#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
HIP1R	9026	broad.mit.edu	37	12	123333155	123333170	+	Splice_Site	DEL	TGTGAGTAGCAGCTGC	TGTGAGTAGCAGCTGC	-	rs368178583		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr12:123333155_123333170delTGTGAGTAGCAGCTGC	ENST00000253083.4	+	3	425	c.300delTGTGAGTAGCAGCTGC	c.(298-300)aat>aa	p.N100fs		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	100	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GGCACCCCAATGTGAGTAGCAGCTGCTGCCTCTGCT	0.662																																						ENST00000253083.4	1.000000	3.200000e-01	6.900000e-01	4.200000e-01	0.530000	0.564014	0.530000	0.520000																										0				26						c.(298-300)aat>aa		huntingtin interacting protein 1 related																																				SO:0001630	splice_region_variant	9026	0	0					g.chr12:123333155_123333170delTGTGAGTAGCAGCTGC	AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.300+1TGTGAGTAGCAGCTGC>-	chr12.hg19:g.123333155_123333170delTGTGAGTAGCAGCTGC		1						p.N100fs	NM_003959.1	NP_003950.1	0	2	2	1.790666	O75146	HIP1R_HUMAN		3	425	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		A6NHQ6|Q6NXG8|Q9UED9	Splice_Site	DEL	ENST00000253083.4	1	1	hg19	c.300delTGTGAGTAGCAGCTGC	CCDS31922.1	0																																																																																								0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.662	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	0	0	1		19	2		0	0	0	3	80	0	80	80	1	3.010000	-19.999570	1	0.330000	NM_003959	Frame_Shift_Del	0	17	38	0	180	200	0	0	1	0	0	0	0	80	0	0	0.657441	6.571390e-01	0	0	0	25	0	17	180
HELB	92797	broad.mit.edu	37	12	66709127	66709128	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr12:66709127_66709128insA	ENST00000247815.4	+	6	2023_2024	c.1964_1965insA	c.(1963-1968)agagcafs	p.A656fs		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	656					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		ACAAACCATAGAGCAGAATCTC	0.342																																						ENST00000247815.4	0.720000	4.200000e-01	6.400000e-01	4.800000e-01	0.550000	0.566635	0.550000	0.560000																										0				40						c.(1963-1968)agagcafs		helicase (DNA) B																																				SO:0001589	frameshift_variant	92797	0	0					g.chr12:66709127_66709128insA	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.1965dupA	chr12.hg19:g.66709128_66709128dupA	ENSP00000247815:p.Ala656fs	1						p.A656fs	NM_033647.3	NP_387467.2	1	2	3	1.998260	Q8NG08	HELB_HUMAN	GBM - Glioblastoma multiforme(2;0.000142)	6	2023_2024	+			A8K4C9|Q4G0T2|Q9H7L5	Frame_Shift_Ins	INS	ENST00000247815.4	0	1	hg19	c.1964_1965insA	CCDS8976.1	0																																																																																								0.424077		TCGA-LB-A8F3-01A-11D-A36O-08	0.342	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1	1	0	1		2			0	0	0	0	164	0	164	160	1	3.010000	-2.966611	1	0.330000			0	54	54	0	627	616	0	0	1		0	0	0	164	0	0	1.000000		0	0	0	0	0	54	627
WDFY3	23001	broad.mit.edu	37	4	85678099	85678099	+	Frame_Shift_Del	DEL	G	G	-	rs138292353		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr4:85678099delG	ENST00000295888.4	-	33	5811	c.5404delC	c.(5404-5406)cggfs	p.R1802fs	WDFY3_ENST00000322366.6_Frame_Shift_Del_p.R1802fs	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1802					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGCTTACTCCGGCAGCTGATG	0.488																																						ENST00000295888.4	1.000000	4.100000e-01	6.400000e-01	4.600000e-01	0.520000	0.585698	0.520000	0.510000																										0				134						c.(5404-5406)cggfs		WD repeat and FYVE domain containing 3							121.0	125.0	123.0					4																	85678099		2203	4300	6503	SO:0001589	frameshift_variant	23001	0	0					g.chr4:85678099delG	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5404delC	chr4.hg19:g.85678099delG	ENSP00000295888:p.Arg1802fs	0					WDFY3_ENST00000322366.6_Frame_Shift_Del_p.R1802fs	p.R1802fs	NM_014991.4	NP_055806.2	1	2	3	1.943468	Q8IZQ1	WDFY3_HUMAN		33	5811	-		Hepatocellular(203;0.114)	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Frame_Shift_Del	DEL	ENST00000295888.4	0	1	hg19	c.5404delC	CCDS3609.1	0																																																																																								0.410704		TCGA-LB-A8F3-01A-11D-A36O-08	0.488	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	1	0	1		36			0	0	0	5	248	0	248	244	1	3.010000	-3.221883	1	0.330000	NM_014991		0	75	83	0	924	918	0	0	1		0	0	0	248	0	0	0.999961		0	0	0	0	0	75	924
SP4	6671	broad.mit.edu	37	7	21469543	21469544	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr7:21469543_21469544insT	ENST00000222584.3	+	3	978_979	c.760_761insT	c.(760-762)gtafs	p.V254fs		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	254					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GGCTCAAGTTGTAACAACCCTA	0.5																																						ENST00000222584.3	1.000000	6.600000e-01	1	7.600000e-01	0.890000	0.886725	0.890000	1.000000																										0				35						c.(760-762)gtafs		Sp4 transcription factor																																				SO:0001589	frameshift_variant	6671	0	0					g.chr7:21469543_21469544insT		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.761dupT	chr7.hg19:g.21469544_21469544dupT	ENSP00000222584:p.Val254fs	1						p.V254fs	NM_003112.3	NP_003103.2	1	3	4	2.209617	Q02446	SP4_HUMAN		3	978_979	+			O60402|Q32M52	Frame_Shift_Ins	INS	ENST00000222584.3	0	1	hg19	c.760_761insT	CCDS5373.1	1																																																																																								0.480781		TCGA-LB-A8F3-01A-11D-A36O-08	0.500	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	1	0	1		2			0	0	0	0	114	0	114	114	1	3.010000	-20.000000	1	0.330000	NM_003112		0	46	49	0	365	363	0	0	1		0	0	0	114	0	0	1.000000		0	0	0	0	0	46	365
LZTS2	84445	broad.mit.edu	37	10	102763860	102763860	+	Silent	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr10:102763860C>T	ENST00000370220.1	+	2	4068	c.1005C>T	c.(1003-1005)gaC>gaT	p.D335D	LZTS2_ENST00000370223.3_Silent_p.D335D					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		AGCTCCGAGACCGGGAGGCAG	0.632																																					Esophageal Squamous(8;38 437 13604 19902 37640)	ENST00000370220.1	1.000000	1.300000e-01	1	2.000000e-01	0.300000	0.450094	0.300000	0.250000																										0				22						c.(1003-1005)gaC>gaT		leucine zipper, putative tumor suppressor 2							43.0	47.0	45.0					10																	102763860		2201	4297	6498	SO:0001819	synonymous_variant	84445	0	0					g.chr10:102763860C>T	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1005C>T	chr10.hg19:g.102763860C>T		0					LZTS2_ENST00000370223.3_Silent_p.D335D	p.D335D			2	2	4	2.031040				2	4068	+				Silent	SNP	ENST00000370220.1	1	1	hg19	c.1005C>T	CCDS7507.1	0																																																																																								0.436074		TCGA-LB-A8F3-01A-11D-A36O-08	0.632	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	0	0	1		2	2	2	0	0	0	0	86	0	86	85	1	3.010000	-10.580220	1	0.330000	XM_046743		0	9	9	0	246	241	0	0	1	1		0	0	86	0	0	0.993925	9.851449e-01	0	10	0	192	0	9	246
ATE1	11101	broad.mit.edu	37	10	123503198	123503198	+	Silent	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr10:123503198G>A	ENST00000224652.6	-	12	1639	c.1554C>T	c.(1552-1554)aaC>aaT	p.N518N	ATE1_ENST00000543447.1_Silent_p.N403N|ATE1_ENST00000540606.1_Silent_p.N511N|ATE1_ENST00000369040.3_Silent_p.N422N|ATE1_ENST00000369043.3_Silent_p.N518N|ATE1_ENST00000535655.1_Silent_p.N219N	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1	518					protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				GAACAGGTCAGTTTCTGAACA	0.522																																						ENST00000224652.6	1.000000	2.300000e-01	1	3.300000e-01	0.470000	0.571444	0.470000	0.400000																										0				14						c.(1552-1554)aaC>aaT		arginyltransferase 1							72.0	60.0	64.0					10																	123503198		2203	4300	6503	SO:0001819	synonymous_variant	11101	0	0					g.chr10:123503198G>A	AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.1554C>T	chr10.hg19:g.123503198G>A		0					ATE1_ENST00000369040.3_Silent_p.N422N|ATE1_ENST00000540606.1_Silent_p.N511N|ATE1_ENST00000543447.1_Silent_p.N403N|ATE1_ENST00000369043.3_Silent_p.N518N|ATE1_ENST00000535655.1_Silent_p.N219N	p.N518N	NM_001001976.1	NP_001001976.1	2	2	4	2.031040	O95260	ATE1_HUMAN		12	1639	-		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)	O95261|Q5SQQ3|Q8WW04	Silent	SNP	ENST00000224652.6	1	1	hg19	c.1554C>T	CCDS31300.1	0																																																																																								0.436074		TCGA-LB-A8F3-01A-11D-A36O-08	0.522	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0	0	0	0	36	0	36	36	1	3.010000	-14.619200	1	0.330000	NM_001001976		0	11	11	0	183	181	0	0	1	0		0	0	36	0	0	0.998391	8.528621e-02	0	0	0	8	0	11	183
CALCA	796	broad.mit.edu	37	11	14991575	14991575	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr11:14991575C>T	ENST00000486207.1	-	2	141	c.133G>A	c.(133-135)Gac>Aac	p.D45N	CALCA_ENST00000361010.3_Missense_Mutation_p.D45N|CALCA_ENST00000396372.2_Missense_Mutation_p.D45N|CALCA_ENST00000331587.4_Missense_Mutation_p.D45N|CALCA_ENST00000359642.3_Missense_Mutation_p.D45N|CALCB_ENST00000523376.1_Intron			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	45					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						CGCGCTTCGTCCTCACTGAGC	0.647											OREG0020791	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000486207.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				8						c.(133-135)Gac>Aac		calcitonin-related polypeptide alpha							41.0	41.0	41.0					11																	14991575		2200	4294	6494	SO:0001583	missense	796	0	0					g.chr11:14991575C>T	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.133G>A	chr11.hg19:g.14991575C>T	ENSP00000417833:p.Asp45Asn	1		OREG0020791	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	699	CALCA_ENST00000361010.3_Missense_Mutation_p.D45N|CALCA_ENST00000396372.2_Missense_Mutation_p.D45N|CALCB_ENST00000523376.1_Intron|CALCA_ENST00000359642.3_Missense_Mutation_p.D45N|CALCA_ENST00000331587.4_Missense_Mutation_p.D45N	p.D45N			0	3	3	2.028607	P06881	CALCA_HUMAN		2	141	-			Q93048|Q9UCP0	Missense_Mutation	SNP	ENST00000486207.1	1	1	hg19	c.133G>A	CCDS31432.1	1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460413	0.43736	.	.	ENSG00000110680	ENST00000486207;ENST00000361010;ENST00000359642;ENST00000331587;ENST00000396372	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	4.83	3.86	0.44501	4.83	3.86	0.44501	.	0.545783	0.21140	N	0.079485	T	0.14313	0.0346	L	0.31926	0.97	0.80722	D	1	B;B	0.27316	0.175;0.084	B;B	0.27170	0.052;0.077	T	0.08472	-1.0720	10	0.30078	T	0.28	-17.1724	6.4121	0.21696	0.2889:0.6144:0.0:0.0967	.	45;45	P01258;P06881	CALC_HUMAN;CALCA_HUMAN	N	45	ENSP00000417833:D45N;ENSP00000354286:D45N;ENSP00000352663:D45N;ENSP00000331746:D45N;ENSP00000379657:D45N	ENSP00000331746:D45N	D	-	1	0	0	CALCA	14948151	14948151	0.968000	0.33430	0.098000	0.21074	0.081000	0.17604	2.326000	0.43849	1.312000	0.45043	0.655000	0.94253	GAC	0.421616		TCGA-LB-A8F3-01A-11D-A36O-08	0.647	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	1	0	1		2	2	2	0	0	0	0	30	0	30	29	1	3.010000	-20.000000	1	0.330000	NM_001741		0	46	46	0	114	112	1	0	1			0	0	30	0	0	1.000000	0	0	0	0	0	0	46	114
ALX4	60529	broad.mit.edu	37	11	44286499	44286499	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr11:44286499C>G	ENST00000329255.3	-	4	1244	c.1141G>C	c.(1141-1143)Gag>Cag	p.E381Q		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	381					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						CCGTTGAGCTCGTAGCCATTG	0.652																																						ENST00000329255.3	1.000000	1.800000e-01	1	2.400000e-01	0.330000	0.462232	0.330000	0.300000																										0				16						c.(1141-1143)Gag>Cag		ALX homeobox 4							57.0	52.0	54.0					11																	44286499		2203	4299	6502	SO:0001583	missense	60529	1	121380	32				g.chr11:44286499C>G	AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.1141G>C	chr11.hg19:g.44286499C>G	ENSP00000332744:p.Glu381Gln	1						p.E381Q	NM_021926.3	NP_068745.2	1	3	4	2.093733	Q9H161	ALX4_HUMAN		4	1244	-			Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	ENST00000329255.3	1	1	hg19	c.1141G>C	CCDS31468.1	0	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455312	0.84209	.	.	ENSG00000052850	ENST00000329255	D	0.90563	-2.69	5.19	5.19	0.71726	5.19	5.19	0.71726	.	0.059235	0.64402	D	0.000002	D	0.90903	0.7141	L	0.46157	1.445	0.42428	D	0.992668	D	0.53312	0.959	P	0.54759	0.76	D	0.89026	0.3438	10	0.28530	T	0.3	.	13.9861	0.64337	0.1515:0.8485:0.0:0.0	.	381	Q9H161	ALX4_HUMAN	Q	381	ENSP00000332744:E381Q	ENSP00000332744:E381Q	E	-	1	0	0	ALX4	44243075	44243075	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.538000	0.67193	2.575000	0.86900	0.561000	0.74099	GAG	0.451314		TCGA-LB-A8F3-01A-11D-A36O-08	0.652	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390399.1	0	0	1		2	2	2	0	0	0	0	94	0	94	93	1	3.010000	-3.094407	1	0.330000			0	15	14	0	356	353	0	0	1			0	0	94	0	0	0.999868	0	0	0	0	0	0	15	356
OR8K1	390157	broad.mit.edu	37	11	56113884	56113884	+	Missense_Mutation	SNP	A	A	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr11:56113884A>G	ENST00000279783.2	+	1	464	c.370A>G	c.(370-372)Atg>Gtg	p.M124V		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					TCTATCAGCAATGGCCTATGA	0.403										HNSCC(65;0.19)																												ENST00000279783.2	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				33						c.(370-372)Atg>Gtg		olfactory receptor, family 8, subfamily K, member 1							199.0	199.0	199.0					11																	56113884		2201	4296	6497	SO:0001583	missense	390157	0	0					g.chr11:56113884A>G	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.370A>G	chr11.hg19:g.56113884A>G	ENSP00000279783:p.Met124Val	1	HNSCC(65;0.19)					p.M124V	NM_001002907.1	NP_001002907.1	1	3	4	2.093733	Q8NGG5	OR8K1_HUMAN		1	464	+	Esophageal squamous(21;0.00448)		B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	1	1	hg19	c.370A>G	CCDS31528.1	1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.528822	0.64860	.	.	ENSG00000150261	ENST00000279783	T	0.00995	5.46	5.0	5.0	0.66597	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.04227	0.0117	H	0.94964	3.605	0.45216	D	0.99822	P	0.51537	0.946	P	0.44647	0.456	T	0.08700	-1.0709	10	0.87932	D	0	-28.0834	14.7062	0.69191	1.0:0.0:0.0:0.0	.	124	Q8NGG5	OR8K1_HUMAN	V	124	ENSP00000279783:M124V	ENSP00000279783:M124V	M	+	1	0	0	OR8K1	55870460	55870460	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.771000	0.91751	1.862000	0.54008	0.448000	0.29417	ATG	0.451314		TCGA-LB-A8F3-01A-11D-A36O-08	0.403	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	1	0	1		2	2	2	0	0	0	0	313	0	313	313	1	3.010000	-20.000000	1	0.330000	NM_001002907		0	245	244	0	796	783	1	0	1			0	0	313	0	0	1.000000	0	0	0	0	0	0	245	796
