#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TMEM180	79847	broad.mit.edu	37	10	104235646	104235646	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr10:104235646T>C	ENST00000238936.4	+	10	1696	c.1459T>C	c.(1459-1461)Tcc>Ccc	p.S487P	TMEM180_ENST00000366277.2_Missense_Mutation_p.S216P	NM_024789.3	NP_079065.2	Q14CX5	TM180_HUMAN	transmembrane protein 180	487						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|skin(1)	13		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTTCACCTGGTCCCAGTTCAC	0.627																																						ENST00000238936.4	0.500000	0.070000	0.370000	0.140000	0.230000	0.260596	0.230000	0.210000																										0				13						c.(1459-1461)Tcc>Ccc		transmembrane protein 180							37.0	32.0	34.0					10																	104235646		2203	4300	6503	SO:0001583	missense	79847	2	121412	31				g.chr10:104235646T>C	AK026182	CCDS7535.1	10q24.32	2011-02-09	2006-10-12	2006-10-12	ENSG00000138111	ENSG00000138111			26196	protein-coding gene	gene with protein product				C10orf77		12477932	Standard	XM_006717971		Approved	FLJ22529, bA18I14.8	uc001kvt.3	Q14CX5	OTTHUMG00000018961	ENST00000238936.4:c.1459T>C	chr10.hg19:g.104235646T>C	ENSP00000238936:p.Ser487Pro	0					TMEM180_ENST00000366277.2_Missense_Mutation_p.S216P	p.S487P	NM_024789.3	NP_079065.2	0	0	0	1.954183	Q14CX5	TM180_HUMAN		10	1696	+		Colorectal(252;0.122)	Q6NWM8|Q6NWM9|Q6PEZ7|Q9H679	Missense_Mutation	SNP	ENST00000238936.4	0	1	hg19	c.1459T>C	CCDS7535.1	0	.	.	.	.	.	.	.	.	.	.	t	17.56	3.420014	0.62622	.	.	ENSG00000138111	ENST00000366277;ENST00000238936;ENST00000369930	.	.	.	4.82	3.69	0.42338	4.82	3.69	0.42338	.	0.102864	0.64402	N	0.000002	T	0.69967	0.3170	M	0.80028	2.48	0.51767	D	0.999933	D	0.60160	0.987	D	0.63488	0.915	T	0.67745	-0.5591	9	0.36615	T	0.2	.	6.8488	0.24003	0.134:0.0755:0.0:0.7905	.	487	Q14CX5	TM180_HUMAN	P	216;487;216	.	ENSP00000238936:S487P	S	+	1	0	0	TMEM180	104225636	104225636	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	6.216000	0.72212	0.820000	0.34516	0.255000	0.18592	TCC	0.219392		TCGA-LB-A9Q5-01A-11D-A397-08	0.627	TMEM180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050075.2	0	0	1	2	2	2	2	0	0	0	0	36	0	36	36	1	2	-6.590775	1	0.240000	NM_024789		0	4	4	0	146	142	0		1	0		0	0	36	0	0	0.884969	1.289990e-03	0	0	0	2	0	4	146
PBLD	64081	broad.mit.edu	37	10	70056061	70056061	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr10:70056061G>A	ENST00000358769.2	-	4	447	c.245C>T	c.(244-246)gCc>gTc	p.A82V	PBLD_ENST00000495025.2_Missense_Mutation_p.A82V|PBLD_ENST00000309049.4_Missense_Mutation_p.A82V|PBLD_ENST00000432941.1_Missense_Mutation_p.A82V|PBLD_ENST00000336578.1_Missense_Mutation_p.A49V	NM_022129.3	NP_071412.2	P30039	PBLD_HUMAN	phenazine biosynthesis-like protein domain containing	82					biosynthetic process (GO:0009058)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	isomerase activity (GO:0016853)			endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21						AGCCAGGGTGGCATGGCCACA	0.423																																						ENST00000358769.2	0.420000	0.070000	0.320000	0.130000	0.210000	0.231107	0.210000	0.200000																										0				21						c.(244-246)gCc>gTc		phenazine biosynthesis-like protein domain containing							51.0	51.0	51.0					10																	70056061		2203	4300	6503	SO:0001583	missense	64081	0	0					g.chr10:70056061G>A	AK027673	CCDS7277.2, CCDS44413.1	10q21.3	2006-11-27			ENSG00000108187	ENSG00000108187			23301	protein-coding gene	gene with protein product	MAWD binding protein	612189				11355021	Standard	XM_005270028		Approved	MAWBP, MAWDBP, FLJ14767	uc001jns.1	P30039	OTTHUMG00000073949	ENST00000358769.2:c.245C>T	chr10.hg19:g.70056061G>A	ENSP00000351619:p.Ala82Val	0					PBLD_ENST00000309049.4_Missense_Mutation_p.A82V|PBLD_ENST00000495025.2_Missense_Mutation_p.A82V|PBLD_ENST00000432941.1_Missense_Mutation_p.A82V|PBLD_ENST00000336578.1_Missense_Mutation_p.A49V	p.A82V	NM_022129.3	NP_071412.2	0	0	0	1.954183	P30039	PBLD_HUMAN		4	447	-			A8MZJ3|C9JIM0|Q9HCC2	Missense_Mutation	SNP	ENST00000358769.2	1	1	hg19	c.245C>T	CCDS7277.2	0	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517219	0.85495	.	.	ENSG00000108187	ENST00000336578;ENST00000358769;ENST00000309049;ENST00000432941	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.67	4.76	0.60689	5.67	4.76	0.60689	.	0.058094	0.64402	D	0.000002	T	0.74741	0.3756	H	0.96269	3.795	0.54753	D	0.99998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.83322	-0.0017	10	0.87932	D	0	-10.1697	13.9539	0.64135	0.0:0.1521:0.8479:0.0	.	82;82	C9JIM0;P30039	.;PBLD_HUMAN	V	49;82;82;82	ENSP00000338041:A49V;ENSP00000351619:A82V;ENSP00000308466:A82V;ENSP00000395534:A82V	ENSP00000308466:A82V	A	-	2	0	0	PBLD	69726067	69726067	1.000000	0.71417	0.923000	0.36655	0.851000	0.48451	5.741000	0.68638	1.378000	0.46305	0.561000	0.74099	GCC	0.219392		TCGA-LB-A9Q5-01A-11D-A397-08	0.423	PBLD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048314.1	0	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	2	-3.167927	1	0.240000	NM_022129		0	5	5	0	200	200	0		1	0		0	0	54	0	0	0.938308	2.793004e-01	0	0	0	36	0	5	200
HK1	3098	broad.mit.edu	37	10	71119706	71119706	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr10:71119706C>T	ENST00000359426.6	+	3	384	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W	HK1_ENST00000404387.2_Missense_Mutation_p.R98W|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000360289.2_Missense_Mutation_p.R82W|HK1_ENST00000448642.2_Missense_Mutation_p.R129W|HK1_ENST00000298649.3_Missense_Mutation_p.R93W	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	94	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						TCGAATTCTGCGGGTGCAAGT	0.478																																						ENST00000359426.6	0.220000	0.040000	0.170000	0.070000	0.110000	0.125763	0.110000	0.110000																										0				35						c.(280-282)Cgg>Tgg		hexokinase 1							150.0	138.0	142.0					10																	71119706		2203	4300	6503	SO:0001583	missense	3098	1	121412	33				g.chr10:71119706C>T	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.280C>T	chr10.hg19:g.71119706C>T	ENSP00000352398:p.Arg94Trp	0					HK1_ENST00000448642.2_Missense_Mutation_p.R129W|HK1_ENST00000360289.2_Missense_Mutation_p.R82W|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000404387.2_Missense_Mutation_p.R98W|HK1_ENST00000298649.3_Missense_Mutation_p.R93W	p.R94W	NM_000188.2	NP_000179.2	0	0	0	1.954183	P19367	HXK1_HUMAN		3	384	+			E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	0	1	hg19	c.280C>T	CCDS7292.1	0	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995975	0.54147	.	.	ENSG00000156515	ENST00000450646;ENST00000360289;ENST00000448642;ENST00000421088;ENST00000404387;ENST00000436817;ENST00000298649;ENST00000359426;ENST00000405407	T;T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48	5.51	3.59	0.41128	5.51	3.59	0.41128	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49457	0.1558	M	0.67625	2.065	0.80722	D	1	B;B;B;B;B	0.19817	0.006;0.016;0.029;0.039;0.003	B;B;B;B;B	0.15484	0.006;0.013;0.013;0.013;0.002	T	0.41088	-0.9528	10	0.25751	T	0.34	-2.9677	13.4228	0.61007	0.434:0.566:0.0:0.0	.	94;93;129;98;82	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	W	98;82;129;82;98;93;93;94;94	ENSP00000409761:R98W;ENSP00000353433:R82W;ENSP00000402103:R129W;ENSP00000398316:R82W;ENSP00000384774:R98W;ENSP00000415949:R93W;ENSP00000298649:R93W;ENSP00000352398:R94W	ENSP00000298649:R93W	R	+	1	2	2	HK1	70789712	70789712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.964000	0.49192	0.621000	0.30232	0.561000	0.74099	CGG	0.219392		TCGA-LB-A9Q5-01A-11D-A397-08	0.478	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	0	0	1	2	2	2	2	0	0	0	0	135	0	135	133	1	2	-1.992832	0	0.240000	NM_000188		0	6	6	0	440	436	0		1	0		0	0	135	0	0	0.964225	1.184928e-01	0	0	0	37	0	6	440
EIF3A	8661	broad.mit.edu	37	10	120801889	120801889	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr10:120801889G>A	ENST00000369144.3	-	19	3270	c.3143C>T	c.(3142-3144)cCg>cTg	p.P1048L	EIF3A_ENST00000541549.1_Missense_Mutation_p.P1014L	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TCCTCGCCTCGGCCCCCGGTC	0.607																																						ENST00000369144.3	0.170000	0.040000	0.140000	0.060000	0.090000	0.104748	0.090000	0.090000																										0				56						c.(3142-3144)cCg>cTg		eukaryotic translation initiation factor 3, subunit A							283.0	221.0	242.0					10																	120801889		2203	4300	6503	SO:0001583	missense	8661	1	121412	35				g.chr10:120801889G>A	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3143C>T	chr10.hg19:g.120801889G>A	ENSP00000358140:p.Pro1048Leu	0					EIF3A_ENST00000541549.1_Missense_Mutation_p.P1014L	p.P1048L	NM_003750.2	NP_003741.1	0	0	0	1.954183	P56537	IF6_HUMAN		19	3270	-		Lung NSC(174;0.094)|all_lung(145;0.123)	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	0	1	hg19	c.3143C>T	CCDS7608.1	0	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917505	0.33815	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.25579	1.79;1.8	5.41	0.456	0.16655	5.41	0.456	0.16655	.	0.187445	0.25433	N	0.030713	T	0.22820	0.0551	M	0.76002	2.32	0.80722	D	1	P;B	0.37061	0.58;0.002	B;B	0.26202	0.067;0.001	T	0.06463	-1.0825	10	0.49607	T	0.09	-0.3992	10.0066	0.41961	0.3389:0.0:0.6611:0.0	.	1014;1048	F5H335;Q14152	.;EIF3A_HUMAN	L	1048;1014	ENSP00000358140:P1048L;ENSP00000438178:P1014L	ENSP00000358140:P1048L	P	-	2	0	0	EIF3A	120791879	120791879	0.989000	0.36119	0.065000	0.19835	0.956000	0.61745	1.972000	0.40540	-0.059000	0.13154	-0.126000	0.14955	CCG	0.219392		TCGA-LB-A9Q5-01A-11D-A397-08	0.607	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	0	0	1	2	13	5	2	1	0	1	1	231	0	231	227	1	2	-2.101591	0	0.240000	NM_003750		0	9	9	0	760	754	0		0	0		1	0	231	0	0	0.253193	1.273683e-01	0	3	0	189	0	9	760
DPAGT1	1798	broad.mit.edu	37	11	118971495	118971495	+	Missense_Mutation	SNP	G	G	A	rs397515327		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr11:118971495G>A	ENST00000409993.2	-	5	1892	c.341C>T	c.(340-342)gCg>gTg	p.A114V	DPAGT1_ENST00000354202.4_Missense_Mutation_p.A114V|DPAGT1_ENST00000445653.1_5'UTR|DPAGT1_ENST00000432443.2_Missense_Mutation_p.A7V			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	114					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		TACATCATCCGCAAAGCCCAG	0.567											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000409993.2	0.460000	0.060000	0.310000	0.110000	0.190000	0.221662	0.190000	0.180000																										0				17						c.(340-342)gCg>gTg		dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)							72.0	65.0	67.0					11																	118971495		2200	4295	6495	SO:0001583	missense	1798	3	121412	31				g.chr11:118971495G>A	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.341C>T	chr11.hg19:g.118971495G>A	ENSP00000386597:p.Ala114Val	0		OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1492	DPAGT1_ENST00000432443.2_Missense_Mutation_p.A7V|DPAGT1_ENST00000445653.1_5'UTR|DPAGT1_ENST00000354202.4_Missense_Mutation_p.A114V	p.A114V			1	2	3	2.001681	Q9H3H5	GPT_HUMAN		5	1892	-	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	0	1	hg19	c.341C>T	CCDS8411.1	0	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692412	0.88735	.	.	ENSG00000172269	ENST00000409993;ENST00000354202;ENST00000432443	D;D;D	0.92348	-3.02;-3.02;-3.02	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.87249	0.6130	L	0.32530	0.975	0.80722	D	1	P;B	0.41393	0.748;0.219	B;B	0.33890	0.172;0.09	D	0.88514	0.3091	10	0.54805	T	0.06	-32.643	18.1546	0.89687	0.0:0.0:1.0:0.0	.	7;114	E7EW40;Q9H3H5	.;GPT_HUMAN	V	114;114;7	ENSP00000386597:A114V;ENSP00000346142:A114V;ENSP00000404036:A7V	ENSP00000346142:A114V	A	-	2	0	0	DPAGT1	118476705	118476705	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	9.869000	0.99810	2.524000	0.85096	0.563000	0.77884	GCG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.567	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	0	0	1	2	2	2	2	0	0	0	0	38	0	38	38	1	2	-2.966489	1	0.240000	NM_001382		0	4	4	0	186	185	0		1	0		0	0	38	0	0	0.890011	3.631737e-01	0	0	0	50	0	4	186
OR52B4	143496	broad.mit.edu	37	11	4389022	4389022	+	Silent	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr11:4389022C>T	ENST00000408920.2	-	1	594	c.504G>A	c.(502-504)ttG>ttA	p.L168L		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	168					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCAGAAAGTCAATCTTTTTA	0.343																																						ENST00000408920.2	0.450000	0.130000	0.340000	0.180000	0.250000	0.273660	0.250000	0.240000																										0				31						c.(502-504)ttG>ttA		olfactory receptor, family 52, subfamily B, member 4							63.0	61.0	62.0					11																	4389022		1822	4078	5900	SO:0001819	synonymous_variant	143496	0	0					g.chr11:4389022C>T	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.504G>A	chr11.hg19:g.4389022C>T		0						p.L168L	NM_001005161.3	NP_001005161.2	1	2	3	2.001681	Q8NGK2	O52B4_HUMAN		1	594	-		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)	A6NP68|Q6IFK6	Silent	SNP	ENST00000408920.2	1	1	hg19	c.504G>A	CCDS41609.1	0																																																																																								0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.343	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	0	0	1	2	2	2	2	0	0	0	0	109	0	109	109	1	2	-11.020770	1	0.240000	NM_001005161		0	11	11	0	360	360	0		1			0	0	109	0	0	0.998392	0	0	0	0	0	0	11	360
ABTB2	25841	broad.mit.edu	37	11	34226220	34226220	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr11:34226220C>T	ENST00000435224.2	-	2	1325	c.901G>A	c.(901-903)Gca>Aca	p.A301T	ABTB2_ENST00000298992.2_Missense_Mutation_p.A115T|ABTB2_ENST00000530814.1_5'UTR	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	301					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CTGAAGTATGCGGGGAGGGAG	0.637																																						ENST00000435224.2	0.530000	0.070000	0.360000	0.130000	0.220000	0.254202	0.220000	0.200000																										0				25						c.(901-903)Gca>Aca		ankyrin repeat and BTB (POZ) domain containing 2							33.0	36.0	35.0					11																	34226220		2202	4298	6500	SO:0001583	missense	25841	0	0					g.chr11:34226220C>T	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.901G>A	chr11.hg19:g.34226220C>T	ENSP00000410157:p.Ala301Thr	0					ABTB2_ENST00000298992.2_Missense_Mutation_p.A115T|ABTB2_ENST00000530814.1_5'UTR	p.A301T	NM_145804.2	NP_665803.2	1	2	3	2.001681	Q8N961	ABTB2_HUMAN		2	1325	-		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	ENST00000435224.2	0	1	hg19	c.901G>A	CCDS7890.2	0	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989268	0.53934	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.60040	0.22;0.22	5.1	5.1	0.69264	5.1	5.1	0.69264	Histone-fold (2);	0.060615	0.64402	D	0.000004	T	0.43055	0.1230	L	0.42245	1.32	0.53005	D	0.999969	P	0.48640	0.913	B	0.33121	0.158	T	0.40942	-0.9536	10	0.21014	T	0.42	-16.1742	14.1808	0.65574	0.0:0.8504:0.1496:0.0	.	115	Q8N961	ABTB2_HUMAN	T	301;115	ENSP00000410157:A301T;ENSP00000298992:A115T	ENSP00000298992:A115T	A	-	1	0	0	ABTB2	34182796	34182796	1.000000	0.71417	0.253000	0.24343	0.787000	0.44495	5.696000	0.68287	2.366000	0.80165	0.455000	0.32223	GCA	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.637	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	0	0	1	2	2	2	2	0	0	0	0	49	0	49	39	1	2	-3.568985	1	0.240000	NM_145804		0	4	4	0	160	136	0		1	0		0	0	49	0	0	0.849843	6.138717e-03	0	0	0	4	0	4	160
ROBO4	54538	broad.mit.edu	37	11	124761327	124761327	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr11:124761327G>A	ENST00000306534.3	-	12	2301	c.1816C>T	c.(1816-1818)Cgc>Tgc	p.R606C	RP11-664I21.6_ENST00000524433.1_5'UTR|ROBO4_ENST00000533054.1_Missense_Mutation_p.R461C	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	606					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGTGGGAGGCGCCTGACAGCT	0.662																																						ENST00000306534.3	0.920000	0.290000	0.710000	0.400000	0.540000	0.560290	0.540000	0.520000																										0				76						c.(1816-1818)Cgc>Tgc		roundabout, axon guidance receptor, homolog 4 (Drosophila)							26.0	32.0	30.0					11																	124761327		2201	4299	6500	SO:0001583	missense	54538	5	121394	36				g.chr11:124761327G>A	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1816C>T	chr11.hg19:g.124761327G>A	ENSP00000304945:p.Arg606Cys	0					ROBO4_ENST00000533054.1_Missense_Mutation_p.R461C|RP11-664I21.6_ENST00000524433.1_5'UTR	p.R606C	NM_019055.5	NP_061928.4	1	2	3	2.001681	Q8WZ75	ROBO4_HUMAN		12	2301	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	1	1	hg19	c.1816C>T	CCDS8455.1	0	.	.	.	.	.	.	.	.	.	.	G	8.823	0.937980	0.18206	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.64991	-0.13;0.24	6.11	1.95	0.26073	6.11	1.95	0.26073	.	0.389841	0.19154	N	0.121379	T	0.52468	0.1736	M	0.65975	2.015	0.34129	D	0.665067	B;B;B	0.13145	0.007;0.001;0.004	B;B;B	0.08055	0.002;0.001;0.003	T	0.52094	-0.8621	10	0.33141	T	0.24	.	4.1764	0.10353	0.2735:0.0:0.5689:0.1575	.	606;496;606	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	C	606;496;461	ENSP00000304945:R606C;ENSP00000437129:R461C	ENSP00000304945:R606C	R	-	1	0	0	ROBO4	124266537	124266537	0.937000	0.31787	0.452000	0.26994	0.311000	0.27955	0.378000	0.20569	0.419000	0.25927	-0.137000	0.14449	CGC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.662	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	1	0	1	2	2	2	2	0	0	0	0	53	0	53	51	1	2	-3.321142	1	0.240000	NM_019055		0	12	12	0	178	175	0		1	0		0	0	53	0	0	0.999130	3.679494e-01	0	0	0	19	0	12	178
