>ttT	p.F227F	RAB11FIP3_ENST00000457159.1_Silent_p.F227F	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	227	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				TCGAGGACTTCATCCAGTTTG	0.706																																					Melanoma(160;2366 2595 4474 8099)	ENST00000262305.4	1.000000	2.000000e-02	1.300000e-01	4.000000e-02	0.080000	0.122601	0.080000	0.080000																										0				12						c.(679-681)ttC>ttT		RAB11 family interacting protein 3 (class II)							28.0	37.0	34.0					16																	476687		2198	4298	6496	SO:0001819	synonymous_variant	9727	0	0					g.chr16:476687C>T	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.681C>T	chr16.hg19:g.476687C>T		0					RAB11FIP3_ENST00000457159.1_Silent_p.F227F	p.F227F	NM_014700.3	NP_055515.1	1	2	3	2.325029	O75154	RFIP3_HUMAN		1	1069	+		Hepatocellular(16;0.0218)	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Silent	SNP	ENST00000262305.4	0	1	hg19	c.681C>T	CCDS32351.1	0																																																																																								0.645669		TCGA-LB-A7SX-01A-11D-A33T-08	0.706	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4	0	0	0		2	2	2	0	0	0	0	26	0	26	26	1	1.650000	-6.411320	1	0.640000	NM_014700		0	5	5	0	209	207	0	0	1	0		0	0	26	0	0	0.936730	2.062573e-01	0	0	0	30	0	5	209
PIGQ	9091	broad.mit.edu	37	16	633027	633027	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:633027C>A	ENST00000026218.5	+	10	1764	c.1676C>A	c.(1675-1677)gCa>gAa	p.A559E	PIGQ_ENST00000409527.2_Missense_Mutation_p.Q580K|PIGQ_ENST00000321878.5_Missense_Mutation_p.Q580K	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	559					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				AGGGGACAAGCAGGACTGAGG	0.667																																						ENST00000026218.5	1.000000	9.000000e-02	1.900000e-01	1.100000e-01	0.140000	0.185290	0.140000	0.150000																										0				13						c.(1675-1677)gCa>gAa		phosphatidylinositol glycan anchor biosynthesis, class Q							55.0	57.0	56.0					16																	633027		2201	4300	6501	SO:0001583	missense	9091	0	0					g.chr16:633027C>A	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1676C>A	chr16.hg19:g.633027C>A	ENSP00000026218:p.Ala559Glu	0					PIGQ_ENST00000321878.5_Missense_Mutation_p.Q580K|PIGQ_ENST00000409527.2_Missense_Mutation_p.Q580K	p.A559E	NM_148920.2	NP_683721.1	1	2	3	2.325029	Q9BRB3	PIGQ_HUMAN		10	1764	+		Hepatocellular(780;0.00335)	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	1	1	hg19	c.1676C>A	CCDS10411.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.93|12.93	2.085822|2.085822	0.36758|0.36758	.|.	.|.	ENSG00000007541|ENSG00000007541	ENST00000026218|ENST00000409527;ENST00000321878;ENST00000540241	T|T;T	0.22945|0.44482	1.93|0.92;0.92	5.54|5.54	5.54|5.54	0.83059|0.83059	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	1.882170|.	0.02546|.	N|.	0.095120|.	T|T	0.28995|0.28995	0.0720|0.0720	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D;P|B	0.89917|0.23249	1.0;0.506|0.082	D;B|B	0.76575|0.24269	0.988;0.044|0.052	T|T	0.12656|0.12656	-1.0539|-1.0539	10|9	0.72032|0.62326	D|D	0.01|0.03	-6.9865|-6.9865	18.0399|18.0399	0.89316|0.89316	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	129;559|580	B3KRR7;Q9BRB3|Q9BRB3-2	.;PIGQ_HUMAN|.	E|K	559|580;580;138	ENSP00000026218:A559E|ENSP00000386760:Q580K;ENSP00000326674:Q580K	ENSP00000026218:A559E|ENSP00000326674:Q580K	A|Q	+|+	2|1	0|0	0|0	PIGQ|PIGQ	573028|573028	573028|573028	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.878000|0.878000	0.50629|0.50629	1.786000|1.786000	0.38694|0.38694	2.618000|2.618000	0.88619|0.88619	0.462000|0.462000	0.41574|0.41574	GCA|CAG	0.645669		TCGA-LB-A7SX-01A-11D-A33T-08	0.667	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	1	0	1		2	2	2	0	0	0	0	87	0	87	85	1	1.650000	-20.000000	1	0.640000	NM_004204		0	27	28	0	551	543	0	0	1	1		0	0	87	0	0	1.000000	9.848813e-01	0	5	0	132	0	27	551
FAM86A	196483	broad.mit.edu	37	16	5141882	5141882	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:5141882G>A	ENST00000427587.4	-	4	323	c.255C>T	c.(253-255)caC>caT	p.H85H	FAM86A_ENST00000587133.1_Intron|FAM86A_ENST00000458008.4_Intron	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	85						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						AAGGCTCTGTGTGGACAGCCT	0.547																																						ENST00000427587.4	1.000000	7.000000e-01	9.400000e-01	7.700000e-01	0.840000	0.856910	0.840000	0.850000																										0				12						c.(253-255)caC>caT		family with sequence similarity 86, member A							36.0	34.0	35.0					16																	5141882		2197	4300	6497	SO:0001819	synonymous_variant	196483	0	0					g.chr16:5141882G>A	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.255C>T	chr16.hg19:g.5141882G>A		0					FAM86A_ENST00000458008.4_Intron|FAM86A_ENST00000587133.1_Intron	p.H85H	NM_201400.2	NP_958802.1	1	2	3	2.325029	Q96G04	FA86A_HUMAN		4	323	-			D3DUF0|Q96S85	Silent	SNP	ENST00000427587.4	1	1	hg19	c.255C>T	CCDS10529.1	0																																																																																								0.645669		TCGA-LB-A7SX-01A-11D-A33T-08	0.547	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	1	0	1		2	2	2	0	0	0	0	50	0	50	53	1	1.650000	-20.000000	1	0.640000	NM_201400		0	88	86	0	241	231	1	0	1	1		0	0	50	0	0	1.000000	9.996957e-01	0	10	0	26	0	88	241
SH2B1	25970	broad.mit.edu	37	16	28877903	28877903	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:28877903G>A	ENST00000322610.8	+	4	927	c.488G>A	c.(487-489)cGa>cAa	p.R163Q	SH2B1_ENST00000395532.4_Missense_Mutation_p.R163Q|SH2B1_ENST00000545570.1_Intron|SH2B1_ENST00000337120.5_Missense_Mutation_p.R163Q|SH2B1_ENST00000359285.5_Missense_Mutation_p.R163Q|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000538342.1_Intron			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	163	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|Interaction with RAC1. {ECO:0000250}.|Required for NGF signaling. {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CGCTCTGTCCGAGGCTCAGTC	0.652																																						ENST00000322610.8	1.000000	6.700000e-01	8.400000e-01	7.200000e-01	0.770000	0.784783	0.770000	0.780000																										0				25						c.(487-489)cGa>cAa		SH2B adaptor protein 1							87.0	82.0	84.0					16																	28877903		2197	4300	6497	SO:0001583	missense	25970	0	0					g.chr16:28877903G>A	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.488G>A	chr16.hg19:g.28877903G>A	ENSP00000321221:p.Arg163Gln	0					SH2B1_ENST00000359285.5_Missense_Mutation_p.R163Q|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000395532.4_Missense_Mutation_p.R163Q|SH2B1_ENST00000337120.5_Missense_Mutation_p.R163Q|SH2B1_ENST00000545570.1_Intron|SH2B1_ENST00000538342.1_Intron	p.R163Q			1	2	3	2.310551	Q9NRF2	SH2B1_HUMAN		4	927	+			A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	1	1	hg19	c.488G>A	CCDS53996.1	0	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663858	0.67700	.	.	ENSG00000178188	ENST00000322610;ENST00000359285;ENST00000395532;ENST00000337120	T;T;T;T	0.51325	0.71;0.72;0.73;0.73	3.95	3.95	0.45737	3.95	3.95	0.45737	.	0.218237	0.26692	N	0.022987	T	0.40979	0.1139	N	0.14661	0.345	0.41978	D	0.990788	D;D;D	0.63880	0.991;0.974;0.993	P;P;P	0.51079	0.658;0.565;0.546	T	0.44711	-0.9310	10	0.46703	T	0.11	-31.1346	14.9215	0.70841	0.0:0.0:1.0:0.0	.	163;163;163	Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;SH2B1_HUMAN	Q	163	ENSP00000321221:R163Q;ENSP00000352232:R163Q;ENSP00000378903:R163Q;ENSP00000337163:R163Q	ENSP00000321221:R163Q	R	+	2	0	0	SH2B1	28785404	28785404	0.996000	0.38824	0.972000	0.41901	0.952000	0.60782	2.673000	0.46858	2.055000	0.61198	0.455000	0.32223	CGA	0.644550		TCGA-LB-A7SX-01A-11D-A33T-08	0.652	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	1	0	1		2	2	2	0	0	0	0	69	0	69	60	1	1.650000	-5.761218	1	0.640000	NM_015503		0	174	155	0	535	466	1	0	1	1		0	0	69	0	0	1.000000	1	0	44	0	89	0	174	535
CNTNAP4	85445	broad.mit.edu	37	16	76572111	76572111	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:76572111C>T	ENST00000476707.1	+	18	3242	c.3103C>T	c.(3103-3105)Cat>Tat	p.H1035Y	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.H983Y|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.H1031Y|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.H959Y|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1032					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TGCTTCATTTCATGGTGATAT	0.368																																						ENST00000476707.1	1.000000	6.800000e-01	9.200000e-01	7.500000e-01	0.830000	0.841318	0.830000	0.840000																										0				64						c.(3103-3105)Cat>Tat		contactin associated protein-like 4							70.0	67.0	68.0					16																	76572111		1824	4094	5918	SO:0001583	missense	85445	0	0					g.chr16:76572111C>T	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3103C>T	chr16.hg19:g.76572111C>T	ENSP00000417628:p.His1035Tyr	0					CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.H959Y|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.H983Y|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.H1031Y	p.H1035Y			1	2	3	2.297942	Q9C0A0	CNTP4_HUMAN		18	3242	+			E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	1	1	hg19	c.3103C>T		0	.	.	.	.	.	.	.	.	.	.	C	7.133	0.580282	0.13686	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.35	5.35	0.76521	5.35	5.35	0.76521	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.42821	D	0.000643	T	0.25195	0.0612	.	.	.	0.37798	D	0.927591	B;B;B	0.14805	0.001;0.001;0.011	B;B;B	0.15052	0.002;0.002;0.012	T	0.12630	-1.0540	9	0.09338	T	0.73	.	12.9629	0.58468	0.0:0.9168:0.0:0.0832	.	959;1035;1032	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	Y	1031;983;959;1035	ENSP00000306893:H1031Y;ENSP00000439733:H983Y;ENSP00000418741:H959Y;ENSP00000417628:H1035Y	ENSP00000306893:H1031Y	H	+	1	0	0	CNTNAP4	75129612	75129612	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.793000	0.47845	2.769000	0.95229	0.655000	0.94253	CAT	0.642289		TCGA-LB-A7SX-01A-11D-A33T-08	0.368	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	1	0	1		2	2	2	0	0	0	0	47	0	47	46	1	1.650000	-20.000000	1	0.640000	NM_033401		0	86	86	0	237	234	0	0	1			0	0	47	0	0	1.000000	0	0	0	0	0	0	86	237
IL17C	27189	broad.mit.edu	37	16	88706381	88706381	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr16:88706381C>T	ENST00000244241.4	+	3	544	c.495C>T	c.(493-495)cgC>cgT	p.R165R		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	165					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		CCTGCTCCCGCGACGGCTCGG	0.701																																						ENST00000244241.4	0.170000	4.000000e-02	1.300000e-01	6.000000e-02	0.090000	0.111369	0.090000	0.100000																										0				2						c.(493-495)cgC>cgT		interleukin 17C							29.0	35.0	33.0					16																	88706381		1999	4138	6137	SO:0001819	synonymous_variant	27189	2	120482	31				g.chr16:88706381C>T	AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.495C>T	chr16.hg19:g.88706381C>T		0						p.R165R	NM_013278.3	NP_037410.1	1	2	3	2.297942	Q9P0M4	IL17C_HUMAN		3	544	+			Q3MIG8|Q9HC75	Silent	SNP	ENST00000244241.4	1	1	hg19	c.495C>T	CCDS42217.1	0																																																																																								0.642289		TCGA-LB-A7SX-01A-11D-A33T-08	0.701	IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422575.1	0	0	1		2	2	2	0	0	0	0	48	0	48	48	1	1.650000	-3.550582	1	0.640000	NM_013278		0	12	12	0	384	379	0	0	1	0		0	0	48	0	0	0.999078	3.386817e-01	0	0	0	37	0	12	384
PIP4K2B	8396	broad.mit.edu	37	17	36940505	36940505	+	Silent	SNP	C	C	T	rs143351168		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr17:36940505C>T	ENST00000269554.3	-	3	825	c.345G>A	c.(343-345)caG>caA	p.Q115Q	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	115	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						CCTGGTAATCCTGATCATCAA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		17308	0.001		0.0	False		,,,				2504	0.0					ENST00000269554.3	0.150000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.083774	0.060000	0.060000																										0				19						c.(343-345)caG>caA		phosphatidylinositol-5-phosphate 4-kinase, type II, beta							92.0	76.0	82.0					17																	36940505		2203	4300	6503	SO:0001819	synonymous_variant	8396	2	121412	28				g.chr17:36940505C>T	U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.345G>A	chr17.hg19:g.36940505C>T		0					PIP4K2B_ENST00000311500.6_5'UTR	p.Q115Q	NM_003559.4	NP_003550.1	1	2	3	2.292176	P78356	PI42B_HUMAN		3	825	-			Q5U0E8|Q8TBP2	Silent	SNP	ENST00000269554.3	0	1	hg19	c.345G>A	CCDS11329.1	0																																																																																								0.642289		TCGA-LB-A7SX-01A-11D-A33T-08	0.502	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	0	0	1		2	2	2	0	0	0	0	25	0	25	25	1	1.650000	-3.320245	1	0.640000	NM_003559		0	5	5	0	245	244	0	0	1	0		0	0	25	0	0	0.937505	3.207214e-01	0	1	0	48	0	5	245
MED1	5469	broad.mit.edu	37	17	37571341	37571341	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr17:37571341G>A	ENST00000394287.3	-	16	1642	c.1437C>T	c.(1435-1437)ctC>ctT	p.L479L	MED1_ENST00000300651.6_Silent_p.L479L			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.L479L(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GCCCTTTGTAGAGTTTACAGC	0.408										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	ENST00000394287.3	0.140000	6.000000e-02	1.200000e-01	7.000000e-02	0.090000	0.109961	0.090000	0.100000																										1	Substitution - coding silent(1)	p.L479L(1)	lung(1)	59						c.(1435-1437)ctC>ctT		mediator complex subunit 1							210.0	215.0	213.0					17																	37571341		2203	4300	6503	SO:0001819	synonymous_variant	5469	0	0					g.chr17:37571341G>A	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.1437C>T	chr17.hg19:g.37571341G>A		0	HNSCC(31;0.082)				MED1_ENST00000300651.6_Silent_p.L479L	p.L479L			1	2	3	2.292176	O95243	MBD4_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	16	1642	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Silent	SNP	ENST00000394287.3	1	1	hg19	c.1437C>T		0																																																																																								0.642289		TCGA-LB-A7SX-01A-11D-A33T-08	0.408	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	0	0	1		2	2	2	0	0	0	0	174	0	174	173	1	1.650000	-2.564702	1	0.640000	NM_004774		0	40	40	0	1232	1218	0	0	1	1		0	0	174	0	0	1.000000	1.807887e-01	0	4	0	20	0	40	1232
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.400000e-01	1	9.000000e-01	0.960000	0.955904	0.960000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	24185	GRCh37	CM951226	TP53	M		c.(637-639)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	7157	1	121412	30	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578212G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	chr17.hg19:g.7578212G>A	ENSP00000269305:p.Arg213*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*	p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.630120	P04637	P53_HUMAN		6	826	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.637C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	2	TP53	7518937	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	6	0	0	0	0	39	0	39	38	1	1.650000	-20.000000	1	0.640000	NM_000546		0	86	84	0	91	91	0	0	1	1	1	0	2	39	1355	0	1.000000	9.999766e-01	1	9	411	13	553	86	91
ALOXE3	59344	broad.mit.edu	37	17	8017832	8017832	+	Missense_Mutation	SNP	G	G	A	rs200646727		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr17:8017832G>A	ENST00000448843.2	-	6	990	c.650C>T	c.(649-651)aCg>aTg	p.T217M	ALOXE3_ENST00000380149.1_Missense_Mutation_p.T373M|ALOXE3_ENST00000318227.3_Missense_Mutation_p.T349M	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	217	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						CAGCGAGATCGTCTTGGTGGC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		17716	0.001		0.0	False		,,,				2504	0.0					ENST00000448843.2	0.170000	6.000000e-02	1.500000e-01	8.000000e-02	0.110000	0.120044	0.110000	0.110000																										0				31						c.(649-651)aCg>aTg		arachidonate lipoxygenase 3		G	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	192.0	150.0	164.0		1046,650	4.2	1.0	17		164	0,8600		0,0,4300	yes	missense,missense	ALOXE3	NM_001165960.1,NM_021628.2	81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	349/844,217/712	8017832	1,13005	2203	4300	6503	SO:0001583	missense	59344	14	121412	46				g.chr17:8017832G>A	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.650C>T	chr17.hg19:g.8017832G>A	ENSP00000400581:p.Thr217Met	1					ALOXE3_ENST00000318227.3_Missense_Mutation_p.T349M|ALOXE3_ENST00000380149.1_Missense_Mutation_p.T373M	p.T217M	NM_021628.2	NP_067641.2	0	1	1	1.630120	Q9BYJ1	LOXE3_HUMAN		6	990	-			B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	ENST00000448843.2	1	1	hg19	c.650C>T	CCDS11130.1	0	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606478	0.46527	2.27E-4	0.0	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	D;D;D	0.89681	-2.55;-2.55;-2.55	5.22	4.24	0.50183	5.22	4.24	0.50183	Lipoxygenase, C-terminal (2);	0.286741	0.39985	N	0.001219	D	0.85932	0.5812	L	0.40543	1.245	0.41066	D	0.985412	P;D;D	0.56746	0.782;0.977;0.977	B;P;P	0.47915	0.189;0.561;0.561	D	0.86119	0.1567	10	0.51188	T	0.08	-16.8023	11.1503	0.48455	0.0899:0.0:0.91:0.0	.	349;217;217	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	M	373;349;217	ENSP00000369494:T373M;ENSP00000314879:T349M;ENSP00000400581:T217M	ENSP00000314879:T349M	T	-	2	0	0	ALOXE3	7958557	7958557	0.997000	0.39634	0.954000	0.39281	0.709000	0.40893	2.843000	0.48238	2.578000	0.87016	0.655000	0.94253	ACG	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.547	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1	1	0	1		2	2	2	0	0	0	0	64	0	64	62	1	1.650000	-18.834910	1	0.640000			0	17	17	0	300	294	0	0	1	0		0	0	64	0	0	0.999963	0	0	0	0	1	0	17	300
AOC2	314	broad.mit.edu	37	17	40997985	40997985	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr17:40997985G>A	ENST00000253799.3	+	1	1369	c.1342G>A	c.(1342-1344)Ggt>Agt	p.G448S	AOC2_ENST00000452774.2_Missense_Mutation_p.G448S	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	448					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TTTCTATGGTGGTTTGGCCAG	0.517																																						ENST00000253799.3	1.000000	8.300000e-01	1	9.000000e-01	0.960000	0.956660	0.960000	1.000000																										0				30						c.(1342-1344)Ggt>Agt		amine oxidase, copper containing 2 (retina-specific)							123.0	114.0	117.0					17																	40997985		2203	4300	6503	SO:0001583	missense	314	0	0					g.chr17:40997985G>A	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1342G>A	chr17.hg19:g.40997985G>A	ENSP00000253799:p.Gly448Ser	0					AOC2_ENST00000452774.2_Missense_Mutation_p.G448S	p.G448S	NM_009590.2	NP_033720.2	1	2	3	2.271010	O75106	AOC2_HUMAN		1	1369	+		Breast(137;0.000143)	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	1	1	hg19	c.1342G>A	CCDS11443.1	1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767027	0.49574	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.03580	3.88;3.88	5.46	4.5	0.54988	5.46	4.5	0.54988	Copper amine oxidase, C-terminal (3);	0.056784	0.64402	D	0.000001	T	0.15262	0.0368	M	0.82630	2.6	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.81914	0.995;0.987	T	0.34179	-0.9839	10	0.05351	T	0.99	-21.9121	14.1903	0.65635	0.0723:0.0:0.9277:0.0	.	448;448	O75106;O75106-2	AOC2_HUMAN;.	S	448	ENSP00000253799:G448S;ENSP00000406134:G448S	ENSP00000253799:G448S	G	+	1	0	0	AOC2	38251511	38251511	1.000000	0.71417	0.968000	0.41197	0.044000	0.14063	9.556000	0.98127	1.308000	0.44962	-0.229000	0.12294	GGT	0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.517	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	1	0	1		2	2	2	0	0	0	0	55	0	55	55	1	1.650000	-11.081750	1	0.640000	NM_009590, NM_001158		0	147	145	0	328	323	1	0	1			0	0	55	0	0	1.000000	0	0	0	0	0	0	147	328
CLUL1	27098	broad.mit.edu	37	18	641458	641458	+	Nonsense_Mutation	SNP	G	G	T	rs547348693		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr18:641458G>T	ENST00000400606.2	+	7	1271	c.1126G>T	c.(1126-1128)Gag>Tag	p.E376*	CLUL1_ENST00000338387.7_Nonsense_Mutation_p.E376*|CLUL1_ENST00000540035.1_Nonsense_Mutation_p.E428*|CLUL1_ENST00000579494.1_Nonsense_Mutation_p.E376*|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000581619.1_Nonsense_Mutation_p.E401*	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	376					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						CTATCTGGTGGAGAAGATGAG	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		18478	0.001		0.0	False		,,,				2504	0.0					ENST00000400606.2	1.000000	2.000000e-02	1.100000e-01	3.000000e-02	0.050000	0.197043	0.050000	0.060000																										0				24						c.(1126-1128)Gag>Tag		clusterin-like 1 (retinal)							117.0	113.0	115.0					18																	641458		1945	4140	6085	SO:0001587	stop_gained	27098	1	120872	32				g.chr18:641458G>T	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1126G>T	chr18.hg19:g.641458G>T	ENSP00000383449:p.Glu376*	1					CLUL1_ENST00000540035.1_Nonsense_Mutation_p.E428*|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000338387.7_Nonsense_Mutation_p.E376*|CLUL1_ENST00000579494.1_Nonsense_Mutation_p.E376*|CLUL1_ENST00000581619.1_Nonsense_Mutation_p.E401*	p.E376*	NM_014410.4	NP_055225.1	0	2	2	2.158518	Q15846	CLUL1_HUMAN		7	1271	+			A0FDN7	Nonsense_Mutation	SNP	ENST00000400606.2	0	1	hg19	c.1126G>T	CCDS42405.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116170	0.77323	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	.	.	.	5.59	2.63	0.31362	5.59	2.63	0.31362	.	0.469100	0.24352	N	0.039263	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-1.5628	3.4341	0.07440	0.1012:0.307:0.4344:0.1574	.	.	.	.	X	376;428;376	.	ENSP00000341128:E376X	E	+	1	0	0	CLUL1	631458	631458	0.995000	0.38212	0.832000	0.32986	0.062000	0.15995	0.684000	0.25364	0.676000	0.31285	0.563000	0.77884	GAG	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.493	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1	0	0	1		2	2	2	0	0	0	0	69	0	69	68	1	1.650000	-2.971753	1	0.640000			0	9	10	0	506	498	0	0	1	0		0	0	69	0	0	0.993981	0	0	0	0	1	0	9	506
ZNF521	25925	broad.mit.edu	37	18	22804704	22804704	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr18:22804704G>T	ENST00000361524.3	-	4	3326	c.3178C>A	c.(3178-3180)Cac>Aac	p.H1060N	ZNF521_ENST00000538137.2_Missense_Mutation_p.H1060N|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.H840N	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1060					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTTTGGACGTGCTGGCCCCGC	0.502			T	PAX5	ALL																																	ENST00000361524.3	1.000000	7.000000e-02	2.400000e-01	1.000000e-01	0.140000	0.272767	0.140000	0.140000				Dom	yes			Dom	yes		18	18q11.2	18q11.2	25925	T	zinc finger protein 521				L	L	PAX5		ALL		0				149						c.(3178-3180)Cac>Aac		zinc finger protein 521							75.0	61.0	65.0					18																	22804704		2203	4300	6503	SO:0001583	missense	25925	0	0					g.chr18:22804704G>T	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3178C>A	chr18.hg19:g.22804704G>T	ENSP00000354794:p.His1060Asn	1					ZNF521_ENST00000538137.2_Missense_Mutation_p.H1060N|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.H840N	p.H1060N	NM_015461.2	NP_056276.1	0	2	2	2.158518	Q96K83	ZN521_HUMAN		4	3326	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	1	1	hg19	c.3178C>A	CCDS32806.1	0	.	.	.	.	.	.	.	.	.	.	G	9.539	1.112986	0.20795	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.07800	3.18;3.16	5.98	5.98	0.97165	5.98	5.98	0.97165	.	0.156557	0.56097	D	0.000023	T	0.05227	0.0139	N	0.08118	0	0.36885	D	0.889578	B	0.02656	0.0	B	0.04013	0.001	T	0.47573	-0.9107	10	0.20519	T	0.43	-31.416	15.2044	0.73165	0.0:0.0:0.8593:0.1407	.	1060	Q96K83	ZN521_HUMAN	N	1060;1094;1060	ENSP00000354794:H1060N;ENSP00000382352:H1060N	ENSP00000354794:H1060N	H	-	1	0	0	ZNF521	21058702	21058702	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.500000	0.81588	2.835000	0.97688	0.650000	0.86243	CAC	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.502	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	1	0	1		2	2	2	0	0	0	0	53	0	53	52	1	1.650000	-15.234970	1	0.640000	NM_015461		0	14	14	0	298	293	0	0	1	0		0	0	53	0	0	0.999744	6.801184e-02	0	0	0	9	0	14	298
CD97	976	broad.mit.edu	37	19	14515219	14515219	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:14515219G>A	ENST00000242786.5	+	13	1554	c.1474G>A	c.(1474-1476)Gag>Aag	p.E492K	CD97_ENST00000357355.3_Missense_Mutation_p.E443K|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Missense_Mutation_p.E399K	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	492	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GCCACGGCAGGAGCTGCTCTG	0.642																																						ENST00000242786.5	0.780000	6.200000e-01	7.500000e-01	6.600000e-01	0.700000	0.710448	0.700000	0.710000																										0				30						c.(1474-1476)Gag>Aag		CD97 molecule							87.0	92.0	91.0					19																	14515219		2203	4298	6501	SO:0001583	missense	976	0	0					g.chr19:14515219G>A		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1474G>A	chr19.hg19:g.14515219G>A	ENSP00000242786:p.Glu492Lys	1					CD97_ENST00000357355.3_Missense_Mutation_p.E443K|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Missense_Mutation_p.E399K	p.E492K	NM_078481.3	NP_510966.1	0	1	1	1.574139	P48960	CD97_HUMAN		13	1554	+			A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	1	1	hg19	c.1474G>A	CCDS32929.1	0	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118085	0.56505	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70399	-0.48;-0.38;-0.0	5.22	4.19	0.49359	5.22	4.19	0.49359	GPS domain (2);	.	.	.	.	T	0.68668	0.3026	L	0.35487	1.065	0.19775	N	0.999955	D;D;B	0.69078	0.987;0.997;0.176	P;P;B	0.61592	0.814;0.891;0.122	T	0.57004	-0.7885	9	0.02654	T	1	.	11.2011	0.48741	0.0884:0.0:0.9116:0.0	.	399;443;492	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	K	492;443;399;442	ENSP00000242786:E492K;ENSP00000349918:E443K;ENSP00000351413:E399K	ENSP00000242786:E492K	E	+	1	0	0	CD97	14376219	14376219	0.983000	0.35010	0.187000	0.23214	0.280000	0.26924	1.237000	0.32695	1.435000	0.47434	0.655000	0.94253	GAG	0.470588		TCGA-LB-A7SX-01A-11D-A33T-08	0.642	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	1	0	1		2	2	2	0	0	0	0	113	0	113	111	1	1.650000	-20.000000	1	0.640000	NM_078481		0	209	207	0	416	410	1	0	1	1		0	0	113	0	0	1.000000	1	0	46	0	20	0	209	416
SLC7A10	56301	broad.mit.edu	37	19	33699875	33699875	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:33699875G>A	ENST00000253188.4	-	11	1640	c.1494C>T	c.(1492-1494)gaC>gaT	p.D498D	CTD-2540B15.13_ENST00000609744.1_RNA	NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	498					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					CTTCGGGGGCGTCCTGGGGGT	0.602																																						ENST00000253188.4	1.000000	7.200000e-01	1	8.100000e-01	0.900000	0.901115	0.900000	1.000000																										0				18						c.(1492-1494)gaC>gaT		solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10							35.0	39.0	37.0					19																	33699875		2202	4300	6502	SO:0001819	synonymous_variant	56301	1	121404	31				g.chr19:33699875G>A	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.1494C>T	chr19.hg19:g.33699875G>A		0					CTD-2540B15.13_ENST00000609744.1_RNA	p.D498D	NM_019849.2	NP_062823.1	0	0	0	2.256350	Q9NS82	AAA1_HUMAN		11	1640	-	Esophageal squamous(110;0.137)		B2RE84	Silent	SNP	ENST00000253188.4	1	1	hg19	c.1494C>T	CCDS12431.1	1																																																																																								0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.602	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	1	0	1		2	2	2	0	0	0	0	23	0	23	21	1	1.650000	-20.000000	1	0.640000	NM_019849		0	69	65	0	169	157	1	0	1			0	0	23	0	0	1.000000	0	0	0	0	0	0	69	169