CACNA1C	775	broad.mit.edu	37	12	2566843	2566843	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr12:2566843G>A	ENST00000347598.4	+	5	728	c.728G>A	c.(727-729)cGc>cAc	p.R243H	CACNA1C_ENST00000406454.3_Missense_Mutation_p.R243H|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R243H|CACNA1C_ENST00000480911.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399634.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R243H|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R243H|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R243H|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R243H	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	243					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGCGTGCTGCGCCCCCTGCGG	0.562																																						ENST00000347598.4	1.000000	3.700000e-01	5.700000e-01	4.300000e-01	0.490000	0.520366	0.490000	0.500000																										0				132						c.(727-729)cGc>cAc		calcium channel, voltage-dependent, L type, alpha 1C subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						162.0	183.0	176.0					12																	2566843		2142	4235	6377	SO:0001583	missense	775	0	0					g.chr12:2566843G>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.728G>A	chr12.hg19:g.2566843G>A	ENSP00000266376:p.Arg243His	1					CACNA1C_ENST00000399637.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000480911.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R243H|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R243H|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399634.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R243H|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R243H|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R243H|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R243H	p.R243H	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	2	2	4	2.238903	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	5	728	+			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	1	1	hg19	c.728G>A	CCDS44788.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834960	0.91036	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99591	-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24	4.15	4.15	0.48705	4.15	4.15	0.48705	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	H	0.99965	5.09	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.995;0.996;1.0;0.997;0.998;0.993;0.998;1.0;1.0;0.998;0.994;0.998;1.0;0.998;1.0;0.989;0.998;0.998;0.993;0.993	D	0.95822	0.8850	10	0.87932	D	0	.	16.6608	0.85240	0.0:0.0:1.0:0.0	.	243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	H	243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;243;84	ENSP00000336982:R243H;ENSP00000382563:R243H;ENSP00000437936:R243H;ENSP00000382552:R243H;ENSP00000382547:R243H;ENSP00000382506:R243H;ENSP00000382530:R243H;ENSP00000382546:R243H;ENSP00000382500:R243H;ENSP00000382549:R243H;ENSP00000266376:R243H;ENSP00000382515:R243H;ENSP00000382510:R243H;ENSP00000341092:R243H;ENSP00000382537:R243H;ENSP00000329877:R243H;ENSP00000382557:R243H;ENSP00000385724:R243H;ENSP00000382512:R243H;ENSP00000382542:R243H;ENSP00000382526:R243H;ENSP00000385896:R243H;ENSP00000382504:R243H	ENSP00000323129:R84H	R	+	2	0	0	CACNA1C	2437104	2437104	1.000000	0.71417	0.997000	0.53966	0.807000	0.45602	9.542000	0.98086	2.139000	0.66308	0.563000	0.77884	CGC	0.488628		TCGA-LB-A8F3-01A-11D-A36O-08	0.562	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	0	0	1		12	2	2	1	0	1	1	366	0	366	361	1	3.010000	-9.918375	1	0.330000	NM_000719		0	66	65	0	1002	981	0	0	1			1	0	366	0	0	1.000000	0	0	0	0	0	0	66	1002
KCNA6	3742	broad.mit.edu	37	12	4920759	4920759	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr12:4920759C>T	ENST00000280684.3	+	1	2418	c.1552C>T	c.(1552-1554)Cgg>Tgg	p.R518W	KCNA6_ENST00000433855.1_Missense_Mutation_p.R518W|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	518					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	TACACCACATCGGGCCTATGC	0.597										HNSCC(72;0.22)																												ENST00000280684.3	1.000000	1.400000e-01	3.900000e-01	2.100000e-01	0.280000	0.326409	0.280000	0.270000																										0				49						c.(1552-1554)Cgg>Tgg		potassium voltage-gated channel, shaker-related subfamily, member 6	Dalfampridine(DB06637)						61.0	64.0	63.0					12																	4920759		2203	4300	6503	SO:0001583	missense	3742	0	0					g.chr12:4920759C>T	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.1552C>T	chr12.hg19:g.4920759C>T	ENSP00000280684:p.Arg518Trp	1	HNSCC(72;0.22)				RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.R518W	p.R518W			2	2	4	2.238903	P17658	KCNA6_HUMAN		1	2418	+				Missense_Mutation	SNP	ENST00000280684.3	1	1	hg19	c.1552C>T	CCDS8534.1	0	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935726	0.34189	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97553	-4.43;-4.43	4.97	4.01	0.46588	4.97	4.01	0.46588	.	0.394655	0.23474	N	0.047785	D	0.95027	0.8390	N	0.19112	0.55	0.31860	N	0.62104	D	0.76494	0.999	P	0.53809	0.735	D	0.93607	0.6935	10	0.31617	T	0.26	.	14.9663	0.71196	0.1522:0.8478:0.0:0.0	.	518	P17658	KCNA6_HUMAN	W	518	ENSP00000408321:R518W;ENSP00000280684:R518W	ENSP00000280684:R518W	R	+	1	2	2	KCNA6	4791020	4791020	1.000000	0.71417	1.000000	0.80357	0.119000	0.20118	5.194000	0.65125	2.578000	0.87016	0.655000	0.94253	CGG	0.488628		TCGA-LB-A8F3-01A-11D-A36O-08	0.597	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	0	0	1		2	2	2	0	0	0	0	106	0	106	106	1	3.010000	-3.291887	1	0.330000	NM_002235		0	12	12	0	337	336	0	0	1			0	0	106	0	0	0.999124	0	0	0	0	0	0	12	337
TSPAN11	441631	broad.mit.edu	37	12	31116773	31116773	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr12:31116773G>T	ENST00000261177.9	+	3	156	c.97G>T	c.(97-99)Gcc>Tcc	p.A33S	TSPAN11_ENST00000546076.1_Missense_Mutation_p.A33S|TSPAN11_ENST00000535215.1_5'UTR|TSPAN11_ENST00000544427.1_Missense_Mutation_p.A23S	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	33						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CGGGGGAGCAGCCGTCCTGGC	0.662																																						ENST00000261177.9	0.380000	1.000000e-01	3.000000e-01	1.500000e-01	0.220000	0.234310	0.220000	0.200000																										0				11						c.(97-99)Gcc>Tcc		tetraspanin 11							78.0	69.0	72.0					12																	31116773		2203	4300	6503	SO:0001583	missense	441631	0	0					g.chr12:31116773G>T		CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.97G>T	chr12.hg19:g.31116773G>T	ENSP00000261177:p.Ala33Ser	1					TSPAN11_ENST00000544427.1_Missense_Mutation_p.A23S|TSPAN11_ENST00000535215.1_5'UTR|TSPAN11_ENST00000546076.1_Missense_Mutation_p.A33S	p.A33S	NM_001080509.2	NP_001073978.1	2	2	4	2.302934	A1L157	TSN11_HUMAN		3	156	+	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		A1L158|B2RUX6	Missense_Mutation	SNP	ENST00000261177.9	1	1	hg19	c.97G>T	CCDS31765.1	0	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999666	0.35320	.	.	ENSG00000110900	ENST00000546076;ENST00000544427;ENST00000261177	T;T;T	0.80738	-1.41;-1.41;-1.41	3.5	2.6	0.31112	3.5	2.6	0.31112	.	0.149427	0.43919	U	0.000512	T	0.79112	0.4391	M	0.76328	2.33	0.20489	N	0.999896	P;B	0.35155	0.487;0.083	B;B	0.39465	0.3;0.177	T	0.68977	-0.5267	10	0.41790	T	0.15	.	8.7712	0.34733	0.1194:0.0:0.8806:0.0	.	23;33	F5H0F0;A1L157	.;TSN11_HUMAN	S	33;23;33	ENSP00000437403:A33S;ENSP00000439895:A23S;ENSP00000261177:A33S	ENSP00000261177:A33S	A	+	1	0	0	TSPAN11	31008040	31008040	0.999000	0.42202	0.004000	0.12327	0.645000	0.38454	6.020000	0.70826	0.571000	0.29365	0.457000	0.33378	GCC	0.496241		TCGA-LB-A8F3-01A-11D-A36O-08	0.662	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399888.1	0	0	1		2	2	2	0	0	0	0	97	0	97	94	1	3.010000	-9.287503	1	0.330000	XM_497334		0	9	9	0	332	327	0	0	1	0		0	0	97	0	0	0.993981	0	0	0	0	1	0	9	332
KRT74	121391	broad.mit.edu	37	12	52964517	52964517	+	Missense_Mutation	SNP	C	C	T	rs200558741		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr12:52964517C>T	ENST00000305620.2	-	5	991	c.944G>A	c.(943-945)cGc>cAc	p.R315H	KRT74_ENST00000549343.1_Missense_Mutation_p.R315H	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	315	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		ATAATGCATGCGGACCTCAGC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		17990	0.001		0.0	False		,,,				2504	0.0					ENST00000305620.2	1.000000	6.000000e-02	2.700000e-01	1.000000e-01	0.170000	0.217510	0.170000	0.150000																										0				28						c.(943-945)cGc>cAc		keratin 74							123.0	96.0	105.0					12																	52964517		2203	4300	6503	SO:0001583	missense	121391	1	121412	34				g.chr12:52964517C>T	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.944G>A	chr12.hg19:g.52964517C>T	ENSP00000307240:p.Arg315His	1					KRT74_ENST00000549343.1_Missense_Mutation_p.R315H	p.R315H	NM_175053.3	NP_778223.2	1	2	3	2.012148	Q7RTS7	K2C74_HUMAN		5	991	-			B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	0	1	hg19	c.944G>A	CCDS8832.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	9.276	1.046988	0.19748	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.93307	-3.2;-3.2	4.49	3.56	0.40772	4.49	3.56	0.40772	Filament (1);	0.000000	0.34291	N	0.004087	D	0.93973	0.8070	H	0.95187	3.635	0.09310	N	1	P	0.36633	0.562	B	0.36186	0.219	D	0.90228	0.4277	10	0.87932	D	0	.	6.036	0.19708	0.0:0.6265:0.0:0.3735	.	315	Q7RTS7	K2C74_HUMAN	H	315	ENSP00000447447:R315H;ENSP00000307240:R315H	ENSP00000307240:R315H	R	-	2	0	0	KRT74	51250784	51250784	0.000000	0.05858	0.644000	0.29465	0.067000	0.16453	-0.672000	0.05244	1.137000	0.42214	0.655000	0.94253	CGC	0.420791		TCGA-LB-A8F3-01A-11D-A36O-08	0.592	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	0	0	1		2	2	2	0	0	0	0	84	0	84	83	1	3.010000	-2.557965	1	0.330000	NM_175053		0	5	5	0	217	215	0	0	1			0	0	84	0	0	0.936758	0	0	0	0	0	0	5	217
MTMR6	9107	broad.mit.edu	37	13	25826043	25826043	+	Missense_Mutation	SNP	C	C	T	rs370493335		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr13:25826043C>T	ENST00000381801.5	-	12	2187	c.1426G>A	c.(1426-1428)Gaa>Aaa	p.E476K	MTMR6_ENST00000540661.1_Missense_Mutation_p.E476K	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	476	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		CTGTGAGATTCGGAACTGTAG	0.328													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16807	0.0		0.0	False		,,,				2504	0.0					ENST00000381801.5	1.000000	5.000000e-02	1.500000e-01	7.000000e-02	0.100000	0.168968	0.100000	0.110000																										0				36						c.(1426-1428)Gaa>Aaa		myotubularin related protein 6		C	LYS/GLU	0,4406		0,0,2203	116.0	132.0	126.0		1426	-5.0	0.0	13		126	1,8597	2.2+/-6.3	0,1,4298	no	missense	MTMR6	NM_004685.3	56	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	476/622	25826043	1,13003	2203	4299	6502	SO:0001583	missense	9107	7	121402	42				g.chr13:25826043C>T	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1426G>A	chr13.hg19:g.25826043C>T	ENSP00000371221:p.Glu476Lys	1					MTMR6_ENST00000540661.1_Missense_Mutation_p.E476K	p.E476K	NM_004685.3	NP_004676.3	1	2	3	1.973208	Q9Y217	MTMR6_HUMAN		12	2187	-		Lung SC(185;0.0225)|Breast(139;0.0351)	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	0	1	hg19	c.1426G>A	CCDS9313.1	0	.	.	.	.	.	.	.	.	.	.	C	3.298	-0.143515	0.06627	0.0	1.16E-4	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801;ENST00000319298	D;D	0.90133	-2.62;-2.62	5.63	-5.02	0.02982	5.63	-5.02	0.02982	Myotubularin phosphatase domain (1);	0.741247	0.14353	N	0.324976	T	0.78130	0.4235	L	0.31926	0.97	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.0	T	0.65717	-0.6100	10	0.07030	T	0.85	.	7.079	0.25221	0.0:0.2984:0.3046:0.397	.	476;476	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	K	476;476;476;44	ENSP00000443161:E476K;ENSP00000371221:E476K	ENSP00000317987:E44K	E	-	1	0	0	MTMR6	24724043	24724043	0.000000	0.05858	0.002000	0.10522	0.740000	0.42216	-0.079000	0.11357	-0.861000	0.04094	-0.385000	0.06624	GAA	0.418302		TCGA-LB-A8F3-01A-11D-A36O-08	0.328	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	0	0	1		14	2	2	1	0	1	1	293	0	293	288	1	3.010000	-2.034964	0	0.330000	NM_004685		0	16	14	0	1042	1026	0	0	1	0		1	0	293	0	0	0.690666	1.586151e-02	0	0	0	12	0	16	1042
KBTBD6	89890	broad.mit.edu	37	13	41705888	41705888	+	Missense_Mutation	SNP	G	G	A	rs61999308		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr13:41705888G>A	ENST00000379485.1	-	1	994	c.760C>T	c.(760-762)Cgg>Tgg	p.R254W	KBTBD6_ENST00000499385.2_Missense_Mutation_p.R188W	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	254										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CTGGGACCCCGCTCTTTGGGA	0.582																																						ENST00000379485.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				43						c.(760-762)Cgg>Tgg		kelch repeat and BTB (POZ) domain containing 6							62.0	63.0	62.0					13																	41705888		2203	4300	6503	SO:0001583	missense	89890	0	0					g.chr13:41705888G>A	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.760C>T	chr13.hg19:g.41705888G>A	ENSP00000368799:p.Arg254Trp	1					KBTBD6_ENST00000499385.2_Missense_Mutation_p.R188W	p.R254W	NM_152903.4	NP_690867.3	1	2	3	1.973208	Q86V97	KBTB6_HUMAN		1	994	-		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	1	1	hg19	c.760C>T	CCDS9376.1	1	.	.	.	.	.	.	.	.	.	.	g	15.36	2.811259	0.50527	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.74209	-0.82;-0.82	3.69	3.69	0.42338	3.69	3.69	0.42338	BTB/Kelch-associated (2);	0.227860	0.29980	N	0.010714	D	0.84479	0.5481	M	0.84326	2.69	0.38841	D	0.956059	D;D	0.89917	1.0;1.0	D;D	0.78314	0.989;0.991	D	0.86451	0.1773	10	0.87932	D	0	.	8.6734	0.34165	0.0:0.0:0.7723:0.2277	.	188;254	F5GZN7;Q86V97	.;KBTB6_HUMAN	W	254;188	ENSP00000368799:R254W;ENSP00000444326:R188W	ENSP00000368799:R254W	R	-	1	2	2	KBTBD6	40603888	40603888	0.465000	0.25815	0.999000	0.59377	0.991000	0.79684	0.528000	0.23002	2.065000	0.61736	0.462000	0.41574	CGG	0.418302		TCGA-LB-A8F3-01A-11D-A36O-08	0.582	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	1	0	1		12	2	2	0	0	0	1	114	0	114	125	1	3.010000	-2.341083	0	0.330000	NM_152903		0	102	100	0	278	278	1	0	1			0	0	114	0	0	1.000000	0	0	0	0	0	0	102	278
DOCK9	23348	broad.mit.edu	37	13	99566593	99566593	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr13:99566593C>T	ENST00000376460.1	-	9	1029	c.949G>A	c.(949-951)Gaa>Aaa	p.E317K	DOCK9_ENST00000339416.2_Missense_Mutation_p.E318K|DOCK9_ENST00000442173.1_Missense_Mutation_p.E317K|DOCK9_ENST00000448493.2_Missense_Mutation_p.E329K	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	318					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTGGCAAGTTCCGGCAGGTAG	0.393																																						ENST00000376460.1	1.000000	3.500000e-01	1	5.500000e-01	0.830000	0.798564	0.830000	1.000000																										0				59						c.(949-951)Gaa>Aaa		dedicator of cytokinesis 9							70.0	67.0	68.0					13																	99566593		1887	4109	5996	SO:0001583	missense	23348	0	0					g.chr13:99566593C>T	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.949G>A	chr13.hg19:g.99566593C>T	ENSP00000365643:p.Glu317Lys	1					DOCK9_ENST00000448493.2_Missense_Mutation_p.E329K|DOCK9_ENST00000339416.2_Missense_Mutation_p.E318K|DOCK9_ENST00000442173.1_Missense_Mutation_p.E317K	p.E317K	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	2	2	4	2.236121	Q9BZ29	DOCK9_HUMAN		9	1029	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	0	1	hg19	c.949G>A	CCDS45062.1	0	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243118	0.79912	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.20598	2.41;2.49;2.06;2.06	6.16	6.16	0.99307	6.16	6.16	0.99307	.	0.695998	0.14892	N	0.292369	T	0.29620	0.0739	M	0.68317	2.08	0.54753	D	0.999985	B;B;B;B;B	0.22983	0.038;0.032;0.078;0.004;0.008	B;B;B;B;B	0.23018	0.043;0.013;0.013;0.018;0.01	T	0.04840	-1.0923	9	.	.	.	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	318;317;317;317;318	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	K	317;318;318;318;317;318;329;317	ENSP00000365643:E317K;ENSP00000341086:E318K;ENSP00000401958:E329K;ENSP00000406883:E317K	.	E	-	1	0	0	DOCK9	98364594	98364594	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.097000	0.64542	2.937000	0.99478	0.650000	0.86243	GAA	0.487336		TCGA-LB-A8F3-01A-11D-A36O-08	0.393	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	0	0	1		2	2	2	0	0	0	0	20	0	20	20	1	3.010000	-11.503030	1	0.330000	NM_015296		0	6	6	0	56	56	0	0	1	0		0	0	20	0	0	0.967542	0	0	0	0	1	0	6	56
ACIN1	22985	broad.mit.edu	37	14	23528647	23528647	+	Missense_Mutation	SNP	T	T	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr14:23528647T>G	ENST00000262710.1	-	19	4063	c.3736A>C	c.(3736-3738)Aag>Cag	p.K1246Q	ACIN1_ENST00000397341.3_Missense_Mutation_p.K488Q|ACIN1_ENST00000457657.1_Missense_Mutation_p.K1206Q|ACIN1_ENST00000557515.1_Missense_Mutation_p.K487Q|ACIN1_ENST00000357481.2_Missense_Mutation_p.K488Q|CDH24_ENST00000487137.2_5'Flank|ACIN1_ENST00000338631.6_Missense_Mutation_p.K519Q|CDH24_ENST00000397359.3_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.K1233Q|ACIN1_ENST00000605057.1_Missense_Mutation_p.K1188Q	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1246	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		tcccgctccttGGCCCGTTCG	0.582																																						ENST00000262710.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999879	0.990000	1.000000																										0				37						c.(3736-3738)Aag>Cag		apoptotic chromatin condensation inducer 1							96.0	83.0	87.0					14																	23528647		2203	4300	6503	SO:0001583	missense	22985	0	0					g.chr14:23528647T>G	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3736A>C	chr14.hg19:g.23528647T>G	ENSP00000262710:p.Lys1246Gln	1					ACIN1_ENST00000357481.2_Missense_Mutation_p.K488Q|ACIN1_ENST00000457657.1_Missense_Mutation_p.K1206Q|ACIN1_ENST00000397341.3_Missense_Mutation_p.K488Q|ACIN1_ENST00000557515.1_Missense_Mutation_p.K487Q|ACIN1_ENST00000338631.6_Missense_Mutation_p.K519Q|ACIN1_ENST00000555053.1_Missense_Mutation_p.K1233Q|CDH24_ENST00000487137.2_5'Flank|CDH24_ENST00000397359.3_5'Flank|ACIN1_ENST00000605057.1_Missense_Mutation_p.K1188Q	p.K1246Q	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	0	2	2	1.729271	Q9UKV3	ACINU_HUMAN		19	4063	-	all_cancers(95;1.36e-05)		B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	1	1	hg19	c.3736A>C	CCDS9587.1	1	.	.	.	.	.	.	.	.	.	.	T	14.24	2.476246	0.44044	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02	4.18	4.18	0.49190	4.18	4.18	0.49190	.	0.336627	0.21615	N	0.071728	T	0.33933	0.0880	L	0.29908	0.895	0.42293	D	0.992148	P;P;P;P;P	0.51351	0.944;0.906;0.906;0.476;0.476	P;B;B;B;B	0.47470	0.548;0.346;0.346;0.071;0.071	T	0.03795	-1.1003	10	0.23302	T	0.38	-11.8368	9.4065	0.38464	0.0:0.0:0.1791:0.8209	.	1233;1246;1206;519;488	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	Q	487;519;488;1246;1206;488;1233	ENSP00000451138:K487Q;ENSP00000345541:K519Q;ENSP00000350073:K488Q;ENSP00000262710:K1246Q;ENSP00000405677:K1206Q;ENSP00000380502:K488Q;ENSP00000451328:K1233Q	ENSP00000262710:K1246Q	K	-	1	0	0	ACIN1	22598487	22598487	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.190000	0.58365	1.881000	0.54492	0.379000	0.24179	AAG	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.582	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	1	0	1		2	2	2	0	0	0	0	69	0	69	67	1	3.010000	-20.000000	1	0.330000	NM_014977		0	55	55	0	180	174	1	0	1	1		0	0	69	0	0	1.000000	1	0	224	0	134	0	55	180