CCND2	894	broad.mit.edu	37	12	4387932	4387932	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr12:4387932G>A	ENST00000261254.3	+	3	687	c.418G>A	c.(418-420)Gaa>Aaa	p.E140K	RP11-264F23.3_ENST00000539135.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	140	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			CCAGGAGTGGGAACTGGTGGT	0.562			T	IGL@	"""NHL,CLL"""																																	ENST00000261254.3	1.000000	0.090000	0.300000	0.140000	0.200000	0.243523	0.200000	0.190000				Dom	yes			Dom	yes		12	12p13	12p13	894	T	cyclin D2				L	L	IGL@		NHL,CLL		0				17						c.(418-420)Gaa>Aaa		cyclin D2							86.0	91.0	89.0					12																	4387932		2203	4300	6503	SO:0001583	missense	894	0	0					g.chr12:4387932G>A	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.418G>A	chr12.hg19:g.4387932G>A	ENSP00000261254:p.Glu140Lys	0					RP11-264F23.3_ENST00000539135.1_RNA	p.E140K	NM_001759.3	NP_001750.1	1	2	3	2.012032	P30279	CCND2_HUMAN	all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)	3	687	+			A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	0	1	hg19	c.418G>A	CCDS8524.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.856601|4.856601	0.91355|0.91355	.|.	.|.	ENSG00000118971|ENSG00000118971	ENST00000261254|ENST00000536537	T|.	0.45276|.	0.9|.	4.79|4.79	4.79|4.79	0.61399|0.61399	4.79|4.79	4.79|4.79	0.61399|0.61399	Cyclin, N-terminal (1);Cyclin-like (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88698|0.88698	0.6507|0.6507	H|H	0.97783|0.97783	4.075|4.075	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.93199|0.93199	0.6590|0.6590	10|5	0.87932|.	D|.	0|.	.|.	16.8234|16.8234	0.85924|0.85924	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	140|.	P30279|.	CCND2_HUMAN|.	K|E	140|55	ENSP00000261254:E140K|.	ENSP00000261254:E140K|.	E|G	+|+	1|2	0|0	0|0	CCND2|CCND2	4258193|4258193	4258193|4258193	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.870000|0.870000	0.49936|0.49936	9.860000|9.860000	0.99555|0.99555	2.198000|2.198000	0.70561|0.70561	0.561000|0.561000	0.74099|0.74099	GAA|GGA	0.244533		TCGA-LB-A9Q5-01A-11D-A397-08	0.562	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	0	0	1	2	2	2	2	0	0	0	0	105	0	105	104	1	2	-3.284531	1	0.240000	NM_001759		0	8	8	0	340	338	0		1	0		0	0	105	0	0	0.989323	3.934855e-02	0	0	0	12	0	8	340
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.630000	0.230000	0.500000	0.300000	0.380000	0.405703	0.380000	0.380000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.003470	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	17	2	2	6	0	8	0	0	81	8005	81	79	1	2	-4.738191	1	0.240000	NM_033360		607	16	16	7421	334	329	0	1	1	1	1	0	1	81	542	1	0.999930	9.844747e-02	9.993871e-01	4	26	7	469	16	334
ATP5B	506	broad.mit.edu	37	12	57037309	57037309	+	Missense_Mutation	SNP	C	C	T	rs200966693		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr12:57037309C>T	ENST00000262030.3	-	5	720	c.670G>A	c.(670-672)Gcc>Acc	p.A224T	ATP5B_ENST00000552919.1_Missense_Mutation_p.A224T|ATP5B_ENST00000550162.1_5'Flank|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	224					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)	p.A224T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGGCTTTGGCGACATTGTTG	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		17384	0.0		0.001	False		,,,				2504	0.0					ENST00000262030.3	0.220000	0.030000	0.170000	0.060000	0.100000	0.121130	0.100000	0.100000																										1	Substitution - Missense(1)	p.A224T(1)	large_intestine(1)	19						c.(670-672)Gcc>Acc		ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide							105.0	97.0	100.0					12																	57037309		2203	4300	6503	SO:0001583	missense	506	1	121412	28				g.chr12:57037309C>T	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.670G>A	chr12.hg19:g.57037309C>T	ENSP00000262030:p.Ala224Thr	0					ATP5B_ENST00000552919.1_Missense_Mutation_p.A224T|SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000550162.1_5'Flank	p.A224T	NM_001686.3	NP_001677.2	0	1	1	1.987129	P06576	ATPB_HUMAN		5	720	-			A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	0	1	hg19	c.670G>A	CCDS8924.1	0	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	27.9|27.9	4.873953|4.873953	0.91664|0.91664	.|.	.|.	ENSG00000110955|ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020;ENST00000551570;ENST00000553007|ENST00000552959	T;T;T;T;T|.	0.79352|.	-1.26;-1.26;-1.26;-1.26;-1.26|.	5.9|5.9	5.9|5.9	0.94986|0.94986	5.9|5.9	5.9|5.9	0.94986|0.94986	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);ATPase, AAA+ type, core (1);|.	0.099413|.	0.64402|.	D|.	0.000002|.	D|D	0.84009|0.84009	0.5378|0.5378	M|M	0.87381|0.87381	2.88|2.88	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.66084|.	0.941|.	D|D	0.85062|0.85062	0.0935|0.0935	10|5	0.87932|.	D|.	0|.	-3.7647|-3.7647	19.0535|19.0535	0.93054|0.93054	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	224|.	P06576|.	ATPB_HUMAN|.	T|H	224;224;163;17;125|160	ENSP00000262030:A224T;ENSP00000450297:A224T;ENSP00000446677:A163T;ENSP00000448428:A17T;ENSP00000447571:A125T|.	ENSP00000262030:A224T|.	A|R	-|-	1|2	0|0	0|0	ATP5B|ATP5B	55323576|55323576	55323576|55323576	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.993000|0.993000	0.82548|0.82548	7.688000|7.688000	0.84153|0.84153	2.786000|2.786000	0.95864|0.95864	0.563000|0.563000	0.77884|0.77884	GCC|CGC	0.233562		TCGA-LB-A9Q5-01A-11D-A397-08	0.413	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	0	0	1	2	14	20	2	1	0	1	1	110	0	110	110	1	2	-2.354045	0	0.240000	NM_001686		0	5	5	0	399	396	0		0	0		1	0	110	0	0	0.028781	3.909988e-02	0	3	0	642	0	5	399
SMEK1	55671	broad.mit.edu	37	14	91931722	91931722	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr14:91931722C>T	ENST00000554943.1	-	11	1817	c.1702G>A	c.(1702-1704)Gag>Aag	p.E568K	SMEK1_ENST00000555462.1_Missense_Mutation_p.E329K|SMEK1_ENST00000554684.1_Missense_Mutation_p.E555K|SMEK1_ENST00000428424.2_Missense_Mutation_p.E329K|SMEK1_ENST00000555718.1_5'UTR|SMEK1_ENST00000337238.4_Missense_Mutation_p.E555K			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	568					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TTGTAAAACTCATCTTTTAAT	0.358																																						ENST00000554943.1	0.520000	0.140000	0.390000	0.200000	0.280000	0.305035	0.280000	0.270000																										0				6						c.(1702-1704)Gag>Aag		SMEK homolog 1, suppressor of mek1 (Dictyostelium)							99.0	98.0	98.0					14																	91931722		2203	4300	6503	SO:0001583	missense	55671	0	0					g.chr14:91931722C>T	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1702G>A	chr14.hg19:g.91931722C>T	ENSP00000450883:p.Glu568Lys	0					SMEK1_ENST00000428424.2_Missense_Mutation_p.E329K|SMEK1_ENST00000555718.1_5'UTR|SMEK1_ENST00000555462.1_Missense_Mutation_p.E329K|SMEK1_ENST00000337238.4_Missense_Mutation_p.E555K|SMEK1_ENST00000554684.1_Missense_Mutation_p.E555K	p.E568K			1	2	3	2.005282	Q6IN85	P4R3A_HUMAN		11	1817	-		all_cancers(154;0.0691)|all_epithelial(191;0.219)	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	1	1	hg19	c.1702G>A		0	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516739	0.64634	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390	T;T;D;T;D;T	0.95001	1.58;1.58;-3.58;1.58;-3.58;1.58	6.15	6.15	0.99193	6.15	6.15	0.99193	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.96830	0.8965	M	0.63208	1.945	0.80722	D	1	D;D;D	0.63880	0.974;0.993;0.99	D;P;P	0.70487	0.969;0.901;0.907	D	0.95808	0.8839	10	0.48119	T	0.1	-15.5476	20.8387	0.99724	0.0:1.0:0.0:0.0	.	329;568;555	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	K	555;555;329;568;329;555	ENSP00000450864:E555K;ENSP00000337125:E555K;ENSP00000392704:E329K;ENSP00000450883:E568K;ENSP00000450891:E329K;ENSP00000452596:E555K	ENSP00000337125:E555K	E	-	1	0	0	SMEK1	91001475	91001475	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	7.811000	0.86092	2.932000	0.99384	0.643000	0.83706	GAG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.358	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	0	0	1	2	2	2	2	0	0	0	0	97	0	97	96	1	2	-3.228879	1	0.240000	NM_032560		0	10	10	0	293	290	1		1	1		0	0	97	0	0	0.996854	2.810018e-01	0	8	0	21	0	10	293
CDC42BPB	9578	broad.mit.edu	37	14	103434632	103434632	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr14:103434632C>A	ENST00000361246.2	-	16	2592	c.2304G>T	c.(2302-2304)atG>atT	p.M768I		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CATCAAACAGCATCGCTCTTT	0.368																																						ENST00000361246.2	0.300000	0.060000	0.210000	0.090000	0.140000	0.166167	0.140000	0.140000																										0				49						c.(2302-2304)atG>atT		CDC42 binding protein kinase beta (DMPK-like)							203.0	186.0	192.0					14																	103434632		2203	4300	6503	SO:0001583	missense	9578	0	0					g.chr14:103434632C>A	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.2304G>T	chr14.hg19:g.103434632C>A	ENSP00000355237:p.Met768Ile	0						p.M768I	NM_006035.3	NP_006026.3	1	2	3	2.005282				16	2592	-		Melanoma(154;0.155)		Missense_Mutation	SNP	ENST00000361246.2	0	1	hg19	c.2304G>T	CCDS9978.1	0	.	.	.	.	.	.	.	.	.	.	C	0.788	-0.759973	0.03019	.	.	ENSG00000198752	ENST00000361246	T	0.63580	-0.05	4.47	2.64	0.31445	4.47	2.64	0.31445	.	0.272643	0.42682	N	0.000661	T	0.39545	0.1082	N	0.17082	0.46	0.39110	D	0.961469	B	0.02656	0.0	B	0.01281	0.0	T	0.12041	-1.0563	10	0.23891	T	0.37	.	6.6845	0.23138	0.0:0.706:0.1457:0.1483	.	768	Q9Y5S2	MRCKB_HUMAN	I	768	ENSP00000355237:M768I	ENSP00000355237:M768I	M	-	3	0	0	CDC42BPB	102504385	102504385	1.000000	0.71417	0.251000	0.24312	0.079000	0.17450	0.811000	0.27198	0.461000	0.27071	0.561000	0.74099	ATG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.368	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	0	0	1	2	2	2	2	0	0	0	0	130	0	130	129	1	2	-2.908334	1	0.240000	NM_006035		0	7	7	0	411	406	0		1	1		0	0	130	1	0	0.979955	1.739033e-01	0	5	0	34	0	7	411
CHRNB4	1143	broad.mit.edu	37	15	78922232	78922232	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr15:78922232C>T	ENST00000261751.3	-	5	526	c.415G>A	c.(415-417)Ggc>Agc	p.G139S	CHRNB4_ENST00000560511.1_5'Flank|CHRNB4_ENST00000412074.2_Intron|RP11-335K5.2_ENST00000559120.1_RNA	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	139					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.G139C(1)|p.G139S(1)		endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	AGGACGCTGCCGTTGGACCGG	0.572																																						ENST00000261751.3	1.000000	0.110000	0.470000	0.180000	0.280000	0.364326	0.280000	0.250000																										2	Substitution - Missense(2)	p.G139C(1)|p.G139S(1)	lung(2)	22						c.(415-417)Ggc>Agc		cholinergic receptor, nicotinic, beta 4 (neuronal)	Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)						41.0	44.0	43.0					15																	78922232		2196	4292	6488	SO:0001583	missense	1143	0	0					g.chr15:78922232C>T	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.415G>A	chr15.hg19:g.78922232C>T	ENSP00000261751:p.Gly139Ser	0					RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000560511.1_5'Flank|CHRNB4_ENST00000412074.2_Intron	p.G139S	NM_000750.3	NP_000741.1	1	2	3	2.026427	P30926	ACHB4_HUMAN		5	526	-			A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	ENST00000261751.3	0	1	hg19	c.415G>A	CCDS10306.1	0	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783372	0.70222	.	.	ENSG00000117971	ENST00000261751	D	0.97352	-4.35	4.97	4.97	0.65823	4.97	4.97	0.65823	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.98924	0.9635	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99636	1.0987	10	0.72032	D	0.01	.	18.2167	0.89887	0.0:1.0:0.0:0.0	.	139	P30926	ACHB4_HUMAN	S	139	ENSP00000261751:G139S	ENSP00000261751:G139S	G	-	1	0	0	CHRNB4	76709287	76709287	1.000000	0.71417	0.956000	0.39512	0.065000	0.16274	7.766000	0.85320	2.301000	0.77427	0.655000	0.94253	GGC	0.251674		TCGA-LB-A9Q5-01A-11D-A397-08	0.572	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1	0	0	1	2	2	2	2	0	0	0	0	63	0	63	62	1	2	-2.882874	1	0.240000			0	6	6	0	193	191	0		1			0	0	63	0	0	0.964573	0	0	0	0	0	0	6	193
DET1	55070	broad.mit.edu	37	15	89074164	89074164	+	Missense_Mutation	SNP	C	C	T	rs138430376		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr15:89074164C>T	ENST00000268148.8	-	2	918	c.773G>A	c.(772-774)cGc>cAc	p.R258H	DET1_ENST00000564406.1_Missense_Mutation_p.R269H|DET1_ENST00000559656.1_5'Flank|DET1_ENST00000444300.1_Missense_Mutation_p.R269H|DET1_ENST00000558413.1_3'UTR	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	258						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			ATAGCAAAAGCGGCCAATGGT	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		21511	0.001		0.0	False		,,,				2504	0.0					ENST00000268148.8	1.000000	0.610000	1.000000	0.740000	0.900000	0.885543	0.900000	1.000000																										0				23						c.(772-774)cGc>cAc		de-etiolated homolog 1 (Arabidopsis)							60.0	60.0	60.0					15																	89074164		2035	4186	6221	SO:0001583	missense	55070	1	120958	35				g.chr15:89074164C>T	BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.773G>A	chr15.hg19:g.89074164C>T	ENSP00000268148:p.Arg258His	0					DET1_ENST00000564406.1_Missense_Mutation_p.R269H|DET1_ENST00000559656.1_5'Flank|DET1_ENST00000444300.1_Missense_Mutation_p.R269H|DET1_ENST00000558413.1_3'UTR	p.R258H	NM_001144074.1	NP_001137546.1	1	2	3	2.026427	Q7L5Y6	DET1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.188)	2	918	-	Lung NSC(78;0.105)|all_lung(78;0.182)		B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	ENST00000268148.8	1	1	hg19	c.773G>A	CCDS45344.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	23.0	4.364477	0.82463	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	6.17	5.26	0.73747	6.17	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.78892	0.4355	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80455	-0.1375	9	0.49607	T	0.09	-36.1175	14.418	0.67163	0.0:0.9302:0.0:0.0698	.	258;269	Q7L5Y6;B3KNN6	DET1_HUMAN;.	H	269;258	.	ENSP00000268148:R258H	R	-	2	0	0	DET1	86875168	86875168	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.213000	0.77950	1.620000	0.50308	0.655000	0.94253	CGC	0.251674		TCGA-LB-A9Q5-01A-11D-A397-08	0.507	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2	1	0	1	2	2	2	2	0	0	0	0	61	0	61	60	1	2	-20.000000	1	0.240000	NM_017996		0	29	29	0	249	249	1		1	0		0	0	61	0	0	1.000000	1.302495e-01	0	1	0	5	0	29	249
PKD1	5310	broad.mit.edu	37	16	2160250	2160250	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr16:2160250C>T	ENST00000262304.4	-	15	5126	c.4918G>A	c.(4918-4920)Ggt>Agt	p.G1640S	PKD1_ENST00000423118.1_Missense_Mutation_p.G1640S|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1640	PKD 12. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TAGCGGCCACCGCCCACCACC	0.617																																						ENST00000262304.4	1.000000	0.600000	1.000000	0.760000	0.950000	0.902585	0.950000	1.000000																										0				72						c.(4918-4920)Ggt>Agt		polycystic kidney disease 1 (autosomal dominant)							20.0	20.0	20.0					16																	2160250		2171	4272	6443	SO:0001583	missense	5310	3	120180	35				g.chr16:2160250C>T	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.4918G>A	chr16.hg19:g.2160250C>T	ENSP00000262304:p.Gly1640Ser	0					RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.G1640S	p.G1640S	NM_001009944.2	NP_001009944	1	2	3	2.082312	P98161	PKD1_HUMAN		15	5126	-			Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	0	1	hg19	c.4918G>A	CCDS32369.1	1	.	.	.	.	.	.	.	.	.	.	c	3.215	-0.160795	0.06502	.	.	ENSG00000008710	ENST00000262304;ENST00000423118	T;T	0.57907	0.37;0.37	5.3	4.35	0.52113	5.3	4.35	0.52113	Polycystin cation channel (1);PKD domain (1);	0.226336	0.45606	D	0.000350	T	0.35189	0.0923	L	0.44542	1.39	0.09310	N	1	P;P	0.46020	0.871;0.683	B;B	0.32805	0.144;0.153	T	0.17531	-1.0366	10	0.22706	T	0.39	.	8.5645	0.33531	0.1357:0.7246:0.0:0.1397	.	1640;1640	P98161-3;P98161	.;PKD1_HUMAN	S	1640	ENSP00000262304:G1640S;ENSP00000399501:G1640S	ENSP00000262304:G1640S	G	-	1	0	0	PKD1	2100251	2100251	0.001000	0.12720	0.018000	0.16275	0.014000	0.08584	0.784000	0.26816	0.642000	0.30620	-1.611000	0.00801	GGT	0.256942		TCGA-LB-A9Q5-01A-11D-A397-08	0.617	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1	1	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	2	-3.222029	1	0.240000			0	21	16	0	175	132	0		1	1		0	0	51	0	0	0.999971	3.070657e-01	0	3	0	7	0	21	175
