#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
USP40	55230	broad.mit.edu	37	2	234433205	234433205	+	Frame_Shift_Del	DEL	T	T	-			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr2:234433205delT	ENST00000427112.2	-	14	1846	c.1811delA	c.(1810-1812)gatfs	p.D604fs	USP40_ENST00000251722.6_Frame_Shift_Del_p.D604fs|USP40_ENST00000450966.1_Frame_Shift_Del_p.D616fs			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	604					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TGTCAGTTCATCCCCTAGAAA	0.373																																						ENST00000427112.2	0.560000	0.200000	4.600000e-01	2.700000e-01	0.350000	0.370930	0.350000	0.350000																										0				30						c.(1810-1812)gatfs		ubiquitin specific peptidase 40							75.0	70.0	72.0					2																	234433205		1857	4135	5992	SO:0001589	frameshift_variant	55230	0	0					g.chr2:234433205delT	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1811delA	chr2.hg19:g.234433205delT	ENSP00000387898:p.Asp604fs	0					USP40_ENST00000251722.6_Frame_Shift_Del_p.D604fs|USP40_ENST00000450966.1_Frame_Shift_Del_p.D616fs	p.D604fs			0	1	1	1.946521	Q9NVE5	UBP40_HUMAN		14	1846	-		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)	Q6NX38|Q70EL0	Frame_Shift_Del	DEL	ENST00000427112.2	0	1	hg19	c.1811delA	CCDS46547.1	0																																																																																								0.303696		TCGA-M8-A5N4-01A-11D-A26I-08	0.373	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	1	0	1		2	2		0	0	0	0	20	0	20	18	1	1.800000	-3.320026	1	0.350000	XM_114294		0	13	13	0	184	180	0	0	1	0	0	0	0	20	0	0	0.999529	3.858451e-01	0	1	0	18	0	13	184
SLIT1	6585	broad.mit.edu	37	10	98763971	98763971	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr10:98763971G>A	ENST00000266058.4	-	34	3964	c.3719C>T	c.(3718-3720)aCg>aTg	p.T1240M	SLIT1_ENST00000371070.4_Missense_Mutation_p.T1240M|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1240	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		ATCGTTGATCGTCTCAGCACT	0.567																																						ENST00000266058.4	0.290000	0.150000	2.600000e-01	1.800000e-01	0.210000	0.221627	0.210000	0.210000																										0				78						c.(3718-3720)aCg>aTg		slit homolog 1 (Drosophila)							211.0	185.0	193.0					10																	98763971		2203	4300	6503	SO:0001583	missense	6585	1	121412	37				g.chr10:98763971G>A	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3719C>T	chr10.hg19:g.98763971G>A	ENSP00000266058:p.Thr1240Met	0					ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.T1240M	p.T1240M	NM_003061.2	NP_003052.2	0	0	0	2.039690	O75093	SLIT1_HUMAN		34	3964	-		Colorectal(252;0.162)	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	1	1	hg19	c.3719C>T	CCDS7453.1	0	.	.	.	.	.	.	.	.	.	.	G	8.709	0.911682	0.17833	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	T;T	0.78481	-1.18;-1.18	5.2	3.35	0.38373	5.2	3.35	0.38373	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.094139	0.64402	N	0.000001	T	0.70211	0.3198	L	0.58510	1.815	0.80722	D	1	P	0.35551	0.509	B	0.34138	0.176	T	0.63637	-0.6592	10	0.20519	T	0.43	.	10.8988	0.47038	0.152:0.0:0.848:0.0	.	1240	O75093	SLIT1_HUMAN	M	1240	ENSP00000266058:T1240M;ENSP00000360109:T1240M	ENSP00000266058:T1240M	T	-	2	0	0	SLIT1	98753961	98753961	1.000000	0.71417	0.946000	0.38457	0.192000	0.23643	7.783000	0.85696	0.766000	0.33244	0.655000	0.94253	ACG	0.338422		TCGA-M8-A5N4-01A-11D-A26I-08	0.567	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	1.800000	-3.927023	1	0.350000	NM_003061		0	38	38	0	946	943	0		1	0		0	0	115	0	0	1.000000	0	0	0	0	1	0	38	946
DNHD1	144132	broad.mit.edu	37	11	6592936	6592936	+	Missense_Mutation	SNP	C	C	T	rs375322690		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr11:6592936C>T	ENST00000527990.2	+	41	13982	c.13982C>T	c.(13981-13983)gCg>gTg	p.A4661V	DNHD1_ENST00000254579.6_Missense_Mutation_p.A4661V			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4661					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GTCCTACATGCGGAGTGGGAC	0.627																																						ENST00000527990.2	1.000000	0.350000	8.500000e-01	4.700000e-01	0.630000	0.661360	0.630000	1.000000																										0				55						c.(13981-13983)gCg>gTg		dynein heavy chain domain 1		C	VAL/ALA	1,4179		0,1,2089	34.0	44.0	41.0		13982	4.8	0.1	11		41	0,8430		0,0,4215	no	missense	DNHD1	NM_144666.2	64	0,1,6304	TT,TC,CC		0.0,0.0239,0.0079	probably-damaging	4661/4754	6592936	1,12609	2090	4215	6305	SO:0001583	missense	144132	5	121070	28				g.chr11:6592936C>T	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13982C>T	chr11.hg19:g.6592936C>T	ENSP00000436180:p.Ala4661Val	0					DNHD1_ENST00000254579.6_Missense_Mutation_p.A4661V	p.A4661V			1	2	3	2.116416	Q96M86	DNHD1_HUMAN		41	13982	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	0	1	hg19	c.13982C>T	CCDS44532.1	0	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306357	0.81247	2.39E-4	0.0	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000530197	T;T	0.16196	2.36;2.36	4.75	4.75	0.60458	4.75	4.75	0.60458	Dynein heavy chain (1);	0.000000	0.64402	D	0.000001	T	0.40886	0.1135	M	0.67953	2.075	0.32829	D	0.503832	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.50499	-0.8821	10	0.48119	T	0.1	-13.3807	16.6824	0.85296	0.0:1.0:0.0:0.0	.	3749;714;4661	B0I1S4;Q9NSW8;Q96M86	.;.;DNHD1_HUMAN	V	4661;4661;929	ENSP00000254579:A4661V;ENSP00000436180:A4661V	ENSP00000254579:A4661V	A	+	2	0	0	DNHD1	6549512	6549512	0.984000	0.35163	0.085000	0.20634	0.766000	0.43426	4.130000	0.57964	2.468000	0.83385	0.655000	0.94253	GCG	0.357866		TCGA-M8-A5N4-01A-11D-A26I-08	0.627	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	1	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	1.800000	-18.718010	1	0.350000	NM_144666		0	12	12	0	101	101	1		1	0		0	0	13	0	0	0.999291	1.048713e-01	0	0	0	5	0	12	101
OR5D14	219436	broad.mit.edu	37	11	55563781	55563781	+	Silent	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr11:55563781C>T	ENST00000335605.1	+	1	750	c.750C>T	c.(748-750)atC>atT	p.I250I		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TGACTTCTATCACCATCTTCC	0.453																																						ENST00000335605.1	1.000000	0.240000	4.200000e-01	2.800000e-01	0.340000	0.381791	0.340000	0.350000																										0				48						c.(748-750)atC>atT		olfactory receptor, family 5, subfamily D, member 14							105.0	97.0	100.0					11																	55563781		2200	4296	6496	SO:0001819	synonymous_variant	219436	0	0					g.chr11:55563781C>T	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.750C>T	chr11.hg19:g.55563781C>T		0						p.I250I	NM_001004735.1	NP_001004735.1	1	2	3	2.108393	Q8NGL3	OR5DE_HUMAN		1	750	+		all_epithelial(135;0.196)	Q6IF69|Q6IFD4|Q96RB5	Silent	SNP	ENST00000335605.1	1	1	hg19	c.750C>T	CCDS31508.1	0																																																																																								0.356754		TCGA-M8-A5N4-01A-11D-A26I-08	0.453	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	1.800000	-7.025374	1	0.350000	NM_001004735		0	33	33	0	522	510	0		1		0	0	0	39	0	0	1.000000	0	0	0	0	0	1	33	522
NFRKB	4798	broad.mit.edu	37	11	129753985	129753985	+	Missense_Mutation	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr11:129753985C>T	ENST00000446488.3	-	7	899	c.796G>A	c.(796-798)Gag>Aag	p.E266K	NFRKB_ENST00000524794.1_Missense_Mutation_p.E291K|NFRKB_ENST00000524746.1_Missense_Mutation_p.E266K|NFRKB_ENST00000304521.5_Missense_Mutation_p.E266K	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	266					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		TTCCGCTTCTCGTGGTGCTTC	0.473																																						ENST00000446488.3	1.000000	0.710000	9.300000e-01	7.700000e-01	0.840000	0.852419	0.840000	0.840000																										0				32						c.(796-798)Gag>Aag		nuclear factor related to kappaB binding protein							334.0	275.0	295.0					11																	129753985		2201	4297	6498	SO:0001583	missense	4798	4	121412	38				g.chr11:129753985C>T		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.796G>A	chr11.hg19:g.129753985C>T	ENSP00000400476:p.Glu266Lys	0					NFRKB_ENST00000524746.1_Missense_Mutation_p.E266K|NFRKB_ENST00000524794.1_Missense_Mutation_p.E291K|NFRKB_ENST00000304521.5_Missense_Mutation_p.E266K	p.E266K	NM_001143835.1	NP_001137307.1	1	2	3	2.125324	Q6P4R8	NFRKB_HUMAN		7	899	-	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	1	1	hg19	c.796G>A	CCDS44770.1	0	.	.	.	.	.	.	.	.	.	.	C	18.24	3.579891	0.65992	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755	.	.	.	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.65893	0.2735	N	0.24115	0.695	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.986;0.981;0.992;0.994	T	0.60652	-0.7221	9	0.28530	T	0.3	-28.5975	20.6439	0.99570	0.0:1.0:0.0:0.0	.	278;266;266;291	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	K	266;266;291;266;278	.	ENSP00000303800:E266K	E	-	1	0	0	NFRKB	129259195	129259195	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.899000	0.69846	2.884000	0.98904	0.655000	0.94253	GAG	0.358974		TCGA-M8-A5N4-01A-11D-A26I-08	0.473	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	0	0	1	2	27	2	2	1	1	1	1	110	110	110	110	1	1.800000	-3.221886	1	0.350000	NM_006165		0	139	138	0	820	814	1		1	1		1	0	110	0	0	1.000000	5.382828e-01	0	6	0	6	0	139	820