AMFR	267	broad.mit.edu	37	16	56401435	56401435	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr16:56401435G>A	ENST00000290649.5	-	12	1730	c.1520C>T	c.(1519-1521)tCa>tTa	p.S507L		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	507					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						GATGCTATCTGACCGCTGGAA	0.498																																					Pancreas(2;144 323 39528)	ENST00000290649.5	1.000000	1.000000e-01	1	1.300000e-01	0.170000	0.366231	0.170000	0.150000																										0				17						c.(1519-1521)tCa>tTa		autocrine motility factor receptor, E3 ubiquitin protein ligase							258.0	242.0	248.0					16																	56401435		2198	4300	6498	SO:0001583	missense	267	0	0					g.chr16:56401435G>A	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1520C>T	chr16.hg19:g.56401435G>A	ENSP00000290649:p.Ser507Leu	0						p.S507L	NM_001144.5	NP_001135.3	1	2	3	1.989453	Q9UKV5	AMFR_HUMAN		12	1730	-			P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	1	1	hg19	c.1520C>T	CCDS10758.1	0	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241135	0.39598	.	.	ENSG00000159461	ENST00000290649	T	0.14266	2.52	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.647010	0.15443	N	0.262073	T	0.15825	0.0381	L	0.44542	1.39	0.39616	D	0.96996	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.07424	-1.0773	10	0.27785	T	0.31	-7.4232	18.2436	0.89977	0.0:0.0:1.0:0.0	.	507;156	Q9UKV5;Q1RN03	AMFR2_HUMAN;.	L	507	ENSP00000290649:S507L	ENSP00000290649:S507L	S	-	2	0	0	AMFR	54958936	54958936	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	4.726000	0.61986	2.735000	0.93741	0.655000	0.94253	TCA	0.382943		TCGA-LB-A8F3-01A-11D-A36O-08	0.498	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2	0	0	1		2	2	2	0	0	0	0	325	0	325	321	1	3.010000	-2.558441	1	0.330000			0	25	26	0	1016	987	0	0	1	1		0	0	325	0	0	1.000000	6.526957e-01	0	2	0	89	0	25	1016
NLRC5	84166	broad.mit.edu	37	16	57075463	57075463	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr16:57075463C>G	ENST00000262510.6	+	18	3231	c.3006C>G	c.(3004-3006)tgC>tgG	p.C1002W	NLRC5_ENST00000308149.7_Missense_Mutation_p.C1002W|NLRC5_ENST00000436936.1_Missense_Mutation_p.C1002W|NLRC5_ENST00000539144.1_Missense_Mutation_p.C1002W	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1002					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GAGGAAGCTGCCACCTCGGTC	0.552																																						ENST00000262510.6	1.000000	6.300000e-01	1	7.700000e-01	0.960000	0.910081	0.960000	1.000000																										0				75						c.(3004-3006)tgC>tgG		NLR family, CARD domain containing 5							79.0	74.0	76.0					16																	57075463		2198	4300	6498	SO:0001583	missense	84166	0	0					g.chr16:57075463C>G	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3006C>G	chr16.hg19:g.57075463C>G	ENSP00000262510:p.Cys1002Trp	0					NLRC5_ENST00000539144.1_Missense_Mutation_p.C1002W|NLRC5_ENST00000308149.7_Missense_Mutation_p.C1002W|NLRC5_ENST00000436936.1_Missense_Mutation_p.C1002W	p.C1002W	NM_032206.4	NP_115582.4	1	2	3	1.989453	Q86WI3	NLRC5_HUMAN		18	3231	+		all_neural(199;0.225)	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	1	1	hg19	c.3006C>G	CCDS10773.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.80|11.80	1.746925|1.746925	0.30955|0.30955	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.54479|.	0.57;0.57;0.57;0.57;0.57;0.57|.	3.98|3.98	-2.66|-2.66	0.06077|0.06077	3.98|3.98	-2.66|-2.66	0.06077|0.06077	.|.	1.053610|.	0.07584|.	N|.	0.920873|.	T|T	0.38081|0.38081	0.1027|0.1027	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	1|1	D;D;D;D|.	0.57571|.	0.966;0.972;0.98;0.978|.	P;P;P;P|.	0.56474|.	0.62;0.697;0.706;0.799|.	T|T	0.40403|0.40403	-0.9565|-0.9565	10|5	0.49607|.	T|.	0.09|.	.|.	4.9157|4.9157	0.13844|0.13844	0.0:0.3487:0.1617:0.4897|0.0:0.3487:0.1617:0.4897	.|.	1002;1002;1002;1002|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	W|A	1002;1002;1002;476;1002;509;301|755	ENSP00000262510:C1002W;ENSP00000308886:C1002W;ENSP00000389739:C1002W;ENSP00000441727:C1002W;ENSP00000441597:C509W;ENSP00000440153:C301W|.	ENSP00000262510:C1002W|.	C|P	+|+	3|1	2|0	2|0	NLRC5|NLRC5	55632964|55632964	55632964|55632964	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.263000|0.263000	0.26337|0.26337	-0.740000|-0.740000	0.04861|0.04861	-0.493000|-0.493000	0.06678|0.06678	-0.136000|-0.136000	0.14681|0.14681	TGC|CCA	0.382943		TCGA-LB-A8F3-01A-11D-A36O-08	0.552	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	1	0	1		2	2	2	0	0	0	0	52	0	52	52	1	3.010000	-3.323170	1	0.330000	NM_032206		0	28	25	0	178	176	1	0	1	1		0	0	52	0	0	1.000000	7.252738e-01	0	9	0	9	0	28	178
TMEM104	54868	broad.mit.edu	37	17	72832228	72832228	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr17:72832228C>G	ENST00000335464.5	+	10	1055	c.893C>G	c.(892-894)tCc>tGc	p.S298C	TMEM104_ENST00000582330.1_Missense_Mutation_p.S298C|TMEM104_ENST00000582773.1_Intron|TMEM104_ENST00000417024.2_Intron	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	298						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					ACCCCCGTCTCCTCCAAGCGC	0.622																																						ENST00000335464.5	1.000000	5.500000e-01	1	6.600000e-01	0.800000	0.815025	0.800000	1.000000																										0				19						c.(892-894)tCc>tGc		transmembrane protein 104							197.0	142.0	161.0					17																	72832228		2203	4300	6503	SO:0001583	missense	54868	0	0					g.chr17:72832228C>G	AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.893C>G	chr17.hg19:g.72832228C>G	ENSP00000334849:p.Ser298Cys	1					TMEM104_ENST00000582330.1_Missense_Mutation_p.S298C|TMEM104_ENST00000582773.1_Intron|TMEM104_ENST00000417024.2_Intron	p.S298C	NM_017728.3	NP_060198.3	1	3	4	2.174750	Q8NE00	TM104_HUMAN		10	1055	+	all_lung(278;0.23)		Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	ENST00000335464.5	1	1	hg19	c.893C>G	CCDS32723.1	0	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870313	0.72065	.	.	ENSG00000109066	ENST00000335464	T	0.02369	4.32	5.21	4.23	0.50019	5.21	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.13286	0.0322	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.00482	-1.1713	10	0.72032	D	0.01	-45.754	13.9219	0.63937	0.0:0.9256:0.0:0.0744	.	298	Q8NE00	TM104_HUMAN	C	298	ENSP00000334849:S298C	ENSP00000334849:S298C	S	+	2	0	0	TMEM104	70343823	70343823	1.000000	0.71417	0.949000	0.38748	0.895000	0.52256	7.384000	0.79751	1.319000	0.45190	0.561000	0.74099	TCC	0.474056		TCGA-LB-A8F3-01A-11D-A36O-08	0.622	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	1	0	1		2	2	2	0	0	0	0	126	0	126	125	1	3.010000	-3.318794	1	0.330000	NM_017728		0	32	31	0	287	280	0	0	1	0		0	0	126	0	0	1.000000	2.751977e-01	0	1	0	9	0	32	287
TLE2	7089	broad.mit.edu	37	19	3002419	3002419	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr19:3002419C>T	ENST00000262953.6	-	18	2241	c.1979G>A	c.(1978-1980)cGc>cAc	p.R660H	TLE2_ENST00000426948.2_Missense_Mutation_p.R674H|TLE2_ENST00000443826.3_Missense_Mutation_p.R538H|TLE2_ENST00000447365.2_Missense_Mutation_p.R327H|TLE2_ENST00000455444.2_Missense_Mutation_p.R538H|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000590536.1_Missense_Mutation_p.R661H|TLE2_ENST00000591529.1_Missense_Mutation_p.R674H	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	660				R -> G (in Ref. 1; AAA61193). {ECO:0000305}.	negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCGGCTTGCGGACGTGCAG	0.617																																						ENST00000262953.6	1.000000	1.300000e-01	7.100000e-01	2.300000e-01	0.370000	0.457875	0.370000	0.310000																										0				13						c.(1978-1980)cGc>cAc		transducin-like enhancer of split 2							28.0	32.0	31.0					19																	3002419		2178	4296	6474	SO:0001583	missense	7089	7	121276	24				g.chr19:3002419C>T	M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.1979G>A	chr19.hg19:g.3002419C>T	ENSP00000262953:p.Arg660His	0					TLE2_ENST00000426948.2_Missense_Mutation_p.R674H|TLE2_ENST00000447365.2_Missense_Mutation_p.R327H|TLE2_ENST00000455444.2_Missense_Mutation_p.R538H|TLE2_ENST00000443826.3_Missense_Mutation_p.R538H|TLE2_ENST00000590536.1_Missense_Mutation_p.R661H|TLE2_ENST00000591529.1_Missense_Mutation_p.R674H|TLE2_ENST00000586422.1_Intron	p.R660H	NM_003260.4	NP_003251.2	1	2	3	1.978307	Q04725	TLE2_HUMAN		18	2241	-			B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	ENST00000262953.6	0	1	hg19	c.1979G>A	CCDS45911.1	0	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115899	0.37339	.	.	ENSG00000065717	ENST00000262953;ENST00000455444;ENST00000360654;ENST00000450017;ENST00000447365;ENST00000443826;ENST00000426948	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59	3.79	3.79	0.43588	3.79	3.79	0.43588	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.130101	0.52532	D	0.000070	T	0.07999	0.0200	N	0.04880	-0.145	0.35702	D	0.815685	D;P;B;D;D	0.56287	0.975;0.859;0.102;0.975;0.975	B;B;B;P;P	0.45232	0.375;0.172;0.13;0.474;0.474	T	0.20806	-1.0264	10	0.87932	D	0	-10.9012	9.5891	0.39534	0.0:0.7853:0.2147:0.0	.	538;327;674;538;660	E9PEV7;B4DE62;F8WCH2;B4DE03;Q04725	.;.;.;.;TLE2_HUMAN	H	660;538;209;654;327;538;674	ENSP00000262953:R660H;ENSP00000413107:R538H;ENSP00000406523:R327H;ENSP00000392427:R538H;ENSP00000392869:R674H	ENSP00000262953:R660H	R	-	2	0	0	TLE2	2953419	2953419	0.999000	0.42202	0.973000	0.42090	0.829000	0.46940	3.176000	0.50863	2.128000	0.65567	0.455000	0.32223	CGC	0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.617	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452194.2	0	0	0		2	2	2	0	0	0	0	40	0	40	40	1	3.010000	-7.998348	1	0.330000	NM_003260		0	5	4	0	103	103	0	0	1	0		0	0	40	0	0	0.937529	9.942826e-01	0	1	0	223	0	5	103
ANKRD24	170961	broad.mit.edu	37	19	4216640	4216640	+	Missense_Mutation	SNP	G	G	A	rs373345481		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr19:4216640G>A	ENST00000600132.1	+	18	1759	c.1483G>A	c.(1483-1485)Gag>Aag	p.E495K	ANKRD24_ENST00000318934.4_Missense_Mutation_p.E495K|ANKRD24_ENST00000262970.5_Missense_Mutation_p.E585K	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	495										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TCTCCGGGCCGAGTTTGACCA	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		20483	0.0		0.001	False		,,,				2504	0.0					ENST00000600132.1	1.000000	4.700000e-01	1	7.200000e-01	0.990000	0.899468	0.990000	1.000000																										0				21						c.(1483-1485)Gag>Aag		ankyrin repeat domain 24		G	LYS/GLU	0,4002		0,0,2001	28.0	29.0	29.0		1483	4.6	0.9	19		29	1,8337		0,1,4168	no	missense	ANKRD24	NM_133475.1	56	0,1,6169	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	495/1147	4216640	1,12339	2001	4169	6170	SO:0001583	missense	170961	9	120914	38				g.chr19:4216640G>A	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1483G>A	chr19.hg19:g.4216640G>A	ENSP00000471252:p.Glu495Lys	0					ANKRD24_ENST00000318934.4_Missense_Mutation_p.E495K|ANKRD24_ENST00000262970.5_Missense_Mutation_p.E585K	p.E495K	NM_133475.1	NP_597732.1	1	2	3	1.978307	Q8TF21	ANR24_HUMAN		18	1759	+			O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	1	1	hg19	c.1483G>A	CCDS45925.1	1	.	.	.	.	.	.	.	.	.	.	g	23.0	4.362717	0.82353	0.0	1.2E-4	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.71817	0.38;-0.6	4.6	4.6	0.57074	4.6	4.6	0.57074	.	0.000000	0.34460	N	0.003942	T	0.75213	0.3819	L	0.29908	0.895	0.45415	D	0.998398	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	T	0.74968	-0.3483	10	0.39692	T	0.17	-25.7121	14.5191	0.67840	0.0:0.0:1.0:0.0	.	495;585	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	K	495;585	ENSP00000321731:E495K;ENSP00000262970:E585K	ENSP00000262970:E585K	E	+	1	0	0	ANKRD24	4167640	4167640	1.000000	0.71417	0.899000	0.35326	0.825000	0.46686	5.855000	0.69510	2.288000	0.76882	0.313000	0.20887	GAG	0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.607	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	1	0	1		2	2	2	0	0	0	0	21	0	21	21	1	3.010000	-14.172920	1	0.330000	XM_114000		0	7	7	0	43	41	1	0	1	0		0	0	21	0	0	0.980586	0	0	0	0	1	0	7	43
ANKRD27	84079	broad.mit.edu	37	19	33134064	33134064	+	Silent	SNP	A	A	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr19:33134064A>T	ENST00000306065.4	-	9	905	c.747T>A	c.(745-747)ctT>ctA	p.L249L	ANKRD27_ENST00000587352.1_Silent_p.L249L	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	249	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CTTTCTGCTGAAGATCTTGAA	0.473																																						ENST00000306065.4	1.000000	1.300000e-01	4.400000e-01	1.800000e-01	0.240000	0.359604	0.240000	0.220000																										0				42						c.(745-747)ctT>ctA		ankyrin repeat domain 27 (VPS9 domain)							125.0	126.0	126.0					19																	33134064		2203	4300	6503	SO:0001819	synonymous_variant	84079	0	0					g.chr19:33134064A>T	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.747T>A	chr19.hg19:g.33134064A>T		0					ANKRD27_ENST00000587352.1_Silent_p.L249L	p.L249L	NM_032139.2	NP_115515.2	1	2	3	1.930400	Q96NW4	ANR27_HUMAN		9	905	-	Esophageal squamous(110;0.137)		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Silent	SNP	ENST00000306065.4	1	1	hg19	c.747T>A	CCDS32986.1	0																																																																																								0.407263		TCGA-LB-A8F3-01A-11D-A36O-08	0.473	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	0	0	1		2	2	2	0	0	0	0	133	0	133	132	1	3.010000	-13.726990	1	0.330000	NM_032139		0	14	14	0	411	405	0	0	1	0		0	0	133	0	0	0.999739	1.212377e-02	0	0	0	5	0	14	411
ACTL9	284382	broad.mit.edu	37	19	8807880	8807880	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr19:8807880C>T	ENST00000324436.3	-	1	1292	c.1172G>A	c.(1171-1173)cGc>cAc	p.R391H		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CTGGAAGGCGCGCAGGGAGGC	0.652																																						ENST00000324436.3	1.000000	7.100000e-01	1	8.400000e-01	0.990000	0.939070	0.990000	1.000000																										0				36						c.(1171-1173)cGc>cAc		actin-like 9							38.0	40.0	39.0					19																	8807880		2203	4299	6502	SO:0001583	missense	284382	1	121402	32				g.chr19:8807880C>T		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1172G>A	chr19.hg19:g.8807880C>T	ENSP00000316674:p.Arg391His	0						p.R391H	NM_178525.3	NP_848620.3	1	2	3	1.944477	Q8TC94	ACTL9_HUMAN		1	1292	-			A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	1	1	hg19	c.1172G>A	CCDS12207.1	1	.	.	.	.	.	.	.	.	.	.	c	12.78	2.040034	0.35989	.	.	ENSG00000181786	ENST00000324436	T	0.07800	3.16	4.51	2.32	0.28847	4.51	2.32	0.28847	.	0.317190	0.22565	U	0.058402	T	0.05456	0.0144	N	0.20845	0.615	0.25834	N	0.984134	B	0.25521	0.128	B	0.23419	0.046	T	0.30650	-0.9971	10	0.87932	D	0	.	7.217	0.25965	0.0:0.5778:0.3287:0.0934	.	391	Q8TC94	ACTL9_HUMAN	H	391	ENSP00000316674:R391H	ENSP00000316674:R391H	R	-	2	0	0	ACTL9	8668880	8668880	0.005000	0.15991	0.279000	0.24732	0.748000	0.42578	0.594000	0.24014	0.592000	0.29728	0.457000	0.33378	CGC	0.414105		TCGA-LB-A8F3-01A-11D-A36O-08	0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	1	0	1		2	2	2	0	0	0	0	69	0	69	69	1	3.010000	-3.322053	1	0.330000	NM_178525		0	36	36	0	221	219	1	0	1			0	0	69	0	0	1.000000	0	0	0	0	0	0	36	221