C16orf62	57020	broad.mit.edu	37	16	19680556	19680556	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr16:19680556C>T	ENST00000251143.5	+	27	2308	c.2296C>T	c.(2296-2298)Cgg>Tgg	p.R766W	C16orf62_ENST00000417362.2_Missense_Mutation_p.R673W|C16orf62_ENST00000448695.1_Missense_Mutation_p.R616W|C16orf62_ENST00000543152.1_Missense_Mutation_p.R515W|C16orf62_ENST00000542263.1_Missense_Mutation_p.R762W|C16orf62_ENST00000438132.3_Missense_Mutation_p.R855W			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	766						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TGGGAAGATGCGGCCATCGGA	0.418																																						ENST00000251143.5	1.000000	0.050000	0.240000	0.090000	0.150000	0.187131	0.150000	0.140000																										0				36						c.(2296-2298)Cgg>Tgg		chromosome 16 open reading frame 62							121.0	120.0	120.0					16																	19680556		2197	4300	6497	SO:0001583	missense	57020	0	0					g.chr16:19680556C>T		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2296C>T	chr16.hg19:g.19680556C>T	ENSP00000251143:p.Arg766Trp	0					C16orf62_ENST00000448695.1_Missense_Mutation_p.R616W|C16orf62_ENST00000543152.1_Missense_Mutation_p.R515W|C16orf62_ENST00000438132.3_Missense_Mutation_p.R855W|C16orf62_ENST00000417362.2_Missense_Mutation_p.R673W|C16orf62_ENST00000542263.1_Missense_Mutation_p.R762W	p.R766W			1	2	3	2.009028	Q7Z3J2	CP062_HUMAN		27	2308	+			A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	0	1	hg19	c.2296C>T		0	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995543	0.74703	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.51	4.53	0.55603	5.51	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.64091	0.2567	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	T	0.65113	-0.6247	9	.	.	.	-17.7679	15.8043	0.78481	0.1365:0.8635:0.0:0.0	.	762;766	F5H7K1;Q7Z3J2	.;CP062_HUMAN	W	855;762;766;673;616	ENSP00000400815:R855W;ENSP00000442468:R762W;ENSP00000251143:R766W;ENSP00000395973:R673W;ENSP00000398009:R616W	.	R	+	1	2	2	C16orf62	19588057	19588057	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.337000	0.59310	2.604000	0.88044	0.644000	0.83932	CGG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.418	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	103	0	103	103	1	2	-2.428440	0	0.240000	NM_020314		0	5	5	0	298	297	0		1	0		0	0	103	0	0	0.937504	2.584223e-01	0	0	0	50	0	5	298
MLKL	197259	broad.mit.edu	37	16	74729301	74729301	+	Missense_Mutation	SNP	C	C	G			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr16:74729301C>G	ENST00000308807.7	-	2	818	c.355G>C	c.(355-357)Gag>Cag	p.E119Q	MLKL_ENST00000306247.7_Missense_Mutation_p.E119Q	NM_152649.2	NP_689862.1			mixed lineage kinase domain-like											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(6)|skin(1)|stomach(2)	19						ATGCGTTGCTCAACCTGAAGT	0.517																																						ENST00000308807.7	0.480000	0.180000	0.380000	0.230000	0.300000	0.319064	0.300000	0.300000																										0				19						c.(355-357)Gag>Cag		mixed lineage kinase domain-like							183.0	156.0	165.0					16																	74729301		2198	4300	6498	SO:0001583	missense	197259	0	0					g.chr16:74729301C>G	AK091708	CCDS32487.1, CCDS45528.1	16q22.3	2008-02-05				ENSG00000168404			26617	protein-coding gene	gene with protein product		615153				12477932	Standard	NM_152649		Approved	FLJ34389	uc002fdb.2	Q8NB16		ENST00000308807.7:c.355G>C	chr16.hg19:g.74729301C>G	ENSP00000308351:p.Glu119Gln	0					MLKL_ENST00000306247.7_Missense_Mutation_p.E119Q	p.E119Q	NM_152649.2	NP_689862.1	1	2	3	2.004723				2	818	-				Missense_Mutation	SNP	ENST00000308807.7	1	1	hg19	c.355G>C	CCDS32487.1	0	.	.	.	.	.	.	.	.	.	.	C	10.71	1.426535	0.25726	.	.	ENSG00000168404	ENST00000308807;ENST00000306247	T;T	0.80214	-1.35;2.34	4.28	-8.57	0.00900	4.28	-8.57	0.00900	.	0.814893	0.10962	N	0.614861	T	0.57198	0.2037	N	0.24115	0.695	0.09310	N	1	P;P	0.42078	0.77;0.702	B;B	0.38712	0.28;0.217	T	0.54794	-0.8240	10	0.33940	T	0.23	1.4392	4.0588	0.09829	0.4262:0.1834:0.3155:0.075	.	119;119	Q8NB16-2;Q8NB16	.;MLKL_HUMAN	Q	119	ENSP00000308351:E119Q;ENSP00000303118:E119Q	ENSP00000303118:E119Q	E	-	1	0	0	MLKL	73286802	73286802	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	-0.375000	0.07475	-1.935000	0.01049	-1.051000	0.02340	GAG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.517	MLKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436403.3	0	0	1	2	2	2	2	0	0	0	0	158	0	158	158	1	2	-2.887884	1	0.240000	NM_152649		0	18	18	0	485	482	0		1	1		0	0	158	0	0	0.999982	1.097012e-01	0	3	0	12	0	18	485
KRT24	192666	broad.mit.edu	37	17	38859689	38859689	+	Missense_Mutation	SNP	C	C	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr17:38859689C>A	ENST00000264651.2	-	1	313	c.257G>T	c.(256-258)gGa>gTa	p.G86V		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	86	Gly-rich.|Head.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				CCCACCAAATCCTGTCCCAGA	0.582																																					GBM(61;380 1051 14702 23642 31441)	ENST00000264651.2	1.000000	0.180000	0.440000	0.230000	0.300000	0.394584	0.300000	0.290000																										0				29						c.(256-258)gGa>gTa		keratin 24							73.0	93.0	86.0					17																	38859689		2203	4300	6503	SO:0001583	missense	192666	0	0					g.chr17:38859689C>A		CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.257G>T	chr17.hg19:g.38859689C>A	ENSP00000264651:p.Gly86Val	0						p.G86V	NM_019016.2	NP_061889.2	1	2	3	2.071928	Q2M2I5	K1C24_HUMAN		1	313	-		Breast(137;0.00526)	Q9NXG7	Missense_Mutation	SNP	ENST00000264651.2	1	1	hg19	c.257G>T	CCDS11372.1	0	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600770	0.46423	.	.	ENSG00000167916	ENST00000264651	D	0.90385	-2.66	5.32	4.35	0.52113	5.32	4.35	0.52113	.	.	.	.	.	D	0.92322	0.7564	L	0.57536	1.79	0.53005	D	0.999968	D	0.69078	0.997	D	0.63597	0.916	D	0.89764	0.3949	9	0.13853	T	0.58	.	13.4064	0.60915	0.0:0.9241:0.0:0.0759	.	86	Q2M2I5	K1C24_HUMAN	V	86	ENSP00000264651:G86V	ENSP00000264651:G86V	G	-	2	0	0	KRT24	36113215	36113215	0.014000	0.17966	0.115000	0.21578	0.002000	0.02628	1.059000	0.30517	1.381000	0.46364	-0.258000	0.10820	GGA	0.255194		TCGA-LB-A9Q5-01A-11D-A397-08	0.582	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1	0	0	1	2	2	2	2	0	0	0	0	150	0	150	139	1	2	-3.757956	1	0.240000	NM_019016		0	19	15	0	539	500	0		1			0	0	150	0	0	0.999981	0	0	0	0	0	0	19	539
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.760000	0.230000	0.610000	0.330000	0.450000	0.478078	0.450000	0.440000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	24185	GRCh37	CM951226	TP53	M		c.(637-639)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	7157	1	121412	30	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578212G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	chr17.hg19:g.7578212G>A	ENSP00000269305:p.Arg213*	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*	p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	0	0	1.952837	P04637	P53_HUMAN		6	826	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.637C>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	2	TP53	7518937	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	0.219392		TCGA-LB-A9Q5-01A-11D-A397-08	0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	42	0	42	42	1	2	-4.874490	1	0.240000	NM_000546		0	10	10	0	171	170	0		1	0	1	0	0	42	1732	0	0.997049	3.583846e-01	1	0	49	21	1360	10	171
WFIKKN2	124857	broad.mit.edu	37	17	48917415	48917415	+	Missense_Mutation	SNP	C	C	T	rs200820844		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr17:48917415C>T	ENST00000311378.4	+	2	1294	c.766C>T	c.(766-768)Cgg>Tgg	p.R256W	WFIKKN2_ENST00000426127.1_Missense_Mutation_p.R163W|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	256	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TGTGGTCATGCGGCCCAACCA	0.602																																						ENST00000311378.4	1.000000	0.060000	0.290000	0.110000	0.180000	0.247524	0.180000	0.150000																										0				29						c.(766-768)Cgg>Tgg		WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2			TRP/ARG	0,4406		0,0,2203	117.0	106.0	110.0		766	-7.0	0.9	17		110	1,8599		0,1,4299	no	missense	WFIKKN2	NM_175575.5	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	256/577	48917415	1,13005	2203	4300	6503	SO:0001583	missense	124857	4	121412	38				g.chr17:48917415C>T	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.766C>T	chr17.hg19:g.48917415C>T	ENSP00000311184:p.Arg256Trp	1					WFIKKN2_ENST00000426127.1_Missense_Mutation_p.R163W|RP11-506D12.5_ENST00000572491.2_RNA	p.R256W	NM_175575.5	NP_783165.1	1	2	3	2.202187	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)	2	1294	+			Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	0	1	hg19	c.766C>T	CCDS11575.1	0	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350274	0.41599	0.0	1.16E-4	ENSG00000173714	ENST00000426127;ENST00000311378	D;D	0.96041	-3.89;-3.89	5.44	-7.01	0.01594	5.44	-7.01	0.01594	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.296278	0.33772	N	0.004575	D	0.90542	0.7036	M	0.72479	2.2	0.41747	D	0.989648	B	0.21147	0.052	B	0.14578	0.011	T	0.69250	-0.5194	10	0.59425	D	0.04	.	3.756	0.08585	0.5443:0.1895:0.0762:0.19	.	256	Q8TEU8	WFKN2_HUMAN	W	163;256	ENSP00000405889:R163W;ENSP00000311184:R256W	ENSP00000311184:R256W	R	+	1	2	2	WFIKKN2	46272414	46272414	0.810000	0.29049	0.874000	0.34290	0.986000	0.74619	0.008000	0.13197	-1.163000	0.02793	-0.142000	0.14014	CGG	0.314821		TCGA-LB-A9Q5-01A-11D-A397-08	0.602	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	0	0	1	2	2	2	2	0	0	0	0	81	0	81	81	1	2	-2.623366	1	0.240000	NM_175575		0	5	5	0	285	281	0		1	0		0	0	81	0	0	0.935771	0	0	0	0	1	0	5	285
FASN	2194	broad.mit.edu	37	17	80046303	80046303	+	Silent	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr17:80046303G>A	ENST00000306749.2	-	16	2774	c.2556C>T	c.(2554-2556)aaC>aaT	p.N852N		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	852					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	AACCTGAACCGTTGGGGAAGT	0.667																																					Colon(59;314 1043 11189 28578 32273)	ENST00000306749.2	0.570000	0.110000	0.430000	0.180000	0.290000	0.313007	0.290000	0.260000																										0				34						c.(2554-2556)aaC>aaT		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)						28.0	36.0	34.0					17																	80046303		2196	4292	6488	SO:0001819	synonymous_variant	2194	4	120858	36				g.chr17:80046303G>A	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.2556C>T	chr17.hg19:g.80046303G>A		0						p.N852N	NM_004104.4	NP_004095.4	0	0	0	1.943218	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)	16	2774	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	1	1	hg19	c.2556C>T	CCDS11801.1	0																																																																																								0.215524		TCGA-LB-A9Q5-01A-11D-A397-08	0.667	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	1	0	1	2	2	2	2	0	0	0	0	31	0	31	28	1	2	-7.377589	1	0.240000	NM_004104		0	5	4	0	144	142	0		1	0		0	0	31	0	0	0.935245	1.111136e-01	0	0	0	14	0	5	144
THOC1	9984	broad.mit.edu	37	18	264052	264052	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr18:264052G>A	ENST00000261600.6	-	4	237	c.230C>T	c.(229-231)tCt>tTt	p.S77F	THOC1_ENST00000582313.1_5'UTR	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	77					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				AATAGCAAGAGAAATAATAGC	0.343																																						ENST00000261600.6	0.710000	0.110000	0.520000	0.210000	0.340000	0.373508	0.340000	0.310000																										0				20						c.(229-231)tCt>tTt		THO complex 1							89.0	76.0	80.0					18																	264052		1841	4085	5926	SO:0001583	missense	9984	1	120796	21				g.chr18:264052G>A	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.230C>T	chr18.hg19:g.264052G>A	ENSP00000261600:p.Ser77Phe	0					THOC1_ENST00000582313.1_5'UTR	p.S77F	NM_005131.2	NP_005122.2	0	0	0	1.985920	Q96FV9	THOC1_HUMAN		4	237	-		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	0	1	hg19	c.230C>T	CCDS45820.1	0	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671815	0.29693	.	.	ENSG00000079134	ENST00000261600	.	.	.	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.057850	0.64402	D	0.000001	T	0.65281	0.2676	L	0.58810	1.83	0.50313	D	0.999862	B;P	0.34864	0.418;0.473	B;B	0.36666	0.147;0.23	T	0.65894	-0.6057	9	0.87932	D	0	-13.7479	20.4898	0.99202	0.0:0.0:1.0:0.0	.	77;77	Q96FV9-2;Q96FV9	.;THOC1_HUMAN	F	77	.	ENSP00000261600:S77F	S	-	2	0	0	THOC1	254052	254052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.323000	0.65858	2.941000	0.99782	0.655000	0.94253	TCT	0.232633		TCGA-LB-A9Q5-01A-11D-A397-08	0.343	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	0	0	1	2	2	2	2	0	0	0	0	19	0	19	19	1	2	-7.288534	1	0.240000	NM_005131		0	4	4	0	101	101	0		1	1		0	0	19	0	0	0.891773	1.132422e-01	0	4	0	8	0	4	101
SMAD4	4089	broad.mit.edu	37	18	48593400	48593400	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr18:48593400G>A	ENST00000342988.3	+	10	1689	c.1151G>A	c.(1150-1152)gGc>gAc	p.G384D	SMAD4_ENST00000588745.1_Missense_Mutation_p.G288D|SMAD4_ENST00000398417.2_Missense_Mutation_p.G384D	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	384	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TTGCACATAGGCAAAGGTGTG	0.348																																						ENST00000342988.3	0.720000	0.320000	0.610000	0.400000	0.500000	0.516725	0.500000	0.500000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1150-1152)gGc>gAc		SMAD family member 4							189.0	158.0	168.0					18																	48593400		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48593400G>A	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1151G>A	chr18.hg19:g.48593400G>A	ENSP00000341551:p.Gly384Asp	0					SMAD4_ENST00000588745.1_Missense_Mutation_p.G288D|SMAD4_ENST00000398417.2_Missense_Mutation_p.G384D	p.G384D	NM_005359.5	NP_005350.1	0	0	0	1.985920	Q13485	SMAD4_HUMAN		10	1689	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1151G>A	CCDS11950.1	0	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969730	0.92855	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98849	-5.18;-5.18	5.5	5.5	0.81552	5.5	5.5	0.81552	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.046327	0.85682	D	0.000000	D	0.99384	0.9783	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98789	1.0735	10	0.87932	D	0	.	18.1843	0.89788	0.0:0.0:1.0:0.0	.	384	Q13485	SMAD4_HUMAN	D	384	ENSP00000341551:G384D;ENSP00000381452:G384D	ENSP00000341551:G384D	G	+	2	0	0	SMAD4	46847398	46847398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.759000	0.98931	2.581000	0.87130	0.563000	0.77884	GGC	0.232633		TCGA-LB-A9Q5-01A-11D-A397-08	0.348	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	5	0	0	0	0	129	0	129	127	1	2	-6.249517	1	0.240000	NM_005359		0	23	22	0	355	353	0		1	1	1	0	1	129	824	0	0.999999	4.688237e-01	9.999999e-01	2	22	23	654	23	355
ABCA7	10347	broad.mit.edu	37	19	1046233	1046233	+	Missense_Mutation	SNP	T	T	G			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr19:1046233T>G	ENST00000263094.6	+	13	1681	c.1450T>G	c.(1450-1452)Tgg>Ggg	p.W484G	ABCA7_ENST00000533574.1_3'UTR|ABCA7_ENST00000433129.1_Missense_Mutation_p.W484G|ABCA7_ENST00000435683.2_Missense_Mutation_p.W346G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	484					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGCAGGTTTTGGGACCCTGG	0.642																																						ENST00000263094.6	1.000000	0.010000	0.100000	0.030000	0.060000	0.096715	0.060000	0.060000																										0				65						c.(1450-1452)Tgg>Ggg		ATP-binding cassette, sub-family A (ABC1), member 7							66.0	73.0	71.0					19																	1046233		2203	4297	6500	SO:0001583	missense	10347	0	0					g.chr19:1046233T>G	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1450T>G	chr19.hg19:g.1046233T>G	ENSP00000263094:p.Trp484Gly	0					ABCA7_ENST00000433129.1_Missense_Mutation_p.W484G|ABCA7_ENST00000435683.2_Missense_Mutation_p.W346G|ABCA7_ENST00000533574.1_3'UTR	p.W484G	NM_019112.3	NP_061985.2	1	2	3	2.006579	Q8IZY2	ABCA7_HUMAN		13	1681	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	0	1	hg19	c.1450T>G	CCDS12055.1	0	.	.	.	.	.	.	.	.	.	.	t	17.54	3.414745	0.62511	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.94828	-3.53;-3.53	4.95	4.95	0.65309	4.95	4.95	0.65309	.	.	.	.	.	D	0.96787	0.8951	M	0.79123	2.44	0.46356	D	0.999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.97146	0.9828	9	0.72032	D	0.01	.	12.5427	0.56182	0.0:0.0:0.0:1.0	.	346;484	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	G	484	ENSP00000263094:W484G;ENSP00000414062:W484G	ENSP00000263094:W484G	W	+	1	0	0	ABCA7	997233	997233	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	7.869000	0.87170	1.858000	0.53909	0.454000	0.30748	TGG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.642	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	0	0	1	2	2	2	2	0	0	0	0	198	0	198	197	1	2	-2.623801	1	0.240000	NM_019112		0	5	5	0	708	697	0		1	0		0	0	198	0	0	0.935145	8.022725e-04	0	0	0	5	0	5	708
