#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PEX12	5193	broad.mit.edu	37	17	33902992	33902993	+	Frame_Shift_Del	DEL	AG	AG	-	rs398123301|rs61752110|rs61752111		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:33902992_33902993delAG	ENST00000225873.4	-	3	1495_1496	c.888_889delCT	c.(886-891)ctcttafs	p.LL296fs	SNORD7_ENST00000384567.1_RNA|RP11-1094M14.11_ENST00000592381.1_lincRNA	NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	296					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATTTTGGGTAAGAGGGGAGAAT	0.47																																						ENST00000225873.4	0.440000	2.500000e-01	3.900000e-01	2.900000e-01	0.330000	0.346295	0.330000	0.340000																										0				18	GRCh37	CD982877	PEX12	D		c.(886-891)ctcttafs		peroxisomal biogenesis factor 12				20,4244		10,0,2122				http://www.ncbi.nlm.nih.gov/sites/varvu?gene		5.4	0.6		dbSNP_129	190	6,8246		2,2,4122	no	frameshift	PEX12	NM_000286.2		12,2,6244	A1A1,A1R,RR		0.0727,0.469,0.2077				26,12490				SO:0001589	frameshift_variant	5193	0	0					g.chr17:33902992_33902993delAG	U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.888_889delCT	chr17.hg19:g.33902994_33902995delAG	ENSP00000225873:p.Leu296fs	0					RP11-1094M14.11_ENST00000592381.1_lincRNA|SNORD7_ENST00000384567.1_RNA	p.LL296fs	NM_000286.2	NP_000277.1	0	0	0	2.108319	O00623	PEX12_HUMAN		3	1495_1496	-			B2R6M2	Frame_Shift_Del	DEL	ENST00000225873.4	1	1	hg19	c.888_889delCT	CCDS11296.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.470	PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256489.2	1	0	0		34	2	2	0	0	0	3	77	0	77	77	1	1.770000	-3.318794	1	0.570000	NM_000286		0	45	54	0	413	411	0	0	1	1	0	0	0	77	0	0	0.929685	3.026300e-01	1.879608e-13	2	0	9	1	45	413
LUZP1	7798	broad.mit.edu	37	1	23420152	23420159	+	Frame_Shift_Del	DEL	ATTCAAGT	ATTCAAGT	-	rs553150678		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:23420152_23420159delATTCAAGT	ENST00000302291.4	-	4	1397_1404	c.596_603delACTTGAAT	c.(595-603)tacttgaatfs	p.YLN199fs	LUZP1_ENST00000314174.5_Frame_Shift_Del_p.YLN199fs|LUZP1_ENST00000374623.3_Frame_Shift_Del_p.YLN199fs|LUZP1_ENST00000418342.1_Frame_Shift_Del_p.YLN199fs			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	199					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TCTCCTTTTCATTCAAGTATTTTCTCTC	0.351																																						ENST00000302291.4	0.730000	4.100000e-01	6.500000e-01	4.800000e-01	0.560000	0.573884	0.560000	0.570000																										0				31						c.(595-603)tacttgaatfs		leucine zipper protein 1																																				SO:0001589	frameshift_variant	7798	0	0					g.chr1:23420152_23420159delATTCAAGT	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.596_603delACTTGAAT	chr1.hg19:g.23420152_23420159delATTCAAGT	ENSP00000303758:p.Tyr199fs	0					LUZP1_ENST00000314174.5_Frame_Shift_Del_p.YLN199fs|LUZP1_ENST00000418342.1_Frame_Shift_Del_p.YLN199fs|LUZP1_ENST00000374623.3_Frame_Shift_Del_p.YLN199fs	p.YLN199fs			0	0	0	2.104551	Q86V48	LUZP1_HUMAN		4	1397_1404	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)	Q5TH93|Q8N4X3|Q8TEH1	Frame_Shift_Del	DEL	ENST00000302291.4	1	1	hg19	c.596_603delACTTGAAT	CCDS30628.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.351	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	1	0	1		2			0	0	0	0	55	0	55	55	1	1.770000	-20.000000	1	0.570000	NM_033631		0	39	55	0	200	214	0	0	1			0	0	55	0	0	1.000000			0	0	0	0	39	200
CFAP58	159686	broad.mit.edu	37	10	106118265	106118265	+	Missense_Mutation	SNP	G	G	A	rs534892585		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:106118265G>A	ENST00000369704.3	+	2	310	c.176G>A	c.(175-177)cGt>cAt	p.R59H	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		59						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AATGAAAAGCGTCTGATGGCC	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		18364	0.0		0.001	False		,,,				2504	0.0					ENST00000369704.3	1.000000	1.700000e-01	3.500000e-01	2.200000e-01	0.270000	0.314576	0.270000	0.270000																										0				52						c.(175-177)cGt>cAt									79.0	71.0	74.0					10																	106118265		2203	4300	6503	SO:0001583	missense	0	1	121412	31				g.chr10:106118265G>A																												ENST00000369704.3:c.176G>A	chr10.hg19:g.106118265G>A	ENSP00000358718:p.Arg59His	0					CCDC147_ENST00000312902.5_5'UTR	p.R59H	NM_001008723.1	NP_001008723.1	1	2	3	2.213635	Q5T655	CC147_HUMAN		2	310	+		Colorectal(252;0.103)|Breast(234;0.122)	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	1	1	hg19	c.176G>A	CCDS31282.1	0	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288041	0.80803	.	.	ENSG00000120051	ENST00000369704	T	0.37058	1.22	5.57	5.57	0.84162	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.51024	0.1650	M	0.91090	3.175	0.80722	D	1	P	0.46020	0.871	B	0.42214	0.38	T	0.62718	-0.6795	10	0.52906	T	0.07	-6.117	15.0736	0.72059	0.0699:0.0:0.9301:0.0	.	59	Q5T655	CC147_HUMAN	H	59	ENSP00000358718:R59H	ENSP00000358718:R59H	R	+	2	0	0	CCDC147	106108255	106108255	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.732000	0.74790	2.785000	0.95823	0.655000	0.94253	CGT	0.577229		TCGA-OE-A75W-01A-12D-A32N-08	0.423	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.770000	-20.000000	1	0.570000			0	24	24	0	291	289	0		1			0	0	52	0	0	1.000000	0	0	0	0	0	0	24	291
KIAA1217	56243	broad.mit.edu	37	10	24825794	24825794	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:24825794G>A	ENST00000376454.3	+	17	3536	c.3506G>A	c.(3505-3507)gGc>gAc	p.G1169D	KIAA1217_ENST00000458595.1_Missense_Mutation_p.G1134D|KIAA1217_ENST00000396445.1_Missense_Mutation_p.G852D|KIAA1217_ENST00000307544.6_Missense_Mutation_p.G852D|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000376452.3_Missense_Mutation_p.G1133D|KIAA1217_ENST00000376451.2_Missense_Mutation_p.G852D|KIAA1217_ENST00000396446.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1169					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						ACTAGGTCGGGCGCCACAGTG	0.512																																						ENST00000376454.3	1.000000	2.000000e-02	1.100000e-01	4.000000e-02	0.060000	0.111334	0.060000	0.060000																										0				70						c.(3505-3507)gGc>gAc		KIAA1217							94.0	80.0	85.0					10																	24825794		2203	4300	6503	SO:0001583	missense	56243	0	0					g.chr10:24825794G>A	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.3506G>A	chr10.hg19:g.24825794G>A	ENSP00000365637:p.Gly1169Asp	0					KIAA1217_ENST00000307544.6_Missense_Mutation_p.G852D|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396445.1_Missense_Mutation_p.G852D|KIAA1217_ENST00000376451.2_Missense_Mutation_p.G852D|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000458595.1_Missense_Mutation_p.G1134D|KIAA1217_ENST00000376452.3_Missense_Mutation_p.G1133D	p.G1169D	NM_019590.3	NP_062536.2	1	2	3	2.192967	Q5T5P2	SKT_HUMAN		17	3536	+			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	0	1	hg19	c.3506G>A	CCDS31165.1	0	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814941	0.50527	.	.	ENSG00000120549	ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451	T;T;T;T;T;T	0.56275	1.1;1.47;1.08;0.54;0.47;0.97	5.62	4.66	0.58398	5.62	4.66	0.58398	.	0.130328	0.51477	D	0.000091	T	0.66684	0.2814	M	0.68593	2.085	0.45662	D	0.998584	D;D;D;D;D;D	0.89917	0.996;1.0;0.999;0.999;0.968;0.999	P;D;D;D;P;D	0.75020	0.9;0.974;0.985;0.963;0.733;0.964	T	0.66736	-0.5848	10	0.51188	T	0.08	.	10.0223	0.42051	0.0:0.1282:0.6268:0.2451	.	1134;1133;852;852;852;1169	Q5T5P2-7;A6NLF3;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2	.;.;.;.;.;SKT_HUMAN	D	1134;852;1169;1133;852;852;852;852	ENSP00000392625:G1134D;ENSP00000365637:G1169D;ENSP00000365635:G1133D;ENSP00000302343:G852D;ENSP00000379722:G852D;ENSP00000365634:G852D	ENSP00000302343:G852D	G	+	2	0	0	KIAA1217	24865800	24865800	1.000000	0.71417	1.000000	0.80357	0.154000	0.21943	4.623000	0.61247	2.646000	0.89796	0.655000	0.94253	GGC	0.576041		TCGA-OE-A75W-01A-12D-A32N-08	0.512	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	0	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.770000	-6.807801	1	0.570000	NM_019590		0	6	5	0	318	316	0		1	0		0	0	56	0	0	0.964333	1.847927e-01	0	0	0	36	0	6	318
ERCC6	2074	broad.mit.edu	37	10	50678629	50678629	+	Missense_Mutation	SNP	T	T	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:50678629T>C	ENST00000355832.5	-	18	3455	c.3377A>G	c.(3376-3378)aAt>aGt	p.N1126S	ERCC6_ENST00000465653.1_5'Flank|ERCC6_ENST00000542458.1_Missense_Mutation_p.N496S|RP11-123B3.2_ENST00000423283.1_RNA	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1126					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ACATTCCCCATTTCCACTAAT	0.393								Direct reversal of damage;Nucleotide excision repair (NER)																														ENST00000355832.5	1.000000	3.000000e-02	1.100000e-01	5.000000e-02	0.070000	0.115310	0.070000	0.080000																										0				64						c.(3376-3378)aAt>aGt	Direct reversal of damage;Nucleotide excision repair (NER)	excision repair cross-complementation group 6							151.0	142.0	145.0					10																	50678629		2203	4300	6503	SO:0001583	missense	2074	0	0					g.chr10:50678629T>C	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.3377A>G	chr10.hg19:g.50678629T>C	ENSP00000348089:p.Asn1126Ser	0					ERCC6_ENST00000465653.1_5'Flank|RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.N496S	p.N1126S	NM_000124.2	NP_000115.1	1	2	3	2.192118	Q03468	ERCC6_HUMAN		18	3455	-			D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	0	1	hg19	c.3377A>G	CCDS7229.1	0	.	.	.	.	.	.	.	.	.	.	T	10.92	1.486713	0.26686	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	D;T	0.82344	-1.6;-1.33	5.95	2.33	0.28932	5.95	2.33	0.28932	.	.	.	.	.	T	0.71290	0.3322	L	0.38175	1.15	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.06405	0.002;0.001	T	0.51474	-0.8701	9	0.11794	T	0.64	-1.9129	8.1179	0.30955	0.0:0.2339:0.0:0.7661	.	1126;503	Q03468;Q59FF6	ERCC6_HUMAN;.	S	1126;503;496	ENSP00000348089:N1126S;ENSP00000445134:N496S	ENSP00000348089:N1126S	N	-	2	0	0	ERCC6	50348635	50348635	0.007000	0.16637	0.006000	0.13384	0.404000	0.30871	1.437000	0.34991	0.152000	0.19188	0.533000	0.62120	AAT	0.576041		TCGA-OE-A75W-01A-12D-A32N-08	0.393	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	0	0	1	2	2	2	2	0	0	0	0	101	101	101	100	1	1.770000	-2.893971	1	0.570000	NM_000124		0	13	12	0	604	598	0		1	0		0	0	101	0	0	0.999501	3.171501e-03	0	0	0	4	0	13	604
PCDH15	65217	broad.mit.edu	37	10	55570351	55570351	+	Missense_Mutation	SNP	C	C	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:55570351C>A	ENST00000373965.2	-	35	4862	c.4468G>T	c.(4468-4470)Gtt>Ttt	p.V1490F	PCDH15_ENST00000395438.1_Missense_Mutation_p.W1506C|PCDH15_ENST00000414778.1_Missense_Mutation_p.V1487F|PCDH15_ENST00000395445.1_Missense_Mutation_p.V1490F|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.W1117C|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395446.1_Intron	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GCTTCACCAACCACCTCACCA	0.373										HNSCC(58;0.16)																												ENST00000373965.2	1.000000	6.300000e-01	8.200000e-01	6.800000e-01	0.740000	0.760549	0.740000	0.750000																										0				237						c.(4468-4470)Gtt>Ttt		protocadherin-related 15							180.0	165.0	170.0					10																	55570351		1568	3582	5150	SO:0001583	missense	65217	0	0					g.chr10:55570351C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000373965.2:c.4468G>T	chr10.hg19:g.55570351C>A	ENSP00000363076:p.Val1490Phe	0	HNSCC(58;0.16)				PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.W1117C|PCDH15_ENST00000395438.1_Missense_Mutation_p.W1506C|PCDH15_ENST00000395445.1_Missense_Mutation_p.V1490F|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000414778.1_Missense_Mutation_p.V1487F	p.V1490F	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	1	2	3	2.192118	Q96QU1	PCD15_HUMAN		35	4862	-		Melanoma(3;0.117)|Lung SC(717;0.238)	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000373965.2	1	1	hg19	c.4468G>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.19|15.19	2.760384|2.760384	0.49468|0.49468	.|.	.|.	ENSG00000150275|ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395445|ENST00000395438;ENST00000409834	T;T;T|T;T	0.63096|0.58358	0.03;0.14;-0.02|0.38;0.34	6.16|6.16	4.3|4.3	0.51218|0.51218	6.16|6.16	4.3|4.3	0.51218|0.51218	.|.	.|.	.|.	.|.	.|.	T|T	0.31796|0.31796	0.0808|0.0808	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B;B;B|B	0.34103|0.02656	0.437;0.437;0.437;0.437|0.0	B;B;B;B|B	0.26770|0.04013	0.073;0.073;0.073;0.073|0.001	T|T	0.06698|0.06698	-1.0812|-1.0812	9|9	0.62326|0.45353	D|T	0.03|0.12	.|.	10.6203|10.6203	0.45476|0.45476	0.0:0.7929:0.134:0.0731|0.0:0.7929:0.134:0.0731	.|.	1488;1490;1481;1487|1506	C6ZEF5;A2A3E2;C6ZEF7;C9J4F3|A2A3E3	.;.;.;.|.	F|C	1490;1487;1483;1490|1506;1117	ENSP00000363076:V1490F;ENSP00000410304:V1487F;ENSP00000378832:V1490F|ENSP00000378826:W1506C;ENSP00000386693:W1117C	ENSP00000363076:V1490F|ENSP00000378826:W1506C	V|W	-|-	1|3	0|0	0|0	PCDH15|PCDH15	55240357|55240357	55240357|55240357	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	1.440000|1.440000	0.35024|0.35024	0.907000|0.907000	0.36646|0.36646	0.650000|0.650000	0.86243|0.86243	GTT|TGG	0.576041		TCGA-OE-A75W-01A-12D-A32N-08	0.373	PCDH15-008	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291336.1	0	0	1	2	2	2	2	0	0	0	0	106	106	106	103	1	1.770000	-20.000000	1	0.570000	NM_033056		0	126	123	0	473	464	1		1			0	0	106	0	0	1.000000	0	0	0	0	0	0	126	473
TMEM26	219623	broad.mit.edu	37	10	63170318	63170318	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:63170318G>A	ENST00000399298.3	-	6	1237	c.869C>T	c.(868-870)gCc>gTc	p.A290V	TMEM26_ENST00000507507.1_5'UTR	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	290						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					GTTCTTCGCGGCAAAGAACAC	0.502																																						ENST00000399298.3	1.000000	2.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.118609	0.070000	0.070000																										0				18						c.(868-870)gCc>gTc		transmembrane protein 26							103.0	108.0	107.0					10																	63170318		2114	4229	6343	SO:0001583	missense	219623	0	0					g.chr10:63170318G>A	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.869C>T	chr10.hg19:g.63170318G>A	ENSP00000382237:p.Ala290Val	0					TMEM26_ENST00000507507.1_5'UTR	p.A290V	NM_178505.6	NP_848600.2	1	2	3	2.192118	Q6ZUK4	TMM26_HUMAN		6	1237	-	Prostate(12;0.0112)		Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	ENST00000399298.3	0	1	hg19	c.869C>T	CCDS41530.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834333	0.91036	.	.	ENSG00000196932	ENST00000399298	.	.	.	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.109707	0.64402	D	0.000011	T	0.66177	0.2763	L	0.33189	0.99	0.80722	D	1	D	0.63046	0.992	P	0.59012	0.85	T	0.66732	-0.5849	9	0.66056	D	0.02	-2.1204	20.3967	0.98985	0.0:0.0:1.0:0.0	.	290	Q6ZUK4	TMM26_HUMAN	V	290	.	ENSP00000382237:A290V	A	-	2	0	0	TMEM26	62840324	62840324	1.000000	0.71417	0.967000	0.41034	0.382000	0.30200	9.416000	0.97383	2.829000	0.97493	0.655000	0.94253	GCC	0.576041		TCGA-OE-A75W-01A-12D-A32N-08	0.502	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	0	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.770000	-2.806305	1	0.570000	NM_178505		0	5	5	0	247	247	0		1			0	0	41	0	0	0.938156	0	0	0	0	0	0	5	247
CYP2C8	1558	broad.mit.edu	37	10	96802653	96802653	+	Silent	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:96802653G>T	ENST00000371270.3	-	7	1237	c.1143C>A	c.(1141-1143)atC>atA	p.I381I	CYP2C8_ENST00000535898.1_Silent_p.I279I|CYP2C8_ENST00000539050.1_Silent_p.I295I	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	381					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	TTACCTTGGGGATGAGGTAGT	0.453																																						ENST00000371270.3	1.000000	6.000000e-02	1.700000e-01	8.000000e-02	0.120000	0.167360	0.120000	0.120000																										0				21						c.(1141-1143)atC>atA		cytochrome P450, family 2, subfamily C, polypeptide 8	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)						181.0	164.0	170.0					10																	96802653		2203	4300	6503	SO:0001819	synonymous_variant	1558	0	0					g.chr10:96802653G>T	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.1143C>A	chr10.hg19:g.96802653G>T		0					CYP2C8_ENST00000539050.1_Silent_p.I295I|CYP2C8_ENST00000535898.1_Silent_p.I279I	p.I381I	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	1	2	3	2.213635	P10632	CP2C8_HUMAN		7	1237	-		Colorectal(252;0.0397)	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Silent	SNP	ENST00000371270.3	1	1	hg19	c.1143C>A	CCDS7438.1	0																																																																																								0.577229		TCGA-OE-A75W-01A-12D-A32N-08	0.453	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	0	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	1.770000	-3.858464	1	0.570000	NM_000770		0	14	14	0	407	403	0		1	0		0	0	84	0	0	0.999747	5.775729e-02	0	0	0	11	0	14	407
ATRNL1	26033	broad.mit.edu	37	10	117154220	117154220	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr10:117154220G>A	ENST00000355044.3	+	20	3353	c.3227G>A	c.(3226-3228)tGt>tAt	p.C1076Y	ATRNL1_ENST00000423111.2_Missense_Mutation_p.C127Y|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1076	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACAGGAAAATGTTTCTGCACA	0.343																																						ENST00000355044.3	1.000000	8.400000e-01	1	9.300000e-01	0.990000	0.977569	0.990000	1.000000																										0				95						c.(3226-3228)tGt>tAt		attractin-like 1							144.0	132.0	136.0					10																	117154220		2203	4300	6503	SO:0001583	missense	26033	0	0					g.chr10:117154220G>A	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3227G>A	chr10.hg19:g.117154220G>A	ENSP00000347152:p.Cys1076Tyr	0					ATRNL1_ENST00000303745.7_5'UTR|ATRNL1_ENST00000423111.2_Missense_Mutation_p.C127Y	p.C1076Y	NM_207303.2	NP_997186.1	1	2	3	2.213635	Q5VV63	ATRN1_HUMAN		20	3353	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	1	1	hg19	c.3227G>A	CCDS7592.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.976281|3.976281	0.74360|0.74360	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;T|.	0.62105|.	0.05;0.05|.	5.61|5.61	5.61|5.61	0.85477|0.85477	5.61|5.61	5.61|5.61	0.85477|0.85477	EGF-like, laminin (1);|.	0.087453|.	0.85682|.	D|.	0.000000|.	D|D	0.86531|0.86531	0.5955|0.5955	H|H	0.94222|0.94222	3.51|3.51	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.78314|.	0.991;0.991|.	D|D	0.89807|0.89807	0.3979|0.3979	10|5	0.87932|.	D|.	0|.	-20.6284|-20.6284	15.1377|15.1377	0.72583|0.72583	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	127;1076|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	Y|I	1076;127|159	ENSP00000347152:C1076Y;ENSP00000409624:C127Y|.	ENSP00000347152:C1076Y|.	C|M	+|+	2|3	0|0	0|0	ATRNL1|ATRNL1	117144210|117144210	117144210|117144210	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.632000|7.632000	0.83247|0.83247	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	TGT|ATG	0.577229		TCGA-OE-A75W-01A-12D-A32N-08	0.343	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.770000	-20.000000	1	0.570000	XM_049349		0	79	76	0	194	193	1		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	79	194
KIAA1377	57562	broad.mit.edu	37	11	101833633	101833633	+	Missense_Mutation	SNP	A	A	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:101833633A>T	ENST00000263468.8	+	6	2137	c.1867A>T	c.(1867-1869)Att>Ttt	p.I623F	KIAA1377_ENST00000537689.1_Missense_Mutation_p.I424F	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	623										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AGGTGCAGAAATTCCAAAGAC	0.318																																						ENST00000263468.8	1.000000	7.400000e-01	1	8.300000e-01	0.940000	0.928787	0.940000	1.000000																										0				53						c.(1867-1869)Att>Ttt		KIAA1377							33.0	37.0	35.0					11																	101833633		2201	4295	6496	SO:0001583	missense	57562	0	0					g.chr11:101833633A>T	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1867A>T	chr11.hg19:g.101833633A>T	ENSP00000263468:p.Ile623Phe	0					KIAA1377_ENST00000537689.1_Missense_Mutation_p.I424F	p.I623F	NM_020802.2	NP_065853.2	1	2	3	2.161715	Q9P2H0	K1377_HUMAN		6	2137	+	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	1	1	hg19	c.1867A>T	CCDS31658.1	1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.953067	0.34471	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08807	3.05;3.05	5.42	4.26	0.50523	5.42	4.26	0.50523	.	0.353806	0.27206	N	0.020421	T	0.19446	0.0467	M	0.68317	2.08	0.33432	D	0.581278	D	0.53151	0.958	P	0.54312	0.748	T	0.22556	-1.0213	10	0.48119	T	0.1	-7.3063	12.5825	0.56397	0.8611:0.1389:0.0:0.0	.	623	Q9P2H0	K1377_HUMAN	F	623;424	ENSP00000263468:I623F;ENSP00000443184:I424F	ENSP00000263468:I623F	I	+	1	0	0	KIAA1377	101338843	101338843	0.995000	0.38212	0.784000	0.31847	0.115000	0.19883	3.384000	0.52478	0.952000	0.37798	0.459000	0.35465	ATT	0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.318	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.770000	-20.000000	1	0.570000	NM_020802		0	55	54	0	149	147	1		1			0	0	28	0	0	1.000000	0	0	0	0	0	0	55	149