FFAR2	2867	broad.mit.edu	37	19	35941517	35941517	+	Missense_Mutation	SNP	C	C	T	rs574975926		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:35941517C>T	ENST00000599180.2	+	2	981	c.901C>T	c.(901-903)Cgc>Tgc	p.R301C	FFAR2_ENST00000601590.1_Intron|FFAR2_ENST00000246549.2_Missense_Mutation_p.R301C			O15552	FFAR2_HUMAN	free fatty acid receptor 2	301					cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to fatty acid (GO:0071398)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipid storage (GO:0019915)|mucosal immune response (GO:0002385)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of interleukin-8 secretion (GO:2000484)|regulation of acute inflammatory response (GO:0002673)|regulation of peptide hormone secretion (GO:0090276)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(6)|skin(1)|urinary_tract(1)	22	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCTGTTGGGACGCAGAGGCAA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19039	0.0		0.0	False		,,,				2504	0.001				GBM(40;139 809 9833 23358 48736)	ENST00000599180.2	1.000000	8.800000e-01	1	9.300000e-01	0.980000	0.975398	0.980000	1.000000																										0				22						c.(901-903)Cgc>Tgc		free fatty acid receptor 2							76.0	76.0	76.0					19																	35941517		2203	4300	6503	SO:0001583	missense	2867	12	121412	43				g.chr19:35941517C>T	AF024690	CCDS12461.1	19q13.1	2012-08-08	2006-02-15	2006-02-15		ENSG00000126262		"""GPCR / Class A : Fatty acid receptors"""	4501	protein-coding gene	gene with protein product		603823	"""G protein-coupled receptor 43"""	GPR43		9344866	Standard	NM_005306		Approved	FFA2R	uc010eea.3	O15552		ENST00000599180.2:c.901C>T	chr19.hg19:g.35941517C>T	ENSP00000473159:p.Arg301Cys	0					FFAR2_ENST00000246549.2_Missense_Mutation_p.R301C|FFAR2_ENST00000601590.1_Intron	p.R301C			0	0	0	2.256350	O15552	FFAR2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)	2	981	+	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		B0M0J9|Q4VAZ3|Q4VAZ5|Q4VBL5	Missense_Mutation	SNP	ENST00000599180.2	1	1	hg19	c.901C>T	CCDS12461.1	1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037193	0.35893	.	.	ENSG00000126262	ENST00000246549	T	0.69040	-0.37	4.85	-0.293	0.12835	4.85	-0.293	0.12835	.	0.444083	0.19863	N	0.104381	T	0.52041	0.1710	L	0.51422	1.61	0.09310	N	0.999996	B	0.10296	0.003	B	0.04013	0.001	T	0.41805	-0.9488	10	0.48119	T	0.1	-3.8436	3.8897	0.09113	0.1696:0.4716:0.0:0.3588	.	301	O15552	FFAR2_HUMAN	C	301	ENSP00000246549:R301C	ENSP00000246549:R301C	R	+	1	0	0	FFAR2	40633357	40633357	0.000000	0.05858	0.002000	0.10522	0.282000	0.26991	0.054000	0.14205	-0.091000	0.12440	0.563000	0.77884	CGC	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.567	FFAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466120.3	1	0	1		2	2	2	0	0	0	0	79	0	79	79	1	1.650000	-20.000000	1	0.640000	NM_005306		0	219	218	0	469	465	1	0	1	1		0	0	79	0	0	1.000000	5.097691e-01	0	2	0	3	0	219	469
PRX	57716	broad.mit.edu	37	19	40900573	40900573	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:40900573C>T	ENST00000324001.7	-	7	3956	c.3686G>A	c.(3685-3687)cGa>cAa	p.R1229Q	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1229	Glu-rich (acidic).				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGTGCCTCTCGGCTTAGCCC	0.677																																						ENST00000324001.7	1.000000	4.000000e-02	1.300000e-01	7.000000e-02	0.090000	0.143410	0.090000	0.100000																										0				47						c.(3685-3687)cGa>cAa		periaxin							40.0	39.0	39.0					19																	40900573		2203	4300	6503	SO:0001583	missense	57716	1	121394	35				g.chr19:40900573C>T	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.3686G>A	chr19.hg19:g.40900573C>T	ENSP00000326018:p.Arg1229Gln	0					PRX_ENST00000291825.7_3'UTR	p.R1229Q	NM_181882.2	NP_870998.2	1	2	3	2.336264	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)	7	3956	-			Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	1	1	hg19	c.3686G>A	CCDS33028.1	0	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616264	0.28801	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01043	5.41	4.99	1.46	0.22682	4.99	1.46	0.22682	.	0.789709	0.10820	N	0.630577	T	0.01124	0.0037	L	0.36672	1.1	0.09310	N	0.999995	P	0.51791	0.948	B	0.39503	0.301	T	0.54450	-0.8292	10	0.34782	T	0.22	-0.1423	6.6701	0.23064	0.0:0.5058:0.0:0.4942	.	1229	Q9BXM0	PRAX_HUMAN	Q	1229;1164	ENSP00000326018:R1229Q	ENSP00000326018:R1229Q	R	-	2	0	0	PRX	45592413	45592413	0.011000	0.17503	0.566000	0.28421	0.631000	0.37964	0.073000	0.14640	0.529000	0.28599	0.561000	0.74099	CGA	0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.677	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	0	0	1		2	2	2	0	0	0	0	63	0	63	59	1	1.650000	-3.393076	1	0.640000	NM_020956		0	15	14	0	486	475	0	0	1	0		0	0	63	0	0	0.999849	4.771301e-02	0	0	0	11	0	15	486
PSG7	5676	broad.mit.edu	37	19	43430840	43430840	+	RNA	SNP	G	G	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:43430840G>C	ENST00000406070.2	-	0	834				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TTAAGTTATTGATGGTGATGT	0.463																																						ENST00000406070.2	1.000000	7.000000e-02	1.400000e-01	9.000000e-02	0.110000	0.173489	0.110000	0.110000																										0												pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)							284.0	277.0	279.0					19																	43430840		2201	4298	6499			5676	0	0					g.chr19:43430840G>C			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		chr19.hg19:g.43430840G>C		0					PSG7_ENST00000446844.3_RNA		NM_002783.2	NP_002774.2	2	2	4	2.359799	Q13046	PSG7_HUMAN		0	834	-		Prostate(69;0.00682)	Q15232	RNA	SNP	ENST00000406070.2	1	1	hg19			0																																																																																								0.657534		TCGA-LB-A7SX-01A-11D-A33T-08	0.463	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	0	0	1		2	2	2	0	0	0	0	196	0	196	193	1	1.650000	-3.798021	1	0.640000	NM_001206650		0	52	52	0	1438	1422	0	0	1			0	0	196	0	0	1.000000	0	0	0	0	0	0	52	1438
CADM4	199731	broad.mit.edu	37	19	44129317	44129317	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:44129317G>A	ENST00000222374.2	-	7	889	c.841C>T	c.(841-843)Ctg>Ttg	p.L281L	CADM4_ENST00000593506.1_5'UTR	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	281	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				GCGGATACCAGACCCGGCAGC	0.622																																						ENST00000222374.2	1.000000	6.000000e-02	1.800000e-01	9.000000e-02	0.130000	0.176532	0.130000	0.130000																										0				12						c.(841-843)Ctg>Ttg		cell adhesion molecule 4							55.0	46.0	49.0					19																	44129317		2203	4300	6503	SO:0001819	synonymous_variant	199731	0	0					g.chr19:44129317G>A	AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.841C>T	chr19.hg19:g.44129317G>A		0					CADM4_ENST00000593506.1_5'UTR	p.L281L	NM_145296.1	NP_660339.1	1	2	3	2.341294	Q8NFZ8	CADM4_HUMAN		7	889	-		Prostate(69;0.0199)	B2R7L5|Q9Y4A4	Silent	SNP	ENST00000222374.2	1	1	hg19	c.841C>T	CCDS12627.1	0																																																																																								0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.622	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	0	0	1		2	2	2	0	0	0	0	39	0	39	39	1	1.650000	-13.319810	1	0.640000	NM_145296		0	12	11	0	290	289	0	0	1	1		0	0	39	0	0	0.999131	9.552211e-01	0	12	0	118	0	12	290
FLT3LG	2323	broad.mit.edu	37	19	49983561	49983561	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:49983561C>G	ENST00000594009.1	+	6	567	c.488C>G	c.(487-489)tCa>tGa	p.S163*	CTD-3148I10.9_ENST00000599536.1_Intron|CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000595510.1_Nonsense_Mutation_p.S81*|FLT3LG_ENST00000204637.2_Nonsense_Mutation_p.S81*|FLT3LG_ENST00000600429.1_Nonsense_Mutation_p.S163*|FLT3LG_ENST00000596435.1_Nonsense_Mutation_p.S145*|FLT3LG_ENST00000597551.1_Nonsense_Mutation_p.S163*	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	163					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CCAGACTCCTCAACCCTGCCA	0.667																																						ENST00000594009.1	1.000000	3.000000e-02	1.600000e-01	6.000000e-02	0.100000	0.153980	0.100000	0.100000																										0				10						c.(487-489)tCa>tGa		fms-related tyrosine kinase 3 ligand							48.0	45.0	46.0					19																	49983561		2163	4189	6352	SO:0001587	stop_gained	2323	0	0					g.chr19:49983561C>G	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.488C>G	chr19.hg19:g.49983561C>G	ENSP00000469613:p.Ser163*	0					FLT3LG_ENST00000600429.1_Nonsense_Mutation_p.S163*|FLT3LG_ENST00000204637.2_Nonsense_Mutation_p.S81*|FLT3LG_ENST00000595510.1_Nonsense_Mutation_p.S81*|FLT3LG_ENST00000597551.1_Nonsense_Mutation_p.S163*|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000596435.1_Nonsense_Mutation_p.S145*|CTD-3148I10.15_ENST00000595815.1_RNA	p.S163*	NM_001204503.1	NP_001191432.1	1	2	3	2.341294	P49771	FLT3L_HUMAN		6	567	+		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)	A0AVC2|B9EGH2|Q05C96	Nonsense_Mutation	SNP	ENST00000594009.1	0	1	hg19	c.488C>G	CCDS12767.1	0	.	.	.	.	.	.	.	.	.	.	C	23.7	4.446390	0.84101	.	.	ENSG00000090554	ENST00000204637	.	.	.	3.68	3.68	0.42216	3.68	3.68	0.42216	.	0.299782	0.30901	N	0.008656	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.2738	11.0942	0.48134	0.0:1.0:0.0:0.0	.	.	.	.	X	163	.	ENSP00000204637:S163X	S	+	2	0	0	FLT3LG	54675373	54675373	0.062000	0.20869	0.847000	0.33407	0.441000	0.31987	3.315000	0.51951	2.042000	0.60477	0.561000	0.74099	TCA	0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.667	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465305.1	0	0	1		2	2	2	0	0	0	0	21	0	21	21	1	1.650000	-3.643210	1	0.640000			0	6	6	0	190	189	0	0	1	0		0	0	21	0	0	0.965132	2.110806e-01	0	0	0	24	0	6	190
NLRP5	126206	broad.mit.edu	37	19	56538857	56538857	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:56538857G>A	ENST00000390649.3	+	7	1258	c.1258G>A	c.(1258-1260)Gag>Aag	p.E420K		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	420	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GCTCAAGTCAGAGGTCGTGTC	0.547																																						ENST00000390649.3	1.000000	5.000000e-02	2.100000e-01	8.000000e-02	0.130000	0.185340	0.130000	0.120000																										0				25						c.(1258-1260)Gag>Aag		NLR family, pyrin domain containing 5							48.0	50.0	49.0					19																	56538857		2085	4205	6290	SO:0001583	missense	126206	0	0					g.chr19:56538857G>A	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1258G>A	chr19.hg19:g.56538857G>A	ENSP00000375063:p.Glu420Lys	0						p.E420K	NM_153447.4	NP_703148.4	1	2	3	2.331647	P59047	NALP5_HUMAN		7	1258	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	0	1	hg19	c.1258G>A	CCDS12938.1	0	.	.	.	.	.	.	.	.	.	.	G	8.718	0.913767	0.17907	.	.	ENSG00000171487	ENST00000390649	T	0.78003	-1.14	3.35	-6.7	0.01766	3.35	-6.7	0.01766	.	2.074330	0.02664	N	0.107849	T	0.55847	0.1946	N	0.04508	-0.205	0.09310	N	1	B	0.24092	0.097	B	0.33568	0.166	T	0.54596	-0.8270	10	0.48119	T	0.1	.	2.0967	0.03669	0.2778:0.3996:0.1358:0.1869	.	420	P59047	NALP5_HUMAN	K	420	ENSP00000375063:E420K	ENSP00000375063:E420K	E	+	1	0	0	NLRP5	61230669	61230669	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.837000	0.01689	-3.908000	0.00092	-0.967000	0.02615	GAG	0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.547	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	0	0	1		2	2	2	0	0	0	0	24	0	24	24	1	1.650000	-8.978947	1	0.640000	NM_153447		0	6	6	0	145	144	0	0	1			0	0	24	0	0	0.965222	0	0	0	0	0	0	6	145
ZFP28	140612	broad.mit.edu	37	19	57051065	57051065	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:57051065G>A	ENST00000301318.3	+	2	351	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	ZFP28_ENST00000594386.1_3'UTR|AC005498.3_ENST00000593218.1_lincRNA|ZFP28_ENST00000591844.1_Missense_Mutation_p.E94K	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	94					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GACAGGAATTGAACCTAAAGC	0.468																																					Ovarian(124;554 1662 19430 21141 52494)	ENST00000301318.3	1.000000	5.000000e-02	1.700000e-01	8.000000e-02	0.110000	0.166402	0.110000	0.120000																										0				35						c.(280-282)Gaa>Aaa		ZFP28 zinc finger protein							107.0	105.0	106.0					19																	57051065		2203	4300	6503	SO:0001583	missense	140612	0	0					g.chr19:57051065G>A		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.280G>A	chr19.hg19:g.57051065G>A	ENSP00000301318:p.Glu94Lys	0					AC005498.3_ENST00000593218.1_lincRNA|ZFP28_ENST00000591844.1_Missense_Mutation_p.E94K|ZFP28_ENST00000594386.1_3'UTR	p.E94K	NM_020828.1	NP_065879.1	1	2	3	2.331647	Q8NHY6	ZFP28_HUMAN		2	351	+		Colorectal(82;0.000256)|Ovarian(87;0.243)	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	0	1	hg19	c.280G>A	CCDS12946.1	0	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.927546	0.00493	.	.	ENSG00000196867	ENST00000301318	T	0.04862	3.54	3.15	-2.26	0.06867	3.15	-2.26	0.06867	.	1.302900	0.05857	N	0.622289	T	0.02494	0.0076	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.42378	-0.9455	10	0.06236	T	0.91	.	3.6521	0.08208	0.4893:0.2061:0.3046:0.0	.	94;94	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	K	94	ENSP00000301318:E94K	ENSP00000301318:E94K	E	+	1	0	0	ZFP28	61742877	61742877	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.068000	0.11561	-0.378000	0.07918	0.462000	0.41574	GAA	0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.468	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	0	0	1		2	2	2	0	0	0	0	38	0	38	38	1	1.650000	-11.263180	1	0.640000	NM_020828		0	10	10	0	267	260	0	0	1			0	0	38	0	0	0.996614	0	0	0	0	0	0	10	267
MUC16	94025	broad.mit.edu	37	19	9064306	9064306	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:9064306G>A	ENST00000397910.4	-	3	23343	c.23140C>T	c.(23140-23142)Ccc>Tcc	p.P7714S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7716	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACAGGAAGGGGAGAGGGGGGG	0.532																																						ENST00000397910.4	0.400000	2.300000e-01	3.600000e-01	2.700000e-01	0.310000	0.319899	0.310000	0.320000																										0				590						c.(23140-23142)Ccc>Tcc		mucin 16, cell surface associated							96.0	96.0	96.0					19																	9064306		2025	4178	6203	SO:0001583	missense	94025	0	0					g.chr19:9064306G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23140C>T	chr19.hg19:g.9064306G>A	ENSP00000381008:p.Pro7714Ser	1						p.P7714S	NM_024690.2	NP_078966.2	0	1	1	1.574451	Q8WXI7	MUC16_HUMAN		3	23343	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.23140C>T	CCDS54212.1	0	.	.	.	.	.	.	.	.	.	.	g	3.343	-0.134144	0.06711	.	.	ENSG00000181143	ENST00000397910	T	0.20598	2.06	2.11	-3.35	0.04928	2.11	-3.35	0.04928	.	.	.	.	.	T	0.09113	0.0225	N	0.14661	0.345	.	.	.	P	0.35456	0.502	B	0.27887	0.084	T	0.18903	-1.0322	8	0.87932	D	0	.	6.4736	0.22022	0.6167:0.0:0.3833:0.0	.	7714	B5ME49	.	S	7714	ENSP00000381008:P7714S	ENSP00000381008:P7714S	P	-	1	0	0	MUC16	8925306	8925306	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.693000	0.01917	-0.722000	0.04922	-1.051000	0.02340	CCC	0.470588		TCGA-LB-A7SX-01A-11D-A33T-08	0.532	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1		2	2	2	0	0	0	0	70	0	70	69	1	1.650000	-19.999750	1	0.640000	NM_024690		0	49	47	0	280	274	1	0	1			0	0	70	0	0	1.000000	0	0	0	0	0	0	49	280
ZNF606	80095	broad.mit.edu	37	19	58490523	58490523	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr19:58490523C>T	ENST00000341164.4	-	7	2145	c.1525G>A	c.(1525-1527)Gag>Aag	p.E509K	ZNF606_ENST00000536132.1_Missense_Mutation_p.E419K	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		AAAGGTTTCTCTCCTGTATGA	0.393																																						ENST00000341164.4	1.000000	3.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.141638	0.090000	0.090000																										0				26						c.(1525-1527)Gag>Aag		zinc finger protein 606							49.0	48.0	48.0					19																	58490523		2203	4300	6503	SO:0001583	missense	80095	0	0					g.chr19:58490523C>T	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.1525G>A	chr19.hg19:g.58490523C>T	ENSP00000343617:p.Glu509Lys	0					ZNF606_ENST00000536132.1_Missense_Mutation_p.E419K	p.E509K	NM_025027.3	NP_079303.2	1	2	3	2.331647	Q8WXB4	ZN606_HUMAN		7	2145	-		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	ENST00000341164.4	1	1	hg19	c.1525G>A	CCDS12968.1	0	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343802	0.61073	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	T;T	0.24350	1.86;1.86	4.41	4.41	0.53225	4.41	4.41	0.53225	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000271	T	0.37265	0.0997	L	0.37630	1.12	0.53688	D	0.999973	D	0.60575	0.988	D	0.63793	0.918	T	0.13282	-1.0515	10	0.87932	D	0	.	12.7365	0.57228	0.0:0.833:0.167:0.0	.	509	Q8WXB4	ZN606_HUMAN	K	509;419	ENSP00000343617:E509K;ENSP00000445624:E419K	ENSP00000343617:E509K	E	-	1	0	0	ZNF606	63182335	63182335	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.550000	0.60733	2.446000	0.82766	0.561000	0.74099	GAG	0.646782		TCGA-LB-A7SX-01A-11D-A33T-08	0.393	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	0	0	1		2	2	2	0	0	0	0	32	0	32	32	1	1.650000	-3.437894	1	0.640000	NM_025027		0	8	8	0	278	276	0	0	1	0		0	0	32	0	0	0.989337	2.585587e-02	0	1	0	7	0	8	278
DBT	1629	broad.mit.edu	37	1	100701025	100701025	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:100701025C>G	ENST00000370132.4	-	3	231	c.218G>C	c.(217-219)gGa>gCa	p.G73A	DBT_ENST00000370131.3_Missense_Mutation_p.G73A	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	73	Lipoyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		AATCCCTTCTCCAATGTCTGA	0.289																																						ENST00000370132.4	1.000000	4.500000e-01	6.600000e-01	5.100000e-01	0.570000	0.607553	0.570000	0.570000																										0				19						c.(217-219)gGa>gCa		dihydrolipoamide branched chain transacylase E2							70.0	72.0	71.0					1																	100701025		2203	4298	6501	SO:0001583	missense	1629	0	0					g.chr1:100701025C>G	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.218G>C	chr1.hg19:g.100701025C>G	ENSP00000359151:p.Gly73Ala	0					DBT_ENST00000370131.3_Missense_Mutation_p.G73A	p.G73A	NM_001918.3	NP_001909.3	0	2	2	2.229829	P11182	ODB2_HUMAN		3	231	-		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	1	1	hg19	c.218G>C	CCDS767.1	0	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843596	0.91197	.	.	ENSG00000137992	ENST00000370132;ENST00000370131	T;T	0.73681	-0.77;-0.77	5.62	5.62	0.85841	5.62	5.62	0.85841	Single hybrid motif (1);Biotin/lipoyl attachment (2);	0.000000	0.85682	D	0.000000	D	0.88709	0.6510	M	0.91818	3.245	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.90103	0.4186	10	0.87932	D	0	-22.3909	20.0205	0.97499	0.0:1.0:0.0:0.0	.	73	P11182	ODB2_HUMAN	A	73	ENSP00000359151:G73A;ENSP00000359150:G73A	ENSP00000359150:G73A	G	-	2	0	0	DBT	100473613	100473613	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.982000	0.76173	2.801000	0.96364	0.650000	0.86243	GGA	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.289	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030101.2	1	0	1		2	2	2	0	0	0	0	70	0	70	70	1	1.650000	-3.015423	1	0.640000	NM_001918		0	73	72	0	328	327	1	0	1	1		0	0	70	0	0	1.000000	7.527027e-01	0	7	0	7	0	73	328
ADORA3	140	broad.mit.edu	37	1	112033386	112033386	+	Splice_Site	SNP	T	T	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:112033386T>C	ENST00000369716.4	-	2	484		c.e2-2		ADORA3_ENST00000369717.4_Splice_Site|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor						activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	ATTCTGAATCTGTTTAAGGGA	0.448																																						ENST00000369716.4	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.080570	0.070000	0.070000																										0				12						c.e2-2		adenosine A3 receptor	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)						78.0	72.0	74.0					1																	112033386		2203	4300	6503	SO:0001630	splice_region_variant	140	4	121412	34				g.chr1:112033386T>C	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.351-2A>G	chr1.hg19:g.112033386T>C		0					RNU6-792P_ENST00000363490.1_RNA|ADORA3_ENST00000369717.4_Splice_Site		NM_020683.6	NP_065734.5	0	0	0	2.193149	P33765	AA3R_HUMAN		2	484	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	A2A3P4|Q6UWU0|Q9BYZ1	Splice_Site	SNP	ENST00000369716.4	0	1	hg19		CCDS838.1	0	.	.	.	.	.	.	.	.	.	.	T	11.30	1.598438	0.28445	.	.	ENSG00000121933	ENST00000369717;ENST00000369716	.	.	.	3.49	3.49	0.39957	3.49	3.49	0.39957	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.718	0.34423	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	ADORA3	111834909	111834909	1.000000	0.71417	0.980000	0.43619	0.179000	0.23085	2.961000	0.49168	1.847000	0.53656	0.459000	0.35465	.	0.630542		TCGA-LB-A7SX-01A-11D-A33T-08	0.448	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	0	0	1		2	2	2	0	0	0	0	39	0	39	39	1	1.650000	-7.665525	1	0.640000	NM_000677, NM_020683	Intron	0	6	6	0	256	253	0	0	1			0	0	39	0	0	0.964211	0	0	0	0	0	0	6	256
OTUD7B	56957	broad.mit.edu	37	1	149916371	149916371	+	Silent	SNP	G	G	A	rs199790009		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:149916371G>A	ENST00000369135.4	-	12	2211	c.1917C>T	c.(1915-1917)ttC>ttT	p.F639F		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	639					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GTTCTGCCAGGAATCTCTCCT	0.517																																						ENST00000369135.4	0.680000	5.000000e-01	6.400000e-01	5.400000e-01	0.580000	0.596251	0.580000	0.590000																										0				39						c.(1915-1917)ttC>ttT		OTU deubiquitinase 7B							126.0	126.0	126.0					1																	149916371		1990	4180	6170	SO:0001819	synonymous_variant	56957	0	0					g.chr1:149916371G>A	AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.1917C>T	chr1.hg19:g.149916371G>A		0						p.F639F	NM_020205.2	NP_064590.2	0	0	0	2.179166	Q6GQQ9	OTU7B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)	12	2211	-	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Silent	SNP	ENST00000369135.4	1	1	hg19	c.1917C>T	CCDS41389.1	0																																																																																								0.628099		TCGA-LB-A7SX-01A-11D-A33T-08	0.517	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	1	0	1		2	2	2	0	0	0	0	114	0	114	112	1	1.650000	-20.000000	1	0.640000	NM_020205		0	157	156	0	642	633	1	0	1	1		0	0	114	0	0	1.000000	9.627152e-01	0	6	0	18	0	157	642
CLK2	1196	broad.mit.edu	37	1	155233761	155233761	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:155233761C>G	ENST00000368361.4	-	12	1612	c.1297G>C	c.(1297-1299)Gag>Cag	p.E433Q	CLK2_ENST00000497188.1_5'UTR|SCAMP3_ENST00000355379.3_5'Flank|CLK2_ENST00000536801.1_Missense_Mutation_p.E433Q|CLK2_ENST00000355560.4_Missense_Mutation_p.E431Q|CLK2_ENST00000361168.5_Missense_Mutation_p.E432Q|SCAMP3_ENST00000302631.3_5'Flank			P49760	CLK2_HUMAN	CDC-like kinase 2	433	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TTGCAGTTCTCACGAACATAG	0.542								Other conserved DNA damage response genes																														ENST00000368361.4	0.670000	4.900000e-01	6.300000e-01	5.300000e-01	0.570000	0.584745	0.570000	0.580000																										0				22						c.(1297-1299)Gag>Cag	Other conserved DNA damage response genes	CDC-like kinase 2							88.0	96.0	93.0					1																	155233761		2203	4300	6503	SO:0001583	missense	1196	0	0					g.chr1:155233761C>G	L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.1297G>C	chr1.hg19:g.155233761C>G	ENSP00000357345:p.Glu433Gln	0					CLK2_ENST00000361168.5_Missense_Mutation_p.E432Q|SCAMP3_ENST00000302631.3_5'Flank|CLK2_ENST00000536801.1_Missense_Mutation_p.E433Q|CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000355560.4_Missense_Mutation_p.E431Q|SCAMP3_ENST00000355379.3_5'Flank	p.E433Q			0	0	0	2.179166	P49760	CLK2_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)	12	1612	-	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	ENST00000368361.4	1	1	hg19	c.1297G>C		0	.	.	.	.	.	.	.	.	.	.	.	18.88	3.717852	0.68844	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000424156;ENST00000536801	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	4.2	4.2	0.49525	4.2	4.2	0.49525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.100176	0.64402	D	0.000002	T	0.09905	0.0243	N	0.21324	0.655	0.80722	D	1	B;B	0.31174	0.114;0.311	B;B	0.35770	0.093;0.21	T	0.11421	-1.0588	10	0.54805	T	0.06	.	15.6036	0.76646	0.0:1.0:0.0:0.0	.	433;432	P49760;P49760-3	CLK2_HUMAN;.	Q	432;433;431;205;433	ENSP00000354856:E432Q;ENSP00000357345:E433Q;ENSP00000347759:E431Q;ENSP00000441023:E433Q	ENSP00000347759:E431Q	E	-	1	0	0	CLK2	153500385	153500385	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.607000	0.82883	2.334000	0.79466	0.561000	0.74099	GAG	0.628099		TCGA-LB-A7SX-01A-11D-A33T-08	0.542	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000087391.1	1	0	1		2	2	2	0	0	0	0	98	0	98	98	1	1.650000	-3.089265	1	0.640000	NM_003993		0	141	137	0	591	584	1	0	1	1		0	0	98	0	0	1.000000	1	0	34	0	148	0	141	591
GNB1	2782	broad.mit.edu	37	1	1722012	1722012	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:1722012C>T	ENST00000378609.4	-	9	852	c.521G>A	c.(520-522)gGc>gAc	p.G174D		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	174					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		CGTCTGCTGGCCGGTCTCGAT	0.542																																						ENST00000378609.4	0.240000	6.000000e-02	1.900000e-01	9.000000e-02	0.130000	0.149542	0.130000	0.130000																										0				12						c.(520-522)gGc>gAc		guanine nucleotide binding protein (G protein), beta polypeptide 1							113.0	83.0	93.0					1																	1722012		2203	4300	6503	SO:0001583	missense	2782	0	0					g.chr1:1722012C>T	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.521G>A	chr1.hg19:g.1722012C>T	ENSP00000367872:p.Gly174Asp	0						p.G174D	NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	0	0	0	2.151466	P62873	GBB1_HUMAN		9	852	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)	B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	SNP	ENST00000378609.4	0	1	hg19	c.521G>A	CCDS34.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.6|26.6	4.753994|4.753994	0.89843|0.89843	.|.	.|.	ENSG00000078369|ENSG00000078369	ENST00000424622|ENST00000378609;ENST00000455156;ENST00000378606	.|T	.|0.01613	.|4.73	5.11|5.11	5.11|5.11	0.69529|0.69529	5.11|5.11	5.11|5.11	0.69529|0.69529	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.11024|0.11024	0.0269|0.0269	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	.|D	.|0.61697	.|0.99	.|D	.|0.66351	.|0.943	T|T	0.00353|0.00353	-1.1795|-1.1795	5|10	.|0.87932	.|D	.|0	-24.5913|-24.5913	17.5387|17.5387	0.87841|0.87841	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|174	.|P62873	.|GBB1_HUMAN	T|D	32|174;74;174	.|ENSP00000367872:G174D	.|ENSP00000367869:G174D	A|G	-|-	1|2	0|0	0|0	GNB1|GNB1	1711872|1711872	1711872|1711872	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.586000|7.586000	0.82596|0.82596	2.374000|2.374000	0.81015|0.81015	0.655000|0.655000	0.94253|0.94253	GCC|GGC	0.623116		TCGA-LB-A7SX-01A-11D-A33T-08	0.542	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	1	0	1		2	2	2	0	0	0	0	24	0	24	24	1	1.650000	-11.422060	1	0.640000	NM_002074		0	9	9	0	188	187	0	0	1	1		0	0	24	0	0	0.994415	9.999979e-01	0	21	0	676	0	9	188
CROCC	9696	broad.mit.edu	37	1	17271988	17271988	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:17271988C>T	ENST00000375541.5	+	15	2092	c.2023C>T	c.(2023-2025)Cgc>Tgc	p.R675C	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGAAGGGAAGCGCTCAGTCCT	0.642																																						ENST00000375541.5	0.320000	1.000000e-01	2.600000e-01	1.400000e-01	0.190000	0.203032	0.190000	0.190000																										0				62						c.(2023-2025)Cgc>Tgc		ciliary rootlet coiled-coil, rootletin																																				SO:0001583	missense	9696	11	121314	29				g.chr1:17271988C>T	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2023C>T	chr1.hg19:g.17271988C>T	ENSP00000364691:p.Arg675Cys	0					CROCC_ENST00000467938.1_3'UTR	p.R675C	NM_014675.3	NP_055490.3	0	1	1	2.183241				15	2092	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		Missense_Mutation	SNP	ENST00000375541.5	0	1	hg19	c.2023C>T	CCDS30616.1	0	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885565	0.51908	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.10382	2.88	5.01	4.02	0.46733	5.01	4.02	0.46733	.	.	.	.	.	T	0.25717	0.0626	L	0.57536	1.79	0.48511	D	0.999665	D;D	0.89917	1.0;1.0	D;P	0.64410	0.925;0.878	T	0.00206	-1.1920	9	0.46703	T	0.11	.	13.6849	0.62511	0.1552:0.8448:0.0:0.0	.	538;675	A1L0S8;Q5TZA2	.;CROCC_HUMAN	C	675;556	ENSP00000364691:R675C	ENSP00000364691:R675C	R	+	1	0	0	CROCC	17144575	17144575	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.659000	0.37387	2.712000	0.92718	0.561000	0.74099	CGC	0.625624		TCGA-LB-A7SX-01A-11D-A33T-08	0.642	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	0	0	1		13	2	2	0	0	0	1	23	0	23	39	1	1.650000	-5.283819	1	0.640000	NM_014675		0	11	9	0	164	143	0	0	0	0		0	0	23	0	0	0.278376	1.964007e-01	0	0	0	12	0	11	164