TICAM1	148022	broad.mit.edu	37	19	4816396	4816396	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr19:4816396G>A	ENST00000248244.5	-	2	2223	c.1994C>T	c.(1993-1995)aCg>aTg	p.T665M		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	665	Pro-rich.|Sufficient to induce apoptosis.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GGGTGAGGCCGTAGGGAAGGC	0.662																																						ENST00000248244.5	1.000000	0.080000	0.340000	0.130000	0.210000	0.254509	0.210000	0.200000																										0				26						c.(1993-1995)aCg>aTg		toll-like receptor adaptor molecule 1							51.0	45.0	47.0					19																	4816396		2203	4300	6503	SO:0001583	missense	148022	1	121306	35				g.chr19:4816396G>A	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.1994C>T	chr19.hg19:g.4816396G>A	ENSP00000248244:p.Thr665Met	0						p.T665M	NM_182919.3	NP_891549.1	1	2	3	2.006579	Q8IUC6	TCAM1_HUMAN		2	2223	-			B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	ENST00000248244.5	0	1	hg19	c.1994C>T	CCDS12136.1	0	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273697	0.40194	.	.	ENSG00000127666	ENST00000248244	T	0.44881	0.91	4.68	-0.218	0.13142	4.68	-0.218	0.13142	.	.	.	.	.	T	0.22742	0.0549	N	0.14661	0.345	0.09310	N	1	B	0.21071	0.051	B	0.18561	0.022	T	0.20907	-1.0261	9	0.66056	D	0.02	-3.7983	5.0671	0.14587	0.1798:0.0:0.4884:0.3319	.	665	Q8IUC6	TCAM1_HUMAN	M	665	ENSP00000248244:T665M	ENSP00000248244:T665M	T	-	2	0	0	TICAM1	4767396	4767396	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.115000	0.03289	0.056000	0.16144	-0.258000	0.10820	ACG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.662	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	0	0	1	2	14	6	2	1	0	1	1	56	0	56	55	1	2	-3.554586	1	0.240000	NM_014261		0	5	6	0	206	202	0		0	0		1	0	56	0	0	0.026160	3.371319e-02	0	0	0	71	0	5	206
CPAMD8	27151	broad.mit.edu	37	19	17038840	17038840	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr19:17038840G>A	ENST00000443236.1	-	25	3521	c.3490C>T	c.(3490-3492)Cga>Tga	p.R1164*		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1117						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GCGGTGGCTCGCTCAGACCCA	0.617																																						ENST00000443236.1	1.000000	0.100000	0.340000	0.160000	0.230000	0.268638	0.230000	0.220000																										0				82						c.(3490-3492)Cga>Tga		C3 and PZP-like, alpha-2-macroglobulin domain containing 8							42.0	51.0	48.0					19																	17038840		2036	4175	6211	SO:0001587	stop_gained	27151	2	120932	34				g.chr19:17038840G>A	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3490C>T	chr19.hg19:g.17038840G>A	ENSP00000402505:p.Arg1164*	0						p.R1164*	NM_015692.2	NP_056507.2	1	2	3	2.006579	Q8IZJ3	CPMD8_HUMAN		25	3521	-			Q8NC09|Q9ULD7	Nonsense_Mutation	SNP	ENST00000443236.1	0	1	hg19	c.3490C>T	CCDS42519.1	0	.	.	.	.	.	.	.	.	.	.	G	38	6.940580	0.97952	.	.	ENSG00000160111	ENST00000291440	.	.	.	3.02	1.9	0.25705	3.02	1.9	0.25705	.	0.311950	0.27861	U	0.017554	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8107	0.29230	0.0:0.0:0.3646:0.6354	.	.	.	.	X	1164	.	ENSP00000291440:R1164X	R	-	1	2	2	CPAMD8	16899840	16899840	1.000000	0.71417	0.658000	0.29665	0.098000	0.18820	5.239000	0.65371	1.237000	0.43756	0.655000	0.94253	CGA	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.617	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	0	0	1	2	2	2	2	0	0	0	0	108	0	108	103	1	2	-3.031449	1	0.240000	NM_015692		0	8	8	0	292	291	0		1	0		0	0	108	0	0	0.989480	0	0	0	0	1	0	8	292
NLRP8	126205	broad.mit.edu	37	19	56466067	56466067	+	Missense_Mutation	SNP	G	G	A	rs372844411		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr19:56466067G>A	ENST00000291971.3	+	3	714	c.643G>A	c.(643-645)Gga>Aga	p.G215R	NLRP8_ENST00000590542.1_Missense_Mutation_p.G215R	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	215	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCCTGGGATCGGAAAAACAAT	0.527																																						ENST00000291971.3	1.000000	0.160000	0.430000	0.230000	0.310000	0.350037	0.310000	0.300000																										0				35						c.(643-645)Gga>Aga		NLR family, pyrin domain containing 8		G	ARG/GLY	0,4406		0,0,2203	86.0	70.0	75.0		643	0.9	0.0	19		75	1,8599	1.2+/-3.3	0,1,4299	no	missense	NLRP8	NM_176811.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	215/1049	56466067	1,13005	2203	4300	6503	SO:0001583	missense	126205	2	121412	34				g.chr19:56466067G>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.643G>A	chr19.hg19:g.56466067G>A	ENSP00000291971:p.Gly215Arg	0					NLRP8_ENST00000590542.1_Missense_Mutation_p.G215R	p.G215R	NM_176811.2	NP_789781.2	1	2	3	2.012356	Q86W28	NALP8_HUMAN		3	714	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	1	1	hg19	c.643G>A	CCDS12937.1	0	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275207	0.40194	0.0	1.16E-4	ENSG00000179709	ENST00000291971	D	0.90133	-2.62	2.04	0.899	0.19271	2.04	0.899	0.19271	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.94450	0.8214	M	0.87971	2.92	0.19775	N	0.999955	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85201	0.1015	9	0.87932	D	0	.	5.4852	0.16745	0.0:0.0:0.6708:0.3292	.	215;215	Q86W28-2;Q86W28	.;NALP8_HUMAN	R	215	ENSP00000291971:G215R	ENSP00000291971:G215R	G	+	1	0	0	NLRP8	61157879	61157879	1.000000	0.71417	0.002000	0.10522	0.061000	0.15899	4.154000	0.58125	0.368000	0.24481	0.514000	0.50259	GGA	0.244533		TCGA-LB-A9Q5-01A-11D-A397-08	0.527	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	0	0	1	2	2	2	2	0	0	0	0	75	0	75	74	1	2	-2.778457	1	0.240000	NM_176811		0	11	11	0	294	294	0		1			0	0	75	0	0	0.998414	0	0	0	0	0	0	11	294
ZNF584	201514	broad.mit.edu	37	19	58928643	58928643	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr19:58928643G>A	ENST00000306910.4	+	4	1281	c.758G>A	c.(757-759)cGc>cAc	p.R253H	ZNF584_ENST00000593920.1_Missense_Mutation_p.R208H|CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000599238.1_3'UTR	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		ACCTTCAACCGCAAAGACGCA	0.463																																						ENST00000306910.4	1.000000	0.050000	0.260000	0.100000	0.160000	0.206501	0.160000	0.150000																										0				14						c.(757-759)cGc>cAc		zinc finger protein 584							90.0	78.0	82.0					19																	58928643		2203	4300	6503	SO:0001583	missense	201514	0	0					g.chr19:58928643G>A	AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.758G>A	chr19.hg19:g.58928643G>A	ENSP00000306756:p.Arg253His	0					ZNF584_ENST00000593920.1_Missense_Mutation_p.R208H|CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000599238.1_3'UTR	p.R253H	NM_173548.1	NP_775819.1	1	2	3	2.012356	Q8IVC4	ZN584_HUMAN		4	1281	+		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)	A8K203	Missense_Mutation	SNP	ENST00000306910.4	0	1	hg19	c.758G>A	CCDS12979.1	0	.	.	.	.	.	.	.	.	.	.	G	10.77	1.442947	0.25987	.	.	ENSG00000171574	ENST00000306910;ENST00000354635	T	0.36340	1.26	3.78	1.63	0.23807	3.78	1.63	0.23807	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26991	0.0661	L	0.50333	1.59	0.09310	N	1	B	0.25955	0.138	B	0.22880	0.042	T	0.27157	-1.0082	9	0.13108	T	0.6	.	7.1665	0.25693	0.227:0.0:0.773:0.0	.	253	Q8IVC4	ZN584_HUMAN	H	253;112	ENSP00000306756:R253H	ENSP00000306756:R253H	R	+	2	0	0	ZNF584	63620455	63620455	0.000000	0.05858	1.000000	0.80357	0.863000	0.49368	-1.284000	0.02793	0.389000	0.25086	0.555000	0.69702	CGC	0.244533		TCGA-LB-A9Q5-01A-11D-A397-08	0.463	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467022.1	0	0	1	2	12	2	2	1	0	1	1	90	0	90	90	1	2	-2.986411	1	0.240000	NM_173548		0	5	5	0	277	276	0		0	0		1	0	90	0	0	0.066749	2.013852e-02	0	0	0	10	0	5	277
CELSR2	1952	broad.mit.edu	37	1	109808777	109808777	+	Missense_Mutation	SNP	C	C	T	rs375830885		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:109808777C>T	ENST00000271332.3	+	15	6023	c.5962C>T	c.(5962-5964)Cgt>Tgt	p.R1988C		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1988					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CTGGTGGCCCCGTACCCGCTT	0.617																																					NSCLC(158;1285 2011 34800 34852 42084)	ENST00000271332.3	1.000000	0.210000	0.490000	0.280000	0.370000	0.403608	0.370000	0.370000																										0				82						c.(5962-5964)Cgt>Tgt		cadherin, EGF LAG seven-pass G-type receptor 2		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	67.0	71.0		5962	4.6	1.0	1		71	0,8600		0,0,4300	no	missense	CELSR2	NM_001408.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1988/2924	109808777	1,13005	2203	4300	6503	SO:0001583	missense	1952	6	121412	38				g.chr1:109808777C>T	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.5962C>T	chr1.hg19:g.109808777C>T	ENSP00000271332:p.Arg1988Cys	0						p.R1988C	NM_001408.2	NP_001399.1	1	2	3	2.007491	Q9HCU4	CELR2_HUMAN		15	6023	+		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	1	1	hg19	c.5962C>T	CCDS796.1	0	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182257	0.78677	2.27E-4	0.0	ENSG00000143126	ENST00000271332	T	0.70631	-0.5	4.6	4.6	0.57074	4.6	4.6	0.57074	GPCR, family 2, extracellular hormone receptor domain (2);	.	.	.	.	D	0.82309	0.5009	M	0.83384	2.64	0.58432	D	0.999999	D	0.89917	1.0	D	0.67382	0.951	D	0.85520	0.1203	9	0.87932	D	0	.	17.6074	0.88042	0.0:1.0:0.0:0.0	.	1988	Q9HCU4	CELR2_HUMAN	C	1988	ENSP00000271332:R1988C	ENSP00000271332:R1988C	R	+	1	0	0	CELSR2	109610300	109610300	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.958000	0.70330	2.387000	0.81309	0.462000	0.41574	CGT	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.617	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	1	0	1	2	2	2	2	0	0	0	0	86	0	86	84	1	2	-2.619703	1	0.240000	NM_001408		0	15	15	0	327	325	0		1	0		0	0	86	0	0	0.999875	1.281700e-02	0	0	0	4	0	15	327
RHOC	389	broad.mit.edu	37	1	113244218	113244218	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:113244218G>A	ENST00000285735.2	-	6	1735	c.526C>T	c.(526-528)Cgg>Tgg	p.R176W	RHOC_ENST00000369633.2_Missense_Mutation_p.R176W|RP11-426L16.10_ENST00000471038.2_5'Flank|RHOC_ENST00000369637.1_Missense_Mutation_p.R176W|RHOC_ENST00000369636.2_Silent_p.L155L|RHOC_ENST00000369642.3_Missense_Mutation_p.R176W|RHOC_ENST00000369632.2_Missense_Mutation_p.R176W|RHOC_ENST00000339083.7_Missense_Mutation_p.R176W|RHOC_ENST00000369638.2_Missense_Mutation_p.R176W			P08134	RHOC_HUMAN	ras homolog family member C	176					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCCAGCCCGAGTGGCCATC	0.617																																						ENST00000285735.2	1.000000	0.280000	0.560000	0.350000	0.440000	0.468746	0.440000	0.440000																										0				9						c.(526-528)Cgg>Tgg		ras homolog family member C							114.0	102.0	106.0					1																	113244218		2203	4300	6503	SO:0001583	missense	389	0	0					g.chr1:113244218G>A	BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.526C>T	chr1.hg19:g.113244218G>A	ENSP00000285735:p.Arg176Trp	0					RHOC_ENST00000369637.1_Missense_Mutation_p.R176W|RHOC_ENST00000369636.2_Silent_p.L155L|RP11-426L16.10_ENST00000471038.2_5'Flank|RHOC_ENST00000339083.7_Missense_Mutation_p.R176W|RHOC_ENST00000369633.2_Missense_Mutation_p.R176W|RHOC_ENST00000369632.2_Missense_Mutation_p.R176W|RHOC_ENST00000369642.3_Missense_Mutation_p.R176W|RHOC_ENST00000369638.2_Missense_Mutation_p.R176W	p.R176W			1	2	3	2.007491	P08134	RHOC_HUMAN		6	1735	-	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)	B3KSW1|Q6ICN3	Missense_Mutation	SNP	ENST00000285735.2	1	1	hg19	c.526C>T	CCDS854.1	0	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936495	0.73442	.	.	ENSG00000155366	ENST00000339083;ENST00000369633;ENST00000369642;ENST00000285735;ENST00000369638;ENST00000369637;ENST00000369632;ENST00000484054;ENST00000425265	T;T;T;T;T;T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65;-0.65;-0.65;-0.65;-0.65;-0.65	5.13	0.702	0.18110	5.13	0.702	0.18110	.	.	.	.	.	T	0.76673	0.4020	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.80313	-0.1435	9	0.87932	D	0	-1.3188	14.0156	0.64523	0.0:0.0:0.4807:0.5193	.	176	P08134	RHOC_HUMAN	W	176;176;176;176;176;176;176;213;176	ENSP00000345236:R176W;ENSP00000358647:R176W;ENSP00000358656:R176W;ENSP00000285735:R176W;ENSP00000358652:R176W;ENSP00000358651:R176W;ENSP00000358646:R176W;ENSP00000434877:R213W;ENSP00000390823:R176W	ENSP00000285735:R176W	R	-	1	2	2	RHOC	113045741	113045741	0.990000	0.36364	0.990000	0.47175	0.998000	0.95712	2.208000	0.42797	0.157000	0.19338	0.563000	0.77884	CGG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.617	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032904.2	1	0	1	2	2	2	2	0	0	0	0	98	0	98	97	1	2	-2.921064	1	0.240000	NM_175744		0	22	22	0	398	396	1		1	1		0	0	98	0	0	0.999999	1	0	257	0	641	0	22	398
POLR3C	10623	broad.mit.edu	37	1	145608249	145608249	+	Nonsense_Mutation	SNP	G	G	A	rs375263808		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:145608249G>A	ENST00000334163.3	-	4	608	c.448C>T	c.(448-450)Cga>Tga	p.R150*	POLR3C_ENST00000369294.1_Nonsense_Mutation_p.R150*|POLR3C_ENST00000471254.1_5'UTR|RNF115_ENST00000369291.5_5'Flank	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	150					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			TCTGCCAGTCGCACAAATGTG	0.498																																						ENST00000334163.3	1.000000	0.050000	0.340000	0.100000	0.160000	0.288292	0.160000	0.140000																										0				25						c.(448-450)Cga>Tga		polymerase (RNA) III (DNA directed) polypeptide C (62kD)		G	stop/ARG	0,4406		0,0,2203	198.0	175.0	182.0		448	4.7	1.0	1		182	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	POLR3C	NM_006468.6		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		150/535	145608249	1,13005	2203	4300	6503	SO:0001587	stop_gained	10623	6	121412	39				g.chr1:145608249G>A	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.448C>T	chr1.hg19:g.145608249G>A	ENSP00000334564:p.Arg150*	0					RNF115_ENST00000369291.5_5'Flank|POLR3C_ENST00000471254.1_5'UTR|POLR3C_ENST00000369294.1_Nonsense_Mutation_p.R150*	p.R150*	NM_006468.6	NP_006459.3	1	2	3	2.083156	Q9BUI4	RPC3_HUMAN	Epithelial(2;7.55e-13)	4	608	-	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		O15317|Q9Y3R6	Nonsense_Mutation	SNP	ENST00000334163.3	0	1	hg19	c.448C>T	CCDS921.1	0	.	.	.	.	.	.	.	.	.	.	G	19.75	3.884789	0.72410	0.0	1.16E-4	ENSG00000186141	ENST00000334163;ENST00000369294	.	.	.	5.62	4.69	0.59074	5.62	4.69	0.59074	.	0.193584	0.43919	D	0.000517	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7899	13.4388	0.61101	0.0:0.0:0.8418:0.1582	.	.	.	.	X	150	.	ENSP00000334564:R150X	R	-	1	2	2	POLR3C	144319606	144319606	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	3.850000	0.55918	1.325000	0.45301	0.655000	0.94253	CGA	0.256942		TCGA-LB-A9Q5-01A-11D-A397-08	0.498	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	0	0	1	2	2	2	2	0	0	0	0	89	0	89	88	1	2	-2.594287	1	0.240000	NM_006468		0	5	5	0	296	295	0		1	0		0	0	89	0	0	0.937504	9.301031e-02	0	0	0	25	0	5	296
FLG	2312	broad.mit.edu	37	1	152282617	152282617	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:152282617G>A	ENST00000368799.1	-	3	4780	c.4745C>T	c.(4744-4746)gCg>gTg	p.A1582V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1582	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGGACCCCGCTGATTCTCC	0.607									Ichthyosis																													ENST00000368799.1	1.000000	0.010000	0.130000	0.030000	0.060000	0.201741	0.060000	0.060000																										0				424						c.(4744-4746)gCg>gTg		filaggrin							160.0	170.0	167.0					1																	152282617		2203	4300	6503	SO:0001583	missense	2312	0	0		Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152282617G>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4745C>T	chr1.hg19:g.152282617G>A	ENSP00000357789:p.Ala1582Val	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.A1582V	NM_002016.1	NP_002007.1	1	2	3	2.083156	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	4780	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	0	1	hg19	c.4745C>T	CCDS30860.1	0	.	.	.	.	.	.	.	.	.	.	G	9.786	1.176695	0.21704	.	.	ENSG00000143631	ENST00000368799	T	0.01705	4.68	2.74	-4.7	0.03288	2.74	-4.7	0.03288	.	.	.	.	.	T	0.00412	0.0013	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46938	-0.9155	9	0.28530	T	0.3	.	0.7528	0.00993	0.3328:0.1614:0.3415:0.1644	.	1582	P20930	FILA_HUMAN	V	1582	ENSP00000357789:A1582V	ENSP00000357789:A1582V	A	-	2	0	0	FLG	150549241	150549241	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.013000	0.00160	-1.202000	0.02655	-3.061000	0.00068	GCG	0.256942		TCGA-LB-A9Q5-01A-11D-A397-08	0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	0	0	1	2	2	2	2	0	0	0	0	240	0	240	237	1	2	-1.781269	0	0.240000	NM_002016		0	6	6	0	895	885	0		1			0	0	240	0	0	0.963793	0	0	0	0	0	0	6	895