ELMOD1	55531	broad.mit.edu	37	11	107506439	107506439	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:107506439G>A	ENST00000265840.7	+	6	633	c.368G>A	c.(367-369)cGt>cAt	p.R123H	ELMOD1_ENST00000443271.2_Missense_Mutation_p.R123H|ELMOD1_ENST00000531234.1_Missense_Mutation_p.R117H	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	123					phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		GAAAAACTGCGTAGAGAGGCC	0.433																																						ENST00000265840.7	0.190000	3.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.105137	0.090000	0.100000																										0				19						c.(367-369)cGt>cAt		ELMO/CED-12 domain containing 1							154.0	144.0	147.0					11																	107506439		1887	4121	6008	SO:0001583	missense	55531	1	120828	37				g.chr11:107506439G>A	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.368G>A	chr11.hg19:g.107506439G>A	ENSP00000265840:p.Arg123His	0					ELMOD1_ENST00000531234.1_Missense_Mutation_p.R117H|ELMOD1_ENST00000443271.2_Missense_Mutation_p.R123H	p.R123H	NM_018712.3	NP_061182.3	1	2	3	2.161715	Q8N336	ELMD1_HUMAN		6	633	+		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	ENST00000265840.7	0	1	hg19	c.368G>A	CCDS44723.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.318541	0.95682	.	.	ENSG00000110675	ENST00000531234;ENST00000265840;ENST00000443271	T;T;T	0.33865	1.39;1.39;1.39	5.57	5.57	0.84162	5.57	5.57	0.84162	Engulfment/cell motility, ELMO (1);	0.000000	0.85682	D	0.000000	T	0.65154	0.2664	M	0.81614	2.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.993	T	0.66337	-0.5949	10	0.56958	D	0.05	.	19.918	0.97070	0.0:0.0:1.0:0.0	.	123;123	Q8N336;G5E9S5	ELMD1_HUMAN;.	H	117;123;123	ENSP00000433232:R117H;ENSP00000265840:R123H;ENSP00000412257:R123H	ENSP00000265840:R123H	R	+	2	0	0	ELMOD1	107011649	107011649	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.989000	0.93506	2.785000	0.95823	0.591000	0.81541	CGT	0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.433	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	0	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	1.770000	-3.405233	1	0.570000	NM_018712		0	7	7	0	258	257	0		1			0	0	53	0	0	0.980738	0	0	0	0	0	0	7	258
PTDSS2	81490	broad.mit.edu	37	11	473950	473950	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:473950G>A	ENST00000308020.5	+	3	516	c.340G>A	c.(340-342)Gac>Aac	p.D114N	PTDSS2_ENST00000530087.1_3'UTR	NM_030783.1	NP_110410.1	Q9BVG9	PTSS2_HUMAN	phosphatidylserine synthase 2	114					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CDP-diacylglycerol-serine O-phosphatidyltransferase activity (GO:0003882)			autonomic_ganglia(1)|breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(1)	9		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)	ACAAGCTAAAGACGGGCCATT	0.483																																						ENST00000308020.5	0.990000	7.600000e-01	9.400000e-01	8.100000e-01	0.870000	0.882983	0.870000	0.880000																										0				9						c.(340-342)Gac>Aac		phosphatidylserine synthase 2	Phosphatidylserine(DB00144)						324.0	252.0	276.0					11																	473950		2203	4300	6503	SO:0001583	missense	81490	0	0					g.chr11:473950G>A	BC001210	CCDS7696.1	11p15	2008-05-02			ENSG00000174915	ENSG00000174915			15463	protein-coding gene	gene with protein product		612793				14984733	Standard	NM_030783		Approved	PSS2	uc001lpj.3	Q9BVG9	OTTHUMG00000119087	ENST00000308020.5:c.340G>A	chr11.hg19:g.473950G>A	ENSP00000308258:p.Asp114Asn	0					PTDSS2_ENST00000530087.1_3'UTR	p.D114N	NM_030783.1	NP_110410.1	0	0	0	2.095420	Q9BVG9	PTSS2_HUMAN		3	516	+		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		Missense_Mutation	SNP	ENST00000308020.5	1	1	hg19	c.340G>A	CCDS7696.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281337	0.80692	.	.	ENSG00000174915	ENST00000308020	.	.	.	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.059306	0.64402	D	0.000003	T	0.33147	0.0853	N	0.11341	0.13	0.58432	D	0.999999	P	0.38617	0.64	B	0.32465	0.146	T	0.20107	-1.0285	9	0.30078	T	0.28	-23.8077	17.6882	0.88262	0.0:0.0:1.0:0.0	.	114	Q9BVG9	PTSS2_HUMAN	N	114	.	ENSP00000308258:D114N	D	+	1	0	0	PTDSS2	463950	463950	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.943000	0.92975	2.545000	0.85829	0.462000	0.41574	GAC	0.559967		TCGA-OE-A75W-01A-12D-A32N-08	0.483	PTDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239301.2	1	0	1	2	2	2	2	0	0	0	0	114	114	114	111	1	1.770000	-20.000000	1	0.570000			0	168	165	0	485	471	1		1	1		0	0	114	0	0	1.000000	9.830410e-01	0	3	0	18	0	168	485
OR51A2	401667	broad.mit.edu	37	11	4976514	4976514	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:4976514C>T	ENST00000380371.1	-	1	429	c.430G>A	c.(430-432)Gcc>Acc	p.A144T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCTATTTGGGCAACTCTGACA	0.423																																						ENST00000380371.1	0.280000	1.700000e-01	2.600000e-01	1.900000e-01	0.220000	0.230016	0.220000	0.220000																										0				17						c.(430-432)Gcc>Acc		olfactory receptor, family 51, subfamily A, member 2							111.0	83.0	93.0					11																	4976514		2037	3775	5812	SO:0001583	missense	401667	0	0					g.chr11:4976514C>T	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.430G>A	chr11.hg19:g.4976514C>T	ENSP00000369729:p.Ala144Thr	0					MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	p.A144T	NM_001004748.1	NP_001004748.1	0	0	0	2.141750	Q8NGJ7	O51A2_HUMAN		1	429	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Missense_Mutation	SNP	ENST00000380371.1	1	1	hg19	c.430G>A	CCDS31368.1	0	.	.	.	.	.	.	.	.	.	.	-	9.509	1.105347	0.20632	.	.	ENSG00000205496	ENST00000380371	T	0.37752	1.18	3.13	-4.86	0.03132	3.13	-4.86	0.03132	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.23054	0.0557	L	0.43598	1.365	0.09310	N	1	B	0.19583	0.037	B	0.24006	0.05	T	0.28996	-1.0026	9	0.28530	T	0.3	.	3.2793	0.06909	0.4379:0.2384:0.0:0.3237	.	144	Q8NGJ7	O51A2_HUMAN	T	144	ENSP00000369729:A144T	ENSP00000369729:A144T	A	-	1	0	0	OR51A2	4933090	4933090	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-6.391000	0.00068	-1.068000	0.03156	0.395000	0.25975	GCC	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.423	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	1	0	1	2	2	2	2	0	0	0	0	224	224	224	259	1	1.770000	-12.040710	1	0.570000	NM_001004748		0	73	58	0	1053	903	0		1			0	0	224	0	0	1.000000	0	0	0	0	0	0	73	1053
SHANK2	22941	broad.mit.edu	37	11	70333392	70333392	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:70333392G>A	ENST00000423696.2	-	15	1905	c.1869C>T	c.(1867-1869)gtC>gtT	p.V623V	SHANK2_ENST00000449833.2_Silent_p.V407V|SHANK2_ENST00000338508.4_Silent_p.V1003V|SHANK2_ENST00000409161.1_Silent_p.V406V			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	623					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GCTTGGCGGGGACGTAGACGG	0.617																																						ENST00000423696.2	0.070000	0	5.000000e-02	2.000000e-02	0.030000	0.038887	0.030000	0.040000																										0				62						c.(1867-1869)gtC>gtT		SH3 and multiple ankyrin repeat domains 2							116.0	124.0	122.0					11																	70333392		2200	4294	6494	SO:0001819	synonymous_variant	22941	0	0					g.chr11:70333392G>A	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1869C>T	chr11.hg19:g.70333392G>A		0					SHANK2_ENST00000338508.4_Silent_p.V1003V|SHANK2_ENST00000449833.2_Silent_p.V407V|SHANK2_ENST00000409161.1_Silent_p.V406V	p.V623V			1	2	3	2.161715	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)	15	1905	-			C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	0	1	hg19	c.1869C>T		0																																																																																								0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.617	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	251	251	251	248	1	1.770000	-3.075588	1	0.570000	NM_012309		0	11	11	0	1090	1073	0		1			0	0	251	0	0	0.998174	0	0	0	0	0	0	11	1090
NADSYN1	55191	broad.mit.edu	37	11	71194032	71194032	+	Missense_Mutation	SNP	C	C	T	rs149234649		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:71194032C>T	ENST00000319023.2	+	14	1476	c.1288C>T	c.(1288-1290)Cgg>Tgg	p.R430W	NADSYN1_ENST00000526039.2_3'UTR|NADSYN1_ENST00000539574.1_Missense_Mutation_p.R170W|NADSYN1_ENST00000530055.1_Missense_Mutation_p.R59W	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	430	Ligase. {ECO:0000250}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)	p.R430M(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	GACGTGCACCCGGGCCAGAGA	0.607																																					Ovarian(79;763 1781 6490 50276)	ENST00000319023.2	0.460000	2.400000e-01	4.000000e-01	2.900000e-01	0.340000	0.351215	0.340000	0.340000																										1	Substitution - Missense(1)	p.R430M(1)	lung(1)	25						c.(1288-1290)Cgg>Tgg		NAD synthetase 1	L-Glutamine(DB00130)	C	TRP/ARG	0,4400		0,0,2200	97.0	87.0	90.0		1288	-1.9	0.0	11	dbSNP_134	90	3,8585	3.0+/-9.4	0,3,4291	yes	missense	NADSYN1	NM_018161.4	101	0,3,6491	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	430/707	71194032	3,12985	2200	4294	6494	SO:0001583	missense	55191	22	121412	46				g.chr11:71194032C>T	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.1288C>T	chr11.hg19:g.71194032C>T	ENSP00000326424:p.Arg430Trp	0					NADSYN1_ENST00000526039.2_3'UTR|NADSYN1_ENST00000530055.1_Missense_Mutation_p.R59W|NADSYN1_ENST00000539574.1_Missense_Mutation_p.R170W	p.R430W	NM_018161.4	NP_060631.2	1	2	3	2.161715	Q6IA69	NADE_HUMAN		14	1476	+			B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	ENST00000319023.2	1	1	hg19	c.1288C>T	CCDS8201.1	0	.	.	.	.	.	.	.	.	.	.	C	13.99	2.400419	0.42613	0.0	3.49E-4	ENSG00000172890	ENST00000319023;ENST00000539574;ENST00000529840;ENST00000530055	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.06	-1.88	0.07713	4.06	-1.88	0.07713	NAD/GMP synthase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.69061	0.3069	H	0.94808	3.585	0.49798	D	0.999826	D;D	0.89917	1.0;1.0	D;D	0.91635	0.977;0.999	T	0.73780	-0.3875	10	0.87932	D	0	-26.347	12.5193	0.56050	0.3856:0.6144:0.0:0.0	.	170;430	B3KUU4;Q6IA69	.;NADE_HUMAN	W	430;170;59;59	ENSP00000326424:R430W;ENSP00000443718:R170W;ENSP00000437172:R59W;ENSP00000431820:R59W	ENSP00000326424:R430W	R	+	1	2	2	NADSYN1	70871680	70871680	0.927000	0.31430	0.007000	0.13788	0.216000	0.24613	0.660000	0.25009	-0.610000	0.05716	-0.397000	0.06425	CGG	0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.607	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	1	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	1.770000	-2.598634	1	0.570000	NM_018161		0	39	39	0	359	356	0		1	1		0	0	80	0	0	1.000000	9.999999e-01	0	41	0	187	0	39	359
ME3	10873	broad.mit.edu	37	11	86158183	86158183	+	Missense_Mutation	SNP	C	C	T	rs15926		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:86158183C>T	ENST00000393324.3	-	11	1557	c.1304G>A	c.(1303-1305)cGc>cAc	p.R435H	ME3_ENST00000359636.2_Missense_Mutation_p.R435H|ME3_ENST00000543262.1_Missense_Mutation_p.R435H|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	435					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GATGATAGGGCGCTCGTGGAA	0.622																																						ENST00000393324.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999676	0.990000	1.000000																										0				27						c.(1303-1305)cGc>cAc		malic enzyme 3, NADP(+)-dependent, mitochondrial							80.0	73.0	76.0					11																	86158183		2202	4299	6501	SO:0001583	missense	10873	0	0					g.chr11:86158183C>T	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1304G>A	chr11.hg19:g.86158183C>T	ENSP00000376998:p.Arg435His	0					ME3_ENST00000543262.1_Missense_Mutation_p.R435H|ME3_ENST00000359636.2_Missense_Mutation_p.R435H|RP11-317J19.1_ENST00000524610.1_RNA	p.R435H	NM_001014811.1	NP_001014811.1	1	2	3	2.161715	Q16798	MAON_HUMAN		11	1557	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	1	1	hg19	c.1304G>A	CCDS8277.1	1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025030	0.35701	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.38	3.42	0.39159	5.38	3.42	0.39159	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.098256	0.64402	N	0.000002	T	0.48926	0.1527	M	0.81802	2.56	0.80722	D	1	B	0.19331	0.035	B	0.21546	0.035	T	0.43343	-0.9397	9	.	.	.	.	11.3629	0.49655	0.0:0.845:0.0:0.155	.	435	Q16798	MAON_HUMAN	H	435	ENSP00000352657:R435H;ENSP00000440246:R435H;ENSP00000376998:R435H;ENSP00000431182:R435H	.	R	-	2	0	0	ME3	85835831	85835831	1.000000	0.71417	0.997000	0.53966	0.096000	0.18686	3.210000	0.51129	0.683000	0.31428	-0.355000	0.07637	CGC	0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.622	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2	1	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	1.770000	-20.000000	1	0.570000			0	103	103	0	195	195	1		1	1		0	0	59	0	0	1.000000	1	0	19	0	37	0	103	195
ACRV1	56	broad.mit.edu	37	11	125548083	125548083	+	Silent	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr11:125548083A>G	ENST00000533904.1	-	2	504	c.162T>C	c.(160-162)gcT>gcC	p.A54A	ACRV1_ENST00000453509.1_Intron|ACRV1_ENST00000527795.1_Intron|ACRV1_ENST00000353070.1_Intron|ACRV1_ENST00000425431.1_Intron|ACRV1_ENST00000315608.3_Silent_p.A54A|ACRV1_ENST00000345274.1_Intron|ACRV1_ENST00000530048.1_Intron|ACRV1_ENST00000445562.1_Intron|ACRV1_ENST00000348856.3_Intron			P26436	ASPX_HUMAN	acrosomal vesicle protein 1	54					multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				kidney(1)|large_intestine(3)|lung(2)	6	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		TCTCATATAAAGCCTCAGCAT	0.463																																						ENST00000533904.1	1.000000	7.400000e-01	1	8.200000e-01	0.910000	0.911286	0.910000	1.000000																										0				6						c.(160-162)gcT>gcC		acrosomal vesicle protein 1							67.0	62.0	64.0					11																	125548083		2201	4299	6500	SO:0001819	synonymous_variant	56	0	0					g.chr11:125548083A>G	AK223335	CCDS8460.1, CCDS8461.1, CCDS44759.1, CCDS44761.1	11q24.2	2012-05-16			ENSG00000134940	ENSG00000134940			127	protein-coding gene	gene with protein product	"""sperm protein 10"""	102525				1693291, 8288254	Standard	NM_001612		Approved	SPACA2, SP-10, D11S4365	uc001qcs.3	P26436	OTTHUMG00000165854	ENST00000533904.1:c.162T>C	chr11.hg19:g.125548083A>G		0					ACRV1_ENST00000445562.1_Intron|ACRV1_ENST00000425431.1_Intron|ACRV1_ENST00000315608.3_Silent_p.A54A|ACRV1_ENST00000453509.1_Intron|ACRV1_ENST00000345274.1_Intron|ACRV1_ENST00000530048.1_Intron|ACRV1_ENST00000353070.1_Intron|ACRV1_ENST00000348856.3_Intron|ACRV1_ENST00000527795.1_Intron	p.A54A			1	2	3	2.161715	P26436	ASPX_HUMAN		2	504	-	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	Q53FF4	Silent	SNP	ENST00000533904.1	1	1	hg19	c.162T>C	CCDS8460.1	1																																																																																								0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.463	ACRV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386722.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	63	1	1.770000	-20.000000	1	0.570000	NM_001612		0	79	79	0	224	224	1		1			0	0	65	0	0	1.000000	0	0	0	0	0	0	79	224
TBX5	6910	broad.mit.edu	37	12	114839668	114839668	+	Missense_Mutation	SNP	C	C	T	rs104894377		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:114839668C>T	ENST00000310346.4	-	3	871	c.205G>A	c.(205-207)Gaa>Aaa	p.E69K	TBX5_ENST00000405440.2_Missense_Mutation_p.E69K|TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000526441.1_Missense_Mutation_p.E69K|TBX5_ENST00000349716.5_Missense_Mutation_p.E19K	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	69					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.E69K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GTGCCCACTTCGTGGAATTTT	0.463																																					NSCLC(152;1358 1980 4050 23898 40356)	ENST00000310346.4	0.950000	6.400000e-01	8.800000e-01	7.100000e-01	0.790000	0.799297	0.790000	0.800000																										1	Substitution - Missense(1)	p.E69K(1)	skin(1)	56	GRCh37	CM971436	TBX5	M	rs104894377	c.(205-207)Gaa>Aaa		T-box 5							178.0	144.0	156.0					12																	114839668		2203	4300	6503	SO:0001583	missense	6910	0	0					g.chr12:114839668C>T	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.205G>A	chr12.hg19:g.114839668C>T	ENSP00000309913:p.Glu69Lys	0					TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000405440.2_Missense_Mutation_p.E69K|TBX5_ENST00000349716.5_Missense_Mutation_p.E19K|TBX5_ENST00000526441.1_Missense_Mutation_p.E69K	p.E69K	NM_000192.3	NP_000183.2	0	0	0	2.012138	Q99593	TBX5_HUMAN		3	871	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	1	1	hg19	c.205G>A	CCDS9173.1	0	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642376	0.47153	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000405440;ENST00000526441	D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54	5.07	5.07	0.68467	5.07	5.07	0.68467	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.105066	0.64402	D	0.000005	T	0.79678	0.4487	N	0.20401	0.57	0.80722	D	1	B;B	0.18310	0.027;0.013	B;B	0.17098	0.017;0.004	T	0.73681	-0.3906	10	0.22706	T	0.39	.	11.0049	0.47629	0.0:0.9151:0.0:0.0849	.	69;69	Q99593-2;Q99593	.;TBX5_HUMAN	K	19;69;69;69	ENSP00000337723:E19K;ENSP00000309913:E69K;ENSP00000384152:E69K;ENSP00000433292:E69K	ENSP00000309913:E69K	E	-	1	0	0	TBX5	113324051	113324051	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.914000	0.69964	2.359000	0.80004	0.561000	0.74099	GAA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.463	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.770000	-4.668860	1	0.570000	NM_080717		0	77	76	0	241	235	1		1			0	0	74	0	0	1.000000	0	0	0	0	0	0	77	241
MORN3	283385	broad.mit.edu	37	12	122091031	122091031	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:122091031C>T	ENST00000355329.3	-	4	768	c.598G>A	c.(598-600)Gac>Aac	p.D200N		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	200						nucleus (GO:0005634)		p.D200Y(1)		breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		CGGCCAAAGTCGATCATCGTC	0.607																																						ENST00000355329.3	0.190000	3.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.105605	0.090000	0.090000																										1	Substitution - Missense(1)	p.D200Y(1)	stomach(1)	9						c.(598-600)Gac>Aac		MORN repeat containing 3							51.0	42.0	45.0					12																	122091031		2203	4300	6503	SO:0001583	missense	283385	1	121410	22				g.chr12:122091031C>T	BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.598G>A	chr12.hg19:g.122091031C>T	ENSP00000347486:p.Asp200Asn	0						p.D200N	NM_173855.4	NP_776254.3	0	0	0	2.012138	Q6PF18	MORN3_HUMAN		4	768	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		Q86YQ9	Missense_Mutation	SNP	ENST00000355329.3	0	1	hg19	c.598G>A	CCDS31917.1	0	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929149	0.92389	.	.	ENSG00000139714	ENST00000355329	T	0.74315	-0.83	4.86	4.86	0.63082	4.86	4.86	0.63082	.	0.053142	0.64402	D	0.000001	D	0.83059	0.5172	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.83861	0.0268	10	0.52906	T	0.07	.	17.952	0.89056	0.0:1.0:0.0:0.0	.	200	Q6PF18	MORN3_HUMAN	N	200	ENSP00000347486:D200N	ENSP00000347486:D200N	D	-	1	0	0	MORN3	120575414	120575414	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.215000	0.65241	2.422000	0.82143	0.561000	0.74099	GAC	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.607	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402154.1	0	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	1.770000	-7.134443	1	0.570000	NM_173855		0	5	5	0	179	178	0		1	0		0	0	36	0	0	0.937510	2.826317e-02	0	0	0	8	0	5	179
LRP6	4040	broad.mit.edu	37	12	12300383	12300383	+	Missense_Mutation	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:12300383A>G	ENST00000261349.4	-	15	3390	c.3314T>C	c.(3313-3315)aTt>aCt	p.I1105T	LRP6_ENST00000543091.1_Missense_Mutation_p.I1105T	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1105	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GGCTAAAGCAATTGGTTTACT	0.453																																						ENST00000261349.4	1.000000	7.800000e-01	9.600000e-01	8.400000e-01	0.890000	0.903579	0.890000	0.900000																										0				85						c.(3313-3315)aTt>aCt		low density lipoprotein receptor-related protein 6							125.0	127.0	126.0					12																	12300383		2203	4300	6503	SO:0001583	missense	4040	0	0					g.chr12:12300383A>G	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3314T>C	chr12.hg19:g.12300383A>G	ENSP00000261349:p.Ile1105Thr	0					LRP6_ENST00000543091.1_Missense_Mutation_p.I1105T	p.I1105T	NM_002336.2	NP_002327.2	0	0	0	2.051268	O75581	LRP6_HUMAN		15	3390	-		Prostate(47;0.0865)	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	1	1	hg19	c.3314T>C	CCDS8647.1	1	.	.	.	.	.	.	.	.	.	.	A	7.457	0.643887	0.14451	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.95588	-3.75;-3.75	5.69	5.69	0.88448	5.69	5.69	0.88448	Six-bladed beta-propeller, TolB-like (1);	0.519638	0.17309	U	0.178962	D	0.84338	0.5450	N	0.00569	-1.365	0.50171	D	0.999857	B;B	0.15141	0.007;0.012	B;B	0.23419	0.046;0.036	T	0.81077	-0.1096	10	0.11182	T	0.66	.	15.9477	0.79806	1.0:0.0:0.0:0.0	.	1105;1105	F5H7J9;O75581	.;LRP6_HUMAN	T	1105	ENSP00000261349:I1105T;ENSP00000442472:I1105T	ENSP00000261349:I1105T	I	-	2	0	0	LRP6	12191650	12191650	0.964000	0.33143	0.960000	0.40013	0.960000	0.62799	8.962000	0.93254	2.179000	0.69175	0.460000	0.39030	ATT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1	1	0	1	2	2	2	2	0	0	0	0	124	124	124	121	1	1.770000	-20.000000	1	0.570000			0	180	180	0	491	489	1		1		0	0	0	124	0	0	1.000000	0	0	0	0	0	1	180	491