MNDA	4332	broad.mit.edu	37	1	158812091	158812091	+	Missense_Mutation	SNP	G	G	T	rs140390501		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:158812091G>T	ENST00000368141.4	+	2	409	c.148G>T	c.(148-150)Gat>Tat	p.D50Y	MNDA_ENST00000491210.1_3'UTR	NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	50	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					TAAGATTACAGATTTGATGGA	0.338																																						ENST00000368141.4	0.170000	5.000000e-02	1.400000e-01	8.000000e-02	0.100000	0.114525	0.100000	0.110000																										0				65						c.(148-150)Gat>Tat		myeloid cell nuclear differentiation antigen							95.0	100.0	98.0					1																	158812091		2203	4300	6503	SO:0001583	missense	4332	0	0					g.chr1:158812091G>T	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.148G>T	chr1.hg19:g.158812091G>T	ENSP00000357123:p.Asp50Tyr	0					MNDA_ENST00000491210.1_3'UTR	p.D50Y	NM_002432.1	NP_002423.1	0	0	0	2.179166	P41218	MNDA_HUMAN		2	409	+	all_hematologic(112;0.0378)			Missense_Mutation	SNP	ENST00000368141.4	1	1	hg19	c.148G>T	CCDS1177.1	0	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856515	0.32791	.	.	ENSG00000163563	ENST00000368141	T	0.55052	0.54	3.51	-0.707	0.11245	3.51	-0.707	0.11245	Pyrin (2);	.	.	.	.	T	0.50599	0.1625	M	0.69358	2.11	0.09310	N	1	D	0.89917	1.0	D	0.77557	0.99	T	0.35822	-0.9773	9	0.87932	D	0	-0.51	6.1692	0.20408	0.5109:0.0:0.4891:0.0	.	50	P41218	MNDA_HUMAN	Y	50	ENSP00000357123:D50Y	ENSP00000357123:D50Y	D	+	1	0	0	MNDA	157078715	157078715	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.547000	0.23299	-0.025000	0.13918	-0.259000	0.10710	GAT	0.628099		TCGA-LB-A7SX-01A-11D-A33T-08	0.338	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	0	0	1		2	2	2	0	0	0	0	57	0	57	57	1	1.650000	-3.917358	1	0.640000	NM_002432		0	15	14	0	405	400	0	0	1	0		0	0	57	0	0	0.999863	1.523758e-03	0	0	0	2	0	15	405
RHCE	6006	broad.mit.edu	37	1	25717263	25717263	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:25717263G>A	ENST00000294413.7	-	5	836	c.778C>T	c.(778-780)Cac>Tac	p.H260Y	RHCE_ENST00000349320.3_Missense_Mutation_p.H244Y|RHCE_ENST00000425135.1_Missense_Mutation_p.H260Y|RHCE_ENST00000340849.4_Intron|RHCE_ENST00000374352.2_Missense_Mutation_p.H244Y|RHCE_ENST00000243186.6_Missense_Mutation_p.H260Y|RHCE_ENST00000455194.1_Intron|RHCE_ENST00000413854.1_Missense_Mutation_p.H260Y|RHCE_ENST00000349438.4_Missense_Mutation_p.H260Y|RHCE_ENST00000346452.4_Intron	NM_020485.4	NP_065231	P18577	RHCE_HUMAN	Rh blood group, CcEe antigens	260						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			endometrium(8)|large_intestine(6)|lung(3)	17		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		CTTTGGGGGTGAGCCAAGGAT	0.537																																						ENST00000294413.7	0.350000	2.100000e-01	3.200000e-01	2.400000e-01	0.270000	0.283852	0.270000	0.280000																										0				17						c.(778-780)Cac>Tac		Rh blood group, CcEe antigens							157.0	134.0	142.0					1																	25717263		2203	4300	6503	SO:0001583	missense	6006	0	0					g.chr1:25717263G>A	BC075081	CCDS30634.1, CCDS30635.1, CCDS30636.1, CCDS30637.1	1p36.11	2014-09-17	2006-02-23		ENSG00000188672	ENSG00000188672		"""CD molecules"", ""Blood group antigens"""	10008	protein-coding gene	gene with protein product		111700	"""Rhesus blood group, CcEe antigens"""	RH		8220426	Standard	NM_138618		Approved	CD240CE	uc001bkf.3	P18577	OTTHUMG00000007650	ENST00000294413.7:c.778C>T	chr1.hg19:g.25717263G>A	ENSP00000294413:p.His260Tyr	0					RHCE_ENST00000349438.4_Missense_Mutation_p.H260Y|RHCE_ENST00000346452.4_Intron|RHCE_ENST00000425135.1_Missense_Mutation_p.H260Y|RHCE_ENST00000243186.6_Missense_Mutation_p.H260Y|RHCE_ENST00000340849.4_Intron|RHCE_ENST00000349320.3_Missense_Mutation_p.H244Y|RHCE_ENST00000413854.1_Missense_Mutation_p.H260Y|RHCE_ENST00000374352.2_Missense_Mutation_p.H244Y|RHCE_ENST00000455194.1_Intron	p.H260Y	NM_020485.4	NP_065231	0	1	1	2.183241	P18577	RHCE_HUMAN		5	836	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	A7DW68|B7UDF3|B7UDF4|B7UDF5|B7UDF6|B7UDF7|B7UDF8|B7UDF9|B7UDG0|B7UDG1|B7UDG2|B7UDG3|Q02163|Q02164|Q02165|Q16160|Q2MJW0|Q2VC86|Q3LTM6|Q6AZX5|Q6J2U3|Q7RU06|Q8IZT2|Q8IZT3|Q8IZT4|Q8IZT5|Q9UD13|Q9UD14|Q9UD15|Q9UD16|Q9UD73|Q9UD74|Q9UEC2|Q9UEC3|Q9UPN0	Missense_Mutation	SNP	ENST00000294413.7	1	1	hg19	c.778C>T	CCDS30635.1	0	.	.	.	.	.	.	.	.	.	.	g	10.01	1.233543	0.22626	.	.	ENSG00000188672	ENST00000413854;ENST00000539650;ENST00000374352;ENST00000243186;ENST00000425135;ENST00000349320;ENST00000294413;ENST00000447203;ENST00000349438	T;T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89;1.89	4.23	3.3	0.37823	4.23	3.3	0.37823	Ammonium transporter AmtB-like (3);	0.534254	0.19648	N	0.109285	T	0.50222	0.1603	M	0.83953	2.67	0.19300	N	0.999972	D;D;D	0.69078	0.988;0.997;0.964	D;D;D	0.77004	0.916;0.943;0.989	T	0.37709	-0.9694	10	0.87932	D	0	-2.9623	9.4703	0.38837	0.0:0.0:0.7883:0.2117	.	244;260;260	Q5VSJ9;Q5VSJ8;P18577	.;.;RHCE_HUMAN	Y	260;202;244;260;260;244;260;260;260	ENSP00000415417:H260Y;ENSP00000363472:H244Y;ENSP00000243186:H260Y;ENSP00000392809:H260Y;ENSP00000311185:H244Y;ENSP00000294413:H260Y;ENSP00000334570:H260Y	ENSP00000243186:H260Y	H	-	1	0	0	RHCE	25589850	25589850	0.912000	0.30974	0.077000	0.20336	0.051000	0.14879	2.349000	0.44054	1.106000	0.41623	0.591000	0.81541	CAC	0.625624		TCGA-LB-A7SX-01A-11D-A33T-08	0.537	RHCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020312.2	1	0	1		2	2	2	0	0	0	0	77	0	77	77	1	1.650000	-3.075755	1	0.640000	NM_020485		0	58	58	0	564	561	0	0	1	0		0	0	77	0	0	1.000000	0	0	0	0	1	0	58	564
JAK1	3716	broad.mit.edu	37	1	65310517	65310517	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:65310517C>T	ENST00000342505.4	-	16	2419	c.2171G>A	c.(2170-2172)cGt>cAt	p.R724H	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	724	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GATGCCCTCACGGGCCAGGAG	0.542			Mis		ALL																																	ENST00000342505.4	0.220000	7.000000e-02	1.800000e-01	1.000000e-01	0.130000	0.144553	0.130000	0.130000				Dom	yes			Dom	yes		1	1p32.3-p31.3	1p32.3-p31.3	3716	Mis	Janus kinase 1				L	L			ALL		0				120						c.(2170-2172)cGt>cAt		Janus kinase 1	Ruxolitinib(DB08877)|Tofacitinib(DB08895)						97.0	111.0	107.0					1																	65310517		2091	4208	6299	SO:0001583	missense	3716	0	0					g.chr1:65310517C>T	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2171G>A	chr1.hg19:g.65310517C>T	ENSP00000343204:p.Arg724His	0					JAK1_ENST00000465376.1_5'UTR	p.R724H	NM_002227.2	NP_002218.2	0	1	1	2.183241	P23458	JAK1_HUMAN		16	2419	-			Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	1	1	hg19	c.2171G>A	CCDS41346.1	0	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762736	0.89932	.	.	ENSG00000162434	ENST00000342505	D	0.82893	-1.66	5.0	4.09	0.47781	5.0	4.09	0.47781	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.87509	0.6195	M	0.71036	2.16	0.51767	D	0.999936	D	0.89917	1.0	D	0.91635	0.999	D	0.89235	0.3580	9	0.72032	D	0.01	-5.0492	13.6915	0.62549	0.0:0.9256:0.0:0.0744	.	724	P23458	JAK1_HUMAN	H	724	ENSP00000343204:R724H	ENSP00000343204:R724H	R	-	2	0	0	JAK1	65083105	65083105	1.000000	0.71417	0.864000	0.33941	0.849000	0.48306	7.239000	0.78182	1.347000	0.45714	0.563000	0.77884	CGT	0.625624		TCGA-LB-A7SX-01A-11D-A33T-08	0.542	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	1	0	1		2	2	2	0	0	0	0	41	0	41	40	1	1.650000	-16.096030	1	0.640000	NM_002227		0	15	15	0	315	309	1	0	1	1		0	0	41	0	0	0.999863	9.823398e-01	0	15	0	127	0	15	315
NEGR1	257194	broad.mit.edu	37	1	72400859	72400859	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:72400859C>G	ENST00000357731.5	-	2	551	c.312G>C	c.(310-312)caG>caC	p.Q104H	NEGR1_ENST00000306821.3_5'UTR|NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000434200.1_Missense_Mutation_p.Q102H	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	104	Ig-like C2-type 1.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CATTCTGTATCTGGAGGCTGT	0.443																																						ENST00000357731.5	0.160000	4.000000e-02	1.300000e-01	6.000000e-02	0.090000	0.104038	0.090000	0.100000																										0				32						c.(310-312)caG>caC		neuronal growth regulator 1							121.0	111.0	115.0					1																	72400859		2203	4300	6503	SO:0001583	missense	257194	0	0					g.chr1:72400859C>G	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.312G>C	chr1.hg19:g.72400859C>G	ENSP00000350364:p.Gln104His	0					NEGR1_ENST00000306821.3_5'UTR|NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000434200.1_Missense_Mutation_p.Q102H	p.Q104H	NM_173808.2	NP_776169.2	0	1	1	2.183241	Q7Z3B1	NEGR1_HUMAN		2	551	-		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	1	1	hg19	c.312G>C	CCDS661.1	0	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725868	0.69074	.	.	ENSG00000172260	ENST00000357731;ENST00000434200	T;T	0.27557	1.66;1.66	5.71	4.8	0.61643	5.71	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.055508	0.85682	D	0.000000	T	0.10723	0.0262	L	0.35644	1.08	0.58432	D	0.999997	B;B	0.21452	0.017;0.056	B;B	0.23018	0.026;0.043	T	0.06552	-1.0820	10	0.09590	T	0.72	-5.4874	14.4709	0.67517	0.0:0.9295:0.0:0.0705	.	102;104	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	H	104;102	ENSP00000350364:Q104H;ENSP00000413294:Q102H	ENSP00000350364:Q104H	Q	-	3	2	2	NEGR1	72173447	72173447	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.217000	0.51184	1.423000	0.47198	0.655000	0.94253	CAG	0.625624		TCGA-LB-A7SX-01A-11D-A33T-08	0.443	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	0	0	1		2	2	2	0	0	0	0	55	0	55	54	1	1.650000	-11.303760	1	0.640000	NM_173808		0	11	11	0	333	329	0	0	1	0		0	0	55	0	0	0.998292	1.198114e-02	0	0	0	5	0	11	333
COL24A1	255631	broad.mit.edu	37	1	86313406	86313406	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:86313406G>T	ENST00000370571.2	-	39	3770	c.3404C>A	c.(3403-3405)cCt>cAt	p.P1135H	COL24A1_ENST00000436319.1_Missense_Mutation_p.P1135H	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1135	Collagen-like 11.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTTTCCAGGAGGACCTCTGCT	0.428																																						ENST00000370571.2	1.000000	8.700000e-01	1	9.200000e-01	0.980000	0.971796	0.980000	1.000000																										0				101						c.(3403-3405)cCt>cAt		collagen, type XXIV, alpha 1							148.0	138.0	141.0					1																	86313406		1865	4091	5956	SO:0001583	missense	255631	0	0					g.chr1:86313406G>T	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.3404C>A	chr1.hg19:g.86313406G>T	ENSP00000359603:p.Pro1135His	0					COL24A1_ENST00000436319.1_Missense_Mutation_p.P1135H	p.P1135H	NM_152890.5	NP_690850.2	0	1	1	2.183241	Q17RW2	COOA1_HUMAN		39	3770	-			C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	1	1	hg19	c.3404C>A	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	G	4.161	0.028325	0.08054	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.98701	-5.08;-5.08	5.53	4.62	0.57501	5.53	4.62	0.57501	.	0.000000	0.38058	N	0.001839	D	0.96898	0.8987	M	0.80982	2.52	0.22552	N	0.998991	B;B	0.25904	0.137;0.042	B;B	0.38683	0.279;0.007	D	0.95224	0.8336	10	0.48119	T	0.1	.	7.2398	0.26090	0.081:0.0:0.6546:0.2643	.	1135;1135	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	H	1135	ENSP00000359603:P1135H;ENSP00000392531:P1135H	ENSP00000359603:P1135H	P	-	2	0	0	COL24A1	86085994	86085994	0.874000	0.30092	0.978000	0.43139	0.377000	0.30045	3.233000	0.51311	1.343000	0.45638	-0.224000	0.12420	CCT	0.625624		TCGA-LB-A7SX-01A-11D-A33T-08	0.428	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	1	0	1		2	2	2	0	0	0	0	77	0	77	76	1	1.650000	-15.627090	1	0.640000	NM_152890		0	186	185	0	378	373	1	0	1	0		0	0	77	0	0	1.000000	2.557379e-01	0	1	0	2	0	186	378
XPR1	9213	broad.mit.edu	37	1	180793903	180793903	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr1:180793903G>T	ENST00000367590.4	+	8	976	c.778G>T	c.(778-780)Gaa>Taa	p.E260*	XPR1_ENST00000367589.3_Nonsense_Mutation_p.E260*	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	260					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						ATTTAAACTTGAAACAGATAG	0.328																																						ENST00000367590.4	0.860000	6.000000e-01	8.000000e-01	6.600000e-01	0.730000	0.737623	0.730000	0.740000																										0				35						c.(778-780)Gaa>Taa		xenotropic and polytropic retrovirus receptor 1							81.0	87.0	85.0					1																	180793903		2201	4298	6499	SO:0001587	stop_gained	9213	0	0					g.chr1:180793903G>T	AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.778G>T	chr1.hg19:g.180793903G>T	ENSP00000356562:p.Glu260*	0					XPR1_ENST00000367589.3_Nonsense_Mutation_p.E260*	p.E260*	NM_004736.3	NP_004727.2	0	0	0	2.179166	Q9UBH6	XPR1_HUMAN		8	976	+			O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Nonsense_Mutation	SNP	ENST00000367590.4	0	1	hg19	c.778G>T	CCDS1340.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.511924	0.96402	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	.	.	.	5.3	4.33	0.51752	5.3	4.33	0.51752	.	0.675652	0.14013	N	0.347315	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-5.9541	4.9217	0.13872	0.0811:0.1489:0.6162:0.1538	.	.	.	.	X	260	.	ENSP00000356561:E260X	E	+	1	0	0	XPR1	179060526	179060526	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	2.435000	0.44811	2.489000	0.83994	0.650000	0.86243	GAA	0.628099		TCGA-LB-A7SX-01A-11D-A33T-08	0.328	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	1	0	1		2	2	2	0	0	0	0	42	0	42	42	1	1.650000	-20.000000	1	0.640000	NM_004736		0	94	94	0	293	286	1	0	1	0		0	0	42	0	0	1.000000	9.261044e-01	0	1	0	15	0	94	293
NFS1	9054	broad.mit.edu	37	20	34262340	34262340	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr20:34262340G>A	ENST00000374092.4	-	10	1138	c.1068C>T	c.(1066-1068)ctC>ctT	p.L356L	RP1-309K20.6_ENST00000541176.2_Missense_Mutation_p.S16F|NFS1_ENST00000498084.1_5'Flank|NFS1_ENST00000397425.1_Silent_p.L296L|NFS1_ENST00000541387.1_Silent_p.L305L|NFS1_ENST00000540053.1_Silent_p.L154L|NFS1_ENST00000374085.1_Silent_p.L296L	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	356					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	ATGCAAAGGAGAGGTTGATAC	0.522																																						ENST00000374092.4	1.000000	0	7.000000e-02	2.000000e-02	0.040000	0.117614	0.040000	0.040000																										0				18						c.(1066-1068)ctC>ctT		NFS1 cysteine desulfurase	L-Alanine(DB00160)|L-Cysteine(DB00151)						111.0	103.0	106.0					20																	34262340		2203	4300	6503	SO:0001819	synonymous_variant	9054	0	0					g.chr20:34262340G>A	AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.1068C>T	chr20.hg19:g.34262340G>A		0					NFS1_ENST00000540053.1_Silent_p.L154L|RP1-309K20.6_ENST00000541176.2_Missense_Mutation_p.S16F|NFS1_ENST00000397425.1_Silent_p.L296L|NFS1_ENST00000374085.1_Silent_p.L296L|NFS1_ENST00000498084.1_5'Flank|NFS1_ENST00000541387.1_Silent_p.L305L	p.L356L	NM_021100.4	NP_066923.3	2	2	4	2.383269	Q9Y697	NFS1_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0886)	10	1138	-	Lung NSC(9;0.00608)|all_lung(11;0.00918)		B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Silent	SNP	ENST00000374092.4	0	1	hg19	c.1068C>T	CCDS13262.1	0																																																																																								0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.522	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078936.4	0	0	1		2	2	2	0	0	0	0	70	0	70	70	1	1.650000	-3.141534	1	0.640000	NM_021100		0	8	8	0	606	600	0	0	1	1		0	0	70	0	0	0.989003	4.542917e-01	0	4	0	104	0	8	606
CDH22	64405	broad.mit.edu	37	20	44828152	44828152	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr20:44828152C>G	ENST00000372262.3	-	7	1733	c.1333G>C	c.(1333-1335)Gat>Cat	p.D445H	CDH22_ENST00000537909.1_Missense_Mutation_p.D445H	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	445	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GTGTCCGCATCGATATCGAAG	0.637																																						ENST00000372262.3	1.000000	1.300000e-01	3.500000e-01	1.900000e-01	0.250000	0.317910	0.250000	0.240000																										0				44						c.(1333-1335)Gat>Cat		cadherin 22, type 2							66.0	50.0	55.0					20																	44828152		2203	4300	6503	SO:0001583	missense	64405	0	0					g.chr20:44828152C>G	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1333G>C	chr20.hg19:g.44828152C>G	ENSP00000361336:p.Asp445His	0					CDH22_ENST00000537909.1_Missense_Mutation_p.D445H	p.D445H	NM_021248.1	NP_067071.1	2	2	4	2.392574	Q9UJ99	CAD22_HUMAN		7	1733	-		Myeloproliferative disorder(115;0.0122)	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	0	1	hg19	c.1333G>C	CCDS13395.1	0	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183686	0.57800	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.65732	-0.17;-0.17	5.0	4.06	0.47325	5.0	4.06	0.47325	Cadherin (4);Cadherin-like (1);	0.054615	0.64402	D	0.000001	T	0.78142	0.4237	M	0.83118	2.625	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	T	0.78494	-0.2182	10	0.42905	T	0.14	.	11.1009	0.48174	0.0:0.9137:0.0:0.0863	.	445	Q9UJ99	CAD22_HUMAN	H	445	ENSP00000361336:D445H;ENSP00000437790:D445H	ENSP00000361336:D445H	D	-	1	0	0	CDH22	44261559	44261559	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	4.606000	0.61126	1.228000	0.43614	0.555000	0.69702	GAT	0.661654		TCGA-LB-A7SX-01A-11D-A33T-08	0.637	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	1	0	1		2	2	2	0	0	0	0	14	0	14	14	1	1.650000	-17.635650	1	0.640000	NM_021248		0	13	13	0	165	163	1	0	1	1		0	0	14	0	0	0.999565	5.933198e-01	0	4	0	22	0	13	165
PREX1	57580	broad.mit.edu	37	20	47324868	47324868	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr20:47324868T>C	ENST00000371941.3	-	6	735	c.713A>G	c.(712-714)aAt>aGt	p.N238S	PREX1_ENST00000396220.1_Missense_Mutation_p.N238S	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	238	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CTTGGTCTCATTGATGTTGGA	0.627																																						ENST00000371941.3	1.000000	9.700000e-01	1	9.900000e-01	0.990000	0.998775	0.990000	1.000000																										0				110						c.(712-714)aAt>aGt		phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1							135.0	138.0	137.0					20																	47324868		2203	4300	6503	SO:0001583	missense	57580	0	0					g.chr20:47324868T>C	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.713A>G	chr20.hg19:g.47324868T>C	ENSP00000361009:p.Asn238Ser	0					PREX1_ENST00000396220.1_Missense_Mutation_p.N238S	p.N238S	NM_020820.3	NP_065871	2	2	4	2.392574	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)	6	735	-			E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	1	1	hg19	c.713A>G	CCDS13410.1	1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.898230	0.91962	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.75589	-0.95;-0.95	5.64	5.64	0.86602	5.64	5.64	0.86602	Dbl homology (DH) domain (5);	0.000000	0.64402	U	0.000019	D	0.88250	0.6386	H	0.98089	4.145	0.80722	D	1	P	0.39551	0.678	P	0.47075	0.536	D	0.91608	0.5300	10	0.87932	D	0	.	15.8578	0.78994	0.0:0.0:0.0:1.0	.	238	Q8TCU6	PREX1_HUMAN	S	238	ENSP00000361009:N238S;ENSP00000379522:N238S	ENSP00000361009:N238S	N	-	2	0	0	PREX1	46758275	46758275	1.000000	0.71417	0.970000	0.41538	0.997000	0.91878	7.698000	0.84413	2.147000	0.66899	0.533000	0.62120	AAT	0.661654		TCGA-LB-A7SX-01A-11D-A33T-08	0.627	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	1	0	1		2	2	2	0	0	0	0	158	0	158	156	1	1.650000	-20.000000	1	0.640000	NM_020820		0	438	432	0	934	917	1	0	1	1		0	0	158	0	0	1.000000	9.095388e-01	0	4	0	7	0	438	934
ZNF217	7764	broad.mit.edu	37	20	52192921	52192921	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr20:52192921C>T	ENST00000371471.2	-	4	2807	c.2382G>A	c.(2380-2382)caG>caA	p.Q794Q	ZNF217_ENST00000302342.3_Silent_p.Q794Q|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	794					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CAGGAGGGCTCTGCTTCCCCT	0.562																																						ENST00000371471.2	1.000000	8.600000e-01	1	9.300000e-01	0.990000	0.977937	0.990000	1.000000																										0				50						c.(2380-2382)caG>caA		zinc finger protein 217							46.0	46.0	46.0					20																	52192921		2203	4300	6503	SO:0001819	synonymous_variant	7764	0	0					g.chr20:52192921C>T	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2382G>A	chr20.hg19:g.52192921C>T		0					RP4-724E16.2_ENST00000424252.1_RNA|ZNF217_ENST00000302342.3_Silent_p.Q794Q	p.Q794Q			2	2	4	2.378692	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)	4	2807	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	1	1	hg19	c.2382G>A	CCDS13443.1	1																																																																																								0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.562	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	1	0	1		2	2	2	0	0	0	0	70	0	70	66	1	1.650000	-20.000000	1	0.640000	NM_006526		0	140	140	0	319	318	1	0	1	1		0	0	70	0	0	1.000000	9.996587e-01	0	8	0	22	0	140	319
TMPRSS15	5651	broad.mit.edu	37	21	19666604	19666604	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr21:19666604G>A	ENST00000284885.3	-	21	2502	c.2469C>T	c.(2467-2469)gcC>gcT	p.A823A		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	823	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CGCAGTGTGCGGCGGACACCA	0.582																																						ENST00000284885.3	0.430000	2.500000e-01	3.900000e-01	2.900000e-01	0.340000	0.348718	0.340000	0.340000																										0				85						c.(2467-2469)gcC>gcT		transmembrane protease, serine 15							60.0	60.0	60.0					21																	19666604		2203	4300	6503	SO:0001819	synonymous_variant	5651	1	121410	29				g.chr21:19666604G>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2469C>T	chr21.hg19:g.19666604G>A		1						p.A823A	NM_002772.2	NP_002763	0	1	1	1.505065	P98073	ENTK_HUMAN		21	2502	-			Q2NKL7	Silent	SNP	ENST00000284885.3	1	1	hg19	c.2469C>T	CCDS13571.1	0																																																																																								0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.582	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	0	0	1		2	2	2	1	0	1	0	65	0	65	65	1	1.650000	-3.164906	1	0.640000	NM_002772		0	49	49	0	254	250	1	0	1			1	0	65	0	0	1.000000	0	0	0	0	0	0	49	254
B3GALT5	10317	broad.mit.edu	37	21	41032648	41032648	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr21:41032648G>A	ENST00000380620.4	+	5	754	c.162G>A	c.(160-162)caG>caA	p.Q54Q	B3GALT5_ENST00000380618.1_Silent_p.Q54Q|B3GALT5_ENST00000398714.2_Silent_p.Q54Q|B3GALT5_ENST00000343118.4_Silent_p.Q54Q|AF064860.5_ENST00000416555.1_RNA			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	54					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				ACTGCAGGCAGACACCTCCCT	0.502																																						ENST00000380620.4	0.700000	4.700000e-01	6.500000e-01	5.300000e-01	0.580000	0.594281	0.580000	0.590000																										0				16						c.(160-162)caG>caA		UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5							88.0	80.0	83.0					21																	41032648		2203	4300	6503	SO:0001819	synonymous_variant	10317	0	0					g.chr21:41032648G>A	AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.162G>A	chr21.hg19:g.41032648G>A		0					B3GALT5_ENST00000398714.2_Silent_p.Q54Q|B3GALT5_ENST00000343118.4_Silent_p.Q54Q|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000380618.1_Silent_p.Q54Q	p.Q54Q			0	0	0	2.078603	Q9Y2C3	B3GT5_HUMAN		5	754	+		Prostate(19;2.55e-06)	A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Silent	SNP	ENST00000380620.4	1	1	hg19	c.162G>A	CCDS13667.1	0																																																																																								0.610052		TCGA-LB-A7SX-01A-11D-A33T-08	0.502	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195008.2	1	0	1		2	2	2	0	0	0	0	74	0	74	73	1	1.650000	-20.000000	1	0.640000	NM_033170		0	84	84	0	326	323	1	0	1	1		0	0	74	0	0	1.000000	9.454756e-01	0	10	0	11	0	84	326
MCM3AP	8888	broad.mit.edu	37	21	47686068	47686068	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr21:47686068C>T	ENST00000397708.1	-	12	3056	c.2802G>A	c.(2800-2802)ctG>ctA	p.L934L	MCM3AP_ENST00000291688.1_Silent_p.L934L			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	934	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CAGACCGGTTCAGCTCCACAC	0.567																																						ENST00000397708.1	0.120000	5.000000e-02	1.000000e-01	6.000000e-02	0.080000	0.089021	0.080000	0.090000																										0				72						c.(2800-2802)ctG>ctA		minichromosome maintenance complex component 3 associated protein							151.0	163.0	159.0					21																	47686068		2203	4300	6503	SO:0001819	synonymous_variant	8888	0	0					g.chr21:47686068C>T	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2802G>A	chr21.hg19:g.47686068C>T		0					MCM3AP_ENST00000291688.1_Silent_p.L934L	p.L934L			0	0	0	2.053198	O60318	GANP_HUMAN		12	3056	-	Breast(49;0.112)		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	1	1	hg19	c.2802G>A	CCDS13734.1	0																																																																																								0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.567	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	0	0	1		2	2	2	0	0	0	0	195	0	195	193	1	1.650000	-2.902265	1	0.640000	NM_003906		0	36	38	0	1144	1132	0	0	1	1		0	0	195	0	0	1.000000	7.427446e-01	0	8	0	78	0	36	1144
IGLL5	100423062	broad.mit.edu	37	22	23237723	23237723	+	Missense_Mutation	SNP	A	A	C	rs569843724		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			A	C	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr22:23237723A>C	ENST00000526893.1	+	3	768	c.494A>C	c.(493-495)aAa>aCa	p.K165T	IGLJ1_ENST00000390320.2_RNA|IGLL5_ENST00000531372.1_3'UTR|IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.K166T	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	165	C region (By similarity to lambda light- chain).|Ig-like C1-type.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GAGACCACCAAACCCTCCAAA	0.602													N|||	1	0.000199681	0.0008	0.0	5008	,	,		13346	0.0		0.0	False		,,,				2504	0.0					ENST00000526893.1			0	0																														0				7						c.(493-495)aAa>aCa		immunoglobulin lambda-like polypeptide 5							89.0	90.0	90.0					22																	23237723		2202	4295	6497	SO:0001583	missense	100423062	25	121348	42				g.chr22:23237723A>C	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.494A>C	chr22.hg19:g.23237723A>C	ENSP00000431254:p.Lys165Thr						IGLL5_ENST00000532223.2_Missense_Mutation_p.K166T|IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000531372.1_3'UTR|IGLJ1_ENST00000390320.2_RNA	p.K165T	NM_001178126.1	NP_001171597.1					B9A064	IGLL5_HUMAN		3	768	+				Missense_Mutation	SNP	ENST00000526893.1	0	1	hg19	c.494A>C	CCDS54506.1		.	.	.	.	.	.	.	.	.	.	C	0.004	-2.289688	0.00248	.	.	ENSG00000254709	ENST00000532223;ENST00000526893	T;T	0.00603	6.28;6.28	3.54	-2.51	0.06365	3.54	-2.51	0.06365	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.728791	0.12593	N	0.455429	T	0.00241	0.0007	.	.	.	0.09310	N	0.999998	B	0.06786	0.001	B	0.15052	0.012	T	0.40098	-0.9581	9	0.02654	T	1	.	2.1258	0.03738	0.4304:0.2973:0.1611:0.1113	.	165	B9A064	IGLL5_HUMAN	T	166;165	ENSP00000436353:K166T;ENSP00000431254:K165T	ENSP00000431254:K165T	K	+	2	0	0	IGLL5	21567723	21567723	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.399000	0.07250	-1.086000	0.03084	-5.509000	0.00000	AAA			TCGA-LB-A7SX-01A-11D-A33T-08	0.602	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	0	0	0		2	2	2	0	0	0	0	29	0	29	29	1	1.650000	-11.295330	1	0.640000	NM_001178126		0	11	4	0	383	383	0	0	1	0		0	0	29	0	0	0.998216	1	0	1	0	2707	0	11	383
SEZ6L	23544	broad.mit.edu	37	22	26688941	26688941	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr22:26688941G>A	ENST00000248933.6	+	2	759	c.664G>A	c.(664-666)Ggg>Agg	p.G222R	SEZ6L_ENST00000360929.3_Missense_Mutation_p.G222R|SEZ6L_ENST00000529632.2_Missense_Mutation_p.G222R|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000404234.3_Missense_Mutation_p.G222R|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000343706.4_Missense_Mutation_p.G222R			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	222					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.G222K(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GCCAGAACCCGGGGAGCCTGG	0.642																																						ENST00000248933.6	0.130000	4.000000e-02	1.100000e-01	6.000000e-02	0.080000	0.089489	0.080000	0.090000																										1	Substitution - Missense(1)	p.G222K(1)	skin(1)	80						c.(664-666)Ggg>Agg		seizure related 6 homolog (mouse)-like							34.0	39.0	38.0					22																	26688941		2198	4298	6496	SO:0001583	missense	23544	12	121392	41				g.chr22:26688941G>A	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.664G>A	chr22.hg19:g.26688941G>A	ENSP00000248933:p.Gly222Arg	1					SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000360929.3_Missense_Mutation_p.G222R|SEZ6L_ENST00000404234.3_Missense_Mutation_p.G222R|SEZ6L_ENST00000343706.4_Missense_Mutation_p.G222R|SEZ6L_ENST00000529632.2_Missense_Mutation_p.G222R|SEZ6L_ENST00000402979.1_5'UTR	p.G222R			0	1	1	1.690318	Q9BYH1	SE6L1_HUMAN		2	759	+			A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	1	1	hg19	c.664G>A	CCDS13833.1	0	.	.	.	.	.	.	.	.	.	.	G	11.14	1.552259	0.27739	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.26373	1.98;2.1;2.18;1.98;1.74	4.21	3.17	0.36434	4.21	3.17	0.36434	.	0.807228	0.10049	U	0.722474	T	0.16085	0.0387	N	0.14661	0.345	0.09310	N	0.999994	B;B;B;B;B;B	0.28667	0.047;0.047;0.219;0.219;0.01;0.01	B;B;B;B;B;B	0.22880	0.013;0.008;0.042;0.042;0.003;0.003	T	0.19386	-1.0307	10	0.36615	T	0.2	.	12.2	0.54319	0.0:0.3302:0.6698:0.0	.	222;222;222;222;222;222	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	R	222	ENSP00000384772:G222R;ENSP00000437037:G222R;ENSP00000354185:G222R;ENSP00000248933:G222R;ENSP00000342661:G222R	ENSP00000248933:G222R	G	+	1	0	0	SEZ6L	25018941	25018941	0.138000	0.22547	0.016000	0.15963	0.054000	0.15201	0.882000	0.28186	0.870000	0.35726	0.405000	0.27470	GGG	0.470588		TCGA-LB-A7SX-01A-11D-A33T-08	0.642	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3	0	0	1		2	2	2	0	0	0	0	88	0	88	87	1	1.650000	-2.529767	1	0.640000			0	18	17	0	430	423	0	0	1			0	0	88	0	0	0.999979	0	0	0	0	0	0	18	430