ABCC9	10060	broad.mit.edu	37	12	21968727	21968727	+	Silent	SNP	G	G	A	rs377704379		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr12:21968727G>A	ENST00000261201.4	-	32	3992	c.3993C>T	c.(3991-3993)caC>caT	p.H1331H	ABCC9_ENST00000261200.4_Silent_p.H1331H|ABCC9_ENST00000345162.2_Silent_p.H1295H	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1331	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AAGCCTTGACGTGCTTAAGAA	0.383																																						ENST00000261201.4	0.580000	0.310000	5.100000e-01	3.700000e-01	0.430000	0.447949	0.430000	0.440000																										0				118						c.(3991-3993)caC>caT		ATP-binding cassette, sub-family C (CFTR/MRP), member 9	Adenosine triphosphate(DB00171)|Glyburide(DB01016)	G	,	0,4406		0,0,2203	164.0	150.0	155.0		3993,3993	0.2	1.0	12		155	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ABCC9	NM_005691.2,NM_020297.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	1331/1550,1331/1550	21968727	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10060	3	121408	38				g.chr12:21968727G>A	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3993C>T	chr12.hg19:g.21968727G>A		0					ABCC9_ENST00000345162.2_Silent_p.H1295H|ABCC9_ENST00000261200.4_Silent_p.H1331H	p.H1331H	NM_005691.2	NP_005682.2	0	1	1	1.984529	O60706	ABCC9_HUMAN		32	3992	-			O60707	Silent	SNP	ENST00000261201.4	1	1	hg19	c.3993C>T	CCDS8694.1	0																																																																																								0.302388		TCGA-M8-A5N4-01A-11D-A26I-08	0.383	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.800000	-20.000000	1	0.350000	NM_005691		0	40	40	0	443	439	0		1	0		0	0	36	0	0	1.000000	6.100583e-02	0	0	0	5	0	40	443
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.820000	0.210000	6.400000e-01	3.200000e-01	0.460000	0.487007	0.460000	0.440000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	1	1	1.984529	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.302388		TCGA-M8-A5N4-01A-11D-A26I-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	1.800000	-5.741535	1	0.350000	NM_033360		2198	7	7	5828	76	76	0	1	1	1	1	0	0	11	329	1	0.982149	2.400146e-01	9.999931e-01	4	60	6	323	7	76
FZD10	11211	broad.mit.edu	37	12	130648005	130648005	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr12:130648005G>A	ENST00000229030.4	+	1	1002	c.518G>A	c.(517-519)cGg>cAg	p.R173Q	FZD10_ENST00000539839.1_Silent_p.A140A|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	173					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CGGCCGCAGCGGCCCCACAGC	0.726																																						ENST00000229030.4	0.600000	0.270000	5.200000e-01	3.400000e-01	0.420000	0.434340	0.420000	0.420000																										0				35						c.(517-519)cGg>cAg		frizzled class receptor 10							14.0	18.0	17.0					12																	130648005		2063	4026	6089	SO:0001583	missense	11211	1	118772	31				g.chr12:130648005G>A	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.518G>A	chr12.hg19:g.130648005G>A	ENSP00000229030:p.Arg173Gln	0					FZD10_ENST00000539839.1_Silent_p.A140A|FZD10-AS1_ENST00000505807.2_RNA	p.R173Q			0	1	1	1.984785	Q9ULW2	FZD10_HUMAN		1	1002	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Missense_Mutation	SNP	ENST00000229030.4	1	1	hg19	c.518G>A	CCDS9267.1	0	.	.	.	.	.	.	.	.	.	.	G	8.719	0.913863	0.17907	.	.	ENSG00000111432	ENST00000229030	T	0.76060	-0.99	4.94	4.05	0.47172	4.94	4.05	0.47172	.	0.386985	0.19916	U	0.103198	T	0.58552	0.2130	N	0.21448	0.665	0.47698	D	0.99949	B	0.17852	0.024	B	0.06405	0.002	T	0.50127	-0.8864	10	0.13470	T	0.59	.	13.0224	0.58796	0.0791:0.0:0.9209:0.0	.	173	Q9ULW2	FZD10_HUMAN	Q	173	ENSP00000229030:R173Q	ENSP00000229030:R173Q	R	+	2	0	0	FZD10	129213958	129213958	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	4.087000	0.57671	1.060000	0.40578	0.491000	0.48974	CGG	0.304999		TCGA-M8-A5N4-01A-11D-A26I-08	0.726	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	33	33	33	10	1	1.800000	-20.000000	1	0.350000			0	23	16	0	268	158	0		1			0	0	33	0	0	0.999903	0	0	0	0	0	0	23	268
LRP10	26020	broad.mit.edu	37	14	23346384	23346384	+	Missense_Mutation	SNP	G	G	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr14:23346384G>T	ENST00000359591.4	+	7	2481	c.1790G>T	c.(1789-1791)gGt>gTt	p.G597V	LRP10_ENST00000546834.1_Intron|LRP10_ENST00000470660.1_Intron	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	597					endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		GGTGGCACAGGTCCAGCCCGT	0.672																																						ENST00000359591.4	1.000000	0.900000	1	9.900000e-01	0.990000	0.992960	0.990000	1.000000																										0				32						c.(1789-1791)gGt>gTt		low density lipoprotein receptor-related protein 10							31.0	38.0	36.0					14																	23346384		2201	4296	6497	SO:0001583	missense	26020	0	0					g.chr14:23346384G>T	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.1790G>T	chr14.hg19:g.23346384G>T	ENSP00000352601:p.Gly597Val	0					LRP10_ENST00000546834.1_Intron|LRP10_ENST00000470660.1_Intron	p.G597V	NM_014045.3	NP_054764.2	1	2	3	2.087478	Q7Z4F1	LRP10_HUMAN		7	2481	+	all_cancers(95;4.69e-05)		A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	1	1	hg19	c.1790G>T	CCDS9578.1	1	.	.	.	.	.	.	.	.	.	.	G	6.223	0.409237	0.11812	.	.	ENSG00000197324	ENST00000359591	D	0.93019	-3.15	4.9	4.0	0.46444	4.9	4.0	0.46444	.	0.526557	0.20965	N	0.082496	D	0.89708	0.6793	L	0.44542	1.39	0.09310	N	0.99999	B	0.32968	0.392	B	0.37387	0.248	T	0.83140	-0.0109	10	0.51188	T	0.08	-4.5206	7.5525	0.27806	0.1908:0.0:0.8092:0.0	.	597	Q7Z4F1	LRP10_HUMAN	V	597	ENSP00000352601:G597V	ENSP00000352601:G597V	G	+	2	0	0	LRP10	22416224	22416224	0.000000	0.05858	0.057000	0.19452	0.102000	0.19082	0.245000	0.18142	1.418000	0.47098	0.462000	0.41574	GGT	0.352267		TCGA-M8-A5N4-01A-11D-A26I-08	0.672	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.800000	-20.000000	1	0.350000			0	78	77	0	321	314	1		1	1		0	0	58	0	0	1.000000	1	0	210	0	343	0	78	321
TTBK2	146057	broad.mit.edu	37	15	43044234	43044234	+	Silent	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr15:43044234C>T	ENST00000267890.6	-	14	3318	c.3210G>A	c.(3208-3210)tcG>tcA	p.S1070S		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	1070					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		AGAACTGAGACGAAGTTGAGC	0.493																																						ENST00000267890.6	1.000000	0.770000	9.700000e-01	8.400000e-01	0.910000	0.909975	0.910000	0.930000																										0				43						c.(3208-3210)tcG>tcA		tau tubulin kinase 2							175.0	184.0	181.0					15																	43044234		2012	4173	6185	SO:0001819	synonymous_variant	146057	1	120934	31				g.chr15:43044234C>T	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.3210G>A	chr15.hg19:g.43044234C>T		1						p.S1070S	NM_173500.3	NP_775771.3	0	1	1	1.755898	Q6IQ55	TTBK2_HUMAN		14	3318	-		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)	O94932|Q6ZN52|Q8IVV1	Silent	SNP	ENST00000267890.6	1	1	hg19	c.3210G>A	CCDS42029.1	1																																																																																								0.213789		TCGA-M8-A5N4-01A-11D-A26I-08	0.493	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	1	0	1	2	2	2	2	0	0	0	0	87	87	87	86	1	1.800000	-20.000000	1	0.350000	NM_173500		0	117	117	0	476	475	1		1		0	0	0	87	0	0	1.000000	0	0	0	0	0	1	117	476
TAOK2	9344	broad.mit.edu	37	16	29990391	29990391	+	Splice_Site	SNP	G	G	C			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr16:29990391G>C	ENST00000308893.4	+	6	1492	c.449G>C	c.(448-450)aGg>aCg	p.R150T	TAOK2_ENST00000279394.3_Splice_Site_p.R150T|TAOK2_ENST00000543033.1_Splice_Site_p.R150T|TAOK2_ENST00000416441.2_5'Flank	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						ATGATCCATAGGTACAAGCAG	0.582																																						ENST00000308893.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999676	0.990000	1.000000																										0				22						c.(448-450)aGg>aCg		TAO kinase 2							75.0	72.0	73.0					16																	29990391		2197	4300	6497	SO:0001630	splice_region_variant	9344	0	0					g.chr16:29990391G>C	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.449+1G>C	chr16.hg19:g.29990391G>C		0					TAOK2_ENST00000543033.1_Splice_Site_p.R150T|TAOK2_ENST00000279394.3_Splice_Site_p.R150T|TAOK2_ENST00000416441.2_5'Flank	p.R150T	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	1	2	3	2.122472	Q9UL54	TAOK2_HUMAN		6	1492	+			A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Splice_Site	SNP	ENST00000308893.4	1	0	hg19	c.449G>C	CCDS10663.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991107	0.74703	.	.	ENSG00000149930	ENST00000416441;ENST00000308893;ENST00000543033;ENST00000279394	T;T;T	0.48836	0.8;0.8;0.8	5.43	5.43	0.79202	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80849	0.4702	H	0.97315	3.98	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.87449	0.2400	9	.	.	.	.	18.3871	0.90470	0.0:0.0:1.0:0.0	.	334;150;150;150	Q86V37;Q9UL54-2;A0PJ48;Q9UL54	.;.;.;TAOK2_HUMAN	T	150	ENSP00000310094:R150T;ENSP00000440336:R150T;ENSP00000279394:R150T	.	R	+	2	0	0	TAOK2	29897892	29897892	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	9.813000	0.99286	2.708000	0.92522	0.467000	0.42956	AGG	0.358974		TCGA-M8-A5N4-01A-11D-A26I-08	0.582	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.800000	-3.866522	1	0.350000	NM_016151	Missense_Mutation	0	123	123	0	466	463	1		1	1	0	0	0	66	0	0	1.000000	9.967126e-01	0	8	0	27	1	123	466