TEAD2	8463	broad.mit.edu	37	19	49845730	49845730	+	Missense_Mutation	SNP	T	T	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr19:49845730T>A	ENST00000311227.2	-	11	1285	c.1195A>T	c.(1195-1197)Atg>Ttg	p.M399L	TEAD2_ENST00000539846.1_Missense_Mutation_p.M271L|TEAD2_ENST00000601519.1_Missense_Mutation_p.M402L|TEAD2_ENST00000377214.4_Missense_Mutation_p.M402L|CTC-301O7.4_ENST00000358234.4_lincRNA|TEAD2_ENST00000593945.1_Missense_Mutation_p.M403L|TEAD2_ENST00000598810.1_Missense_Mutation_p.M403L	NM_001256659.1|NM_003598.1	NP_001243588.1|NP_003589.1	Q15562	TEAD2_HUMAN	TEA domain family member 2	399	Transcriptional activation. {ECO:0000255}.				gene expression (GO:0010467)|hippo signaling (GO:0035329)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	29		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		ACGCTGTTCATCATGTATCGC	0.587																																						ENST00000311227.2	1.000000	4.100000e-01	8.100000e-01	5.000000e-01	0.610000	0.657595	0.610000	0.600000																										0				29						c.(1195-1197)Atg>Ttg		TEA domain family member 2							73.0	68.0	69.0					19																	49845730		2203	4300	6503	SO:0001583	missense	8463	0	0					g.chr19:49845730T>A	X94440	CCDS12761.1, CCDS58670.1, CCDS58671.1, CCDS59406.1	19q13.3	2008-07-22							11715	protein-coding gene	gene with protein product		601729				9889009, 8702974	Standard	NM_003598		Approved	TEF-4, ETF, TEF4	uc031rls.1	Q15562		ENST00000311227.2:c.1195A>T	chr19.hg19:g.49845730T>A	ENSP00000310701:p.Met399Leu	0					TEAD2_ENST00000377214.4_Missense_Mutation_p.M402L|TEAD2_ENST00000598810.1_Missense_Mutation_p.M403L|TEAD2_ENST00000593945.1_Missense_Mutation_p.M403L|TEAD2_ENST00000539846.1_Missense_Mutation_p.M271L|TEAD2_ENST00000601519.1_Missense_Mutation_p.M402L|CTC-301O7.4_ENST00000358234.4_lincRNA	p.M399L	NM_001256659.1|NM_003598.1	NP_001243588.1|NP_003589.1	1	2	3	1.929141	Q15562	TEAD2_HUMAN		11	1285	-		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)	B4DTJ6|M0R1T9|Q8NA25|Q96IG3	Missense_Mutation	SNP	ENST00000311227.2	1	1	hg19	c.1195A>T	CCDS12761.1	0	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341581	0.81911	.	.	ENSG00000074219	ENST00000311227;ENST00000377214;ENST00000539846	T;T;T	0.33438	1.41;1.41;1.41	3.9	3.9	0.45041	3.9	3.9	0.45041	.	0.000000	0.64402	D	0.000001	T	0.30510	0.0767	L	0.49571	1.57	0.80722	D	1	B;B;B	0.16396	0.003;0.017;0.0	B;B;B	0.27608	0.01;0.081;0.002	T	0.21143	-1.0254	10	0.87932	D	0	-25.0067	11.3375	0.49513	0.0:0.0:0.0:1.0	.	271;399;402	B4DTJ6;Q15562;Q8NA25	.;TEAD2_HUMAN;.	L	399;402;271	ENSP00000310701:M399L;ENSP00000366419:M402L;ENSP00000437928:M271L	ENSP00000310701:M399L	M	-	1	0	0	TEAD2	54537542	54537542	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.971000	0.88012	1.730000	0.51580	0.496000	0.49642	ATG	0.412410		TCGA-LB-A8F3-01A-11D-A36O-08	0.587	TEAD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465465.1	1	0	1		2	2	2	0	0	0	0	100	0	100	100	1	3.010000	-20.000000	1	0.330000	NM_003598		0	27	26	0	286	280	1	0	1	1		0	0	100	0	0	1.000000	9.999419e-01	0	36	0	128	0	27	286
CD1B	910	broad.mit.edu	37	1	158299919	158299919	+	Splice_Site	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr1:158299919G>A	ENST00000368168.3	-	3	437	c.330C>T	c.(328-330)taC>taT	p.Y110Y		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	110					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					TCTCAAAGGGGTCTATGTAGA	0.428																																						ENST00000368168.3	1.000000	1.900000e-01	1	2.500000e-01	0.320000	0.463680	0.320000	0.320000																										0				30						c.(328-330)taC>taT		CD1b molecule							133.0	137.0	136.0					1																	158299919		2203	4300	6503	SO:0001630	splice_region_variant	910	5	121408	40				g.chr1:158299919G>A	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.329-1C>T	chr1.hg19:g.158299919G>A		1						p.Y110Y	NM_001764.2	NP_001755.1	2	9	11	3.398783	P29016	CD1B_HUMAN		3	437	-	all_hematologic(112;0.0378)		Q5TDK9|Q5TDL0|Q9UMM2	Splice_Site	SNP	ENST00000368168.3	0	1	hg19	c.330C>T	CCDS1176.1	0	.	.	.	.	.	.	.	.	.	.	G	1.531	-0.544230	0.04024	.	.	ENSG00000158485	ENST00000451207	.	.	.	4.45	-3.42	0.04825	4.45	-3.42	0.04825	.	.	.	.	.	T	0.25717	0.0626	.	.	.	0.38491	D	0.947979	.	.	.	.	.	.	T	0.31081	-0.9956	4	.	.	.	.	5.1937	0.15225	0.5354:0.0:0.3163:0.1484	.	.	.	.	S	78	.	.	P	-	1	0	0	CD1B	156566543	156566543	0.141000	0.22595	0.289000	0.24876	0.417000	0.31264	-1.396000	0.02513	-0.854000	0.04131	0.655000	0.94253	CCC	0.661633		TCGA-LB-A8F3-01A-11D-A36O-08	0.428	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	0	0	1		2	2	2	0	0	0	0	215	0	215	213	1	3.010000	-3.315004	1	0.330000	NM_001764	Silent	0	34	31	0	1296	1274	0	0	1			0	0	215	0	0	1.000000	0	0	0	0	0	0	34	1296
MAEL	84944	broad.mit.edu	37	1	166987189	166987189	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr1:166987189G>A	ENST00000367872.4	+	10	1278	c.1034G>A	c.(1033-1035)cGt>cAt	p.R345H	MAEL_ENST00000367870.2_Missense_Mutation_p.R314H|MAEL_ENST00000491055.1_3'UTR	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	345					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						GATGCAGGGCGTTACCAGGTA	0.443																																						ENST00000367872.4	1.000000	1.100000e-01	4.500000e-01	1.800000e-01	0.260000	0.367869	0.260000	0.250000																										0				28						c.(1033-1035)cGt>cAt		maelstrom spermatogenic transposon silencer							146.0	122.0	130.0					1																	166987189		2203	4300	6503	SO:0001583	missense	84944	2	121392	35				g.chr1:166987189G>A	AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.1034G>A	chr1.hg19:g.166987189G>A	ENSP00000356846:p.Arg345His	1					MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Missense_Mutation_p.R314H	p.R345H	NM_032858.1	NP_116247.1	2	8	10	3.503479	Q96JY0	MAEL_HUMAN		10	1278	+			B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	ENST00000367872.4	0	1	hg19	c.1034G>A	CCDS1257.1	0	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356516	0.61293	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624;ENST00000537744	T;T;T	0.60040	0.22;0.27;0.6	5.69	4.76	0.60689	5.69	4.76	0.60689	.	0.000000	0.64402	D	0.000015	T	0.32071	0.0817	L	0.29908	0.895	0.44816	D	0.997822	D;P	0.57257	0.979;0.954	B;B	0.42995	0.328;0.404	T	0.20571	-1.0271	10	0.46703	T	0.11	.	11.9142	0.52755	0.0:0.0:0.8258:0.1742	.	314;345	E9JVC3;Q96JY0	.;MAEL_HUMAN	H	345;314;314;67	ENSP00000356846:R345H;ENSP00000356844:R314H;ENSP00000402143:R314H	ENSP00000356844:R314H	R	+	2	0	0	MAEL	165253813	165253813	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.141000	0.64814	1.381000	0.46364	0.555000	0.69702	CGT	0.674125		TCGA-LB-A8F3-01A-11D-A36O-08	0.443	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083239.1	0	0	1		2	2	2	0	0	0	0	99	0	99	97	1	3.010000	-2.786466	1	0.330000	NM_032858		0	14	14	0	716	703	0	0	1	0		0	0	99	0	0	0.999721	0	0	0	0	1	0	14	716
PIK3C2B	5287	broad.mit.edu	37	1	204412697	204412697	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr1:204412697G>A	ENST00000367187.3	-	20	3452	c.2896C>T	c.(2896-2898)Cag>Tag	p.Q966*	PIK3C2B_ENST00000424712.2_Nonsense_Mutation_p.Q938*	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	966	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			ATGCTGAACTGAGAGTCCTTG	0.567																																						ENST00000367187.3	1.000000	3.400000e-01	1	4.000000e-01	0.480000	0.572935	0.480000	0.490000																										0				52						c.(2896-2898)Cag>Tag		phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta							116.0	114.0	115.0					1																	204412697		2203	4300	6503	SO:0001587	stop_gained	5287	0	0					g.chr1:204412697G>A	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2896C>T	chr1.hg19:g.204412697G>A	ENSP00000356155:p.Gln966*	1					PIK3C2B_ENST00000424712.2_Nonsense_Mutation_p.Q938*	p.Q966*	NM_002646.3	NP_002637.3	2	9	11	3.493699	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)	20	3452	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		O95666|Q5SW99	Nonsense_Mutation	SNP	ENST00000367187.3	0	1	hg19	c.2896C>T	CCDS1446.1	0	.	.	.	.	.	.	.	.	.	.	G	46	12.910723	0.99705	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	.	.	.	5.98	5.98	0.97165	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	13.2926	0.60278	0.0728:0.0:0.9272:0.0	.	.	.	.	X	966;938	.	ENSP00000356155:Q966X	Q	-	1	0	0	PIK3C2B	202679320	202679320	1.000000	0.71417	0.976000	0.42696	0.995000	0.86356	4.809000	0.62591	2.847000	0.97988	0.591000	0.81541	CAG	0.671488		TCGA-LB-A8F3-01A-11D-A36O-08	0.567	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	0	0	1		2	2	2	0	0	0	0	244	0	244	242	1	3.010000	-3.261609	1	0.330000	NM_002646		0	59	60	0	1534	1514	0	0	1	0		0	0	244	0	0	1.000000	1.327794e-02	0	0	0	5	0	59	1534
OBSCN	84033	broad.mit.edu	37	1	228495118	228495118	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr1:228495118C>T	ENST00000422127.1	+	46	12396	c.12352C>T	c.(12352-12354)Cgg>Tgg	p.R4118W	OBSCN_ENST00000284548.11_Missense_Mutation_p.R4118W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5075W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1237W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R1752W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4118	Ig-like 42.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTACGAGATGCGGAGCCAGGG	0.662																																						ENST00000422127.1	1.000000	1.000000e-01	6.600000e-01	2.000000e-01	0.350000	0.430789	0.350000	0.270000																										0				223						c.(12352-12354)Cgg>Tgg		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							27.0	39.0	35.0					1																	228495118		2118	4211	6329	SO:0001583	missense	84033	3	121030	28				g.chr1:228495118C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12352C>T	chr1.hg19:g.228495118C>T	ENSP00000409493:p.Arg4118Trp	1					OBSCN_ENST00000284548.11_Missense_Mutation_p.R4118W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R1752W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5075W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1237W	p.R4118W	NM_001098623.2	NP_001092093.2	2	8	10	3.619451	Q5VST9	OBSCN_HUMAN		46	12396	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	0	1	hg19	c.12352C>T	CCDS58065.1	0	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897492	0.52121	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.79	1.41	0.22369	5.79	1.41	0.22369	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.288780	0.05292	N	0.521231	T	0.76572	0.4006	L	0.53729	1.69	0.24836	N	0.992496	D;B	0.89917	1.0;0.37	D;B	0.78314	0.991;0.059	T	0.57505	-0.7800	10	0.54805	T	0.06	.	6.5659	0.22511	0.5717:0.2742:0.0:0.154	.	4118;4118	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4118;4118;1752;1237	ENSP00000284548:R4118W;ENSP00000409493:R4118W;ENSP00000355668:R1752W;ENSP00000355670:R1237W	ENSP00000284548:R4118W	R	+	1	2	2	OBSCN	226561741	226561741	0.809000	0.29036	0.030000	0.17652	0.186000	0.23388	0.384000	0.20668	0.364000	0.24374	-0.515000	0.04445	CGG	0.684260		TCGA-LB-A8F3-01A-11D-A36O-08	0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0	0	0	0	27	0	27	27	1	3.010000	-5.866944	1	0.330000	NM_052843		0	4	4	0	175	170	0	0	1	0		0	0	27	0	0	0.883149	2.633681e-03	0	0	0	3	0	4	175
SLC12A5	57468	broad.mit.edu	37	20	44675062	44675062	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr20:44675062C>T	ENST00000454036.2	+	14	1892	c.1843C>T	c.(1843-1845)Cga>Tga	p.R615*	SLC12A5_ENST00000243964.3_Nonsense_Mutation_p.R592*	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	615					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCCACGCTTTCGATATTACCA	0.552																																						ENST00000454036.2	1.000000	1.700000e-01	1	2.400000e-01	0.330000	0.474609	0.330000	0.310000																										0				80						c.(1843-1845)Cga>Tga		solute carrier family 12 (potassium/chloride transporter), member 5	Bumetanide(DB00887)|Potassium Chloride(DB00761)						113.0	96.0	102.0					20																	44675062		2203	4300	6503	SO:0001587	stop_gained	57468	0	0					g.chr20:44675062C>T	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1843C>T	chr20.hg19:g.44675062C>T	ENSP00000387694:p.Arg615*	1					SLC12A5_ENST00000243964.3_Nonsense_Mutation_p.R592*	p.R615*	NM_001134771.1	NP_001128243.1	3	3	6	2.405922	Q9H2X9	S12A5_HUMAN		14	1892	+		Myeloproliferative disorder(115;0.0122)	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Nonsense_Mutation	SNP	ENST00000454036.2	0	1	hg19	c.1843C>T	CCDS46610.1	0	.	.	.	.	.	.	.	.	.	.	C	38	7.042841	0.98021	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	.	.	.	4.33	4.33	0.51752	4.33	4.33	0.51752	.	0.075781	0.52532	D	0.000070	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	10.9059	0.47079	0.1878:0.8122:0.0:0.0	.	.	.	.	X	615;592	.	ENSP00000243964:R592X	R	+	1	2	2	SLC12A5	44108469	44108469	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.103000	0.57783	2.253000	0.74438	0.467000	0.42956	CGA	0.522316		TCGA-LB-A8F3-01A-11D-A36O-08	0.552	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1	1	0	1		2	2	2	0	0	0	0	91	0	91	86	1	3.010000	-12.894970	1	0.330000			0	13	13	0	359	349	0	0	1			0	0	91	0	0	0.999466	0	0	0	0	0	0	13	359
OGFR	11054	broad.mit.edu	37	20	61444217	61444217	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr20:61444217G>A	ENST00000290291.6	+	7	1275	c.1250G>A	c.(1249-1251)tGt>tAt	p.C417Y	OGFR_ENST00000370461.1_Missense_Mutation_p.C365Y	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	417					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					TTGGAGGGGTGTGCCCTCAGC	0.682																																						ENST00000290291.6	1.000000	2.600000e-01	1	3.700000e-01	0.530000	0.613356	0.530000	0.460000																										0				17						c.(1249-1251)tGt>tAt		opioid growth factor receptor							40.0	46.0	44.0					20																	61444217		2199	4300	6499	SO:0001583	missense	11054	0	0					g.chr20:61444217G>A	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1250G>A	chr20.hg19:g.61444217G>A	ENSP00000290291:p.Cys417Tyr	1					OGFR_ENST00000370461.1_Missense_Mutation_p.C365Y	p.C417Y	NM_007346.2	NP_031372.2	3	3	6	2.405922	Q9NZT2	OGFR_HUMAN		7	1275	+	Breast(26;3.65e-08)		O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	1	1	hg19	c.1250G>A	CCDS13504.1	0	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577779	0.45902	.	.	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163;ENST00000370469;ENST00000370461	T;T;T	0.64085	0.56;0.05;-0.08	4.98	3.99	0.46301	4.98	3.99	0.46301	.	0.131453	0.51477	D	0.000099	T	0.71685	0.3369	M	0.66939	2.045	0.09310	N	0.999996	D;D;D	0.60160	0.987;0.987;0.987	P;P;P	0.57371	0.819;0.819;0.819	T	0.65434	-0.6169	10	0.72032	D	0.01	-13.4023	13.2842	0.60232	0.0:0.0:0.7181:0.2819	.	417;400;417	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	Y	417;417;417;272;365	ENSP00000290291:C417Y;ENSP00000359499:C417Y;ENSP00000359491:C365Y	ENSP00000290291:C417Y	C	+	2	0	0	OGFR	60914662	60914662	0.964000	0.33143	0.980000	0.43619	0.665000	0.39181	1.485000	0.35519	2.278000	0.76064	0.555000	0.69702	TGT	0.522316		TCGA-LB-A8F3-01A-11D-A36O-08	0.682	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1	1	0	1		2	2	2	0	0	0	0	55	0	55	54	1	3.010000	-13.979590	1	0.330000			0	11	11	0	191	185	0	0	1	1		0	0	55	0	0	0.998194	9.977942e-01	0	4	0	185	0	11	191