EIF3D	8664	broad.mit.edu	37	22	36915498	36915498	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr22:36915498C>T	ENST00000216190.8	-	8	1035	c.665G>A	c.(664-666)cGc>cAc	p.R222H	EIF3D_ENST00000541106.1_Missense_Mutation_p.R173H|EIF3D_ENST00000405442.1_Missense_Mutation_p.R222H	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						GTGGAAGATGCGCTTGATGCT	0.567																																						ENST00000216190.8	1.000000	8.000000e-01	1	8.600000e-01	0.920000	0.929541	0.920000	1.000000																										0				15						c.(664-666)cGc>cAc		eukaryotic translation initiation factor 3, subunit D							267.0	214.0	232.0					22																	36915498		2203	4300	6503	SO:0001583	missense	8664	0	0					g.chr22:36915498C>T	U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.665G>A	chr22.hg19:g.36915498C>T	ENSP00000216190:p.Arg222His	1					EIF3D_ENST00000541106.1_Missense_Mutation_p.R173H|EIF3D_ENST00000405442.1_Missense_Mutation_p.R222H	p.R222H	NM_003753.3	NP_003744.1	2	2	4	2.428286				8	1035	-				Missense_Mutation	SNP	ENST00000216190.8	1	1	hg19	c.665G>A	CCDS13930.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.693888	0.96793	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442;ENST00000455547	.	.	.	6.04	6.04	0.98038	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.85788	0.5778	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.976;0.99	D	0.86823	0.2006	9	0.72032	D	0.01	0.1102	20.5792	0.99380	0.0:1.0:0.0:0.0	.	173;222	B4DVY1;O15371	.;EIF3D_HUMAN	H	222;207;173;222;222	.	ENSP00000216190:R222H	R	-	2	0	0	EIF3D	35245444	35245444	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.419000	0.80179	2.873000	0.98535	0.561000	0.74099	CGC	0.665676		TCGA-LB-A7SX-01A-11D-A33T-08	0.567	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319026.1	1	0	1		2	2	2	0	0	0	0	76	0	76	76	1	1.650000	-20.000000	1	0.640000			0	159	159	0	420	416	1	0	1	1		0	0	76	0	0	1.000000	1	0	289	0	389	0	159	420
PHF5A	84844	broad.mit.edu	37	22	41863571	41863571	+	Missense_Mutation	SNP	G	G	C	rs569271036		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr22:41863571G>C	ENST00000216252.3	-	3	195	c.124C>G	c.(124-126)Ctg>Gtg	p.L42V	ACO2_ENST00000216254.4_5'Flank|PHF5A_ENST00000491254.1_5'UTR|ACO2_ENST00000396512.3_5'Flank	NM_032758.3	NP_116147.1	Q7RTV0	PHF5A_HUMAN	PHD finger protein 5A	42					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|U12-type spliceosomal complex (GO:0005689)|U2 snRNP (GO:0005686)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						ATGCGCACCAGAGTGCAGGGA	0.493																																					Ovarian(15;130 571 1826 2981 46141)	ENST00000216252.3	1.000000	2.000000e-02	1.000000e-01	3.000000e-02	0.060000	0.155533	0.060000	0.060000																										0				4						c.(124-126)Ctg>Gtg		PHD finger protein 5A							113.0	97.0	102.0					22																	41863571		2203	4300	6503	SO:0001583	missense	84844	0	0					g.chr22:41863571G>C	BC007321	CCDS14016.1	22q13.2	2014-02-14			ENSG00000100410	ENSG00000100410		"""Zinc fingers, PHD-type"""	18000	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 7"""					12054543, 12234937, 18076038	Standard	NM_032758		Approved	MGC1346, SF3b14b, INI, bK223H9.2, Rds3, SAP14b, SF3B7	uc003bab.3	Q7RTV0	OTTHUMG00000150966	ENST00000216252.3:c.124C>G	chr22.hg19:g.41863571G>C	ENSP00000216252:p.Leu42Val	1					PHF5A_ENST00000491254.1_5'UTR|ACO2_ENST00000396512.3_5'Flank|ACO2_ENST00000216254.4_5'Flank	p.L42V	NM_032758.3	NP_116147.1	2	2	4	2.428428	Q7RTV0	PHF5A_HUMAN		3	195	-			Q9UH06	Missense_Mutation	SNP	ENST00000216252.3	0	1	hg19	c.124C>G	CCDS14016.1	0	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064935	0.55432	.	.	ENSG00000100410	ENST00000216252	.	.	.	5.54	4.53	0.55603	5.54	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.72353	2.195	0.80722	D	1	B	0.30664	0.289	B	0.40940	0.344	T	0.65957	-0.6042	9	0.41790	T	0.15	-12.734	11.3569	0.49621	0.1449:0.0:0.8551:0.0	.	42	Q7RTV0	PHF5A_HUMAN	V	42	.	ENSP00000216252:L42V	L	-	1	2	2	PHF5A	40193517	40193517	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.705000	0.54823	1.476000	0.48215	0.655000	0.94253	CTG	0.665676		TCGA-LB-A7SX-01A-11D-A33T-08	0.493	PHF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320686.1	0	0	1		2	2	2	0	0	0	0	57	0	57	57	1	1.650000	-6.536546	1	0.640000	NM_032758		0	7	7	0	404	404	0	0	1	1		0	0	57	0	0	0.980810	8.260086e-01	0	9	0	178	0	7	404
CERK	64781	broad.mit.edu	37	22	47087589	47087589	+	Silent	SNP	G	G	T	rs201852137		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr22:47087589G>T	ENST00000216264.8	-	11	1324	c.1212C>A	c.(1210-1212)ccC>ccA	p.P404P	CERK_ENST00000471929.1_5'UTR|CERK_ENST00000541677.1_Silent_p.P206P	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	404					ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)			cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGAGGCCCCTGGGGCTCCGGC	0.557													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17513	0.0		0.0	False		,,,				2504	0.0					ENST00000216264.8	1.000000	6.100000e-01	1	6.900000e-01	0.790000	0.825973	0.790000	0.760000																										0				20						c.(1210-1212)ccC>ccA		ceramide kinase							49.0	46.0	47.0					22																	47087589		2202	4300	6502	SO:0001819	synonymous_variant	64781	3	121408	34				g.chr22:47087589G>T	AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.1212C>A	chr22.hg19:g.47087589G>T		1					CERK_ENST00000471929.1_5'UTR|CERK_ENST00000541677.1_Silent_p.P206P	p.P404P	NM_022766.5	NP_073603.2	2	2	4	2.923040	Q8TCT0	CERK1_HUMAN		11	1324	-		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Silent	SNP	ENST00000216264.8	1	1	hg19	c.1212C>A	CCDS14077.1	0																																																																																								0.728589		TCGA-LB-A7SX-01A-11D-A33T-08	0.557	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317924.2	1	0	1		2	2	2	0	0	0	0	41	0	41	40	1	1.650000	-3.435703	1	0.640000	NM_022766		0	71	71	0	314	310	1	0	1	1		0	0	41	0	0	1.000000	9.999997e-01	0	41	0	58	0	71	314
ZBED4	9889	broad.mit.edu	37	22	50279764	50279764	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr22:50279764C>T	ENST00000216268.5	+	2	2931	c.2454C>T	c.(2452-2454)aaC>aaT	p.N818N		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	818						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AGACGCTGAACGAGGGGGAGC	0.622																																						ENST00000216268.5	1.000000	6.000000e-02	2.300000e-01	1.000000e-01	0.150000	0.219025	0.150000	0.150000																										0				44						c.(2452-2454)aaC>aaT		zinc finger, BED-type containing 4							38.0	38.0	38.0					22																	50279764		2203	4299	6502	SO:0001819	synonymous_variant	9889	6	116610	33				g.chr22:50279764C>T	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2454C>T	chr22.hg19:g.50279764C>T		0						p.N818N	NM_014838.2	NP_055653.2	2	2	4	2.375485	O75132	ZBED4_HUMAN		2	2931	+		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)	B2RZH1|Q1ECU0|Q9UGG8	Silent	SNP	ENST00000216268.5	1	1	hg19	c.2454C>T	CCDS33677.1	0																																																																																								0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.622	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	1	0	1		2	2	2	0	0	0	0	26	0	26	26	1	1.650000	-10.991430	1	0.640000	NM_014838		0	8	8	0	178	178	0	0	1	1		0	0	26	0	0	0.989846	5.997546e-01	0	3	0	41	0	8	178
AFF3	3899	broad.mit.edu	37	2	100623429	100623429	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:100623429G>T	ENST00000409236.2	-	5	650	c.538C>A	c.(538-540)Cag>Aag	p.Q180K	AFF3_ENST00000409579.1_Missense_Mutation_p.Q205K|AFF3_ENST00000317233.4_Missense_Mutation_p.Q180K|AFF3_ENST00000356421.2_Missense_Mutation_p.Q205K			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	180					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GCCCGAGGCTGCTGTCTGCCA	0.582																																						ENST00000409236.2	0.240000	1.000000e-01	2.000000e-01	1.200000e-01	0.160000	0.167767	0.160000	0.160000																										0				86						c.(538-540)Cag>Aag		AF4/FMR2 family, member 3							48.0	50.0	50.0					2																	100623429		2203	4300	6503	SO:0001583	missense	3899	0	0					g.chr2:100623429G>T	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.538C>A	chr2.hg19:g.100623429G>T	ENSP00000387207:p.Gln180Lys	1					AFF3_ENST00000356421.2_Missense_Mutation_p.Q205K|AFF3_ENST00000409579.1_Missense_Mutation_p.Q205K|AFF3_ENST00000317233.4_Missense_Mutation_p.Q180K	p.Q180K			0	1	1	2.102294	P51826	AFF3_HUMAN		5	650	-			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	1	1	hg19	c.538C>A	CCDS42723.1	0	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375513	0.24857	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	5.36	4.48	0.54585	5.36	4.48	0.54585	.	0.250032	0.28317	N	0.015799	T	0.53077	0.1774	N	0.08118	0	0.26248	N	0.978761	B;B;D;B;B	0.59357	0.425;0.372;0.985;0.425;0.372	B;B;D;B;B	0.73708	0.192;0.085;0.981;0.192;0.121	T	0.48258	-0.9051	10	0.06236	T	0.91	.	8.8744	0.35337	0.0751:0.0:0.7765:0.1484	.	334;334;180;180;205	B7Z4I6;C9JXV5;A8K353;P51826;P51826-2	.;.;.;AFF3_HUMAN;.	K	180;205;205;180;180;334;205	ENSP00000317421:Q180K;ENSP00000348793:Q205K;ENSP00000386834:Q205K;ENSP00000387207:Q180K	ENSP00000317421:Q180K	Q	-	1	0	0	AFF3	99989861	99989861	1.000000	0.71417	0.988000	0.46212	0.886000	0.51366	6.148000	0.71788	1.259000	0.44117	0.585000	0.79938	CAG	0.603175		TCGA-LB-A7SX-01A-11D-A33T-08	0.582	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	1	0	1		2	2	2	0	0	0	0	49	0	49	49	1	1.650000	-19.999960	1	0.640000	NM_002285		0	22	22	0	364	359	0	0	1			0	0	49	0	0	0.999999	0	0	0	0	0	0	22	364
RANBP2	5903	broad.mit.edu	37	2	109367778	109367778	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:109367778G>A	ENST00000283195.6	+	10	1458	c.1332G>A	c.(1330-1332)tgG>tgA	p.W444*		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	444					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						GCTTACAGTGGAATTCATTGC	0.388																																						ENST00000283195.6	0.890000	7.100000e-01	8.500000e-01	7.500000e-01	0.790000	0.804680	0.790000	0.800000																									RANBP2/ALK(34)	0				129						c.(1330-1332)tgG>tgA		RAN binding protein 2							27.0	31.0	30.0					2																	109367778		1439	2642	4081	SO:0001587	stop_gained	5903	0	0					g.chr2:109367778G>A	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.1332G>A	chr2.hg19:g.109367778G>A	ENSP00000283195:p.Trp444*	1						p.W444*	NM_006267.4	NP_006258.3	0	1	1	2.102294	P49792	RBP2_HUMAN		10	1458	+			Q13074|Q15280|Q53TE2|Q59FH7	Nonsense_Mutation	SNP	ENST00000283195.6	0	1	hg19	c.1332G>A	CCDS2079.1	0	.	.	.	.	.	.	.	.	.	.	G	39	7.400347	0.98262	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	.	.	.	5.08	5.08	0.68730	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.6229	18.8314	0.92141	0.0:0.0:1.0:0.0	.	.	.	.	X	444	.	ENSP00000283195:W444X	W	+	3	0	0	RANBP2	108734210	108734210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.957000	0.93082	2.521000	0.84997	0.650000	0.86243	TGG	0.603175		TCGA-LB-A7SX-01A-11D-A33T-08	0.388	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	0	0	1		2	2	2	0	0	0	0	134	0	134	175	1	1.650000	-20.000000	1	0.640000	NM_006267		0	222	65	0	561	115	0	0	1	0		0	0	134	0	0	1.000000	3.198684e-01	0	0	0	4	0	222	561
NCKAP5	344148	broad.mit.edu	37	2	133887563	133887563	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:133887563G>T	ENST00000409261.1	-	6	701	c.328C>A	c.(328-330)Cag>Aag	p.Q110K	NCKAP5_ENST00000409213.1_Missense_Mutation_p.Q110K|NCKAP5_ENST00000405974.3_Missense_Mutation_p.Q110K|NCKAP5_ENST00000317721.6_Missense_Mutation_p.Q110K	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	110										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GAGAACTGCTGCTGCAAGCTA	0.488																																						ENST00000409261.1	1.000000	5.000000e-01	8.800000e-01	6.100000e-01	0.740000	0.752593	0.740000	1.000000																										0				118						c.(328-330)Cag>Aag		NCK-associated protein 5							91.0	91.0	91.0					2																	133887563		2010	4181	6191	SO:0001583	missense	344148	0	0					g.chr2:133887563G>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.328C>A	chr2.hg19:g.133887563G>T	ENSP00000387128:p.Gln110Lys	1					NCKAP5_ENST00000317721.6_Missense_Mutation_p.Q110K|NCKAP5_ENST00000405974.3_Missense_Mutation_p.Q110K|NCKAP5_ENST00000409213.1_Missense_Mutation_p.Q110K	p.Q110K	NM_207363.2	NP_997246.2	0	1	1	2.096084	O14513	NCKP5_HUMAN		6	701	-			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	1	1	hg19	c.328C>A	CCDS46418.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.69|15.69	2.909250|2.909250	0.52439|0.52439	.|.	.|.	ENSG00000176771|ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834|ENST00000427594	T;T;T;T|.	0.44083|.	2.93;0.93;2.93;0.93|.	6.17|6.17	2.06|2.06	0.26882|0.26882	6.17|6.17	2.06|2.06	0.26882|0.26882	.|.	.|.	.|.	.|.	.|.	T|T	0.22513|0.22513	0.0543|0.0543	N|N	0.24115|0.24115	0.695|0.695	0.23120|0.23120	N|N	0.998262|0.998262	B;B;B;B|.	0.29988|.	0.017;0.082;0.264;0.242|.	B;B;B;B|.	0.31101|.	0.031;0.032;0.124;0.055|.	T|T	0.21793|0.21793	-1.0235|-1.0235	9|5	0.49607|.	T|.	0.09|.	.|.	4.4369|4.4369	0.11555|0.11555	0.0791:0.2901:0.4811:0.1497|0.0791:0.2901:0.4811:0.1497	.|.	110;85;110;110|.	F5GYX5;O14513-3;O14513-2;O14513|.	.;.;.;NCKP5_HUMAN|.	K|R	110;110;110;110;110;85|105	ENSP00000387128:Q110K;ENSP00000386952:Q110K;ENSP00000380603:Q110K;ENSP00000385692:Q110K|.	ENSP00000380603:Q110K|.	Q|S	-|-	1|3	0|2	0|2	NCKAP5|NCKAP5	133604033|133604033	133604033|133604033	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.993000|0.993000	0.82548|0.82548	1.743000|1.743000	0.38258|0.38258	0.433000|0.433000	0.26313|0.26313	0.655000|0.655000	0.94253|0.94253	CAG|AGC	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.488	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	1	0	1		2	2	2	0	0	0	0	10	0	10	9	1	1.650000	-20.000000	1	0.640000	NM_207481		0	22	22	0	62	62	1	0	1			0	0	10	0	0	1.000000	0	0	0	0	0	0	22	62
IFIH1	64135	broad.mit.edu	37	2	163144827	163144827	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:163144827C>T	ENST00000263642.2	-	5	1308	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	305					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						AGCTGGAGTTCTGGCTCCGGG	0.478																																						ENST00000263642.2	0.900000	6.400000e-01	8.400000e-01	7.000000e-01	0.760000	0.776669	0.760000	0.770000																										0				39						c.(913-915)Gaa>Aaa		interferon induced with helicase C domain 1							71.0	68.0	69.0					2																	163144827		2203	4300	6503	SO:0001583	missense	64135	0	0					g.chr2:163144827C>T	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.913G>A	chr2.hg19:g.163144827C>T	ENSP00000263642:p.Glu305Lys	1						p.E305K	NM_022168.3	NP_071451.2	0	1	1	2.096084	Q9BYX4	IFIH1_HUMAN		5	1308	-			Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	1	1	hg19	c.913G>A	CCDS2217.1	0	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663722	0.67700	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.53640	0.61	6.03	5.16	0.70880	6.03	5.16	0.70880	DEAD-like helicase (1);	0.117044	0.56097	D	0.000030	T	0.45955	0.1368	L	0.38838	1.175	0.43054	D	0.994663	P	0.48162	0.906	P	0.48738	0.588	T	0.49293	-0.8955	10	0.72032	D	0.01	-17.0742	10.9061	0.47081	0.0:0.8028:0.1295:0.0677	.	305	Q9BYX4	IFIH1_HUMAN	K	305	ENSP00000263642:E305K	ENSP00000263642:E305K	E	-	1	0	0	IFIH1	162853073	162853073	1.000000	0.71417	0.971000	0.41717	0.967000	0.64934	3.203000	0.51075	1.562000	0.49601	0.557000	0.71058	GAA	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.478	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	1	0	1		2	2	2	0	0	0	0	49	0	49	49	1	1.650000	-20.000000	1	0.640000	NM_022168		0	92	92	0	246	246	1	0	1	1		0	0	49	0	0	1.000000	9.999131e-01	0	15	0	25	0	92	246
COL3A1	1281	broad.mit.edu	37	2	189868505	189868505	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:189868505G>A	ENST00000304636.3	+	38	2823	c.2653G>A	c.(2653-2655)Ggt>Agt	p.G885S	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	885	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGGTCCTCCTGGTAGTAATGT	0.363																																						ENST00000304636.3	0.160000	5.000000e-02	1.400000e-01	7.000000e-02	0.100000	0.108683	0.100000	0.100000																										0				126						c.(2653-2655)Ggt>Agt		collagen, type III, alpha 1	Collagenase(DB00048)						136.0	132.0	133.0					2																	189868505		2203	4300	6503	SO:0001583	missense	1281	0	0					g.chr2:189868505G>A	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2653G>A	chr2.hg19:g.189868505G>A	ENSP00000304408:p.Gly885Ser	1					COL3A1_ENST00000317840.5_Intron	p.G885S	NM_000090.3	NP_000081	0	1	1	2.096084	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)	38	2823	+			D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	1	1	hg19	c.2653G>A	CCDS2297.1	0	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087492	0.76642	.	.	ENSG00000168542	ENST00000304636	D	0.99607	-6.27	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.52532	D	0.000071	D	0.99718	0.9891	H	0.97077	3.935	0.80722	D	1	D	0.67145	0.996	D	0.63597	0.916	D	0.97479	1.0046	10	0.87932	D	0	.	13.6693	0.62416	0.0738:0.0:0.9262:0.0	.	885	P02461	CO3A1_HUMAN	S	885	ENSP00000304408:G885S	ENSP00000304408:G885S	G	+	1	0	0	COL3A1	189576750	189576750	1.000000	0.71417	0.983000	0.44433	0.893000	0.52053	7.914000	0.87478	2.590000	0.87494	0.551000	0.68910	GGT	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.363	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	0	0	1		2	2	2	0	0	0	0	47	0	47	47	1	1.650000	-2.879242	1	0.640000	NM_000090		0	14	14	0	376	373	0	0	1	0		0	0	47	0	0	0.999752	9.999997e-01	0	0	0	844	0	14	376
PNKD	25953	broad.mit.edu	37	2	219204548	219204548	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:219204548C>T	ENST00000273077.4	+	3	330	c.279C>T	c.(277-279)taC>taT	p.Y93Y	PNKD_ENST00000258362.3_Silent_p.Y69Y|AC021016.8_ENST00000411433.1_RNA|PNKD_ENST00000436005.2_Silent_p.Y33Y	NM_015488.4	NP_056303.3	Q8N490	PNKD_HUMAN	paroxysmal nonkinesigenic dyskinesia	93					glutathione biosynthetic process (GO:0006750)|neuromuscular process controlling posture (GO:0050884)|regulation of dopamine metabolic process (GO:0042053)|regulation of synaptic transmission, dopaminergic (GO:0032225)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCTCTTCTACCGACAGCAGC	0.607																																						ENST00000273077.4	0.220000	5.000000e-02	1.700000e-01	8.000000e-02	0.120000	0.130200	0.120000	0.120000																										0				10						c.(277-279)taC>taT		paroxysmal nonkinesigenic dyskinesia							56.0	57.0	56.0					2																	219204548		2203	4300	6503	SO:0001819	synonymous_variant	25953	0	0					g.chr2:219204548C>T		CCDS2411.1, CCDS2413.1, CCDS42816.1	2q35	2011-01-21	2007-07-12		ENSG00000127838	ENSG00000127838			9153	protein-coding gene	gene with protein product	"""myofibrillogenesis regulator 1"""	609023	"""paroxysmal nonkinesiogenic dyskinesia"""			8659518	Standard	NM_015488		Approved	DYT8, PDC, DKFZp564N1362, FPD1, MR-1, BRP17, FKSG19, TAHCCP2, KIAA1184, KIPP1184, MGC31943, PKND1	uc002vhn.3	Q8N490	OTTHUMG00000133110	ENST00000273077.4:c.279C>T	chr2.hg19:g.219204548C>T		1					AC021016.8_ENST00000411433.1_RNA|PNKD_ENST00000436005.2_Silent_p.Y33Y|PNKD_ENST00000258362.3_Silent_p.Y69Y	p.Y93Y	NM_015488.4	NP_056303.3	0	1	1	2.096084	Q8N490	PNKD_HUMAN		3	330	+		Renal(207;0.0474)	A8K1F2|Q96A48|Q9BU26|Q9NSX4|Q9ULN6|Q9Y4T1	Silent	SNP	ENST00000273077.4	1	1	hg19	c.279C>T	CCDS2411.1	0																																																																																								0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.607	PNKD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256775.2	1	0	1		2	2	2	0	0	0	0	22	0	22	21	1	1.650000	-10.443830	1	0.640000			0	8	8	0	186	186	1	0	1	1		0	0	22	0	0	0.989822	3.488304e-01	0	6	0	21	0	8	186
ARMC9	80210	broad.mit.edu	37	2	232104753	232104753	+	Splice_Site	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:232104753C>T	ENST00000349938.4	+	9	1072	c.878C>T	c.(877-879)aCg>aTg	p.T293M	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	293						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		AGGCCTGGGACGGTGAGGCTC	0.522																																						ENST00000349938.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999256	0.990000	1.000000																										0				22						c.(877-879)aCg>aTg		armadillo repeat containing 9							57.0	46.0	50.0					2																	232104753		2203	4300	6503	SO:0001630	splice_region_variant	80210	8	121410	33				g.chr2:232104753C>T	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.879+1C>T	chr2.hg19:g.232104753C>T		1					ARMC9_ENST00000483477.1_3'UTR	p.T293M	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	0	1	1	2.096084	Q7Z3E5	ARMC9_HUMAN		9	1072	+		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Splice_Site	SNP	ENST00000349938.4	1	0	hg19	c.878C>T	CCDS2484.1	1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.581425	0.65992	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000444285	T;T	0.45276	2.08;0.9	5.03	5.03	0.67393	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.62986	0.2473	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.66148	-0.5996	10	0.62326	D	0.03	-19.4815	16.518	0.84306	0.0:1.0:0.0:0.0	.	293	Q7Z3E5	ARMC9_HUMAN	M	293;293;47	ENSP00000258417:T293M;ENSP00000407146:T47M	ENSP00000258417:T293M	T	+	2	0	0	ARMC9	231812997	231812997	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.989000	0.76219	2.309000	0.77851	0.561000	0.74099	ACG	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.522	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	1	0	1		2	2	2	0	0	0	0	19	0	19	19	1	1.650000	-20.000000	1	0.640000	NM_025139	Missense_Mutation	0	50	49	0	61	60	0	0	1	1		0	0	19	0	0	1.000000	9.983015e-01	0	6	0	10	0	50	61
SPDYA	245711	broad.mit.edu	37	2	29052132	29052132	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:29052132C>T	ENST00000334056.5	+	6	688	c.499C>T	c.(499-501)Ctc>Ttc	p.L167F	SPDYA_ENST00000379579.4_Missense_Mutation_p.L167F|SPDYA_ENST00000462832.1_3'UTR	NM_182756.3	NP_877433.2			speedy/RINGO cell cycle regulator family member A											cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					AAGGGACCAGCTCTGGGATAG	0.348																																						ENST00000334056.5	0.130000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.077331	0.060000	0.070000																										0				9						c.(499-501)Ctc>Ttc		speedy/RINGO cell cycle regulator family member A							65.0	69.0	68.0					2																	29052132		2203	4300	6503	SO:0001583	missense	245711	0	0					g.chr2:29052132C>T	AA424209	CCDS1767.2	2p23	2013-05-08	2013-05-08	2006-03-31	ENSG00000163806	ENSG00000163806		"""Speedy homologs"""	30613	protein-coding gene	gene with protein product		614029	"""speedy homolog 1 (Drosophila)"", ""speedy homolog A (Xenopus laevis)"""	SPDY1		11980914, 12839962, 15611625	Standard	NM_182756		Approved	SPY1, Ringo3	uc002rmk.3	Q5MJ70	OTTHUMG00000074041	ENST00000334056.5:c.499C>T	chr2.hg19:g.29052132C>T	ENSP00000335628:p.Leu167Phe	0					SPDYA_ENST00000462832.1_3'UTR|SPDYA_ENST00000379579.4_Missense_Mutation_p.L167F	p.L167F	NM_182756.3	NP_877433.2	0	0	0	2.096230				6	688	+	Acute lymphoblastic leukemia(172;0.155)			Missense_Mutation	SNP	ENST00000334056.5	0	1	hg19	c.499C>T	CCDS1767.2	0	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978601	0.53720	.	.	ENSG00000163806	ENST00000379579;ENST00000334056	.	.	.	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.096409	0.43579	U	0.000554	T	0.62295	0.2416	N	0.25031	0.7	0.58432	D	0.999999	D;D	0.67145	0.996;0.995	P;P	0.61477	0.889;0.823	T	0.59852	-0.7376	9	0.32370	T	0.25	0.5219	19.4215	0.94723	0.0:1.0:0.0:0.0	.	167;167	Q5MJ70;Q5MJ70-1	SPDYA_HUMAN;.	F	167	.	ENSP00000335628:L167F	L	+	1	0	0	SPDYA	28905636	28905636	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.309000	0.59135	2.664000	0.90586	0.563000	0.77884	CTC	0.612737		TCGA-LB-A7SX-01A-11D-A33T-08	0.348	SPDYA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157171.1	0	0	1		2	2	2	0	0	0	0	56	0	56	56	1	1.650000	-3.482211	1	0.640000	NM_182756		0	9	9	0	364	363	0	0	1	0		0	0	56	0	0	0.994285	7.801418e-04	0	0	0	2	0	9	364
EIF2AK2	5610	broad.mit.edu	37	2	37365423	37365423	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:37365423G>A	ENST00000233057.4	-	8	999	c.677C>T	c.(676-678)tCg>tTg	p.S226L	EIF2AK2_ENST00000395127.2_Missense_Mutation_p.S226L|EIF2AK2_ENST00000405334.1_Missense_Mutation_p.S226L	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	226					activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				CATAAGCAACGAAGAACTGTT	0.358																																						ENST00000233057.4	0.300000	1.300000e-01	2.600000e-01	1.700000e-01	0.210000	0.218403	0.210000	0.210000																										0				22						c.(676-678)tCg>tTg		eukaryotic translation initiation factor 2-alpha kinase 2							121.0	122.0	122.0					2																	37365423		2203	4300	6503	SO:0001583	missense	5610	1	121410	30				g.chr2:37365423G>A	BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.677C>T	chr2.hg19:g.37365423G>A	ENSP00000233057:p.Ser226Leu	1					EIF2AK2_ENST00000395127.2_Missense_Mutation_p.S226L|EIF2AK2_ENST00000405334.1_Missense_Mutation_p.S226L	p.S226L	NM_001135651.2	NP_001129123.1	0	1	1	2.090964	P19525	E2AK2_HUMAN		8	999	-		all_hematologic(82;0.248)	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Missense_Mutation	SNP	ENST00000233057.4	1	1	hg19	c.677C>T	CCDS1786.1	0	.	.	.	.	.	.	.	.	.	.	G	9.576	1.122371	0.20877	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334;ENST00000379156	T;T;T	0.76448	-0.99;-0.99;-1.02	2.93	-0.132	0.13489	2.93	-0.132	0.13489	.	2.710630	0.01408	N	0.013874	T	0.75102	0.3804	M	0.71581	2.175	0.09310	N	1	B;B;B;B	0.14805	0.011;0.011;0.003;0.003	B;B;B;B	0.09377	0.004;0.002;0.002;0.002	T	0.45101	-0.9284	10	0.26408	T	0.33	0.431	6.4738	0.22024	0.3144:0.0:0.6856:0.0	.	226;226;226;226	Q8IW76;B7ZKK7;P19525;E9PC80	.;.;E2AK2_HUMAN;.	L	226	ENSP00000233057:S226L;ENSP00000378559:S226L;ENSP00000385014:S226L	ENSP00000233057:S226L	S	-	2	0	0	EIF2AK2	37218927	37218927	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.674000	0.05233	-0.052000	0.13311	0.557000	0.71058	TCG	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.358	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2	1	0	1		2	2	2	0	0	0	0	40	0	40	40	1	1.650000	-3.017760	1	0.640000	NM_002759		0	24	24	0	299	294	0	0	1	0		0	0	40	0	0	1.000000	7.584051e-01	0	1	0	35	0	24	299
SMYD5	10322	broad.mit.edu	37	2	73451115	73451115	+	Missense_Mutation	SNP	T	T	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:73451115T>G	ENST00000389501.4	+	10	969	c.924T>G	c.(922-924)ttT>ttG	p.F308L		NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	308	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						CTGGCCTCTTTGTGCTTCAGA	0.478																																						ENST00000389501.4	0.400000	2.600000e-01	3.700000e-01	2.900000e-01	0.330000	0.337908	0.330000	0.330000																										0				13						c.(922-924)ttT>ttG		SMYD family member 5							230.0	209.0	216.0					2																	73451115		2203	4300	6503	SO:0001583	missense	10322	0	0					g.chr2:73451115T>G	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.924T>G	chr2.hg19:g.73451115T>G	ENSP00000374152:p.Phe308Leu	1						p.F308L	NM_006062.2	NP_006053.2	0	1	1	2.090964	Q6GMV2	SMYD5_HUMAN		10	969	+			D6W5H3|Q13558	Missense_Mutation	SNP	ENST00000389501.4	1	1	hg19	c.924T>G	CCDS33221.2	0	.	.	.	.	.	.	.	.	.	.	T	17.98	3.521334	0.64747	.	.	ENSG00000135632	ENST00000389501	T	0.81415	-1.49	4.77	2.14	0.27477	4.77	2.14	0.27477	SET domain (2);	0.218148	0.48767	D	0.000176	T	0.73125	0.3547	L	0.45581	1.43	0.40606	D	0.981624	B	0.29481	0.245	B	0.35182	0.197	T	0.70594	-0.4829	10	0.66056	D	0.02	-8.2184	6.1113	0.20102	0.0:0.5224:0.0:0.4776	.	308	Q6GMV2	SMYD5_HUMAN	L	308	ENSP00000374152:F308L	ENSP00000374152:F308L	F	+	3	2	2	SMYD5	73304623	73304623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.888000	0.28268	0.815000	0.34398	0.533000	0.62120	TTT	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.478	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	1	0	1		2	2	2	0	0	0	0	114	0	114	114	1	1.650000	-20.000000	1	0.640000	NM_006062		0	84	83	0	629	626	1	0	1	1		0	0	114	0	0	1.000000	9.989949e-01	0	15	0	62	0	84	629