ATP13A2	23400	broad.mit.edu	37	1	17313653	17313653	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:17313653G>A	ENST00000326735.8	-	26	3004	c.2971C>T	c.(2971-2973)Cgg>Tgg	p.R991W	ATP13A2_ENST00000341676.5_Missense_Mutation_p.R947W|ATP13A2_ENST00000452699.1_Missense_Mutation_p.R986W|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	991					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CCCGGTGGCCGCACCCGTCCC	0.687																																						ENST00000326735.8	0.490000	0.070000	0.360000	0.140000	0.230000	0.256707	0.230000	0.210000																										0				32						c.(2971-2973)Cgg>Tgg		ATPase type 13A2							46.0	43.0	44.0					1																	17313653		2203	4299	6502	SO:0001583	missense	23400	4	121340	34				g.chr1:17313653G>A	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2971C>T	chr1.hg19:g.17313653G>A	ENSP00000327214:p.Arg991Trp	0					RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.R947W|ATP13A2_ENST00000452699.1_Missense_Mutation_p.R986W	p.R991W			0	1	1	1.988550	Q9NQ11	AT132_HUMAN		26	3004	-		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	0	1	hg19	c.2971C>T	CCDS175.1	0	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745542	0.69418	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000502418	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.37	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.95510	0.8541	M	0.92219	3.285	0.45806	D	0.998684	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.995	D	0.96317	0.9233	10	0.87932	D	0	-37.805	14.0426	0.64687	0.0:0.0:1.0:0.0	.	947;986;991	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	W	991;947;986;187	ENSP00000327214:R991W;ENSP00000341115:R947W;ENSP00000413307:R986W;ENSP00000423065:R187W	ENSP00000327214:R991W	R	-	1	2	2	ATP13A2	17186240	17186240	1.000000	0.71417	0.993000	0.49108	0.482000	0.33219	5.012000	0.64017	2.390000	0.81377	0.561000	0.74099	CGG	0.235412		TCGA-LB-A9Q5-01A-11D-A397-08	0.687	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	0	0	1	2	2	2	2	0	0	0	0	45	0	45	44	1	2	-6.088020	1	0.240000	NM_022089		0	4	4	0	152	150	0		1	0		0	0	45	0	0	0.888342	8.600144e-01	0	0	0	138	0	4	152
OR10K1	391109	broad.mit.edu	37	1	158435396	158435396	+	Silent	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:158435396C>T	ENST00000289451.2	+	1	125	c.45C>T	c.(43-45)ctC>ctT	p.L15L		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					TCGTCGTCCTCGGCTTCTCAT	0.507																																						ENST00000289451.2	1.000000	0.240000	0.730000	0.330000	0.450000	0.525801	0.450000	0.410000																										0				27						c.(43-45)ctC>ctT		olfactory receptor, family 10, subfamily K, member 1							101.0	88.0	92.0					1																	158435396		2203	4300	6503	SO:0001819	synonymous_variant	391109	1	121412	28				g.chr1:158435396C>T	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.45C>T	chr1.hg19:g.158435396C>T		0						p.L15L	NM_001004473.1	NP_001004473.1	1	2	3	2.083156	Q8NGX5	O10K1_HUMAN		1	125	+	all_hematologic(112;0.0378)		Q6IFS2	Silent	SNP	ENST00000289451.2	1	1	hg19	c.45C>T	CCDS30897.1	0																																																																																								0.256942		TCGA-LB-A9Q5-01A-11D-A397-08	0.507	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1	0	0	1	2	2	2	2	0	0	0	0	81	0	81	81	1	2	-2.961561	1	0.240000			0	12	12	0	232	230	0		1			0	0	81	0	0	0.999142	0	0	0	0	0	0	12	232
PKP1	5317	broad.mit.edu	37	1	201252975	201252975	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:201252975G>A	ENST00000352845.3	+	1	145	c.145G>A	c.(145-147)Gtc>Atc	p.V49I	PKP1_ENST00000263946.3_Missense_Mutation_p.V49I|PKP1_ENST00000367324.3_Missense_Mutation_p.V49I			Q13835	PKP1_HUMAN	plakophilin 1	49					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GATGATGACCGTCAAGCGGCA	0.612																																						ENST00000352845.3	1.000000	0.150000	0.620000	0.230000	0.350000	0.438161	0.350000	0.310000																										0				22						c.(145-147)Gtc>Atc		plakophilin 1							117.0	92.0	100.0					1																	201252975		2203	4300	6503	SO:0001583	missense	5317	0	0					g.chr1:201252975G>A	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.145G>A	chr1.hg19:g.201252975G>A	ENSP00000295597:p.Val49Ile	0					PKP1_ENST00000263946.3_Missense_Mutation_p.V49I|PKP1_ENST00000367324.3_Missense_Mutation_p.V49I	p.V49I			1	2	3	2.083156	Q13835	PKP1_HUMAN		1	145	+			O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	1	1	hg19	c.145G>A	CCDS30966.1	0	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274211	0.80580	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.37915	1.17;1.17;1.17	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.260506	0.26153	N	0.026030	T	0.43853	0.1266	N	0.17082	0.46	0.41428	D	0.987843	D;D	0.71674	0.998;0.961	D;B	0.71184	0.972;0.245	T	0.45687	-0.9244	10	0.45353	T	0.12	-19.2651	16.3155	0.82918	0.0:0.0:1.0:0.0	.	49;49	Q13835-2;Q13835	.;PKP1_HUMAN	I	49	ENSP00000356293:V49I;ENSP00000263946:V49I;ENSP00000295597:V49I	ENSP00000263946:V49I	V	+	1	0	0	PKP1	199519598	199519598	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.458000	0.60095	2.278000	0.76064	0.655000	0.94253	GTC	0.256942		TCGA-LB-A9Q5-01A-11D-A397-08	0.612	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	0	0	1	2	2	2	2	0	0	0	0	53	0	53	53	1	2	-3.175439	1	0.240000	NM_000299		0	8	8	0	211	209	0		1			0	0	53	0	0	0.989363	0	0	0	0	0	0	8	211
OR2M5	127059	broad.mit.edu	37	1	248309257	248309257	+	Nonsense_Mutation	SNP	C	C	T	rs368493003		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr1:248309257C>T	ENST00000366476.1	+	1	808	c.808C>T	c.(808-810)Cag>Tag	p.Q270*		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CTCCCCTATGCAGGACAAGCT	0.512																																						ENST00000366476.1	1.000000	0.120000	0.300000	0.160000	0.200000	0.317264	0.200000	0.200000																										0				49						c.(808-810)Cag>Tag		olfactory receptor, family 2, subfamily M, member 5							162.0	146.0	152.0					1																	248309257		2203	4300	6503	SO:0001587	stop_gained	127059	0	0					g.chr1:248309257C>T		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.808C>T	chr1.hg19:g.248309257C>T	ENSP00000355432:p.Gln270*	0						p.Q270*	NM_001004690.1	NP_001004690.1	1	2	3	2.078234	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)	1	808	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)			Nonsense_Mutation	SNP	ENST00000366476.1	0	1	hg19	c.808C>T	CCDS31105.1	0	.	.	.	.	.	.	.	.	.	.	c	10.73	1.432018	0.25813	.	.	ENSG00000162727	ENST00000366476	.	.	.	3.15	-2.55	0.06288	3.15	-2.55	0.06288	.	.	.	.	.	.	.	.	.	.	.	0.48135	D	0.999598	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	2.4525	0.04522	0.2978:0.3147:0.2927:0.0948	.	.	.	.	X	270	.	ENSP00000355432:Q270X	Q	+	1	0	0	OR2M5	246375880	246375880	0.000000	0.05858	0.010000	0.14722	0.020000	0.10135	-1.939000	0.01545	-0.351000	0.08249	-0.565000	0.04167	CAG	0.256069		TCGA-LB-A9Q5-01A-11D-A397-08	0.512	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	0	0	1	2	2	2	2	0	0	0	0	225	0	225	223	1	2	-2.587653	1	0.240000	NM_001004690		0	21	21	0	879	870	0		1			0	0	225	0	0	0.999997	0	0	0	0	0	0	21	879
PHACTR3	116154	broad.mit.edu	37	20	58318299	58318299	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr20:58318299G>A	ENST00000371015.1	+	2	723	c.256G>A	c.(256-258)Gaa>Aaa	p.E86K	PHACTR3_ENST00000395636.2_Missense_Mutation_p.E45K|PHACTR3_ENST00000361300.4_Missense_Mutation_p.E45K|PHACTR3_ENST00000541461.1_Missense_Mutation_p.E45K|PHACTR3_ENST00000355648.4_Missense_Mutation_p.E45K|PHACTR3_ENST00000395639.4_Missense_Mutation_p.E45K|PHACTR3_ENST00000359926.3_Missense_Mutation_p.E83K	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	86						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AAAGAAAAACGAAAAACTGAA	0.577																																						ENST00000371015.1	0.620000	0.160000	0.460000	0.230000	0.330000	0.355606	0.330000	0.310000																										0				59						c.(256-258)Gaa>Aaa		phosphatase and actin regulator 3																																				SO:0001583	missense	116154	0	0					g.chr20:58318299G>A	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.256G>A	chr20.hg19:g.58318299G>A	ENSP00000360054:p.Glu86Lys	0					PHACTR3_ENST00000395639.4_Missense_Mutation_p.E45K|PHACTR3_ENST00000355648.4_Missense_Mutation_p.E45K|PHACTR3_ENST00000361300.4_Missense_Mutation_p.E45K|PHACTR3_ENST00000359926.3_Missense_Mutation_p.E83K|PHACTR3_ENST00000541461.1_Missense_Mutation_p.E45K|PHACTR3_ENST00000395636.2_Missense_Mutation_p.E45K	p.E86K	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	1	2	3	2.002407	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)	2	723	+	all_lung(29;0.00344)		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	1	1	hg19	c.256G>A	CCDS13480.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.154383	0.94686	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.46063	1.21;1.15;0.88;1.24;1.24;1.24;0.88	4.26	4.26	0.50523	4.26	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.63010	0.2475	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76575	0.988;0.986;0.986	T	0.66670	-0.5865	10	0.51188	T	0.08	-17.4511	15.6464	0.77055	0.0:0.0:1.0:0.0	.	45;86;83	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	K	83;86;45;45;45;45;45	ENSP00000353002:E83K;ENSP00000360054:E86K;ENSP00000379001:E45K;ENSP00000442483:E45K;ENSP00000347866:E45K;ENSP00000378998:E45K;ENSP00000354555:E45K	ENSP00000347866:E45K	E	+	1	0	0	PHACTR3	57751694	57751694	1.000000	0.71417	0.934000	0.37439	0.898000	0.52572	9.593000	0.98250	1.910000	0.55303	0.462000	0.41574	GAA	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.577	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	0	0	1	2	2	2	2	0	0	0	0	62	0	62	61	1	2	-10.485810	1	0.240000	NM_080672		0	9	9	0	225	224	0		1			0	0	62	0	0	0.994372	0	0	0	0	0	0	9	225
MICAL3	57553	broad.mit.edu	37	22	18301393	18301393	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr22:18301393C>T	ENST00000441493.2	-	26	4386	c.4034G>A	c.(4033-4035)cGc>cAc	p.R1345H	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1345	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CCCCTTGCTGCGGTCCACAGG	0.632																																						ENST00000441493.2	0.200000	0.020000	0.130000	0.050000	0.080000	0.103407	0.080000	0.080000																										0				4						c.(4033-4035)cGc>cAc		microtubule associated monooxygenase, calponin and LIM domain containing 3							52.0	62.0	59.0					22																	18301393		1988	4162	6150	SO:0001583	missense	57553	5	120944	42				g.chr22:18301393C>T	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4034G>A	chr22.hg19:g.18301393C>T	ENSP00000416015:p.Arg1345His	0					MICAL3_ENST00000580469.1_5'Flank	p.R1345H	NM_015241.2	NP_056056.2	1	2	3	2.001304	Q7RTP6	MICA3_HUMAN		26	4386	-		all_epithelial(15;0.198)	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	0	1	hg19	c.4034G>A	CCDS46659.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.14|18.14	3.557135|3.557135	0.65425|0.65425	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.78003	.|-1.14	4.74|4.74	4.74|4.74	0.60224|0.60224	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	.|.	.|.	.|.	.|.	D|D	0.86418|0.86418	0.5928|0.5928	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	D|D	0.86441|0.86441	0.1767|0.1767	5|9	.|0.44086	.|T	.|0.13	.|.	17.7462|17.7462	0.88421|0.88421	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1345	.|Q7RTP6	.|MICA3_HUMAN	T|H	327|1345	.|ENSP00000416015:R1345H	.|ENSP00000416015:R1345H	A|R	-|-	1|2	0|0	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16681393|16681393	16681393|16681393	1.000000|1.000000	0.71417|0.71417	0.157000|0.157000	0.22605|0.22605	0.229000|0.229000	0.25112|0.25112	7.482000|7.482000	0.81143|0.81143	2.188000|2.188000	0.69820|0.69820	0.462000|0.462000	0.41574|0.41574	GCA|CGC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.632	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1	0	0	1	2	2	2	2	0	0	0	0	140	0	140	140	1	2	-2.532073	1	0.240000			0	5	5	0	520	514	0		1	0		0	0	140	0	0	0.935918	1.047194e-02	0	0	0	13	0	5	520
UGGT1	56886	broad.mit.edu	37	2	128941276	128941276	+	Silent	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:128941276G>A	ENST00000259253.6	+	38	4319	c.4272G>A	c.(4270-4272)aaG>aaA	p.K1424K	UGGT1_ENST00000375990.3_Silent_p.K1400K	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1424	Glucosyltransferase. {ECO:0000250}.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ATCTGAAGAAGTTTAGGAAAA	0.423																																						ENST00000259253.6	0.550000	0.090000	0.380000	0.150000	0.250000	0.276320	0.250000	0.220000																										0				63						c.(4270-4272)aaG>aaA		UDP-glucose glycoprotein glucosyltransferase 1							122.0	117.0	119.0					2																	128941276		2203	4300	6503	SO:0001819	synonymous_variant	56886	0	0					g.chr2:128941276G>A	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.4272G>A	chr2.hg19:g.128941276G>A		0					UGGT1_ENST00000375990.3_Silent_p.K1400K	p.K1424K	NM_020120.3	NP_064505.1	1	2	3	2.004620	Q9NYU2	UGGG1_HUMAN		38	4319	+			Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Silent	SNP	ENST00000259253.6	0	1	hg19	c.4272G>A	CCDS2154.1	0																																																																																								0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.423	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	0	0	1	2	2	2	2	0	0	0	0	43	0	43	43	1	2	-7.303947	1	0.240000	NM_020120		0	5	5	0	176	173	0		1	0		0	0	43	0	0	0.935651	2.587388e-01	0	0	0	30	0	5	176
CCDC74A	90557	broad.mit.edu	37	2	132290319	132290319	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:132290319G>A	ENST00000295171.6	+	5	979	c.841G>A	c.(841-843)Gag>Aag	p.E281K	CCDC74A_ENST00000467992.2_3'UTR|CCDC74A_ENST00000409856.3_Missense_Mutation_p.E215K	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	281										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GCTCATCCGCGAGCTGTGGAA	0.677																																						ENST00000295171.6	0.450000	0.120000	0.330000	0.170000	0.240000	0.263118	0.240000	0.240000																										0				19						c.(841-843)Gag>Aag		coiled-coil domain containing 74A							51.0	51.0	51.0					2																	132290319		2202	4276	6478	SO:0001583	missense	90557	5	121384	35				g.chr2:132290319G>A		CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.841G>A	chr2.hg19:g.132290319G>A	ENSP00000295171:p.Glu281Lys	0					CCDC74A_ENST00000409856.3_Missense_Mutation_p.E215K|CCDC74A_ENST00000467992.2_3'UTR	p.E281K	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	1	2	3	2.004620	Q96AQ1	CC74A_HUMAN		5	979	+			Q6P4I5	Missense_Mutation	SNP	ENST00000295171.6	0	1	hg19	c.841G>A	CCDS2167.1	0	.	.	.	.	.	.	.	.	.	.	.	10.85	1.466572	0.26335	.	.	ENSG00000163040	ENST00000295171;ENST00000409856	T;T	0.30448	1.53;1.53	2.66	1.74	0.24563	2.66	1.74	0.24563	.	0.228610	0.22012	U	0.065844	T	0.13329	0.0323	N	0.08118	0	0.80722	D	1	B;B	0.31611	0.221;0.331	B;B	0.25614	0.026;0.062	T	0.09037	-1.0693	10	0.66056	D	0.02	.	7.4179	0.27055	0.0:0.7175:0.2825:0.0	.	215;281	Q96AQ1-2;Q96AQ1	.;CC74A_HUMAN	K	281;215	ENSP00000295171:E281K;ENSP00000387009:E215K	ENSP00000295171:E281K	E	+	1	0	0	CCDC74A	132006789	132006789	0.981000	0.34729	0.988000	0.46212	0.372000	0.29890	2.366000	0.44204	0.211000	0.20683	0.194000	0.17425	GAG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.677	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	0	0	0	2	2	2	2	0	0	0	0	92	0	92	120	1	2	-10.193920	1	0.240000	NM_138770		0	10	4	0	344	220	0		1	0		0	0	92	0	0	0.976629	6.199715e-02	0	1	0	12	0	10	344
SCN1A	6323	broad.mit.edu	37	2	166930064	166930064	+	Missense_Mutation	SNP	G	G	A	rs139397227	byFrequency	TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:166930064G>A	ENST00000303395.4	-	1	67	c.68C>T	c.(67-69)gCg>gTg	p.A23V	SCN1A_ENST00000409050.1_Missense_Mutation_p.A23V|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.A23V|SCN1A_ENST00000423058.2_Missense_Mutation_p.A23V			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	23					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCAATAGCCGCAAGAGATTC	0.423													G|||	7	0.00139776	0.0053	0.0	5008	,	,		17024	0.0		0.0	False		,,,				2504	0.0					ENST00000303395.4	0.170000	0.020000	0.120000	0.040000	0.070000	0.091800	0.070000	0.070000																										0				200						c.(67-69)gCg>gTg		sodium channel, voltage-gated, type I, alpha subunit	Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	7,4399	14.3+/-33.2	0,7,2196	167.0	163.0	164.0		68,68,68,68	5.8	1.0	2	dbSNP_134	164	0,8600		0,0,4300	yes	missense,missense,missense,missense	SCN1A	NM_001165963.1,NM_001165964.1,NM_001202435.1,NM_006920.4	64,64,64,64	0,7,6496	AA,AG,GG		0.0,0.1589,0.0538	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	23/2010,23/1982,23/2010,23/1999	166930064	7,12999	2203	4300	6503	SO:0001583	missense	6323	46	121412	52				g.chr2:166930064G>A	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.68C>T	chr2.hg19:g.166930064G>A	ENSP00000303540:p.Ala23Val	0					AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.A23V|SCN1A_ENST00000409050.1_Missense_Mutation_p.A23V|SCN1A_ENST00000423058.2_Missense_Mutation_p.A23V|AC010127.3_ENST00000599041.1_RNA	p.A23V			1	2	3	2.004620	P35498	SCN1A_HUMAN		1	67	-			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	0	1	hg19	c.68C>T	CCDS54413.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.91	3.503542	0.64298	0.001589	0.0	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96802	-4.13;-4.13;-4.1;-4.08	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.093676	0.46442	D	0.000293	D	0.95214	0.8448	L	0.53780	1.695	0.44570	D	0.997536	P	0.51057	0.941	P	0.46585	0.521	D	0.93992	0.7268	10	0.38643	T	0.18	.	14.2196	0.65818	0.0:0.0:0.8509:0.1491	.	23	P35498-2	.	V	23	ENSP00000407030:A23V;ENSP00000303540:A23V;ENSP00000364554:A23V;ENSP00000386312:A23V	ENSP00000303540:A23V	A	-	2	0	0	SCN1A	166638310	166638310	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.216000	0.42871	2.885000	0.99019	0.655000	0.94253	GCG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.423	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	0	0	1	2	14	2	2	1	0	1	1	190	0	190	190	1	2	-1.846177	0	0.240000	NM_006920		0	6	9	0	695	686	0		0			1	0	190	0	0	0.053841	0	0	0	0	0	0	6	695