CLIP1	6249	broad.mit.edu	37	12	122825973	122825973	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:122825973G>A	ENST00000540338.1	-	10	1819	c.1778C>T	c.(1777-1779)aCc>aTc	p.T593I	CLIP1_ENST00000361654.4_Missense_Mutation_p.T547I|CLIP1_ENST00000302528.7_Missense_Mutation_p.T582I|CLIP1_ENST00000358808.2_Missense_Mutation_p.T582I|CLIP1_ENST00000537178.1_Missense_Mutation_p.T547I|CLIP1_ENST00000545889.1_Missense_Mutation_p.T283I			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	593					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTCCGTGGCGGTATACAGAGC	0.458																																						ENST00000540338.1	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.034060	0.020000	0.030000																										0				60						c.(1777-1779)aCc>aTc		CAP-GLY domain containing linker protein 1							142.0	143.0	142.0					12																	122825973		2203	4300	6503	SO:0001583	missense	6249	0	0					g.chr12:122825973G>A		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1778C>T	chr12.hg19:g.122825973G>A	ENSP00000439093:p.Thr593Ile	0					CLIP1_ENST00000361654.4_Missense_Mutation_p.T547I|CLIP1_ENST00000545889.1_Missense_Mutation_p.T283I|CLIP1_ENST00000537178.1_Missense_Mutation_p.T547I|CLIP1_ENST00000302528.7_Missense_Mutation_p.T582I|CLIP1_ENST00000358808.2_Missense_Mutation_p.T582I	p.T593I			0	0	0	2.012138	P30622	CLIP1_HUMAN		10	1819	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	0	1	hg19	c.1778C>T	CCDS58285.1	0	.	.	.	.	.	.	.	.	.	.	G	7.866	0.727207	0.15439	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304	T;T;T;T;T;T	0.61627	2.74;0.69;0.69;0.7;0.69;0.09	5.37	0.13	0.14746	5.37	0.13	0.14746	.	0.766493	0.13191	N	0.406706	T	0.23965	0.0580	N	0.01352	-0.895	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.18116	-1.0347	10	0.44086	T	0.13	3.1754	5.4745	0.16688	0.372:0.1308:0.4972:0.0	.	283;547;582;593	F5H0N7;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	I	283;582;582;427;547;593;516	ENSP00000438743:T283I;ENSP00000303585:T582I;ENSP00000351665:T582I;ENSP00000445531:T547I;ENSP00000439093:T593I;ENSP00000437786:T516I	ENSP00000303585:T582I	T	-	2	0	0	CLIP1	121391926	121391926	0.848000	0.29623	0.000000	0.03702	0.566000	0.35808	2.612000	0.46343	0.033000	0.15463	0.561000	0.74099	ACC	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.458	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	0	0	1	2	17	2	2	1	1	1	1	185	185	185	185	1	1.770000	-2.212927	0	0.570000	NM_002956		0	8	8	0	857	848	0		0	0		1	0	185	0	0	0.049530	1.165960e-03	0	0	0	5	0	8	857
NTF3	4908	broad.mit.edu	37	12	5603958	5603958	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:5603958C>T	ENST00000331010.6	+	1	661	c.578C>T	c.(577-579)aCg>aTg	p.T193M	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.T206M	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	193					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						TTTTATGAAACGCGATGTAAG	0.507																																					GBM(194;1104 2182 8339 9578 18493)	ENST00000331010.6	0.430000	2.100000e-01	3.800000e-01	2.600000e-01	0.310000	0.323689	0.310000	0.320000																										0				22						c.(577-579)aCg>aTg		neurotrophin 3							55.0	55.0	55.0					12																	5603958		2203	4300	6503	SO:0001583	missense	4908	0	0					g.chr12:5603958C>T		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.578C>T	chr12.hg19:g.5603958C>T	ENSP00000328738:p.Thr193Met	0					NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.T206M	p.T193M	NM_002527.4	NP_002518.1	0	0	0	2.055069	P20783	NTF3_HUMAN		1	661	+			B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	1	1	hg19	c.578C>T	CCDS8538.1	0	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155349	0.78114	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.73681	-0.77;-0.77	5.45	5.45	0.79879	5.45	5.45	0.79879	Nerve growth factor-related (5);	0.000000	0.85682	D	0.000000	D	0.87665	0.6234	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89132	0.3510	10	0.87932	D	0	-33.1613	18.2818	0.90101	0.0:1.0:0.0:0.0	.	193;206	P20783;B7Z1T5	NTF3_HUMAN;.	M	206;193	ENSP00000397297:T206M;ENSP00000328738:T193M	ENSP00000328738:T193M	T	+	2	0	0	NTF3	5474219	5474219	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	7.818000	0.86416	2.583000	0.87209	0.650000	0.86243	ACG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.507	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	1.770000	-1.750592	0	0.570000			0	28	27	0	271	268	0		1	0		0	0	62	0	0	1.000000	4.990021e-02	0	0	0	4	0	28	271
GUCY2C	2984	broad.mit.edu	37	12	14766211	14766211	+	Missense_Mutation	SNP	C	C	T	rs118078831	byFrequency	TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:14766211C>T	ENST00000261170.3	-	27	3198	c.3062G>A	c.(3061-3063)cGt>cAt	p.R1021H	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	1021					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	TGCTTGCAAACGCTGTTGATT	0.413													C|||	2	0.000399361	0.0	0.0	5008	,	,		19834	0.002		0.0	False		,,,				2504	0.0					ENST00000261170.3	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.037489	0.030000	0.040000																										0				51						c.(3061-3063)cGt>cAt		guanylate cyclase 2C (heat stable enterotoxin receptor)	Linaclotide(DB08890)	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	155.0	164.0	161.0		3062	4.8	1.0	12	dbSNP_133	161	1,8599		0,1,4299	yes	missense	GUCY2C	NM_004963.3	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	1021/1074	14766211	2,13004	2203	4300	6503	SO:0001583	missense	2984	22	121406	50				g.chr12:14766211C>T		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.3062G>A	chr12.hg19:g.14766211C>T	ENSP00000261170:p.Arg1021His	0					RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	p.R1021H	NM_004963.3	NP_004954.2	0	0	0	2.051268	P25092	GUC2C_HUMAN		27	3198	-			B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	0	1	hg19	c.3062G>A	CCDS8664.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.52	2.560274	0.45590	2.27E-4	1.16E-4	ENSG00000070019	ENST00000261170	D	0.81659	-1.52	5.85	4.78	0.61160	5.85	4.78	0.61160	.	0.209202	0.48767	D	0.000168	T	0.73265	0.3565	L	0.39147	1.195	0.58432	D	0.999994	B	0.25272	0.122	B	0.20955	0.032	T	0.70346	-0.4897	10	0.42905	T	0.14	.	14.7732	0.69696	0.0:0.8799:0.0:0.1201	.	1021	P25092	GUC2C_HUMAN	H	1021	ENSP00000261170:R1021H	ENSP00000261170:R1021H	R	-	2	0	0	GUCY2C	14657478	14657478	0.984000	0.35163	0.979000	0.43373	0.997000	0.91878	2.584000	0.46102	2.773000	0.95371	0.655000	0.94253	CGT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.413	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1	0	0	1	2	2	2	2	0	0	0	0	143	143	143	142	1	1.770000	-2.806187	1	0.570000			0	7	7	0	707	702	0		1	0		0	0	143	0	0	0.980171	1.394695e-04	0	0	0	2	0	7	707
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	7.800000e-01	1	9.200000e-01	0.990000	0.972074	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.051268	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.770000	-20.000000	1	0.570000	NM_033360		2553	30	30	5469	63	63	1	1	1	1	1	0	0	18	304	1	1.000000	9.601079e-01	1	6	67	8	264	30	63
PPFIBP1	8496	broad.mit.edu	37	12	27832529	27832529	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:27832529G>C	ENST00000318304.8	+	19	2024	c.1741G>C	c.(1741-1743)Gat>Cat	p.D581H	PPFIBP1_ENST00000537927.1_Missense_Mutation_p.D428H|PPFIBP1_ENST00000228425.6_Missense_Mutation_p.D575H|PPFIBP1_ENST00000542629.1_Missense_Mutation_p.D550H	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	581					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					TCCATCTCCAGATTCCAAAAA	0.443																																						ENST00000318304.8	0.080000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.050245	0.040000	0.040000																									PPFIBP1/ALK(3)	0				32						c.(1741-1743)Gat>Cat		PTPRF interacting protein, binding protein 1 (liprin beta 1)							125.0	132.0	130.0					12																	27832529		2203	4300	6503	SO:0001583	missense	8496	0	0					g.chr12:27832529G>C	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.1741G>C	chr12.hg19:g.27832529G>C	ENSP00000314724:p.Asp581His	0					PPFIBP1_ENST00000537927.1_Missense_Mutation_p.D428H|PPFIBP1_ENST00000542629.1_Missense_Mutation_p.D550H|PPFIBP1_ENST00000228425.6_Missense_Mutation_p.D575H	p.D581H	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	0	0	0	2.051268	Q86W92	LIPB1_HUMAN		19	2024	+	Lung SC(9;0.0873)		O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	ENST00000318304.8	0	1	hg19	c.1741G>C	CCDS55812.1	0	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808956	0.90707	.	.	ENSG00000110841	ENST00000540114;ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.000000	0.35096	U	0.003459	D	0.87030	0.6076	L	0.59436	1.845	0.80722	D	1	D;D;D;P;D	0.89917	0.999;1.0;0.999;0.886;0.996	D;D;D;P;D	0.91635	0.981;0.999;0.928;0.847;0.967	D	0.87005	0.2119	10	0.66056	D	0.02	-23.4066	19.6581	0.95851	0.0:0.0:1.0:0.0	.	428;412;581;575;550	Q86W92-3;F5GZP6;Q86W92;Q86W92-2;Q86W92-4	.;.;LIPB1_HUMAN;.;.	H	412;428;581;550;575	ENSP00000444304:D412H;ENSP00000445425:D428H;ENSP00000314724:D581H;ENSP00000443442:D550H;ENSP00000228425:D575H	ENSP00000228425:D575H	D	+	1	0	0	PPFIBP1	27723796	27723796	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.039000	0.76544	2.735000	0.93741	0.655000	0.94253	GAT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.443	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	0	0	1	2	2	2	2	0	0	0	0	112	112	112	111	1	1.770000	-2.667391	1	0.570000	NM_003622		0	9	9	0	660	649	0		1			0	0	112	0	0	0.993808	0	0	0	0	0	0	9	660
NELL2	4753	broad.mit.edu	37	12	45169879	45169879	+	Missense_Mutation	SNP	T	T	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:45169879T>A	ENST00000429094.2	-	8	1321	c.817A>T	c.(817-819)Act>Tct	p.T273S	NELL2_ENST00000452445.2_Missense_Mutation_p.T273S|NELL2_ENST00000395487.2_Missense_Mutation_p.T272S|NELL2_ENST00000437801.2_Missense_Mutation_p.T323S|NELL2_ENST00000333837.4_Missense_Mutation_p.T296S|NELL2_ENST00000549027.1_Missense_Mutation_p.T272S|NELL2_ENST00000551601.1_Missense_Mutation_p.T272S	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	273	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ATGGTGCAAGTCCTTTCACAA	0.458																																						ENST00000429094.2	0.960000	6.200000e-01	8.800000e-01	7.000000e-01	0.780000	0.797052	0.780000	0.790000																										0				65						c.(817-819)Act>Tct		NEL-like 2 (chicken)							179.0	150.0	159.0					12																	45169879		2203	4300	6503	SO:0001583	missense	4753	0	0					g.chr12:45169879T>A	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.817A>T	chr12.hg19:g.45169879T>A	ENSP00000390680:p.Thr273Ser	0					NELL2_ENST00000437801.2_Missense_Mutation_p.T323S|NELL2_ENST00000549027.1_Missense_Mutation_p.T272S|NELL2_ENST00000452445.2_Missense_Mutation_p.T273S|NELL2_ENST00000395487.2_Missense_Mutation_p.T272S|NELL2_ENST00000333837.4_Missense_Mutation_p.T296S|NELL2_ENST00000551601.1_Missense_Mutation_p.T272S	p.T273S	NM_001145108.1	NP_001138580.1	0	0	0	2.051268	Q99435	NELL2_HUMAN		8	1321	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	1	1	hg19	c.817A>T	CCDS8746.1	0	.	.	.	.	.	.	.	.	.	.	T	12.43	1.935303	0.34189	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684;ENST00000550462;ENST00000552993	T;T;T;T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.61	5.61	0.85477	5.61	5.61	0.85477	von Willebrand factor, type C (1);	0.050756	0.85682	D	0.000000	T	0.38878	0.1057	N	0.13003	0.285	0.52099	D	0.999945	B;B;B;B;B;B	0.30824	0.01;0.296;0.045;0.036;0.027;0.185	B;B;B;B;B;B	0.24006	0.003;0.05;0.038;0.012;0.017;0.034	T	0.34428	-0.9829	10	0.10111	T	0.7	-16.8894	10.9681	0.47424	0.1394:0.0:0.0:0.8606	.	296;323;272;273;273;272	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.;.;.;.;NELL2_HUMAN;.	S	272;273;272;273;272;296;323;272;46;273	ENSP00000378866:T272S;ENSP00000390680:T273S;ENSP00000449332:T272S;ENSP00000394612:T273S;ENSP00000447927:T272S;ENSP00000327988:T296S;ENSP00000416341:T323S;ENSP00000450102:T46S;ENSP00000447085:T273S	ENSP00000327988:T296S	T	-	1	0	0	NELL2	43456146	43456146	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.818000	0.69236	2.137000	0.66172	0.528000	0.53228	ACT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.458	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.770000	-20.000000	1	0.570000	NM_006159		0	65	64	0	211	207	1		1	0		0	0	44	0	0	1.000000	0	0	0	0	1	0	65	211
ANO6	196527	broad.mit.edu	37	12	45814920	45814920	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:45814920C>T	ENST00000320560.8	+	18	2486	c.2284C>T	c.(2284-2286)Cct>Tct	p.P762S	ANO6_ENST00000435642.1_Missense_Mutation_p.P762S|ANO6_ENST00000423947.3_Missense_Mutation_p.P783S|ANO6_ENST00000441606.2_Missense_Mutation_p.P744S|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000425752.2_Missense_Mutation_p.P762S	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	762					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CTTCTCCGTCCCTCCCTACGG	0.473																																						ENST00000320560.8	1.000000	8.700000e-01	1	9.400000e-01	0.990000	0.979368	0.990000	1.000000																										0				46						c.(2284-2286)Cct>Tct		anoctamin 6							185.0	156.0	166.0					12																	45814920		2203	4300	6503	SO:0001583	missense	196527	0	0					g.chr12:45814920C>T	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.2284C>T	chr12.hg19:g.45814920C>T	ENSP00000320087:p.Pro762Ser	0					ANO6_ENST00000425752.2_Missense_Mutation_p.P762S|ANO6_ENST00000435642.1_Missense_Mutation_p.P762S|ANO6_ENST00000441606.2_Missense_Mutation_p.P744S|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000423947.3_Missense_Mutation_p.P783S	p.P762S	NM_001025356.2	NP_001020527.2	0	0	0	2.051268	Q4KMQ2	ANO6_HUMAN		18	2486	+			A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	1	1	hg19	c.2284C>T	CCDS31782.1	1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759155	0.31137	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.69435	-0.4;-0.27;-0.4;-0.26;-0.26	5.05	5.05	0.67936	5.05	5.05	0.67936	.	0.319688	0.35151	N	0.003416	T	0.55784	0.1942	L	0.34521	1.04	0.46798	D	0.999205	B;B;B;B	0.27068	0.008;0.055;0.167;0.006	B;B;B;B	0.23018	0.019;0.02;0.031;0.043	T	0.51718	-0.8670	10	0.13853	T	0.58	.	19.2834	0.94061	0.0:1.0:0.0:0.0	.	744;783;762;762	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	S	762;783;762;762;744	ENSP00000391417:P762S;ENSP00000409126:P783S;ENSP00000413840:P762S;ENSP00000320087:P762S;ENSP00000413137:P744S	ENSP00000320087:P762S	P	+	1	0	0	ANO6	44101187	44101187	0.996000	0.38824	0.803000	0.32268	0.219000	0.24729	3.992000	0.56980	2.717000	0.92951	0.650000	0.86243	CCT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.473	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	1	0	0	2	2	2	2	0	0	0	0	77	77	77	77	1	1.770000	-9.600790	1	0.570000	XM_113743		0	133	132	0	307	303	1		1	0		0	0	77	0	0	1.000000	9.197120e-02	0	0	0	2	0	133	307
RAPGEF3	10411	broad.mit.edu	37	12	48134500	48134500	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:48134500G>A	ENST00000449771.2	-	21	2244	c.2156C>T	c.(2155-2157)gCc>gTc	p.A719V	RP1-197B17.3_ENST00000547799.1_lincRNA|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.A677V|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.A719V|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.A677V|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.A628V|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.A677V			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	719	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		CAGCTCGGTGGCCACCCAGTA	0.652																																						ENST00000449771.2	0.100000	1.000000e-02	8.000000e-02	2.000000e-02	0.040000	0.055832	0.040000	0.050000																										0				25						c.(2155-2157)gCc>gTc		Rap guanine nucleotide exchange factor (GEF) 3							41.0	50.0	47.0					12																	48134500		2203	4300	6503	SO:0001583	missense	10411	0	0					g.chr12:48134500G>A	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.2156C>T	chr12.hg19:g.48134500G>A	ENSP00000395708:p.Ala719Val	0					RAPGEF3_ENST00000548919.1_Missense_Mutation_p.A628V|RP1-197B17.3_ENST00000547799.1_lincRNA|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.A719V|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.A677V|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.A677V|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.A677V	p.A719V			0	0	0	2.051268	O95398	RPGF3_HUMAN		21	2244	-	Lung SC(27;0.192)		A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	0	1	hg19	c.2156C>T	CCDS41775.1	0	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452324	0.43531	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	3.82	2.9	0.33743	3.82	2.9	0.33743	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.148106	0.44688	D	0.000440	T	0.16342	0.0393	N	0.16368	0.405	0.35502	D	0.799909	B	0.33841	0.428	B	0.38106	0.265	T	0.14144	-1.0483	10	0.02654	T	1	.	9.7478	0.40457	0.1057:0.0:0.8943:0.0	.	719	O95398	RPGF3_HUMAN	V	677;719;366;677;677;677;719;682;628	ENSP00000384521:A677V;ENSP00000395708:A719V;ENSP00000448619:A677V;ENSP00000171000:A677V;ENSP00000373864:A719V;ENSP00000448480:A628V	ENSP00000171000:A677V	A	-	2	0	0	RAPGEF3	46420767	46420767	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.182000	0.32029	1.870000	0.54199	0.561000	0.74099	GCC	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.652	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	0	0	0	2	2	2	2	0	0	0	0	81	81	81	80	1	1.770000	-5.074177	1	0.570000	NM_006105		0	5	4	0	354	348	0		1	0		0	0	81	0	0	0.934678	9.433103e-02	0	0	0	30	0	5	354
GALNT6	11226	broad.mit.edu	37	12	51749736	51749736	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:51749736C>G	ENST00000543196.2	-	10	1814	c.1609G>C	c.(1609-1611)Gag>Cag	p.E537Q	GALNT6_ENST00000356317.3_Missense_Mutation_p.E537Q			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	537	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GTTGTGTACTCAAAGTACTGG	0.547																																						ENST00000543196.2	0.110000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.063322	0.050000	0.060000																										0				27						c.(1609-1611)Gag>Cag		polypeptide N-acetylgalactosaminyltransferase 6							126.0	107.0	114.0					12																	51749736		2203	4300	6503	SO:0001583	missense	11226	0	0					g.chr12:51749736C>G	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1609G>C	chr12.hg19:g.51749736C>G	ENSP00000444171:p.Glu537Gln	0					GALNT6_ENST00000356317.3_Missense_Mutation_p.E537Q	p.E537Q			0	0	0	2.051268	Q8NCL4	GALT6_HUMAN		10	1814	-			Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	0	1	hg19	c.1609G>C	CCDS8813.1	0	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729653	0.69074	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.26810	1.71;1.71	3.92	3.92	0.45320	3.92	3.92	0.45320	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.54629	-0.8265	10	0.27082	T	0.32	.	15.908	0.79445	0.0:1.0:0.0:0.0	.	537	Q8NCL4	GALT6_HUMAN	Q	537;537;518	ENSP00000444171:E537Q;ENSP00000348668:E537Q	ENSP00000348668:E537Q	E	-	1	0	0	GALNT6	50036003	50036003	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	7.378000	0.79679	2.485000	0.83878	0.655000	0.94253	GAG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.547	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	0	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	1.770000	-2.650283	1	0.570000	NM_007210		0	7	7	0	416	414	0		1	0		0	0	67	0	0	0.980470	2.617245e-02	0	0	0	13	0	7	416
HOXC11	3227	broad.mit.edu	37	12	54367152	54367152	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:54367152G>A	ENST00000546378.1	+	1	243	c.127G>A	c.(127-129)Gag>Aag	p.E43K	HOXC11_ENST00000243082.4_Missense_Mutation_p.E43K|HOTAIR_ENST00000455246.1_RNA|HOTAIR_ENST00000424518.1_RNA			O43248	HXC11_HUMAN	homeobox C11	43					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						CTACATGCCCGAGTTCTCCAC	0.642			T	NUP98	AML																																	ENST00000546378.1	0.100000	2.000000e-02	8.000000e-02	4.000000e-02	0.060000	0.066415	0.060000	0.060000				Dom	yes			Dom	yes		12	12q13.3	12q13.3	3227	T	homeo box C11				L	L	NUP98		AML		0				2						c.(127-129)Gag>Aag		homeobox C11							114.0	119.0	117.0					12																	54367152		2203	4300	6503	SO:0001583	missense	3227	0	0					g.chr12:54367152G>A		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.127G>A	chr12.hg19:g.54367152G>A	ENSP00000446680:p.Glu43Lys	0					HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.E43K|HOTAIR_ENST00000424518.1_RNA	p.E43K			0	0	0	2.020472	O43248	HXC11_HUMAN		1	243	+			A8K7D1|Q96DH2	Missense_Mutation	SNP	ENST00000546378.1	0	1	hg19	c.127G>A	CCDS8867.1	0	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433131	0.83776	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	T;T	0.49432	0.78;0.78	4.47	4.47	0.54385	4.47	4.47	0.54385	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.052375	0.85682	D	0.000000	T	0.55955	0.1953	L	0.54323	1.7	0.58432	D	0.999998	P	0.51791	0.948	P	0.51999	0.687	T	0.61569	-0.7036	10	0.72032	D	0.01	.	16.4268	0.83817	0.0:0.0:1.0:0.0	.	43	O43248	HXC11_HUMAN	K	43	ENSP00000446680:E43K;ENSP00000243082:E43K	ENSP00000243082:E43K	E	+	1	0	0	HOXC11	52653419	52653419	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	9.227000	0.95236	2.471000	0.83476	0.561000	0.74099	GAG	0.544008		TCGA-OE-A75W-01A-12D-A32N-08	0.642	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2	0	0	1	2	2	2	2	0	0	0	0	156	156	156	153	1	1.770000	-2.410515	0	0.570000			0	16	16	0	828	810	0		1			0	0	156	0	0	0.999919	0	0	0	0	0	0	16	828