DGUOK	1716	broad.mit.edu	37	2	74154141	74154141	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:74154141G>A	ENST00000264093.4	+	1	189	c.104G>A	c.(103-105)gGg>gAg	p.G35E	DGUOK_ENST00000356837.6_Missense_Mutation_p.G35E|DGUOK_ENST00000348222.1_Missense_Mutation_p.G35E|DGUOK_ENST00000462685.1_3'UTR	NM_080916.2	NP_550438.1	Q16854	DGUOK_HUMAN	deoxyguanosine kinase	35					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|dGTP metabolic process (GO:0046070)|guanosine metabolic process (GO:0008617)|negative regulation of neuron projection development (GO:0010977)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein phosphorylation (GO:0006468)|purine deoxyribonucleoside metabolic process (GO:0046122)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxyguanosine kinase activity (GO:0004138)|nucleoside kinase activity (GO:0019206)			endometrium(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	8					Nelarabine(DB01280)	CTGCACGCGGGGCGCGGGCCC	0.672																																						ENST00000264093.4	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.043006	0.030000	0.040000																										0				8						c.(103-105)gGg>gAg		deoxyguanosine kinase	Nelarabine(DB01280)						35.0	38.0	37.0					2																	74154141		2203	4299	6502	SO:0001583	missense	1716	0	0					g.chr2:74154141G>A	U41668	CCDS1931.1, CCDS1932.1	2p13	2008-02-05			ENSG00000114956	ENSG00000114956	2.7.1.113		2858	protein-coding gene	gene with protein product		601465					Standard	NM_080916		Approved	dGK	uc002sjx.3	Q16854	OTTHUMG00000129819	ENST00000264093.4:c.104G>A	chr2.hg19:g.74154141G>A	ENSP00000264093:p.Gly35Glu	1					DGUOK_ENST00000356837.6_Missense_Mutation_p.G35E|DGUOK_ENST00000348222.1_Missense_Mutation_p.G35E|DGUOK_ENST00000462685.1_3'UTR	p.G35E	NM_080916.2	NP_550438.1	0	1	1	2.090964	Q16854	DGUOK_HUMAN		1	189	+			P78532|Q16759|Q4ZG09|Q7L1W9|Q96BC1	Missense_Mutation	SNP	ENST00000264093.4	0	1	hg19	c.104G>A	CCDS1931.1	0	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016699	0.54468	.	.	ENSG00000114956	ENST00000264093;ENST00000348222;ENST00000356837;ENST00000347161	D;D;D	0.99832	-5.27;-4.72;-7.02	4.19	1.14	0.20703	4.19	1.14	0.20703	.	0.757041	0.13116	N	0.412588	D	0.98438	0.9480	L	0.38838	1.175	0.24671	N	0.99342	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	D	0.99942	1.1420	10	0.07175	T	0.84	-3.3064	5.3436	0.15996	0.4514:0.0:0.5486:0.0	.	35;35	E5KSL6;Q16854	.;DGUOK_HUMAN	E	35	ENSP00000264093:G35E;ENSP00000306964:G35E;ENSP00000349294:G35E	ENSP00000264093:G35E	G	+	2	0	0	DGUOK	74007649	74007649	0.784000	0.28713	0.720000	0.30636	0.681000	0.39784	0.699000	0.25586	0.222000	0.20900	0.655000	0.94253	GGG	0.604569		TCGA-LB-A7SX-01A-11D-A33T-08	0.672	DGUOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252050.1	0	0	0		2	2	2	0	0	0	0	61	0	61	60	1	1.650000	-5.032479	1	0.640000			0	6	6	0	454	446	0	0	1	1		0	0	61	0	0	0.963254	8.522890e-01	0	6	0	258	0	6	454
INPP4A	3631	broad.mit.edu	37	2	99169316	99169316	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:99169316G>A	ENST00000523221.1	+	13	1246	c.1246G>A	c.(1246-1248)Gcc>Acc	p.A416T	INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409540.3_Missense_Mutation_p.A416T|INPP4A_ENST00000545415.1_Missense_Mutation_p.A416T|INPP4A_ENST00000409016.4_Missense_Mutation_p.A416T|INPP4A_ENST00000074304.5_Missense_Mutation_p.A416T|INPP4A_ENST00000409851.3_Missense_Mutation_p.A411T			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	416					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GGAGATCATCGCCCAGATCAA	0.517																																						ENST00000523221.1	0.280000	7.000000e-02	2.200000e-01	1.100000e-01	0.150000	0.169347	0.150000	0.150000																										0				43						c.(1246-1248)Gcc>Acc		inositol polyphosphate-4-phosphatase, type I, 107kDa							80.0	77.0	78.0					2																	99169316		2005	4167	6172	SO:0001583	missense	3631	0	0					g.chr2:99169316G>A	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1246G>A	chr2.hg19:g.99169316G>A	ENSP00000427722:p.Ala416Thr	1					INPP4A_ENST00000545415.1_Missense_Mutation_p.A416T|INPP4A_ENST00000409851.3_Missense_Mutation_p.A411T|INPP4A_ENST00000409540.3_Missense_Mutation_p.A416T|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409016.4_Missense_Mutation_p.A416T|INPP4A_ENST00000074304.5_Missense_Mutation_p.A416T	p.A416T			0	1	1	2.102294	Q96PE3	INP4A_HUMAN		13	1246	+			O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	0	1	hg19	c.1246G>A	CCDS46369.1	0	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847369	0.91277	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17	5.03	5.03	0.67393	5.03	5.03	0.67393	.	0.054882	0.64402	D	0.000001	T	0.25644	0.0624	L	0.40543	1.245	0.54753	D	0.999988	D;D;D;D	0.58268	0.959;0.978;0.982;0.982	B;B;P;P	0.47864	0.357;0.378;0.559;0.559	T	0.00790	-1.1565	10	0.36615	T	0.2	-24.8771	17.5362	0.87832	0.0:0.0:1.0:0.0	.	416;416;416;411	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	T	416;411;416;416;416;416	ENSP00000386704:A416T;ENSP00000386777:A411T;ENSP00000074304:A416T;ENSP00000442149:A416T;ENSP00000387294:A416T;ENSP00000427722:A416T	ENSP00000074304:A416T	A	+	1	0	0	INPP4A	98535748	98535748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.492000	0.81482	2.608000	0.88229	0.655000	0.94253	GCC	0.603175		TCGA-LB-A7SX-01A-11D-A33T-08	0.517	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	1	0	1		2	2	2	0	0	0	0	15	0	15	15	1	1.650000	-4.455787	1	0.640000	NM_001566		0	8	8	0	140	140	0	0	1	0		0	0	15	0	0	0.989996	5.558005e-01	0	1	0	31	0	8	140
SH3BP4	23677	broad.mit.edu	37	2	235949825	235949825	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr2:235949825G>A	ENST00000409212.1	+	4	919	c.412G>A	c.(412-414)Gag>Aag	p.E138K	SH3BP4_ENST00000392011.2_Missense_Mutation_p.E138K|SH3BP4_ENST00000344528.4_Missense_Mutation_p.E138K			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	138					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGTAGCCAAGGAGCTGGAGCT	0.507																																						ENST00000409212.1	0.410000	2.300000e-01	3.700000e-01	2.700000e-01	0.310000	0.325962	0.310000	0.320000																										0				44						c.(412-414)Gag>Aag		SH3-domain binding protein 4							86.0	85.0	85.0					2																	235949825		2203	4300	6503	SO:0001583	missense	23677	0	0					g.chr2:235949825G>A	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.412G>A	chr2.hg19:g.235949825G>A	ENSP00000386862:p.Glu138Lys	1					SH3BP4_ENST00000392011.2_Missense_Mutation_p.E138K|SH3BP4_ENST00000344528.4_Missense_Mutation_p.E138K	p.E138K			0	1	1	2.029684	Q9P0V3	SH3B4_HUMAN		4	919	+		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	1	1	hg19	c.412G>A	CCDS2513.1	0	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080730	0.76528	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000409212;ENST00000344528;ENST00000446904	T;T;T;T	0.34275	2.74;2.74;2.74;1.37	5.39	5.39	0.77823	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.50411	0.1614	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.72338	0.977;0.977	T	0.49485	-0.8935	10	0.54805	T	0.06	-0.3903	17.7288	0.88371	0.0:0.0:1.0:0.0	.	138;138	A8K594;Q9P0V3	.;SH3B4_HUMAN	K	138	ENSP00000375867:E138K;ENSP00000386862:E138K;ENSP00000340237:E138K;ENSP00000415391:E138K	ENSP00000340237:E138K	E	+	1	0	0	SH3BP4	235614564	235614564	1.000000	0.71417	0.953000	0.39169	0.031000	0.12232	9.549000	0.98106	2.519000	0.84933	0.655000	0.94253	GAG	0.601770		TCGA-LB-A7SX-01A-11D-A33T-08	0.507	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1	0	0	1		2	2	2	0	0	0	0	67	0	67	66	1	1.650000	-20.000000	1	0.640000			0	45	45	0	351	346	1	0	1	1		0	0	67	0	0	1.000000	9.960359e-01	0	17	0	51	0	45	351
ATP2B2	491	broad.mit.edu	37	3	10442753	10442753	+	Missense_Mutation	SNP	A	A	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:10442753A>G	ENST00000352432.4	-	4	734	c.665T>C	c.(664-666)cTc>cCc	p.L222P	ATP2B2_ENST00000397077.1_Missense_Mutation_p.L222P|ATP2B2_ENST00000383800.4_Missense_Mutation_p.L222P|ATP2B2_ENST00000360273.2_Missense_Mutation_p.L222P|ATP2B2_ENST00000343816.4_Missense_Mutation_p.L222P			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	222					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GTCGGCAGGGAGGAGGTCACC	0.567																																					Ovarian(125;1619 1709 15675 19819 38835)	ENST00000352432.4	0.160000	3.000000e-02	1.300000e-01	5.000000e-02	0.080000	0.095423	0.080000	0.080000																										0				74						c.(664-666)cTc>cCc		ATPase, Ca++ transporting, plasma membrane 2							70.0	66.0	67.0					3																	10442753		2203	4300	6503	SO:0001583	missense	491	0	0					g.chr3:10442753A>G	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.665T>C	chr3.hg19:g.10442753A>G	ENSP00000324172:p.Leu222Pro	1					ATP2B2_ENST00000397077.1_Missense_Mutation_p.L222P|ATP2B2_ENST00000383800.4_Missense_Mutation_p.L222P|ATP2B2_ENST00000360273.2_Missense_Mutation_p.L222P|ATP2B2_ENST00000343816.4_Missense_Mutation_p.L222P	p.L222P			0	1	1	1.597415	Q01814	AT2B2_HUMAN		4	734	-			O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	1	1	hg19	c.665T>C	CCDS33701.1	0	.	.	.	.	.	.	.	.	.	.	A	22.6	4.314875	0.81358	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76;-2.76;-2.76	5.6	5.6	0.85130	5.6	5.6	0.85130	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.95516	0.8543	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	D	0.96098	0.9067	10	0.87932	D	0	-32.0976	15.7913	0.78367	1.0:0.0:0.0:0.0	.	222;234;222	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	P	222;222;222;222;222;188;109;222	ENSP00000324172:L222P;ENSP00000373311:L222P;ENSP00000380267:L222P;ENSP00000353414:L222P;ENSP00000344677:L222P;ENSP00000414854:L109P	ENSP00000342954:L222P	L	-	2	0	0	ATP2B2	10417753	10417753	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.313000	0.96297	2.124000	0.65301	0.528000	0.53228	CTC	0.470588		TCGA-LB-A7SX-01A-11D-A33T-08	0.567	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	0	0	1		2	2	2	0	0	0	0	31	0	31	30	1	1.650000	-9.546685	1	0.640000	NM_001683		0	7	7	0	168	165	0	0	1			0	0	31	0	0	0.980068	0	0	0	0	0	0	7	168
CD96	10225	broad.mit.edu	37	3	111286413	111286413	+	Missense_Mutation	SNP	G	G	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:111286413G>C	ENST00000283285.5	+	3	593	c.462G>C	c.(460-462)gaG>gaC	p.E154D	CD96_ENST00000352690.4_Missense_Mutation_p.E154D|CD96_ENST00000438817.2_Missense_Mutation_p.E154D	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	154					cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TAGAAATAGAGATAAATCAGA	0.368									Opitz Trigonocephaly syndrome																													ENST00000283285.5	0.270000	8.000000e-02	2.100000e-01	1.100000e-01	0.150000	0.171535	0.150000	0.160000																										0				35						c.(460-462)gaG>gaC		CD96 molecule							98.0	90.0	93.0					3																	111286413		2203	4300	6503	SO:0001583	missense	10225	0	0		Opitz Trigonocephaly syndrome	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	g.chr3:111286413G>C	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.462G>C	chr3.hg19:g.111286413G>C	ENSP00000283285:p.Glu154Asp	0					CD96_ENST00000438817.2_Missense_Mutation_p.E154D|CD96_ENST00000352690.4_Missense_Mutation_p.E154D	p.E154D	NM_198196.2	NP_937839.1	1	2	3	2.293641	P40200	TACT_HUMAN		3	593	+			Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	1	1	hg19	c.462G>C	CCDS2959.1	0	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628223	0.28978	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.66099	1.65;-0.19;1.65	5.37	2.35	0.29111	5.37	2.35	0.29111	Immunoglobulin subtype (1);	0.968819	0.08496	N	0.937108	T	0.42381	0.1200	L	0.27053	0.805	0.20563	N	0.999889	P;P;P;B	0.37781	0.608;0.557;0.608;0.421	B;B;B;B	0.34242	0.115;0.178;0.115;0.086	T	0.21895	-1.0232	10	0.19590	T	0.45	-0.5288	4.485	0.11785	0.2025:0.1855:0.6119:0.0	.	154;154;154;154	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	D	154	ENSP00000342040:E154D;ENSP00000283285:E154D;ENSP00000389801:E154D	ENSP00000283285:E154D	E	+	3	2	2	CD96	112769103	112769103	1.000000	0.71417	0.973000	0.42090	0.941000	0.58515	2.051000	0.41307	0.812000	0.34326	-0.157000	0.13467	GAG	0.642289		TCGA-LB-A7SX-01A-11D-A33T-08	0.368	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2	1	0	1		2	2	2	0	0	0	0	41	0	41	41	1	1.650000	-15.416020	1	0.640000			0	13	13	0	254	248	0	0	1	0		0	0	41	0	0	0.999500	4.983202e-02	0	0	0	7	0	13	254
GPR156	165829	broad.mit.edu	37	3	119962536	119962536	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:119962536G>A	ENST00000464295.1	-	3	629	c.184C>T	c.(184-186)Ctg>Ttg	p.L62L	GPR156_ENST00000461057.1_Silent_p.L62L|GPR156_ENST00000315843.3_Silent_p.L62L			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		AGTATCAGCAGAAGTCCACAG	0.428																																						ENST00000464295.1	1.000000	9.300000e-01	1	9.900000e-01	0.990000	0.994216	0.990000	1.000000																										0				32						c.(184-186)Ctg>Ttg		G protein-coupled receptor 156							127.0	115.0	119.0					3																	119962536		2203	4300	6503	SO:0001819	synonymous_variant	165829	0	0					g.chr3:119962536G>A	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.184C>T	chr3.hg19:g.119962536G>A		0					GPR156_ENST00000461057.1_Silent_p.L62L|GPR156_ENST00000315843.3_Silent_p.L62L	p.L62L			1	2	3	2.277020	Q8NFN8	GP156_HUMAN		3	629	-			B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Silent	SNP	ENST00000464295.1	1	1	hg19	c.184C>T	CCDS2997.1	1																																																																																								0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.428	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	1	0	1		2	2	2	0	0	0	0	57	0	57	57	1	1.650000	-20.000000	1	0.640000	NM_153002		0	178	176	0	348	343	1	0	1	0		0	0	57	0	0	1.000000	0	0	1	0	0	0	178	348
STXBP5L	9515	broad.mit.edu	37	3	120957910	120957910	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:120957910T>C	ENST00000273666.6	+	13	1548	c.1277T>C	c.(1276-1278)aTt>aCt	p.I426T	STXBP5L_ENST00000472879.1_Missense_Mutation_p.I426T|STXBP5L_ENST00000471454.1_Missense_Mutation_p.I426T|STXBP5L_ENST00000497029.1_Missense_Mutation_p.I426T|STXBP5L_ENST00000492541.1_Missense_Mutation_p.I426T	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	426					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CCGGATTTGATTCTAGTACTG	0.313																																						ENST00000273666.6	0.200000	4.000000e-02	1.500000e-01	7.000000e-02	0.100000	0.113059	0.100000	0.100000																										0				68						c.(1276-1278)aTt>aCt		syntaxin binding protein 5-like							53.0	50.0	51.0					3																	120957910		1834	4093	5927	SO:0001583	missense	9515	0	0					g.chr3:120957910T>C	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1277T>C	chr3.hg19:g.120957910T>C	ENSP00000273666:p.Ile426Thr	0					STXBP5L_ENST00000497029.1_Missense_Mutation_p.I426T|STXBP5L_ENST00000492541.1_Missense_Mutation_p.I426T|STXBP5L_ENST00000471454.1_Missense_Mutation_p.I426T|STXBP5L_ENST00000472879.1_Missense_Mutation_p.I426T	p.I426T	NM_014980.2	NP_055795.1	1	2	3	2.277020	Q9Y2K9	STB5L_HUMAN		13	1548	+			Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	1	1	hg19	c.1277T>C	CCDS43137.1	0	.	.	.	.	.	.	.	.	.	.	T	14.61	2.586545	0.46110	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.39229	1.78;1.78;1.58;1.09;1.58;1.79	4.97	4.97	0.65823	4.97	4.97	0.65823	WD40 repeat-like-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.64997	1.995	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.83275	0.996;0.996	T	0.64381	-0.6421	10	0.59425	D	0.04	-30.5866	14.8108	0.69994	0.0:0.0:0.0:1.0	.	426;426	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	T	426	ENSP00000273666:I426T;ENSP00000420019:I426T;ENSP00000419627:I426T;ENSP00000420287:I426T;ENSP00000420666:I426T;ENSP00000420167:I426T	ENSP00000273666:I426T	I	+	2	0	0	STXBP5L	122440600	122440600	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	7.827000	0.86722	2.088000	0.63022	0.533000	0.62120	ATT	0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.313	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3	0	0	1		2	2	2	0	0	0	0	31	0	31	31	1	1.650000	-9.775703	1	0.640000			0	8	8	0	239	239	0	0	1			0	0	31	0	0	0.989701	0	0	0	0	0	0	8	239
ADCY5	111	broad.mit.edu	37	3	123010065	123010065	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:123010065G>A	ENST00000462833.1	-	18	4434	c.3222C>T	c.(3220-3222)ttC>ttT	p.F1074F	ADCY5_ENST00000491190.1_Silent_p.F732F|ADCY5_ENST00000309879.5_Silent_p.F724F	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1074	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.F1074L(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGATGGAGGCGAACATGACCG	0.577																																						ENST00000462833.1	0.740000	4.900000e-01	6.800000e-01	5.500000e-01	0.610000	0.618607	0.610000	0.620000																										1	Substitution - Missense(1)	p.F1074L(1)	lung(1)	60						c.(3220-3222)ttC>ttT		adenylate cyclase 5							101.0	80.0	87.0					3																	123010065		2203	4300	6503	SO:0001819	synonymous_variant	111	0	0					g.chr3:123010065G>A	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3222C>T	chr3.hg19:g.123010065G>A		0					ADCY5_ENST00000309879.5_Silent_p.F724F|ADCY5_ENST00000491190.1_Silent_p.F732F	p.F1074F	NM_183357.2	NP_899200.1	1	2	3	2.277020	O95622	ADCY5_HUMAN		18	4434	-			B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	1	1	hg19	c.3222C>T	CCDS3022.1	0																																																																																								0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.577	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	1	0	1		2	2	2	0	0	0	0	61	0	61	61	1	1.650000	-3.474703	1	0.640000	XM_171048		0	81	81	0	332	330	1	0	1	0		0	0	61	0	0	1.000000	9.807758e-01	0	1	0	27	0	81	332
ADCY5	111	broad.mit.edu	37	3	123021988	123021988	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:123021988G>A	ENST00000462833.1	-	14	3850	c.2638C>T	c.(2638-2640)Cac>Tac	p.H880Y	ADCY5_ENST00000491190.1_Missense_Mutation_p.H513Y|ADCY5_ENST00000309879.5_Missense_Mutation_p.H530Y	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	880					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TCCGCCACGTGACACGCGTTG	0.642																																						ENST00000462833.1	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.060000	0.076866	0.060000	0.060000																										0				60						c.(2638-2640)Cac>Tac		adenylate cyclase 5							57.0	51.0	53.0					3																	123021988		2203	4300	6503	SO:0001583	missense	111	0	0					g.chr3:123021988G>A	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2638C>T	chr3.hg19:g.123021988G>A	ENSP00000419361:p.His880Tyr	0					ADCY5_ENST00000309879.5_Missense_Mutation_p.H530Y|ADCY5_ENST00000491190.1_Missense_Mutation_p.H513Y	p.H880Y	NM_183357.2	NP_899200.1	1	2	3	2.277020	O95622	ADCY5_HUMAN		14	3850	-			B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	0	1	hg19	c.2638C>T	CCDS3022.1	0	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819575	0.32145	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.066645	0.64402	D	0.000016	T	0.44074	0.1276	M	0.61703	1.905	0.48135	D	0.999599	B;B	0.14438	0.01;0.001	B;B	0.10450	0.005;0.001	T	0.47045	-0.9147	10	0.02654	T	1	.	18.5817	0.91174	0.0:0.0:1.0:0.0	.	880;513	O95622;B3KWA8	ADCY5_HUMAN;.	Y	880;513;530;439	ENSP00000419361:H880Y;ENSP00000418537:H513Y;ENSP00000308685:H530Y;ENSP00000420082:H439Y	ENSP00000308685:H530Y	H	-	1	0	0	ADCY5	124504678	124504678	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	7.719000	0.84751	2.619000	0.88677	0.561000	0.74099	CAC	0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.642	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	0	0	1		2	2	2	0	0	0	0	30	0	30	30	1	1.650000	-7.222277	1	0.640000	XM_171048		0	6	6	0	277	275	0	0	1	0		0	0	30	0	0	0.964652	2.618954e-02	0	0	0	10	0	6	277
XRN1	54464	broad.mit.edu	37	3	142142485	142142485	+	Splice_Site	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:142142485C>T	ENST00000264951.4	-	6	745		c.e6-1		XRN1_ENST00000392981.2_Splice_Site|XRN1_ENST00000544157.1_Splice_Site|XRN1_ENST00000463916.1_Splice_Site	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CAAGCATAATCTGTTGAAAAA	0.279																																						ENST00000264951.4	0.790000	4.800000e-01	7.100000e-01	5.500000e-01	0.620000	0.634935	0.620000	0.630000																										0				61						c.e6-1		5'-3' exoribonuclease 1							81.0	77.0	78.0					3																	142142485		2200	4300	6500	SO:0001630	splice_region_variant	54464	0	0					g.chr3:142142485C>T	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.628-1G>A	chr3.hg19:g.142142485C>T		0					XRN1_ENST00000463916.1_Splice_Site|XRN1_ENST00000544157.1_Splice_Site|XRN1_ENST00000392981.2_Splice_Site		NM_019001.3	NP_061874.3	1	2	3	2.277020	Q8IZH2	XRN1_HUMAN		6	745	-			Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Splice_Site	SNP	ENST00000264951.4	1	1	hg19		CCDS3123.1	0	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363755	0.82353	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000477237	.	.	.	5.52	5.52	0.82312	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4475	0.94854	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	XRN1	143625175	143625175	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.568000	0.82369	2.609000	0.88269	0.460000	0.39030	.	0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.279	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	1	0	1		2	2	2	0	0	0	0	33	0	33	32	1	1.650000	-20.000000	1	0.640000	NM_019001	Intron	0	54	54	0	215	215	1	0	1			0	0	33	0	0	1.000000	0	0	0	0	0	0	54	215
ECT2	1894	broad.mit.edu	37	3	172480552	172480552	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:172480552C>A	ENST00000392692.3	+	10	1137	c.961C>A	c.(961-963)Ctt>Att	p.L321I	ECT2_ENST00000417960.1_Missense_Mutation_p.L289I|ECT2_ENST00000232458.5_Missense_Mutation_p.L290I|ECT2_ENST00000427830.1_Missense_Mutation_p.L290I|ECT2_ENST00000540509.1_Missense_Mutation_p.L321I|ECT2_ENST00000441497.2_Missense_Mutation_p.L290I	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	321	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			AGTAAAAGATCTTCCCTTTGA	0.333																																						ENST00000392692.3	1.000000	8.600000e-01	1	9.400000e-01	0.990000	0.980082	0.990000	1.000000																										0				37						c.(961-963)Ctt>Att		epithelial cell transforming 2							97.0	99.0	98.0					3																	172480552		2203	4299	6502	SO:0001583	missense	1894	0	0					g.chr3:172480552C>A	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.961C>A	chr3.hg19:g.172480552C>A	ENSP00000376457:p.Leu321Ile	0					ECT2_ENST00000417960.1_Missense_Mutation_p.L289I|ECT2_ENST00000232458.5_Missense_Mutation_p.L290I|ECT2_ENST00000427830.1_Missense_Mutation_p.L290I|ECT2_ENST00000441497.2_Missense_Mutation_p.L290I|ECT2_ENST00000540509.1_Missense_Mutation_p.L321I	p.L321I	NM_001258315.1	NP_001245244.1	1	2	3	2.277020	Q9H8V3	ECT2_HUMAN	Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)	10	1137	+	Ovarian(172;0.00197)|Breast(254;0.158)		Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	1	1	hg19	c.961C>A	CCDS58860.1	1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769443	0.31320	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	5.84	3.99	0.46301	5.84	3.99	0.46301	BRCT (2);	0.123450	0.53938	D	0.000041	T	0.71600	0.3359	L	0.43701	1.375	0.52099	D	0.999947	B;B;B;B	0.16166	0.0;0.016;0.008;0.001	B;B;B;B	0.19666	0.005;0.026;0.017;0.012	T	0.63184	-0.6694	10	0.31617	T	0.26	-13.9281	8.7265	0.34471	0.3898:0.5435:0.0:0.0666	.	321;321;290;289	Q9H8V3;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.	I	290;321;290;289;290;321	ENSP00000232458:L290I;ENSP00000376457:L321I;ENSP00000401910:L290I;ENSP00000415876:L289I;ENSP00000412259:L290I;ENSP00000443160:L321I	ENSP00000232458:L290I	L	+	1	0	0	ECT2	173963246	173963246	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.884000	0.48562	0.744000	0.32741	-0.282000	0.10007	CTT	0.641148		TCGA-LB-A7SX-01A-11D-A33T-08	0.333	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	1	0	1		2	2	2	0	0	0	0	37	0	37	37	1	1.650000	-20.000000	1	0.640000	NM_018098		0	104	102	0	213	212	1	0	1	1		0	0	37	0	0	1.000000	9.999156e-01	0	15	0	17	0	104	213
CHL1	10752	broad.mit.edu	37	3	367698	367698	+	Missense_Mutation	SNP	G	G	A	rs150837773		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:367698G>A	ENST00000256509.2	+	4	790	c.148G>A	c.(148-150)Gat>Aat	p.D50N	CHL1_ENST00000397491.2_Missense_Mutation_p.D50N	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTTTCCCTTCGATGAGTATTT	0.333																																						ENST00000256509.2			0	0																														0				93						c.(148-150)Gat>Aat		cell adhesion molecule L1-like		G	ASN/ASP	0,4404		0,0,2202	86.0	87.0	87.0		148	5.7	0.9	3	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense	CHL1	NM_006614.2	23	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	50/1225	367698	1,13003	2202	4300	6502	SO:0001583	missense	10752	3	121370	37				g.chr3:367698G>A	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.148G>A	chr3.hg19:g.367698G>A	ENSP00000256509:p.Asp50Asn						CHL1_ENST00000397491.2_Missense_Mutation_p.D50N	p.D50N	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2					Q96FC9	DDX11_HUMAN		4	790	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	1	1	hg19	c.148G>A	CCDS2556.1		.	.	.	.	.	.	.	.	.	.	G	26.3	4.724427	0.89298	0.0	1.16E-4	ENSG00000134121	ENST00000256509;ENST00000397491;ENST00000427688;ENST00000421198;ENST00000435603;ENST00000449294	T;T;T;T;T;D	0.95885	-0.27;-0.27;0.19;-0.27;-0.27;-3.84	5.67	5.67	0.87782	5.67	5.67	0.87782	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.182770	0.46145	D	0.000309	D	0.96719	0.8929	L	0.45744	1.44	0.53688	D	0.999976	D;D;D	0.89917	0.992;1.0;1.0	P;D;D	0.87578	0.808;0.998;0.995	D	0.96379	0.9280	10	0.45353	T	0.12	.	17.9886	0.89162	0.0:0.0:1.0:0.0	.	50;50;50	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	N	50	ENSP00000256509:D50N;ENSP00000380628:D50N;ENSP00000403311:D50N;ENSP00000413628:D50N;ENSP00000397445:D50N;ENSP00000390440:D50N	ENSP00000256509:D50N	D	+	1	0	0	CHL1	342698	342698	1.000000	0.71417	0.950000	0.38849	0.738000	0.42128	7.870000	0.87175	2.669000	0.90835	0.551000	0.68910	GAT			TCGA-LB-A7SX-01A-11D-A33T-08	0.333	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	1	0	1		2	2	2	0	0	0	0	47	0	47	47	1	1.650000	-3.092964	1	0.640000	NM_006614		0	7	7	0	212	209	0	0	1	0		0	0	47	0	0	0.980147	0	0	0	0	1	0	7	212
CTNNB1	1499	broad.mit.edu	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)	ENST00000349496.5	1.000000	8.500000e-01	1	9.100000e-01	0.960000	0.959743	0.960000	1.000000	T41A(CCK81_LARGE_INTESTINE)	15		Dom	yes			Dom	yes		3	3p22-p21.3	3p22-p21.3	1499	H, Mis, T	"""catenin (cadherin-associated protein), beta 1"""				"""E, M, O"""	E, M, O	PLAG1		colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma	CTNNB1/PLAG1(60)	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	3893						c.(121-123)Acc>Gcc		catenin (cadherin-associated protein), beta 1, 88kDa							89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	0	0		Pilomatrixoma, Familial Clustering of	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	g.chr3:41266124A>G	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	chr3.hg19:g.41266124A>G	ENSP00000344456:p.Thr41Ala	1					CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	p.T41A	NM_001904.3	NP_001895.1	0	1	1	1.608223	P35222	CTNB1_HUMAN		3	401	+			A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	1	1	hg19	c.121A>G	CCDS2694.1	1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	0	CTNNB1	41241128	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	1	0	1		2	2	2	0	0	0	0	37	0	37	36	1	1.650000	-20.000000	1	0.640000	NM_001098210		0	106	104	0	114	114	1	0	1	1		0	0	37	0	0	1.000000	1	0	219	0	67	0	106	114