HPR	3250	broad.mit.edu	37	16	72110604	72110604	+	Missense_Mutation	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr16:72110604C>T	ENST00000540303.2	+	5	703	c.671C>T	c.(670-672)tCt>tTt	p.S224F	HPR_ENST00000356967.5_Missense_Mutation_p.S224F|HPR_ENST00000228226.8_Missense_Mutation_p.S261F|HPR_ENST00000561690.1_Intron	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	224	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				GGTTACGTGTCTGGCTGGGGA	0.453																																						ENST00000540303.2	1.000000	0.740000	1	8.200000e-01	0.900000	0.906899	0.900000	1.000000																										0				20						c.(670-672)tCt>tTt		haptoglobin-related protein							188.0	138.0	155.0					16																	72110604		2060	4186	6246	SO:0001583	missense	3250	0	0					g.chr16:72110604C>T	BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.671C>T	chr16.hg19:g.72110604C>T	ENSP00000441828:p.Ser224Phe	0					HPR_ENST00000228226.8_Missense_Mutation_p.S261F|HPR_ENST00000561690.1_Intron|HPR_ENST00000356967.5_Missense_Mutation_p.S224F	p.S224F	NM_020995.3	NP_066275.3	1	2	3	2.122472	P00739	HPTR_HUMAN		5	703	+		Ovarian(137;0.125)	Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	ENST00000540303.2	1	1	hg19	c.671C>T	CCDS42193.1	1	.	.	.	.	.	.	.	.	.	.	.	11.02	1.515799	0.27123	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	D;D;D	0.93811	-3.29;-3.29;-3.29	2.5	2.5	0.30297	2.5	2.5	0.30297	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.068951	0.64402	D	0.000013	D	0.96676	0.8915	M	0.92122	3.275	0.37659	D	0.922709	D	0.76494	0.999	D	0.78314	0.991	D	0.96891	0.9653	10	0.87932	D	0	.	8.5567	0.33485	0.0:0.76:0.24:0.0	.	224	P00739	HPTR_HUMAN	F	224;224;261	ENSP00000349451:S224F;ENSP00000441828:S224F;ENSP00000228226:S261F	ENSP00000228226:S261F	S	+	2	0	0	HP	70668105	70668105	0.998000	0.40836	0.906000	0.35671	0.026000	0.11368	3.369000	0.52365	1.386000	0.46466	0.205000	0.17691	TCT	0.358974		TCGA-M8-A5N4-01A-11D-A26I-08	0.453	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421696.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.800000	-20.000000	1	0.350000	NM_020995		0	96	95	0	520	513	1		1			0	0	66	0	0	1.000000	0	0	0	0	0	0	96	520
TP53	7157	broad.mit.edu	37	17	7577118	7577118	+	Missense_Mutation	SNP	C	C	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr17:7577118C>A	ENST00000269305.4	-	8	1009	c.820G>T	c.(820-822)Gtt>Ttt	p.V274F	TP53_ENST00000445888.2_Missense_Mutation_p.V274F|TP53_ENST00000420246.2_Missense_Mutation_p.V274F|TP53_ENST00000359597.4_Missense_Mutation_p.V274F|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.V274F|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	274	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V274F(21)|p.V274L(11)|p.0?(8)|p.V274I(4)|p.?(2)|p.R273_C275delRVC(1)|p.V274fs*71(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V274_P278del(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGCACAAACACGCACCTCA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.690000	9.800000e-01	8.000000e-01	0.900000	0.893673	0.900000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		54	Substitution - Missense(36)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Unknown(2)	p.V274F(21)|p.V274L(11)|p.0?(8)|p.V274I(4)|p.?(2)|p.R273_C275delRVC(1)|p.V274fs*71(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V274_P278del(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.V272_K292del21(1)	large_intestine(9)|breast(7)|upper_aerodigestive_tract(6)|ovary(4)|prostate(4)|bone(4)|central_nervous_system(3)|urinary_tract(3)|lung(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|skin(2)|adrenal_gland(1)|stomach(1)|soft_tissue(1)|liver(1)	24185						c.(820-822)Gtt>Ttt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						69.0	60.0	63.0					17																	7577118		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577118C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.820G>T	chr17.hg19:g.7577118C>A	ENSP00000269305:p.Val274Phe	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.V274F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V274F|TP53_ENST00000420246.2_Missense_Mutation_p.V274F|TP53_ENST00000359597.4_Missense_Mutation_p.V274F|TP53_ENST00000413465.2_Intron	p.V274F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.760334	P04637	P53_HUMAN		8	1009	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.820G>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201113	0.38905	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99832	-7.02;-7.02;-7.02;-7.02;-7.02;-7.02	4.92	-0.763	0.11030	4.92	-0.763	0.11030	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.312804	0.33382	N	0.004980	D	0.99670	0.9877	M	0.87456	2.885	0.38916	D	0.957632	B;D;B;B	0.56746	0.434;0.977;0.209;0.125	B;P;P;B	0.61477	0.373;0.889;0.561;0.389	D	0.99218	1.0878	10	0.87932	D	0	-10.2267	9.2232	0.37390	0.0:0.5803:0.0:0.4197	.	274;274;274;274	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	F	274;274;274;274;274;263;142	ENSP00000352610:V274F;ENSP00000269305:V274F;ENSP00000398846:V274F;ENSP00000391127:V274F;ENSP00000391478:V274F;ENSP00000425104:V142F	ENSP00000269305:V274F	V	-	1	0	0	TP53	7517843	7517843	0.002000	0.14202	0.148000	0.22405	0.724000	0.41520	-0.002000	0.12924	-0.004000	0.14419	0.462000	0.41574	GTT	0.213789		TCGA-M8-A5N4-01A-11D-A26I-08	0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.800000	-20.000000	1	0.350000	NM_000546		0	34	34	0	125	123	0		1	1	1	0	0	20	1031	0	1.000000	9.999343e-01	1	29	184	30	777	34	125
RASL10B	91608	broad.mit.edu	37	17	34062239	34062239	+	Silent	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr17:34062239G>A	ENST00000268864.3	+	2	413	c.36G>A	c.(34-36)gcG>gcA	p.A12A		NM_033315.3	NP_201572.1	Q96S79	RSLAB_HUMAN	RAS-like, family 10, member B	12	Small GTPase-like.				GTP catabolic process (GO:0006184)|positive regulation of peptide hormone secretion (GO:0090277)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|endometrium(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGCTGGGGGCGCGAGGTGTGG	0.682																																						ENST00000268864.3	1.000000	0.780000	1	8.900000e-01	0.990000	0.960288	0.990000	1.000000																										0				10						c.(34-36)gcG>gcA		RAS-like, family 10, member B							63.0	61.0	62.0					17																	34062239		2202	4300	6502	SO:0001819	synonymous_variant	91608	5	121402	36				g.chr17:34062239G>A	BC041133	CCDS11297.1	17q21.1	2014-05-09			ENSG00000141150	ENSG00000270885			30295	protein-coding gene	gene with protein product		612128				12477932	Standard	NM_033315		Approved	VTS58635, RRP17	uc002hju.3	Q96S79	OTTHUMG00000188385	ENST00000268864.3:c.36G>A	chr17.hg19:g.34062239G>A		0						p.A12A	NM_033315.3	NP_201572.1	1	2	3	2.093291	Q96S79	RSLAB_HUMAN		2	413	+			B3KV31	Silent	SNP	ENST00000268864.3	1	1	hg19	c.36G>A	CCDS11297.1	1																																																																																								0.354518		TCGA-M8-A5N4-01A-11D-A26I-08	0.682	RASL10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256498.2	1	0	1	2	2	2	2	0	0	0	0	52	52	52	50	1	1.800000	-3.387782	1	0.350000	NM_033315		0	56	56	0	263	260	1		1	0		0	0	52	0	0	1.000000	2.184153e-01	0	0	0	5	0	56	263
OR7D4	125958	broad.mit.edu	37	19	9325150	9325150	+	Missense_Mutation	SNP	G	G	A	rs552376975		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr19:9325150G>A	ENST00000308682.2	-	1	392	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						GCCACAAACCGGTCATAGGCC	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		20891	0.0		0.0	False		,,,				2504	0.001					ENST00000308682.2	1.000000	0.690000	9.700000e-01	7.700000e-01	0.870000	0.875693	0.870000	1.000000																										0				26						c.(364-366)Cgg>Tgg		olfactory receptor, family 7, subfamily D, member 4							87.0	79.0	82.0					19																	9325150		2203	4300	6503	SO:0001583	missense	125958	17	121412	45				g.chr19:9325150G>A		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.364C>T	chr19.hg19:g.9325150G>A	ENSP00000310488:p.Arg122Trp	0						p.R122W	NM_001005191.2	NP_001005191.1	0	1	1	1.973323	Q8NG98	OR7D4_HUMAN		1	392	-			A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	1	1	hg19	c.364C>T	CCDS32901.1	1	.	.	.	.	.	.	.	.	.	.	G	9.590	1.125799	0.20959	.	.	ENSG00000174667	ENST00000308682	T	0.77620	-1.11	4.0	0.493	0.16878	4.0	0.493	0.16878	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000036	T	0.81240	0.4781	H	0.97390	3.995	0.33784	D	0.62468	B	0.22211	0.066	B	0.08055	0.003	T	0.78301	-0.2257	10	0.87932	D	0	.	5.4796	0.16717	0.1815:0.0:0.6597:0.1588	.	122	Q8NG98	OR7D4_HUMAN	W	122	ENSP00000310488:R122W	ENSP00000310488:R122W	R	-	1	2	2	OR7D4	9186150	9186150	0.375000	0.25089	0.907000	0.35723	0.323000	0.28346	0.213000	0.17521	0.107000	0.17824	-0.436000	0.05848	CGG	0.312715		TCGA-M8-A5N4-01A-11D-A26I-08	0.502	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	1.800000	-3.233492	1	0.350000			0	69	68	0	356	353	1		1			0	0	57	0	0	1.000000	0	0	0	0	0	0	69	356
SIPA1L3	23094	broad.mit.edu	37	19	38631993	38631993	+	Missense_Mutation	SNP	G	G	A	rs373059257		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr19:38631993G>A	ENST00000222345.6	+	11	3822	c.3313G>A	c.(3313-3315)Ggc>Agc	p.G1105S		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1105					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AACCACTCCCGGCCATGCCCA	0.677																																						ENST00000222345.6	0.510000	0.300000	4.600000e-01	3.400000e-01	0.390000	0.406280	0.390000	0.400000																										0				59						c.(3313-3315)Ggc>Agc		signal-induced proliferation-associated 1 like 3		G	SER/GLY	0,4406		0,0,2203	52.0	59.0	57.0		3313	4.5	0.9	19		57	1,8599	1.2+/-3.3	0,1,4299	no	missense	SIPA1L3	NM_015073.1	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1105/1782	38631993	1,13005	2203	4300	6503	SO:0001583	missense	23094	1	121410	39				g.chr19:38631993G>A	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3313G>A	chr19.hg19:g.38631993G>A	ENSP00000222345:p.Gly1105Ser	0						p.G1105S	NM_015073.1	NP_055888.1	0	1	1	1.973323	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)	11	3822	+			Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	1	1	hg19	c.3313G>A	CCDS33007.1	0	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693622	0.48202	0.0	1.16E-4	ENSG00000105738	ENST00000222345	T	0.75821	-0.97	4.47	4.47	0.54385	4.47	4.47	0.54385	.	0.357974	0.27971	N	0.017118	T	0.60856	0.2301	L	0.40543	1.245	0.42698	D	0.993608	P	0.44776	0.843	B	0.30855	0.121	T	0.64643	-0.6359	10	0.28530	T	0.3	-39.7275	16.0823	0.81012	0.0:0.0:1.0:0.0	.	1105	O60292	SI1L3_HUMAN	S	1105	ENSP00000222345:G1105S	ENSP00000222345:G1105S	G	+	1	0	0	SIPA1L3	43323833	43323833	0.984000	0.35163	0.921000	0.36526	0.306000	0.27790	1.874000	0.39568	2.326000	0.78906	0.460000	0.39030	GGC	0.312715		TCGA-M8-A5N4-01A-11D-A26I-08	0.677	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	107	1	1.800000	-3.017764	1	0.350000	XM_032278		0	56	55	0	698	680	1		1	1		0	0	109	0	0	1.000000	8.916491e-01	0	8	0	42	0	56	698