LRIG3	121227	broad.mit.edu	37	12	59267907	59267907	+	Silent	SNP	T	T	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:59267907T>A	ENST00000320743.3	-	18	3331	c.3045A>T	c.(3043-3045)ctA>ctT	p.L1015L	LRIG3_ENST00000379141.4_Silent_p.L955L	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	1015					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			AGGACTTGTTTAGACACAGAT	0.408			T	ROS1	NSCLC																																	ENST00000320743.3	0.240000	8.000000e-02	2.000000e-01	1.100000e-01	0.150000	0.160017	0.150000	0.150000				Dom	yes			Dom	yes		12	12q14.1	12q14.1	121227	T	leucine-rich repeats and immunoglobulin-like domains 3				E	E	ROS1		NSCLC	LRIG3/ROS1(2)	0				48						c.(3043-3045)ctA>ctT		leucine-rich repeats and immunoglobulin-like domains 3							76.0	78.0	77.0					12																	59267907		2203	4300	6503	SO:0001819	synonymous_variant	121227	0	0					g.chr12:59267907T>A	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.3045A>T	chr12.hg19:g.59267907T>A		0					LRIG3_ENST00000379141.4_Silent_p.L955L	p.L1015L	NM_153377.4	NP_700356.2	0	0	0	2.020472	Q6UXM1	LRIG3_HUMAN	GBM - Glioblastoma multiforme(1;1.17e-18)	18	3331	-			Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	1	1	hg19	c.3045A>T	CCDS8960.1	0	.	.	.	.	.	.	.	.	.	.	T	7.635	0.679659	0.14907	.	.	ENSG00000139263	ENST00000550825	.	.	.	5.63	-9.02	0.00741	5.63	-9.02	0.00741	.	.	.	.	.	.	.	.	.	.	.	0.26728	N	0.97065	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2731	0.43493	0.0:0.3257:0.4744:0.1999	.	.	.	.	X	117	.	.	K	-	1	0	0	LRIG3	57554174	57554174	0.386000	0.25180	0.082000	0.20525	0.229000	0.25112	-0.728000	0.04925	-2.026000	0.00934	-0.417000	0.06048	AAA	0.544008		TCGA-OE-A75W-01A-12D-A32N-08	0.408	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	1	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	1.770000	-16.762910	1	0.570000	NM_153377		0	15	15	0	313	313	0		1	0		0	0	60	0	0	0.999881	9.828050e-01	0	0	0	142	0	15	313
MGAT4C	25834	broad.mit.edu	37	12	86374022	86374022	+	Missense_Mutation	SNP	G	G	A	rs140499591		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:86374022G>A	ENST00000604798.1	-	8	1686	c.482C>T	c.(481-483)gCg>gTg	p.A161V	MGAT4C_ENST00000552808.2_Missense_Mutation_p.A161V|MGAT4C_ENST00000332156.1_Missense_Mutation_p.A161V|MGAT4C_ENST00000548651.1_Missense_Mutation_p.A161V|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000393205.2_Missense_Mutation_p.A190V|MGAT4C_ENST00000549405.2_Missense_Mutation_p.A161V			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	161					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AATATGGTGCGCAAATTTCTG	0.403																																						ENST00000604798.1	0.090000	0	6.000000e-02	1.000000e-02	0.030000	0.052728	0.030000	0.040000																										0				41						c.(481-483)gCg>gTg		MGAT4 family, member C		G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	93.0	91.0	92.0		482	3.7	0.6	12	dbSNP_134	92	1,8599	1.2+/-3.3	0,1,4299	no	missense	MGAT4C	NM_013244.3	64	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	161/479	86374022	2,13004	2203	4300	6503	SO:0001583	missense	25834	4	121410	38				g.chr12:86374022G>A		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.482C>T	chr12.hg19:g.86374022G>A	ENSP00000474896:p.Ala161Val	0					MGAT4C_ENST00000549405.2_Missense_Mutation_p.A161V|MGAT4C_ENST00000548651.1_Missense_Mutation_p.A161V|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000552808.2_Missense_Mutation_p.A161V|MGAT4C_ENST00000332156.1_Missense_Mutation_p.A161V|MGAT4C_ENST00000393205.2_Missense_Mutation_p.A190V	p.A161V			1	2	3	2.170025	Q9UBM8	MGT4C_HUMAN		8	1686	-			B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	0	1	hg19	c.482C>T	CCDS9030.1	0	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293358	0.40594	2.27E-4	1.16E-4	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	5.58	3.67	0.42095	5.58	3.67	0.42095	.	0.272302	0.36134	N	0.002770	D	0.88916	0.6567	M	0.66939	2.045	0.32647	N	0.519858	D;D	0.69078	0.997;0.997	P;P	0.62560	0.904;0.904	D	0.89173	0.3538	10	0.26408	T	0.33	-7.7201	12.7018	0.57038	0.0:0.1257:0.7434:0.1309	.	190;161	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	V	161;190;161;161;161;161;161	ENSP00000331664:A161V;ENSP00000376900:A190V;ENSP00000449022:A161V;ENSP00000446647:A161V;ENSP00000447253:A161V;ENSP00000449172:A161V	ENSP00000331664:A161V	A	-	2	0	0	MGAT4C	84898153	84898153	1.000000	0.71417	0.635000	0.29338	0.003000	0.03518	6.447000	0.73465	1.321000	0.45227	0.655000	0.94253	GCG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.403	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	0	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	1.770000	-2.060875	0	0.570000	NM_013244		0	5	6	0	477	476	0		1			0	0	83	0	0	0.937840	0	0	0	0	0	0	5	477
PITPNM2	57605	broad.mit.edu	37	12	123470864	123470864	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr12:123470864G>A	ENST00000542749.1	-	24	3823	c.3760C>T	c.(3760-3762)Cag>Tag	p.Q1254*	PITPNM2_ENST00000320201.4_Nonsense_Mutation_p.Q1254*|PITPNM2_ENST00000280562.5_Nonsense_Mutation_p.Q1248*|PITPNM2_ENST00000392428.1_Nonsense_Mutation_p.Q975*			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1254					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TACTTCAGCTGCGCCAGGTGG	0.726																																						ENST00000542749.1	0.390000	6.000000e-02	2.900000e-01	1.100000e-01	0.180000	0.203342	0.180000	0.170000																										0				39						c.(3760-3762)Cag>Tag		phosphatidylinositol transfer protein, membrane-associated 2							10.0	11.0	10.0					12																	123470864		2148	4240	6388	SO:0001587	stop_gained	57605	0	0					g.chr12:123470864G>A	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3760C>T	chr12.hg19:g.123470864G>A	ENSP00000437611:p.Gln1254*	0					PITPNM2_ENST00000280562.5_Nonsense_Mutation_p.Q1248*|PITPNM2_ENST00000320201.4_Nonsense_Mutation_p.Q1254*|PITPNM2_ENST00000392428.1_Nonsense_Mutation_p.Q975*	p.Q1254*			0	0	0	2.012138	Q9BZ72	PITM2_HUMAN		24	3823	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		Q9P271	Nonsense_Mutation	SNP	ENST00000542749.1	0	1	hg19	c.3760C>T	CCDS9242.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.645874	0.98899	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	.	.	.	4.8	4.8	0.61643	4.8	4.8	0.61643	.	0.071076	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-33.4146	18.4084	0.90542	0.0:0.0:1.0:0.0	.	.	.	.	X	1248;1254;975;1254	.	ENSP00000280562:Q1248X	Q	-	1	0	0	PITPNM2	122036817	122036817	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	7.611000	0.82962	2.664000	0.90586	0.561000	0.74099	CAG	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.726	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.770000	-8.464021	1	0.570000	NM_020845		0	4	4	0	74	72	0		1			0	0	18	0	0	0.885999	0	0	0	0	0	0	4	74
MPHOSPH8	54737	broad.mit.edu	37	13	20221309	20221309	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr13:20221309C>G	ENST00000361479.5	+	3	1164	c.1096C>G	c.(1096-1098)Caa>Gaa	p.Q366E	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.Q366E	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	366					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GCAGAGGAATCAAGACAGAAG	0.502																																						ENST00000361479.5	1.000000	6.600000e-01	1	7.600000e-01	0.880000	0.881290	0.880000	1.000000																										0				16						c.(1096-1098)Caa>Gaa		M-phase phosphoprotein 8							48.0	49.0	48.0					13																	20221309		2203	4300	6503	SO:0001583	missense	54737	0	0					g.chr13:20221309C>G	AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1096C>G	chr13.hg19:g.20221309C>G	ENSP00000355388:p.Gln366Glu	0					MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.Q366E	p.Q366E	NM_017520.3	NP_059990.2	0	0	0	2.141106	Q99549	MPP8_HUMAN		3	1164	+		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	1	1	hg19	c.1096C>G	CCDS9287.1	1	.	.	.	.	.	.	.	.	.	.	C	8.005	0.756354	0.15846	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.35048	1.34;1.33	5.61	5.61	0.85477	5.61	5.61	0.85477	.	1.796160	0.02353	N	0.076114	T	0.48077	0.1480	L	0.58101	1.795	0.41991	D	0.990848	P;B;P;B	0.41131	0.739;0.435;0.571;0.435	B;B;B;B	0.40782	0.34;0.15;0.225;0.152	T	0.49341	-0.8950	10	0.25106	T	0.35	.	19.6274	0.95684	0.0:1.0:0.0:0.0	.	366;366;366;366	F5H8H9;Q99549;Q99549-2;B3KS10	.;MPP8_HUMAN;.;.	E	366	ENSP00000414663:Q366E;ENSP00000355388:Q366E	ENSP00000355388:Q366E	Q	+	1	0	0	MPHOSPH8	19119309	19119309	1.000000	0.71417	0.852000	0.33557	0.180000	0.23129	4.294000	0.59043	2.634000	0.89283	0.585000	0.79938	CAA	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.502	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.770000	-20.000000	1	0.570000	NM_017520		0	39	36	0	115	115	1		1	1		0	0	32	0	0	1.000000	9.991951e-01	0	16	0	20	0	39	115
SPG20	23111	broad.mit.edu	37	13	36886315	36886315	+	Missense_Mutation	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr13:36886315A>G	ENST00000451493.1	-	8	1917	c.1700T>C	c.(1699-1701)gTt>gCt	p.V567A	SPG20_ENST00000355182.4_Missense_Mutation_p.V567A|SPG20_ENST00000438666.2_Missense_Mutation_p.V567A|SPG20_ENST00000494062.2_Missense_Mutation_p.V567A	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	567					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		TTCTGCTGAAACATTGTTAAC	0.323																																						ENST00000451493.1	0.930000	6.200000e-01	8.500000e-01	6.900000e-01	0.760000	0.777012	0.760000	0.770000																										0				27						c.(1699-1701)gTt>gCt		spastic paraplegia 20 (Troyer syndrome)							95.0	103.0	100.0					13																	36886315		2203	4300	6503	SO:0001583	missense	23111	0	0					g.chr13:36886315A>G	AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1700T>C	chr13.hg19:g.36886315A>G	ENSP00000414147:p.Val567Ala	0					SPG20_ENST00000438666.2_Missense_Mutation_p.V567A|SPG20_ENST00000355182.4_Missense_Mutation_p.V567A|SPG20_ENST00000494062.2_Missense_Mutation_p.V567A	p.V567A	NM_001142295.1	NP_001135767.1	0	0	0	2.112994	Q8N0X7	SPG20_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	8	1917	-		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	ENST00000451493.1	1	1	hg19	c.1700T>C	CCDS9356.1	0	.	.	.	.	.	.	.	.	.	.	A	27.8	4.862134	0.91511	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.89617	-2.54;-2.54;-2.54	5.86	5.86	0.93980	5.86	5.86	0.93980	Senescence/spartin-associated (1);	0.000000	0.85682	D	0.000000	D	0.93268	0.7855	M	0.61703	1.905	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92473	0.5987	10	0.37606	T	0.19	-22.1858	16.2644	0.82568	1.0:0.0:0.0:0.0	.	567;567	A8K6Q9;Q8N0X7	.;SPG20_HUMAN	A	567	ENSP00000406061:V567A;ENSP00000347314:V567A;ENSP00000414147:V567A	ENSP00000347314:V567A	V	-	2	0	0	SPG20	35784315	35784315	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.703000	0.74633	2.244000	0.73946	0.528000	0.53228	GTT	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.323	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044494.2	1	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	1.770000	-20.000000	1	0.570000			0	74	74	0	258	254	1		1	0		0	0	49	0	0	1.000000	9.746497e-01	0	0	0	23	0	74	258
SMAD9	4093	broad.mit.edu	37	13	37453546	37453546	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr13:37453546C>T	ENST00000399275.2	-	1	420	c.281G>A	c.(280-282)cGc>cAc	p.R94H	SMAD9_ENST00000379826.4_Missense_Mutation_p.R94H|SMAD9_ENST00000350148.5_Missense_Mutation_p.R94H|SMAD9_ENST00000483941.1_5'Flank			O15198	SMAD9_HUMAN	SMAD family member 9	94	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GCGCCACACGCGACAGTAAAT	0.627																																						ENST00000399275.2	0.210000	4.000000e-02	1.600000e-01	7.000000e-02	0.110000	0.120249	0.110000	0.100000																										0				18						c.(280-282)cGc>cAc		SMAD family member 9							35.0	38.0	37.0					13																	37453546		2203	4300	6503	SO:0001583	missense	4093	1	121410	31				g.chr13:37453546C>T		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.281G>A	chr13.hg19:g.37453546C>T	ENSP00000382216:p.Arg94His	0					SMAD9_ENST00000483941.1_5'Flank|SMAD9_ENST00000379826.4_Missense_Mutation_p.R94H|SMAD9_ENST00000350148.5_Missense_Mutation_p.R94H	p.R94H			0	0	0	2.112994	O15198	SMAD9_HUMAN		1	420	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	0	1	hg19	c.281G>A	CCDS45032.1	0	.	.	.	.	.	.	.	.	.	.	C	21.4	4.140955	0.77775	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	D;D;D	0.82255	-1.59;-1.59;-1.59	5.53	5.53	0.82687	5.53	5.53	0.82687	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.92506	0.7620	M	0.88512	2.96	0.80722	D	1	D;D	0.76494	0.992;0.999	P;D	0.70716	0.801;0.97	D	0.93576	0.6908	10	0.87932	D	0	.	18.4517	0.90705	0.0:1.0:0.0:0.0	.	94;94	O15198-2;O15198	.;SMAD9_HUMAN	H	94	ENSP00000382216:R94H;ENSP00000239885:R94H;ENSP00000369154:R94H	ENSP00000239885:R94H	R	-	2	0	0	SMAD9	36351546	36351546	1.000000	0.71417	0.962000	0.40283	0.019000	0.09904	6.034000	0.70933	2.599000	0.87857	0.563000	0.77884	CGC	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.627	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	0	0	1	2	2	2	2	0	0	0	0	60	60	60	57	1	1.770000	-8.859226	1	0.570000	NM_005905		0	7	7	0	221	220	0		1			0	0	60	0	0	0.980783	0	0	0	0	0	0	7	221
NOVA1	4857	broad.mit.edu	37	14	26917998	26917998	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr14:26917998G>A	ENST00000539517.2	-	5	1008	c.691C>T	c.(691-693)Cga>Tga	p.R231*	NOVA1_ENST00000267422.7_Nonsense_Mutation_p.R109*|NOVA1_ENST00000465357.2_Nonsense_Mutation_p.R207*	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	234	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		ACAGCTTTTCGGTTTTGTTCA	0.473																																						ENST00000539517.2	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.043886	0.030000	0.040000																										0				40						c.(691-693)Cga>Tga		neuro-oncological ventral antigen 1							237.0	215.0	223.0					14																	26917998		2203	4300	6503	SO:0001587	stop_gained	4857	0	0					g.chr14:26917998G>A	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.691C>T	chr14.hg19:g.26917998G>A	ENSP00000438875:p.Arg231*	0					NOVA1_ENST00000267422.7_Nonsense_Mutation_p.R109*|NOVA1_ENST00000465357.2_Nonsense_Mutation_p.R207*	p.R231*	NM_002515.2	NP_002506.2	0	0	0	2.122520	P51513	NOVA1_HUMAN		5	1008	-			A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Nonsense_Mutation	SNP	ENST00000539517.2	0	1	hg19	c.691C>T	CCDS32061.1	0	.	.	.	.	.	.	.	.	.	.	G	38	6.801762	0.97849	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422;ENST00000449198;ENST00000347476	.	.	.	5.73	5.73	0.89815	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-3.4817	19.8956	0.96956	0.0:0.0:1.0:0.0	.	.	.	.	X	207;231;109;190;85	.	ENSP00000267422:R109X	R	-	1	2	2	NOVA1	25987838	25987838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.824000	0.99380	2.708000	0.92522	0.563000	0.77884	CGA	0.567535		TCGA-OE-A75W-01A-12D-A32N-08	0.473	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	0	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	1.770000	-2.172289	0	0.570000	NM_006491		0	6	6	0	546	544	0		1			0	0	92	0	0	0.964745	0	0	0	0	0	0	6	546
EXOC5	10640	broad.mit.edu	37	14	57698379	57698379	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr14:57698379C>G	ENST00000413566.2	-	11	1352	c.993G>C	c.(991-993)caG>caC	p.Q331H	EXOC5_ENST00000340918.7_Missense_Mutation_p.Q266H	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	331					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						ACAAGAAAGTCTGTTTATCAG	0.343																																						ENST00000413566.2	0.140000	2.000000e-02	1.000000e-01	3.000000e-02	0.060000	0.075501	0.060000	0.060000																										0				22						c.(991-993)caG>caC		exocyst complex component 5							72.0	68.0	69.0					14																	57698379		1823	4079	5902	SO:0001583	missense	10640	0	0					g.chr14:57698379C>G	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.993G>C	chr14.hg19:g.57698379C>G	ENSP00000389934:p.Gln331His	0					EXOC5_ENST00000340918.7_Missense_Mutation_p.Q266H	p.Q331H	NM_006544.3	NP_006535.1	0	0	0	2.142545	O00471	EXOC5_HUMAN		11	1352	-			B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	0	1	hg19	c.993G>C	CCDS45111.1	0	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240468	0.39598	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.44482	0.92;0.92	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.048260	0.85682	D	0.000000	T	0.23766	0.0575	N	0.02539	-0.55	0.51767	D	0.999934	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.08617	-1.0713	10	0.33940	T	0.23	-8.6151	20.0333	0.97547	0.0:1.0:0.0:0.0	.	266;331	F8W9B8;O00471	.;EXOC5_HUMAN	H	331;266	ENSP00000389934:Q331H;ENSP00000342100:Q266H	ENSP00000342100:Q266H	Q	-	3	2	2	EXOC5	56768132	56768132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.013000	0.57138	2.810000	0.96702	0.585000	0.79938	CAG	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.343	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	0	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.770000	-4.106622	1	0.570000	NM_006544		0	5	5	0	271	267	0		1			0	0	36	0	0	0.935682	0	0	0	0	0	0	5	271
SIPA1L1	26037	broad.mit.edu	37	14	72055518	72055518	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr14:72055518C>T	ENST00000555818.1	+	2	1277	c.929C>T	c.(928-930)tCa>tTa	p.S310L	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.S310L|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.S310L	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	310					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CTTGGGAAGTCATCAGATCTT	0.418																																						ENST00000555818.1	0.130000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.074481	0.060000	0.060000																										0				78						c.(928-930)tCa>tTa		signal-induced proliferation-associated 1 like 1							66.0	71.0	69.0					14																	72055518		2203	4300	6503	SO:0001583	missense	26037	0	0					g.chr14:72055518C>T	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.929C>T	chr14.hg19:g.72055518C>T	ENSP00000450832:p.Ser310Leu	0					SIPA1L1_ENST00000381232.3_Missense_Mutation_p.S310L|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.S310L	p.S310L	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	0	0	0	2.142545	O43166	SI1L1_HUMAN		2	1277	+			J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	0	1	hg19	c.929C>T	CCDS9807.1	0	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558807	0.27827	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.43688	0.94;0.94;0.94	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.428174	0.28161	N	0.016373	T	0.46698	0.1406	L	0.39898	1.24	0.80722	D	1	B;P;B	0.37500	0.074;0.597;0.001	B;B;B	0.43990	0.01;0.438;0.001	T	0.15752	-1.0426	10	0.36615	T	0.2	-11.6329	20.6593	0.99626	0.0:1.0:0.0:0.0	.	310;310;310	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	L	310	ENSP00000370630:S310L;ENSP00000450832:S310L;ENSP00000351352:S310L	ENSP00000351352:S310L	S	+	2	0	0	SIPA1L1	71125271	71125271	0.983000	0.35010	0.378000	0.26068	0.087000	0.18053	2.677000	0.46892	2.885000	0.99019	0.655000	0.94253	TCA	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.418	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	0	0	0	2	2	2	2	0	0	0	0	45	45	45	45	1	1.770000	-6.530284	1	0.570000	NM_015556		0	6	6	0	321	317	0		1	0		0	0	45	0	0	0.963994	1.519339e-03	0	0	0	3	0	6	321
SIPA1L1	26037	broad.mit.edu	37	14	72055521	72055521	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr14:72055521C>A	ENST00000555818.1	+	2	1280	c.932C>A	c.(931-933)tCa>tAa	p.S311*	SIPA1L1_ENST00000381232.3_Nonsense_Mutation_p.S311*|SIPA1L1_ENST00000358550.2_Nonsense_Mutation_p.S311*	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	311					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GGGAAGTCATCAGATCTTGAA	0.413																																						ENST00000555818.1	0.140000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.076095	0.060000	0.060000																										0				78						c.(931-933)tCa>tAa		signal-induced proliferation-associated 1 like 1							66.0	71.0	69.0					14																	72055521		2203	4300	6503	SO:0001587	stop_gained	26037	0	0					g.chr14:72055521C>A	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.932C>A	chr14.hg19:g.72055521C>A	ENSP00000450832:p.Ser311*	0					SIPA1L1_ENST00000381232.3_Nonsense_Mutation_p.S311*|SIPA1L1_ENST00000358550.2_Nonsense_Mutation_p.S311*	p.S311*	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	0	0	0	2.142545	O43166	SI1L1_HUMAN		2	1280	+			J3KP19|O95321|Q9UDU4|Q9UNU4	Nonsense_Mutation	SNP	ENST00000555818.1	0	1	hg19	c.932C>A	CCDS9807.1	0	.	.	.	.	.	.	.	.	.	.	C	42	9.477020	0.99181	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	.	.	.	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.378699	0.30869	N	0.008709	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.9733	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	311	.	ENSP00000351352:S311X	S	+	2	0	0	SIPA1L1	71125274	71125274	1.000000	0.71417	0.271000	0.24616	0.037000	0.13140	7.575000	0.82447	2.885000	0.99019	0.655000	0.94253	TCA	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.413	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	0	0	0	2	2	2	2	0	0	0	0	44	44	44	44	1	1.770000	-4.039786	1	0.570000	NM_015556		0	6	6	0	314	311	0		1	0		0	0	44	0	0	0.964327	1.585379e-03	0	0	0	3	0	6	314