SCAP	22937	broad.mit.edu	37	3	47455391	47455391	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:47455391C>T	ENST00000265565.5	-	23	4205	c.3793G>A	c.(3793-3795)Gag>Aag	p.E1265K	SCAP_ENST00000441517.2_Missense_Mutation_p.E1009K|SCAP_ENST00000545718.1_Missense_Mutation_p.E872K	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	1265	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		AGGCTGAGCTCACTGCCAAAG	0.617																																					Pancreas(149;978 1908 29304 37806 46700)	ENST00000265565.5	0.130000	6.000000e-02	1.100000e-01	7.000000e-02	0.090000	0.097126	0.090000	0.100000																										0				26						c.(3793-3795)Gag>Aag		SREBF chaperone							148.0	149.0	149.0					3																	47455391		2203	4300	6503	SO:0001583	missense	22937	0	0					g.chr3:47455391C>T	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.3793G>A	chr3.hg19:g.47455391C>T	ENSP00000265565:p.Glu1265Lys	1					SCAP_ENST00000441517.2_Missense_Mutation_p.E1009K|SCAP_ENST00000545718.1_Missense_Mutation_p.E872K	p.E1265K	NM_012235.2	NP_036367.2	0	1	1	1.608223	Q12770	SCAP_HUMAN		23	4205	-			Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	1	1	hg19	c.3793G>A	CCDS2755.2	0	.	.	.	.	.	.	.	.	.	.	C	33	5.230099	0.95207	.	.	ENSG00000114650	ENST00000339815;ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.81078	-1.45;-1.41;0.74	5.0	5.0	0.66597	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.82061	0.4955	L	0.29908	0.895	0.80722	D	1	D;D	0.65815	0.995;0.985	P;P	0.57152	0.814;0.718	D	0.84115	0.0403	10	0.62326	D	0.03	-31.3009	18.0736	0.89421	0.0:1.0:0.0:0.0	.	1009;1265	F8W921;Q12770	.;SCAP_HUMAN	K	757;891;1265;1009;872	ENSP00000265565:E1265K;ENSP00000416847:E1009K;ENSP00000438956:E872K	ENSP00000265565:E1265K	E	-	1	0	0	SCAP	47430395	47430395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.427000	0.66483	2.596000	0.87737	0.655000	0.94253	GAG	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.617	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	1	0	1		2	2	2	0	0	0	0	209	0	209	208	1	1.650000	-4.718108	1	0.640000	NM_012235		0	44	42	0	942	933	0	0	1	1		0	0	209	0	0	1.000000	9.975529e-01	0	16	0	176	0	44	942
BSN	8927	broad.mit.edu	37	3	49690204	49690204	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:49690204G>A	ENST00000296452.4	+	5	3329	c.3215G>A	c.(3214-3216)cGc>cAc	p.R1072H		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1072					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AGCACGGCCCGCAAGACCCGG	0.652																																						ENST00000296452.4	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.062453	0.050000	0.050000																										0				106						c.(3214-3216)cGc>cAc		bassoon presynaptic cytomatrix protein							34.0	39.0	37.0					3																	49690204		2203	4300	6503	SO:0001583	missense	8927	0	0					g.chr3:49690204G>A	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.3215G>A	chr3.hg19:g.49690204G>A	ENSP00000296452:p.Arg1072His	1						p.R1072H	NM_003458.3	NP_003449.2	0	1	1	1.608223	Q9UPA5	BSN_HUMAN		5	3329	+			O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	0	1	hg19	c.3215G>A	CCDS2800.1	0	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313063	0.60414	.	.	ENSG00000164061	ENST00000296452	T	0.24151	1.87	4.73	4.73	0.59995	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.50257	0.1605	M	0.68952	2.095	0.50171	D	0.999851	D	0.89917	1.0	D	0.71656	0.974	T	0.54476	-0.8288	10	0.72032	D	0.01	.	18.0791	0.89437	0.0:0.0:1.0:0.0	.	1072	Q9UPA5	BSN_HUMAN	H	1072	ENSP00000296452:R1072H	ENSP00000296452:R1072H	R	+	2	0	0	BSN	49665208	49665208	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.807000	0.99171	2.357000	0.79964	0.561000	0.74099	CGC	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.652	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	0	0	0		17	2	2	1	0	1	1	38	0	38	36	1	1.650000	-6.521200	1	0.640000	NM_003458		0	5	4	0	197	193	0	0	0			1	0	38	0	0	0.005750	0	0	0	0	0	0	5	197
PBRM1	55193	broad.mit.edu	37	3	52610715	52610715	+	Splice_Site	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:52610715C>T	ENST00000296302.7	-	22	3535		c.e22-1		PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(6)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTTTCAATTCTTGGGGAGGA	0.343			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	ENST00000296302.7	0.150000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.083432	0.070000	0.070000				Rec	yes			Rec	yes		3	3p21	3p21	55193	Mis, N, F, S, D, O	polybromo 1				E	E			clear cell renal carcinoma, breast		6	Unknown(6)	p.?(6)	kidney(6)	335						c.e22-1		polybromo 1							52.0	51.0	52.0					3																	52610715		2199	4300	6499	SO:0001630	splice_region_variant	55193	0	0					g.chr3:52610715C>T	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3534-1G>A	chr3.hg19:g.52610715C>T		1					PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|SMIM4_ENST00000476842.1_Intron				0	1	1	1.592792	Q86U86	PB1_HUMAN		22	3535	-			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	0	1	hg19			0	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568252	0.86439	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	.	.	.	5.33	5.33	0.75918	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3907	0.94581	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	PBRM1	52585755	52585755	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.720000	0.84759	2.664000	0.90586	0.591000	0.81541	.	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.343	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	0	0	1		2	2	2	0	0	0	0	33	0	33	33	1	1.650000	-8.272936	1	0.640000	NM_018165	Intron	0	6	6	0	170	167	0	0	1		1	0	0	33	459	0	0.963252	0	9.986524e-01	0	19	0	386	6	170
FBXO45	200933	broad.mit.edu	37	3	196304578	196304578	+	Silent	SNP	T	T	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr3:196304578T>C	ENST00000311630.6	+	2	870	c.573T>C	c.(571-573)agT>agC	p.S191S	FBXO45_ENST00000440469.1_Silent_p.S12S	NM_001105573.1	NP_001099043.1	P0C2W1	FBSP1_HUMAN	F-box protein 45	191	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				anterior commissure morphogenesis (GO:0021960)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|corticospinal tract morphogenesis (GO:0021957)|neuron migration (GO:0001764)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|synapse assembly involved in innervation (GO:0060386)	cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	7	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TGCTGGGCAGTGATGACCAGA	0.517																																						ENST00000311630.6	1.000000	7.800000e-01	1	8.800000e-01	0.990000	0.956297	0.990000	1.000000																										0				7						c.(571-573)agT>agC		F-box protein 45							55.0	56.0	56.0					3																	196304578		1969	4162	6131	SO:0001819	synonymous_variant	200933	0	0					g.chr3:196304578T>C	AK025697	CCDS46985.1	3q29	2008-02-05			ENSG00000174013	ENSG00000174013		"""F-boxes /  ""other"""""	29148	protein-coding gene	gene with protein product		609112					Standard	NM_001105573		Approved	Fbx45	uc010iai.3	P0C2W1	OTTHUMG00000155571	ENST00000311630.6:c.573T>C	chr3.hg19:g.196304578T>C		0					FBXO45_ENST00000440469.1_Silent_p.S12S	p.S191S	NM_001105573.1	NP_001099043.1	0	0	0	2.236930	P0C2W1	FBSP1_HUMAN	Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	2	870	+	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		A6NF90|D3DXB5	Silent	SNP	ENST00000311630.6	1	1	hg19	c.573T>C	CCDS46985.1	1																																																																																								0.637681		TCGA-LB-A7SX-01A-11D-A33T-08	0.517	FBXO45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340687.2	1	0	1		2	2	2	0	0	0	0	28	0	28	28	1	1.650000	-20.000000	1	0.640000			0	54	54	0	114	113	1	0	1	1		0	0	28	0	0	1.000000	7.129333e-01	0	2	0	5	0	54	114
TACR3	6870	broad.mit.edu	37	4	104640521	104640521	+	Silent	SNP	G	G	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:104640521G>C	ENST00000304883.2	-	1	452	c.312C>G	c.(310-312)ctC>ctG	p.L104L		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	104					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		AGATGACGATGAGATTTCCCA	0.592																																						ENST00000304883.2	0.220000	9.000000e-02	1.900000e-01	1.200000e-01	0.140000	0.156213	0.140000	0.150000																										0				51						c.(310-312)ctC>ctG		tachykinin receptor 3							114.0	104.0	107.0					4																	104640521		2203	4300	6503	SO:0001819	synonymous_variant	6870	0	0					g.chr4:104640521G>C	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.312C>G	chr4.hg19:g.104640521G>C		1						p.L104L	NM_001059.2	NP_001050.1	0	1	1	2.052406	P29371	NK3R_HUMAN		1	452	-		Hepatocellular(203;0.217)	Q0P510	Silent	SNP	ENST00000304883.2	1	1	hg19	c.312C>G	CCDS3664.1	0																																																																																								0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.592	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	1	0	1		2	2	2	0	0	0	0	67	0	67	62	1	1.650000	-3.142967	1	0.640000	NM_001059		0	24	24	0	411	405	0	0	1			0	0	67	0	0	1.000000	0	0	0	0	0	0	24	411
PAPSS1	9061	broad.mit.edu	37	4	108641321	108641321	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:108641321C>T	ENST00000265174.4	-	1	287	c.15G>A	c.(13-15)ggG>ggA	p.G5G	PAPSS1_ENST00000511304.1_5'UTR	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	5					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		TGCACAGGCTCCCGGGGATCT	0.677																																						ENST00000265174.4	0.830000	6.000000e-01	7.800000e-01	6.600000e-01	0.710000	0.723180	0.710000	0.720000																										0				16						c.(13-15)ggG>ggA		3'-phosphoadenosine 5'-phosphosulfate synthase 1							63.0	58.0	60.0					4																	108641321		2203	4300	6503	SO:0001819	synonymous_variant	9061	0	0					g.chr4:108641321C>T	Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.15G>A	chr4.hg19:g.108641321C>T		1					PAPSS1_ENST00000511304.1_5'UTR	p.G5G	NM_005443.4	NP_005434.4	0	1	1	2.052406	O43252	PAPS1_HUMAN		1	287	-		Hepatocellular(203;0.217)	O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Silent	SNP	ENST00000265174.4	1	1	hg19	c.15G>A	CCDS3676.1	0																																																																																								0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.677	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253946.2	1	0	1		2	2	2	0	0	0	0	61	0	61	60	1	1.650000	-6.166117	1	0.640000			0	115	114	0	321	320	0	0	1	1		0	0	61	0	0	1.000000	1	0	47	0	42	0	115	321
HADH	3033	broad.mit.edu	37	4	108940775	108940775	+	Missense_Mutation	SNP	G	G	A	rs370306695		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:108940775G>A	ENST00000309522.3	+	4	648	c.499G>A	c.(499-501)Gct>Act	p.A167T	HADH_ENST00000403312.1_Missense_Mutation_p.A226T|HADH_ENST00000454409.2_Missense_Mutation_p.A171T|HADH_ENST00000603302.1_Missense_Mutation_p.A167T|HADH_ENST00000505878.1_Missense_Mutation_p.A171T	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	495					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		AGACCGATTCGCTGGCCTCCA	0.498																																						ENST00000309522.3	1.000000	8.800000e-01	1	9.200000e-01	0.970000	0.971177	0.970000	1.000000																										0				15						c.(499-501)Gct>Act		hydroxyacyl-CoA dehydrogenase							165.0	153.0	157.0					4																	108940775		2203	4300	6503	SO:0001583	missense	3033	0	0					g.chr4:108940775G>A	X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.499G>A	chr4.hg19:g.108940775G>A	ENSP00000312288:p.Ala167Thr	1					HADH_ENST00000603302.1_Missense_Mutation_p.A167T|HADH_ENST00000454409.2_Missense_Mutation_p.A171T|HADH_ENST00000505878.1_Missense_Mutation_p.A171T|HADH_ENST00000403312.1_Missense_Mutation_p.A226T	p.A167T	NM_005327.4	NP_005318	0	1	1	2.052406	P40939	ECHA_HUMAN		4	648	+		Hepatocellular(203;0.217)	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000309522.3	1	1	hg19	c.499G>A	CCDS3678.1	1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731123	0.89390	.	.	ENSG00000138796	ENST00000403312;ENST00000309522;ENST00000505878;ENST00000454409	T;T;T	0.76968	-1.06;-1.06;-1.06	5.37	4.53	0.55603	5.37	4.53	0.55603	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.153383	0.56097	D	0.000023	D	0.84370	0.5457	M	0.84846	2.72	0.38132	D	0.938196	P;D;P	0.56035	0.941;0.974;0.953	B;P;P	0.50708	0.419;0.648;0.555	D	0.87171	0.2221	10	0.42905	T	0.14	-16.0779	15.4449	0.75223	0.0:0.0:0.8599:0.1401	.	226;171;167	Q16836-2;E9PF18;Q16836	.;.;HCDH_HUMAN	T	167;167;171;171	ENSP00000312288:A167T;ENSP00000425952:A171T;ENSP00000395167:A171T	ENSP00000312288:A167T	A	+	1	0	0	HADH	109160224	109160224	1.000000	0.71417	0.073000	0.20177	0.941000	0.58515	6.776000	0.75023	1.244000	0.43870	0.655000	0.94253	GCT	0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.498	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254750.2	1	0	1		2	2	2	0	0	0	0	97	0	97	95	1	1.650000	-20.000000	1	0.640000	NM_005327		0	271	267	0	483	475	1	0	1	1		0	0	97	0	0	1.000000	1	0	160	0	146	0	271	483
OTUD4	54726	broad.mit.edu	37	4	146073752	146073752	+	Silent	SNP	T	T	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:146073752T>A	ENST00000447906.2	-	11	1096	c.909A>T	c.(907-909)gcA>gcT	p.A303A	OTUD4_ENST00000455611.2_5'UTR|Y_RNA_ENST00000459374.1_RNA|OTUD4_ENST00000454497.2_Silent_p.A238A			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	303					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					CTTGAACATCTGCATTCAAAA	0.363																																						ENST00000447906.2	0.690000	4.200000e-01	6.300000e-01	4.800000e-01	0.550000	0.559086	0.550000	0.550000																										0				33						c.(907-909)gcA>gcT		OTU deubiquitinase 4							74.0	71.0	72.0					4																	146073752		2203	4300	6503	SO:0001819	synonymous_variant	54726	0	0					g.chr4:146073752T>A		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.909A>T	chr4.hg19:g.146073752T>A		1					Y_RNA_ENST00000459374.1_RNA|OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000454497.2_Silent_p.A238A	p.A303A			0	1	1	2.052406	Q01804	OTUD4_HUMAN		11	1096	-	all_hematologic(180;0.151)		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	1	1	hg19	c.909A>T		0																																																																																								0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.363	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	1	0	1		2	2	2	0	0	0	0	24	0	24	24	1	1.650000	-20.000000	1	0.640000	NM_017493		0	48	48	0	189	186	1	0	1	1		0	0	24	0	0	1.000000	9.504278e-01	0	4	0	18	0	48	189
JAKMIP1	152789	broad.mit.edu	37	4	6107248	6107248	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:6107248G>A	ENST00000282924.5	-	3	1061	c.576C>T	c.(574-576)gaC>gaT	p.D192D	JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409021.3_Silent_p.D192D|JAKMIP1_ENST00000409371.3_Intron|JAKMIP1_ENST00000409831.1_Silent_p.D192D	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	192	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGTGCACCTCGTCTTGGTGCG	0.701																																						ENST00000282924.5	1.000000	7.300000e-01	1	8.500000e-01	0.980000	0.943839	0.980000	1.000000																										0				42						c.(574-576)gaC>gaT		janus kinase and microtubule interacting protein 1							24.0	22.0	23.0					4																	6107248		2201	4298	6499	SO:0001819	synonymous_variant	152789	4	121248	27				g.chr4:6107248G>A	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.576C>T	chr4.hg19:g.6107248G>A		1					JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000409831.1_Silent_p.D192D|JAKMIP1_ENST00000409021.3_Silent_p.D192D|JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409371.3_Intron	p.D192D	NM_144720.3	NP_653321.1	0	1	1	1.983207	Q96N16	JKIP1_HUMAN		3	1061	-			A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	ENST00000282924.5	1	1	hg19	c.576C>T	CCDS3385.1	1																																																																																								0.585635		TCGA-LB-A7SX-01A-11D-A33T-08	0.701	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	1	0	1		2	2	2	0	0	0	0	14	0	14	13	1	1.650000	-20.000000	1	0.640000	NM_144720		0	33	33	0	57	56	1	0	1	0		0	0	14	0	0	1.000000	0	0	0	0	1	0	33	57
PCDH7	5099	broad.mit.edu	37	4	30724130	30724130	+	Missense_Mutation	SNP	G	G	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:30724130G>C	ENST00000361762.2	+	1	2094	c.1086G>C	c.(1084-1086)gaG>gaC	p.E362D	PCDH7_ENST00000543491.1_Missense_Mutation_p.E362D	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	362	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GCCTTGACGAGACGTCCGGCT	0.692																																						ENST00000361762.2	0.110000	2.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.064318	0.050000	0.060000																										0				55						c.(1084-1086)gaG>gaC		protocadherin 7							27.0	31.0	30.0					4																	30724130		2186	4267	6453	SO:0001583	missense	5099	0	0					g.chr4:30724130G>C	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1086G>C	chr4.hg19:g.30724130G>C	ENSP00000355243:p.Glu362Asp	1					PCDH7_ENST00000543491.1_Missense_Mutation_p.E362D	p.E362D	NM_002589.2	NP_002580.2	0	1	1	1.983207	O60245	PCDH7_HUMAN		1	2094	+			O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	0	1	hg19	c.1086G>C	CCDS33971.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.56|11.56	1.676129|1.676129	0.29783|0.29783	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.53640	.|0.61;0.61	5.69|5.69	2.56|2.56	0.30785|0.30785	5.69|5.69	2.56|2.56	0.30785|0.30785	.|Cadherin (5);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.51160|0.51160	0.1658|0.1658	L|L	0.48935|0.48935	1.535|1.535	0.45607|0.45607	D|D	0.998546|0.998546	.|P;P;P	.|0.45212	.|0.823;0.823;0.853	.|P;P;P	.|0.53102	.|0.595;0.595;0.718	T|T	0.43458|0.43458	-0.9390|-0.9390	5|9	.|0.35671	.|T	.|0.21	.|.	11.5739|11.5739	0.50850|0.50850	0.2318:0.0:0.7682:0.0|0.2318:0.0:0.7682:0.0	.|.	.|362;315;362	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	H|D	52|362;362;315	.|ENSP00000355243:E362D;ENSP00000441802:E362D	.|ENSP00000330302:E315D	D|E	+|+	1|3	0|2	0|2	PCDH7|PCDH7	30333228|30333228	30333228|30333228	1.000000|1.000000	0.71417|0.71417	0.961000|0.961000	0.40146|0.40146	0.003000|0.003000	0.03518|0.03518	3.394000|3.394000	0.52551|0.52551	0.742000|0.742000	0.32697|0.32697	-0.136000|-0.136000	0.14681|0.14681	GAC|GAG	0.585635		TCGA-LB-A7SX-01A-11D-A33T-08	0.692	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	0	0	1		2	2	2	0	0	0	0	40	0	40	40	1	1.650000	-7.657125	1	0.640000	NM_032457, NM_002589		0	7	7	0	328	323	0	0	1	1		0	0	40	0	0	0.979825	7.808060e-02	0	2	0	17	0	7	328
ADAMTS3	9508	broad.mit.edu	37	4	73205309	73205309	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:73205309C>T	ENST00000286657.4	-	5	799	c.763G>A	c.(763-765)Gat>Aat	p.D255N		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	255					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATATTGTAATCGTTTTCTCCC	0.498																																					NSCLC(168;1941 2048 2918 13048 43078)	ENST00000286657.4	0.110000	4.000000e-02	9.000000e-02	5.000000e-02	0.070000	0.079041	0.070000	0.080000																										0				76						c.(763-765)Gat>Aat		ADAM metallopeptidase with thrombospondin type 1 motif, 3							286.0	273.0	278.0					4																	73205309		2203	4300	6503	SO:0001583	missense	9508	0	0					g.chr4:73205309C>T	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.763G>A	chr4.hg19:g.73205309C>T	ENSP00000286657:p.Asp255Asn	1						p.D255N	NM_014243.2	NP_055058.2	0	1	1	2.033537	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)	5	799	-			A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	1	1	hg19	c.763G>A	CCDS3553.1	0	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109068	0.56398	.	.	ENSG00000156140	ENST00000286657	T	0.61274	0.12	5.31	5.31	0.75309	5.31	5.31	0.75309	Metallopeptidase, catalytic domain (1);	0.059999	0.64402	D	0.000005	T	0.59128	0.2171	M	0.68593	2.085	0.80722	D	1	B	0.30542	0.284	B	0.28232	0.087	T	0.59836	-0.7379	10	0.48119	T	0.1	.	19.1722	0.93583	0.0:1.0:0.0:0.0	.	255	O15072	ATS3_HUMAN	N	255	ENSP00000286657:D255N	ENSP00000286657:D255N	D	-	1	0	0	ADAMTS3	73424173	73424173	0.998000	0.40836	0.992000	0.48379	0.181000	0.23173	3.879000	0.56138	2.763000	0.94921	0.563000	0.77884	GAT	0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.498	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2	0	0	1		2	2	2	0	0	0	0	189	0	189	188	1	1.650000	-2.439103	0	0.640000			0	32	31	0	1107	1098	0	0	1	0		0	0	189	0	0	1.000000	0	0	0	0	1	0	32	1107
PDGFC	56034	broad.mit.edu	37	4	157689125	157689125	+	Silent	SNP	G	G	A	rs201389930		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr4:157689125G>A	ENST00000502773.1	-	5	1211	c.721C>T	c.(721-723)Cta>Tta	p.L241L	PDGFC_ENST00000504672.1_5'UTR|PDGFC_ENST00000542208.1_Silent_p.L86L|PDGFC_ENST00000422544.2_Silent_p.L241L|PDGFC_ENST00000541126.1_Silent_p.L78L	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	241					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		TCCTCTGTTAGAAGGTTCAGA	0.383																																						ENST00000502773.1	0.150000	6.000000e-02	1.300000e-01	8.000000e-02	0.100000	0.111134	0.100000	0.110000																										0				19						c.(721-723)Cta>Tta		platelet derived growth factor C							143.0	134.0	137.0					4																	157689125		2203	4300	6503	SO:0001819	synonymous_variant	56034	0	0					g.chr4:157689125G>A	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.721C>T	chr4.hg19:g.157689125G>A		1					PDGFC_ENST00000541126.1_Silent_p.L78L|PDGFC_ENST00000542208.1_Silent_p.L86L|PDGFC_ENST00000422544.2_Silent_p.L241L|PDGFC_ENST00000504672.1_5'UTR	p.L241L	NM_016205.2	NP_057289.1	0	1	1	2.052406	Q9NRA1	PDGFC_HUMAN		5	1211	-	all_hematologic(180;0.24)	Renal(120;0.0458)	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Silent	SNP	ENST00000502773.1	1	1	hg19	c.721C>T	CCDS3795.1	0	.	.	.	.	.	.	.	.	.	.	G	8.399	0.841530	0.16963	.	.	ENSG00000145431	ENST00000543489	.	.	.	5.21	5.21	0.72293	5.21	5.21	0.72293	.	.	.	.	.	T	0.74703	0.3751	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73830	-0.3859	5	0.40728	T	0.16	-7.46	18.7512	0.91816	0.0:0.0:1.0:0.0	.	.	.	.	F	155	.	ENSP00000446162:S155F	S	-	2	0	0	PDGFC	157908575	157908575	1.000000	0.71417	0.747000	0.31113	0.955000	0.61496	5.667000	0.68067	2.434000	0.82447	0.655000	0.94253	TCT	0.588665		TCGA-LB-A7SX-01A-11D-A33T-08	0.383	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1	0	0	1		2	2	2	0	0	0	0	111	0	111	109	1	1.650000	-3.260869	1	0.640000			0	28	28	0	683	676	0	0	1	0		0	0	111	0	0	1.000000	5.996003e-01	0	1	0	49	0	28	683
ZDHHC11	79844	broad.mit.edu	37	5	837564	837564	+	Silent	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr5:837564G>T	ENST00000283441.8	-	6	1199	c.816C>A	c.(814-816)ctC>ctA	p.L272L	ZDHHC11_ENST00000424784.2_Silent_p.L272L|ZDHHC11_ENST00000503758.2_5'UTR	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	272						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GGTTATTAATGAGATACTCAA	0.493																																						ENST00000283441.8	1.000000	2.000000e-02	1	4.000000e-02	0.060000	0.289419	0.060000	0.070000																										0				21						c.(814-816)ctC>ctA		zinc finger, DHHC-type containing 11							171.0	199.0	189.0					5																	837564		2203	4300	6503	SO:0001819	synonymous_variant	79844	0	0					g.chr5:837564G>T	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.816C>A	chr5.hg19:g.837564G>T		1					ZDHHC11_ENST00000503758.2_5'UTR|ZDHHC11_ENST00000424784.2_Silent_p.L272L	p.L272L	NM_024786.2	NP_079062.1	1	2	3	2.629439	Q9H8X9	ZDH11_HUMAN	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	6	1199	-			Q6UWR9	Silent	SNP	ENST00000283441.8	0	1	hg19	c.816C>A	CCDS3857.1	0																																																																																								0.684432		TCGA-LB-A7SX-01A-11D-A33T-08	0.493	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206681.3	0	0	1		2	2	2	0	0	0	0	103	0	103	113	1	1.650000	-2.448733	0	0.640000	NM_024786		0	17	16	0	943	930	0	0	1	0		0	0	103	0	0	0.999959	5.238575e-03	0	0	0	6	0	17	943
ADAMTS16	170690	broad.mit.edu	37	5	5182355	5182355	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr5:5182355C>A	ENST00000274181.7	+	4	838	c.700C>A	c.(700-702)Cac>Aac	p.H234N	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.H234N	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	234					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCAACCCCTGCACAGCAGCGA	0.532																																						ENST00000274181.7	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999983	0.990000	1.000000																										0				107						c.(700-702)Cac>Aac		ADAM metallopeptidase with thrombospondin type 1 motif, 16							68.0	73.0	71.0					5																	5182355		2091	4232	6323	SO:0001583	missense	170690	0	0					g.chr5:5182355C>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.700C>A	chr5.hg19:g.5182355C>A	ENSP00000274181:p.His234Asn	1					ADAMTS16_ENST00000511368.1_Missense_Mutation_p.H234N	p.H234N	NM_139056.2	NP_620687.2	1	2	3	2.629439	Q8TE57	ATS16_HUMAN		4	838	+			C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	1	1	hg19	c.700C>A	CCDS43299.1	1	.	.	.	.	.	.	.	.	.	.	C	8.922	0.961376	0.18583	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.61392	0.19;0.11	5.04	-2.03	0.07365	5.04	-2.03	0.07365	.	0.772006	0.11949	N	0.513896	T	0.41627	0.1167	L	0.45581	1.43	0.09310	N	1	B;B;B	0.17038	0.011;0.004;0.02	B;B;B	0.17098	0.011;0.009;0.017	T	0.29488	-1.0010	10	0.15952	T	0.53	.	5.9596	0.19293	0.3613:0.5011:0.0:0.1375	.	234;234;234	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	N	234	ENSP00000274181:H234N;ENSP00000421631:H234N	ENSP00000274181:H234N	H	+	1	0	0	ADAMTS16	5235355	5235355	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.111000	0.15458	-0.120000	0.11809	-0.188000	0.12872	CAC	0.684432		TCGA-LB-A7SX-01A-11D-A33T-08	0.532	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	1	0	1		2	2	2	0	0	0	0	66	0	66	65	1	1.650000	-20.000000	1	0.640000	NM_139056		0	159	159	0	300	299	1	0	1			0	0	66	0	0	1.000000	0	0	0	0	0	0	159	300
MRPS30	10884	broad.mit.edu	37	5	44815301	44815301	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr5:44815301C>T	ENST00000507110.1	+	5	1355	c.1317C>T	c.(1315-1317)aaC>aaT	p.N439N		NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	439					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					TGTTGGAAAACTGAAAAAGCA	0.294																																						ENST00000507110.1	1.000000	5.000000e-02	1	9.000000e-02	0.130000	0.316554	0.130000	0.110000																										0				20						c.(1315-1317)aaC>aaT		mitochondrial ribosomal protein S30							36.0	38.0	37.0					5																	44815301		2203	4297	6500	SO:0001819	synonymous_variant	10884	0	0					g.chr5:44815301C>T	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.1317C>T	chr5.hg19:g.44815301C>T		1						p.N439N	NM_016640.3	NP_057724.2	2	2	4	2.716313	Q9NP92	RT30_HUMAN		5	1355	+	Lung NSC(6;8.08e-07)		Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Silent	SNP	ENST00000507110.1	1	1	hg19	c.1317C>T	CCDS3951.1	0																																																																																								0.702774		TCGA-LB-A7SX-01A-11D-A33T-08	0.294	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	0	0	1		2	2	2	0	0	0	0	32	0	32	32	1	1.650000	-10.146630	1	0.640000	NM_016640		0	9	9	0	277	275	0	0	1	1		0	0	32	0	0	0.994237	8.857023e-01	0	4	0	117	0	9	277
PCDHAC1	56135	broad.mit.edu	37	5	140308195	140308195	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr5:140308195C>T	ENST00000253807.2	+	1	1718	c.1718C>T	c.(1717-1719)tCt>tTt	p.S573F	PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.S573F	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCCCGCTCTGCCAGGACT	0.488																																						ENST00000253807.2	0.080000	1.000000e-02	6.000000e-02	2.000000e-02	0.040000	0.047301	0.040000	0.040000																										0				65						c.(1717-1719)tCt>tTt		protocadherin alpha subfamily C, 1							110.0	115.0	113.0					5																	140308195		2203	4300	6503	SO:0001583	missense	56135	0	0					g.chr5:140308195C>T	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1718C>T	chr5.hg19:g.140308195C>T	ENSP00000253807:p.Ser573Phe	1					PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.S573F|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron	p.S573F	NM_018898.3	NP_061721.2	0	1	1	1.643100	Q9H158	PCDC1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1718	+			Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	0	1	hg19	c.1718C>T	CCDS4241.1	0	.	.	.	.	.	.	.	.	.	.	C	4.946	0.175719	0.09391	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.60920	0.15;0.15	5.95	1.95	0.26073	5.95	1.95	0.26073	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.61400	0.2344	M	0.83483	2.645	0.22226	N	0.999273	B;B	0.31209	0.313;0.043	B;B	0.41236	0.351;0.047	T	0.59101	-0.7517	9	0.49607	T	0.09	.	2.6964	0.05136	0.2432:0.478:0.1188:0.1601	.	573;573	Q9H158;Q9H158-2	PCDC1_HUMAN;.	F	573	ENSP00000386356:S573F;ENSP00000253807:S573F	ENSP00000253807:S573F	S	+	2	0	0	PCDHAC1	140288379	140288379	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.405000	0.21015	0.376000	0.24707	0.563000	0.77884	TCT	0.522293		TCGA-LB-A7SX-01A-11D-A33T-08	0.488	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	0	0	1		2	2	2	0	0	0	0	109	0	109	107	1	1.650000	-2.517518	1	0.640000	NM_018898		0	10	10	0	535	532	0	0	1			0	0	109	0	0	0.996841	0	0	0	0	0	0	10	535