PRAMEF1	65121	broad.mit.edu	37	1	12854372	12854372	+	Missense_Mutation	SNP	T	T	C			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr1:12854372T>C	ENST00000332296.7	+	3	699	c.596T>C	c.(595-597)tTg>tCg	p.L199S	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	199					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAAGTCATTGAAAATAATA	0.403																																						ENST00000332296.7			0	0																														0				35						c.(595-597)tTg>tCg		PRAME family member 1							266.0	266.0	266.0					1																	12854372		2203	4300	6503	SO:0001583	missense	65121	0	0					g.chr1:12854372T>C	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.596T>C	chr1.hg19:g.12854372T>C	ENSP00000332134:p.Leu199Ser						PRAMEF1_ENST00000400814.3_5'Flank	p.L199S	NM_023013.2	NP_075389.1					O95521	PRAM1_HUMAN		3	699	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	1	1	hg19	c.596T>C	CCDS148.1		.	.	.	.	.	.	.	.	.	.	.	10.22	1.290503	0.23478	.	.	ENSG00000116721	ENST00000332296	T	0.01304	5.03	1.74	-0.699	0.11277	1.74	-0.699	0.11277	.	0.103357	0.40385	N	0.001104	T	0.06462	0.0166	M	0.86651	2.83	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.11817	-1.0572	10	0.66056	D	0.02	.	4.2602	0.10737	0.0:0.4723:0.0:0.5277	.	199	O95521	PRAM1_HUMAN	S	199	ENSP00000332134:L199S	ENSP00000332134:L199S	L	+	2	0	0	PRAMEF1	12776959	12776959	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.259000	0.18405	-0.203000	0.10251	-0.451000	0.05528	TTG			TCGA-M8-A5N4-01A-11D-A26I-08	0.403	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	1	0	1	2	2	2	2	0	0	0	0	310	310	310	433	1	1.800000	-20.000000	1	0.350000	NM_023013		0	203	178	0	2943	2497	0		1			0	0	310	0	0	1.000000	0	0	0	0	0	0	203	2943
SPEN	23013	broad.mit.edu	37	1	16264319	16264319	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr1:16264319G>A	ENST00000375759.3	+	13	10726	c.10522G>A	c.(10522-10524)Gtg>Atg	p.V3508M		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3508	SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GTACCCCATCGTGTGGCAGGG	0.597																																						ENST00000375759.3	1.000000	0.820000	1	8.900000e-01	0.960000	0.956317	0.960000	1.000000																										0				149						c.(10522-10524)Gtg>Atg		spen family transcriptional repressor							107.0	108.0	108.0					1																	16264319		2203	4300	6503	SO:0001583	missense	23013	0	0					g.chr1:16264319G>A		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10522G>A	chr1.hg19:g.16264319G>A	ENSP00000364912:p.Val3508Met	0						p.V3508M	NM_015001.2	NP_055816.2	0	0	0	1.998920	Q96T58	MINT_HUMAN		13	10726	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	1	1	hg19	c.10522G>A	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323605	0.60634	.	.	ENSG00000065526	ENST00000375759	T	0.08896	3.04	5.71	5.71	0.89125	5.71	5.71	0.89125	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);Spen paralogue/orthologue C-terminal, metazoa (1);	.	.	.	.	T	0.05823	0.0152	N	0.11560	0.145	0.53688	D	0.999972	P	0.44380	0.834	B	0.35655	0.207	T	0.47774	-0.9091	9	0.37606	T	0.19	-13.6961	19.8449	0.96704	0.0:0.0:1.0:0.0	.	3508	Q96T58	MINT_HUMAN	M	3508	ENSP00000364912:V3508M	ENSP00000364912:V3508M	V	+	1	0	0	SPEN	16136906	16136906	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.544000	0.82117	2.680000	0.91292	0.655000	0.94253	GTG	0.323973		TCGA-M8-A5N4-01A-11D-A26I-08	0.597	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	1	0	1	2	2	2	2	0	0	0	0	121	121	121	115	1	1.800000	-20.000000	1	0.350000	NM_015001		0	131	115	0	607	526	1		1	1		0	0	121	0	0	1.000000	9.992775e-01	0	23	0	28	0	131	607
OR6Y1	391112	broad.mit.edu	37	1	158517227	158517227	+	Silent	SNP	G	G	A	rs537972026		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr1:158517227G>A	ENST00000302617.3	-	1	668	c.669C>T	c.(667-669)taC>taT	p.Y223Y		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GGATAGCAGCGTAGGATGCCA	0.537																																						ENST00000302617.3	1.000000	0.620000	9.400000e-01	7.100000e-01	0.810000	0.824293	0.810000	1.000000																										0				30						c.(667-669)taC>taT		olfactory receptor, family 6, subfamily Y, member 1							115.0	109.0	111.0					1																	158517227		2202	4300	6502	SO:0001819	synonymous_variant	391112	9	121402	39				g.chr1:158517227G>A	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.669C>T	chr1.hg19:g.158517227G>A		0						p.Y223Y	NM_001005189.1	NP_001005189.1	1	2	3	2.126262	Q8NGX8	OR6Y1_HUMAN		1	668	-	all_hematologic(112;0.0378)		Q6IFS0	Silent	SNP	ENST00000302617.3	1	1	hg19	c.669C>T	CCDS30899.1	0																																																																																								0.358974		TCGA-M8-A5N4-01A-11D-A26I-08	0.537	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.800000	-3.319188	1	0.350000	NM_001005189		0	56	56	0	346	341	1		1			0	0	52	0	0	1.000000	0	0	0	0	0	0	56	346
PROX1	5629	broad.mit.edu	37	1	214170479	214170479	+	Nonsense_Mutation	SNP	C	C	T	rs200548077		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr1:214170479C>T	ENST00000366958.4	+	2	1209	c.601C>T	c.(601-603)Cga>Tga	p.R201*	PROX1_ENST00000435016.1_Nonsense_Mutation_p.R201*|PROX1_ENST00000498508.2_Nonsense_Mutation_p.R201*|PROX1_ENST00000261454.4_Nonsense_Mutation_p.R201*	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	201					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TGTGAGTCCCCGAGAAAGTTA	0.502																																						ENST00000366958.4	1.000000	0.080000	2.300000e-01	1.100000e-01	0.160000	0.226577	0.160000	0.150000																										0				47						c.(601-603)Cga>Tga		prospero homeobox 1							44.0	49.0	47.0					1																	214170479		2203	4300	6503	SO:0001587	stop_gained	5629	0	0					g.chr1:214170479C>T	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.601C>T	chr1.hg19:g.214170479C>T	ENSP00000355925:p.Arg201*	0					PROX1_ENST00000261454.4_Nonsense_Mutation_p.R201*|PROX1_ENST00000435016.1_Nonsense_Mutation_p.R201*|PROX1_ENST00000498508.2_Nonsense_Mutation_p.R201*	p.R201*	NM_001270616.1	NP_001257545.1	1	2	3	2.132000	Q92786	PROX1_HUMAN		2	1209	+			A6NK29|A8K2B1|Q5SW76|Q8TB91	Nonsense_Mutation	SNP	ENST00000366958.4	0	1	hg19	c.601C>T	CCDS31021.1	0	.	.	.	.	.	.	.	.	.	.	C	43	10.327939	0.99384	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	.	.	.	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.062767	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-1.8463	15.3849	0.74691	0.1393:0.8607:0.0:0.0	.	.	.	.	X	201	.	ENSP00000261454:R201X	R	+	1	2	2	PROX1	212237102	212237102	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.382000	0.44345	2.885000	0.99019	0.655000	0.94253	CGA	0.360079		TCGA-M8-A5N4-01A-11D-A26I-08	0.502	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	0	0	1	2	2	2	2	0	0	0	0	44	44	44	43	1	1.800000	-2.847615	1	0.350000	NM_002763		0	11	11	0	405	402	0		1			0	0	44	0	0	0.998314	0	0	0	0	0	0	11	405
OBSCN	84033	broad.mit.edu	37	1	228475547	228475547	+	Missense_Mutation	SNP	C	C	T	rs367605500		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr1:228475547C>T	ENST00000422127.1	+	36	9741	c.9697C>T	c.(9697-9699)Cgc>Tgc	p.R3233C	OBSCN_ENST00000366709.4_Missense_Mutation_p.R352C|OBSCN_ENST00000366707.4_Missense_Mutation_p.R352C|OBSCN_ENST00000359599.6_Missense_Mutation_p.R2080C|OBSCN_ENST00000284548.11_Missense_Mutation_p.R3233C|OBSCN_ENST00000570156.2_Missense_Mutation_p.R3662C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3233	Ig-like 32.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ATACAGCCTACGCCAGGAGGG	0.622																																						ENST00000422127.1	1.000000	0.310000	5.900000e-01	3.900000e-01	0.470000	0.513894	0.470000	0.460000																										0				223						c.(9697-9699)Cgc>Tgc		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF		C	CYS/ARG,CYS/ARG	2,4294		0,2,2146	79.0	87.0	84.0		9697,9697	4.2	1.0	1		84	0,8494		0,0,4247	no	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	180,180	0,2,6393	TT,TC,CC		0.0,0.0466,0.0156	probably-damaging,probably-damaging	3233/7969,3233/6621	228475547	2,12788	2148	4247	6395	SO:0001583	missense	84033	3	121188	42				g.chr1:228475547C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9697C>T	chr1.hg19:g.228475547C>T	ENSP00000409493:p.Arg3233Cys	0					OBSCN_ENST00000284548.11_Missense_Mutation_p.R3233C|OBSCN_ENST00000366707.4_Missense_Mutation_p.R352C|OBSCN_ENST00000570156.2_Missense_Mutation_p.R3662C|OBSCN_ENST00000359599.6_Missense_Mutation_p.R2080C|OBSCN_ENST00000366709.4_Missense_Mutation_p.R352C	p.R3233C	NM_001098623.2	NP_001092093.2	1	2	3	2.133881	Q5VST9	OBSCN_HUMAN		36	9741	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	0	1	hg19	c.9697C>T	CCDS58065.1	0	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875638	0.51695	4.66E-4	0.0	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.06	4.15	0.48705	5.06	4.15	0.48705	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.075114	0.48286	N	0.000199	T	0.79511	0.4458	M	0.89095	3.005	0.41537	D	0.988493	D;D	0.89917	1.0;1.0	D;P	0.72625	0.978;0.886	T	0.77958	-0.2392	10	0.37606	T	0.19	.	3.8297	0.08868	0.2637:0.5173:0.136:0.0829	.	3233;3233	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	C	3233;3233;352;352;2080	ENSP00000284548:R3233C;ENSP00000409493:R3233C;ENSP00000355668:R352C;ENSP00000355670:R352C;ENSP00000352613:R2080C	ENSP00000284548:R3233C	R	+	1	0	0	OBSCN	226542170	226542170	0.059000	0.20769	0.965000	0.40720	0.044000	0.14063	1.922000	0.40045	1.136000	0.42199	0.561000	0.74099	CGC	0.360079		TCGA-M8-A5N4-01A-11D-A26I-08	0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	18	2	2	1	1	1	1	63	63	63	62	1	1.800000	-20.000000	1	0.350000	NM_052843		0	28	28	0	322	319	0		1	1		1	0	63	0	0	0.948727	5.796282e-02	0	2	0	3	0	28	322