GDF7	151449	broad.mit.edu	37	2	20870689	20870689	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:20870689C>T	ENST00000272224.3	+	2	1433	c.857C>T	c.(856-858)gCc>gTc	p.A286V		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	286					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGATCCGCGCCCAGGCCCGC	0.736																																						ENST00000272224.3	1.000000	0.270000	1.000000	0.470000	0.770000	0.747394	0.770000	1.000000																										0				7						c.(856-858)gCc>gTc		growth differentiation factor 7							4.0	5.0	4.0					2																	20870689		1414	2995	4409	SO:0001583	missense	151449	0	0					g.chr2:20870689C>T	AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.857C>T	chr2.hg19:g.20870689C>T	ENSP00000272224:p.Ala286Val	0						p.A286V	NM_182828.2	NP_878248.2	1	2	3	2.004620	Q7Z4P5	GDF7_HUMAN		2	1433	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			Missense_Mutation	SNP	ENST00000272224.3	0	1	hg19	c.857C>T	CCDS1701.1	0	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960656	0.53400	.	.	ENSG00000143869	ENST00000272224	T	0.79653	-1.29	3.37	3.37	0.38596	3.37	3.37	0.38596	.	0.735154	0.10906	U	0.621094	T	0.66819	0.2828	N	0.19112	0.55	0.33733	D	0.618491	P	0.44627	0.839	B	0.38562	0.276	T	0.73209	-0.4055	10	0.59425	D	0.04	.	9.0478	0.36358	0.4019:0.5981:0.0:0.0	.	286	Q7Z4P5	GDF7_HUMAN	V	286	ENSP00000272224:A286V	ENSP00000272224:A286V	A	+	2	0	0	GDF7	20734170	20734170	1.000000	0.71417	0.987000	0.45799	0.306000	0.27790	4.331000	0.59273	1.890000	0.54733	0.462000	0.41574	GCC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.736	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207563.2	0	0	1	2	2	2	2	0	0	0	0	13	0	13	13	1	2	-9.388750	1	0.240000	NM_182828		0	4	4	0	42	41	0		1			0	0	13	0	0	0.888139	0	0	0	0	0	0	4	42
ZNF513	130557	broad.mit.edu	37	2	27602967	27602967	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:27602967G>T	ENST00000323703.6	-	2	402	c.204C>A	c.(202-204)gaC>gaA	p.D68E	ZNF513_ENST00000407879.1_Missense_Mutation_p.D6E|ZNF513_ENST00000491924.1_5'Flank	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	68	Gly-rich.				regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTTCCGAGTCTCTCTCGA	0.557																																						ENST00000323703.6	0.440000	0.210000	0.370000	0.250000	0.300000	0.320369	0.300000	0.310000																										0				17						c.(202-204)gaC>gaA		zinc finger protein 513							134.0	136.0	135.0					2																	27602967		2203	4300	6503	SO:0001583	missense	130557	0	0					g.chr2:27602967G>T	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.204C>A	chr2.hg19:g.27602967G>T	ENSP00000318373:p.Asp68Glu	0					ZNF513_ENST00000407879.1_Missense_Mutation_p.D6E|ZNF513_ENST00000491924.1_5'Flank	p.D68E	NM_144631.5	NP_653232.3	1	2	3	2.004620	Q8N8E2	ZN513_HUMAN		2	402	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	ENST00000323703.6	1	1	hg19	c.204C>A	CCDS1751.1	0	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969320	0.53614	.	.	ENSG00000163795	ENST00000323703;ENST00000407879;ENST00000436006	T;T;T	0.66815	3.17;2.98;-0.23	4.29	4.29	0.51040	4.29	4.29	0.51040	.	0.000000	0.49916	D	0.000123	T	0.48352	0.1495	N	0.19112	0.55	0.29729	N	0.838021	P	0.40476	0.718	B	0.42343	0.384	T	0.48514	-0.9029	10	0.02654	T	1	-12.4003	12.1265	0.53920	0.0:0.0:1.0:0.0	.	68	Q8N8E2	ZN513_HUMAN	E	68;6;6	ENSP00000318373:D68E;ENSP00000384874:D6E;ENSP00000394226:D6E	ENSP00000318373:D68E	D	-	3	2	2	ZNF513	27456471	27456471	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.816000	0.48026	2.233000	0.73108	0.555000	0.69702	GAC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.557	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	0	0	1	2	2	2	2	0	0	0	0	242	0	242	238	1	2	-4.005628	1	0.240000	NM_144631		0	34	32	0	893	884	0		1	0		0	0	242	0	0	1.000000	1.469589e-01	0	1	0	17	0	34	893
CNNM4	26504	broad.mit.edu	37	2	97426885	97426885	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:97426885G>A	ENST00000377075.2	+	1	247	c.149G>A	c.(148-150)aGg>aAg	p.R50K		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	50					biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						GTGGGCATGAGGCTGGCGAGC	0.701																																						ENST00000377075.2	0.760000	0.170000	0.550000	0.260000	0.380000	0.410276	0.380000	0.350000																										0				20						c.(148-150)aGg>aAg		cyclin and CBS domain divalent metal cation transport mediator 4																																				SO:0001583	missense	26504	0	0					g.chr2:97426885G>A	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.149G>A	chr2.hg19:g.97426885G>A	ENSP00000366275:p.Arg50Lys	0						p.R50K	NM_020184.3	NP_064569.3	1	2	3	2.004620	Q6P4Q7	CNNM4_HUMAN		1	247	+			B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	1	1	hg19	c.149G>A	CCDS2024.2	0	.	.	.	.	.	.	.	.	.	.	G	31	5.088319	0.94100	.	.	ENSG00000158158	ENST00000377075	D	0.84370	-1.84	3.72	3.72	0.42706	3.72	3.72	0.42706	.	0.000000	0.64402	U	0.000006	D	0.87958	0.6309	M	0.71036	2.16	0.80722	D	1	D	0.67145	0.996	P	0.51615	0.675	D	0.89989	0.4106	10	0.72032	D	0.01	-18.3957	14.7617	0.69610	0.0:0.0:1.0:0.0	.	50	Q6P4Q7	CNNM4_HUMAN	K	50	ENSP00000366275:R50K	ENSP00000366275:R50K	R	+	2	0	0	CNNM4	96790612	96790612	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.077000	0.71275	2.069000	0.61940	0.462000	0.41574	AGG	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.701	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	0	0	1	2	2	2	2	0	0	0	0	46	0	46	45	1	2	-9.845501	1	0.240000	NM_020184		0	7	7	0	153	147	0		1	0		0	0	46	0	0	0.978600	1.506310e-02	0	0	0	4	0	7	153
TTN	7273	broad.mit.edu	37	2	179398331	179398331	+	Missense_Mutation	SNP	G	G	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr2:179398331G>T	ENST00000591111.1	-	308	98312	c.98088C>A	c.(98086-98088)aaC>aaA	p.N32696K	TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.N25397K|TTN_ENST00000460472.2_Missense_Mutation_p.N25272K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N25464K|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N34337K|TTN-AS1_ENST00000585625.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.N31769K|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000604571.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32696	Ig-like 144.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCATATTTGTTCCTTGCCA	0.413																																						ENST00000591111.1	0.530000	0.120000	0.390000	0.190000	0.270000	0.298127	0.270000	0.260000																										0				1448						c.(98086-98088)aaC>aaA		titin							152.0	135.0	141.0					2																	179398331		1990	4187	6177	SO:0001583	missense	7273	0	0					g.chr2:179398331G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98088C>A	chr2.hg19:g.179398331G>T	ENSP00000465570:p.Asn32696Lys	0					TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.N31769K|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.N25272K|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N34337K|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N25464K|TTN_ENST00000359218.5_Missense_Mutation_p.N25397K|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000450692.2_RNA	p.N32696K			1	2	3	2.004620	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	308	98312	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.98088C>A		0	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196169	0.78902	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.74	5.74	0.90152	5.74	5.74	0.90152	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91888	0.7432	H	0.99074	4.42	0.50813	D	0.999894	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.94384	0.7607	9	0.87932	D	0	.	13.58	0.61896	0.0803:0.0:0.9197:0.0	.	25272;25397;25464;32696	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	31769;25272;25464;25397;25269	ENSP00000343764:N31769K;ENSP00000434586:N25272K;ENSP00000340554:N25464K;ENSP00000352154:N25397K	ENSP00000340554:N25464K	N	-	3	2	2	TTN	179106577	179106577	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	4.905000	0.63286	2.712000	0.92718	0.561000	0.74099	AAC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	76	0	76	76	1	2	-9.400417	1	0.240000	NM_133378		0	8	8	0	245	244	0		1	0		0	0	76	0	0	0.989521	0	0	0	0	1	0	8	245
PLXNA1	5361	broad.mit.edu	37	3	126732924	126732924	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr3:126732924G>A	ENST00000393409.2	+	10	2375	c.2375G>A	c.(2374-2376)gGc>gAc	p.G792D	PLXNA1_ENST00000251772.4_Missense_Mutation_p.G769D	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	792					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GTGTGGAACGGCAACTTTGTC	0.632																																						ENST00000393409.2	0.180000	0.020000	0.130000	0.050000	0.080000	0.099827	0.080000	0.080000																										0				67						c.(2374-2376)gGc>gAc		plexin A1							147.0	142.0	144.0					3																	126732924		2203	4300	6503	SO:0001583	missense	5361	0	0					g.chr3:126732924G>A	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2375G>A	chr3.hg19:g.126732924G>A	ENSP00000377061:p.Gly792Asp	0					PLXNA1_ENST00000251772.4_Missense_Mutation_p.G769D	p.G792D	NM_032242.3	NP_115618.3	1	2	3	2.001181	Q9UIW2	PLXA1_HUMAN		10	2375	+				Missense_Mutation	SNP	ENST00000393409.2	0	1	hg19	c.2375G>A	CCDS33847.2	0	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380294	0.82682	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.71222	-0.55;-0.55	2.87	2.87	0.33458	2.87	2.87	0.33458	.	1.820450	0.02776	N	0.120250	D	0.84447	0.5474	M	0.85373	2.75	0.80722	D	1	P	0.45715	0.865	P	0.52710	0.707	T	0.76318	-0.3003	10	0.87932	D	0	.	14.5372	0.67969	0.0:0.0:1.0:0.0	.	792	Q9UIW2	PLXA1_HUMAN	D	792;769	ENSP00000377061:G792D;ENSP00000251772:G769D	ENSP00000251772:G769D	G	+	2	0	0	PLXNA1	128215614	128215614	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	5.506000	0.66993	1.912000	0.55364	0.491000	0.48974	GGC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.632	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	0	0	1	2	13	2	2	0	0	0	1	201	0	201	199	1	2	-2.264807	0	0.240000	NM_032242		0	6	6	0	632	627	0		0	0		0	0	201	0	0	0.078843	2.191286e-02	0	0	0	20	0	6	632
LRRN1	57633	broad.mit.edu	37	3	3888153	3888153	+	Missense_Mutation	SNP	G	G	A	rs199850493	byFrequency	TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr3:3888153G>A	ENST00000319331.3	+	2	2589	c.1828G>A	c.(1828-1830)Gta>Ata	p.V610I	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	610	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		AAAGTCATGCGTAAATGTCAC	0.458													G|||	2	0.000399361	0.0	0.0029	5008	,	,		22138	0.0		0.0	False		,,,				2504	0.0					ENST00000319331.3	0.210000	0.020000	0.140000	0.050000	0.080000	0.108040	0.080000	0.080000																										0				26						c.(1828-1830)Gta>Ata		leucine rich repeat neuronal 1							162.0	155.0	157.0					3																	3888153		2203	4300	6503	SO:0001583	missense	57633	11	121412	45				g.chr3:3888153G>A	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1828G>A	chr3.hg19:g.3888153G>A	ENSP00000314901:p.Val610Ile	0					SUMF1_ENST00000534863.1_Intron	p.V610I	NM_020873.5	NP_065924.3	1	2	3	2.001181	Q6UXK5	LRRN1_HUMAN		2	2589	+			Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	0	1	hg19	c.1828G>A	CCDS33685.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	8.266	0.812185	0.16537	.	.	ENSG00000175928	ENST00000319331	T	0.45276	0.9	5.5	4.63	0.57726	5.5	4.63	0.57726	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.056986	0.64402	D	0.000001	T	0.23451	0.0567	N	0.13168	0.305	0.45161	D	0.998179	B	0.23990	0.095	B	0.13407	0.009	T	0.06770	-1.0808	10	0.18276	T	0.48	.	10.8023	0.46495	0.145:0.0:0.855:0.0	.	610	Q6UXK5	LRRN1_HUMAN	I	610	ENSP00000314901:V610I	ENSP00000314901:V610I	V	+	1	0	0	LRRN1	3863153	3863153	1.000000	0.71417	0.372000	0.25991	0.961000	0.63080	7.558000	0.82253	1.461000	0.47929	-0.145000	0.13849	GTA	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.458	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	0	0	1	2	2	2	2	0	0	0	0	140	0	140	140	1	2	-2.468413	0	0.240000	NM_020873		0	5	5	0	495	489	0		1	0		0	0	140	0	0	0.935831	9.883287e-03	0	0	0	12	0	5	495
SCN5A	6331	broad.mit.edu	37	3	38601865	38601865	+	Missense_Mutation	SNP	C	C	T	rs199473605		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr3:38601865C>T	ENST00000333535.4	-	23	4167	c.4018G>A	c.(4018-4020)Gtc>Atc	p.V1340I	SCN5A_ENST00000455624.2_Missense_Mutation_p.V1339I|SCN5A_ENST00000449557.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000413689.1_Missense_Mutation_p.V1340I|SCN5A_ENST00000443581.1_Missense_Mutation_p.V1339I|SCN5A_ENST00000425664.1_Missense_Mutation_p.V1340I|SCN5A_ENST00000450102.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000451551.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000423572.2_Missense_Mutation_p.V1339I|SCN5A_ENST00000414099.2_Missense_Mutation_p.V1340I			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1340					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	ATGAGGCAGACGAGGAGGACG	0.577																																						ENST00000333535.4	0.700000	0.170000	0.520000	0.250000	0.370000	0.393113	0.370000	0.350000																										0				107						c.(4018-4020)Gtc>Atc		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						112.0	106.0	108.0					3																	38601865		2203	4300	6503	SO:0001583	missense	6331	6	121412	36				g.chr3:38601865C>T	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4018G>A	chr3.hg19:g.38601865C>T	ENSP00000328968:p.Val1340Ile	0					SCN5A_ENST00000450102.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000451551.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000413689.1_Missense_Mutation_p.V1340I|SCN5A_ENST00000423572.2_Missense_Mutation_p.V1339I|SCN5A_ENST00000455624.2_Missense_Mutation_p.V1339I|SCN5A_ENST00000443581.1_Missense_Mutation_p.V1339I|SCN5A_ENST00000425664.1_Missense_Mutation_p.V1340I|SCN5A_ENST00000449557.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000414099.2_Missense_Mutation_p.V1340I	p.V1340I			1	2	3	2.001181	Q14524	SCN5A_HUMAN		23	4167	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	1	1	hg19	c.4018G>A	CCDS46796.1	0	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994698	0.93167	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96	4.25	4.25	0.50352	4.25	4.25	0.50352	Ion transport (1);	0.133960	0.49916	D	0.000126	D	0.98865	0.9616	M	0.80616	2.505	0.54753	D	0.999989	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D;P	0.87578	0.977;0.995;0.984;0.991;0.996;0.998;0.859	D	0.99758	1.1020	10	0.87932	D	0	.	17.2234	0.86963	0.0:1.0:0.0:0.0	.	1286;1339;1340;1340;1340;1339;1340	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	I	1340;1339;1340;1286;1339;1340;1340;1339;1286;1286	ENSP00000398962:V1340I;ENSP00000398266:V1339I;ENSP00000410257:V1340I;ENSP00000388797:V1286I;ENSP00000397915:V1339I;ENSP00000416634:V1340I;ENSP00000328968:V1340I;ENSP00000399524:V1339I;ENSP00000403355:V1286I;ENSP00000413996:V1286I	ENSP00000328968:V1340I	V	-	1	0	0	SCN5A	38576869	38576869	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.848000	0.69458	2.355000	0.79922	0.655000	0.94253	GTC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.577	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	0	0	1	2	2	2	2	0	0	0	0	60	0	60	59	1	2	-4.239150	1	0.240000	NM_198056		0	8	8	0	181	178	0		1			0	0	60	0	0	0.989145	0	0	0	0	0	0	8	181