POPDC3	64208	broad.mit.edu	37	6	105609437	105609437	+	Silent	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr6:105609437G>A	ENST00000254765.3	-	2	626	c.348C>T	c.(346-348)ttC>ttT	p.F116F	BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA|BVES-AS1_ENST00000369120.2_RNA|POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369122.3_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	116					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				CCAGGGGCTGGAAAAGGGAGC	0.443																																						ENST00000254765.3	1.000000	9.100000e-01	1	9.400000e-01	0.970000	0.976485	0.970000	1.000000																										0				26						c.(346-348)ttC>ttT		popeye domain containing 3							138.0	148.0	145.0					6																	105609437		2203	4300	6503	SO:0001819	synonymous_variant	64208	0	0					g.chr6:105609437G>A	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.348C>T	chr6.hg19:g.105609437G>A		1					POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369120.2_RNA|BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA	p.F116F	NM_022361.4	NP_071756.2	0	1	1	1.626020	Q9HBV1	POPD3_HUMAN		2	626	-		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)	B2RA98|Q5T3Y8|Q8TBW6	Silent	SNP	ENST00000254765.3	1	1	hg19	c.348C>T	CCDS5052.1	1																																																																																								0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.443	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	1	0	1		2	2	2	0	0	0	0	128	0	128	127	1	1.650000	-20.000000	1	0.640000	NM_022361		0	316	314	0	354	351	1	0	1	1		0	0	128	0	0	1.000000	4.576972e-01	0	3	0	0	0	316	354
FAM184A	79632	broad.mit.edu	37	6	119285893	119285893	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr6:119285893G>A	ENST00000338891.7	-	16	3520	c.3077C>T	c.(3076-3078)aCt>aTt	p.T1026I	RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000368475.4_Intron|FAM184A_ENST00000352896.5_Missense_Mutation_p.T857I|FAM184A_ENST00000521531.1_Intron	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	1026						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						GTTGAAGTTAGTTTCTCGATT	0.303																																						ENST00000338891.7	0.330000	1.100000e-01	2.700000e-01	1.500000e-01	0.200000	0.214934	0.200000	0.200000																										0				52						c.(3076-3078)aCt>aTt		family with sequence similarity 184, member A							107.0	98.0	101.0					6																	119285893		1828	4074	5902	SO:0001583	missense	79632	0	0					g.chr6:119285893G>A	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.3077C>T	chr6.hg19:g.119285893G>A	ENSP00000342604:p.Thr1026Ile	1					FAM184A_ENST00000521531.1_Intron|FAM184A_ENST00000368475.4_Intron|FAM184A_ENST00000352896.5_Missense_Mutation_p.T857I|RP11-351A11.1_ENST00000518570.1_RNA	p.T1026I	NM_024581.4	NP_078857.5	0	1	1	1.626020	Q8NB25	F184A_HUMAN		16	3520	-			B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	1	1	hg19	c.3077C>T	CCDS43499.1	0	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087818	0.76642	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368472	T;T;T	0.52057	2.35;2.29;0.68	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.64238	0.2580	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.60520	-0.7247	10	0.41790	T	0.15	-12.1337	19.9925	0.97371	0.0:0.0:1.0:0.0	.	857;1026	F8W8D6;Q8NB25	.;F184A_HUMAN	I	1026;857;87	ENSP00000342604:T1026I;ENSP00000326608:T857I;ENSP00000357457:T87I	ENSP00000342604:T1026I	T	-	2	0	0	FAM184A	119327592	119327592	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.655000	0.74392	2.721000	0.93114	0.655000	0.94253	ACT	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.303	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	1	0	1		2	2	2	0	0	0	0	32	0	32	32	1	1.650000	-18.289750	1	0.640000	NM_024581		0	12	12	0	114	113	1	0	1	0		0	0	32	0	0	0.999233	8.585599e-02	0	0	0	5	0	12	114
PRL	5617	broad.mit.edu	37	6	22290545	22290545	+	Missense_Mutation	SNP	C	C	T	rs139327343	byFrequency	TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr6:22290545C>T	ENST00000306482.1	-	4	868	c.350G>A	c.(349-351)cGa>cAa	p.R117Q	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	117					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					ATTCCAGGATCGCAATATGCT	0.423													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17704	0.0		0.0	False		,,,				2504	0.0					ENST00000306482.1	1.000000	8.800000e-01	1	9.300000e-01	0.960000	0.965731	0.960000	0.990000																										0				16						c.(349-351)cGa>cAa		prolactin		C	GLN/ARG,GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	116.0	109.0	112.0		350,350	4.1	0.9	6	dbSNP_134	112	0,8600		0,0,4300	yes	missense,missense	PRL	NM_000948.5,NM_001163558.2	43,43	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,benign	117/228,117/228	22290545	3,13003	2203	4300	6503	SO:0001583	missense	5617	9	121412	41				g.chr6:22290545C>T	D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.350G>A	chr6.hg19:g.22290545C>T	ENSP00000302150:p.Arg117Gln	1					RP3-404K8.2_ENST00000561912.1_RNA	p.R117Q	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	0	1	1	1.604606	P01236	PRL_HUMAN		4	868	-	Ovarian(93;0.163)		Q15199|Q92996	Missense_Mutation	SNP	ENST00000306482.1	1	1	hg19	c.350G>A	CCDS4548.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	12.55	1.972820	0.34848	6.81E-4	0.0	ENSG00000172179	ENST00000306482;ENST00000438606	D	0.87650	-2.28	5.87	4.05	0.47172	5.87	4.05	0.47172	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.376195	0.34088	N	0.004279	T	0.68311	0.2987	L	0.42245	1.32	0.38772	D	0.954562	B;P	0.42556	0.148;0.783	B;B	0.34873	0.023;0.191	T	0.66468	-0.5916	10	0.26408	T	0.33	1.517	10.4581	0.44563	0.135:0.7953:0.0:0.0697	.	117;118	P01236;Q5I0G2	PRL_HUMAN;.	Q	117;86	ENSP00000302150:R117Q	ENSP00000302150:R117Q	R	-	2	0	0	PRL	22398524	22398524	0.993000	0.37304	0.907000	0.35723	0.318000	0.28184	2.575000	0.46025	0.887000	0.36136	0.655000	0.94253	CGA	0.470588		TCGA-LB-A7SX-01A-11D-A33T-08	0.423	PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043327.1	1	0	1		2	2	2	0	0	0	0	49	0	49	49	1	1.650000	-20.000000	1	0.640000	NM_000948		0	162	162	0	172	172	1	0	1			0	0	49	0	0	1.000000	0	0	0	0	0	0	162	172
HIST1H2AL	8332	broad.mit.edu	37	6	27833264	27833264	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr6:27833264C>T	ENST00000357320.2	+	1	231	c.132C>T	c.(130-132)gtC>gtT	p.V44V		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	44						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						CTGAGCGGGTCGGGGCCGGCG	0.692																																						ENST00000357320.2	0.170000	8.000000e-02	1.500000e-01	9.000000e-02	0.110000	0.126019	0.110000	0.120000																										0				9						c.(130-132)gtC>gtT		histone cluster 1, H2al							46.0	54.0	52.0					6																	27833264		2202	4299	6501	SO:0001819	synonymous_variant	8332	1	121366	39				g.chr6:27833264C>T	X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.132C>T	chr6.hg19:g.27833264C>T		1						p.V44V	NM_003511.2	NP_003502.1	0	1	1	1.642223	P0C0S8	H2A1_HUMAN		1	231	+			P02261|Q2M1R2|Q76PA6	Silent	SNP	ENST00000357320.2	1	1	hg19	c.132C>T	CCDS4634.1	0																																																																																								0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.692	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040160.1	0	0	1		2	2	2	0	0	0	0	112	0	112	108	1	1.650000	-6.492383	1	0.640000	NM_003511		0	31	32	0	508	506	0	0	1	0		0	0	112	0	0	1.000000	1.984773e-02	0	0	0	4	0	31	508
GRM1	2911	broad.mit.edu	37	6	146350993	146350993	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr6:146350993G>A	ENST00000282753.1	+	1	575	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	GRM1_ENST00000507907.1_Missense_Mutation_p.V114M|GRM1_ENST00000355289.4_Missense_Mutation_p.V114M|GRM1_ENST00000392299.2_Missense_Mutation_p.V114M|GRM1_ENST00000361719.2_Missense_Mutation_p.V114M|GRM1_ENST00000492807.2_Missense_Mutation_p.V114M			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	114					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCACTCTTCCGTGGCTCTGGA	0.567																																						ENST00000282753.1	0.360000	1.600000e-01	3.100000e-01	2.000000e-01	0.250000	0.262215	0.250000	0.250000																										0				126						c.(340-342)Gtg>Atg		glutamate receptor, metabotropic 1							48.0	47.0	48.0					6																	146350993		2203	4300	6503	SO:0001583	missense	2911	0	0					g.chr6:146350993G>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.340G>A	chr6.hg19:g.146350993G>A	ENSP00000282753:p.Val114Met	1					GRM1_ENST00000492807.2_Missense_Mutation_p.V114M|GRM1_ENST00000355289.4_Missense_Mutation_p.V114M|GRM1_ENST00000507907.1_Missense_Mutation_p.V114M|GRM1_ENST00000361719.2_Missense_Mutation_p.V114M|GRM1_ENST00000392299.2_Missense_Mutation_p.V114M	p.V114M			0	1	1	1.615513	Q13255	GRM1_HUMAN		1	575	+		Ovarian(120;0.0387)	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	1	1	hg19	c.340G>A	CCDS5209.1	0	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326441	0.81690	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.69	5.69	0.88448	5.69	5.69	0.88448	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.71904	0.3395	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.998;0.997	T	0.71593	-0.4546	10	0.54805	T	0.06	.	19.8011	0.96507	0.0:0.0:1.0:0.0	.	114;114;109;114	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	M	114	ENSP00000354896:V114M;ENSP00000376119:V114M;ENSP00000424095:V114M;ENSP00000282753:V114M;ENSP00000347437:V114M;ENSP00000425599:V114M	ENSP00000282753:V114M	V	+	1	0	0	GRM1	146392686	146392686	1.000000	0.71417	0.978000	0.43139	0.966000	0.64601	9.869000	0.99810	2.679000	0.91253	0.561000	0.74099	GTG	0.473068		TCGA-LB-A7SX-01A-11D-A33T-08	0.567	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	1	0	1		2	2	2	0	0	0	0	41	0	41	40	1	1.650000	-20.000000	1	0.640000	NM_000838		0	21	20	0	155	153	1	0	1	0		0	0	41	0	0	0.999998	0	0	0	0	1	0	21	155
RINT1	60561	broad.mit.edu	37	7	105182892	105182892	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:105182892G>A	ENST00000257700.2	+	4	542	c.311G>A	c.(310-312)cGa>cAa	p.R104Q	RINT1_ENST00000477285.1_3'UTR	NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	104					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AAAAGAATTCGAAGTGCCTTA	0.328																																						ENST00000257700.2	1.000000	2.200000e-01	3.800000e-01	2.600000e-01	0.310000	0.366626	0.310000	0.310000																										0				22						c.(310-312)cGa>cAa		RAD50 interactor 1							62.0	67.0	65.0					7																	105182892		2203	4300	6503	SO:0001583	missense	60561	0	0					g.chr7:105182892G>A	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.311G>A	chr7.hg19:g.105182892G>A	ENSP00000257700:p.Arg104Gln	0					RINT1_ENST00000477285.1_3'UTR	p.R104Q	NM_021930.4	NP_068749.3	2	2	4	2.375626	Q6NUQ1	RINT1_HUMAN		4	542	+			Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	1	1	hg19	c.311G>A	CCDS34726.1	0	.	.	.	.	.	.	.	.	.	.	G	2.986	-0.209338	0.06140	.	.	ENSG00000135249	ENST00000257700;ENST00000493041	T	0.20463	2.07	4.63	3.47	0.39725	4.63	3.47	0.39725	.	0.315890	0.35179	N	0.003399	T	0.04497	0.0123	N	0.00268	-1.735	0.19300	N	0.99998	B	0.02656	0.0	B	0.01281	0.0	T	0.39057	-0.9632	10	0.09843	T	0.71	-1.5379	10.271	0.43483	0.9205:0.0:0.0795:0.0	.	104	Q6NUQ1	RINT1_HUMAN	Q	104;73	ENSP00000257700:R104Q	ENSP00000257700:R104Q	R	+	2	0	0	RINT1	104970128	104970128	1.000000	0.71417	0.986000	0.45419	0.841000	0.47740	4.133000	0.57983	0.606000	0.29965	-0.959000	0.02639	CGA	0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.328	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	1	0	1		2	2	2	0	0	0	0	53	0	53	53	1	1.650000	-3.142702	1	0.640000	NM_021930		0	40	39	0	385	383	0	0	1	1		0	0	53	0	0	1.000000	4.920891e-01	0	6	0	11	0	40	385
HDAC9	9734	broad.mit.edu	37	7	18788739	18788739	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:18788739C>A	ENST00000432645.2	+	13	2012	c.2012C>A	c.(2011-2013)aCt>aAt	p.T671N	HDAC9_ENST00000441542.2_Missense_Mutation_p.T674N|HDAC9_ENST00000401921.1_Missense_Mutation_p.T630N|HDAC9_ENST00000406451.4_Missense_Mutation_p.T671N	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	671	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CTGCAAGAAACTGGGCTGCTA	0.438																																						ENST00000432645.2	1.000000	6.100000e-01	1	7.200000e-01	0.850000	0.851703	0.850000	1.000000																										0				82						c.(2011-2013)aCt>aAt		histone deacetylase 9	Valproic Acid(DB00313)						80.0	78.0	79.0					7																	18788739		1911	4139	6050	SO:0001583	missense	9734	0	0					g.chr7:18788739C>A	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.2012C>A	chr7.hg19:g.18788739C>A	ENSP00000410337:p.Thr671Asn	0					HDAC9_ENST00000441542.2_Missense_Mutation_p.T674N|HDAC9_ENST00000401921.1_Missense_Mutation_p.T630N|HDAC9_ENST00000406451.4_Missense_Mutation_p.T671N	p.T671N	NM_058176.2	NP_478056.1	2	2	4	2.385000	Q9UKV0	HDAC9_HUMAN		13	2012	+	all_lung(11;0.187)		A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	1	1	hg19	c.2012C>A	CCDS47555.1	1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884382	0.51908	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	5.3	5.3	0.74995	5.3	5.3	0.74995	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000010	T	0.70894	0.3276	M	0.65975	2.015	0.80722	D	1	B;P;P;P;P;P;P	0.43885	0.001;0.82;0.64;0.64;0.69;0.64;0.69	B;B;B;B;B;B;B	0.41666	0.01;0.328;0.248;0.248;0.363;0.248;0.279	T	0.74973	-0.3481	10	0.56958	D	0.05	-19.3258	15.5062	0.75743	0.0:0.8616:0.1384:0.0	.	671;583;630;674;671;671;649	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	N	671;630;671;674;583	ENSP00000384657:T671N;ENSP00000383912:T630N;ENSP00000410337:T671N;ENSP00000408617:T674N	ENSP00000339165:T583N	T	+	2	0	0	HDAC9	18755264	18755264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.797000	0.55514	2.756000	0.94617	0.563000	0.77884	ACT	0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.438	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1	1	0	1		2	2	2	0	0	0	0	15	0	15	15	1	1.650000	-20.000000	1	0.640000			0	34	34	0	100	100	1	0	1	0		0	0	15	0	0	1.000000	0	0	0	0	1	0	34	100
GLI3	2737	broad.mit.edu	37	7	42018283	42018283	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:42018283G>T	ENST00000395925.3	-	11	1646	c.1562C>A	c.(1561-1563)tCa>tAa	p.S521*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	521					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CTGCTCTCTTGAGCAGTCCAG	0.453									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999243	0.990000	1.000000																										0				112						c.(1561-1563)tCa>tAa		GLI family zinc finger 3							109.0	101.0	104.0					7																	42018283		2203	4300	6503	SO:0001587	stop_gained	2737	0	0		Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42018283G>T		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1562C>A	chr7.hg19:g.42018283G>T	ENSP00000379258:p.Ser521*	0					GLI3_ENST00000479210.1_5'UTR	p.S521*	NM_000168.5	NP_000159.3	1	2	3	2.343501	P10071	GLI3_HUMAN		11	1646	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	ENST00000395925.3	0	1	hg19	c.1562C>A	CCDS5465.1	1	.	.	.	.	.	.	.	.	.	.	G	41	8.584889	0.98872	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1381	0.98040	0.0:0.0:1.0:0.0	.	.	.	.	X	521	.	ENSP00000379258:S521X	S	-	2	0	0	GLI3	41984808	41984808	1.000000	0.71417	0.965000	0.40720	0.998000	0.95712	7.817000	0.86213	2.763000	0.94921	0.650000	0.86243	TCA	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.453	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	1	0	1		2	2	2	0	0	0	0	41	0	41	41	1	1.650000	-16.819040	1	0.640000	NM_000168		0	154	154	0	279	275	0	0	1	0		0	0	41	0	0	1.000000	1.274913e-01	0	0	0	2	0	154	279
ABCA13	154664	broad.mit.edu	37	7	48431547	48431547	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:48431547C>T	ENST00000435803.1	+	38	11708	c.11684C>T	c.(11683-11685)aCt>aTt	p.T3895I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3895	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CACCCTCCCACTTCTGGAACC	0.522																																						ENST00000435803.1	1.000000	2.000000e-02	1.400000e-01	5.000000e-02	0.080000	0.144679	0.080000	0.080000																										0				270						c.(11683-11685)aCt>aTt		ATP-binding cassette, sub-family A (ABC1), member 13							80.0	80.0	80.0					7																	48431547		1999	4164	6163	SO:0001583	missense	154664	0	0					g.chr7:48431547C>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11684C>T	chr7.hg19:g.48431547C>T	ENSP00000411096:p.Thr3895Ile	0						p.T3895I	NM_152701.3	NP_689914.2	1	2	3	2.343501	Q86UQ4	ABCAD_HUMAN		38	11708	+			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	0	1	hg19	c.11684C>T	CCDS47584.1	0	.	.	.	.	.	.	.	.	.	.	C	15.16	2.749632	0.49257	.	.	ENSG00000179869	ENST00000435803	D	0.94330	-3.4	4.95	4.03	0.46877	4.95	4.03	0.46877	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.178832	0.26016	U	0.026841	D	0.97018	0.9026	M	0.92412	3.305	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.74674	0.968;0.984	D	0.97391	0.9989	10	0.87932	D	0	.	12.1583	0.54089	0.0:0.7004:0.2996:0.0	.	1597;3895	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	I	3895	ENSP00000411096:T3895I	ENSP00000411096:T3895I	T	+	2	0	0	ABCA13	48402093	48402093	0.183000	0.23186	0.451000	0.26982	0.445000	0.32107	1.741000	0.38238	2.296000	0.77279	0.467000	0.42956	ACT	0.647887		TCGA-LB-A7SX-01A-11D-A33T-08	0.522	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	0	0	1		2	2	2	0	0	0	0	22	0	22	22	1	1.650000	-7.417472	1	0.640000	NM_152701		0	5	5	0	196	196	0	0	1	0		0	0	22	0	0	0.938320	0	0	0	0	1	0	5	196
PCLO	27445	broad.mit.edu	37	7	82585369	82585369	+	Missense_Mutation	SNP	C	C	T	rs75707968	byFrequency	TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:82585369C>T	ENST00000333891.9	-	5	5237	c.4900G>A	c.(4900-4902)Gat>Aat	p.D1634N	PCLO_ENST00000423517.2_Missense_Mutation_p.D1634N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AATGCTTCATCGTCTTCATCA	0.428													C|||	9	0.00179712	0.0068	0.0	5008	,	,		23239	0.0		0.0	False		,,,				2504	0.0					ENST00000333891.9	1.000000	5.900000e-01	7.400000e-01	6.300000e-01	0.680000	0.706043	0.680000	0.680000																										0				259						c.(4900-4902)Gat>Aat		piccolo presynaptic cytomatrix protein		C	ASN/ASP,ASN/ASP	9,4045		0,9,2018	296.0	280.0	285.0		4900,4900	5.3	0.6	7	dbSNP_132	285	0,8344		0,0,4172	yes	missense,missense	PCLO	NM_014510.2,NM_033026.5	23,23	0,9,6190	TT,TC,CC		0.0,0.222,0.0726	probably-damaging,probably-damaging	1634/4936,1634/5143	82585369	9,12389	2027	4172	6199	SO:0001583	missense	27445	40	120956	53				g.chr7:82585369C>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4900G>A	chr7.hg19:g.82585369C>T	ENSP00000334319:p.Asp1634Asn	0					PCLO_ENST00000423517.2_Missense_Mutation_p.D1634N	p.D1634N	NM_033026.5	NP_149015.2	2	2	4	2.375626				5	5237	-				Missense_Mutation	SNP	ENST00000333891.9	1	0	hg19	c.4900G>A	CCDS47630.1	0	12	0.005494505494505495	12	0.024390243902439025	0	0.0	0	0.0	0	0.0	C	12.57	1.979136	0.34942	0.00222	0.0	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.20332	2.08;2.09	5.32	5.32	0.75619	5.32	5.32	0.75619	.	.	.	.	.	T	0.26955	0.0660	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65773	0.938;0.938	T	0.11131	-1.0600	9	0.87932	D	0	.	18.9962	0.92813	0.0:1.0:0.0:0.0	.	1634;1634	Q9Y6V0-5;Q9Y6V0-6	.;.	N	1565;1634;1634	ENSP00000334319:D1634N;ENSP00000388393:D1634N	ENSP00000334319:D1634N	D	-	1	0	0	PCLO	82423305	82423305	1.000000	0.71417	0.638000	0.29380	0.917000	0.54804	5.333000	0.65917	2.483000	0.83821	0.655000	0.94253	GAT	0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	1	0	1		2	2	2	0	0	0	0	169	0	169	169	1	1.650000	-3.298910	1	0.640000	NM_014510		0	207	206	0	797	792	1	0	1			0	0	169	0	0	1.000000	0	0	0	0	0	0	207	797
C7orf43	55262	broad.mit.edu	37	7	99755385	99755385	+	Splice_Site	SNP	T	T	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:99755385T>A	ENST00000316937.3	-	3	693	c.508A>T	c.(508-510)Att>Ttt	p.I170F	C7orf43_ENST00000457641.1_5'UTR|MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000394035.2_5'Flank	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	170										breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTCACTACAATCTGTCAAGAG	0.527											OREG0018198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000316937.3	1.000000	6.600000e-01	8.400000e-01	7.100000e-01	0.770000	0.788956	0.770000	0.770000																										0				10						c.(508-510)Att>Ttt		chromosome 7 open reading frame 43							105.0	104.0	104.0					7																	99755385		2203	4300	6503	SO:0001630	splice_region_variant	55262	0	0					g.chr7:99755385T>A		CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.508-1A>T	chr7.hg19:g.99755385T>A		0		OREG0018198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1346	C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000457641.1_5'UTR|MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000394035.2_5'Flank	p.I170F	NM_018275.3	NP_060745.3	2	2	4	2.375626	Q8WVR3	CG043_HUMAN		3	693	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Splice_Site	SNP	ENST00000316937.3	1	0	hg19	c.508A>T	CCDS5687.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.035638|4.035638	0.75617|0.75617	.|.	.|.	ENSG00000146826|ENSG00000146826	ENST00000456769|ENST00000316937	.|T	.|0.33216	.|1.42	5.8|5.8	5.8|5.8	0.92144|0.92144	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.072818	.|0.56097	.|D	.|0.000030	T|T	0.31544|0.31544	0.0800|0.0800	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D	.|0.58268	.|0.982	.|P	.|0.51866	.|0.682	T|T	0.10730|0.10730	-1.0617|-1.0617	5|10	.|0.72032	.|D	.|0.01	-9.3115|-9.3115	14.1012|14.1012	0.65056|0.65056	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|170	.|Q8WVR3	.|CG043_HUMAN	V|F	75|170	.|ENSP00000324741:I170F	.|ENSP00000324741:I170F	D|I	-|-	2|1	0|0	0|0	C7orf43|C7orf43	99593321|99593321	99593321|99593321	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	3.517000|3.517000	0.53443|0.53443	2.217000|2.217000	0.71921|0.71921	0.379000|0.379000	0.24179|0.24179	GAT|ATT	0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.527	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	1	0	1		2	2	2	0	0	0	0	108	0	108	108	1	1.650000	-20.000000	1	0.640000	NM_018275	Missense_Mutation	0	173	170	0	569	562	1	0	1	1		0	0	108	0	0	1.000000	9.999998e-01	0	23	0	51	0	173	569
CASP2	835	broad.mit.edu	37	7	143002066	143002066	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr7:143002066G>T	ENST00000310447.5	+	11	1502	c.1261G>T	c.(1261-1263)Gct>Tct	p.A421S	CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	421					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GGAAGGTTATGCTCCTGGCAC	0.552																																						ENST00000310447.5	1.000000	7.900000e-01	1	8.700000e-01	0.950000	0.942577	0.950000	1.000000																										0				21						c.(1261-1263)Gct>Tct		caspase 2, apoptosis-related cysteine peptidase							97.0	81.0	86.0					7																	143002066		2203	4300	6503	SO:0001583	missense	835	0	0					g.chr7:143002066G>T	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.1261G>T	chr7.hg19:g.143002066G>T	ENSP00000312664:p.Ala421Ser	0					CASP2_ENST00000493642.1_3'UTR	p.A421S	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	2	2	4	2.375626	P42575	CASP2_HUMAN		11	1502	+	Melanoma(164;0.059)		A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	1	1	hg19	c.1261G>T	CCDS5879.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.219130	0.95104	.	.	ENSG00000106144	ENST00000310447	T	0.29142	1.58	5.27	5.27	0.74061	5.27	5.27	0.74061	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.000000	0.85682	D	0.000000	T	0.32406	0.0828	N	0.11789	0.175	0.80722	D	1	D	0.59357	0.985	P	0.62560	0.904	T	0.03887	-1.0995	10	0.06494	T	0.89	.	18.9739	0.92728	0.0:0.0:1.0:0.0	.	421	P42575	CASP2_HUMAN	S	421	ENSP00000312664:A421S	ENSP00000312664:A421S	A	+	1	0	0	CASP2	142712188	142712188	1.000000	0.71417	0.963000	0.40424	0.944000	0.59088	9.394000	0.97261	2.478000	0.83669	0.650000	0.86243	GCT	0.659607		TCGA-LB-A7SX-01A-11D-A33T-08	0.552	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	1	0	1		2	2	2	0	0	0	0	36	0	36	36	1	1.650000	-20.000000	1	0.640000	NM_032982		0	96	95	0	238	235	1	0	1	1		0	0	36	0	0	1.000000	9.999999e-01	0	25	0	37	0	96	238
FBXO43	286151	broad.mit.edu	37	8	101153416	101153416	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:101153416G>A	ENST00000428847.2	-	2	1382	c.1066C>T	c.(1066-1068)Caa>Taa	p.Q356*		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	356					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AGTAGTTCTTGAAAAGAACCC	0.463																																						ENST00000428847.2	0.850000	6.400000e-01	8.000000e-01	6.900000e-01	0.740000	0.753995	0.740000	0.750000																										0				31						c.(1066-1068)Caa>Taa		F-box protein 43							121.0	113.0	116.0					8																	101153416		1860	4094	5954	SO:0001587	stop_gained	286151	0	0					g.chr8:101153416G>A	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1066C>T	chr8.hg19:g.101153416G>A	ENSP00000403293:p.Gln356*	1						p.Q356*	NM_001029860.3	NP_001025031.2	0	1	1	2.110200	Q4G163	FBX43_HUMAN	Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)	2	1382	-	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)			Nonsense_Mutation	SNP	ENST00000428847.2	0	1	hg19	c.1066C>T	CCDS47904.1	0	.	.	.	.	.	.	.	.	.	.	G	37	6.453024	0.97581	.	.	ENSG00000156509	ENST00000428847	.	.	.	5.57	4.68	0.58851	5.57	4.68	0.58851	.	0.342235	0.34314	N	0.004079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-1.0291	16.6488	0.85183	0.0:0.13:0.87:0.0	.	.	.	.	X	356	.	ENSP00000403293:Q356X	Q	-	1	0	0	FBXO43	101222592	101222592	1.000000	0.71417	0.989000	0.46669	0.445000	0.32107	7.277000	0.78572	1.444000	0.47605	0.655000	0.94253	CAA	0.608696		TCGA-LB-A7SX-01A-11D-A33T-08	0.463	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	1	0	1		2	2	2	0	0	0	0	99	0	99	98	1	1.650000	-20.000000	1	0.640000	XM_209918		0	156	154	0	440	436	1	0	1	0		0	0	99	0	0	1.000000	1.710510e-01	0	0	0	3	0	156	440
TRMT12	55039	broad.mit.edu	37	8	125463295	125463295	+	Missense_Mutation	SNP	T	T	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:125463295T>G	ENST00000328599.3	+	1	248	c.127T>G	c.(127-129)Ttt>Gtt	p.F43V	TRMT12_ENST00000521443.1_3'UTR	NM_017956.3	NP_060426.2	Q53H54	TYW2_HUMAN	tRNA methyltransferase 12 homolog (S. cerevisiae)	43					tRNA processing (GO:0008033)		transferase activity (GO:0016740)			breast(2)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GCAGAAACTCTTTGATACACA	0.557																																						ENST00000328599.3	0.100000	1.000000e-02	8.000000e-02	2.000000e-02	0.040000	0.055655	0.040000	0.050000																										0				15						c.(127-129)Ttt>Gtt		tRNA methyltransferase 12 homolog (S. cerevisiae)							83.0	85.0	85.0					8																	125463295		2203	4300	6503	SO:0001583	missense	55039	0	0					g.chr8:125463295T>G	AF313041	CCDS6349.1	8q24.13	2011-05-09	2006-11-16		ENSG00000183665	ENSG00000183665			26091	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 2"""	611244	"""tRNA methyltranferase 12 homolog (S. cerevisiae)"""			16005430, 17150819	Standard	NM_017956		Approved	FLJ20772, Trm12, TYW2	uc003yra.4	Q53H54	OTTHUMG00000165022	ENST00000328599.3:c.127T>G	chr8.hg19:g.125463295T>G	ENSP00000329858:p.Phe43Val	1					TRMT12_ENST00000521443.1_3'UTR	p.F43V	NM_017956.3	NP_060426.2	0	1	1	2.110200	Q53H54	TYW2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)	1	248	+	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		Q6PKB9|Q96F21|Q9NWK6	Missense_Mutation	SNP	ENST00000328599.3	0	1	hg19	c.127T>G	CCDS6349.1	0	.	.	.	.	.	.	.	.	.	.	T	12.58	1.980463	0.34942	.	.	ENSG00000183665	ENST00000328599	T	0.40225	1.04	5.14	-3.63	0.04529	5.14	-3.63	0.04529	.	0.071623	0.56097	D	0.000028	T	0.17450	0.0419	N	0.08118	0	0.24462	N	0.994434	B	0.12630	0.006	B	0.06405	0.002	T	0.06303	-1.0834	10	0.66056	D	0.02	-6.7128	6.8676	0.24102	0.0:0.362:0.1226:0.5154	.	43	Q53H54	TYW2_HUMAN	V	43	ENSP00000329858:F43V	ENSP00000329858:F43V	F	+	1	0	0	TRMT12	125532476	125532476	0.057000	0.20700	0.842000	0.33263	0.587000	0.36485	-0.847000	0.04331	-0.876000	0.04017	-0.375000	0.07067	TTT	0.608696		TCGA-LB-A7SX-01A-11D-A33T-08	0.557	TRMT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381465.1	0	0	1		2	2	2	0	0	0	0	59	0	59	59	1	1.650000	-6.606910	1	0.640000	NM_017956		0	6	6	0	353	351	0	0	1	0		0	0	59	0	0	0.964693	4.571259e-02	0	0	0	17	0	6	353