C21orf2	755	broad.mit.edu	37	21	45753071	45753071	+	Missense_Mutation	SNP	C	C	T	rs140451304		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr21:45753071C>T	ENST00000339818.4	-	4	425	c.218G>A	c.(217-219)cGc>cAc	p.R73H	C21orf2_ENST00000325223.7_Missense_Mutation_p.R73H|C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000397956.3_Missense_Mutation_p.R73H	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	73					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		GCTGGGGATGCGGTTCCTCCG	0.677																																						ENST00000339818.4	1.000000	1.000000e-01	1	1.900000e-01	0.340000	0.449314	0.340000	0.270000																										0				2						c.(217-219)cGc>cAc		chromosome 21 open reading frame 2							26.0	27.0	27.0					21																	45753071		2202	4300	6502	SO:0001583	missense	755	38	121316	43				g.chr21:45753071C>T	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.218G>A	chr21.hg19:g.45753071C>T	ENSP00000344566:p.Arg73His	0					C21orf2_ENST00000325223.7_Missense_Mutation_p.R73H|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000397956.3_Missense_Mutation_p.R73H|C21orf2_ENST00000496321.1_5'UTR	p.R73H	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	1	2	3	1.912912	O43822	CU002_HUMAN		4	425	-			A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Missense_Mutation	SNP	ENST00000339818.4	0	1	hg19	c.218G>A	CCDS13709.1	0	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164124	0.38217	.	.	ENSG00000160226	ENST00000339818;ENST00000380160;ENST00000397956;ENST00000325223	T;T;T	0.09911	2.93;2.93;2.93	4.99	2.04	0.26737	4.99	2.04	0.26737	.	0.730148	0.13311	N	0.397507	T	0.05960	0.0155	L	0.33245	0.995	0.09310	N	0.999998	B;P;B;B	0.36378	0.04;0.55;0.049;0.001	B;B;B;B	0.24541	0.007;0.054;0.011;0.001	T	0.34254	-0.9836	10	0.34782	T	0.22	-18.6603	4.4168	0.11461	0.17:0.583:0.0:0.247	.	73;73;73;32	G5E952;Q8N5X6;O43822;O43822-2	.;.;CU002_HUMAN;.	H	73;109;73;73	ENSP00000344566:R73H;ENSP00000381047:R73H;ENSP00000317302:R73H	ENSP00000317302:R73H	R	-	2	0	0	C21orf2	44577499	44577499	0.135000	0.22499	0.996000	0.52242	0.789000	0.44602	-0.042000	0.12063	0.587000	0.29643	-0.126000	0.14955	CGC	0.403782		TCGA-LB-A8F3-01A-11D-A36O-08	0.677	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	0	0	1		2	2	2	0	0	0	0	26	0	26	26	1	3.010000	-3.261623	1	0.330000	NM_004928		0	4	4	0	96	90	0	0	1	0		0	0	26	0	0	0.876685	8.383465e-01	0	0	0	82	0	4	96
CECR1	51816	broad.mit.edu	37	22	17669277	17669277	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr22:17669277C>T	ENST00000399839.1	-	7	1303	c.1033G>A	c.(1033-1035)Gcc>Acc	p.A345T	CECR1_ENST00000262607.3_Missense_Mutation_p.A345T|CECR1_ENST00000399837.2_Missense_Mutation_p.A345T|CECR1_ENST00000330232.4_Missense_Mutation_p.A104T|CECR1_ENST00000480276.1_5'Flank|CECR1_ENST00000449907.2_Missense_Mutation_p.A303T	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	345					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CCATCCTTGGCGGGGATCATC	0.607																																						ENST00000399839.1	1.000000	7.000000e-02	3.100000e-01	1.200000e-01	0.180000	0.291938	0.180000	0.170000																										0				25						c.(1033-1035)Gcc>Acc		cat eye syndrome chromosome region, candidate 1							96.0	78.0	84.0					22																	17669277		2203	4300	6503	SO:0001583	missense	51816	8	121412	39				g.chr22:17669277C>T	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1033G>A	chr22.hg19:g.17669277C>T	ENSP00000382733:p.Ala345Thr	0					CECR1_ENST00000449907.2_Missense_Mutation_p.A303T|CECR1_ENST00000262607.3_Missense_Mutation_p.A345T|CECR1_ENST00000330232.4_Missense_Mutation_p.A104T|CECR1_ENST00000399837.2_Missense_Mutation_p.A345T|CECR1_ENST00000480276.1_5'Flank	p.A345T	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	1	2	3	2.011614	Q9NZK5	CECR1_HUMAN		7	1303	-		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	0	1	hg19	c.1033G>A	CCDS13742.1	0	.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228346	0.06022	.	.	ENSG00000093072	ENST00000399839;ENST00000330232;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67	4.24	-1.32	0.09201	4.24	-1.32	0.09201	Adenosine/AMP deaminase (1);	0.973928	0.08462	N	0.942354	T	0.68081	0.2962	L	0.38838	1.175	0.09310	N	1	B;B	0.20887	0.049;0.008	B;B	0.10450	0.005;0.002	T	0.49224	-0.8962	10	0.12766	T	0.61	.	3.2155	0.06697	0.2619:0.3322:0.0:0.406	.	345;104	Q9NZK5;Q9NZK5-2	CECR1_HUMAN;.	T	345;104;345;303;345	ENSP00000382733:A345T;ENSP00000332871:A104T;ENSP00000262607:A345T;ENSP00000406443:A303T;ENSP00000382731:A345T	ENSP00000262607:A345T	A	-	1	0	0	CECR1	16049277	16049277	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.129000	0.15830	0.143000	0.18926	0.561000	0.74099	GCC	0.410704		TCGA-LB-A8F3-01A-11D-A36O-08	0.607	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1	0	0	1		2	2	2	0	0	0	0	99	0	99	99	1	3.010000	-2.953949	1	0.330000			0	8	8	0	326	320	0	0	1	0		0	0	99	0	0	0.988784	3.010218e-02	0	0	0	10	0	8	326
FAM171B	165215	broad.mit.edu	37	2	187626909	187626909	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr2:187626909C>T	ENST00000304698.5	+	8	2043	c.1840C>T	c.(1840-1842)Cca>Tca	p.P614S		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	614						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						ACAGAGCCTGCCATCCCAGGC	0.483																																						ENST00000304698.5	1.000000	5.000000e-01	9.500000e-01	6.000000e-01	0.730000	0.756409	0.730000	0.700000																										0				54						c.(1840-1842)Cca>Tca		family with sequence similarity 171, member B							75.0	79.0	78.0					2																	187626909		2203	4300	6503	SO:0001583	missense	165215	0	0					g.chr2:187626909C>T	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1840C>T	chr2.hg19:g.187626909C>T	ENSP00000304108:p.Pro614Ser	0						p.P614S	NM_177454.3	NP_803237.3	1	2	3	1.965871	Q6P995	F171B_HUMAN		8	2043	+			Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	1	1	hg19	c.1840C>T	CCDS33347.1	0	.	.	.	.	.	.	.	.	.	.	C	8.496	0.863233	0.17250	.	.	ENSG00000144369	ENST00000304698	T	0.27890	1.64	5.85	5.85	0.93711	5.85	5.85	0.93711	.	0.072813	0.56097	D	0.000025	T	0.23410	0.0566	N	0.25647	0.755	0.32038	N	0.598562	B;B	0.18461	0.028;0.028	B;B	0.24848	0.056;0.056	T	0.15780	-1.0425	10	0.26408	T	0.33	-16.0957	12.8401	0.57797	0.0:0.884:0.0:0.116	.	614;615	Q6P995;A8K122	F171B_HUMAN;.	S	614	ENSP00000304108:P614S	ENSP00000304108:P614S	P	+	1	0	0	FAM171B	187335154	187335154	0.101000	0.21875	1.000000	0.80357	0.980000	0.70556	1.693000	0.37742	2.753000	0.94483	0.655000	0.94253	CCA	0.410704		TCGA-LB-A8F3-01A-11D-A36O-08	0.483	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	1	0	1		2	2	2	0	0	0	0	91	0	91	90	1	3.010000	-12.732200	1	0.330000	NM_177454		0	33	33	0	289	284	1	0	1			0	0	91	0	0	1.000000	0	0	0	0	0	0	33	289
MYO1B	4430	broad.mit.edu	37	2	192261178	192261178	+	Silent	SNP	A	A	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr2:192261178A>G	ENST00000392318.3	+	21	2497	c.2250A>G	c.(2248-2250)acA>acG	p.T750T	MYO1B_ENST00000392316.1_Silent_p.T750T|MYO1B_ENST00000304164.4_Silent_p.T750T|MYO1B_ENST00000439065.2_Silent_p.T24T|MYO1B_ENST00000339514.4_Silent_p.T750T	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	750	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ACCAGCAGACAAAGAGTTCCG	0.368																																						ENST00000392318.3	1.000000	1.500000e-01	3.600000e-01	1.900000e-01	0.250000	0.352180	0.250000	0.250000																										0				55						c.(2248-2250)acA>acG		myosin IB							151.0	148.0	149.0					2																	192261178		2203	4300	6503	SO:0001819	synonymous_variant	4430	0	0					g.chr2:192261178A>G	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.2250A>G	chr2.hg19:g.192261178A>G		0					MYO1B_ENST00000392316.1_Silent_p.T750T|MYO1B_ENST00000304164.4_Silent_p.T750T|MYO1B_ENST00000439065.2_Silent_p.T24T|MYO1B_ENST00000339514.4_Silent_p.T750T	p.T750T	NM_001130158.1	NP_001123630.1	1	2	3	1.965871	O43795	MYO1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)	21	2497	+			O43794|Q7Z6L5	Silent	SNP	ENST00000392318.3	1	1	hg19	c.2250A>G	CCDS46477.1	0																																																																																								0.410704		TCGA-LB-A8F3-01A-11D-A36O-08	0.368	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	0	0	1		2	2	2	0	0	0	0	169	0	169	168	1	3.010000	-18.085410	1	0.330000	NM_012223		0	20	20	0	548	540	1	0	1	1		0	0	169	0	0	0.999995	7.094443e-01	0	6	0	63	0	20	548
SLC1A4	6509	broad.mit.edu	37	2	65243676	65243676	+	Silent	SNP	T	T	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr2:65243676T>A	ENST00000234256.3	+	5	1146	c.903T>A	c.(901-903)tcT>tcA	p.S301S	SLC1A4_ENST00000493121.1_3'UTR|SLC1A4_ENST00000531327.1_Intron	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	301					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	TCTTCGCATCTATATTGGGCC	0.458																																						ENST00000234256.3	1.000000	1.500000e-01	1	2.000000e-01	0.260000	0.381474	0.260000	0.250000																										0				13						c.(901-903)tcT>tcA		solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	L-Alanine(DB00160)						184.0	178.0	180.0					2																	65243676		2203	4300	6503	SO:0001819	synonymous_variant	6509	0	0					g.chr2:65243676T>A		CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.903T>A	chr2.hg19:g.65243676T>A		0					SLC1A4_ENST00000531327.1_Intron|SLC1A4_ENST00000493121.1_3'UTR	p.S301S	NM_003038.4	NP_003029.2	1	2	3	1.922617	P43007	SATT_HUMAN		5	1146	+			B7Z3C0|D6W5F0	Silent	SNP	ENST00000234256.3	1	1	hg19	c.903T>A	CCDS1879.1	0																																																																																								0.406397		TCGA-LB-A8F3-01A-11D-A36O-08	0.458	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251726.2	0	0	1		2	2	2	0	0	0	0	170	0	170	168	1	3.010000	-17.052850	1	0.330000	NM_003038		0	18	18	0	477	472	0	0	1	0		0	0	170	0	0	0.999981	1.650680e-01	0	1	0	18	0	18	477
CNGA3	1261	broad.mit.edu	37	2	99013711	99013711	+	Missense_Mutation	SNP	A	A	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr2:99013711A>G	ENST00000272602.2	+	7	2117	c.2078A>G	c.(2077-2079)cAa>cGa	p.Q693R	CNGA3_ENST00000436404.2_Missense_Mutation_p.Q675R|CNGA3_ENST00000409937.1_Missense_Mutation_p.Q697R|CNGA3_ENST00000393504.1_Missense_Mutation_p.Q693R			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	693					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GAGGACAAACAACAGTGAAAA	0.562																																						ENST00000272602.2	1.000000	1.500000e-01	5.600000e-01	2.300000e-01	0.350000	0.425818	0.350000	0.320000																										0				49						c.(2077-2079)cAa>cGa		cyclic nucleotide gated channel alpha 3							28.0	30.0	29.0					2																	99013711		2203	4300	6503	SO:0001583	missense	1261	0	0					g.chr2:99013711A>G	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.2078A>G	chr2.hg19:g.99013711A>G	ENSP00000272602:p.Gln693Arg	0					CNGA3_ENST00000393504.1_Missense_Mutation_p.Q693R|CNGA3_ENST00000409937.1_Missense_Mutation_p.Q697R|CNGA3_ENST00000436404.2_Missense_Mutation_p.Q675R	p.Q693R			1	2	3	1.939341	Q16281	CNGA3_HUMAN		7	2117	+			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	0	1	hg19	c.2078A>G	CCDS2034.1	0	.	.	.	.	.	.	.	.	.	.	A	17.02	3.281297	0.59758	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97553	-4.27;-4.21;-4.27;-4.43	5.18	-1.08	0.09936	5.18	-1.08	0.09936	.	1.144930	0.06868	N	0.800336	D	0.90195	0.6935	L	0.29908	0.895	0.09310	N	1	B;B;B	0.29716	0.255;0.0;0.0	B;B;B	0.16722	0.016;0.001;0.001	T	0.81933	-0.0706	10	0.10377	T	0.69	.	0.7756	0.01031	0.4129:0.1827:0.2527:0.1518	.	697;675;693	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	R	693;675;693;697	ENSP00000377140:Q693R;ENSP00000410070:Q675R;ENSP00000272602:Q693R;ENSP00000386761:Q697R	ENSP00000272602:Q693R	Q	+	2	0	0	CNGA3	98380143	98380143	0.000000	0.05858	0.000000	0.03702	0.853000	0.48598	0.012000	0.13287	-0.316000	0.08690	0.533000	0.62120	CAA	0.414105		TCGA-LB-A8F3-01A-11D-A36O-08	0.562	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	0	0	1		2	2	2	0	0	0	0	45	0	45	45	1	3.010000	-10.201140	1	0.330000	NM_001298		0	7	7	0	144	140	0	0	1			0	0	45	0	0	0.979508	0	0	0	0	0	0	7	144
MPP4	58538	broad.mit.edu	37	2	202552087	202552087	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr2:202552087T>C	ENST00000409474.3	-	5	494	c.287A>G	c.(286-288)gAg>gGg	p.E96G	MPP4_ENST00000447335.2_Missense_Mutation_p.E96G|MPP4_ENST00000359962.5_Missense_Mutation_p.E96G|MPP4_ENST00000315506.7_Missense_Mutation_p.E96G|MPP4_ENST00000396886.3_Missense_Mutation_p.E96G|MPP4_ENST00000428900.2_Missense_Mutation_p.E96G|MPP4_ENST00000409143.1_Intron	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	96	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						ACGTAATAACTCCACTACCTG	0.393																																						ENST00000409474.3	1.000000	1.200000e-01	9.300000e-01	2.500000e-01	0.460000	0.525470	0.460000	1.000000																										0				12						c.(286-288)gAg>gGg		membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)							68.0	64.0	65.0					2																	202552087		1821	4080	5901	SO:0001583	missense	58538	0	0					g.chr2:202552087T>C	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.287A>G	chr2.hg19:g.202552087T>C	ENSP00000387278:p.Glu96Gly	0					MPP4_ENST00000359962.5_Missense_Mutation_p.E96G|MPP4_ENST00000315506.7_Missense_Mutation_p.E96G|MPP4_ENST00000428900.2_Missense_Mutation_p.E96G|MPP4_ENST00000447335.2_Missense_Mutation_p.E96G|MPP4_ENST00000409143.1_Intron|MPP4_ENST00000396886.3_Missense_Mutation_p.E96G	p.E96G	NM_033066.2	NP_149055	1	2	3	1.965871	Q96JB8	MPP4_HUMAN		5	494	-			C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	ENST00000409474.3	0	1	hg19	c.287A>G	CCDS46491.1	0	.	.	.	.	.	.	.	.	.	.	T	12.24	1.877332	0.33162	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000428900;ENST00000447335	T;T;T;T;T	0.06687	3.28;3.27;3.28;3.28;3.28	5.88	3.43	0.39272	5.88	3.43	0.39272	L27, C-terminal (1);L27 (2);	0.697165	0.13777	N	0.363487	T	0.08044	0.0201	L	0.43757	1.38	0.09310	N	0.999996	B;B;B;B;B;B;B;B;B	0.10296	0.003;0.002;0.002;0.002;0.001;0.002;0.003;0.001;0.001	B;B;B;B;B;B;B;B;B	0.13407	0.008;0.006;0.002;0.002;0.001;0.002;0.009;0.001;0.005	T	0.32079	-0.9920	10	0.52906	T	0.07	.	5.6829	0.17786	0.0:0.1486:0.1428:0.7086	.	96;96;96;96;96;96;109;96;96	B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;F8WC25;F8WBH8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;.;MPP4_HUMAN;.	G	96	ENSP00000387278:E96G;ENSP00000319363:E96G;ENSP00000353047:E96G;ENSP00000416781:E96G;ENSP00000406160:E96G	ENSP00000319363:E96G	E	-	2	0	0	MPP4	202260332	202260332	0.937000	0.31787	0.005000	0.12908	0.084000	0.17831	2.824000	0.48088	0.445000	0.26639	0.533000	0.62120	GAG	0.410704		TCGA-LB-A8F3-01A-11D-A36O-08	0.393	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2	0	0	0		2	2	2	0	0	0	0	10	0	10	9	1	3.010000	-7.301237	1	0.330000			0	3	2	0	54	50	0	0	1			0	0	10	0	0	0.782304	0	0	0	0	0	0	3	54
RFTN1	23180	broad.mit.edu	37	3	16475415	16475415	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr3:16475415C>T	ENST00000334133.4	-	3	547	c.275G>A	c.(274-276)cGg>cAg	p.R92Q	RFTN1_ENST00000432519.1_Missense_Mutation_p.R56Q	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	92					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.R92L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						CGTCTTCTCCCGCTCATGGGT	0.632																																						ENST00000334133.4	1.000000	4.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.190757	0.090000	0.090000																										1	Substitution - Missense(1)	p.R92L(1)	lung(1)	38						c.(274-276)cGg>cAg		raftlin, lipid raft linker 1							95.0	103.0	100.0					3																	16475415		2203	4300	6503	SO:0001583	missense	23180	1	121412	38				g.chr3:16475415C>T	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.275G>A	chr3.hg19:g.16475415C>T	ENSP00000334153:p.Arg92Gln	1					RFTN1_ENST00000432519.1_Missense_Mutation_p.R56Q	p.R92Q	NM_015150.1	NP_055965.1	0	2	2	1.700345	Q14699	RFTN1_HUMAN		3	547	-			Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	0	1	hg19	c.275G>A	CCDS33712.1	0	.	.	.	.	.	.	.	.	.	.	C	5.639	0.302648	0.10678	.	.	ENSG00000131378	ENST00000432519;ENST00000334133;ENST00000451036;ENST00000449415;ENST00000441460;ENST00000431547	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.21	-8.08	0.01094	5.21	-8.08	0.01094	.	1.391410	0.04296	N	0.346433	T	0.13884	0.0336	N	0.16790	0.44	0.09310	N	1	B;B	0.20261	0.043;0.014	B;B	0.12837	0.008;0.003	T	0.13845	-1.0494	10	0.19147	T	0.46	0.1934	4.5627	0.12168	0.1791:0.1421:0.0834:0.5953	.	56;92	G3XAJ6;Q14699	.;RFTN1_HUMAN	Q	56;92;92;92;92;92	ENSP00000403926:R56Q;ENSP00000334153:R92Q;ENSP00000403997:R92Q;ENSP00000409427:R92Q;ENSP00000388718:R92Q;ENSP00000393216:R92Q	ENSP00000334153:R92Q	R	-	2	0	0	RFTN1	16450419	16450419	0.012000	0.17670	0.001000	0.08648	0.415000	0.31203	0.128000	0.15810	-2.466000	0.00533	-0.367000	0.07326	CGG	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.632	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	0	0	1		2	2	2	0	0	0	0	267	0	267	264	1	3.010000	-1.792441	0	0.330000	NM_015150		0	10	9	0	676	661	0	0	1	0		0	0	267	0	0	0.996516	3.135803e-02	0	0	0	17	0	10	676