FERMT1	55612	broad.mit.edu	37	20	6078257	6078257	+	Missense_Mutation	SNP	G	G	C			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr20:6078257G>C	ENST00000217289.4	-	7	1659	c.871C>G	c.(871-873)Caa>Gaa	p.Q291E	FERMT1_ENST00000536936.1_Missense_Mutation_p.Q34E	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	291	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						TCATAGAGTTGGTTTATTCGG	0.403																																						ENST00000217289.4	0.960000	0.670000	9.000000e-01	7.400000e-01	0.810000	0.822817	0.810000	0.820000																										0				17						c.(871-873)Caa>Gaa		fermitin family member 1							143.0	135.0	138.0					20																	6078257		2203	4300	6503	SO:0001583	missense	55612	0	0					g.chr20:6078257G>C	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.871C>G	chr20.hg19:g.6078257G>C	ENSP00000217289:p.Gln291Glu	1					FERMT1_ENST00000536936.1_Missense_Mutation_p.Q34E	p.Q291E	NM_017671.4	NP_060141.3	0	1	1	1.748781	Q9BQL6	FERM1_HUMAN		7	1659	-			D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	1	1	hg19	c.871C>G	CCDS13098.1	0	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883375	0.91740	.	.	ENSG00000101311	ENST00000217289;ENST00000536936;ENST00000339538	T;T	0.80304	-1.36;-1.36	5.64	5.64	0.86602	5.64	5.64	0.86602	Band 4.1 domain (1);FERM central domain (2);	0.000000	0.85682	D	0.000000	D	0.90865	0.7130	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.988;0.994;0.999	D	0.91498	0.5217	10	0.72032	D	0.01	-13.9011	19.3066	0.94165	0.0:0.0:1.0:0.0	.	291;291;291	B2RAX1;Q9BQL6-4;Q9BQL6	.;.;FERM1_HUMAN	E	291;34;291	ENSP00000217289:Q291E;ENSP00000441063:Q34E	ENSP00000217289:Q291E	Q	-	1	0	0	FERMT1	6026257	6026257	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	9.405000	0.97313	2.673000	0.90976	0.555000	0.69702	CAA	0.215450		TCGA-M8-A5N4-01A-11D-A26I-08	0.403	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.800000	-3.253614	1	0.350000	NM_017671		0	93	91	0	441	439	1		1	1		0	0	50	0	0	1.000000	8.837772e-01	0	20	0	0	0	93	441
RIMS4	140730	broad.mit.edu	37	20	43400046	43400046	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr20:43400046G>A	ENST00000372851.3	-	2	172	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	RIMS4_ENST00000541604.2_Missense_Mutation_p.R37W	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	36					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.R36W(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				TTCAGCCTCCGGCTGTCCCCT	0.622																																						ENST00000372851.3	0.360000	0.160000	3.100000e-01	2.000000e-01	0.250000	0.261543	0.250000	0.250000																										1	Substitution - Missense(1)	p.R36W(1)	ovary(1)	29						c.(106-108)Cgg>Tgg		regulating synaptic membrane exocytosis 4							55.0	55.0	55.0					20																	43400046		2203	4300	6503	SO:0001583	missense	140730	0	0					g.chr20:43400046G>A		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.106C>T	chr20.hg19:g.43400046G>A	ENSP00000361942:p.Arg36Trp	0					RIMS4_ENST00000541604.2_Missense_Mutation_p.R37W	p.R36W	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	0	1	1	2.072277	Q9H426	RIMS4_HUMAN		2	172	-		Myeloproliferative disorder(115;0.0122)	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	1	1	hg19	c.106C>T	CCDS13338.1	0	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948065	0.73787	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.25912	1.83;1.77	4.37	4.37	0.52481	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.41673	0.1169	L	0.50333	1.59	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	P;D	0.63793	0.881;0.918	T	0.33929	-0.9849	10	0.87932	D	0	.	13.1683	0.59583	0.0:0.0:0.8396:0.1604	.	37;36	E1P613;Q9H426	.;RIMS4_HUMAN	W	36;37	ENSP00000361942:R36W;ENSP00000439287:R37W	ENSP00000361942:R36W	R	-	1	2	2	RIMS4	42833460	42833460	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	3.390000	0.52523	2.148000	0.66965	0.551000	0.68910	CGG	0.348861		TCGA-M8-A5N4-01A-11D-A26I-08	0.622	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.800000	-3.305778	1	0.350000	NM_182970		0	26	25	0	559	556	0		1			0	0	76	0	0	1.000000	0	0	0	0	0	0	26	559
RFPL3	10738	broad.mit.edu	37	22	32756681	32756681	+	Silent	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr22:32756681C>T	ENST00000249007.4	+	2	1021	c.816C>T	c.(814-816)agC>agT	p.S272S	RFPL3S_ENST00000461833.1_5'UTR|RFPL3_ENST00000382088.3_Silent_p.S243S|RFPL3_ENST00000397468.1_Silent_p.S243S|RFPL3S_ENST00000382084.4_3'UTR|RFPL3S_ENST00000400234.1_3'UTR	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	272	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						CATTCAGGAGCGTCTCTGCTG	0.478																																						ENST00000249007.4	1.000000	0.730000	9.900000e-01	8.100000e-01	0.890000	0.899647	0.890000	1.000000																										0				15						c.(814-816)agC>agT		ret finger protein-like 3							110.0	96.0	101.0					22																	32756681		2203	4300	6503	SO:0001819	synonymous_variant	10738	1	121412	35				g.chr22:32756681C>T	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.816C>T	chr22.hg19:g.32756681C>T		0					RFPL3_ENST00000397468.1_Silent_p.S243S|RFPL3S_ENST00000400234.1_3'UTR|RFPL3S_ENST00000382084.4_3'UTR|RFPL3_ENST00000382088.3_Silent_p.S243S|RFPL3S_ENST00000461833.1_5'UTR	p.S272S	NM_001098535.1	NP_001092005.1	0	1	1	1.950417	O75679	RFPL3_HUMAN		2	1021	+			A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Silent	SNP	ENST00000249007.4	1	1	hg19	c.816C>T	CCDS43011.1	1																																																																																								0.295775		TCGA-M8-A5N4-01A-11D-A26I-08	0.478	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	1	0	1	2	2	2	2	0	0	0	0	36	36	36	37	1	1.800000	-20.000000	1	0.350000	NM_006604		0	92	85	0	445	436	0		1			0	0	36	0	0	1.000000	0	0	0	0	0	0	92	445
ATAD2B	54454	broad.mit.edu	37	2	23977530	23977530	+	Missense_Mutation	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr2:23977530C>T	ENST00000238789.5	-	26	4536	c.4193G>A	c.(4192-4194)cGt>cAt	p.R1398H	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	1398						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAATCTCTCACGATCAACTAT	0.403																																						ENST00000238789.5	0.420000	0.180000	3.600000e-01	2.300000e-01	0.290000	0.302167	0.290000	0.290000																										0				1						c.(4192-4194)cGt>cAt		ATPase family, AAA domain containing 2B							85.0	88.0	87.0					2																	23977530		1860	4089	5949	SO:0001583	missense	54454	0	0					g.chr2:23977530C>T	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.4193G>A	chr2.hg19:g.23977530C>T	ENSP00000238789:p.Arg1398His	1					ATAD2B_ENST00000474583.1_5'UTR	p.R1398H	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	0	1	1	1.746408	Q9ULI0	ATD2B_HUMAN		26	4536	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	1	1	hg19	c.4193G>A	CCDS46227.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.192|5.192	0.221047|0.221047	0.09863|0.09863	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000238789;ENST00000546030|ENST00000381024	D|.	0.90261|.	-2.64|.	5.39|5.39	-4.04|-4.04	0.04010|0.04010	5.39|5.39	-4.04|-4.04	0.04010|0.04010	.|.	0.279593|.	0.29438|.	N|.	0.012153|.	T|T	0.05410|0.05410	0.0143|0.0143	N|N	0.00095|0.00095	-2.16|-2.16	0.22675|0.22675	N|N	0.998867|0.998867	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.45308|0.45308	-0.9270|-0.9270	10|5	0.02654|.	T|.	1|.	.|.	11.5971|11.5971	0.50979|0.50979	0.0:0.4558:0.0:0.5442|0.0:0.4558:0.0:0.5442	.|.	1398;1393|.	Q9ULI0;Q9ULI0-2|.	ATD2B_HUMAN;.|.	H|M	1398;566|674	ENSP00000238789:R1398H|.	ENSP00000238789:R1398H|.	R|V	-|-	2|1	0|0	0|0	ATAD2B|ATAD2B	23831034|23831034	23831034|23831034	0.195000|0.195000	0.23338|0.23338	0.527000|0.527000	0.27925|0.27925	0.987000|0.987000	0.75469|0.75469	-0.109000|-0.109000	0.10840|0.10840	-0.957000|-0.957000	0.03627|0.03627	0.650000|0.650000	0.86243|0.86243	CGT|GTG	0.215450		TCGA-M8-A5N4-01A-11D-A26I-08	0.403	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.800000	-6.279321	1	0.350000	NM_017552		0	21	21	0	318	313	0		1	0		0	0	31	0	0	0.999997	1.340952e-01	0	1	0	9	0	21	318
CCDC85A	114800	broad.mit.edu	37	2	56419682	56419682	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr2:56419682G>A	ENST00000407595.2	+	2	849	c.347G>A	c.(346-348)cGg>cAg	p.R116Q	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	116										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GATGATGACCGGCAGAAAGGC	0.527																																						ENST00000407595.2	0.940000	0.570000	8.500000e-01	6.500000e-01	0.740000	0.758441	0.740000	0.750000																										0				38						c.(346-348)cGg>cAg		coiled-coil domain containing 85A							76.0	83.0	81.0					2																	56419682		1972	4159	6131	SO:0001583	missense	114800	1	120926	33				g.chr2:56419682G>A	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.347G>A	chr2.hg19:g.56419682G>A	ENSP00000384040:p.Arg116Gln	0					RP11-482H16.1_ENST00000607540.1_RNA	p.R116Q	NM_001080433.1	NP_001073902.1	0	1	1	1.992135	Q96PX6	CC85A_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)	2	849	+				Missense_Mutation	SNP	ENST00000407595.2	1	1	hg19	c.347G>A	CCDS46290.1	0	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021809	0.93462	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.051335	0.85682	D	0.000000	D	0.83871	0.5348	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86316	0.1689	9	0.87932	D	0	-27.2196	18.8832	0.92365	0.0:0.0:1.0:0.0	.	116	Q96PX6	CC85A_HUMAN	Q	116	.	ENSP00000384040:R116Q	R	+	2	0	0	CCDC85A	56273186	56273186	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.455000	0.83008	0.655000	0.94253	CGG	0.315249		TCGA-M8-A5N4-01A-11D-A26I-08	0.527	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.800000	-2.642531	1	0.350000			0	54	53	0	335	332	1		1	1		0	0	46	0	0	1.000000	2.009499e-02	0	2	0	0	0	54	335