PRKDC	5591	broad.mit.edu	37	8	48691183	48691183	+	Missense_Mutation	SNP	A	A	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:48691183A>C	ENST00000314191.2	-	84	11743	c.11687T>G	c.(11686-11688)tTc>tGc	p.F3896C	PRKDC_ENST00000338368.3_Missense_Mutation_p.F3865C|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3897	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GAGCGCCAGGAAAGCCTCAGG	0.562								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	ENST00000314191.2	0.760000	3.900000e-01	6.700000e-01	4.700000e-01	0.560000	0.576437	0.560000	0.560000																										0				147						c.(11686-11688)tTc>tGc	Non-homologous end-joining	protein kinase, DNA-activated, catalytic polypeptide	Caffeine(DB00201)						38.0	38.0	38.0					8																	48691183		1976	4152	6128	SO:0001583	missense	5591	0	0					g.chr8:48691183A>C		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.11687T>G	chr8.hg19:g.48691183A>C	ENSP00000313420:p.Phe3896Cys	1					PRKDC_ENST00000338368.3_Missense_Mutation_p.F3865C|PRKDC_ENST00000523565.1_5'UTR	p.F3896C	NM_006904.6	NP_008835.5	0	1	1	2.111336	P78527	PRKDC_HUMAN		84	11743	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	1	1	hg19	c.11687T>G		0	.	.	.	.	.	.	.	.	.	.	A	18.53	3.644011	0.67244	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	D;D	0.83250	-1.7;-1.7	5.52	5.52	0.82312	5.52	5.52	0.82312	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.92838	0.7722	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.987	D	0.94371	0.7596	10	0.87932	D	0	.	15.6454	0.77046	1.0:0.0:0.0:0.0	.	3865;3897	E7EUY0;P78527	.;PRKDC_HUMAN	C	3896;3865	ENSP00000313420:F3896C;ENSP00000345182:F3865C	ENSP00000313420:F3896C	F	-	2	0	0	PRKDC	48853736	48853736	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	8.843000	0.92142	2.084000	0.62774	0.533000	0.62120	TTC	0.608696		TCGA-LB-A7SX-01A-11D-A33T-08	0.562	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1		2	2	2	0	0	0	0	23	0	23	23	1	1.650000	-20.000000	1	0.640000	NM_001081640		0	27	27	0	110	110	1	0	1	1		0	0	23	0	0	1.000000	1	0	21	0	125	0	27	110
EFCAB1	79645	broad.mit.edu	37	8	49643125	49643125	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:49643125C>A	ENST00000262103.3	-	3	373	c.293G>T	c.(292-294)cGa>cTa	p.R98L	EFCAB1_ENST00000433756.1_Missense_Mutation_p.R46L|EFCAB1_ENST00000521002.1_Intron|EFCAB1_ENST00000523092.1_Missense_Mutation_p.R46L	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	98	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CAAAGATCCTCGAAGAAACAG	0.343																																						ENST00000262103.3	0.540000	2.400000e-01	4.700000e-01	3.000000e-01	0.380000	0.391279	0.380000	0.380000																										0				14						c.(292-294)cGa>cTa		EF-hand calcium binding domain 1							115.0	103.0	107.0					8																	49643125		2203	4300	6503	SO:0001583	missense	79645	0	0					g.chr8:49643125C>A		CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.293G>T	chr8.hg19:g.49643125C>A	ENSP00000262103:p.Arg98Leu	1					EFCAB1_ENST00000521002.1_Intron|EFCAB1_ENST00000523092.1_Missense_Mutation_p.R46L|EFCAB1_ENST00000433756.1_Missense_Mutation_p.R46L	p.R98L	NM_024593.3	NP_078869.1	0	1	1	2.111336	Q9HAE3	EFCB1_HUMAN		3	373	-		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)	B4DSB4|E7EVN7	Missense_Mutation	SNP	ENST00000262103.3	0	1	hg19	c.293G>T	CCDS6145.1	0	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489315	0.84962	.	.	ENSG00000034239	ENST00000433756;ENST00000262103;ENST00000450553;ENST00000523092	T;T;T	0.68025	-0.3;-0.29;-0.3	4.44	4.44	0.53790	4.44	4.44	0.53790	EF-hand-like domain (1);	0.060216	0.64402	D	0.000002	D	0.84638	0.5516	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.76575	0.988;0.962	D	0.88273	0.2931	10	0.87932	D	0	.	14.9317	0.70919	0.0:1.0:0.0:0.0	.	46;98	Q9HAE3-2;Q9HAE3	.;EFCB1_HUMAN	L	46;98;98;46	ENSP00000400873:R46L;ENSP00000262103:R98L;ENSP00000430765:R46L	ENSP00000262103:R98L	R	-	2	0	0	EFCAB1	49805678	49805678	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.789000	0.75110	2.441000	0.82636	0.563000	0.77884	CGA	0.608696		TCGA-LB-A7SX-01A-11D-A33T-08	0.343	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1	1	0	1		2	2	2	0	0	0	0	20	0	20	20	1	1.650000	-3.082581	1	0.640000	NM_024593		0	21	21	0	138	138	1	0	1			0	0	20	0	0	0.999998	0	0	0	0	0	0	21	138
DCAF4L2	138009	broad.mit.edu	37	8	88885210	88885210	+	Silent	SNP	C	C	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:88885210C>A	ENST00000319675.3	-	1	1086	c.990G>T	c.(988-990)gcG>gcT	p.A330A		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	330										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GGCCCACGGCCGCCACGACTC	0.567																																						ENST00000319675.3	0.140000	3.000000e-02	1.100000e-01	5.000000e-02	0.080000	0.087813	0.080000	0.080000																										0				83						c.(988-990)gcG>gcT		DDB1 and CUL4 associated factor 4-like 2							78.0	82.0	80.0					8																	88885210		2203	4300	6503	SO:0001819	synonymous_variant	138009	0	0					g.chr8:88885210C>A	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.990G>T	chr8.hg19:g.88885210C>A		1						p.A330A	NM_152418.3	NP_689631.1	0	1	1	2.111336	Q8NA75	DC4L2_HUMAN		1	1086	-				Silent	SNP	ENST00000319675.3	1	1	hg19	c.990G>T	CCDS6245.1	0																																																																																								0.608696		TCGA-LB-A7SX-01A-11D-A33T-08	0.567	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	0	0	1		2	2	2	0	0	0	0	52	0	52	52	1	1.650000	-3.324949	1	0.640000	NM_152418		0	12	11	0	411	404	0	0	1			0	0	52	0	0	0.999037	0	0	0	0	0	0	12	411
KIAA1429	25962	broad.mit.edu	37	8	95538657	95538657	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:95538657C>T	ENST00000297591.5	-	8	1890	c.1815G>A	c.(1813-1815)gtG>gtA	p.V605V	KIAA1429_ENST00000437199.1_Silent_p.V605V|KIAA1429_ENST00000421249.2_Silent_p.V605V	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	605					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TAGAAGCTTCCACCTCATTTT	0.383																																						ENST00000297591.5	0.200000	1.000000e-01	1.700000e-01	1.200000e-01	0.140000	0.151189	0.140000	0.150000																										0				66						c.(1813-1815)gtG>gtA		KIAA1429							152.0	144.0	147.0					8																	95538657		2203	4300	6503	SO:0001819	synonymous_variant	25962	0	0					g.chr8:95538657C>T	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1815G>A	chr8.hg19:g.95538657C>T		1					KIAA1429_ENST00000421249.2_Silent_p.V605V|KIAA1429_ENST00000437199.1_Silent_p.V605V	p.V605V	NM_015496.4	NP_056311.2	0	1	1	2.110200	Q69YN4	VIR_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00185)	8	1890	-	Breast(36;3.29e-05)		Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	1	1	hg19	c.1815G>A	CCDS34923.1	0																																																																																								0.608696		TCGA-LB-A7SX-01A-11D-A33T-08	0.383	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	1	0	1		2	2	2	0	0	0	0	105	0	105	105	1	1.650000	-2.878750	1	0.640000	NM_015496		0	38	38	0	701	695	0	0	1	0		0	0	105	0	0	1.000000	1.861928e-01	0	0	0	15	0	38	701
GRINA	2907	broad.mit.edu	37	8	145066090	145066090	+	Silent	SNP	G	G	C			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr8:145066090G>C	ENST00000313269.5	+	4	815	c.537G>C	c.(535-537)acG>acC	p.T179T	GRINA_ENST00000395068.4_Silent_p.T179T	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	179						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCTGTCCACGGTGTCTGTGT	0.572																																						ENST00000313269.5	0.690000	5.300000e-01	6.600000e-01	5.700000e-01	0.610000	0.621291	0.610000	0.620000																										0				9						c.(535-537)acG>acC		glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)							224.0	218.0	220.0					8																	145066090		2203	4300	6503	SO:0001819	synonymous_variant	2907	0	0					g.chr8:145066090G>C	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.537G>C	chr8.hg19:g.145066090G>C		1					GRINA_ENST00000395068.4_Silent_p.T179T	p.T179T	NM_000837.1	NP_000828.1	0	1	1	2.087693	Q7Z429	LFG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)	4	815	+	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		B3KXM7|O43836|Q8IVW7	Silent	SNP	ENST00000313269.5	1	1	hg19	c.537G>C	CCDS34961.1	0	.	.	.	.	.	.	.	.	.	.	G	9.085	1.000167	0.19121	.	.	ENSG00000178719	ENST00000534791;ENST00000527194	.	.	.	4.7	-4.37	0.03633	4.7	-4.37	0.03633	.	.	.	.	.	T	0.38506	0.1043	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36817	-0.9732	4	.	.	.	-16.3463	2.2111	0.03948	0.1049:0.2036:0.2433:0.4482	.	.	.	.	R	103;35	.	.	G	+	1	0	0	GRINA	145138078	145138078	0.001000	0.12720	0.911000	0.35937	0.983000	0.72400	-1.702000	0.01901	-0.701000	0.05063	0.650000	0.86243	GGT	0.601770		TCGA-LB-A7SX-01A-11D-A33T-08	0.572	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	1	0	1		2	2	2	0	0	0	0	136	0	136	135	1	1.650000	-3.741634	1	0.640000	NM_001009184		0	194	193	0	690	684	1	0	1	1		0	0	136	0	0	1.000000	1	0	83	0	276	0	194	690
PTPRD	5789	broad.mit.edu	37	9	8341947	8341947	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr9:8341947C>T	ENST00000381196.4	-	37	5236	c.4693G>A	c.(4693-4695)Gtc>Atc	p.V1565I	PTPRD_ENST00000540109.1_Missense_Mutation_p.V1565I|PTPRD_ENST00000356435.5_Missense_Mutation_p.V1565I|PTPRD_ENST00000397611.3_Missense_Mutation_p.V1155I|PTPRD_ENST00000537002.1_Missense_Mutation_p.V1155I|PTPRD_ENST00000360074.4_Missense_Mutation_p.V1552I|PTPRD_ENST00000358503.5_Missense_Mutation_p.V1543I|PTPRD_ENST00000355233.5_Missense_Mutation_p.V1159I|PTPRD_ENST00000486161.1_Missense_Mutation_p.V1158I|PTPRD_ENST00000397606.3_Missense_Mutation_p.V1158I|PTPRD_ENST00000397617.3_Missense_Mutation_p.V1158I	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1565	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V1565I(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCATCTATGACGATGAAGCAA	0.358										TSP Lung(15;0.13)																												ENST00000381196.4	0.130000	3.000000e-02	1.100000e-01	5.000000e-02	0.070000	0.083637	0.070000	0.080000																										1	Substitution - Missense(1)	p.V1565I(1)	skin(1)	168						c.(4693-4695)Gtc>Atc		protein tyrosine phosphatase, receptor type, D							67.0	67.0	67.0					9																	8341947		2203	4300	6503	SO:0001583	missense	5789	0	0					g.chr9:8341947C>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4693G>A	chr9.hg19:g.8341947C>T	ENSP00000370593:p.Val1565Ile	1	TSP Lung(15;0.13)				PTPRD_ENST00000355233.5_Missense_Mutation_p.V1159I|PTPRD_ENST00000360074.4_Missense_Mutation_p.V1552I|PTPRD_ENST00000358503.5_Missense_Mutation_p.V1543I|PTPRD_ENST00000356435.5_Missense_Mutation_p.V1565I|PTPRD_ENST00000537002.1_Missense_Mutation_p.V1155I|PTPRD_ENST00000397606.3_Missense_Mutation_p.V1158I|PTPRD_ENST00000397617.3_Missense_Mutation_p.V1158I|PTPRD_ENST00000540109.1_Missense_Mutation_p.V1565I|PTPRD_ENST00000397611.3_Missense_Mutation_p.V1155I|PTPRD_ENST00000486161.1_Missense_Mutation_p.V1158I	p.V1565I	NM_002839.3	NP_002830.1	0	1	1	1.617199	P23468	PTPRD_HUMAN		37	5236	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	1	1	hg19	c.4693G>A	CCDS43786.1	0	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619525	0.46736	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	6.07	5.17	0.71159	6.07	5.17	0.71159	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	M	0.92367	3.3	0.58432	D	0.999999	B;B;B;B;D;B;D;P;D	0.89917	0.137;0.137;0.137;0.137;0.979;0.113;1.0;0.918;1.0	B;B;B;B;P;B;D;B;D	0.74348	0.047;0.047;0.047;0.047;0.532;0.028;0.983;0.38;0.981	T	0.75895	-0.3156	9	.	.	.	.	16.7686	0.85531	0.1302:0.8698:0.0:0.0	.	1158;1149;1158;1159;1155;1155;1552;1565;1565	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	I	1565;1565;1552;1543;1159;1158;1155;1155;1036;1565;1158;1158	ENSP00000370593:V1565I;ENSP00000348812:V1565I;ENSP00000353187:V1552I;ENSP00000351293:V1543I;ENSP00000347373:V1159I;ENSP00000380741:V1158I;ENSP00000380735:V1155I;ENSP00000440515:V1155I;ENSP00000438164:V1565I;ENSP00000417093:V1158I;ENSP00000380731:V1158I	.	V	-	1	0	0	PTPRD	8331947	8331947	1.000000	0.71417	0.996000	0.52242	0.011000	0.07611	7.445000	0.80570	1.559000	0.49555	-0.181000	0.13052	GTC	0.475524		TCGA-LB-A7SX-01A-11D-A33T-08	0.358	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3	0	0	1		2	2	2	0	0	0	0	58	0	58	56	1	1.650000	-11.270790	1	0.640000			0	10	10	0	269	264	0	0	1			0	0	58	0	0	0.996738	0	0	0	0	0	0	10	269
OR13C2	392376	broad.mit.edu	37	9	107367328	107367328	+	Missense_Mutation	SNP	T	T	C	rs74954118		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chr9:107367328T>C	ENST00000542196.1	-	1	623	c.581A>G	c.(580-582)gAc>gGc	p.D194G		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GAACTCATTGTCTGAGATGTC	0.388																																						ENST00000542196.1	0.100000	3.000000e-02	9.000000e-02	4.000000e-02	0.060000	0.071663	0.060000	0.070000																										0				22						c.(580-582)gAc>gGc		olfactory receptor, family 13, subfamily C, member 2							158.0	152.0	154.0					9																	107367328		2201	4300	6501	SO:0001583	missense	392376	0	0					g.chr9:107367328T>C		CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.581A>G	chr9.hg19:g.107367328T>C	ENSP00000438815:p.Asp194Gly	1						p.D194G	NM_001004481.1	NP_001004481.1	0	1	1	1.683794	Q8NGS9	O13C2_HUMAN		1	623	-			B9EGV8|Q6IF54	Missense_Mutation	SNP	ENST00000542196.1	1	1	hg19	c.581A>G	CCDS35092.1	0	.	.	.	.	.	.	.	.	.	.	T	5.601	0.295593	0.10622	.	.	ENSG00000257019	ENST00000542196	T	0.00076	8.76	3.52	-3.12	0.05282	3.52	-3.12	0.05282	GPCR, rhodopsin-like superfamily (1);	0.807899	0.10032	N	0.724612	T	0.00073	0.0002	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.01337	-1.1381	10	0.26408	T	0.33	.	3.4954	0.07653	0.4312:0.2306:0.0:0.3382	.	194	Q8NGS9	O13C2_HUMAN	G	194	ENSP00000438815:D194G	ENSP00000438815:D194G	D	-	2	0	0	OR13C2	106407149	106407149	0.000000	0.05858	0.006000	0.13384	0.702000	0.40608	-0.856000	0.04290	-0.430000	0.07318	-0.415000	0.06103	GAC	0.494382		TCGA-LB-A7SX-01A-11D-A33T-08	0.388	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	0	0	1		2	2	2	0	0	0	0	110	0	110	110	1	1.650000	-3.314926	1	0.640000	NM_001004481		0	18	17	0	569	567	0	0	1			0	0	110	0	0	0.999981	0	0	0	0	0	0	18	569
TBC1D8B	54885	broad.mit.edu	37	X	106111641	106111641	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:106111641C>T	ENST00000357242.5	+	18	2921	c.2747C>T	c.(2746-2748)tCt>tTt	p.S916F	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.S910F	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	916							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAAGTGAAATCTAAGGATGCT	0.343																																						ENST00000357242.5	0.220000	6.000000e-02	1.800000e-01	9.000000e-02	0.120000	0.138071	0.120000	0.130000																										0				47						c.(2746-2748)tCt>tTt		TBC1 domain family, member 8B (with GRAM domain)							84.0	77.0	80.0					X																	106111641		2202	4299	6501	SO:0001583	missense	54885	0	0					g.chrX:106111641C>T	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.2747C>T	chrX.hg19:g.106111641C>T	ENSP00000349781:p.Ser916Phe						TBC1D8B_ENST00000276175.3_Missense_Mutation_p.S910F	p.S916F	NM_017752.2	NP_060222.2	0	1	1		Q0IIM8	TBC8B_HUMAN		18	2921	+			B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	ENST00000357242.5	1	1	hg19	c.2747C>T	CCDS14522.1	0	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514460	0.27123	.	.	ENSG00000133138	ENST00000357242;ENST00000276175;ENST00000394972	T;T	0.08720	3.06;3.06	5.88	2.91	0.33838	5.88	2.91	0.33838	EF-hand-like domain (1);	0.641843	0.14963	N	0.288267	T	0.07818	0.0196	L	0.59436	1.845	0.25619	N	0.986428	B	0.15473	0.013	B	0.17979	0.02	T	0.47058	-0.9146	10	0.09338	T	0.73	1.5005	5.2383	0.15458	0.1503:0.6334:0.1307:0.0856	.	916	Q0IIM8	TBC8B_HUMAN	F	916;910;178	ENSP00000349781:S916F;ENSP00000276175:S910F	ENSP00000276175:S910F	S	+	2	0	0	TBC1D8B	105998297	105998297	0.551000	0.26497	0.029000	0.17559	0.958000	0.62258	1.060000	0.30530	0.140000	0.18849	0.600000	0.82982	TCT	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.343	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	0	0	1		2	2	2	0	0	0	0	47	0	47	47	1	1.650000	-12.409540	1	0.640000	NM_017752		0	11	11	0	258	257	0	0	1	1		0	0	47	0	0	0.998397	7.260425e-02	0	3	0	7	0	11	258
RGAG1	57529	broad.mit.edu	37	X	109697313	109697313	+	Silent	SNP	A	A	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:109697313A>G	ENST00000465301.2	+	3	3714	c.3468A>G	c.(3466-3468)gaA>gaG	p.E1156E	RGAG1_ENST00000540313.1_Silent_p.E1156E	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1156										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						AAGAGCAGGAAGCAGCCCGGG	0.512																																						ENST00000465301.2	0.430000	2.400000e-01	3.900000e-01	2.800000e-01	0.330000	0.341234	0.330000	0.340000																										0				73						c.(3466-3468)gaA>gaG		retrotransposon gag domain containing 1							103.0	96.0	98.0					X																	109697313		2203	4300	6503	SO:0001819	synonymous_variant	57529	0	0					g.chrX:109697313A>G	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3468A>G	chrX.hg19:g.109697313A>G							RGAG1_ENST00000540313.1_Silent_p.E1156E	p.E1156E	NM_020769.2	NP_065820.1	0	1	1		Q8NET4	RGAG1_HUMAN		3	3714	+			Q9P2M8	Silent	SNP	ENST00000465301.2	1	1	hg19	c.3468A>G	CCDS14552.1	0																																																																																								0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	1	0	1		2	2	2	0	0	0	0	94	0	94	92	1	1.650000	-16.566330	1	0.640000	NM_020769		0	47	46	0	390	386	1	0	1	0		0	0	94	0	0	1.000000	0	0	0	0	1	0	47	390
ZNF645	158506	broad.mit.edu	37	X	22292031	22292031	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:22292031C>T	ENST00000323684.1	+	1	967	c.923C>T	c.(922-924)tCg>tTg	p.S308L		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	308	Pro-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						ACTCCTAACTCGGTTCGTAGC	0.448																																						ENST00000323684.1	0.180000	7.000000e-02	1.500000e-01	9.000000e-02	0.120000	0.127714	0.120000	0.120000																										0				27						c.(922-924)tCg>tTg		zinc finger protein 645							136.0	104.0	115.0					X																	22292031		2203	4300	6503	SO:0001583	missense	158506	0	0					g.chrX:22292031C>T	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.923C>T	chrX.hg19:g.22292031C>T	ENSP00000323348:p.Ser308Leu							p.S308L	NM_152577.3	NP_689790.1	0	1	1		Q8N7E2	ZN645_HUMAN		1	967	+			A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	1	1	hg19	c.923C>T	CCDS14205.1	0	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.552333	0.00918	.	.	ENSG00000175809	ENST00000323684	T	0.30182	1.54	2.42	-1.52	0.08637	2.42	-1.52	0.08637	.	0.974552	0.08262	N	0.972933	T	0.07773	0.0195	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34800	-0.9814	10	0.07030	T	0.85	.	6.635	0.22877	0.0:0.4115:0.0:0.5885	.	308	Q8N7E2	ZN645_HUMAN	L	308	ENSP00000323348:S308L	ENSP00000323348:S308L	S	+	2	0	0	ZNF645	22201952	22201952	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	2.686000	0.46968	-0.498000	0.06632	-0.366000	0.07423	TCG	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.448	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	0	0	1		2	2	2	0	0	0	0	93	0	93	91	1	1.650000	-3.067490	1	0.640000	NM_152577		0	26	26	0	632	628	0	0	1			0	0	93	0	0	1.000000	0	0	0	0	0	0	26	632
MAGEB4	4115	broad.mit.edu	37	X	30260943	30260943	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:30260943G>A	ENST00000378982.2	+	1	887	c.691G>A	c.(691-693)Gat>Aat	p.D231N	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	231	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GGGGATCTATGATGGAAAGAG	0.473																																						ENST00000378982.2	0.140000	4.000000e-02	1.100000e-01	5.000000e-02	0.080000	0.089354	0.080000	0.080000																										0				27						c.(691-693)Gat>Aat		melanoma antigen family B, 4							76.0	72.0	74.0					X																	30260943		2202	4300	6502	SO:0001583	missense	4115	0	0					g.chrX:30260943G>A		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.691G>A	chrX.hg19:g.30260943G>A	ENSP00000368266:p.Asp231Asn						MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	p.D231N	NM_002367.3	NP_002358.1	0	1	1		O15481	MAGB4_HUMAN		1	887	+			B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	1	1	hg19	c.691G>A	CCDS14221.1	0	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209960	0.39003	.	.	ENSG00000120289	ENST00000378982	T	0.05025	3.51	3.31	1.44	0.22558	3.31	1.44	0.22558	.	0.365804	0.22917	U	0.054080	T	0.22282	0.0537	M	0.88181	2.935	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.05632	-1.0873	10	0.48119	T	0.1	.	3.927	0.09269	0.1458:0.2453:0.609:0.0	.	231	O15481	MAGB4_HUMAN	N	231	ENSP00000368266:D231N	ENSP00000368266:D231N	D	+	1	0	0	MAGEB4	30170864	30170864	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.003000	0.12901	0.252000	0.21531	-0.192000	0.12808	GAT	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.473	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	0	0	1		2	2	2	0	0	0	0	62	0	62	62	1	1.650000	-3.362688	1	0.640000	NM_002367		0	12	12	0	440	435	0	0	1			0	0	62	0	0	0.999078	0	0	0	0	0	0	12	440
SHROOM4	57477	broad.mit.edu	37	X	50377159	50377159	+	Silent	SNP	A	A	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:50377159A>G	ENST00000289292.7	-	4	2197	c.1914T>C	c.(1912-1914)tcT>tcC	p.S638S	SHROOM4_ENST00000460112.3_Silent_p.S522S|SHROOM4_ENST00000376020.2_Silent_p.S638S			Q9ULL8	SHRM4_HUMAN	shroom family member 4	638					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					AAGATAGAAGAGATGTGTTAG	0.522																																						ENST00000289292.7	0.430000	2.400000e-01	3.900000e-01	2.800000e-01	0.330000	0.339198	0.330000	0.340000																										0				52						c.(1912-1914)tcT>tcC		shroom family member 4							57.0	60.0	59.0					X																	50377159		2203	4300	6503	SO:0001819	synonymous_variant	57477	0	0					g.chrX:50377159A>G	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1914T>C	chrX.hg19:g.50377159A>G							SHROOM4_ENST00000460112.3_Silent_p.S522S|SHROOM4_ENST00000376020.2_Silent_p.S638S	p.S638S			0	1	1		Q9ULL8	SHRM4_HUMAN		4	2197	-	Ovarian(276;0.236)		A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	1	1	hg19	c.1914T>C	CCDS35277.1	0																																																																																								0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.522	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	1	0	1		2	2	2	0	0	0	0	58	0	58	58	1	1.650000	-15.636670	1	0.640000	NM_020717		0	44	42	0	368	366	1	0	1	0		0	0	58	0	0	1.000000	1.727114e-01	0	0	0	7	0	44	368
TRO	7216	broad.mit.edu	37	X	54956406	54956406	+	Silent	SNP	C	C	T			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:54956406C>T	ENST00000173898.7	+	12	3361	c.3249C>T	c.(3247-3249)gtC>gtT	p.V1083V	SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375041.2_Silent_p.V686V|TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000420798.2_Silent_p.V614V|TRO_ENST00000319167.8_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1083	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GTGGTGCTGTCAGCACCAGTG	0.592																																						ENST00000173898.7	0.200000	5.000000e-02	1.600000e-01	8.000000e-02	0.110000	0.125638	0.110000	0.120000																										0				37						c.(3247-3249)gtC>gtT		trophinin							29.0	28.0	28.0					X																	54956406		2049	4175	6224	SO:0001819	synonymous_variant	7216	0	0					g.chrX:54956406C>T	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3249C>T	chrX.hg19:g.54956406C>T							TRO_ENST00000420798.2_Silent_p.V614V|TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Silent_p.V686V|TRO_ENST00000319167.8_Intron|SNORA11_ENST00000408823.1_RNA	p.V1083V	NM_001039705.2	NP_001034794.1	0	1	1		Q12816	TROP_HUMAN		12	3361	+			B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	1	1	hg19	c.3249C>T	CCDS43959.1	0																																																																																								0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.592	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	0	0	1		2	2	2	0	0	0	0	58	0	58	58	1	1.650000	-11.431290	1	0.640000	NM_016157		0	10	9	0	261	260	0	0	1			0	0	58	0	0	0.996917	0	0	0	0	0	0	10	261
HDAC8	55869	broad.mit.edu	37	X	71788701	71788701	+	Silent	SNP	C	C	T	rs373199509		TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:71788701C>T	ENST00000373573.3	-	3	539	c.198G>A	c.(196-198)gaG>gaA	p.E66E	HDAC8_ENST00000373554.1_Silent_p.E66E|HDAC8_ENST00000373571.1_Silent_p.E66E|HDAC8_ENST00000373559.4_Intron|HDAC8_ENST00000373556.3_Silent_p.E66E|HDAC8_ENST00000478743.1_5'UTR|HDAC8_ENST00000439122.2_Silent_p.E66E|HDAC8_ENST00000373583.1_Intron|HDAC8_ENST00000373589.4_Intron|HDAC8_ENST00000373560.2_Silent_p.E66E|HDAC8_ENST00000373561.4_Silent_p.E66E|HDAC8_ENST00000429103.2_5'UTR	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	66	Histone deacetylase.				chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	AGGTGGCCATCTCCTCCATGG	0.483																																						ENST00000373573.3	0.230000	3.000000e-02	1.700000e-01	6.000000e-02	0.110000	0.122880	0.110000	0.100000																										0				10						c.(196-198)gaG>gaA		histone deacetylase 8	Vorinostat(DB02546)						96.0	73.0	81.0					X																	71788701		2203	4300	6503	SO:0001819	synonymous_variant	55869	0	0					g.chrX:71788701C>T	AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.198G>A	chrX.hg19:g.71788701C>T							HDAC8_ENST00000373561.4_Silent_p.E66E|HDAC8_ENST00000373583.1_Intron|HDAC8_ENST00000439122.2_Silent_p.E66E|HDAC8_ENST00000373556.3_Silent_p.E66E|HDAC8_ENST00000478743.1_5'UTR|HDAC8_ENST00000429103.2_5'UTR|HDAC8_ENST00000373571.1_Silent_p.E66E|HDAC8_ENST00000373559.4_Intron|HDAC8_ENST00000373589.4_Intron|HDAC8_ENST00000373560.2_Silent_p.E66E|HDAC8_ENST00000373554.1_Silent_p.E66E	p.E66E	NM_018486.2	NP_060956.1	0	1	1		Q9BY41	HDAC8_HUMAN		3	539	-	Renal(35;0.156)		A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Silent	SNP	ENST00000373573.3	0	1	hg19	c.198G>A	CCDS14420.1	0																																																																																								0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.483	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057193.2	0	0	1		2	2	2	0	0	0	0	31	0	31	31	1	1.650000	-8.322308	1	0.640000	NM_018486		0	5	5	0	145	145	0	0	1	1		0	0	31	0	0	0.938608	1.099400e-01	0	4	0	10	0	5	145
IL9R	3581	broad.mit.edu	37	X	155239804	155239804	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A7SX-01A-11D-A33T-08	TCGA-LB-A7SX-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4b53f23-f5e7-431d-b4f7-05291a2a2817	1812ab16-427e-4d05-896f-58697b0f3805	g.chrX:155239804C>G	ENST00000244174.5	+	9	1475	c.1296C>G	c.(1294-1296)agC>agG	p.S432R	IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000369423.2_3'UTR|IL9R_ENST00000424344.3_Missense_Mutation_p.S411R	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	432	Poly-Ser.				cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gcaggagcagcagcagcagca	0.627																																						ENST00000244174.5	0.390000	7.000000e-02	3.000000e-01	1.200000e-01	0.200000	0.216565	0.200000	0.180000																										0				23						c.(1294-1296)agC>agG		interleukin 9 receptor							17.0	27.0	24.0					X																	155239804		2201	4295	6496	SO:0001583	missense	3581	13	115670	29				g.chrX:155239804C>G	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1296C>G	chrX.hg19:g.155239804C>G	ENSP00000244174:p.Ser432Arg						IL9R_ENST00000369423.2_3'UTR|IL9R_ENST00000424344.3_Missense_Mutation_p.S411R|IL9R_ENST00000540897.1_3'UTR	p.S432R	NM_002186.2	NP_002177.2	0	1	1		Q01113	IL9R_HUMAN		9	1475	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	0	1	hg19	c.1296C>G	CCDS14771.4	0	.	.	.	.	.	.	.	.	.	.	c	9.402	1.078258	0.20227	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.10860	2.83;2.83	0.195	0.195	0.15151	0.195	0.195	0.15151	.	3.852910	0.00870	N	0.002015	T	0.14356	0.0347	.	.	.	0.09310	N	1	P	0.42518	0.782	P	0.46110	0.504	T	0.20806	-1.0264	8	0.48119	T	0.1	-15.0951	.	.	.	.	432	Q01113	IL9R_HUMAN	R	432;411	ENSP00000244174:S432R;ENSP00000388918:S411R	ENSP00000244174:S432R	S	+	3	2	2	IL9R	154892998	154892998	0.001000	0.12720	0.005000	0.12908	0.005000	0.04900	-0.363000	0.07593	0.283000	0.22279	0.287000	0.19450	AGC	0.640000		TCGA-LB-A7SX-01A-11D-A33T-08	0.627	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	0	0	1		2	2	2	0	0	0	0	14	0	14	12	1	1.650000	-2.451345	0	0.640000	NM_002186		0	5	5	0	79	78	0	0	1			0	0	14	0	0	0.937548	0	0	0	0	0	0	5	79