GATA2	2624	broad.mit.edu	37	3	128200783	128200783	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr3:128200783G>A	ENST00000341105.2	-	5	1353	c.1022C>T	c.(1021-1023)gCc>gTc	p.A341V	GATA2_ENST00000430265.2_Intron|GATA2_ENST00000487848.1_Missense_Mutation_p.A341V|GATA2_ENST00000489987.1_5'UTR	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	341					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A341_G346del(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		TCTTCTGGCGGCCGACTGGGA	0.667			Mis		AML(CML blast transformation)																																	ENST00000341105.2	1.000000	5.000000e-02	3.100000e-01	1.000000e-01	0.170000	0.264770	0.170000	0.140000				Dom	yes			Dom	yes		3	3q21.3	3q21.3	2624	Mis	GATA binding protein 2				L	L			AML(CML blast transformation)		1	Deletion - In frame(1)	p.A341_G346del(1)	haematopoietic_and_lymphoid_tissue(1)	79						c.(1021-1023)gCc>gTc		GATA binding protein 2							76.0	62.0	67.0					3																	128200783		2203	4300	6503	SO:0001583	missense	2624	0	0					g.chr3:128200783G>A	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1022C>T	chr3.hg19:g.128200783G>A	ENSP00000345681:p.Ala341Val	1					GATA2_ENST00000430265.2_Intron|GATA2_ENST00000487848.1_Missense_Mutation_p.A341V|GATA2_ENST00000489987.1_5'UTR	p.A341V	NM_032638.4	NP_116027.2	0	2	2	1.700345	P23769	GATA2_HUMAN		5	1353	-			D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Missense_Mutation	SNP	ENST00000341105.2	0	1	hg19	c.1022C>T	CCDS3049.1	0	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871747	0.91587	.	.	ENSG00000179348	ENST00000341105;ENST00000487848	D;D	0.97710	-4.5;-4.5	4.95	4.95	0.65309	4.95	4.95	0.65309	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (1);	0.000000	0.85682	D	0.000000	D	0.97142	0.9066	L	0.31926	0.97	0.80722	D	1	P	0.50528	0.936	P	0.56434	0.798	D	0.97318	0.9942	10	0.42905	T	0.14	-6.4427	18.1809	0.89777	0.0:0.0:1.0:0.0	.	341	P23769	GATA2_HUMAN	V	341	ENSP00000345681:A341V;ENSP00000417074:A341V	ENSP00000345681:A341V	A	-	2	0	0	GATA2	129683473	129683473	1.000000	0.71417	0.857000	0.33713	0.977000	0.68977	9.778000	0.99011	2.271000	0.75665	0.591000	0.81541	GCC	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.667	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	0	0	1		2	2	2	0	0	0	0	82	0	82	81	1	3.010000	-5.911514	1	0.330000	NM_032638		0	4	5	0	161	160	0	0	1	0		0	0	82	0	0	0.891348	3.119290e-03	0	0	0	3	0	4	161
SAMD7	344658	broad.mit.edu	37	3	169644499	169644499	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr3:169644499T>C	ENST00000428432.2	+	6	838	c.449T>C	c.(448-450)cTg>cCg	p.L150P	SAMD7_ENST00000335556.3_Missense_Mutation_p.L150P	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	150										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GCCGGTGACCTGCATTTTCAC	0.592																																						ENST00000428432.2	1.000000	6.800000e-01	1	7.900000e-01	0.930000	0.910262	0.930000	1.000000																										0				31						c.(448-450)cTg>cCg		sterile alpha motif domain containing 7							58.0	60.0	59.0					3																	169644499		2203	4300	6503	SO:0001583	missense	344658	0	0					g.chr3:169644499T>C	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.449T>C	chr3.hg19:g.169644499T>C	ENSP00000391299:p.Leu150Pro	1					SAMD7_ENST00000335556.3_Missense_Mutation_p.L150P	p.L150P	NM_182610.2	NP_872416.1	0	2	2	1.700345	Q7Z3H4	SAMD7_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)	6	838	+	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)			Missense_Mutation	SNP	ENST00000428432.2	1	1	hg19	c.449T>C	CCDS3209.1	1	.	.	.	.	.	.	.	.	.	.	T	9.381	1.072926	0.20147	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.55588	0.51;0.51	6.16	3.76	0.43208	6.16	3.76	0.43208	.	0.394431	0.24664	N	0.036603	T	0.35451	0.0932	N	0.21448	0.665	0.51012	D	0.999903	B	0.24533	0.105	B	0.20384	0.029	T	0.09058	-1.0692	10	0.40728	T	0.16	-0.459	8.2492	0.31706	0.1197:0.065:0.0:0.8154	.	150	Q7Z3H4	SAMD7_HUMAN	P	150	ENSP00000391299:L150P;ENSP00000334668:L150P	ENSP00000334668:L150P	L	+	2	0	0	SAMD7	171127193	171127193	1.000000	0.71417	0.997000	0.53966	0.051000	0.14879	3.078000	0.50096	0.541000	0.28827	0.528000	0.53228	CTG	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.592	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	1	0	1		2	2	2	0	0	0	0	90	0	90	89	1	3.010000	-19.986190	1	0.330000	NM_182610		0	44	44	0	248	245	1	0	1			0	0	90	0	0	1.000000	0	0	0	0	0	0	44	248
SH3TC1	54436	broad.mit.edu	37	4	8230216	8230216	+	Missense_Mutation	SNP	T	T	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr4:8230216T>A	ENST00000245105.3	+	12	2862	c.2795T>A	c.(2794-2796)cTg>cAg	p.L932Q	SH3TC1_ENST00000539824.1_Missense_Mutation_p.L856Q	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	932										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCCGTGCGGCTGTTCTCGAGG	0.706																																					NSCLC(145;2298 2623 35616 37297)	ENST00000245105.3	1.000000	6.800000e-01	1	8.500000e-01	0.990000	0.946202	0.990000	1.000000																										0				33						c.(2794-2796)cTg>cAg		SH3 domain and tetratricopeptide repeats 1							23.0	28.0	26.0					4																	8230216		2200	4295	6495	SO:0001583	missense	54436	0	0					g.chr4:8230216T>A	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2795T>A	chr4.hg19:g.8230216T>A	ENSP00000245105:p.Leu932Gln	0					SH3TC1_ENST00000539824.1_Missense_Mutation_p.L856Q	p.L932Q	NM_018986.3	NP_061859	1	2	3	1.932073	Q8TE82	S3TC1_HUMAN		12	2862	+			Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	1	1	hg19	c.2795T>A	CCDS3399.1	1	.	.	.	.	.	.	.	.	.	.	T	13.09	2.134594	0.37630	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.69306	-0.39;-0.39	4.63	3.4	0.38934	4.63	3.4	0.38934	Tetratricopeptide-like helical (1);	0.234828	0.36303	N	0.002670	T	0.79575	0.4469	M	0.78049	2.395	0.44485	D	0.997427	D	0.89917	1.0	D	0.77557	0.99	T	0.79694	-0.1696	10	0.87932	D	0	-16.7905	10.304	0.43670	0.1479:0.0:0.0:0.8521	.	932	Q8TE82	S3TC1_HUMAN	Q	670;932;856;761	ENSP00000245105:L932Q;ENSP00000441045:L856Q	ENSP00000245105:L932Q	L	+	2	0	0	SH3TC1	8281116	8281116	1.000000	0.71417	0.885000	0.34714	0.007000	0.05969	7.019000	0.76412	0.585000	0.29608	0.459000	0.35465	CTG	0.411558		TCGA-LB-A8F3-01A-11D-A36O-08	0.706	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	1	0	1		2	2	2	0	0	0	0	49	0	49	48	1	3.010000	-20.000000	1	0.330000	NM_018986		0	23	22	0	134	129	1	0	1	1		0	0	49	0	0	0.999999	9.927851e-01	0	13	0	36	0	23	134
FRAS1	80144	broad.mit.edu	37	4	79396679	79396679	+	Silent	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr4:79396679C>T	ENST00000264895.6	+	54	8210	c.7770C>T	c.(7768-7770)cgC>cgT	p.R2590R		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2590	Calx-beta 1.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCCTGTGTCGCACCGAGCAAG	0.582																																						ENST00000264895.6	1.000000	4.000000e-02	2.700000e-01	8.000000e-02	0.140000	0.255151	0.140000	0.120000																										0				103						c.(7768-7770)cgC>cgT		Fraser extracellular matrix complex subunit 1							109.0	120.0	117.0					4																	79396679		2106	4229	6335	SO:0001819	synonymous_variant	80144	0	0					g.chr4:79396679C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7770C>T	chr4.hg19:g.79396679C>T		0						p.R2590R	NM_025074.6	NP_079350.5	1	2	3	1.943468	Q86XX4	FRAS1_HUMAN		54	8210	+			A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	0	1	hg19	c.7770C>T	CCDS54771.1	0	.	.	.	.	.	.	.	.	.	.	C	1.648	-0.514788	0.04200	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.44	0.23	0.15372	5.44	0.23	0.15372	.	.	.	.	.	T	0.41534	0.1163	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20338	-1.0278	4	.	.	.	.	1.4158	0.02301	0.2395:0.4251:0.1163:0.219	.	.	.	.	Y	819	.	.	H	+	1	0	0	FRAS1	79615703	79615703	0.998000	0.40836	0.409000	0.26459	0.132000	0.20833	0.632000	0.24583	-0.322000	0.08615	-0.194000	0.12790	CAC	0.410704		TCGA-LB-A8F3-01A-11D-A36O-08	0.582	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	0		2	2	2	0	0	0	0	80	0	80	80	1	3.010000	-5.894410	1	0.330000			0	5	5	0	284	277	0	0	1	0		0	0	80	0	0	0.933971	4.942805e-04	0	0	0	2	0	5	284
CPE	1363	broad.mit.edu	37	4	166418761	166418761	+	Nonstop_Mutation	SNP	A	A	T	rs34858186		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr4:166418761A>T	ENST00000402744.4	+	9	1710	c.1430A>T	c.(1429-1431)tAa>tTa	p.*477L		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	0					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTAAATTTTTAAAAAGGCTTC	0.299																																						ENST00000402744.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999981	0.990000	1.000000																										0				26						c.(1429-1431)tAa>tTa		carboxypeptidase E	"""Insulin(DB00071)|Insulin Regular(DB00030)"						48.0	51.0	50.0					4																	166418761		2201	4292	6493	SO:0001578	stop_lost	1363	0	0					g.chr4:166418761A>T	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.1430A>T	chr4.hg19:g.166418761A>T	ENSP00000386104:p.*477Leuext*4	1						p.*477L	NM_001873.2	NP_001864.1	1	2	3	1.984231	P16870	CBPE_HUMAN		9	1710	+	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Nonstop_Mutation	SNP	ENST00000402744.4	0	1	hg19	c.1430A>T	CCDS3810.1	1	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808900	0.31961	.	.	ENSG00000109472	ENST00000402744	.	.	.	5.76	4.59	0.56863	5.76	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.884	0.35392	0.8565:0.0:0.1435:0.0	.	.	.	.	L	477	.	.	X	+	2	2	2	CPE	166638211	166638211	1.000000	0.71417	0.896000	0.35187	0.550000	0.35303	3.556000	0.53734	1.019000	0.39547	-0.250000	0.11733	TAA	0.416630		TCGA-LB-A8F3-01A-11D-A36O-08	0.299	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	0	0	1		2	2	2	0	0	0	0	42	0	42	42	1	3.010000	-20.000000	1	0.330000	NM_001873		0	37	37	0	114	114	1	0	1	1		0	0	42	0	0	1.000000	9.999967e-01	0	7	0	59	0	37	114
SLC6A19	340024	broad.mit.edu	37	5	1201792	1201792	+	Silent	SNP	C	C	T	rs370311234		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr5:1201792C>T	ENST00000304460.10	+	1	83	c.27C>T	c.(25-27)ccC>ccT	p.P9P		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	9					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TGCCCAACCCCGGCCTAGACG	0.697																																						ENST00000304460.10	1.000000	4.000000e-01	1	5.700000e-01	0.810000	0.798889	0.810000	1.000000																										0				44						c.(25-27)ccC>ccT		solute carrier family 6 (neutral amino acid transporter), member 19		C		0,4384		0,0,2192	25.0	26.0	25.0		27	-8.0	0.5	5		25	2,8590		0,2,4294	no	coding-synonymous	SLC6A19	NM_001003841.2		0,2,6486	TT,TC,CC		0.0233,0.0,0.0154		9/635	1201792	2,12974	2192	4296	6488	SO:0001819	synonymous_variant	340024	15	120904	36				g.chr5:1201792C>T	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.27C>T	chr5.hg19:g.1201792C>T		0						p.P9P	NM_001003841.2	NP_001003841.1	1	2	3	1.943568	Q695T7	S6A19_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)	1	83	+	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		A8K446	Silent	SNP	ENST00000304460.10	1	1	hg19	c.27C>T	CCDS34130.1	0																																																																																								0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.697	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	1	0	1		2	2	2	0	0	0	0	31	0	31	30	1	3.010000	-15.304850	1	0.330000	XM_291120		0	9	9	0	74	71	1	0	1	1		0	0	31	0	0	0.994166	4.009623e-02	0	3	0	0	0	9	74
ACTBL2	345651	broad.mit.edu	37	5	56778497	56778497	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr5:56778497T>C	ENST00000423391.1	-	1	139	c.38A>G	c.(37-39)aAt>aGt	p.N13S	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	13						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		CCCTGACCCATTATCCACTAC	0.542																																						ENST00000423391.1	1.000000	4.700000e-01	1	6.100000e-01	0.780000	0.792426	0.780000	1.000000																										0				28						c.(37-39)aAt>aGt		actin, beta-like 2							80.0	59.0	66.0					5																	56778497		2203	4300	6503	SO:0001583	missense	345651	0	0					g.chr5:56778497T>C		CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.38A>G	chr5.hg19:g.56778497T>C	ENSP00000416706:p.Asn13Ser	0					AC025470.1_ENST00000584598.1_RNA|CTD-2023N9.1_ENST00000506106.1_RNA	p.N13S	NM_001017992.3	NP_001017992.1	1	2	3	1.943568	Q562R1	ACTBL_HUMAN		1	139	-		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	ENST00000423391.1	1	1	hg19	c.38A>G	CCDS34163.1	0	.	.	.	.	.	.	.	.	.	.	T	15.83	2.949343	0.53186	.	.	ENSG00000169067	ENST00000423391	D	0.97665	-4.48	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000002	D	0.98040	0.9354	M	0.93854	3.465	0.49798	D	0.999821	B	0.26318	0.146	B	0.40741	0.339	D	0.98614	1.0664	10	0.87932	D	0	.	12.977	0.58542	0.0:0.0:0.0:1.0	.	13	Q562R1	ACTBL_HUMAN	S	13	ENSP00000416706:N13S	ENSP00000416706:N13S	N	-	2	0	0	ACTBL2	56814254	56814254	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.054000	0.71096	2.156000	0.67533	0.460000	0.39030	AAT	0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.542	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368579.1	1	0	1		2	2	2	0	0	0	0	46	0	46	46	1	3.010000	-20.000000	1	0.330000	NM_001017992		0	18	17	0	149	147	1	0	1			0	0	46	0	0	0.999985	0	0	0	0	0	0	18	149
TAS2R1	50834	broad.mit.edu	37	5	9629850	9629850	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr5:9629850G>A	ENST00000382492.2	-	1	613	c.295C>T	c.(295-297)Ctc>Ttc	p.L99F	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	99					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						AAAACGCCGAGCCATGTGGCA	0.433																																						ENST00000382492.2	1.000000	1.000000e-01	4.800000e-01	1.600000e-01	0.260000	0.363873	0.260000	0.230000																										0				39						c.(295-297)Ctc>Ttc		taste receptor, type 2, member 1							31.0	33.0	32.0					5																	9629850		2203	4300	6503	SO:0001583	missense	50834	0	0					g.chr5:9629850G>A	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.295C>T	chr5.hg19:g.9629850G>A	ENSP00000371932:p.Leu99Phe	0					CTD-2001E22.1_ENST00000504182.2_RNA	p.L99F	NM_019599.2	NP_062545.1	1	2	3	1.943568	Q9NYW7	TA2R1_HUMAN		1	613	-			Q646G8	Missense_Mutation	SNP	ENST00000382492.2	0	1	hg19	c.295C>T	CCDS3876.1	0	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185783	0.78789	.	.	ENSG00000169777	ENST00000382492	T	0.02216	4.39	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000004	T	0.14917	0.0360	M	0.84773	2.715	0.48135	D	0.999591	D	0.89917	1.0	D	0.97110	1.0	T	0.00059	-1.2166	9	.	.	.	.	16.5409	0.84384	0.0:0.0:1.0:0.0	.	99	Q9NYW7	TA2R1_HUMAN	F	99	ENSP00000371932:L99F	.	L	-	1	0	0	TAS2R1	9682850	9682850	1.000000	0.71417	0.995000	0.50966	0.692000	0.40212	6.136000	0.71703	2.767000	0.95098	0.655000	0.94253	CTC	0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.433	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2	0	0	1		2	2	2	0	0	0	0	39	0	39	38	1	3.010000	-8.629536	1	0.330000			0	6	6	0	175	173	0	0	1			0	0	39	0	0	0.964546	0	0	0	0	0	0	6	175
GPR98	84059	broad.mit.edu	37	5	89979973	89979973	+	Missense_Mutation	SNP	C	C	T	rs529727564		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr5:89979973C>T	ENST00000405460.2	+	28	6331	c.6235C>T	c.(6235-6237)Ctc>Ttc	p.L2079F		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2079	Calx-beta 14. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TATCGAACTACTCAACTCTAC	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		15557	0.0		0.0	False		,,,				2504	0.001					ENST00000405460.2	1.000000	5.500000e-01	1	7.000000e-01	0.880000	0.864492	0.880000	1.000000																										0				269						c.(6235-6237)Ctc>Ttc		G protein-coupled receptor 98							59.0	55.0	56.0					5																	89979973		1857	4098	5955	SO:0001583	missense	84059	2	120792	37				g.chr5:89979973C>T	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6235C>T	chr5.hg19:g.89979973C>T	ENSP00000384582:p.Leu2079Phe	0						p.L2079F	NM_032119.3	NP_115495.3	1	2	3	1.943568	Q8WXG9	GPR98_HUMAN		28	6331	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	1	1	hg19	c.6235C>T	CCDS47246.1	1	.	.	.	.	.	.	.	.	.	.	C	6.792	0.515177	0.12944	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.28069	1.63	5.71	1.34	0.21922	5.71	1.34	0.21922	Na-Ca exchanger/integrin-beta4 (1);	0.425070	0.27821	N	0.017719	T	0.13756	0.0333	N	0.16307	0.4	0.42111	D	0.991388	B	0.20368	0.044	B	0.24006	0.05	T	0.10382	-1.0632	10	0.13853	T	0.58	.	3.4706	0.07566	0.1498:0.5324:0.0958:0.2221	.	2079	Q8WXG9	GPR98_HUMAN	F	2079	ENSP00000384582:L2079F	ENSP00000296619:L2079F	L	+	1	0	0	GPR98	90015729	90015729	0.004000	0.15560	0.946000	0.38457	0.893000	0.52053	0.320000	0.19540	0.319000	0.23209	0.591000	0.81541	CTC	0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	1	0	1		2	2	2	0	0	0	0	52	0	52	52	1	3.010000	-20.000000	1	0.330000	NM_032119		0	20	20	0	143	142	1	0	1			0	0	52	0	0	0.999997	0	0	0	0	0	0	20	143