ZSWIM2	151112	broad.mit.edu	37	2	187698677	187698677	+	Missense_Mutation	SNP	C	C	T	rs200253183	byFrequency	TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr2:187698677C>T	ENST00000295131.2	-	6	863	c.824G>A	c.(823-825)cGt>cAt	p.R275H		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	275					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			CTGTACCTCACGAAATGTAAA	0.363													C|||	2	0.000399361	0.0	0.0029	5008	,	,		18511	0.0		0.0	False		,,,				2504	0.0					ENST00000295131.2	0.780000	0.370000	6.800000e-01	4.500000e-01	0.560000	0.572523	0.560000	0.560000																										0				52						c.(823-825)cGt>cAt		zinc finger, SWIM-type containing 2		C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	123.0	107.0	112.0		824	5.8	1.0	2		112	0,8600		0,0,4300	no	missense	ZSWIM2	NM_182521.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	275/634	187698677	1,13005	2203	4300	6503	SO:0001583	missense	151112	5	121390	39				g.chr2:187698677C>T	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.824G>A	chr2.hg19:g.187698677C>T	ENSP00000295131:p.Arg275His	0						p.R275H	NM_182521.2	NP_872327.2	0	1	1	2.007246	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)	6	863	-			B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	0	1	hg19	c.824G>A	CCDS33348.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	17.35	3.366207	0.61513	2.27E-4	0.0	ENSG00000163012	ENST00000295131	D	0.87650	-2.28	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.000000	0.53938	D	0.000044	D	0.91287	0.7253	L	0.47190	1.495	0.47374	D	0.999403	D	0.89917	1.0	D	0.74023	0.982	D	0.91766	0.5424	10	0.87932	D	0	-19.6714	16.9191	0.86159	0.0:1.0:0.0:0.0	.	275	Q8NEG5	ZSWM2_HUMAN	H	275	ENSP00000295131:R275H	ENSP00000295131:R275H	R	-	2	0	0	ZSWIM2	187406922	187406922	0.998000	0.40836	0.997000	0.53966	0.106000	0.19336	4.940000	0.63533	2.722000	0.93159	0.467000	0.42956	CGT	0.319015		TCGA-M8-A5N4-01A-11D-A26I-08	0.363	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	1.800000	-20.000000	1	0.350000	NM_182521		0	24	24	0	210	210	1		1			0	0	23	0	0	1.000000	0	0	0	0	0	0	24	210
TBCK	93627	broad.mit.edu	37	4	107168383	107168383	+	Missense_Mutation	SNP	G	G	A	rs538717258		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr4:107168383G>A	ENST00000273980.5	-	11	1291	c.844C>T	c.(844-846)Ccc>Tcc	p.P282S	TBCK_ENST00000394708.2_Missense_Mutation_p.P282S|TBCK_ENST00000361687.4_Missense_Mutation_p.P219S|TBCK_ENST00000394706.3_Missense_Mutation_p.P243S|TBCK_ENST00000432496.2_Missense_Mutation_p.P282S					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TTGGTAAAGGGGGTATATAAA	0.378																																						ENST00000273980.5	0.750000	0.400000	6.600000e-01	4.800000e-01	0.560000	0.578910	0.560000	0.570000																										0				25						c.(844-846)Ccc>Tcc		TBC1 domain containing kinase							85.0	90.0	88.0					4																	107168383		2203	4300	6503	SO:0001583	missense	93627	0	0					g.chr4:107168383G>A		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.844C>T	chr4.hg19:g.107168383G>A	ENSP00000273980:p.Pro282Ser	0					TBCK_ENST00000394706.3_Missense_Mutation_p.P243S|TBCK_ENST00000394708.2_Missense_Mutation_p.P282S|TBCK_ENST00000432496.2_Missense_Mutation_p.P282S|TBCK_ENST00000361687.4_Missense_Mutation_p.P219S	p.P282S			0	1	1	1.957095				11	1291	-				Missense_Mutation	SNP	ENST00000273980.5	1	1	hg19	c.844C>T	CCDS54788.1	0	.	.	.	.	.	.	.	.	.	.	G	9.964	1.223662	0.22457	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.08634	3.07;3.07;3.07;3.07;3.07	5.59	3.83	0.44106	5.59	3.83	0.44106	Protein kinase-like domain (1);	0.142749	0.64402	D	0.000004	T	0.08133	0.0203	L	0.54323	1.7	0.43588	D	0.995939	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.13407	0.0;0.009;0.004	T	0.13872	-1.0493	10	0.12766	T	0.61	.	8.6759	0.34179	0.0709:0.0:0.657:0.2721	.	282;243;219	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	S	282;282;219;243;282	ENSP00000273980:P282S;ENSP00000405847:P282S;ENSP00000355338:P219S;ENSP00000378196:P243S;ENSP00000378198:P282S	ENSP00000273980:P282S	P	-	1	0	0	TBCK	107387832	107387832	1.000000	0.71417	0.060000	0.19600	0.300000	0.27592	3.203000	0.51075	1.339000	0.45563	0.563000	0.77884	CCC	0.298435		TCGA-M8-A5N4-01A-11D-A26I-08	0.378	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	1	0	0	2	2	2	2	0	0	0	0	25	25	25	25	1	1.800000	-20.000000	1	0.350000	NM_033115		0	36	35	0	298	289	1		1	0		0	0	25	0	0	1.000000	2.597964e-01	0	0	0	9	0	36	298
CORIN	10699	broad.mit.edu	37	4	47682234	47682234	+	Silent	SNP	G	G	A	rs574925971		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr4:47682234G>A	ENST00000273857.4	-	8	1055	c.1056C>T	c.(1054-1056)gaC>gaT	p.D352D	CORIN_ENST00000504584.1_Intron|CORIN_ENST00000502252.1_Silent_p.D285D|CORIN_ENST00000508498.1_Silent_p.D213D|CORIN_ENST00000505909.1_Intron	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	352	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TGCAGCGCCCGTCCCCGCAGC	0.532																																						ENST00000273857.4	1.000000	0.590000	9.800000e-01	7.100000e-01	0.830000	0.840200	0.830000	1.000000																										0				79						c.(1054-1056)gaC>gaT		corin, serine peptidase							114.0	87.0	96.0					4																	47682234		2203	4300	6503	SO:0001819	synonymous_variant	10699	4	121410	33				g.chr4:47682234G>A	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1056C>T	chr4.hg19:g.47682234G>A		0					CORIN_ENST00000504584.1_Intron|CORIN_ENST00000502252.1_Silent_p.D285D|CORIN_ENST00000508498.1_Silent_p.D213D|CORIN_ENST00000505909.1_Intron	p.D352D	NM_006587.2	NP_006578.2	0	1	1	1.957095	Q9Y5Q5	CORIN_HUMAN		8	1055	-			B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Silent	SNP	ENST00000273857.4	1	1	hg19	c.1056C>T	CCDS3477.1	0																																																																																								0.298435		TCGA-M8-A5N4-01A-11D-A26I-08	0.532	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.800000	-20.000000	1	0.350000			0	32	32	0	169	167	1		1	0		0	0	34	0	0	1.000000	3.813976e-01	0	0	0	8	0	32	169
WDR17	116966	broad.mit.edu	37	4	177100716	177100716	+	Missense_Mutation	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr4:177100716C>T	ENST00000280190.4	+	31	4111	c.3955C>T	c.(3955-3957)Ctc>Ttc	p.L1319F	WDR17_ENST00000508596.1_Missense_Mutation_p.L1280F|WDR17_ENST00000507824.2_Missense_Mutation_p.L1294F|WDR17_ENST00000393643.2_Missense_Mutation_p.L1295F			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1319										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGGAATACGACTCAATCCATT	0.368																																						ENST00000280190.4	1.000000	0.730000	1	8.200000e-01	0.920000	0.918253	0.920000	1.000000																										0				92						c.(3955-3957)Ctc>Ttc		WD repeat domain 17							141.0	129.0	133.0					4																	177100716		2203	4300	6503	SO:0001583	missense	116966	0	0					g.chr4:177100716C>T	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3955C>T	chr4.hg19:g.177100716C>T	ENSP00000280190:p.Leu1319Phe	1					WDR17_ENST00000507824.2_Missense_Mutation_p.L1294F|WDR17_ENST00000393643.2_Missense_Mutation_p.L1295F|WDR17_ENST00000508596.1_Missense_Mutation_p.L1280F	p.L1319F			2	2	4	2.187993	Q8IZU2	WDR17_HUMAN		31	4111	+		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	1	1	hg19	c.3955C>T	CCDS3825.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.111338|4.111338	0.77210|0.77210	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	T;T;T|.	0.63096|.	-0.01;0.04;-0.02|.	5.54|5.54	5.54|5.54	0.83059|0.83059	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.072960|.	0.56097|.	D|.	0.000031|.	T|T	0.76485|0.76485	0.3994|0.3994	M|M	0.70595|0.70595	2.14|2.14	0.52099|0.52099	D|D	0.999941|0.999941	D;D;D|.	0.65815|.	0.986;0.995;0.995|.	P;P;P|.	0.56700|.	0.717;0.804;0.804|.	T|T	0.74334|0.74334	-0.3699|-0.3699	10|5	0.66056|.	D|.	0.02|.	-12.7112|-12.7112	19.8379|19.8379	0.96666|0.96666	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1295;1280;1319|.	E7EP77;E7EQX0;Q8IZU2|.	.;.;WDR17_HUMAN|.	F|I	1280;1295;1319;1295|553	ENSP00000422763:L1280F;ENSP00000377258:L1295F;ENSP00000280190:L1319F|.	ENSP00000280190:L1319F|.	L|T	+|+	1|2	0|0	0|0	WDR17|WDR17	177337710|177337710	177337710|177337710	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.734000|4.734000	0.62043|0.62043	2.765000|2.765000	0.95021|0.95021	0.655000|0.655000	0.94253|0.94253	CTC|ACT	0.384470		TCGA-M8-A5N4-01A-11D-A26I-08	0.368	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2	1	0	1	2	2	2	2	0	0	0	0	32	32	32	31	1	1.800000	-20.000000	1	0.350000			0	75	75	0	421	416	1		1	0		0	0	32	0	0	1.000000	0	0	1	0	0	0	75	421
ADAMTS12	81792	broad.mit.edu	37	5	33546294	33546294	+	Missense_Mutation	SNP	C	C	G			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr5:33546294C>G	ENST00000504830.1	-	22	4651	c.4316G>C	c.(4315-4317)tGt>tCt	p.C1439S	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.C1354S	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1439	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCCACCTCCACAGGACCTGGA	0.468										HNSCC(64;0.19)																												ENST00000504830.1	1.000000	0.680000	1	8.100000e-01	0.960000	0.925339	0.960000	1.000000																										0				216						c.(4315-4317)tGt>tCt		ADAM metallopeptidase with thrombospondin type 1 motif, 12							73.0	65.0	68.0					5																	33546294		2203	4300	6503	SO:0001583	missense	81792	0	0					g.chr5:33546294C>G	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4316G>C	chr5.hg19:g.33546294C>G	ENSP00000422554:p.Cys1439Ser	0	HNSCC(64;0.19)				ADAMTS12_ENST00000352040.3_Missense_Mutation_p.C1354S	p.C1439S	NM_030955.2	NP_112217.2	1	2	3	2.131482	P58397	ATS12_HUMAN		22	4651	-			A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	1	1	hg19	c.4316G>C	CCDS34140.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950606	0.73787	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.79033	-1.23;-1.23	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.93864	0.8037	H	0.99847	4.84	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.994;0.997	D	0.96252	0.9184	10	0.87932	D	0	.	14.9937	0.71412	0.0:1.0:0.0:0.0	.	1354;1439	P58397-3;P58397	.;ATS12_HUMAN	S	1439;1354	ENSP00000422554:C1439S;ENSP00000344847:C1354S	ENSP00000344847:C1354S	C	-	2	0	0	ADAMTS12	33582051	33582051	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.457000	0.60088	2.605000	0.88082	0.655000	0.94253	TGT	0.360079		TCGA-M8-A5N4-01A-11D-A26I-08	0.468	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.800000	-20.000000	1	0.350000	NM_030955		0	33	33	0	168	167	0		1	0		0	0	25	0	0	1.000000	9.513854e-01	0	0	0	28	0	33	168