SLC26A6	65010	broad.mit.edu	37	3	48667366	48667366	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr3:48667366C>T	ENST00000395550.2	-	13	1515	c.1468G>A	c.(1468-1470)Gac>Aac	p.D490N	SLC26A6_ENST00000482282.1_5'Flank|SLC26A6_ENST00000455886.2_Missense_Mutation_p.D454N|SLC26A6_ENST00000420764.2_Missense_Mutation_p.D490N|SLC26A6_ENST00000358747.6_Missense_Mutation_p.D469N|SLC26A6_ENST00000383733.3_Missense_Mutation_p.D490N|SLC26A6_ENST00000337000.8_Missense_Mutation_p.D383N			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	490					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		AAGCCAAGGTCCAGGTTCAGC	0.607																																					NSCLC(13;369 479 28271 30152 44026)	ENST00000395550.2	0.810000	0.250000	0.620000	0.350000	0.470000	0.493694	0.470000	0.460000																									SLC26A6/PRKAR2A(2)	0				19						c.(1468-1470)Gac>Aac		solute carrier family 26 (anion exchanger), member 6							77.0	90.0	86.0					3																	48667366		2134	4237	6371	SO:0001583	missense	65010	0	0					g.chr3:48667366C>T	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.1468G>A	chr3.hg19:g.48667366C>T	ENSP00000378920:p.Asp490Asn	0					SLC26A6_ENST00000420764.2_Missense_Mutation_p.D490N|SLC26A6_ENST00000383733.3_Missense_Mutation_p.D490N|SLC26A6_ENST00000482282.1_5'Flank|SLC26A6_ENST00000337000.8_Missense_Mutation_p.D383N|SLC26A6_ENST00000455886.2_Missense_Mutation_p.D454N|SLC26A6_ENST00000358747.6_Missense_Mutation_p.D469N	p.D490N			1	2	3	2.001181	Q9BXS9	S26A6_HUMAN		13	1515	-			B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	ENST00000395550.2	1	1	hg19	c.1468G>A	CCDS43087.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.416008	0.96092	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000421649	D;D;D;D;D;D;D	0.93859	-3.03;-3.03;-3.15;-2.99;-3.02;-3.12;-3.3	4.92	4.92	0.64577	4.92	4.92	0.64577	.	.	.	.	.	D	0.97142	0.9066	M	0.86343	2.81	0.58432	D	0.999999	D;P;D;D;D;D;D	0.89917	1.0;0.952;1.0;1.0;1.0;1.0;1.0	D;P;D;D;D;D;D	0.97110	1.0;0.841;1.0;1.0;1.0;1.0;0.996	D	0.97654	1.0156	9	0.87932	D	0	.	18.6614	0.91473	0.0:1.0:0.0:0.0	.	454;503;383;490;490;490;3895	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	N	490;490;490;383;503;469;454;298	ENSP00000404684:D490N;ENSP00000378920:D490N;ENSP00000373239:D490N;ENSP00000337648:D383N;ENSP00000351597:D469N;ENSP00000401066:D454N;ENSP00000389922:D298N	ENSP00000337648:D383N	D	-	1	0	0	SLC26A6	48642370	48642370	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.298000	0.59067	2.699000	0.92147	0.655000	0.94253	GAC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.607	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	1	0	1	2	2	2	2	0	0	0	0	52	0	52	52	1	2	-3.325469	1	0.240000	NM_022911		0	12	11	0	205	202	0		1	1		0	0	52	0	0	0.999099	2.463685e-01	0	2	0	14	0	12	205
OR5K1	26339	broad.mit.edu	37	3	98188534	98188534	+	Silent	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr3:98188534C>T	ENST00000332650.5	+	1	211	c.114C>T	c.(112-114)acC>acT	p.T38T		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T38T(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ATCTGATCACCGTGGTGGGGA	0.433																																						ENST00000332650.5	0.360000	0.140000	0.290000	0.180000	0.230000	0.247933	0.230000	0.230000																										2	Substitution - coding silent(2)	p.T38T(2)	lung(2)	30						c.(112-114)acC>acT		olfactory receptor, family 5, subfamily K, member 1							166.0	165.0	166.0					3																	98188534		2203	4297	6500	SO:0001819	synonymous_variant	26339	3	121406	40				g.chr3:98188534C>T	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.114C>T	chr3.hg19:g.98188534C>T		0						p.T38T	NM_001004736.2	NP_001004736.2	1	2	3	2.001181	Q8NHB7	OR5K1_HUMAN		1	211	+			B9EGY5|Q6IF46	Silent	SNP	ENST00000332650.5	1	1	hg19	c.114C>T	CCDS43115.1	0																																																																																								0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.433	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1	0	0	1	2	2	2	2	0	0	0	0	232	0	232	278	1	2	-2.023983	0	0.240000			0	21	19	0	738	666	0		1			0	0	232	0	0	0.999993	0	0	0	0	0	0	21	738
RBP1	5947	broad.mit.edu	37	3	139257784	139257784	+	Missense_Mutation	SNP	G	G	A	rs565159052		TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr3:139257784G>A	ENST00000483943.2	-	2	277	c.277C>T	c.(277-279)Cgc>Tgc	p.R93C	RBP1_ENST00000232219.2_Missense_Mutation_p.R93C|RP11-319G6.1_ENST00000381790.3_RNA|RBP1_ENST00000492918.1_Missense_Mutation_p.R93C|RP11-319G6.1_ENST00000515247.1_RNA	NM_001130993.1	NP_001124465.1	P09455	RET1_HUMAN	retinol binding protein 1, cellular	31					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	GCGATTTTGCGCAAGGCCACA	0.552																																						ENST00000483943.2	0.220000	0.030000	0.150000	0.050000	0.090000	0.115353	0.090000	0.090000																										0				5						c.(277-279)Cgc>Tgc		retinol binding protein 1, cellular	Acitretin(DB00459)|Vitamin A(DB00162)						162.0	142.0	148.0					3																	139257784		2203	4300	6503	SO:0001583	missense	5947	0	0					g.chr3:139257784G>A		CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000483943.2:c.277C>T	chr3.hg19:g.139257784G>A	ENSP00000424813:p.Arg93Cys	0					RBP1_ENST00000232219.2_Missense_Mutation_p.R93C|RBP1_ENST00000492918.1_Missense_Mutation_p.R93C|RP11-319G6.1_ENST00000381790.3_RNA|RP11-319G6.1_ENST00000515247.1_RNA	p.R93C	NM_001130993.1	NP_001124465.1	1	2	3	2.001181	P09455	RET1_HUMAN		2	277	-			A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	ENST00000483943.2	0	1	hg19	c.277C>T	CCDS46925.1	0	.	.	.	.	.	.	.	.	.	.	G	20.3	3.975146	0.74360	.	.	ENSG00000114115	ENST00000232219;ENST00000483943;ENST00000492918	T;T;T	0.09630	2.96;2.96;2.96	5.15	3.16	0.36331	5.15	3.16	0.36331	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.135740	0.44483	D	0.000456	T	0.36936	0.0985	M	0.93720	3.45	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	T	0.22452	-1.0216	10	0.87932	D	0	.	5.8333	0.18593	0.1029:0.0:0.5208:0.3763	.	93;93;31	F2Z2F2;E7EWV0;P09455	.;.;RET1_HUMAN	C	93	ENSP00000232219:R93C;ENSP00000424813:R93C;ENSP00000429166:R93C	ENSP00000232219:R93C	R	-	1	0	0	RBP1	140740474	140740474	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.512000	0.60469	1.163000	0.42636	0.455000	0.32223	CGC	0.241820		TCGA-LB-A9Q5-01A-11D-A397-08	0.552	RBP1-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341497.2	0	0	1	2	2	2	2	0	0	0	0	151	0	151	150	1	2	-2.202903	0	0.240000	NM_002899		0	5	5	0	460	457	0		1	0		0	0	151	0	0	0.936789	9.811812e-01	0	0	0	696	0	5	460
DNAH5	1767	broad.mit.edu	37	5	13891148	13891148	+	Silent	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr5:13891148C>T	ENST00000265104.4	-	17	2618	c.2514G>A	c.(2512-2514)acG>acA	p.T838T	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	838	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GACAAAGAGGCGTGCTGCTCA	0.408									Kartagener syndrome																													ENST00000265104.4	1.000000	0.080000	0.220000	0.110000	0.150000	0.189913	0.150000	0.150000																										0				378						c.(2512-2514)acG>acA		dynein, axonemal, heavy chain 5							101.0	109.0	107.0					5																	13891148		2203	4300	6503	SO:0001819	synonymous_variant	1767	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr5:13891148C>T	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2514G>A	chr5.hg19:g.13891148C>T		0					CTB-51A17.1_ENST00000503244.1_RNA	p.T838T	NM_001369.2	NP_001360.1	1	2	3	2.009230	Q8TE73	DYH5_HUMAN		17	2618	-	Lung NSC(4;0.00476)		Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	0	1	hg19	c.2514G>A	CCDS3882.1	0																																																																																								0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.408	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	0	0	1	2	2	2	2	0	0	0	0	162	0	162	161	1	2	-2.542959	1	0.240000	NM_001369		0	12	12	0	639	636	0		1			0	0	162	0	0	0.999097	0	0	0	0	0	0	12	639
GALNT10	55568	broad.mit.edu	37	5	153760011	153760011	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr5:153760011G>A	ENST00000297107.6	+	6	895	c.758G>A	c.(757-759)cGc>cAc	p.R253H	SAP30L-AS1_ENST00000519727.1_RNA|GALNT10_ENST00000377661.2_Missense_Mutation_p.R191H|GALNT10_ENST00000425427.2_Missense_Mutation_p.R253H|GALNT10_ENST00000519544.1_3'UTR	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	253	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TCTTCAGACCGCATTGCTCGG	0.502																																						ENST00000297107.6	1.000000	0.020000	0.120000	0.040000	0.070000	0.110910	0.070000	0.070000																										0				32						c.(757-759)cGc>cAc		polypeptide N-acetylgalactosaminyltransferase 10							180.0	154.0	163.0					5																	153760011		2203	4300	6503	SO:0001583	missense	55568	1	121412	34				g.chr5:153760011G>A	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.758G>A	chr5.hg19:g.153760011G>A	ENSP00000297107:p.Arg253His	0					SAP30L-AS1_ENST00000519727.1_RNA|GALNT10_ENST00000519544.1_3'UTR|GALNT10_ENST00000425427.2_Missense_Mutation_p.R253H|GALNT10_ENST00000377661.2_Missense_Mutation_p.R191H	p.R253H	NM_198321.3	NP_938080.1	1	2	3	2.009230	Q86SR1	GLT10_HUMAN	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)	6	895	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Missense_Mutation	SNP	ENST00000297107.6	0	1	hg19	c.758G>A	CCDS4325.1	0	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038191	0.75617	.	.	ENSG00000164574	ENST00000425427;ENST00000297107;ENST00000377661	T;T;T	0.61742	0.08;0.08;0.22	5.41	5.41	0.78517	5.41	5.41	0.78517	Glycosyl transferase, family 2 (1);	0.052285	0.85682	D	0.000000	T	0.70029	0.3177	M	0.67625	2.065	0.80722	D	1	D;D;D	0.76494	0.991;0.999;0.997	P;P;P	0.59288	0.855;0.801;0.607	T	0.71487	-0.4578	10	0.51188	T	0.08	.	14.7691	0.69662	0.0:0.1441:0.8559:0.0	.	191;253;253	Q86SR1-2;Q86SR1;Q86SR1-3	.;GLT10_HUMAN;.	H	253;253;191	ENSP00000415210:R253H;ENSP00000297107:R253H;ENSP00000366889:R191H	ENSP00000297107:R253H	R	+	2	0	0	GALNT10	153740204	153740204	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	6.457000	0.73505	2.535000	0.85469	0.462000	0.41574	CGC	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.502	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	0	0	1	2	2	2	2	1	0	1	0	149	0	149	147	1	2	-1.857861	0	0.240000	NM_198321		0	5	5	0	584	583	0		1	0		1	0	149	0	0	0.937501	1.428892e-02	0	0	0	17	0	5	584
ABCA13	154664	broad.mit.edu	37	7	48494876	48494876	+	Missense_Mutation	SNP	T	T	C			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr7:48494876T>C	ENST00000435803.1	+	43	12832	c.12808T>C	c.(12808-12810)Ttt>Ctt	p.F4270L	ABCA13_ENST00000544596.1_Missense_Mutation_p.F30L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4270					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CGAGACCTACTTTTTCAGGTA	0.463																																						ENST00000435803.1	1.000000	0.360000	1.000000	0.540000	0.790000	0.775994	0.790000	1.000000																										0				270						c.(12808-12810)Ttt>Ctt		ATP-binding cassette, sub-family A (ABC1), member 13							24.0	27.0	26.0					7																	48494876		1902	4092	5994	SO:0001583	missense	154664	0	0					g.chr7:48494876T>C	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12808T>C	chr7.hg19:g.48494876T>C	ENSP00000411096:p.Phe4270Leu	0					ABCA13_ENST00000544596.1_Missense_Mutation_p.F30L	p.F4270L	NM_152701.3	NP_689914.2	1	2	3	2.018893	Q86UQ4	ABCAD_HUMAN		43	12832	+			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	1	1	hg19	c.12808T>C	CCDS47584.1	0	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087255	0.55968	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.91407	-2.32;-2.39;-2.84	5.0	5.0	0.66597	5.0	5.0	0.66597	.	0.000000	0.49916	D	0.000134	D	0.94984	0.8377	M	0.86420	2.815	0.44234	D	0.997078	P;D;D	0.69078	0.745;0.99;0.997	P;D;D	0.75020	0.652;0.909;0.985	D	0.94276	0.7515	10	0.35671	T	0.21	.	11.3979	0.49854	0.0:0.0:0.0:1.0	.	30;1972;4270	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	L	4270;73;30	ENSP00000411096:F4270L;ENSP00000391042:F73L;ENSP00000442634:F30L	ENSP00000391042:F73L	F	+	1	0	0	ABCA13	48465422	48465422	1.000000	0.71417	0.964000	0.40570	0.174000	0.22865	4.818000	0.62657	2.006000	0.58801	0.459000	0.35465	TTT	0.245433		TCGA-LB-A9Q5-01A-11D-A397-08	0.463	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	1	0	1	2	2	2	2	0	0	0	0	26	0	26	26	1	2	-12.623190	1	0.240000	NM_152701		0	7	7	0	71	70	0		1			0	0	26	0	0	0.981420	0	0	0	0	0	0	7	71
PIK3CG	5294	broad.mit.edu	37	7	106508683	106508683	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr7:106508683G>A	ENST00000359195.3	+	2	987	c.677G>A	c.(676-678)cGc>cAc	p.R226H	PIK3CG_ENST00000440650.2_Missense_Mutation_p.R226H|PIK3CG_ENST00000496166.1_Missense_Mutation_p.R226H	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	226	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GTCATTCACCGCAGCACCACC	0.572																																						ENST00000359195.3	1.000000	0.030000	0.160000	0.050000	0.090000	0.145699	0.090000	0.090000																										0				132						c.(676-678)cGc>cAc		phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma							115.0	118.0	117.0					7																	106508683		2203	4300	6503	SO:0001583	missense	5294	0	0					g.chr7:106508683G>A		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.677G>A	chr7.hg19:g.106508683G>A	ENSP00000352121:p.Arg226His	0					PIK3CG_ENST00000496166.1_Missense_Mutation_p.R226H|PIK3CG_ENST00000440650.2_Missense_Mutation_p.R226H	p.R226H	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	1	2	3	2.018893	P48736	PK3CG_HUMAN		2	987	+			A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	0	1	hg19	c.677G>A	CCDS5739.1	0	.	.	.	.	.	.	.	.	.	.	G	11.11	1.543339	0.27563	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.70282	-0.47;-0.47;-0.47	5.5	5.5	0.81552	5.5	5.5	0.81552	Phosphoinositide 3-kinase, ras-binding (2);	0.132697	0.56097	D	0.000040	T	0.64114	0.2569	L	0.44542	1.39	0.43564	D	0.995886	P	0.50066	0.931	P	0.45377	0.478	T	0.59150	-0.7508	10	0.14252	T	0.57	-24.9223	13.0307	0.58840	0.074:0.0:0.926:0.0	.	226	P48736	PK3CG_HUMAN	H	226	ENSP00000392258:R226H;ENSP00000419260:R226H;ENSP00000352121:R226H	ENSP00000352121:R226H	R	+	2	0	0	PIK3CG	106295919	106295919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.392000	0.59659	2.736000	0.93811	0.591000	0.81541	CGC	0.245433		TCGA-LB-A9Q5-01A-11D-A397-08	0.572	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1	0	0	1	2	15	2	2	1	0	1	1	121	0	121	121	1	2	-2.359945	0	0.240000			0	5	5	0	476	474	0		0	0		1	0	121	0	0	0.019002	1.796622e-04	0	0	0	2	0	5	476
MYOM2	9172	broad.mit.edu	37	8	2041906	2041906	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr8:2041906C>T	ENST00000262113.4	+	17	2254	c.2113C>T	c.(2113-2115)Cag>Tag	p.Q705*	MYOM2_ENST00000523438.1_Nonsense_Mutation_p.Q130*	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	705	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CATAAAAGTGCAGGCCGCACT	0.488																																						ENST00000262113.4	1.000000	0.120000	0.380000	0.180000	0.270000	0.302749	0.270000	0.250000																										0				104						c.(2113-2115)Cag>Tag		myomesin 2							164.0	134.0	144.0					8																	2041906		2203	4300	6503	SO:0001587	stop_gained	9172	0	0					g.chr8:2041906C>T		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2113C>T	chr8.hg19:g.2041906C>T	ENSP00000262113:p.Gln705*	0					MYOM2_ENST00000523438.1_Nonsense_Mutation_p.Q130*	p.Q705*	NM_003970.2	NP_003961.2	1	2	3	2.011056	P54296	MYOM2_HUMAN		17	2254	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	Q7Z3Y2	Nonsense_Mutation	SNP	ENST00000262113.4	0	1	hg19	c.2113C>T	CCDS5957.1	0	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297700	0.60086	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	.	.	.	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.157344	0.48286	D	0.000183	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1534	0.65401	0.1499:0.8501:0.0:0.0	.	.	.	.	X	705;130	.	ENSP00000262113:Q705X	Q	+	1	0	0	MYOM2	2029313	2029313	1.000000	0.71417	0.998000	0.56505	0.034000	0.12701	2.879000	0.48522	2.558000	0.86282	0.655000	0.94253	CAG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.488	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	0	0	1	2	2	2	2	0	0	0	0	67	0	67	67	1	2	-3.424635	1	0.240000	NM_003970		0	8	8	0	254	252	0		1	0		0	0	67	0	0	0.989345	0	0	0	0	1	0	8	254
TEX15	56154	broad.mit.edu	37	8	30705431	30705431	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr8:30705431C>T	ENST00000256246.2	-	1	1177	c.1103G>A	c.(1102-1104)gGg>gAg	p.G368E	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	368					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATTTATTTTCCCCAATTTCAG	0.383																																						ENST00000256246.2	1.000000	0.170000	0.410000	0.230000	0.310000	0.343066	0.310000	0.310000																										0				138						c.(1102-1104)gGg>gAg		testis expressed 15							77.0	75.0	76.0					8																	30705431		2203	4300	6503	SO:0001583	missense	56154	0	0					g.chr8:30705431C>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1103G>A	chr8.hg19:g.30705431C>T	ENSP00000256246:p.Gly368Glu	0					TEX15_ENST00000523186.1_5'Flank	p.G368E	NM_031271.3	NP_112561.2	1	2	3	2.011056	Q9BXT5	TEX15_HUMAN		1	1177	-				Missense_Mutation	SNP	ENST00000256246.2	1	1	hg19	c.1103G>A	CCDS6080.1	0	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.000801	0.00431	.	.	ENSG00000133863	ENST00000256246	T	0.08193	3.12	5.51	-1.54	0.08584	5.51	-1.54	0.08584	.	0.673251	0.14063	N	0.343910	T	0.02156	0.0067	N	0.01168	-0.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39482	-0.9612	10	0.87932	D	0	.	1.294	0.02066	0.1349:0.2395:0.1397:0.4859	.	368	Q9BXT5	TEX15_HUMAN	E	368	ENSP00000256246:G368E	ENSP00000256246:G368E	G	-	2	0	0	TEX15	30824973	30824973	0.043000	0.20138	0.001000	0.08648	0.169000	0.22640	0.166000	0.16583	-0.412000	0.07519	-0.312000	0.09012	GGG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.383	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1	0	0	1	2	2	2	2	0	0	0	0	107	0	107	106	1	2	-3.221883	1	0.240000			0	14	14	0	369	368	0		1			0	0	107	0	0	0.999762	0	0	0	0	0	0	14	369