HIST1H2BO	8348	broad.mit.edu	37	6	27861401	27861401	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr6:27861401G>A	ENST00000303806.4	+	1	199	c.161G>A	c.(160-162)gGc>gAc	p.G54D	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	54					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CCCGACACCGGCATCTCATCG	0.557																																						ENST00000303806.4	1.000000	1.000000e-02	1	3.000000e-02	0.060000	0.237457	0.060000	0.070000																										0										c.(160-162)gGc>gAc		histone cluster 1, H2bo							161.0	145.0	151.0					6																	27861401		2203	4300	6503	SO:0001583	missense	8348	0	0					g.chr6:27861401G>A	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.161G>A	chr6.hg19:g.27861401G>A	ENSP00000303408:p.Gly54Asp	1					HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank	p.G54D	NM_003527.4	NP_003518.2	2	2	4	2.129274	P23527	H2B1O_HUMAN		1	199	+			Q3KPI7|Q8TCV6	Missense_Mutation	SNP	ENST00000303806.4	0	1	hg19	c.161G>A	CCDS4640.1	0	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928991	0.73327	.	.	ENSG00000196331	ENST00000303806	T	0.69435	-0.4	3.55	3.55	0.40652	3.55	3.55	0.40652	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.82240	0.4994	M	0.93150	3.385	0.51767	D	0.999939	D	0.61697	0.99	D	0.64595	0.927	D	0.87114	0.2187	9	0.87932	D	0	.	14.9186	0.70818	0.0:0.0:1.0:0.0	.	54	P23527	H2B1O_HUMAN	D	54	ENSP00000303408:G54D	ENSP00000303408:G54D	G	+	2	0	0	HIST1H2BO	27969380	27969380	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	7.022000	0.76431	2.275000	0.75901	0.561000	0.74099	GGC	0.461501		TCGA-LB-A8F3-01A-11D-A36O-08	0.557	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1	0	0	1		2	2	2	0	0	0	0	249	0	249	247	1	3.010000	-1.757050	0	0.330000	NM_003527		0	6	6	0	791	779	0	0	1			0	0	249	0	0	0.963366	0	0	0	0	0	0	6	791
IYD	389434	broad.mit.edu	37	6	150715311	150715311	+	Missense_Mutation	SNP	G	G	A	rs377381152		TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr6:150715311G>A	ENST00000344419.3	+	4	747	c.607G>A	c.(607-609)Gca>Aca	p.A203T	IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	203					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TGGTTTCGCCGCAAATGGCAA	0.433																																						ENST00000344419.3	1.000000	4.000000e-02	1	7.000000e-02	0.110000	0.279275	0.110000	0.110000																										0				15						c.(607-609)Gca>Aca		iodotyrosine deiodinase		A	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	122.0	109.0	113.0		607,607,607	2.1	0.0	6		113	0,8600		0,0,4300	no	missense,missense,missense	IYD	NM_001164694.1,NM_001164695.1,NM_203395.2	58,58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	203/294,203/248,203/290	150715311	1,13005	2203	4300	6503	SO:0001583	missense	389434	3	121412	38				g.chr6:150715311G>A	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.607G>A	chr6.hg19:g.150715311G>A	ENSP00000343763:p.Ala203Thr	1					IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T|IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T	p.A203T	NM_203395.2	NP_981932.1	2	2	4	2.129274	Q6PHW0	IYD1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.215)	4	747	+		Ovarian(120;0.028)	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	0	1	hg19	c.607G>A	CCDS5227.1	0	.	.	.	.	.	.	.	.	.	.	g	5.689	0.311597	0.10789	2.27E-4	0.0	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320;ENST00000425615	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	6.17	2.1	0.27182	6.17	2.1	0.27182	Nitroreductase-like (3);	0.509560	0.22264	N	0.062376	T	0.43055	0.1230	L	0.46885	1.475	0.09310	N	1	B;B;B;B	0.20261	0.004;0.043;0.001;0.002	B;B;B;B	0.18561	0.003;0.022;0.001;0.005	T	0.24548	-1.0157	10	0.27785	T	0.31	-23.7178	1.2452	0.01971	0.2372:0.2256:0.3896:0.1475	.	121;203;203;203	Q2VPV9;C9JFW2;Q6PHW0-3;Q6PHW0	.;.;.;IYD1_HUMAN	T	203;203;203;203;203;148	ENSP00000229447:A203T;ENSP00000343763:A203T;ENSP00000376085:A203T;ENSP00000376084:A203T;ENSP00000441276:A203T;ENSP00000390081:A148T	ENSP00000229447:A203T	A	+	1	0	0	IYD	150757004	150757004	0.019000	0.18553	0.001000	0.08648	0.174000	0.22865	0.255000	0.18333	0.496000	0.27904	-0.119000	0.15052	GCA	0.461501		TCGA-LB-A8F3-01A-11D-A36O-08	0.433	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	0	0	1		2	2	2	0	0	0	0	127	0	127	126	1	3.010000	-1.969494	0	0.330000	NM_203395		0	8	8	0	572	565	0	0	1	0		0	0	127	0	0	0.988910	0	0	0	0	1	0	8	572
LRRN3	54674	broad.mit.edu	37	7	110763403	110763403	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr7:110763403T>C	ENST00000422987.3	+	2	1406	c.575T>C	c.(574-576)aTt>aCt	p.I192T	IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000437687.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.I192T|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000415362.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.I192T|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	192					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AATCTAGAGATTCTGATGATT	0.373																																						ENST00000422987.3	1.000000	7.800000e-01	1	8.900000e-01	0.990000	0.959597	0.990000	1.000000																										0				55						c.(574-576)aTt>aCt		leucine rich repeat neuronal 3							65.0	68.0	67.0					7																	110763403		2203	4299	6502	SO:0001583	missense	54674	0	0					g.chr7:110763403T>C	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.575T>C	chr7.hg19:g.110763403T>C	ENSP00000412417:p.Ile192Thr	0					IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.I192T|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.I192T|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000415362.1_Intron	p.I192T	NM_018334.4	NP_060804.3	1	2	3	1.729580	Q9H3W5	LRRN3_HUMAN		2	1406	+			O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	1	1	hg19	c.575T>C	CCDS5754.1	1	.	.	.	.	.	.	.	.	.	.	T	17.33	3.362159	0.61403	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.23348	1.91;1.91;1.91;4.37	5.94	5.94	0.96194	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000013	T	0.35653	0.0939	L	0.55017	1.72	0.58432	D	0.999999	D	0.56968	0.978	P	0.51974	0.686	T	0.05666	-1.0871	10	0.15499	T	0.54	.	16.4075	0.83691	0.0:0.0:0.0:1.0	.	192	Q9H3W5	LRRN3_HUMAN	T	192	ENSP00000312001:I192T;ENSP00000397312:I192T;ENSP00000412417:I192T;ENSP00000407927:I192T	ENSP00000312001:I192T	I	+	2	0	0	LRRN3	110550639	110550639	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.275000	0.75901	0.528000	0.53228	ATT	0.334393		TCGA-LB-A8F3-01A-11D-A36O-08	0.373	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	1	0	1		2	2	2	0	0	0	0	116	0	116	116	1	3.010000	-20.000000	1	0.330000	NM_018334		0	60	57	0	304	301	1	0	1			0	0	116	0	0	1.000000	0	0	0	0	0	0	60	304
WBSCR28	135886	broad.mit.edu	37	7	73279489	73279489	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr7:73279489G>A	ENST00000320531.2	+	2	275	c.239G>A	c.(238-240)gGg>gAg	p.G80E		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	80						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				CTCTGGGCTGGGCTGGCTCTG	0.697																																						ENST00000320531.2	1.000000	6.700000e-01	1	7.700000e-01	0.890000	0.887982	0.890000	1.000000																										0				11						c.(238-240)gGg>gAg		Williams-Beuren syndrome chromosome region 28							47.0	53.0	51.0					7																	73279489		1913	4115	6028	SO:0001583	missense	135886	0	0					g.chr7:73279489G>A	BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.239G>A	chr7.hg19:g.73279489G>A	ENSP00000316775:p.Gly80Glu	1						p.G80E	NM_182504.3	NP_872310.2	1	3	4	2.213029	Q6UE05	WBS28_HUMAN		2	275	+		Lung NSC(55;0.159)	Q6UE04|Q8NHP4	Missense_Mutation	SNP	ENST00000320531.2	1	1	hg19	c.239G>A	CCDS43597.1	1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.755009	0.49362	.	.	ENSG00000175877	ENST00000320531	T	0.36699	1.24	4.63	2.63	0.31362	4.63	2.63	0.31362	.	0.340255	0.21598	N	0.071982	T	0.45458	0.1343	L	0.36672	1.1	0.09310	N	1	D	0.76494	0.999	D	0.72075	0.976	T	0.16600	-1.0397	10	0.87932	D	0	-14.5081	9.5408	0.39251	0.0:0.0:0.622:0.378	.	80	Q6UE05	WBS28_HUMAN	E	80	ENSP00000316775:G80E	ENSP00000316775:G80E	G	+	2	0	0	WBSCR28	72917425	72917425	0.201000	0.23410	0.191000	0.23289	0.093000	0.18481	1.085000	0.30840	1.121000	0.41925	0.650000	0.86243	GGG	0.478112		TCGA-LB-A8F3-01A-11D-A36O-08	0.697	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348130.1	1	0	1		2	2	2	0	0	0	0	176	0	176	176	1	3.010000	-20.000000	1	0.330000	NM_182504		0	58	57	0	459	447	1	0	1			0	0	176	0	0	1.000000	0	0	0	0	0	0	58	459
OR2A7	401427	broad.mit.edu	37	7	143956698	143956698	+	Silent	SNP	G	G	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr7:143956698G>T	ENST00000493325.1	-	1	117	c.24C>A	c.(22-24)atC>atA	p.I8I	OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|ARHGEF35_ENST00000543357.1_Intron	NM_001005328.1	NP_001005328.1	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A, member 7	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	6	Melanoma(164;0.14)					GGAACTCTGTGATGGATGTTA	0.448																																						ENST00000493325.1			0	0																														0				6						c.(22-24)atC>atA		olfactory receptor, family 2, subfamily A, member 7							117.0	150.0	139.0					7																	143956698		2202	4300	6502	SO:0001819	synonymous_variant	401427	0	0					g.chr7:143956698G>T		CCDS55177.1	7q35	2013-09-20			ENSG00000243896	ENSG00000243896		"""GPCR / Class A : Olfactory receptors"""	8234	protein-coding gene	gene with protein product							Standard	NM_001005328		Approved	HSDJ0798C17	uc011kuc.2	Q96R45	OTTHUMG00000158002	ENST00000493325.1:c.24C>A	chr7.hg19:g.143956698G>T							OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA	p.I8I	NM_001005328.1	NP_001005328.1					Q96R45	OR2A7_HUMAN		1	117	-	Melanoma(164;0.14)		B2RN57|Q6IFP4	Silent	SNP	ENST00000493325.1	1	1	hg19	c.24C>A	CCDS55177.1																																																																																											TCGA-LB-A8F3-01A-11D-A36O-08	0.448	OR2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349979.1	1	0	1		2	2	2	0	0	0	0	127	0	127	126	1	3.010000	-19.996180	1	0.330000			0	60	57	0	440	435	0	0	1	0		0	0	127	0	0	1.000000	1.497786e-02	0	1	0	1	0	60	440
ADAM2	2515	broad.mit.edu	37	8	39626997	39626997	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr8:39626997G>A	ENST00000265708.4	-	12	1229	c.1126C>T	c.(1126-1128)Cgc>Tgc	p.R376C	ADAM2_ENST00000379853.2_Missense_Mutation_p.R250C|ADAM2_ENST00000347580.4_Missense_Mutation_p.R357C|ADAM2_ENST00000521880.1_Missense_Mutation_p.R376C	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	376					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GGATCTAAGCGAGGCTGATTG	0.433																																						ENST00000265708.4	1.000000	1.600000e-01	4.600000e-01	2.200000e-01	0.310000	0.387395	0.310000	0.300000																										0				53						c.(1126-1128)Cgc>Tgc		ADAM metallopeptidase domain 2							154.0	136.0	142.0					8																	39626997		2203	4300	6503	SO:0001583	missense	2515	0	0					g.chr8:39626997G>A	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1126C>T	chr8.hg19:g.39626997G>A	ENSP00000265708:p.Arg376Cys	1					ADAM2_ENST00000379853.2_Missense_Mutation_p.R250C|ADAM2_ENST00000347580.4_Missense_Mutation_p.R357C|ADAM2_ENST00000521880.1_Missense_Mutation_p.R376C	p.R376C	NM_001464.3	NP_001455.3	0	2	2	1.737975	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	12	1229	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	1	1	hg19	c.1126C>T	CCDS34884.1	0	.	.	.	.	.	.	.	.	.	.	G	13.10	2.134834	0.37728	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.02258	4.99;4.37;5.23;5.19	5.11	3.29	0.37713	5.11	3.29	0.37713	Metallopeptidase, catalytic domain (1);	.	.	.	.	T	0.08044	0.0201	M	0.81802	2.56	0.09310	N	0.999999	P;D;D;P	0.69078	0.955;0.997;0.973;0.955	P;P;P;P	0.55667	0.608;0.649;0.781;0.608	T	0.18241	-1.0343	8	.	.	.	.	6.5366	0.22357	0.0932:0.0:0.7281:0.1787	.	376;250;357;376	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	C	357;250;376;376	ENSP00000343854:R357C;ENSP00000369182:R250C;ENSP00000265708:R376C;ENSP00000429352:R376C	.	R	-	1	0	0	ADAM2	39746154	39746154	0.001000	0.12720	0.048000	0.18961	0.292000	0.27327	0.361000	0.20267	0.635000	0.30488	0.650000	0.86243	CGC	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.433	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	1	0	1		2	2	2	0	0	0	0	62	0	62	62	1	3.010000	-2.939794	1	0.330000	NM_001464		0	11	11	0	215	214	0	0	1			0	0	62	0	0	0.998417	0	0	0	0	0	0	11	215
SAMD12	401474	broad.mit.edu	37	8	119391680	119391680	+	Silent	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr8:119391680G>A	ENST00000314727.4	-	4	718	c.582C>T	c.(580-582)atC>atT	p.I194I	AC023590.1_ENST00000430457.1_Intron|SAMD12_ENST00000409003.4_Intron|SAMD12_ENST00000527515.1_Intron	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	194										endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			TATTTTCTATGATGGAAATTC	0.368																																						ENST00000314727.4	1.000000	5.000000e-02	2.500000e-01	8.000000e-02	0.140000	0.238232	0.140000	0.120000																										0				9						c.(580-582)atC>atT		sterile alpha motif domain containing 12							56.0	57.0	56.0					8																	119391680		2203	4300	6503	SO:0001819	synonymous_variant	401474	0	0					g.chr8:119391680G>A	AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.582C>T	chr8.hg19:g.119391680G>A		1					AC023590.1_ENST00000430457.1_Intron|SAMD12_ENST00000527515.1_Intron|SAMD12_ENST00000409003.4_Intron	p.I194I	NM_207506.2	NP_997389.2	0	2	2	1.737975	Q8N8I0	SAM12_HUMAN	STAD - Stomach adenocarcinoma(47;0.00391)	4	718	-	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		Q0P502	Silent	SNP	ENST00000314727.4	0	1	hg19	c.582C>T	CCDS6325.1	0																																																																																								0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.368	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	0	0	1		2	2	2	0	0	0	0	78	0	78	78	1	3.010000	-3.289897	1	0.330000	NM_207506		0	5	5	0	234	231	0	0	1			0	0	78	0	0	0.936107	0	0	0	0	0	0	5	234
MUSK	4593	broad.mit.edu	37	9	113547892	113547892	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr9:113547892C>T	ENST00000374448.4	+	13	1806	c.1672C>T	c.(1672-1674)Ccg>Tcg	p.P558S	MUSK_ENST00000416899.2_Missense_Mutation_p.P550S|MUSK_ENST00000189978.5_Missense_Mutation_p.P558S|MUSK_ENST00000374438.1_Missense_Mutation_p.P74S	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	558					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CCAGAGGATGCCGCTCCTTCT	0.498																																						ENST00000374448.4	1.000000	0	1.100000e-01	2.000000e-02	0.050000	0.186542	0.050000	0.060000																										0				49						c.(1672-1674)Ccg>Tcg		muscle, skeletal, receptor tyrosine kinase							215.0	207.0	209.0					9																	113547892		1966	4156	6122	SO:0001583	missense	4593	0	0					g.chr9:113547892C>T	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1672C>T	chr9.hg19:g.113547892C>T	ENSP00000363571:p.Pro558Ser	0					MUSK_ENST00000416899.2_Missense_Mutation_p.P550S|MUSK_ENST00000189978.5_Missense_Mutation_p.P558S|MUSK_ENST00000374438.1_Missense_Mutation_p.P74S	p.P558S	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	1	2	3	1.943401	O15146	MUSK_HUMAN		13	1806	+			Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	0	1	hg19	c.1672C>T	CCDS48005.1	0	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084498	0.76642	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000374441;ENST00000416899;ENST00000374438	T;D	0.88664	-0.83;-2.41	5.86	5.86	0.93980	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.92394	0.7586	L	0.45228	1.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90595	0.4540	10	0.33940	T	0.23	.	19.1684	0.93567	0.0:1.0:0.0:0.0	.	558	O15146	MUSK_HUMAN	S	564;558;558;472;472;74;556;74	ENSP00000363571:P558S;ENSP00000363561:P74S	ENSP00000189978:P564S	P	+	1	0	0	MUSK	112587713	112587713	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.777000	0.95525	0.655000	0.94253	CCG	0.409848		TCGA-LB-A8F3-01A-11D-A36O-08	0.498	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0	0	0	0	246	0	246	245	1	3.010000	-1.858213	0	0.330000			0	6	6	0	856	841	0	0	1			0	0	246	0	0	0.963081	0	0	0	0	0	0	6	856