PCDHB8	56128	broad.mit.edu	37	5	140559743	140559743	+	Missense_Mutation	SNP	G	G	A	rs142723933	byFrequency	TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr5:140559743G>A	ENST00000239444.2	+	1	2373	c.2128G>A	c.(2128-2130)Gtg>Atg	p.V710M	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	710					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCTGTTCGTGGCGGTGCT	0.677																																						ENST00000239444.2	1.000000	0.400000	5.600000e-01	4.400000e-01	0.490000	0.531449	0.490000	0.500000																										0				83						c.(2128-2130)Gtg>Atg		protocadherin beta 8							95.0	97.0	96.0					5																	140559743		2201	4298	6499	SO:0001583	missense	56128	42	121398	51				g.chr5:140559743G>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.2128G>A	chr5.hg19:g.140559743G>A	ENSP00000239444:p.Val710Met	0					PCDHB16_ENST00000361016.2_5'Flank	p.V710M	NM_019120.3	NP_061993.2	1	2	3	2.122033	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	2373	+			B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	1	1	hg19	c.2128G>A	CCDS4250.1	0	.	.	.	.	.	.	.	.	.	.	G	15.96	2.988166	0.53934	.	.	ENSG00000120322	ENST00000239444	T	0.15256	2.44	4.22	0.734	0.18294	4.22	0.734	0.18294	.	.	.	.	.	T	0.26955	0.0660	M	0.92317	3.295	0.09310	N	1	P	0.38745	0.645	B	0.35770	0.21	T	0.19451	-1.0305	9	0.72032	D	0.01	.	8.2196	0.31532	0.4409:0.0:0.5591:0.0	.	710	Q9UN66	PCDB8_HUMAN	M	710	ENSP00000239444:V710M	ENSP00000239444:V710M	V	+	1	0	0	PCDHB8	140539927	140539927	0.011000	0.17503	0.084000	0.20598	0.243000	0.25628	0.173000	0.16724	0.252000	0.21531	0.298000	0.19748	GTG	0.358974		TCGA-M8-A5N4-01A-11D-A26I-08	0.677	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	1	0	1	2	22	2	2	0	0	0	1	158	158	158	145	1	1.800000	-19.950560	1	0.350000	NM_019120		0	91	83	0	973	907	0		1	0		0	0	158	0	0	1.000000	1.477097e-01	0	0	0	8	0	91	973
ATF6B	1388	broad.mit.edu	37	6	32093957	32093957	+	Missense_Mutation	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr6:32093957C>T	ENST00000375203.3	-	5	447	c.415G>A	c.(415-417)Gac>Aac	p.D139N	ATF6B_ENST00000468502.1_5'UTR|ATF6B_ENST00000375201.4_Missense_Mutation_p.D136N	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	139					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						GATGTTGGGTCATCTCCCAGG	0.552																																						ENST00000375203.3	0.560000	0.290000	4.900000e-01	3.500000e-01	0.410000	0.427974	0.410000	0.420000																										0				22						c.(415-417)Gac>Aac		activating transcription factor 6 beta							126.0	111.0	116.0					6																	32093957		2203	4300	6503	SO:0001583	missense	1388	0	0					g.chr6:32093957C>T		CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.415G>A	chr6.hg19:g.32093957C>T	ENSP00000364349:p.Asp139Asn	0					ATF6B_ENST00000375201.4_Missense_Mutation_p.D136N|ATF6B_ENST00000468502.1_5'UTR	p.D139N	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	0	1	1	2.038868	Q99941	ATF6B_HUMAN		5	447	-			B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Missense_Mutation	SNP	ENST00000375203.3	1	1	hg19	c.415G>A	CCDS4737.1	0	.	.	.	.	.	.	.	.	.	.	C	7.560	0.664502	0.14710	.	.	ENSG00000213676	ENST00000375203;ENST00000375201	T;T	0.55588	0.51;1.25	5.25	3.44	0.39384	5.25	3.44	0.39384	.	0.566730	0.15890	U	0.239616	T	0.26955	0.0660	L	0.51422	1.61	0.25129	N	0.990582	P;B;B	0.40731	0.728;0.277;0.181	P;B;B	0.44359	0.447;0.109;0.051	T	0.11542	-1.0583	10	0.15066	T	0.55	-1.4539	6.9996	0.24803	0.0:0.7337:0.1747:0.0917	.	139;136;139	Q96QL7;Q99941-2;Q99941	.;.;ATF6B_HUMAN	N	139;136	ENSP00000364349:D139N;ENSP00000364347:D136N	ENSP00000364347:D136N	D	-	1	0	0	ATF6B	32201935	32201935	0.976000	0.34144	0.989000	0.46669	0.994000	0.84299	1.092000	0.30927	0.774000	0.33427	0.650000	0.86243	GAC	0.339599		TCGA-M8-A5N4-01A-11D-A26I-08	0.552	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2	1	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	1.800000	-8.879146	1	0.350000			0	34	35	0	422	420	1		1	1		0	0	84	0	0	1.000000	9.999943e-01	0	30	0	199	0	34	422
RIMS1	22999	broad.mit.edu	37	6	72806839	72806839	+	Missense_Mutation	SNP	G	G	C			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr6:72806839G>C	ENST00000521978.1	+	3	433	c.433G>C	c.(433-435)Ggc>Cgc	p.G145R	RIMS1_ENST00000522291.1_Missense_Mutation_p.G145R|RIMS1_ENST00000348717.5_Missense_Mutation_p.G145R|RIMS1_ENST00000517960.1_Missense_Mutation_p.G145R|RIMS1_ENST00000264839.7_Missense_Mutation_p.G145R|RIMS1_ENST00000491071.2_Missense_Mutation_p.G145R|RIMS1_ENST00000518273.1_Missense_Mutation_p.G145R|RIMS1_ENST00000520567.1_Missense_Mutation_p.G145R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	145	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GCGCTGCGGAGGCCGCGTGTC	0.483																																						ENST00000521978.1	0.960000	0.520000	8.500000e-01	6.200000e-01	0.720000	0.739693	0.720000	0.730000																										0				102						c.(433-435)Ggc>Cgc		regulating synaptic membrane exocytosis 1							78.0	81.0	80.0					6																	72806839		2091	4232	6323	SO:0001583	missense	22999	0	0					g.chr6:72806839G>C	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.433G>C	chr6.hg19:g.72806839G>C	ENSP00000428417:p.Gly145Arg	0					RIMS1_ENST00000522291.1_Missense_Mutation_p.G145R|RIMS1_ENST00000491071.2_Missense_Mutation_p.G145R|RIMS1_ENST00000520567.1_Missense_Mutation_p.G145R|RIMS1_ENST00000348717.5_Missense_Mutation_p.G145R|RIMS1_ENST00000517960.1_Missense_Mutation_p.G145R|RIMS1_ENST00000518273.1_Missense_Mutation_p.G145R|RIMS1_ENST00000264839.7_Missense_Mutation_p.G145R	p.G145R	NM_014989.5	NP_055804.2	0	0	0	1.920782	Q86UR5	RIMS1_HUMAN		3	433	+		all_epithelial(107;0.179)|all_hematologic(105;0.212)	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	1	1	hg19	c.433G>C	CCDS47449.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.223292	0.95139	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26	5.81	5.81	0.92471	5.81	5.81	0.92471	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000007	T	0.62319	0.2418	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67003	-0.5780	10	0.87932	D	0	-14.7865	20.0804	0.97772	0.0:0.0:1.0:0.0	.	145	Q86UR5	RIMS1_HUMAN	R	145	ENSP00000430101:G145R;ENSP00000275037:G145R;ENSP00000264839:G145R;ENSP00000429959:G145R;ENSP00000430408:G145R;ENSP00000430502:G145R;ENSP00000430932:G145R;ENSP00000428417:G145R	ENSP00000264839:G145R	G	+	1	0	0	RIMS1	72863560	72863560	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.773000	0.98989	2.738000	0.93877	0.655000	0.94253	GGC	0.295775		TCGA-M8-A5N4-01A-11D-A26I-08	0.483	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.800000	-3.321823	1	0.350000			0	35	35	0	217	216	1		1			0	0	32	0	0	1.000000	0	0	0	0	0	0	35	217
SPAM1	6677	broad.mit.edu	37	7	123593723	123593723	+	Silent	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr7:123593723C>T	ENST00000439500.1	+	4	712	c.99C>T	c.(97-99)tgC>tgT	p.C33C	SPAM1_ENST00000460182.1_Silent_p.C33C|SPAM1_ENST00000223028.7_Silent_p.C33C|SPAM1_ENST00000340011.5_Silent_p.C33C|SPAM1_ENST00000402183.2_Silent_p.C33C	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	33					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTCCATGTTGCTTGACTCTGA	0.413																																						ENST00000439500.1	1.000000	0.840000	1	9.600000e-01	0.990000	0.983256	0.990000	1.000000																										0				46						c.(97-99)tgC>tgT		sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)							83.0	77.0	79.0					7																	123593723		2203	4300	6503	SO:0001819	synonymous_variant	6677	0	0					g.chr7:123593723C>T	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.99C>T	chr7.hg19:g.123593723C>T		0					SPAM1_ENST00000223028.7_Silent_p.C33C|SPAM1_ENST00000460182.1_Silent_p.C33C|SPAM1_ENST00000340011.5_Silent_p.C33C|SPAM1_ENST00000402183.2_Silent_p.C33C	p.C33C	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	1	2	3	2.110087	P38567	HYALP_HUMAN		4	712	+			Q8TC30	Silent	SNP	ENST00000439500.1	1	1	hg19	c.99C>T	CCDS5791.1	1																																																																																								0.356754		TCGA-M8-A5N4-01A-11D-A26I-08	0.413	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.800000	-20.000000	1	0.350000			0	55	54	0	237	237	1		1			0	0	20	0	0	1.000000	0	0	0	0	0	0	55	237
SLC13A4	26266	broad.mit.edu	37	7	135392895	135392895	+	Missense_Mutation	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr7:135392895C>T	ENST00000354042.4	-	3	1021	c.332G>A	c.(331-333)cGc>cAc	p.R111H		NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	111					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						CAAGACCATGCGCAGAGCAAT	0.592																																						ENST00000354042.4	1.000000	0.960000	1	9.900000e-01	0.990000	0.997954	0.990000	1.000000																										0				24						c.(331-333)cGc>cAc		solute carrier family 13 (sodium/sulfate symporter), member 4							90.0	91.0	91.0					7																	135392895		2203	4300	6503	SO:0001583	missense	26266	0	0					g.chr7:135392895C>T	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.332G>A	chr7.hg19:g.135392895C>T	ENSP00000297282:p.Arg111His	0						p.R111H	NM_012450.2	NP_036582.2	1	2	3	2.099380	Q9UKG4	S13A4_HUMAN		3	1021	-			A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	1	1	hg19	c.332G>A	CCDS5840.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.622414	0.96660	.	.	ENSG00000164707	ENST00000354042	T	0.02974	4.09	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.055341	0.64402	D	0.000001	T	0.12263	0.0298	L	0.55743	1.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00182	-1.1946	10	0.87932	D	0	.	15.9821	0.80116	0.0:1.0:0.0:0.0	.	111	Q9UKG4	S13A4_HUMAN	H	111	ENSP00000297282:R111H	ENSP00000297282:R111H	R	-	2	0	0	SLC13A4	135043435	135043435	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.688000	0.61715	2.639000	0.89480	0.561000	0.74099	CGC	0.355638		TCGA-M8-A5N4-01A-11D-A26I-08	0.592	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	1	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	1.800000	-20.000000	1	0.350000	NM_012450		0	176	176	0	739	732	1		1	0		0	0	106	0	0	1.000000	0	0	0	0	1	0	176	739