NIPA2	81614	broad.mit.edu	37	15	23006789	23006789	+	Missense_Mutation	SNP	C	C	T	rs201271184		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:23006789C>T	ENST00000337451.3	-	8	1127	c.515G>A	c.(514-516)cGc>cAc	p.R172H	NIPA2_ENST00000398013.3_Missense_Mutation_p.R172H|NIPA2_ENST00000539711.2_Missense_Mutation_p.R153H|NIPA2_ENST00000398014.2_Missense_Mutation_p.R172H|NIPA2_ENST00000359727.4_Missense_Mutation_p.R153H	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2	172						early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		CTGTCCATGGCGAGGACCCAC	0.468																																						ENST00000337451.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				15						c.(514-516)cGc>cAc		non imprinted in Prader-Willi/Angelman syndrome 2							71.0	63.0	66.0					15																	23006789		2203	4300	6503	SO:0001583	missense	81614	8	121412	39				g.chr15:23006789C>T	AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.515G>A	chr15.hg19:g.23006789C>T	ENSP00000337618:p.Arg172His	1					NIPA2_ENST00000398013.3_Missense_Mutation_p.R172H|NIPA2_ENST00000359727.4_Missense_Mutation_p.R153H|NIPA2_ENST00000539711.2_Missense_Mutation_p.R153H|NIPA2_ENST00000398014.2_Missense_Mutation_p.R172H	p.R172H	NM_030922.6	NP_112184.4	0	2	2	2.275188	Q8N8Q9	NIPA2_HUMAN		8	1127	-		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	F8W7Y8|Q96F03|Q9BVS2	Missense_Mutation	SNP	ENST00000337451.3	1	1	hg19	c.515G>A	CCDS10010.1	1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097751	0.56075	.	.	ENSG00000140157	ENST00000337451;ENST00000398014;ENST00000359727;ENST00000539711;ENST00000398013	D;D;D	0.91740	-2.9;-2.9;-2.9	5.65	3.79	0.43588	5.65	3.79	0.43588	.	0.047323	0.85682	D	0.000000	D	0.91646	0.7360	M	0.81614	2.55	0.80722	D	1	P;P	0.38020	0.615;0.562	B;B	0.37888	0.17;0.26	D	0.90560	0.4515	10	0.59425	D	0.04	-18.3833	12.5884	0.56430	0.0:0.8679:0.0:0.1321	.	153;172	F8W7Y8;Q8N8Q9	.;NIPA2_HUMAN	H	172;172;153;172;153	ENSP00000337618:R172H;ENSP00000381096:R172H;ENSP00000352762:R153H	ENSP00000337618:R172H	R	-	2	0	0	NIPA2	20558230	20558230	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	4.882000	0.63121	0.871000	0.35750	-0.768000	0.03414	CGC	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.468	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251137.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.770000	-20.000000	1	0.570000	NM_030922		0	113	109	0	113	112	1		1	1		0	0	41	0	0	1.000000	1	0	54	0	12	0	113	113
TJP1	7082	broad.mit.edu	37	15	30001114	30001114	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:30001114G>A	ENST00000346128.6	-	25	4973	c.4499C>T	c.(4498-4500)cCc>cTc	p.P1500L	TJP1_ENST00000545208.2_Missense_Mutation_p.P1420L|TJP1_ENST00000356107.6_Missense_Mutation_p.P1500L|TJP1_ENST00000400011.2_Missense_Mutation_p.P1424L	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1500					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ACTTTTCTGGGGATAGAAAGC	0.438																																					Melanoma(77;681 1843 6309 6570)	ENST00000346128.6	1.000000	0	5.000000e-02	1.000000e-02	0.030000	0.089759	0.030000	0.040000																										0				68						c.(4498-4500)cCc>cTc		tight junction protein 1							165.0	157.0	159.0					15																	30001114		1853	4100	5953	SO:0001583	missense	7082	0	0					g.chr15:30001114G>A		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4499C>T	chr15.hg19:g.30001114G>A	ENSP00000281537:p.Pro1500Leu	1					TJP1_ENST00000356107.6_Missense_Mutation_p.P1500L|TJP1_ENST00000545208.2_Missense_Mutation_p.P1420L|TJP1_ENST00000400011.2_Missense_Mutation_p.P1424L	p.P1500L	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	0	2	2	2.275188	Q07157	ZO1_HUMAN		25	4973	-		all_lung(180;7.48e-11)|Breast(32;0.000153)	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	0	1	hg19	c.4499C>T	CCDS42007.1	0	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371619	0.61624	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.59083	0.29;0.29	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.111909	0.64402	D	0.000008	T	0.63593	0.2524	L	0.50333	1.59	0.80722	D	1	B;B;B;P	0.45827	0.005;0.001;0.009;0.867	B;B;B;P	0.48030	0.009;0.002;0.016;0.564	T	0.65747	-0.6093	10	0.87932	D	0	.	19.8945	0.96949	0.0:0.0:1.0:0.0	.	1493;1420;1500;1424	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	L	1500;1424;1500;1420;1420	ENSP00000281537:P1500L;ENSP00000382890:P1424L	ENSP00000281537:P1500L	P	-	2	0	0	TJP1	27788406	27788406	1.000000	0.71417	0.902000	0.35471	0.988000	0.76386	9.263000	0.95617	2.937000	0.99478	0.650000	0.86243	CCC	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.438	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	0	0	1	2	2	2	2	0	0	0	0	132	132	132	130	1	1.770000	-2.276977	0	0.570000	NM_003257		0	8	8	0	859	854	0		1	0		0	0	132	0	0	0.989130	1.947290e-02	0	0	0	20	0	8	859
VPS18	57617	broad.mit.edu	37	15	41192857	41192857	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:41192857G>A	ENST00000220509.5	+	4	2180	c.1841G>A	c.(1840-1842)tGg>tAg	p.W614*	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	614					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GTAGATGCCTGGATTGAGATG	0.637																																						ENST00000220509.5	1.000000	8.000000e-02	1.800000e-01	1.100000e-01	0.140000	0.170823	0.140000	0.140000																										0				28						c.(1840-1842)tGg>tAg		vacuolar protein sorting 18 homolog (S. cerevisiae)							78.0	76.0	77.0					15																	41192857		2203	4300	6503	SO:0001587	stop_gained	57617	0	0					g.chr15:41192857G>A	AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.1841G>A	chr15.hg19:g.41192857G>A	ENSP00000220509:p.Trp614*	1					VPS18_ENST00000558474.1_Intron	p.W614*	NM_020857.2	NP_065908.1	0	2	2	2.243088	Q9P253	VPS18_HUMAN		4	2180	+		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	Q8TCG0|Q96DI3|Q9H268	Nonsense_Mutation	SNP	ENST00000220509.5	0	1	hg19	c.1841G>A	CCDS10069.1	0	.	.	.	.	.	.	.	.	.	.	G	40	8.369804	0.98781	.	.	ENSG00000104142	ENST00000220509	.	.	.	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.9768	20.1278	0.97990	0.0:0.0:1.0:0.0	.	.	.	.	X	614	.	ENSP00000220509:W614X	W	+	2	0	0	VPS18	38980149	38980149	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.768000	0.95171	0.561000	0.74099	TGG	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.637	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252443.2	0	0	1	2	16	3	2	1	1	1	1	118	118	118	117	1	1.770000	-2.927596	1	0.570000			0	21	21	0	504	500	0		1	0		1	0	118	0	0	0.835106	1.427688e-01	0	2	0	29	0	21	504
SEMA6D	80031	broad.mit.edu	37	15	48060897	48060897	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:48060897G>A	ENST00000316364.5	+	18	2324	c.1885G>A	c.(1885-1887)Gat>Aat	p.D629N	SEMA6D_ENST00000389433.2_Missense_Mutation_p.D610N|SEMA6D_ENST00000389432.2_Intron|SEMA6D_ENST00000358066.4_Intron|SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000354744.4_Intron|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000536845.2_Missense_Mutation_p.D629N|SEMA6D_ENST00000558014.1_Intron	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	629					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AGTTCAAGATGATCCAAACAC	0.433																																						ENST00000316364.5	1.000000	5.000000e-02	1.400000e-01	7.000000e-02	0.100000	0.133806	0.100000	0.100000																										0				77						c.(1885-1887)Gat>Aat		sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D							131.0	124.0	126.0					15																	48060897		2198	4297	6495	SO:0001583	missense	80031	0	0					g.chr15:48060897G>A	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1885G>A	chr15.hg19:g.48060897G>A	ENSP00000324857:p.Asp629Asn	1					SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000358066.4_Intron|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000389433.2_Missense_Mutation_p.D610N|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000389432.2_Intron|SEMA6D_ENST00000536845.2_Missense_Mutation_p.D629N|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000558014.1_Intron|SEMA6D_ENST00000354744.4_Intron	p.D629N	NM_153618.1	NP_705871.1	0	2	2	2.243088	Q8NFY4	SEM6D_HUMAN		18	2324	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	1	1	hg19	c.1885G>A	CCDS32225.1	0	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979420	0.53827	.	.	ENSG00000137872	ENST00000536845;ENST00000316364;ENST00000389433	T;T;T	0.17854	2.25;2.25;2.27	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.490778	0.22255	N	0.062495	T	0.11110	0.0271	N	0.08118	0	0.80722	D	1	B	0.23058	0.079	B	0.23018	0.043	T	0.26916	-1.0089	10	0.17832	T	0.49	.	19.7433	0.96241	0.0:0.0:1.0:0.0	.	629	Q8NFY4	SEM6D_HUMAN	N	629;629;610	ENSP00000446152:D629N;ENSP00000324857:D629N;ENSP00000374084:D610N	ENSP00000324857:D629N	D	+	1	0	0	SEMA6D	45848189	45848189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.466000	0.80914	2.733000	0.93635	0.655000	0.94253	GAT	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.433	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	0	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	1.770000	-3.625637	1	0.570000	NM_024966		0	12	12	0	407	402	0		1			0	0	62	0	0	0.999078	0	0	0	0	0	0	12	407
CYP19A1	1588	broad.mit.edu	37	15	51504611	51504611	+	Missense_Mutation	SNP	T	T	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:51504611T>C	ENST00000396402.1	-	9	1322	c.1169A>G	c.(1168-1170)aAg>aGg	p.K390R	CYP19A1_ENST00000559878.1_Missense_Mutation_p.K390R|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000396404.4_Missense_Mutation_p.K390R|CYP19A1_ENST00000260433.2_Missense_Mutation_p.K390R	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	390					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	GTTTGTCCCCTTTTTCACTGG	0.413																																					Melanoma(142;1016 1807 39614 48966 51721)	ENST00000396402.1	1.000000	0	6.000000e-02	1.000000e-02	0.030000	0.065686	0.030000	0.040000																										0				33						c.(1168-1170)aAg>aGg		cytochrome P450, family 19, subfamily A, polypeptide 1	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)						190.0	173.0	179.0					15																	51504611		2196	4293	6489	SO:0001583	missense	1588	0	0					g.chr15:51504611T>C	D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.1169A>G	chr15.hg19:g.51504611T>C	ENSP00000379683:p.Lys390Arg	1					CYP19A1_ENST00000559878.1_Missense_Mutation_p.K390R|CYP19A1_ENST00000396404.4_Missense_Mutation_p.K390R|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000260433.2_Missense_Mutation_p.K390R	p.K390R	NM_000103.3	NP_000094.2	0	2	2	2.243088	P11511	CP19A_HUMAN		9	1322	-			Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	0	1	hg19	c.1169A>G	CCDS10139.1	0	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922211	0.52653	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404	T;T;T	0.73575	-0.76;-0.76;-0.76	6.06	2.13	0.27403	6.06	2.13	0.27403	.	0.084915	0.85682	N	0.000000	T	0.69691	0.3139	L	0.58354	1.805	0.46279	D	0.998961	B	0.15141	0.012	B	0.27262	0.078	T	0.66152	-0.5995	10	0.52906	T	0.07	-23.6398	10.5475	0.45068	0.0:0.2114:0.0:0.7886	.	390	P11511	CP19A_HUMAN	R	390	ENSP00000379683:K390R;ENSP00000260433:K390R;ENSP00000379685:K390R	ENSP00000260433:K390R	K	-	2	0	0	CYP19A1	49291903	49291903	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	3.131000	0.50515	0.541000	0.28827	0.533000	0.62120	AAG	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.413	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.770000	-1.959807	0	0.570000			0	6	7	0	630	626	0		1			0	0	107	0	0	0.964585	0	0	0	0	0	0	6	630
LMAN1L	79748	broad.mit.edu	37	15	75116728	75116728	+	Missense_Mutation	SNP	C	C	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:75116728C>A	ENST00000309664.5	+	13	1499	c.1360C>A	c.(1360-1362)Ccc>Acc	p.P454T	CPLX3_ENST00000395018.4_5'Flank|RP11-414J4.2_ENST00000564823.1_RNA|LMAN1L_ENST00000379709.3_Missense_Mutation_p.P442T	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	454						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACCTGGCCAGCCCCCAAGGGC	0.602																																						ENST00000309664.5	1.000000	8.400000e-01	1	8.900000e-01	0.940000	0.947453	0.940000	1.000000																										0				19						c.(1360-1362)Ccc>Acc		lectin, mannose-binding, 1 like							92.0	102.0	99.0					15																	75116728		2197	4295	6492	SO:0001583	missense	79748	1	121406	32				g.chr15:75116728C>A	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.1360C>A	chr15.hg19:g.75116728C>A	ENSP00000310431:p.Pro454Thr	1					LMAN1L_ENST00000379709.3_Missense_Mutation_p.P442T|RP11-414J4.2_ENST00000564823.1_RNA|CPLX3_ENST00000395018.4_5'Flank	p.P454T	NM_021819.2	NP_068591.2	0	2	2	2.243088	Q9HAT1	LMA1L_HUMAN		13	1499	+			Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	1	1	hg19	c.1360C>A	CCDS10270.1	1	.	.	.	.	.	.	.	.	.	.	C	9.098	1.003432	0.19121	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.45276	1.06;0.9	4.95	-3.18	0.05186	4.95	-3.18	0.05186	.	4.451500	0.00424	N	0.000078	T	0.27205	0.0667	L	0.29908	0.895	0.09310	N	1	B;B	0.17038	0.02;0.001	B;B	0.19391	0.025;0.002	T	0.05194	-1.0900	10	0.26408	T	0.33	.	1.6489	0.02767	0.1359:0.32:0.1328:0.4113	.	442;454	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	T	454;442	ENSP00000310431:P454T;ENSP00000369031:P442T	ENSP00000310431:P454T	P	+	1	0	0	LMAN1L	72903781	72903781	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.646000	0.05403	-0.565000	0.06061	-1.288000	0.01363	CCC	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.602	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4	1	0	1	2	2	2	2	0	0	0	0	177	177	177	176	1	1.770000	-20.000000	1	0.570000			0	252	248	0	679	666	1		1			0	0	177	0	0	1.000000	0	0	0	0	0	0	252	679
ACAN	176	broad.mit.edu	37	15	89402244	89402244	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:89402244G>C	ENST00000561243.1	+	11	6428	c.6428G>C	c.(6427-6429)aGa>aCa	p.R2143T	ACAN_ENST00000439576.2_Missense_Mutation_p.R2143T|ACAN_ENST00000352105.7_Missense_Mutation_p.R2143T|ACAN_ENST00000559004.1_Missense_Mutation_p.R2143T			P16112	PGCA_HUMAN	aggrecan	2028	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AACCTTGAGAGATCCTCTGGC	0.577																																						ENST00000561243.1	1.000000	1.000000e-02	8.000000e-02	3.000000e-02	0.040000	0.082215	0.040000	0.050000																										0				93						c.(6427-6429)aGa>aCa		aggrecan							77.0	82.0	80.0					15																	89402244		2089	4222	6311	SO:0001583	missense	176	0	0					g.chr15:89402244G>C	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6428G>C	chr15.hg19:g.89402244G>C	ENSP00000453342:p.Arg2143Thr	1					ACAN_ENST00000559004.1_Missense_Mutation_p.R2143T|ACAN_ENST00000352105.7_Missense_Mutation_p.R2143T|ACAN_ENST00000439576.2_Missense_Mutation_p.R2143T	p.R2143T			0	2	2	2.243088	P16112	PGCA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)	11	6428	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	0	1	hg19	c.6428G>C	CCDS53970.1	0	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.123810	0.00031	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.01804	4.8;4.63	4.78	0.0257	0.14146	4.78	0.0257	0.14146	.	1.021840	0.07884	N	0.969992	T	0.00875	0.0029	N	0.03608	-0.345	0.09310	N	1	B;B	0.22346	0.041;0.068	B;B	0.17433	0.018;0.018	T	0.48479	-0.9032	10	0.13108	T	0.6	2.0912	4.3001	0.10920	0.1066:0.5139:0.2441:0.1353	.	2143;2143	E7ENV9;E7EX88	.;.	T	2143;2143;2029	ENSP00000387356:R2143T;ENSP00000341615:R2143T	ENSP00000268134:R2029T	R	+	2	0	0	ACAN	87203248	87203248	0.000000	0.05858	0.010000	0.14722	0.065000	0.16274	-0.708000	0.05035	0.410000	0.25675	0.555000	0.69702	AGA	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.577	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	0	0	1	2	2	2	2	0	0	0	0	134	134	134	134	1	1.770000	-3.147050	1	0.570000	NM_001135		0	8	8	0	564	560	0		1	0		0	0	134	0	0	0.989142	2.624323e-03	0	0	0	5	0	8	564
RCCD1	91433	broad.mit.edu	37	15	91500894	91500894	+	Silent	SNP	G	G	A	rs375710438		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr15:91500894G>A	ENST00000394258.2	+	4	820	c.618G>A	c.(616-618)gcG>gcA	p.A206A	AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000556774.1_Intron|RCCD1_ENST00000555155.1_Silent_p.A206A|RCCD1_ENST00000556618.1_Silent_p.A206A	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	206						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			TGTTGGAGGCGTTGCAGGGCC	0.607																																						ENST00000394258.2	1.000000	0	7.000000e-02	2.000000e-02	0.040000	0.077956	0.040000	0.040000																										0				4						c.(616-618)gcG>gcA		RCC1 domain containing 1							90.0	86.0	87.0					15																	91500894		2198	4298	6496	SO:0001819	synonymous_variant	91433	1	121406	30				g.chr15:91500894G>A		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.618G>A	chr15.hg19:g.91500894G>A		1					AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000556774.1_Intron|RCCD1_ENST00000555155.1_Silent_p.A206A|RCCD1_ENST00000556618.1_Silent_p.A206A	p.A206A	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	0	2	2	2.243088	A6NED2	RCCD1_HUMAN	Lung(145;0.189)	4	820	+	Lung NSC(78;0.0987)|all_lung(78;0.175)		B2RTP9|Q29RX6	Silent	SNP	ENST00000394258.2	0	1	hg19	c.618G>A	CCDS32333.1	0																																																																																								0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.607	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	0	0	1	2	2	2	2	0	0	0	0	106	106	106	104	1	1.770000	-2.919649	1	0.570000	NM_033544		0	6	6	0	476	463	0		1	0		0	0	106	0	0	0.961869	8.256143e-02	0	0	0	32	0	6	476
IFT140	9742	broad.mit.edu	37	16	1657152	1657152	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr16:1657152G>A	ENST00000426508.2	-	3	479	c.116C>T	c.(115-117)tCa>tTa	p.S39L	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	39					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GCTGCCTGTTGAGGTTGTGCT	0.522																																						ENST00000426508.2	0.090000	1.000000e-02	7.000000e-02	3.000000e-02	0.040000	0.055501	0.040000	0.050000																										0				53						c.(115-117)tCa>tTa		intraflagellar transport 140							214.0	182.0	193.0					16																	1657152		2199	4300	6499	SO:0001583	missense	9742	0	0					g.chr16:1657152G>A	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.116C>T	chr16.hg19:g.1657152G>A	ENSP00000406012:p.Ser39Leu	0					IFT140_ENST00000439987.2_5'UTR|LA16c-395F10.2_ENST00000563162.1_RNA	p.S39L	NM_014714.3	NP_055529.2	0	0	0	2.054168	Q96RY7	IF140_HUMAN		3	479	-		Hepatocellular(780;0.219)	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	0	1	hg19	c.116C>T	CCDS10439.1	0	.	.	.	.	.	.	.	.	.	.	G	7.782	0.709735	0.15239	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T;T	0.65178	-0.14;-0.14	5.53	3.52	0.40303	5.53	3.52	0.40303	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.614492	0.17548	N	0.170274	T	0.50922	0.1644	L	0.49126	1.545	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.39313	-0.9620	10	0.31617	T	0.26	.	6.0312	0.19681	0.1449:0.0:0.7042:0.1509	.	39	Q96RY7	IF140_HUMAN	L	39	ENSP00000380562:S39L;ENSP00000406012:S39L	ENSP00000380562:S39L	S	-	2	0	0	IFT140	1597153	1597153	0.000000	0.05858	0.006000	0.13384	0.029000	0.11900	0.693000	0.25497	0.653000	0.30826	0.655000	0.94253	TCA	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.522	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	0	0	1	2	2	2	2	0	0	0	0	134	134	134	133	1	1.770000	-2.405791	0	0.570000	NM_014714		0	10	10	0	655	644	0		1			0	0	134	0	0	0.996638	0	0	0	0	0	0	10	655