TACC1	6867	broad.mit.edu	37	8	38677137	38677137	+	Silent	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr8:38677137G>A	ENST00000317827.4	+	3	754	c.375G>A	c.(373-375)caG>caA	p.Q125Q	TACC1_ENST00000348567.4_Intron|TACC1_ENST00000519416.1_5'UTR|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000520340.1_Silent_p.Q89Q|TACC1_ENST00000520615.1_5'UTR|TACC1_ENST00000518415.1_Silent_p.Q80Q|TACC1_ENST00000443286.2_Silent_p.Q141Q|TACC1_ENST00000520973.1_5'UTR|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000379931.3_Silent_p.Q125Q|TACC1_ENST00000522752.1_Intron	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	125					cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			TGCCACAGCAGGCCATTGACT	0.383																																						ENST00000317827.4	1.000000	0.110000	0.320000	0.160000	0.230000	0.262875	0.230000	0.220000																										0				17						c.(373-375)caG>caA		transforming, acidic coiled-coil containing protein 1							70.0	64.0	66.0					8																	38677137		2203	4300	6503	SO:0001819	synonymous_variant	6867	0	0					g.chr8:38677137G>A	AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.375G>A	chr8.hg19:g.38677137G>A		0					TACC1_ENST00000443286.2_Silent_p.Q141Q|TACC1_ENST00000519416.1_5'UTR|TACC1_ENST00000379931.3_Silent_p.Q125Q|TACC1_ENST00000518415.1_Silent_p.Q80Q|TACC1_ENST00000520340.1_Silent_p.Q89Q|TACC1_ENST00000520615.1_5'UTR|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000520973.1_5'UTR	p.Q125Q	NM_006283.2	NP_006274.2	1	2	3	2.011056	O75410	TACC1_HUMAN	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)	3	754	+		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Silent	SNP	ENST00000317827.4	1	1	hg19	c.375G>A	CCDS6109.1	0																																																																																								0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.383	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	0	0	1	2	2	2	2	0	0	0	0	108	0	108	107	1	2	-9.842539	1	0.240000	NM_006283		0	10	10	0	367	362	0		1	0		0	0	108	0	0	0.996761	2.493309e-01	0	0	0	33	0	10	367
TPD52	7163	broad.mit.edu	37	8	80954871	80954871	+	Missense_Mutation	SNP	T	T	G			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr8:80954871T>G	ENST00000379097.3	-	5	901	c.539A>C	c.(538-540)aAg>aCg	p.K180T	TPD52_ENST00000518937.1_Missense_Mutation_p.K163T|TPD52_ENST00000520527.1_Missense_Mutation_p.K203T|TPD52_ENST00000448733.2_Missense_Mutation_p.K194T|TPD52_ENST00000379096.5_Missense_Mutation_p.K140T|TPD52_ENST00000519303.2_Missense_Mutation_p.K16T|TPD52_ENST00000523395.1_5'UTR|TPD52_ENST00000517427.1_Missense_Mutation_p.K189T|TPD52_ENST00000537855.1_Missense_Mutation_p.K180T	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	180					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			GTTTTCGACCTTTTCTTCAAA	0.308																																						ENST00000379097.3	1.000000	0.170000	0.460000	0.240000	0.330000	0.365120	0.330000	0.320000																										0				8						c.(538-540)aAg>aCg		tumor protein D52							112.0	116.0	115.0					8																	80954871		2203	4299	6502	SO:0001583	missense	7163	0	0					g.chr8:80954871T>G	U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.539A>C	chr8.hg19:g.80954871T>G	ENSP00000368391:p.Lys180Thr	0					TPD52_ENST00000518937.1_Missense_Mutation_p.K163T|TPD52_ENST00000523395.1_5'UTR|TPD52_ENST00000519303.2_Missense_Mutation_p.K16T|TPD52_ENST00000520527.1_Missense_Mutation_p.K203T|TPD52_ENST00000448733.2_Missense_Mutation_p.K194T|TPD52_ENST00000537855.1_Missense_Mutation_p.K180T|TPD52_ENST00000517427.1_Missense_Mutation_p.K189T|TPD52_ENST00000379096.5_Missense_Mutation_p.K140T	p.K180T	NM_001025252.1	NP_001020423.1	1	2	3	2.011056	P55327	TPD52_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)	5	901	-	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Missense_Mutation	SNP	ENST00000379097.3	1	1	hg19	c.539A>C	CCDS34912.1	0	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807809	0.70797	.	.	ENSG00000076554	ENST00000537855;ENST00000379096;ENST00000518937;ENST00000520527;ENST00000517427;ENST00000448733;ENST00000379097;ENST00000425513;ENST00000519303	T;T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.143577	0.64402	D	0.000008	T	0.56016	0.1957	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.81914	0.925;0.982;0.995	T	0.61397	-0.7071	10	0.66056	D	0.02	-31.5479	9.074	0.36511	0.0:0.0816:0.0:0.9184	.	140;163;180	P55327-2;E5RKB4;P55327	.;.;TPD52_HUMAN	T	180;140;163;203;189;194;180;140;16	ENSP00000438113:K180T;ENSP00000368390:K140T;ENSP00000429915:K163T;ENSP00000429309:K203T;ENSP00000429351:K189T;ENSP00000410222:K194T;ENSP00000368391:K180T;ENSP00000428951:K16T	ENSP00000368390:K140T	K	-	2	0	0	TPD52	81117426	81117426	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.512000	0.53407	2.265000	0.75225	0.482000	0.46254	AAG	0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.308	TPD52-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379539.2	0	0	1	2	2	2	2	0	0	0	0	85	0	85	85	1	2	-3.221883	1	0.240000	NM_005079		0	11	11	0	274	273	0		1	1		0	0	85	0	0	0.998390	8.009196e-01	0	9	0	68	0	11	274
SCRIB	23513	broad.mit.edu	37	8	144895217	144895217	+	Silent	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr8:144895217G>A	ENST00000320476.3	-	7	631	c.625C>T	c.(625-627)Ctg>Ttg	p.L209L	SCRIB_ENST00000377533.3_Silent_p.L128L|MIR937_ENST00000401271.1_RNA|SCRIB_ENST00000356994.2_Silent_p.L209L	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	209	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGTGCTGACAGCTGGTTCCGG	0.622																																					Pancreas(51;966 1133 10533 14576 29674)	ENST00000320476.3	1.000000	0.320000	1.000000	0.610000	0.990000	0.855537	0.990000	1.000000																										0				42						c.(625-627)Ctg>Ttg		scribbled planar cell polarity protein							14.0	17.0	16.0					8																	144895217		2182	4290	6472	SO:0001819	synonymous_variant	23513	0	0					g.chr8:144895217G>A	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.625C>T	chr8.hg19:g.144895217G>A		0					SCRIB_ENST00000356994.2_Silent_p.L209L|MIR937_ENST00000401271.1_RNA|SCRIB_ENST00000377533.3_Silent_p.L128L	p.L209L	NM_015356.4	NP_056171	1	2	3	2.011056	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)	7	631	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	0	1	hg19	c.625C>T	CCDS6411.1	1																																																																																								0.243631		TCGA-LB-A9Q5-01A-11D-A397-08	0.622	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	0	0	1	2	2	2	2	0	0	0	0	12	0	12	12	1	2	-8.940018	1	0.240000	NM_015356		0	3	3	0	22	21	0		1	0		0	0	12	0	0	0.799609	8.364176e-01	0	0	0	27	0	3	22
TGFBR1	7046	broad.mit.edu	37	9	101911492	101911492	+	Missense_Mutation	SNP	G	G	A			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr9:101911492G>A	ENST00000374994.4	+	9	1534	c.1417G>A	c.(1417-1419)Gaa>Aaa	p.E473K	TGFBR1_ENST00000550253.1_Missense_Mutation_p.E404K|TGFBR1_ENST00000552516.1_Missense_Mutation_p.E477K|TGFBR1_ENST00000374990.2_Missense_Mutation_p.E396K	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	473	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				AATTATGAGAGAATGTTGGTA	0.348																																						ENST00000374994.4	0.720000	0.220000	0.580000	0.310000	0.430000	0.456509	0.430000	0.420000																										0				27						c.(1417-1419)Gaa>Aaa		transforming growth factor, beta receptor 1							71.0	64.0	66.0					9																	101911492		2203	4300	6503	SO:0001583	missense	7046	0	0					g.chr9:101911492G>A		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1417G>A	chr9.hg19:g.101911492G>A	ENSP00000364133:p.Glu473Lys	0					TGFBR1_ENST00000552516.1_Missense_Mutation_p.E477K|TGFBR1_ENST00000374990.2_Missense_Mutation_p.E396K|TGFBR1_ENST00000550253.1_Missense_Mutation_p.E404K	p.E473K	NM_004612.2	NP_004603.1	0	1	1	1.978128	P36897	TGFR1_HUMAN		9	1534	+		Acute lymphoblastic leukemia(62;0.0559)	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	0	1	hg19	c.1417G>A	CCDS6738.1	0	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880269	0.91740	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.66	5.66	0.87406	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80204	0.4580	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.986;0.997	T	0.81272	-0.1008	10	0.87932	D	0	.	18.8853	0.92375	0.0:0.0:1.0:0.0	.	396;473	P36897-3;P36897	.;TGFR1_HUMAN	K	473;435;396;477;404	ENSP00000364133:E473K;ENSP00000364129:E396K;ENSP00000447297:E477K;ENSP00000450052:E404K	ENSP00000364129:E396K	E	+	1	0	0	TGFBR1	100951313	100951313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.827000	0.97445	0.655000	0.94253	GAA	0.212598		TCGA-LB-A9Q5-01A-11D-A397-08	0.348	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3	0	0	1	2	2	2	2	0	0	0	0	55	0	55	54	1	2	-13.494670	1	0.240000			0	10	10	0	178	177	0		1	1	1	0	0	55	840	0	0.997040	5.255390e-01	9.999998e-01	2	40	29	716	10	178
CACNA1B	774	broad.mit.edu	37	9	140952516	140952516	+	Silent	SNP	C	C	T	rs140374106	byFrequency	TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chr9:140952516C>T	ENST00000371372.1	+	28	4267	c.4122C>T	c.(4120-4122)tcC>tcT	p.S1374S	CACNA1B_ENST00000371357.1_Silent_p.S1375S|CACNA1B_ENST00000371363.1_Silent_p.S1374S|CACNA1B_ENST00000371355.4_Silent_p.S1375S|CACNA1B_ENST00000277551.2_Silent_p.S1374S|CACNA1B_ENST00000277549.5_Silent_p.S570S	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1374					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGAAACACTCCGTGGATGCCA	0.562													C|||	8	0.00159744	0.0	0.0	5008	,	,		22283	0.0079		0.0	False		,,,				2504	0.0					ENST00000371372.1	0.770000	0.290000	0.640000	0.390000	0.500000	0.523576	0.500000	0.500000																										0				80						c.(4120-4122)tcC>tcT		calcium channel, voltage-dependent, N type, alpha 1B subunit	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)						141.0	131.0	134.0					9																	140952516		2006	4190	6196	SO:0001819	synonymous_variant	774	65	120944	49				g.chr9:140952516C>T	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4122C>T	chr9.hg19:g.140952516C>T		0					CACNA1B_ENST00000277551.2_Silent_p.S1374S|CACNA1B_ENST00000277549.5_Silent_p.S570S|CACNA1B_ENST00000371355.4_Silent_p.S1375S|CACNA1B_ENST00000371363.1_Silent_p.S1374S|CACNA1B_ENST00000371357.1_Silent_p.S1375S	p.S1374S	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	0	1	1	1.978128	Q00975	CAC1B_HUMAN		28	4267	+	all_cancers(76;0.166)		B1AQK5	Silent	SNP	ENST00000371372.1	1	0	hg19	c.4122C>T	CCDS59522.1	0																																																																																								0.212598		TCGA-LB-A9Q5-01A-11D-A397-08	0.562	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	1	0	1	2	2	2	2	0	0	0	0	62	0	62	62	1	2	-2.842482	1	0.240000	NM_000718		0	15	15	0	225	224	0		1			0	0	62	0	0	0.999883	0	0	0	0	0	0	15	225
BEX4	56271	broad.mit.edu	37	X	102471391	102471391	+	Missense_Mutation	SNP	C	C	T	rs139178618	byFrequency	TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chrX:102471391C>T	ENST00000372695.5	+	3	545	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	BEX4_ENST00000372691.3_Missense_Mutation_p.R104C	NM_001080425.3	NP_001073894.1	Q9NWD9	BEX4_HUMAN	brain expressed, X-linked 4	104						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	9						GCACTATATGCGCTTCCAAAC	0.418																																						ENST00000372695.5	0.410000	0.160000	0.340000	0.210000	0.270000	0.282381	0.270000	0.270000																										0				9						c.(310-312)Cgc>Tgc		brain expressed, X-linked 4							198.0	170.0	179.0					X																	102471391		2203	4300	6503	SO:0001583	missense	56271	0	0					g.chrX:102471391C>T	AL035494	CCDS35355.1	Xq22.1-q22.3	2014-03-21	2008-11-04	2007-08-24	ENSG00000102409	ENSG00000102409			25475	protein-coding gene	gene with protein product		300692	"""brain expressed X-linked-like 1"", ""BEX family member 4"""	BEXL1		15958283, 16221301	Standard	NM_001080425		Approved	FLJ10097	uc004ejw.4	Q9NWD9	OTTHUMG00000022091	ENST00000372695.5:c.310C>T	chrX.hg19:g.102471391C>T	ENSP00000361780:p.Arg104Cys						BEX4_ENST00000372691.3_Missense_Mutation_p.R104C	p.R104C	NM_001080425.3	NP_001073894.1	0	1	1		Q9NWD9	BEX4_HUMAN		3	545	+				Missense_Mutation	SNP	ENST00000372695.5	1	1	hg19	c.310C>T	CCDS35355.1	0	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778944	0.49891	.	.	ENSG00000102409	ENST00000372695;ENST00000372691	T;T	0.49720	0.77;0.77	3.84	2.98	0.34508	3.84	2.98	0.34508	.	0.159217	0.30277	N	0.009992	T	0.43344	0.1243	M	0.76170	2.325	0.09310	N	1	B	0.26195	0.144	B	0.21151	0.033	T	0.44907	-0.9297	10	0.59425	D	0.04	.	6.479	0.22053	0.0:0.8657:0.0:0.1343	.	104	Q9NWD9	BEX4_HUMAN	C	104	ENSP00000361780:R104C;ENSP00000361776:R104C	ENSP00000361776:R104C	R	+	1	0	0	BEX4	102358047	102358047	0.001000	0.12720	0.001000	0.08648	0.847000	0.48162	0.082000	0.14847	0.979000	0.38497	0.594000	0.82650	CGC	0.240000		TCGA-LB-A9Q5-01A-11D-A397-08	0.418	BEX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057694.1	0	0	1	2	2	2	2	0	0	0	0	129	0	129	129	1	2	-2.453738	0	0.240000	XM_043653		0	19	19	0	566	562	0		1	0		0	0	129	0	0	0.999990	7.530266e-01	0	0	0	82	0	19	566
HUWE1	10075	broad.mit.edu	37	X	53566769	53566769	+	Silent	SNP	G	G	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chrX:53566769G>T	ENST00000342160.3	-	74	11938	c.11481C>A	c.(11479-11481)tcC>tcA	p.S3827S	HUWE1_ENST00000262854.6_Silent_p.S3827S			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3827					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGGTTCCATCGGAGGCTGGAG	0.502																																						ENST00000342160.3	0.900000	0.150000	0.660000	0.260000	0.430000	0.469893	0.430000	0.390000																										0				153						c.(11479-11481)tcC>tcA		HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase							39.0	32.0	34.0					X																	53566769		2203	4300	6503	SO:0001819	synonymous_variant	10075	0	0					g.chrX:53566769G>T	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11481C>A	chrX.hg19:g.53566769G>T							HUWE1_ENST00000262854.6_Silent_p.S3827S	p.S3827S			0	1	1		Q7Z6Z7	HUWE1_HUMAN		74	11938	-			O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	0	1	hg19	c.11481C>A	CCDS35301.1	0																																																																																								0.240000		TCGA-LB-A9Q5-01A-11D-A397-08	0.502	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	1	0	1	2	2	2	2	0	0	0	0	14	0	14	14	1	2	-4.107394	1	0.240000	XM_497119		0	4	4	0	79	78	0		1	1		0	0	14	0	0	0.889231	8.337717e-01	0	20	0	47	0	4	79
MTM1	4534	broad.mit.edu	37	X	149832023	149832023	+	Missense_Mutation	SNP	C	C	T			TCGA-LB-A9Q5-01A-11D-A397-08	TCGA-LB-A9Q5-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	672b821b-fc2b-4b1f-955d-93cfec7be541	d254b381-9cf2-480d-a681-ad441818a4dc	g.chrX:149832023C>T	ENST00000370396.2	+	14	1639	c.1585C>T	c.(1585-1587)Cgt>Tgt	p.R529C	MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000542741.1_3'UTR|MTM1_ENST00000413012.2_Missense_Mutation_p.R492C|MTM1_ENST00000543350.1_Missense_Mutation_p.R414C	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	529	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					TGCCAGTATGCGTCACTTGGA	0.358																																						ENST00000370396.2	0.140000	0.020000	0.110000	0.040000	0.070000	0.079448	0.070000	0.070000																										0				26						c.(1585-1587)Cgt>Tgt		myotubularin 1							91.0	79.0	83.0					X																	149832023		2203	4300	6503	SO:0001583	missense	4534	0	0					g.chrX:149832023C>T	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1585C>T	chrX.hg19:g.149832023C>T	ENSP00000359423:p.Arg529Cys						MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.R414C|MTM1_ENST00000413012.2_Missense_Mutation_p.R492C|MTM1_ENST00000542741.1_3'UTR	p.R529C	NM_000252.2	NP_000243.1	0	1	1		Q13496	MTM1_HUMAN		14	1639	+	Acute lymphoblastic leukemia(192;6.56e-05)		A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	0	1	hg19	c.1585C>T	CCDS14694.1	0	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790939	0.50102	.	.	ENSG00000171100	ENST00000370396;ENST00000543350;ENST00000413012	D;D;D	0.90261	-2.64;-2.64;-2.64	5.39	4.52	0.55395	5.39	4.52	0.55395	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.89798	0.6819	M	0.85777	2.775	0.80722	D	1	P;B	0.35033	0.481;0.245	B;B	0.26094	0.055;0.066	D	0.87953	0.2725	10	0.44086	T	0.13	.	13.4599	0.61221	0.0:0.9221:0.0:0.0779	.	492;529	B7Z491;Q13496	.;MTM1_HUMAN	C	529;414;492	ENSP00000359423:R529C;ENSP00000439784:R414C;ENSP00000389157:R492C	ENSP00000359423:R529C	R	+	1	0	0	MTM1	149582681	149582681	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.262000	0.78410	1.039000	0.40074	0.513000	0.50165	CGT	0.240000		TCGA-LB-A9Q5-01A-11D-A397-08	0.358	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	0	0	1	2	2	2	2	0	0	0	0	225	0	225	225	1	2	-2.417651	0	0.240000	NM_000252		0	6	6	0	723	721	0		1	0		0	0	225	0	0	0.964769	4.411844e-03	0	0	0	10	0	6	723