SLC29A4	222962	broad.mit.edu	37	7	5330780	5330780	+	Silent	SNP	C	C	T			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr7:5330780C>T	ENST00000396872.3	+	4	488	c.327C>T	c.(325-327)agC>agT	p.S109S	SLC29A4_ENST00000406453.3_Silent_p.S109S|SLC29A4_ENST00000297195.4_Silent_p.S109S			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	109					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	TTGACATGAGCCTCACCTACA	0.632																																						ENST00000396872.3	1.000000	0.490000	8.000000e-01	5.700000e-01	0.670000	0.692557	0.670000	0.670000																										0				20						c.(325-327)agC>agT		solute carrier family 29 (equilibrative nucleoside transporter), member 4	Metformin(DB00331)						101.0	86.0	91.0					7																	5330780		2203	4300	6503	SO:0001819	synonymous_variant	222962	0	0					g.chr7:5330780C>T	AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.327C>T	chr7.hg19:g.5330780C>T		0					SLC29A4_ENST00000297195.4_Silent_p.S109S|SLC29A4_ENST00000406453.3_Silent_p.S109S	p.S109S			1	2	3	2.103402	Q7RTT9	S29A4_HUMAN		4	488	+		Ovarian(82;0.0175)	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	ENST00000396872.3	1	1	hg19	c.327C>T	CCDS5340.1	0																																																																																								0.355638		TCGA-M8-A5N4-01A-11D-A26I-08	0.632	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.800000	-20.000000	1	0.350000	NM_153247		0	39	38	0	296	292	1		1	0		0	0	46	0	0	1.000000	0	0	0	0	1	0	39	296
ICA1	3382	broad.mit.edu	37	7	8258081	8258081	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr7:8258081G>A	ENST00000402384.3	-	6	699	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	ICA1_ENST00000407906.1_Missense_Mutation_p.R145W|ICA1_ENST00000401396.1_Missense_Mutation_p.R133W|ICA1_ENST00000406470.2_Missense_Mutation_p.R145W|ICA1_ENST00000422063.2_Missense_Mutation_p.R145W|ICA1_ENST00000476942.1_5'UTR|ICA1_ENST00000396675.3_Missense_Mutation_p.R145W|ICA1_ENST00000265577.7_Missense_Mutation_p.R144W			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	145	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GCCCGATGCCGAAAAGTCTCC	0.483																																						ENST00000402384.3	1.000000	0.750000	1	8.400000e-01	0.950000	0.934863	0.950000	1.000000																										0				23						c.(433-435)Cgg>Tgg		islet cell autoantigen 1, 69kDa							116.0	100.0	106.0					7																	8258081		2203	4300	6503	SO:0001583	missense	3382	4	121412	36				g.chr7:8258081G>A		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.433C>T	chr7.hg19:g.8258081G>A	ENSP00000385570:p.Arg145Trp	0					ICA1_ENST00000422063.2_Missense_Mutation_p.R145W|ICA1_ENST00000396675.3_Missense_Mutation_p.R145W|ICA1_ENST00000406470.2_Missense_Mutation_p.R145W|ICA1_ENST00000407906.1_Missense_Mutation_p.R145W|ICA1_ENST00000476942.1_5'UTR|ICA1_ENST00000401396.1_Missense_Mutation_p.R133W|ICA1_ENST00000265577.7_Missense_Mutation_p.R144W	p.R145W			1	2	3	2.103402	Q05084	ICA69_HUMAN		6	699	-		Ovarian(82;0.0612)	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Missense_Mutation	SNP	ENST00000402384.3	1	1	hg19	c.433C>T	CCDS34602.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284344	0.80803	.	.	ENSG00000003147	ENST00000402384;ENST00000406470;ENST00000265577;ENST00000396675;ENST00000401396;ENST00000422063;ENST00000407906;ENST00000317367;ENST00000447326	T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	5.82	4.92	0.64577	5.82	4.92	0.64577	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.85720	0.5762	M	0.64567	1.98	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.97110	0.976;0.999;0.98;1.0;0.97;1.0	D	0.86066	0.1535	10	0.51188	T	0.08	-16.4668	13.94	0.64048	0.0:0.0:0.6576:0.3423	.	145;145;144;133;145;133	B3FTQ2;E7ENI6;Q96HG3;B9ZVM7;Q05084;E9PDL4	.;.;.;.;ICA69_HUMAN;.	W	145;145;144;145;133;145;145;133;145	ENSP00000385570:R145W;ENSP00000385651:R145W;ENSP00000265577:R144W;ENSP00000379908:R145W;ENSP00000385305:R133W;ENSP00000403982:R145W;ENSP00000386021:R145W;ENSP00000316074:R133W;ENSP00000398435:R145W	ENSP00000265577:R144W	R	-	1	2	2	ICA1	8224606	8224606	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.099000	0.57755	1.397000	0.46682	0.655000	0.94253	CGG	0.355638		TCGA-M8-A5N4-01A-11D-A26I-08	0.483	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.800000	-2.896757	1	0.350000	NM_004968		0	68	68	0	344	340	1		1	1		0	0	48	0	0	1.000000	9.999085e-01	0	28	0	43	0	68	344
C7orf33	202865	broad.mit.edu	37	7	148288176	148288176	+	Silent	SNP	C	C	T	rs549712040		TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr7:148288176C>T	ENST00000307003.2	+	1	520	c.159C>T	c.(157-159)ggC>ggT	p.G53G		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	53								p.G53G(1)		central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			ACGTTAGGGGCGGTCCAGGTC	0.512																																						ENST00000307003.2	1.000000	0.670000	9.300000e-01	7.400000e-01	0.820000	0.837217	0.820000	0.830000																										1	Substitution - coding silent(1)	p.G53G(1)	prostate(1)	14						c.(157-159)ggC>ggT		chromosome 7 open reading frame 33							100.0	82.0	88.0					7																	148288176		2203	4300	6503	SO:0001819	synonymous_variant	202865	2	121412	33				g.chr7:148288176C>T	BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.159C>T	chr7.hg19:g.148288176C>T		0						p.G53G	NM_145304.2	NP_660347.1	1	2	3	2.091214	Q8WU49	CG033_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	1	520	+	Melanoma(164;0.15)			Silent	SNP	ENST00000307003.2	1	1	hg19	c.159C>T	CCDS5890.1	0																																																																																								0.354518		TCGA-M8-A5N4-01A-11D-A26I-08	0.512	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.800000	-2.473802	0	0.350000	NM_145304		0	85	83	0	505	499	1		1			0	0	65	0	0	1.000000	0	0	0	0	0	0	85	505
FRMPD1	22844	broad.mit.edu	37	9	37708488	37708488	+	Missense_Mutation	SNP	G	G	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chr9:37708488G>A	ENST00000539465.1	+	4	945	c.352G>A	c.(352-354)Gat>Aat	p.D118N	FRMPD1_ENST00000377765.3_Missense_Mutation_p.D118N|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	118	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		ACGAGCAGTCGATATTCTCAG	0.463																																						ENST00000539465.1	1.000000	0.850000	1	9.500000e-01	0.990000	0.983611	0.990000	1.000000																										0				93						c.(352-354)Gat>Aat		FERM and PDZ domain containing 1							96.0	88.0	90.0					9																	37708488		2203	4300	6503	SO:0001583	missense	22844	8	121412	40				g.chr9:37708488G>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.352G>A	chr9.hg19:g.37708488G>A	ENSP00000444411:p.Asp118Asn	0					FRMPD1_ENST00000377765.3_Missense_Mutation_p.D118N|RP11-613M10.9_ENST00000540557.1_Intron	p.D118N			1	2	3	2.123207	Q5SYB0	FRPD1_HUMAN		4	945	+			B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	1	1	hg19	c.352G>A	CCDS6612.1	1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696486	0.30142	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.38722	1.12;1.12	5.91	0.863	0.19062	5.91	0.863	0.19062	PDZ/DHR/GLGF (4);	0.448448	0.27294	N	0.020031	T	0.22282	0.0537	N	0.17901	0.54	0.31784	N	0.630458	B	0.17268	0.021	B	0.15052	0.012	T	0.09228	-1.0684	10	0.33940	T	0.23	-0.9785	5.2235	0.15381	0.311:0.1378:0.5512:0.0	.	118	Q5SYB0	FRPD1_HUMAN	N	118	ENSP00000366995:D118N;ENSP00000444411:D118N	ENSP00000366995:D118N	D	+	1	0	0	FRMPD1	37698488	37698488	0.009000	0.17119	0.038000	0.18304	0.878000	0.50629	-0.224000	0.09164	-0.092000	0.12417	0.650000	0.86243	GAT	0.358974		TCGA-M8-A5N4-01A-11D-A26I-08	0.463	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.800000	-3.432222	1	0.350000	NM_014907		0	72	72	0	319	319	0		1			0	0	31	0	0	1.000000	0	0	0	0	0	0	72	319
P2RY4	5030	broad.mit.edu	37	X	69478725	69478725	+	Silent	SNP	C	C	A			TCGA-M8-A5N4-01A-11D-A26I-08	TCGA-M8-A5N4-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac6d223e-26a4-4b06-b260-bb1988f1f808	483217e3-6f76-47b0-ae68-da24243056c0	g.chrX:69478725C>A	ENST00000374519.2	-	1	929	c.750G>T	c.(748-750)gtG>gtT	p.V250V		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	250					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						AGACAGTCAGCACCACAGCTA	0.557																																						ENST00000374519.2	1.000000	0.610000	9.700000e-01	7.200000e-01	0.840000	0.845407	0.840000	1.000000																										0				18						c.(748-750)gtG>gtT		pyrimidinergic receptor P2Y, G-protein coupled, 4							72.0	60.0	64.0					X																	69478725		2203	4300	6503	SO:0001819	synonymous_variant	5030	0	0					g.chrX:69478725C>A	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.750G>T	chrX.hg19:g.69478725C>A								p.V250V	NM_002565.3	NP_002556.1	0	1	1		P51582	P2RY4_HUMAN		1	929	-			Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Silent	SNP	ENST00000374519.2	1	1	hg19	c.750G>T	CCDS14398.1	0																																																																																								0.350000		TCGA-M8-A5N4-01A-11D-A26I-08	0.557	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.800000	-20.000000	1	0.350000	NM_002565		0	38	37	0	219	217	1		1			0	0	37	0	0	1.000000	0	0	0	0	0	0	38	219