MYLK3	91807	broad.mit.edu	37	16	46781922	46781922	+	Missense_Mutation	SNP	G	G	A	rs200653944		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr16:46781922G>A	ENST00000394809.4	-	1	299	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	62					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.R62W(2)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TGCAGGCCCCGCTCCAGGTGG	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17468	0.0		0.0	False		,,,				2504	0.0					ENST00000394809.4	1.000000	7.700000e-01	1	8.600000e-01	0.960000	0.943995	0.960000	1.000000																										2	Substitution - Missense(2)	p.R62W(2)	prostate(2)	37						c.(184-186)Cgg>Tgg		myosin light chain kinase 3		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	37.0	39.0	39.0		184	1.7	1.0	16		39	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MYLK3	NM_182493.2	101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging	62/820	46781922	2,13004	2203	4300	6503	SO:0001583	missense	91807	11	121412	40				g.chr16:46781922G>A	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.184C>T	chr16.hg19:g.46781922G>A	ENSP00000378288:p.Arg62Trp	0					MYLK3_ENST00000536476.1_Intron	p.R62W	NM_182493.2	NP_872299.2	0	0	0	2.119491	Q32MK0	MYLK3_HUMAN		1	299	-		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	1	1	hg19	c.184C>T	CCDS10723.2	1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694724	0.30052	2.27E-4	1.16E-4	ENSG00000140795	ENST00000394809	T	0.73152	-0.72	5.09	1.66	0.24008	5.09	1.66	0.24008	.	0.248315	0.21157	N	0.079230	T	0.61022	0.2314	L	0.29908	0.895	0.09310	N	0.999997	D	0.63880	0.993	P	0.47470	0.548	T	0.55854	-0.8075	10	0.72032	D	0.01	.	9.4835	0.38915	0.0:0.1113:0.4457:0.443	.	62	Q32MK0	MYLK3_HUMAN	W	62	ENSP00000378288:R62W	ENSP00000378288:R62W	R	-	1	2	2	MYLK3	45339423	45339423	0.991000	0.36638	0.963000	0.40424	0.003000	0.03518	0.984000	0.29565	0.466000	0.27193	-0.500000	0.04577	CGG	0.567535		TCGA-OE-A75W-01A-12D-A32N-08	0.652	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.770000	-20.000000	1	0.570000	NM_182493		0	65	64	0	169	166	1		1			0	0	48	0	0	1.000000	0	0	0	0	0	0	65	169
GPR97	222487	broad.mit.edu	37	16	57714440	57714440	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr16:57714440G>A	ENST00000333493.4	+	8	953	c.792G>A	c.(790-792)acG>acA	p.T264T	GPR97_ENST00000327655.6_Silent_p.T54T|RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Silent_p.T144T	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	264					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T264T(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ACCAGTCCACGGTGCATATCC	0.587																																						ENST00000333493.4	1.000000	7.200000e-01	1	8.000000e-01	0.890000	0.896346	0.890000	1.000000																										1	Substitution - coding silent(1)	p.T264T(1)	large_intestine(1)	30						c.(790-792)acG>acA		G protein-coupled receptor 97							136.0	119.0	125.0					16																	57714440		2198	4300	6498	SO:0001819	synonymous_variant	222487	0	0					g.chr16:57714440G>A	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.792G>A	chr16.hg19:g.57714440G>A		0					GPR97_ENST00000450388.3_Silent_p.T144T|RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000327655.6_Silent_p.T54T	p.T264T	NM_170776.4	NP_740746.4	0	0	0	2.115270	Q86Y34	GPR97_HUMAN		8	953	+			Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	ENST00000333493.4	1	1	hg19	c.792G>A	CCDS10786.1	1																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.587	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	1	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	1.770000	-4.695790	1	0.570000	NM_170776		0	67	67	0	191	188	1		1			0	0	40	0	0	1.000000	0	0	0	0	0	0	67	191
CES3	23491	broad.mit.edu	37	16	67006386	67006386	+	Silent	SNP	C	C	T	rs201944889		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr16:67006386C>T	ENST00000303334.4	+	11	1490	c.1419C>T	c.(1417-1419)ctC>ctT	p.L473L	CES3_ENST00000543856.1_Silent_p.L112L|CES3_ENST00000394037.1_Silent_p.L473L	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	473						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		GTCCCTTCCTCATGGACGAGA	0.592																																						ENST00000303334.4	0.120000	3.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.075811	0.060000	0.070000																										0				24						c.(1417-1419)ctC>ctT		carboxylesterase 3							129.0	126.0	127.0					16																	67006386		2200	4300	6500	SO:0001819	synonymous_variant	23491	0	0					g.chr16:67006386C>T	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1419C>T	chr16.hg19:g.67006386C>T		0					CES3_ENST00000543856.1_Silent_p.L112L|CES3_ENST00000394037.1_Silent_p.L473L	p.L473L	NM_024922.5	NP_079198.2	0	0	0	2.115270	Q6UWW8	EST3_HUMAN		11	1490	+		Ovarian(137;0.0563)	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Silent	SNP	ENST00000303334.4	0	1	hg19	c.1419C>T	CCDS10826.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.592	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	130	1	1.770000	-2.595096	1	0.570000	NM_024922		0	12	12	0	580	573	0		1	0		0	0	131	0	0	0.999061	1.499770e-01	0	1	0	30	0	12	580
ESRP2	80004	broad.mit.edu	37	16	68265495	68265495	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr16:68265495G>A	ENST00000565858.1	-	11	1518	c.1432C>T	c.(1432-1434)Cgc>Tgc	p.R478C	ESRP2_ENST00000473183.2_Missense_Mutation_p.R468C|RP11-96D1.11_ENST00000571197.1_RNA	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	478	RRM 3.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						CCTCGGAGGCGTACACAGTCC	0.622																																						ENST00000565858.1	0.120000	1.000000e-02	9.000000e-02	2.000000e-02	0.050000	0.061450	0.050000	0.050000																										0				16						c.(1432-1434)Cgc>Tgc		epithelial splicing regulatory protein 2							90.0	78.0	82.0					16																	68265495		2198	4300	6498	SO:0001583	missense	80004	0	0					g.chr16:68265495G>A	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1432C>T	chr16.hg19:g.68265495G>A	ENSP00000454554:p.Arg478Cys	0					RP11-96D1.11_ENST00000571197.1_RNA|ESRP2_ENST00000473183.2_Missense_Mutation_p.R468C	p.R478C	NM_024939.2	NP_079215.2	0	0	0	2.115270	Q9H6T0	ESRP2_HUMAN		11	1518	-			Q8N6H8|Q8WZ15|Q9H6I4	Missense_Mutation	SNP	ENST00000565858.1	0	1	hg19	c.1432C>T		0	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012624	0.75161	.	.	ENSG00000103067	ENST00000473183	T	0.09163	3.01	5.93	5.93	0.95920	5.93	5.93	0.95920	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.52500	0.1738	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69105	-0.5233	10	0.87932	D	0	-15.6647	20.3437	0.98782	0.0:0.0:1.0:0.0	.	478;468	Q9H6T0;Q9H6T0-2	ESRP2_HUMAN;.	C	468	ENSP00000418748:R468C	ENSP00000418748:R468C	R	-	1	0	0	ESRP2	66822996	66822996	1.000000	0.71417	0.999000	0.59377	0.909000	0.53808	6.459000	0.73513	2.815000	0.96918	0.561000	0.74099	CGC	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.622	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	0	0	0	2	2	2	2	0	0	0	0	82	82	82	81	1	1.770000	-4.970394	1	0.570000	NM_024939		0	4	4	0	275	274	0		1	0		0	0	82	0	0	0.890207	2.322939e-01	0	0	0	51	0	4	275
NF1	4763	broad.mit.edu	37	17	29652851	29652851	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:29652851C>T	ENST00000358273.4	+	37	5232	c.4849C>T	c.(4849-4851)Caa>Taa	p.Q1617*	NF1_ENST00000356175.3_Nonsense_Mutation_p.Q1596*|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1617	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAAAACTGGTCAAATCAATGG	0.323			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												ENST00000358273.4	0.100000	0	7.000000e-02	2.000000e-02	0.040000	0.053452	0.040000	0.040000			yes	Rec	yes	Neurofibromatosis type 1	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	17q12	4763	D, Mis, N, F, S, O	neurofibromatosis type 1 gene				O	O		neurofibroma, glioma	neurofibroma, glioma	NF1/ACCN1(2)	11	Whole gene deletion(8)|Unknown(3)	p.0?(8)|p.?(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	599						c.(4849-4851)Caa>Taa		neurofibromin 1							88.0	89.0	89.0					17																	29652851		2203	4300	6503	SO:0001587	stop_gained	4763	0	0		Neurofibromatosis, type 1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	g.chr17:29652851C>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4849C>T	chr17.hg19:g.29652851C>T	ENSP00000351015:p.Gln1617*	0	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Nonsense_Mutation_p.Q1596*	p.Q1617*	NM_001042492.2	NP_001035957.1	0	0	0	2.108319	P21359	NF1_HUMAN		37	5232	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	0	1	hg19	c.4849C>T	CCDS42292.1	0	.	.	.	.	.	.	.	.	.	.	C	47	13.673406	0.99756	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	18.7588	0.91842	0.0:1.0:0.0:0.0	.	.	.	.	X	1617;1596;1262	.	ENSP00000348498:Q1596X	Q	+	1	0	0	NF1	26676977	26676977	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.456000	0.80751	2.697000	0.92050	0.655000	0.94253	CAA	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.323	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	0	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.770000	-3.083064	1	0.570000	NM_000267		0	5	5	0	381	380	0		1			0	0	44	0	0	0.937502	0	0	0	0	0	0	5	381
NF1	4763	broad.mit.edu	37	17	29665118	29665118	+	Silent	SNP	T	T	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:29665118T>G	ENST00000358273.4	+	45	7163	c.6780T>G	c.(6778-6780)tcT>tcG	p.S2260S	NF1_ENST00000356175.3_Silent_p.S2239S|NF1_ENST00000417592.2_Intron|NF1_ENST00000444181.2_Silent_p.S53S	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2260					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AACGAGTGTCTCATGGGCAGA	0.403			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												ENST00000358273.4	0.340000	2.000000e-01	3.100000e-01	2.300000e-01	0.260000	0.275802	0.260000	0.270000			yes	Rec	yes	Neurofibromatosis type 1	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	17q12	4763	D, Mis, N, F, S, O	neurofibromatosis type 1 gene				O	O		neurofibroma, glioma	neurofibroma, glioma	NF1/ACCN1(2)	11	Whole gene deletion(8)|Unknown(3)	p.0?(8)|p.?(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	599						c.(6778-6780)tcT>tcG		neurofibromin 1							161.0	154.0	156.0					17																	29665118		2203	4300	6503	SO:0001819	synonymous_variant	4763	0	0		Neurofibromatosis, type 1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	g.chr17:29665118T>G		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6780T>G	chr17.hg19:g.29665118T>G		0	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_ENST00000444181.2_Silent_p.S53S|NF1_ENST00000356175.3_Silent_p.S2239S|NF1_ENST00000417592.2_Intron	p.S2260S	NM_001042492.2	NP_001035957.1	0	0	0	2.108319	P21359	NF1_HUMAN		45	7163	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	1	1	hg19	c.6780T>G	CCDS42292.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.403	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	1	0	1	2	2	2	2	0	0	0	0	143	143	143	140	1	1.770000	-13.762360	1	0.570000	NM_000267		0	61	61	0	716	712	0		1			0	0	143	0	0	1.000000	0	0	0	0	0	0	61	716
LIG3	3980	broad.mit.edu	37	17	33318808	33318808	+	Missense_Mutation	SNP	T	T	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:33318808T>A	ENST00000378526.4	+	6	1293	c.1160T>A	c.(1159-1161)cTc>cAc	p.L387H	LIG3_ENST00000262327.5_Missense_Mutation_p.L387H	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	387					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	CTGTCCAAGCTCACCAAGGAG	0.552								Other BER factors																														ENST00000378526.4	0.180000	4.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.104841	0.090000	0.100000																										0				31						c.(1159-1161)cTc>cAc	Other BER factors	ligase III, DNA, ATP-dependent	Bleomycin(DB00290)						70.0	62.0	65.0					17																	33318808		2203	4300	6503	SO:0001583	missense	3980	0	0					g.chr17:33318808T>A		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1160T>A	chr17.hg19:g.33318808T>A	ENSP00000367787:p.Leu387His	0					LIG3_ENST00000262327.5_Missense_Mutation_p.L387H	p.L387H	NM_013975.3	NP_039269.2	0	0	0	2.108319	P49916	DNLI3_HUMAN		6	1293	+		Ovarian(249;0.17)	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	0	1	hg19	c.1160T>A	CCDS11284.2	0	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480006	0.84747	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.21191	2.02;2.02	5.5	5.5	0.81552	5.5	5.5	0.81552	DNA ligase, ATP-dependent, N-terminal (3);	0.064354	0.64402	D	0.000004	T	0.46444	0.1393	M	0.78049	2.395	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70935	0.971;0.971;0.957	T	0.38090	-0.9677	10	0.36615	T	0.2	-20.8443	14.9457	0.71029	0.0:0.0:0.0:1.0	.	387;387;387	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	H	387	ENSP00000367787:L387H;ENSP00000262327:L387H	ENSP00000262327:L387H	L	+	2	0	0	LIG3	30342921	30342921	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.672000	0.83956	2.308000	0.77769	0.533000	0.62120	CTC	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.552	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	0	0	1	2	2	2	2	0	0	0	0	68	68	68	64	1	1.770000	-9.291851	1	0.570000	NM_013975		0	8	8	0	287	285	0		1	0		0	0	68	0	0	0.989335	2.975820e-03	0	0	0	3	0	8	287
SMARCE1	6605	broad.mit.edu	37	17	38787103	38787103	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:38787103C>T	ENST00000348513.6	-	10	1670	c.890G>A	c.(889-891)cGc>cAc	p.R297H	SMARCE1_ENST00000400122.3_Missense_Mutation_p.R227H|KRT222_ENST00000476049.1_3'UTR|SMARCE1_ENST00000580419.1_Missense_Mutation_p.R262H|SMARCE1_ENST00000377808.4_Missense_Mutation_p.R262H|SMARCE1_ENST00000544009.1_Missense_Mutation_p.R227H|SMARCE1_ENST00000578044.1_Missense_Mutation_p.R227H|SMARCE1_ENST00000431889.2_Missense_Mutation_p.R279H	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	297					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)	p.R297H(1)		large_intestine(1)	1		Breast(137;0.000812)				CTGCCTTTTGCGGGCCTGTTC	0.507																																						ENST00000348513.6	1.000000	7.500000e-01	9.500000e-01	8.100000e-01	0.870000	0.885355	0.870000	1.000000																										1	Substitution - Missense(1)	p.R297H(1)	large_intestine(1)	1						c.(889-891)cGc>cAc		SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1							122.0	106.0	111.0					17																	38787103		2203	4300	6503	SO:0001583	missense	6605	0	0					g.chr17:38787103C>T	AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.890G>A	chr17.hg19:g.38787103C>T	ENSP00000323967:p.Arg297His	0					SMARCE1_ENST00000578044.1_Missense_Mutation_p.R227H|SMARCE1_ENST00000544009.1_Missense_Mutation_p.R227H|SMARCE1_ENST00000377808.4_Missense_Mutation_p.R262H|KRT222_ENST00000476049.1_3'UTR|SMARCE1_ENST00000580419.1_Missense_Mutation_p.R262H|SMARCE1_ENST00000400122.3_Missense_Mutation_p.R227H|SMARCE1_ENST00000431889.2_Missense_Mutation_p.R279H	p.R297H	NM_003079.4	NP_003070.3	0	0	0	2.108319	Q969G3	SMCE1_HUMAN		10	1670	-		Breast(137;0.000812)	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Missense_Mutation	SNP	ENST00000348513.6	1	1	hg19	c.890G>A	CCDS11370.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.53|17.53	3.412636|3.412636	0.62511|0.62511	.|.	.|.	ENSG00000073584|ENSG00000073584	ENST00000400122|ENST00000348513;ENST00000544009;ENST00000431889;ENST00000377808;ENST00000447024	.|T;T;T	.|0.20598	.|2.07;2.06;2.3	5.47|5.47	5.47|5.47	0.80525|0.80525	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.048290	.|0.85682	.|D	.|0.000000	T|T	0.44993|0.44993	0.1320|0.1320	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.76071	.|0.987;0.98;0.98	T|T	0.28332|0.28332	-1.0047|-1.0047	5|10	.|0.72032	.|D	.|0.01	.|.	19.7017|19.7017	0.96057|0.96057	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|262;262;297	.|C0IMW5;C0IMW4;Q969G3	.|.;.;SMCE1_HUMAN	T|H	123|297;227;279;262;91	.|ENSP00000323967:R297H;ENSP00000445370:R279H;ENSP00000367039:R262H	.|ENSP00000323967:R297H	A|R	-|-	1|2	0|0	0|0	SMARCE1|SMARCE1	36040629|36040629	36040629|36040629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.872000|0.872000	0.50106|0.50106	6.978000|6.978000	0.76147|0.76147	2.724000|2.724000	0.93272|0.93272	0.561000|0.561000	0.74099|0.74099	GCA|CGC	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.507	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257203.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	1.770000	-5.881682	1	0.570000	NM_003079		0	125	122	0	365	360	0		1	1		0	0	93	0	0	1.000000	1	0	108	0	252	0	125	365
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.500000e-01	9.900000e-01	9.000000e-01	0.950000	0.953260	0.950000	0.990000	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	24185	GRCh37	CM971506	TP53	M	rs121913344	c.(916-918)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						120.0	106.0	110.0					17																	7577022		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577022G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	chr17.hg19:g.7577022G>A	ENSP00000269305:p.Arg306*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000413465.2_Intron	p.R306*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.562258	P04637	P53_HUMAN		8	1105	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.916C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	2	TP53	7517747	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA	0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	20	2	6	1	1	1	2	74	74	74	72	1	1.770000	-20.000000	1	0.570000	NM_000546		0	120	120	0	174	174	1		1	1	1	1	1	74	960	0	1.000000	9.879044e-01	1	2	253	11	344	120	174
CHD3	1107	broad.mit.edu	37	17	7797171	7797171	+	Missense_Mutation	SNP	G	G	A	rs139173826		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:7797171G>A	ENST00000330494.7	+	6	992	c.842G>A	c.(841-843)cGc>cAc	p.R281H	CHD3_ENST00000358181.4_Missense_Mutation_p.R281H|CHD3_ENST00000380358.4_Missense_Mutation_p.R340H	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	281					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CCTGATGGACGCAAGAAGCTT	0.542																																						ENST00000330494.7	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.026824	0.020000	0.020000																										0				65						c.(841-843)cGc>cAc		chromodomain helicase DNA binding protein 3		G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	137.0	132.0	134.0		1019,842,842	5.3	1.0	17	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	CHD3	NM_001005271.2,NM_001005273.2,NM_005852.3	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	340/2060,281/2001,281/1967	7797171	1,13005	2203	4300	6503	SO:0001583	missense	1107	10	121412	45				g.chr17:7797171G>A	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.842G>A	chr17.hg19:g.7797171G>A	ENSP00000332628:p.Arg281His	1					CHD3_ENST00000358181.4_Missense_Mutation_p.R281H|CHD3_ENST00000380358.4_Missense_Mutation_p.R340H	p.R281H	NM_001005273.2	NP_001005273.1	0	1	1	1.562258	Q12873	CHD3_HUMAN		6	992	+		Prostate(122;0.202)	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	0	1	hg19	c.842G>A	CCDS32554.1	0	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571999	0.28092	0.0	1.16E-4	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.90504	-2.68;-2.63;-2.62	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.000000	0.44688	D	0.000423	T	0.80529	0.4640	N	0.22421	0.69	0.34035	D	0.654297	P;P;P	0.46220	0.871;0.874;0.874	B;B;B	0.35550	0.205;0.101;0.145	D	0.85691	0.1307	10	0.62326	D	0.03	-6.0171	7.7325	0.28796	0.0868:0.1663:0.7469:0.0	.	281;281;340	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	H	340;281;281	ENSP00000369716:R340H;ENSP00000350907:R281H;ENSP00000332628:R281H	ENSP00000332628:R281H	R	+	2	0	0	CHD3	7737896	7737896	0.981000	0.34729	1.000000	0.80357	0.987000	0.75469	1.600000	0.36762	2.480000	0.83734	0.650000	0.86243	CGC	0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.542	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	0	0	1	2	2	2	2	0	0	0	0	167	167	167	167	1	1.770000	-2.038208	0	0.570000	NM_001005273		0	6	6	0	645	637	0		1	0		0	0	167	0	0	0.963730	0	0	0	0	1	0	6	645
ARHGEF15	22899	broad.mit.edu	37	17	8221919	8221919	+	Missense_Mutation	SNP	G	G	A	rs143720339		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:8221919G>A	ENST00000361926.3	+	11	1921	c.1811G>A	c.(1810-1812)cGc>cAc	p.R604H	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Missense_Mutation_p.R604H	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	604					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GAGGTGGGGCGCATGAAGCAG	0.612																																						ENST00000361926.3	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.062232	0.050000	0.050000																										0				37						c.(1810-1812)cGc>cAc		Rho guanine nucleotide exchange factor (GEF) 15		G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	62.0	63.0	62.0		1811,1811	5.3	1.0	17	dbSNP_134	62	0,8600		0,0,4300	no	missense,missense	ARHGEF15	NM_025014.1,NM_173728.3	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	604/842,604/842	8221919	1,13005	2203	4300	6503	SO:0001583	missense	22899	2	121412	29				g.chr17:8221919G>A	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1811G>A	chr17.hg19:g.8221919G>A	ENSP00000355026:p.Arg604His	1					ARHGEF15_ENST00000421050.1_Missense_Mutation_p.R604H|AC135178.7_ENST00000458568.1_RNA	p.R604H	NM_173728.3	NP_776089.2	0	1	1	1.562258	O94989	ARHGF_HUMAN		11	1921	+			A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	0	1	hg19	c.1811G>A	CCDS11139.1	0	.	.	.	.	.	.	.	.	.	.	g	23.0	4.358370	0.82243	2.27E-4	0.0	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.32515	1.45;1.45	5.29	5.29	0.74685	5.29	5.29	0.74685	Dbl homology (DH) domain (1);	0.059270	0.64402	D	0.000004	T	0.51160	0.1658	L	0.59436	1.845	0.46113	D	0.998873	D;D	0.89917	1.0;1.0	D;D	0.66979	0.948;0.948	T	0.49679	-0.8914	10	0.54805	T	0.06	-18.0429	16.4339	0.83864	0.0:0.0:1.0:0.0	.	604;604	D3DTR7;O94989	.;ARHGF_HUMAN	H	604;394;604	ENSP00000355026:R604H;ENSP00000412505:R604H	ENSP00000355026:R604H	R	+	2	0	0	ARHGEF15	8162644	8162644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.368000	0.59505	2.470000	0.83445	0.555000	0.69702	CGC	0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.612	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	1.770000	-3.072909	1	0.570000	NM_173728		0	4	4	0	194	193	0		1	0		0	0	73	0	0	0.890036	2.187084e-03	0	0	0	3	0	4	194