VLDLR	7436	broad.mit.edu	37	9	2641436	2641436	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr9:2641436C>T	ENST00000382100.3	+	4	741	c.385C>T	c.(385-387)Cca>Tca	p.P129S	VLDLR_ENST00000382099.2_Missense_Mutation_p.P129S|RP11-125B21.2_ENST00000599229.1_RNA	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	129	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		TCAGTGTATCCCAGTGTCCTG	0.433																																						ENST00000382100.3	1.000000	4.000000e-02	2.100000e-01	7.000000e-02	0.110000	0.225867	0.110000	0.100000																										0				24						c.(385-387)Cca>Tca		very low density lipoprotein receptor							233.0	210.0	218.0					9																	2641436		2203	4300	6503	SO:0001583	missense	7436	0	0					g.chr9:2641436C>T		CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.385C>T	chr9.hg19:g.2641436C>T	ENSP00000371532:p.Pro129Ser	1					RP11-125B21.2_ENST00000599229.1_RNA|VLDLR_ENST00000382099.2_Missense_Mutation_p.P129S	p.P129S	NM_003383.3	NP_003374.3	0	2	2	1.718977	P98155	VLDLR_HUMAN		4	741	+			B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	ENST00000382100.3	0	1	hg19	c.385C>T	CCDS6446.1	0	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645424	0.67358	.	.	ENSG00000147852	ENST00000382100;ENST00000382099	D;D	0.95554	-3.74;-3.74	6.07	6.07	0.98685	6.07	6.07	0.98685	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.52532	D	0.000066	D	0.96648	0.8906	L	0.50919	1.6	0.80722	D	1	B;B	0.33694	0.421;0.148	B;P	0.51055	0.429;0.657	D	0.95111	0.8238	10	0.49607	T	0.09	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	129;129	Q5VVF5;P98155	.;VLDLR_HUMAN	S	129	ENSP00000371532:P129S;ENSP00000371531:P129S	ENSP00000371531:P129S	P	+	1	0	0	VLDLR	2631436	2631436	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.635000	0.61332	2.884000	0.98904	0.655000	0.94253	CCA	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.433	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	0	0	1		2	2	2	0	0	0	0	117	0	117	116	1	3.010000	-2.544284	1	0.330000	NM_003383		0	6	6	0	339	336	0	0	1	0		0	0	117	0	0	0.964364	1.171486e-02	0	0	0	8	0	6	339
PRKACG	5568	broad.mit.edu	37	9	71628843	71628843	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr9:71628843C>T	ENST00000377276.2	-	1	196	c.166G>A	c.(166-168)Ggg>Agg	p.G56R		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	56	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						ATCACCCGCCCGAAGGAGCCC	0.592																																					Esophageal Squamous(110;2236 2623 32146)	ENST00000377276.2	1.000000	7.000000e-02	2.800000e-01	1.100000e-01	0.170000	0.265395	0.170000	0.160000																										0				22						c.(166-168)Ggg>Agg		protein kinase, cAMP-dependent, catalytic, gamma							108.0	97.0	101.0					9																	71628843		2203	4300	6503	SO:0001583	missense	5568	0	0					g.chr9:71628843C>T	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.166G>A	chr9.hg19:g.71628843C>T	ENSP00000366488:p.Gly56Arg	1						p.G56R	NM_002732.3	NP_002723.2	0	2	2	1.712697	P22612	KAPCG_HUMAN		1	196	-			O60850|Q5VZ02|Q86YI1	Missense_Mutation	SNP	ENST00000377276.2	0	1	hg19	c.166G>A	CCDS6625.1	0	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877235	0.51801	.	.	ENSG00000165059	ENST00000377276	T	0.80738	-1.41	1.32	1.32	0.21799	1.32	1.32	0.21799	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.31531	U	0.007486	D	0.92120	0.7502	H	0.98682	4.3	0.36255	D	0.854184	D	0.89917	1.0	D	0.87578	0.998	D	0.92260	0.5816	10	0.87932	D	0	.	8.1306	0.31024	0.0:1.0:0.0:0.0	.	56	P22612	KAPCG_HUMAN	R	56	ENSP00000366488:G56R	ENSP00000366488:G56R	G	-	1	0	0	PRKACG	70818663	70818663	0.004000	0.15560	0.002000	0.10522	0.002000	0.02628	1.488000	0.35551	0.687000	0.31509	0.563000	0.77884	GGG	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.592	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1	0	0	1		2	2	2	0	0	0	0	105	0	105	102	1	3.010000	-2.935363	1	0.330000			0	7	7	0	269	264	0	0	1			0	0	105	0	0	0.979684	0	0	0	0	0	0	7	269
ANAPC2	29882	broad.mit.edu	37	9	140082360	140082360	+	Missense_Mutation	SNP	G	G	C			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chr9:140082360G>C	ENST00000323927.2	-	2	317	c.313C>G	c.(313-315)Ccc>Gcc	p.P105A	SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	105					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		AGGCACTGGGGCTCATCCGCA	0.582																																						ENST00000323927.2	1.000000	6.500000e-01	1	7.900000e-01	0.960000	0.918259	0.960000	1.000000																										0				15						c.(313-315)Ccc>Gcc		anaphase promoting complex subunit 2							89.0	93.0	92.0					9																	140082360		2203	4300	6503	SO:0001583	missense	29882	0	0					g.chr9:140082360G>C	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.313C>G	chr9.hg19:g.140082360G>C	ENSP00000314004:p.Pro105Ala	0					SSNA1_ENST00000322310.5_5'Flank	p.P105A	NM_013366.3	NP_037498.1	1	2	3	1.955606	Q9UJX6	ANC2_HUMAN	STAD - Stomach adenocarcinoma(284;0.0698)	2	317	-	all_cancers(76;0.0926)		Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	1	1	hg19	c.313C>G	CCDS7033.1	1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452889	0.26161	.	.	ENSG00000176248	ENST00000323927	T	0.70399	-0.48	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.187678	0.48767	D	0.000169	T	0.57007	0.2024	L	0.40543	1.245	0.31326	N	0.685481	B	0.06786	0.001	B	0.04013	0.001	T	0.52003	-0.8633	10	0.07482	T	0.82	-30.4898	11.8137	0.52197	0.0:0.1774:0.8226:0.0	.	105	Q9UJX6	ANC2_HUMAN	A	105	ENSP00000314004:P105A	ENSP00000314004:P105A	P	-	1	0	0	ANAPC2	139202181	139202181	1.000000	0.71417	0.983000	0.44433	0.770000	0.43624	2.929000	0.48916	2.365000	0.80145	0.561000	0.74099	CCC	0.406397		TCGA-LB-A8F3-01A-11D-A36O-08	0.582	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	1	0	1		2	2	2	0	0	0	0	80	0	80	80	1	3.010000	-14.950100	1	0.330000	NM_013366		0	30	29	0	192	190	1	0	1	1		0	0	80	0	0	1.000000	9.351292e-01	0	9	0	23	0	30	192
CXorf23	256643	broad.mit.edu	37	X	19955570	19955570	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chrX:19955570G>T	ENST00000379682.4	-	8	1859	c.1826C>A	c.(1825-1827)tCa>tAa	p.S609*	CXorf23_ENST00000379687.3_Intron|CXorf23_ENST00000356980.3_Intron			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	609						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TCTAAAATTTGATTTTATAAA	0.289																																						ENST00000379682.4	1.000000	5.300000e-01	9.200000e-01	6.400000e-01	0.770000	0.786483	0.770000	1.000000																										0				11						c.(1825-1827)tCa>tAa		chromosome X open reading frame 23							51.0	41.0	44.0					X																	19955570		692	1572	2264	SO:0001587	stop_gained	256643	0	0					g.chrX:19955570G>T	AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.1826C>A	chrX.hg19:g.19955570G>T	ENSP00000369004:p.Ser609*						CXorf23_ENST00000379687.3_Intron|CXorf23_ENST00000356980.3_Intron	p.S609*			0	1	1		A2AJT9	CX023_HUMAN		8	1859	-			A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Nonsense_Mutation	SNP	ENST00000379682.4	0	1	hg19	c.1826C>A		0	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928330	0.73327	.	.	ENSG00000173681	ENST00000379682	.	.	.	5.49	5.49	0.81192	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.43480	D	0.995702	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6845	0.45835	0.0912:0.0:0.9088:0.0	.	.	.	.	X	609	.	.	S	-	2	0	0	CXorf23	19865491	19865491	0.998000	0.40836	0.587000	0.28692	0.095000	0.18619	4.275000	0.58927	2.293000	0.77203	0.538000	0.68166	TCA	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.289	CXorf23-006	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000055991.2	0	0	1		2	2	2	0	0	0	0	48	0	48	48	1	3.010000	-13.818080	1	0.330000	NM_198279		0	28	28	0	190	189	1	0	1	0		0	0	48	0	0	1.000000	1.789387e-02	0	0	0	2	0	28	190
ZNF645	158506	broad.mit.edu	37	X	22292216	22292216	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chrX:22292216G>A	ENST00000323684.1	+	1	1152	c.1108G>A	c.(1108-1110)Gaa>Aaa	p.E370K		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	370					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TCAGTTCACCGAAAATCAAGA	0.448																																						ENST00000323684.1	0.600000	3.000000e-01	5.300000e-01	3.700000e-01	0.440000	0.452432	0.440000	0.440000																										0				27						c.(1108-1110)Gaa>Aaa		zinc finger protein 645							126.0	103.0	111.0					X																	22292216		2203	4300	6503	SO:0001583	missense	158506	0	0					g.chrX:22292216G>A	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.1108G>A	chrX.hg19:g.22292216G>A	ENSP00000323348:p.Glu370Lys							p.E370K	NM_152577.3	NP_689790.1	0	1	1		Q8N7E2	ZN645_HUMAN		1	1152	+			A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	1	1	hg19	c.1108G>A	CCDS14205.1	0	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921190	0.33908	.	.	ENSG00000175809	ENST00000323684	T	0.44881	0.91	2.9	2.03	0.26663	2.9	2.03	0.26663	.	0.187414	0.44902	U	0.000420	T	0.44787	0.1310	L	0.50333	1.59	0.24531	N	0.994111	D	0.61080	0.989	P	0.54856	0.762	T	0.23547	-1.0185	10	0.46703	T	0.11	.	7.378	0.26839	0.143:0.0:0.857:0.0	.	370	Q8N7E2	ZN645_HUMAN	K	370	ENSP00000323348:E370K	ENSP00000323348:E370K	E	+	1	0	0	ZNF645	22202137	22202137	0.998000	0.40836	0.003000	0.11579	0.002000	0.02628	1.969000	0.40510	0.622000	0.30249	-0.191000	0.12829	GAA	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.448	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	1	0	1		2	2	2	0	0	0	0	127	0	127	126	1	3.010000	-3.318785	1	0.330000	NM_152577		0	32	31	0	406	401	0	0	1			0	0	127	0	0	1.000000	0	0	0	0	0	0	32	406
KIF4A	24137	broad.mit.edu	37	X	69607059	69607059	+	Missense_Mutation	SNP	A	A	G			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chrX:69607059A>G	ENST00000374403.3	+	20	2226	c.2144A>G	c.(2143-2145)aAg>aGg	p.K715R	KIF4A_ENST00000374388.3_Missense_Mutation_p.K715R	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	715	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AAGCGTCTCAAGGATGCTCTC	0.423																																						ENST00000374403.3	1.000000	8.500000e-01	1	9.900000e-01	0.990000	0.991401	0.990000	1.000000																										0				51						c.(2143-2145)aAg>aGg		kinesin family member 4A							49.0	40.0	43.0					X																	69607059		2200	4284	6484	SO:0001583	missense	24137	0	0					g.chrX:69607059A>G	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2144A>G	chrX.hg19:g.69607059A>G	ENSP00000363524:p.Lys715Arg						KIF4A_ENST00000374388.3_Missense_Mutation_p.K715R	p.K715R	NM_012310.4	NP_036442.3	0	1	1		O95239	KIF4A_HUMAN		20	2226	+			B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	1	1	hg19	c.2144A>G	CCDS14401.1	1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.637444	0.47049	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.71461	2.54;-0.57	4.6	2.26	0.28386	4.6	2.26	0.28386	.	0.203530	0.34460	N	0.003950	T	0.61048	0.2316	L	0.55990	1.75	0.54753	D	0.999982	B	0.19935	0.04	B	0.16722	0.016	T	0.56306	-0.8001	10	0.41790	T	0.15	.	7.6175	0.28167	0.803:0.0:0.197:0.0	.	715	O95239	KIF4A_HUMAN	R	715;715;17	ENSP00000363509:K715R;ENSP00000363524:K715R	ENSP00000363509:K715R	K	+	2	0	0	KIF4A	69523784	69523784	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.459000	0.53021	0.707000	0.31934	0.381000	0.24937	AAG	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.423	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	1	0	1		2	2	2	0	0	0	0	11	0	11	11	1	3.010000	-19.999980	1	0.330000	NM_012310		0	12	12	0	36	36	1	0	1	0		0	0	11	0	0	0.999525	7.137255e-02	0	1	0	1	0	12	36
PCDH19	57526	broad.mit.edu	37	X	99662436	99662436	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chrX:99662436C>T	ENST00000373034.4	-	1	2835	c.1160G>A	c.(1159-1161)cGt>cAt	p.R387H	PCDH19_ENST00000420881.2_Missense_Mutation_p.R387H|PCDH19_ENST00000255531.7_Missense_Mutation_p.R387H	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	387	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GCCCAGCAAACGGCACTGCAC	0.607																																						ENST00000373034.4	0.820000	4.600000e-01	7.300000e-01	5.400000e-01	0.630000	0.644324	0.630000	0.630000																										0				68						c.(1159-1161)cGt>cAt		protocadherin 19							77.0	76.0	76.0					X																	99662436		2180	4256	6436	SO:0001583	missense	57526	0	0					g.chrX:99662436C>T	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1160G>A	chrX.hg19:g.99662436C>T	ENSP00000362125:p.Arg387His						PCDH19_ENST00000420881.2_Missense_Mutation_p.R387H|PCDH19_ENST00000255531.7_Missense_Mutation_p.R387H	p.R387H	NM_001184880.1	NP_001171809.1	0	1	1		Q8TAB3	PCD19_HUMAN		1	2835	-			B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	1	1	hg19	c.1160G>A	CCDS55462.1	0	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215554	0.58452	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.53640	0.61;0.61;0.61	5.95	5.95	0.96441	5.95	5.95	0.96441	Cadherin (4);Cadherin-like (1);	0.045907	0.85682	D	0.000000	T	0.53546	0.1803	L	0.39514	1.22	0.49389	D	0.99978	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71414	0.937;0.955;0.973	T	0.52983	-0.8502	10	0.32370	T	0.25	.	6.888	0.24214	0.0:0.7732:0.0:0.2268	.	387;387;387	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	H	387	ENSP00000400327:R387H;ENSP00000362125:R387H;ENSP00000255531:R387H	ENSP00000255531:R387H	R	-	2	0	0	PCDH19	99549092	99549092	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.536000	0.53582	2.498000	0.84270	0.513000	0.50165	CGT	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.607	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	1	0	1		2	2	2	0	0	0	0	102	0	102	100	1	3.010000	-20.000000	1	0.330000	NM_020766		0	41	41	0	350	347	0	0	1			0	0	102	0	0	1.000000	0	0	0	0	0	0	41	350
STAG2	10735	broad.mit.edu	37	X	123176477	123176477	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A8F3-01A-11D-A36O-08	TCGA-LB-A8F3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d875181-2048-4fa9-9dda-6fd59784c583	2bbbc64a-f365-4fcb-8de2-b6ca00f3cb4a	g.chrX:123176477G>A	ENST00000371160.1	+	7	734	c.444G>A	c.(442-444)atG>atA	p.M148I	STAG2_ENST00000371145.3_Missense_Mutation_p.M148I|STAG2_ENST00000354548.5_Missense_Mutation_p.M79I|STAG2_ENST00000371157.3_Missense_Mutation_p.M148I|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.M148I|STAG2_ENST00000371144.3_Missense_Mutation_p.M148I	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	148					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTCGAAAAATGACTGAAGAAT	0.299																																						ENST00000371160.1	0.580000	2.700000e-01	5.000000e-01	3.300000e-01	0.410000	0.422390	0.410000	0.410000																										0				78						c.(442-444)atG>atA		stromal antigen 2							78.0	74.0	76.0					X																	123176477		2203	4300	6503	SO:0001583	missense	10735	0	0					g.chrX:123176477G>A	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.444G>A	chrX.hg19:g.123176477G>A	ENSP00000360202:p.Met148Ile						STAG2_ENST00000354548.5_Missense_Mutation_p.M79I|STAG2_ENST00000371157.3_Missense_Mutation_p.M148I|STAG2_ENST00000218089.9_Missense_Mutation_p.M148I|STAG2_ENST00000371145.3_Missense_Mutation_p.M148I|STAG2_ENST00000371144.3_Missense_Mutation_p.M148I|STAG2_ENST00000469481.1_Intron	p.M148I	NM_001282418.1	NP_001269347.1	0	1	1		Q8N3U4	STAG2_HUMAN		7	734	+			B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	1	1	hg19	c.444G>A	CCDS14607.1	0	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274155	0.80580	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000435103;ENST00000371157;ENST00000371145;ENST00000371144;ENST00000428941;ENST00000435215	T;T;T;T;T;T;T	0.42900	1.9;0.96;1.52;1.51;1.51;1.9;1.51	5.74	4.86	0.63082	5.74	4.86	0.63082	.	0.077879	0.85682	D	0.000000	T	0.60958	0.2309	M	0.83603	2.65	0.80722	D	1	D;P	0.55172	0.97;0.884	P;P	0.56700	0.804;0.54	T	0.62817	-0.6774	10	0.29301	T	0.29	-15.651	15.262	0.73631	0.0:0.0:0.8586:0.1414	.	148;148	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	I	148;148;79;148;148;148;148;148;148;148	ENSP00000218089:M148I;ENSP00000397265:M148I;ENSP00000346555:M79I;ENSP00000360202:M148I;ENSP00000360199:M148I;ENSP00000360187:M148I;ENSP00000360186:M148I	ENSP00000218089:M148I	M	+	3	0	0	STAG2	123004158	123004158	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.740000	0.98839	1.172000	0.42781	0.522000	0.50473	ATG	0.330000		TCGA-LB-A8F3-01A-11D-A36O-08	0.299	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	1	0	1		2	2	2	0	0	0	0	111	0	111	111	1	3.010000	-20.000000	1	0.330000	NM_006603		0	25	25	0	344	339	0	0	1	0		0	0	111	0	0	1.000000	1.290434e-01	0	0	0	9	0	25	344