VPS25	84313	broad.mit.edu	37	17	40925889	40925889	+	Missense_Mutation	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr17:40925889G>T	ENST00000253794.2	+	2	232	c.192G>T	c.(190-192)aaG>aaT	p.K64N		NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)	64					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		ACAACGTCAAGCTACAGCGTA	0.607																																						ENST00000253794.2	1.000000	6.900000e-01	9.600000e-01	7.700000e-01	0.860000	0.870295	0.860000	1.000000																										0				5						c.(190-192)aaG>aaT		vacuolar protein sorting 25 homolog (S. cerevisiae)							60.0	64.0	62.0					17																	40925889		2203	4300	6503	SO:0001583	missense	84313	0	0					g.chr17:40925889G>T	AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1		ENST00000253794.2:c.192G>T	chr17.hg19:g.40925889G>T	ENSP00000253794:p.Lys64Asn	0						p.K64N	NM_032353.2	NP_115729.1	0	0	0	2.108319	Q9BRG1	VPS25_HUMAN		2	232	+		Breast(137;0.00104)	B2R581	Missense_Mutation	SNP	ENST00000253794.2	1	1	hg19	c.192G>T	CCDS11438.1	1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419314	0.42918	.	.	ENSG00000131475	ENST00000253794	T	0.45276	0.9	5.64	4.67	0.58626	5.64	4.67	0.58626	ESCRT-II complex, Vps25 subunit, N-terminal winged helix (1);	0.048195	0.85682	D	0.000000	T	0.30572	0.0769	L	0.41124	1.26	0.58432	D	0.999997	B	0.27117	0.168	B	0.25759	0.063	T	0.10359	-1.0633	10	0.30854	T	0.27	-27.0428	7.0885	0.25272	0.1496:0.0:0.7087:0.1416	.	64	Q9BRG1	VPS25_HUMAN	N	64	ENSP00000253794:K64N	ENSP00000253794:K64N	K	+	3	2	2	VPS25	38179415	38179415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.207000	0.42788	1.383000	0.46405	0.655000	0.94253	AAG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.607	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452383.1	1	0	1	2	2	2	2	0	0	0	0	35	35	35	34	1	1.770000	-20.000000	1	0.570000	NM_032353		0	66	64	0	197	194	1		1	1		0	0	35	0	0	1.000000	1	0	53	0	127	0	66	197
SMCHD1	23347	broad.mit.edu	37	18	2739500	2739500	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr18:2739500G>C	ENST00000320876.6	+	27	3834	c.3496G>C	c.(3496-3498)Gag>Cag	p.E1166Q	SMCHD1_ENST00000261598.8_Missense_Mutation_p.E1166Q|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1166					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GATGGGCCAAGAGCTTCAAGG	0.338																																						ENST00000320876.6	0.200000	3.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.107223	0.090000	0.090000																										0				45						c.(3496-3498)Gag>Cag		structural maintenance of chromosomes flexible hinge domain containing 1							85.0	77.0	80.0					18																	2739500		1842	4084	5926	SO:0001583	missense	23347	0	0					g.chr18:2739500G>C	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3496G>C	chr18.hg19:g.2739500G>C	ENSP00000326603:p.Glu1166Gln	1					SMCHD1_ENST00000261598.8_Missense_Mutation_p.E1166Q|RP11-703M24.5_ENST00000583546.1_RNA	p.E1166Q	NM_015295.2	NP_056110.2	0	1	1	1.551594	A6NHR9	SMHD1_HUMAN		27	3834	+			O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	1	1	hg19	c.3496G>C	CCDS45822.1	0	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527477	0.64860	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.23552	1.9;1.91	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.195294	0.46758	D	0.000274	T	0.32526	0.0832	L	0.51422	1.61	0.39011	D	0.959543	P	0.45044	0.849	P	0.45377	0.478	T	0.03157	-1.1066	10	0.32370	T	0.25	-17.716	18.627	0.91344	0.0:0.0:1.0:0.0	.	1166	A6NHR9	SMHD1_HUMAN	Q	1166	ENSP00000326603:E1166Q;ENSP00000261598:E1166Q	ENSP00000261598:E1166Q	E	+	1	0	0	SMCHD1	2729500	2729500	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.796000	0.75145	2.642000	0.89623	0.650000	0.86243	GAG	0.403358		TCGA-OE-A75W-01A-12D-A32N-08	0.338	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.770000	-7.731958	1	0.570000			0	5	5	0	133	131	0		1			0	0	24	0	0	0.936303	0	0	0	0	0	0	5	133
LPHN1	22859	broad.mit.edu	37	19	14266197	14266197	+	Missense_Mutation	SNP	C	C	T	rs536482945		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:14266197C>T	ENST00000340736.6	-	19	3580	c.3283G>A	c.(3283-3285)Gtc>Atc	p.V1095I	CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.V1090I|CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000592086.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1095					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.V1095I(1)		central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAGTGAAAGACGAAGATGAAG	0.587																																						ENST00000340736.6	1.000000	8.900000e-01	1	9.400000e-01	0.990000	0.981856	0.990000	1.000000																										1	Substitution - Missense(1)	p.V1095I(1)	upper_aerodigestive_tract(1)	32						c.(3283-3285)Gtc>Atc		latrophilin 1							150.0	142.0	145.0					19																	14266197		2203	4300	6503	SO:0001583	missense	22859	2	121412	41				g.chr19:14266197C>T	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3283G>A	chr19.hg19:g.14266197C>T	ENSP00000340688:p.Val1095Ile	1					CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.V1090I|CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA	p.V1095I	NM_001008701.2	NP_001008701.1	0	1	1	1.945463	O94910	LPHN1_HUMAN		19	3580	-			Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	1	1	hg19	c.3283G>A	CCDS32928.1	1	.	.	.	.	.	.	.	.	.	.	C	5.280	0.237123	0.10023	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.41065	1.01;1.01	5.21	4.18	0.49190	5.21	4.18	0.49190	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	0.070788	0.56097	D	0.000027	T	0.13200	0.0320	N	0.01529	-0.815	0.40998	D	0.984908	B;B	0.10296	0.003;0.003	B;B	0.12837	0.008;0.001	T	0.18808	-1.0325	10	0.02654	T	1	.	7.6688	0.28447	0.0:0.8111:0.0:0.1889	.	1090;1095	O94910-2;O94910	.;LPHN1_HUMAN	I	1095;1090	ENSP00000340688:V1095I;ENSP00000355328:V1090I	ENSP00000340688:V1095I	V	-	1	0	0	LPHN1	14127197	14127197	0.986000	0.35501	0.984000	0.44739	0.998000	0.95712	2.344000	0.44010	1.184000	0.42957	0.561000	0.74099	GTC	0.493492		TCGA-OE-A75W-01A-12D-A32N-08	0.587	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	1	0	1	2	2	2	2	0	0	0	0	166	166	166	163	1	1.770000	-20.000000	1	0.570000	NM_014921		0	188	185	0	365	364	0		1	1		0	0	166	0	0	1.000000	9.819391e-01	0	3	0	12	0	188	365
SPPL2B	56928	broad.mit.edu	37	19	2341000	2341000	+	RNA	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:2341000G>A	ENST00000452401.2	+	0	1021							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGTCTTCCGCAACGAGGAC	0.701																																						ENST00000452401.2	0.190000	4.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.107680	0.090000	0.100000																										0												signal peptide peptidase like 2B							47.0	56.0	53.0					19																	2341000		2197	4296	6493			56928	1	121324	25				g.chr19:2341000G>A		CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			chr19.hg19:g.2341000G>A		0									0	1	1	1.954477	Q8TCT7	SPP2B_HUMAN		0	1021	+		Hepatocellular(1079;0.137)	D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	RNA	SNP	ENST00000452401.2	0	1	hg19			0	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604692	0.66445	.	.	ENSG00000005206	ENST00000452401;ENST00000382189	.	.	.	4.47	4.47	0.54385	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.79845	0.4516	.	.	.	0.51767	D	0.999931	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84965	0.0879	7	0.87932	D	0	-33.5577	15.6943	0.77481	0.0:0.0:1.0:0.0	.	315;314	Q8TCT7;C9JFE6	PSL1_HUMAN;.	H	314;303	.	ENSP00000371624:R303H	R	+	2	0	0	AC004410.1	2292000	2292000	1.000000	0.71417	0.983000	0.44433	0.048000	0.14542	9.152000	0.94680	2.041000	0.60428	0.561000	0.74099	CGC	0.532710		TCGA-OE-A75W-01A-12D-A32N-08	0.701	SPPL2B-202	KNOWN	basic	processed_transcript	processed_transcript		0	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	1.770000	-8.207476	1	0.570000	NM_020172		0	7	7	0	230	226	0		1	1		0	0	53	0	0	0.979864	6.651939e-01	0	4	0	69	0	7	230
NOTCH3	4854	broad.mit.edu	37	19	15271827	15271827	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:15271827C>T	ENST00000263388.2	-	33	6687	c.6612G>A	c.(6610-6612)ccG>ccA	p.P2204P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2204					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCCGCTCCTGCGGGGAGACGG	0.741																																						ENST00000263388.2	0.890000	2.200000e-01	7.000000e-01	3.400000e-01	0.500000	0.529496	0.500000	0.480000																										0				93						c.(6610-6612)ccG>ccA		notch 3							3.0	5.0	4.0					19																	15271827		1881	3842	5723	SO:0001819	synonymous_variant	4854	1	116512	21				g.chr19:15271827C>T	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6612G>A	chr19.hg19:g.15271827C>T		0						p.P2204P	NM_000435.2	NP_000426.2	0	1	1	1.923758	Q9UM47	NOTC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)	33	6687	-			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	1	1	hg19	c.6612G>A	CCDS12326.1	0																																																																																								0.525360		TCGA-OE-A75W-01A-12D-A32N-08	0.741	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	18	1	1.770000	-13.643960	1	0.570000	NM_000435		0	6	6	0	33	32	0		1	0		0	0	20	0	0	0.966505	9.959318e-01	0	0	0	66	0	6	33
ATP4A	495	broad.mit.edu	37	19	36043993	36043993	+	Silent	SNP	C	C	T	rs200535073		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:36043993C>T	ENST00000262623.3	-	18	2725	c.2697G>A	c.(2695-2697)gcG>gcA	p.A899A		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	899					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CCTCCCACTGCGCCCGCAGCC	0.647																																						ENST00000262623.3	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.045314	0.030000	0.040000																										0				53						c.(2695-2697)gcG>gcA		ATPase, H+/K+ exchanging, alpha polypeptide	Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)						93.0	89.0	90.0					19																	36043993		2203	4300	6503	SO:0001819	synonymous_variant	495	2	121412	39				g.chr19:36043993C>T		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2697G>A	chr19.hg19:g.36043993C>T		0						p.A899A	NM_000704.2	NP_000695.2	0	0	0	2.108690	P20648	ATP4A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)	18	2725	-	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		O00738	Silent	SNP	ENST00000262623.3	0	1	hg19	c.2697G>A	CCDS12467.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.647	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	0	0	1	2	2	2	2	0	0	0	0	163	163	163	159	1	1.770000	-2.665716	1	0.570000	NM_000704		0	9	9	0	758	752	0		1			0	0	163	0	0	0.994034	0	0	0	0	0	0	9	758
ARHGAP33	115703	broad.mit.edu	37	19	36271129	36271129	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:36271129G>A	ENST00000007510.4	+	7	662	c.518G>A	c.(517-519)cGg>cAg	p.R173Q	ARHGAP33_ENST00000378944.5_Missense_Mutation_p.R37Q|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.R173Q			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	173					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.R173Q(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						AATCACGGCCGGCGACTGCTC	0.592																																						ENST00000007510.4	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.037151	0.030000	0.040000																										1	Substitution - Missense(1)	p.R173Q(1)	lung(1)	37						c.(517-519)cGg>cAg		Rho GTPase activating protein 33							78.0	70.0	73.0					19																	36271129		2203	4300	6503	SO:0001583	missense	115703	1	121412	37				g.chr19:36271129G>A	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.518G>A	chr19.hg19:g.36271129G>A	ENSP00000007510:p.Arg173Gln	0					ARHGAP33_ENST00000314737.5_Missense_Mutation_p.R173Q|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.R37Q	p.R173Q			0	0	0	2.108690	O14559	RHG33_HUMAN		7	662	+			O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	0	1	hg19	c.518G>A		0	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590020	0.86851	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.11930	3.08;2.73;3.15	4.84	3.8	0.43715	4.84	3.8	0.43715	.	0.305936	0.23487	N	0.047642	T	0.21267	0.0512	L	0.49126	1.545	0.30529	N	0.767663	D;D	0.71674	0.998;0.974	P;P	0.58721	0.844;0.466	T	0.04537	-1.0944	10	0.54805	T	0.06	.	5.6018	0.17357	0.2761:0.0:0.7239:0.0	.	37;173	O14559-10;O14559-11	.;.	Q	173;173;37	ENSP00000007510:R173Q;ENSP00000320038:R173Q;ENSP00000368227:R37Q	ENSP00000007510:R173Q	R	+	2	0	0	ARHGAP33	40962969	40962969	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.552000	0.67281	2.227000	0.72691	0.561000	0.74099	CGG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.592	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	98	98	98	96	1	1.770000	-2.673527	1	0.570000	NM_052948		0	5	5	0	545	540	0		1	0		0	0	98	0	0	0.936292	0	0	0	0	1	0	5	545
PRODH2	58510	broad.mit.edu	37	19	36303061	36303061	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:36303061G>A	ENST00000301175.3	-	4	730	c.713C>T	c.(712-714)aCg>aTg	p.T238M		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	238					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGTCAGCGCCGTCACCTTCAG	0.687																																						ENST00000301175.3	0.230000	9.000000e-02	2.000000e-01	1.200000e-01	0.150000	0.163953	0.150000	0.160000																										0				21						c.(712-714)aCg>aTg		proline dehydrogenase (oxidase) 2							53.0	58.0	56.0					19																	36303061		2203	4300	6503	SO:0001583	missense	58510	1	121412	35				g.chr19:36303061G>A	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.713C>T	chr19.hg19:g.36303061G>A	ENSP00000301175:p.Thr238Met	0						p.T238M	NM_021232.1	NP_067055.1	0	0	0	2.108690	Q9UF12	PROD2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)	4	730	-	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)			Missense_Mutation	SNP	ENST00000301175.3	1	1	hg19	c.713C>T	CCDS12478.1	0	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186150	0.78789	.	.	ENSG00000250799	ENST00000301175	T	0.41065	1.01	4.85	4.85	0.62838	4.85	4.85	0.62838	.	.	.	.	.	T	0.62986	0.2473	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.66925	-0.5800	9	0.66056	D	0.02	.	15.5053	0.75735	0.0:0.0:1.0:0.0	.	238	Q9UF12	PROD2_HUMAN	M	238	ENSP00000301175:T238M	ENSP00000301175:T238M	T	-	2	0	0	PRODH2	40994901	40994901	1.000000	0.71417	0.997000	0.53966	0.859000	0.49053	7.408000	0.80041	2.531000	0.85337	0.655000	0.94253	ACG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.687	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	1	0	1	2	2	2	2	0	0	0	0	90	90	90	89	1	1.770000	-3.213168	1	0.570000	NM_021232		0	23	22	0	482	478	0		1			0	0	90	0	0	0.999999	0	0	0	0	0	0	23	482
SIPA1L3	23094	broad.mit.edu	37	19	38682812	38682812	+	Silent	SNP	C	C	T	rs569236464		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:38682812C>T	ENST00000222345.6	+	17	4967	c.4458C>T	c.(4456-4458)gtC>gtT	p.V1486V		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1486					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCAAAAATGTCTTTGGGCAAC	0.522																																						ENST00000222345.6	0.850000	5.300000e-01	7.700000e-01	6.000000e-01	0.680000	0.694280	0.680000	0.690000																										0				59						c.(4456-4458)gtC>gtT		signal-induced proliferation-associated 1 like 3							112.0	93.0	99.0					19																	38682812		2203	4300	6503	SO:0001819	synonymous_variant	23094	0	0					g.chr19:38682812C>T	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.4458C>T	chr19.hg19:g.38682812C>T		0						p.V1486V	NM_015073.1	NP_055888.1	0	0	0	2.108690	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)	17	4967	+			Q2TV87	Silent	SNP	ENST00000222345.6	1	1	hg19	c.4458C>T	CCDS33007.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.522	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.770000	-20.000000	1	0.570000	XM_032278		0	58	58	0	234	228	1		1	1		0	0	50	0	0	1.000000	8.951679e-01	0	4	0	14	0	58	234
RYR1	6261	broad.mit.edu	37	19	39075614	39075614	+	Missense_Mutation	SNP	G	G	A	rs118192151		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:39075614G>A	ENST00000359596.3	+	102	14678	c.14678G>A	c.(14677-14679)cGg>cAg	p.R4893Q	RYR1_ENST00000360985.3_Missense_Mutation_p.R4888Q|RYR1_ENST00000355481.4_Missense_Mutation_p.R4888Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4893			R -> Q (in CCD). {ECO:0000269|PubMed:12565913}.|R -> W (in CCD; release of calcium from intracellular stores in the absence of any pharmacological activator of RYR; smaller thapsigargin-sensitive intracellular calcium stores; normal sensitivity of the calcium release to the RYR inhibitor dantrolene). {ECO:0000269|PubMed:11709545, ECO:0000269|PubMed:14670767}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GTGGGTGTCCGGGCTGGCGGA	0.572																																						ENST00000359596.3	0.560000	3.000000e-01	5.000000e-01	3.600000e-01	0.420000	0.436794	0.420000	0.430000																										0				285	GRCh37	CM030713|CM061940	RYR1	M	rs118192151	c.(14677-14679)cGg>cAg		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						189.0	159.0	169.0					19																	39075614		2203	4300	6503	SO:0001583	missense	6261	0	0					g.chr19:39075614G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14678G>A	chr19.hg19:g.39075614G>A	ENSP00000352608:p.Arg4893Gln	0					RYR1_ENST00000360985.3_Missense_Mutation_p.R4888Q|RYR1_ENST00000355481.4_Missense_Mutation_p.R4888Q	p.R4893Q			0	0	0	2.108690	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	102	14678	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	1	1	hg19	c.14678G>A	CCDS33011.1	0	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959539	0.74016	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.94457	-3.43;-3.43;-3.43	5.08	5.08	0.68730	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.64402	U	0.000015	D	0.98086	0.9369	M	0.94142	3.5	0.52501	D	0.999954	D;D	0.76494	0.999;0.999	D;D	0.80764	0.99;0.994	D	0.99081	1.0837	10	0.87932	D	0	.	18.3248	0.90250	0.0:0.0:1.0:0.0	.	4888;4893	P21817-2;P21817	.;RYR1_HUMAN	Q	4893;4888;4888	ENSP00000352608:R4893Q;ENSP00000347667:R4888Q;ENSP00000354254:R4888Q	ENSP00000347667:R4888Q	R	+	2	0	0	RYR1	43767454	43767454	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.656000	0.98514	2.658000	0.90341	0.449000	0.29647	CGG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.572	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	64	1	1.770000	-2.559263	1	0.570000			0	37	35	0	262	259	1		1	0		0	0	65	0	0	1.000000	1.630327e-02	0	0	0	2	0	37	262
CYP2A6	1548	broad.mit.edu	37	19	41351245	41351245	+	Missense_Mutation	SNP	C	C	T	rs145036049		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:41351245C>T	ENST00000301141.5	-	7	1135	c.1115G>A	c.(1114-1116)cGc>cAc	p.R372H	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	372					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TTTGACTCTGCGGGCCAAACT	0.572													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17968	0.0		0.0	False		,,,				2504	0.0					ENST00000301141.5	0.060000	0	4.000000e-02	1.000000e-02	0.020000	0.030430	0.020000	0.020000																										0				37						c.(1114-1116)cGc>cAc		cytochrome P450, family 2, subfamily A, polypeptide 6	Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	C	HIS/ARG	1,4405		0,1,2202	118.0	114.0	116.0		1115	0.6	0.1	19	dbSNP_134	116	0,8600		0,0,4300	no	missense	CYP2A6	NM_000762.5	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	372/495	41351245	1,13005	2203	4300	6503	SO:0001583	missense	1548	20	121308	46				g.chr19:41351245C>T	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.1115G>A	chr19.hg19:g.41351245C>T	ENSP00000301141:p.Arg372His	0					CTC-490E21.12_ENST00000601627.1_Intron	p.R372H	NM_000762.5	NP_000753	0	0	0	2.108690	P11509	CP2A6_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)	7	1135	-			A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	0	1	hg19	c.1115G>A	CCDS12568.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	-	0.014	-1.595383	0.00857	2.27E-4	0.0	ENSG00000255974	ENST00000301141	T	0.77877	-1.13	2.76	0.567	0.17325	2.76	0.567	0.17325	.	0.199062	0.42821	N	0.000649	T	0.50871	0.1641	N	0.02973	-0.45	0.09310	N	1	B;B	0.32693	0.105;0.38	B;B	0.43413	0.046;0.419	T	0.55885	-0.8070	10	0.02654	T	1	.	4.58	0.12253	0.0:0.4325:0.0:0.5675	.	372;372	Q13120;P11509	.;CP2A6_HUMAN	H	372	ENSP00000301141:R372H	ENSP00000301141:R372H	R	-	2	0	0	CYP2A6	46043085	46043085	0.000000	0.05858	0.056000	0.19401	0.181000	0.23173	-1.136000	0.03222	0.446000	0.26666	0.379000	0.24179	CGC	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.572	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	0	0	1	2	2	2	2	0	0	0	0	133	133	133	133	1	1.770000	-1.531743	0	0.570000	NM_000762		0	6	6	0	765	751	0		1			0	0	133	0	0	0.963015	0	0	0	0	0	0	6	765
TNFAIP8L1	126282	broad.mit.edu	37	19	4652052	4652052	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:4652052G>A	ENST00000536716.1	+	2	317	c.171G>A	c.(169-171)caG>caA	p.Q57Q	TNFAIP8L1_ENST00000327473.4_Silent_p.Q57Q|AC005339.2_ENST00000598070.1_RNA	NM_001167942.1	NP_001161414.1	Q8WVP5	TP8L1_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 1	57					negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)				endometrium(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAGGCCCAGAAGATGCTCA	0.662																																						ENST00000536716.1	1.000000	5.400000e-01	9.300000e-01	6.500000e-01	0.780000	0.794521	0.780000	1.000000																										0				1						c.(169-171)caG>caA		tumor necrosis factor, alpha-induced protein 8-like 1							57.0	56.0	56.0					19																	4652052		2203	4299	6502	SO:0001819	synonymous_variant	126282	0	0					g.chr19:4652052G>A	BC017672	CCDS12132.1	19p13.3	2008-02-05				ENSG00000185361			28279	protein-coding gene	gene with protein product		615869				12477932	Standard	NM_001167942		Approved	MGC17791	uc002max.3	Q8WVP5		ENST00000536716.1:c.171G>A	chr19.hg19:g.4652052G>A		0					TNFAIP8L1_ENST00000327473.4_Silent_p.Q57Q|AC005339.2_ENST00000598070.1_RNA	p.Q57Q	NM_001167942.1	NP_001161414.1	0	1	1	1.954477	Q8WVP5	TP8L1_HUMAN		2	317	+			D6W627	Silent	SNP	ENST00000536716.1	1	1	hg19	c.171G>A	CCDS12132.1	0																																																																																								0.532710		TCGA-OE-A75W-01A-12D-A32N-08	0.662	TNFAIP8L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458662.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	1.770000	-20.000000	1	0.570000	NM_152362		0	24	23	0	74	73	1		1	1		0	0	36	0	0	1.000000	4.631738e-01	0	2	0	4	0	24	74
EXOSC5	56915	broad.mit.edu	37	19	41903139	41903139	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:41903139G>A	ENST00000221233.4	-	1	245	c.95C>T	c.(94-96)gCc>gTc	p.A32V	BCKDHA_ENST00000269980.2_5'Flank|EXOSC5_ENST00000596905.1_Missense_Mutation_p.A32V|BCKDHA_ENST00000595085.1_Intron|BCKDHA_ENST00000457836.2_5'Flank|CTC-435M10.3_ENST00000604424.1_Intron|CTC-435M10.10_ENST00000598988.1_RNA|CTC-435M10.3_ENST00000540732.1_Intron	NM_020158.3	NP_064543.3	Q9NQT4	EXOS5_HUMAN	exosome component 5	32					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7						CTGTTCGCAGGCAAAGTGCCG	0.582																																						ENST00000221233.4	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.036700	0.030000	0.040000																										0				7						c.(94-96)gCc>gTc		exosome component 5							129.0	122.0	124.0					19																	41903139		2203	4300	6503	SO:0001583	missense	56915	0	0					g.chr19:41903139G>A	AF285785	CCDS12580.1	19q13.1	2008-02-05				ENSG00000077348			24662	protein-coding gene	gene with protein product	"""exosome component Rrp46"""	606492				11110791, 11812149	Standard	NM_020158		Approved	hRrp46p, Rrp46p, RRP46, RRP41B, MGC12901, p12B	uc002oqo.3	Q9NQT4		ENST00000221233.4:c.95C>T	chr19.hg19:g.41903139G>A	ENSP00000221233:p.Ala32Val	0					BCKDHA_ENST00000269980.2_5'Flank|BCKDHA_ENST00000457836.2_5'Flank|CTC-435M10.10_ENST00000598988.1_RNA|CTC-435M10.3_ENST00000540732.1_Intron|BCKDHA_ENST00000595085.1_Intron|EXOSC5_ENST00000596905.1_Missense_Mutation_p.A32V|CTC-435M10.3_ENST00000604424.1_Intron	p.A32V	NM_020158.3	NP_064543.3	0	0	0	2.108690	Q9NQT4	EXOS5_HUMAN		1	245	-			Q32Q81|Q8NG16|Q96I89	Missense_Mutation	SNP	ENST00000221233.4	0	1	hg19	c.95C>T	CCDS12580.1	0	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819174	0.50633	.	.	ENSG00000077348	ENST00000221233	T	0.63580	-0.05	5.55	4.52	0.55395	5.55	4.52	0.55395	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.159578	0.53938	N	0.000054	T	0.36963	0.0986	N	0.05351	-0.065	0.38224	D	0.940854	B	0.26547	0.152	B	0.17098	0.017	T	0.32322	-0.9911	10	0.31617	T	0.26	-17.2989	8.2921	0.31963	0.1727:0.0:0.8273:0.0	.	32	Q9NQT4	EXOS5_HUMAN	V	32	ENSP00000221233:A32V	ENSP00000221233:A32V	A	-	2	0	0	EXOSC5	46594979	46594979	0.997000	0.39634	0.992000	0.48379	0.964000	0.63967	2.911000	0.48774	1.579000	0.49836	0.590000	0.80494	GCC	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.582	EXOSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463492.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	125	1	1.770000	-2.148347	0	0.570000	NM_020158		0	7	6	0	740	733	0		1	0		0	0	127	0	0	0.979893	2.728728e-01	0	0	0	96	0	7	740
CD33	945	broad.mit.edu	37	19	51728379	51728379	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:51728379C>T	ENST00000262262.4	+	1	26	c.5C>T	c.(4-6)cCg>cTg	p.P2L	CD33_ENST00000436584.2_Missense_Mutation_p.P2L|CD33_ENST00000421133.2_Missense_Mutation_p.P2L|CD33_ENST00000391796.3_Missense_Mutation_p.P2L	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	2					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TCAGACATGCCGCTGCTGCTA	0.652																																						ENST00000262262.4	1.000000	2.000000e-01	4.200000e-01	2.600000e-01	0.320000	0.373980	0.320000	0.310000																										0				24						c.(4-6)cCg>cTg		CD33 molecule	Gemtuzumab ozogamicin(DB00056)						36.0	37.0	36.0					19																	51728379		2203	4300	6503	SO:0001583	missense	945	0	0					g.chr19:51728379C>T	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.5C>T	chr19.hg19:g.51728379C>T	ENSP00000262262:p.Pro2Leu	0					CD33_ENST00000421133.2_Missense_Mutation_p.P2L|CD33_ENST00000436584.2_Missense_Mutation_p.P2L|CD33_ENST00000391796.3_Missense_Mutation_p.P2L	p.P2L	NM_001772.3	NP_001763.3	1	2	3	2.233574	P20138	CD33_HUMAN		1	26	+		all_neural(266;0.0199)	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	ENST00000262262.4	1	1	hg19	c.5C>T	CCDS33084.1	0	.	.	.	.	.	.	.	.	.	.	.	5.629	0.300790	0.10678	.	.	ENSG00000105383	ENST00000436584;ENST00000262262;ENST00000421133;ENST00000391796	T;T;T;T	0.39592	1.07;2.53;1.38;2.41	3.75	-4.49	0.03504	3.75	-4.49	0.03504	.	.	.	.	.	T	0.11793	0.0287	N	0.02192	-0.645	0.09310	N	1	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.28106	-1.0054	9	0.02654	T	1	.	5.3402	0.15979	0.0:0.2105:0.3616:0.4279	.	2;2;2	C9JEN7;F8WAL2;P20138	.;.;CD33_HUMAN	L	2	ENSP00000403331:P2L;ENSP00000262262:P2L;ENSP00000410126:P2L;ENSP00000375673:P2L	ENSP00000262262:P2L	P	+	2	0	0	CD33	56420191	56420191	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.283000	0.01155	-1.134000	0.02899	-1.099000	0.02127	CCG	0.579585		TCGA-OE-A75W-01A-12D-A32N-08	0.652	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.770000	-20.000000	1	0.570000	NM_001772		0	20	21	0	205	198	1		1	0		0	0	29	0	0	0.999995	8.926501e-03	0	0	0	2	0	20	205
KIR3DL2	3812	broad.mit.edu	37	19	55363669	55363669	+	Missense_Mutation	SNP	G	G	A	rs148964687	byFrequency	TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:55363669G>A	ENST00000326321.3	+	3	320	c.287G>A	c.(286-288)cGg>cAg	p.R96Q	KIR3DL1_ENST00000402254.2_Intron|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.R96Q	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	96	Ig-like C2-type 1.				cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R96Q(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		TACAGATGTCGGGGTTCACGC	0.582																																						ENST00000326321.3	1.000000	2.900000e-01	4.600000e-01	3.300000e-01	0.390000	0.432148	0.390000	0.390000																										1	Substitution - Missense(1)	p.R96Q(1)	upper_aerodigestive_tract(1)	23						c.(286-288)cGg>cAg		killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2							55.0	50.0	52.0					19																	55363669		2162	4120	6282	SO:0001583	missense	3812	252	115524	55				g.chr19:55363669G>A	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.287G>A	chr19.hg19:g.55363669G>A	ENSP00000325525:p.Arg96Gln	0					KIR3DL2_ENST00000270442.5_Missense_Mutation_p.R96Q|KIR3DL1_ENST00000402254.2_Intron	p.R96Q	NM_006737.3	NP_006728.2	1	2	3	2.233574	P43630	KI3L2_HUMAN		3	320	+			Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	1	0	hg19	c.287G>A	CCDS12906.1	0	.	.	.	.	.	.	.	.	.	.	g	8.265	0.812014	0.16537	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.13657	2.57;2.57	1.03	-0.701	0.11269	1.03	-0.701	0.11269	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	5.841140	0.01572	U	0.020616	T	0.18425	0.0442	M	0.73372	2.23	0.09310	N	1	D;P	0.59357	0.985;0.938	B;B	0.43386	0.418;0.343	T	0.27191	-1.0081	10	0.66056	D	0.02	.	3.417	0.07380	0.5147:0.0:0.4853:0.0	.	96;96	Q95366;P43630	.;KI3L2_HUMAN	Q	96	ENSP00000325525:R96Q;ENSP00000270442:R96Q	ENSP00000270442:R96Q	R	+	2	0	0	KIR3DL2	60055481	60055481	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	-1.794000	0.01753	-0.237000	0.09739	0.184000	0.17185	CGG	0.579585		TCGA-OE-A75W-01A-12D-A32N-08	0.582	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1	1	0	1	2	2	2	2	0	0	0	0	85	85	85	106	1	1.770000	-2.665581	1	0.570000			0	51	49	0	421	389	0		1			0	0	85	0	0	1.000000	0	0	0	0	0	0	51	421
NLRP9	338321	broad.mit.edu	37	19	56243922	56243922	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:56243922G>A	ENST00000332836.2	-	2	1302	c.1275C>T	c.(1273-1275)ggC>ggT	p.G425G		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	425	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.		G -> D (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CCCACATCACGCCCTCAGACT	0.473																																						ENST00000332836.2	1.000000	8.500000e-01	1	9.100000e-01	0.980000	0.967244	0.980000	1.000000																										0				74						c.(1273-1275)ggC>ggT		NLR family, pyrin domain containing 9							98.0	99.0	99.0					19																	56243922		2203	4300	6503	SO:0001819	synonymous_variant	338321	0	0					g.chr19:56243922G>A	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1275C>T	chr19.hg19:g.56243922G>A		0						p.G425G	NM_176820.2	NP_789790.2	1	2	3	2.233574	Q7RTR0	NALP9_HUMAN		2	1302	-		Colorectal(82;0.000133)|Ovarian(87;0.133)	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	1	1	hg19	c.1275C>T	CCDS12934.1	1																																																																																								0.579585		TCGA-OE-A75W-01A-12D-A32N-08	0.473	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	1	0	1	2	2	2	2	0	0	0	0	110	110	110	109	1	1.770000	-9.029628	1	0.570000	NM_176820		0	186	185	0	495	487	1		1			0	0	110	0	0	1.000000	0	0	0	0	0	0	186	495
FBN3	84467	broad.mit.edu	37	19	8190815	8190815	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:8190815C>T	ENST00000600128.1	-	22	3106	c.2692G>A	c.(2692-2694)Gag>Aag	p.E898K	FBN3_ENST00000270509.2_Missense_Mutation_p.E898K|FBN3_ENST00000601739.1_Missense_Mutation_p.E898K			Q75N90	FBN3_HUMAN	fibrillin 3	898	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ATCAGGCCCTCTGGACACTCA	0.622																																						ENST00000600128.1	0.180000	5.000000e-02	1.500000e-01	7.000000e-02	0.100000	0.113542	0.100000	0.100000																										0				132						c.(2692-2694)Gag>Aag		fibrillin 3							60.0	51.0	54.0					19																	8190815		2203	4300	6503	SO:0001583	missense	84467	0	0					g.chr19:8190815C>T		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2692G>A	chr19.hg19:g.8190815C>T	ENSP00000470498:p.Glu898Lys	0					FBN3_ENST00000601739.1_Missense_Mutation_p.E898K|FBN3_ENST00000270509.2_Missense_Mutation_p.E898K	p.E898K			0	1	1	1.950536	Q75N90	FBN3_HUMAN		22	3106	-			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	1	1	hg19	c.2692G>A	CCDS12196.1	0	.	.	.	.	.	.	.	.	.	.	c	4.459	0.085024	0.08583	.	.	ENSG00000142449	ENST00000270509	D	0.92348	-3.02	4.0	-8.0	0.01126	4.0	-8.0	0.01126	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.296672	0.32884	N	0.005521	T	0.77315	0.4112	N	0.17564	0.495	0.09310	N	1	B	0.22146	0.065	B	0.18561	0.022	T	0.62515	-0.6838	10	0.33940	T	0.23	.	4.9192	0.13862	0.084:0.3077:0.4089:0.1993	.	898	Q75N90	FBN3_HUMAN	K	898	ENSP00000270509:E898K	ENSP00000270509:E898K	E	-	1	0	0	FBN3	8096815	8096815	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.712000	0.05013	-2.657000	0.00421	-1.887000	0.00540	GAG	0.528328		TCGA-OE-A75W-01A-12D-A32N-08	0.622	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	0	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	1.770000	-10.576320	1	0.570000	NM_032447		0	10	10	0	297	294	0		1			0	0	59	0	0	0.996854	0	0	0	0	0	0	10	297
ZNF471	57573	broad.mit.edu	37	19	57036821	57036821	+	Missense_Mutation	SNP	A	A	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr19:57036821A>T	ENST00000308031.5	+	5	1518	c.1385A>T	c.(1384-1386)aAg>aTg	p.K462M	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_3'UTR	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		TATGAATGCAAGGAATGTGGG	0.378																																					Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	ENST00000308031.5	1.000000	1.600000e-01	2.800000e-01	1.900000e-01	0.220000	0.282187	0.220000	0.230000																										0				36						c.(1384-1386)aAg>aTg		zinc finger protein 471							87.0	83.0	84.0					19																	57036821		2203	4300	6503	SO:0001583	missense	57573	0	0					g.chr19:57036821A>T	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.1385A>T	chr19.hg19:g.57036821A>T	ENSP00000309161:p.Lys462Met	0					ZNF471_ENST00000591537.1_3'UTR|ZNF471_ENST00000593197.1_Intron	p.K462M	NM_020813.2	NP_065864.2	1	2	3	2.233574	Q9BX82	ZN471_HUMAN		5	1518	+		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	1	1	hg19	c.1385A>T	CCDS12945.1	0	.	.	.	.	.	.	.	.	.	.	A	12.94	2.089753	0.36855	.	.	ENSG00000196263	ENST00000308031	T	0.08193	3.12	3.66	2.64	0.31445	3.66	2.64	0.31445	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19446	0.0467	M	0.68317	2.08	0.09310	N	0.999999	D	0.69078	0.997	P	0.62649	0.905	T	0.09015	-1.0694	9	0.56958	D	0.05	.	4.605	0.12372	0.6982:0.1949:0.1069:0.0	.	462	Q9BX82	ZN471_HUMAN	M	462	ENSP00000309161:K462M	ENSP00000309161:K462M	K	+	2	0	0	ZNF471	61728633	61728633	0.000000	0.05858	0.954000	0.39281	0.962000	0.63368	-1.500000	0.02283	0.496000	0.27904	0.379000	0.24179	AAG	0.579585		TCGA-OE-A75W-01A-12D-A32N-08	0.378	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	108	1	1.770000	-8.202811	1	0.570000	NM_020813		0	37	37	0	546	543	0		1	0		0	0	109	0	0	1.000000	0	0	0	0	1	0	37	546
CELF3	11189	broad.mit.edu	37	1	151680404	151680404	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:151680404G>A	ENST00000290583.4	-	6	1287	c.494C>T	c.(493-495)tCg>tTg	p.S165L	CELF3_ENST00000392706.3_5'Flank|CELF3_ENST00000470688.1_5'UTR|AL589765.1_ENST00000442233.2_5'Flank|CELF3_ENST00000290585.4_Missense_Mutation_p.S165L|RP11-98D18.1_ENST00000457548.1_RNA|RIIAD1_ENST00000326413.3_5'Flank	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	165	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						CAGGCTGGACGAGGCACCCTG	0.647																																						ENST00000290583.4	1.000000	6.600000e-01	1	7.600000e-01	0.870000	0.874227	0.870000	1.000000																										0				21						c.(493-495)tCg>tTg		CUGBP, Elav-like family member 3							48.0	40.0	43.0					1																	151680404		2203	4300	6503	SO:0001583	missense	11189	0	0					g.chr1:151680404G>A	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.494C>T	chr1.hg19:g.151680404G>A	ENSP00000290583:p.Ser165Leu	0					CELF3_ENST00000290585.4_Missense_Mutation_p.S165L|RIIAD1_ENST00000326413.3_5'Flank|CELF3_ENST00000392706.3_5'Flank|AL589765.1_ENST00000442233.2_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR	p.S165L	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	1	2	3	2.165351	Q5SZQ8	CELF3_HUMAN		6	1287	-			B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	1	1	hg19	c.494C>T	CCDS1002.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	24.9|24.9	4.582586|4.582586	0.86748|0.86748	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000420342|ENST00000290585;ENST00000290583;ENST00000368833	.|T;T	.|0.06449	.|3.3;3.3	3.75|3.75	3.75|3.75	0.43078|0.43078	3.75|3.75	3.75|3.75	0.43078|0.43078	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.10165|0.10165	0.0249|0.0249	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.998;1.0;0.999;0.999;0.998	.|P;D;D;P;P	.|0.64877	.|0.834;0.93;0.918;0.887;0.819	T|T	0.04078|0.04078	-1.0979|-1.0979	5|10	.|0.87932	.|D	.|0	-4.7861|-4.7861	14.6626|14.6626	0.68882|0.68882	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|165;165;164;165;164	.|Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.|.;.;.;CELF3_HUMAN;.	C|L	166|165;165;164	.|ENSP00000290585:S165L;ENSP00000290583:S165L	.|ENSP00000290583:S165L	R|S	-|-	1|2	0|0	0|0	CELF3|CELF3	149947028|149947028	149947028|149947028	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.999000|0.999000	0.98932|0.98932	9.566000|9.566000	0.98157|0.98157	2.098000|2.098000	0.63641|0.63641	0.655000|0.655000	0.94253|0.94253	CGT|TCG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.647	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.770000	-20.000000	1	0.570000	NM_007185		0	42	42	0	127	125	1		1	0		0	0	46	0	0	1.000000	0	0	0	0	1	0	42	127
PGLYRP3	114771	broad.mit.edu	37	1	153271680	153271680	+	Silent	SNP	C	C	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:153271680C>A	ENST00000290722.1	-	6	808	c.756G>T	c.(754-756)gtG>gtT	p.V252V		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	252					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCCTTCATACACGCCACCAT	0.458																																						ENST00000290722.1	1.000000	8.500000e-01	1	9.800000e-01	0.990000	0.986701	0.990000	1.000000																										0				28						c.(754-756)gtG>gtT		peptidoglycan recognition protein 3							79.0	68.0	71.0					1																	153271680		2203	4300	6503	SO:0001819	synonymous_variant	114771	0	0					g.chr1:153271680C>A	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.756G>T	chr1.hg19:g.153271680C>A		0						p.V252V	NM_052891.1	NP_443123.1	1	2	3	2.165351	Q96LB9	PGRP3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	6	808	-	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		A1A4U8|Q5SY65	Silent	SNP	ENST00000290722.1	1	1	hg19	c.756G>T	CCDS1035.1	1																																																																																								0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.458	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	30	1	1.770000	-20.000000	1	0.570000	NM_052891		0	40	39	0	85	85	1		1		0	0	0	31	0	0	1.000000	0	0	0	0	0	1	40	85
OR10J1	26476	broad.mit.edu	37	1	159410194	159410194	+	Missense_Mutation	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:159410194G>T	ENST00000423932.3	+	1	683	c.646G>T	c.(646-648)Gtg>Ttg	p.V216L	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	216					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					CAGTGTGCTGGTGCTTGTTGT	0.453																																						ENST00000423932.3	1.000000	8.600000e-01	1	9.200000e-01	0.980000	0.970913	0.980000	1.000000																										0				25						c.(646-648)Gtg>Ttg		olfactory receptor, family 10, subfamily J, member 1							290.0	264.0	273.0					1																	159410194		2203	4300	6503	SO:0001583	missense	26476	0	0					g.chr1:159410194G>T	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.646G>T	chr1.hg19:g.159410194G>T	ENSP00000399078:p.Val216Leu	0					RP11-550P17.5_ENST00000431862.1_RNA	p.V216L	NM_012351.2	NP_036483.2	1	2	3	2.165351	P30954	O10J1_HUMAN		1	683	+	all_hematologic(112;0.0429)		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	1	1	hg19	c.646G>T	CCDS1185.1	1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855739	0.51376	.	.	ENSG00000196184	ENST00000423932	T	0.00036	8.86	4.42	3.49	0.39957	4.42	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37437	N	0.002096	T	0.00073	0.0002	N	0.25245	0.725	0.09310	N	1	D	0.55385	0.971	P	0.58577	0.841	T	0.04440	-1.0951	10	0.45353	T	0.12	.	6.6645	0.23032	0.0986:0.1797:0.7217:0.0	.	216	P30954	O10J1_HUMAN	L	216	ENSP00000399078:V216L	ENSP00000399078:V216L	V	+	1	0	0	OR10J1	157676818	157676818	0.000000	0.05858	0.028000	0.17463	0.974000	0.67602	-0.144000	0.10280	1.155000	0.42497	0.650000	0.86243	GTG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.453	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	1.770000	-20.000000	1	0.570000	NM_012351		0	161	161	0	411	409	1		1			0	0	107	0	0	1.000000	0	0	0	0	0	0	161	411
CACNA1E	777	broad.mit.edu	37	1	181724500	181724500	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:181724500C>G	ENST00000367573.2	+	28	3956	c.3956C>G	c.(3955-3957)aCg>aGg	p.T1319R	CACNA1E_ENST00000526775.1_Missense_Mutation_p.T1300R|CACNA1E_ENST00000358338.5_Missense_Mutation_p.T1251R|CACNA1E_ENST00000360108.3_Missense_Mutation_p.T1300R|CACNA1E_ENST00000367567.4_Missense_Mutation_p.T926R|CACNA1E_ENST00000357570.5_Missense_Mutation_p.T1270R|CACNA1E_ENST00000367570.1_Missense_Mutation_p.T1319R	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1319					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTTTATTGCACGGACAGTTCC	0.453																																						ENST00000367573.2	0.110000	2.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.070560	0.050000	0.060000																										0				204						c.(3955-3957)aCg>aGg		calcium channel, voltage-dependent, R type, alpha 1E subunit							234.0	228.0	230.0					1																	181724500		2095	4231	6326	SO:0001583	missense	777	0	0					g.chr1:181724500C>G	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3956C>G	chr1.hg19:g.181724500C>G	ENSP00000356545:p.Thr1319Arg	0					CACNA1E_ENST00000367567.4_Missense_Mutation_p.T926R|CACNA1E_ENST00000526775.1_Missense_Mutation_p.T1300R|CACNA1E_ENST00000360108.3_Missense_Mutation_p.T1300R|CACNA1E_ENST00000358338.5_Missense_Mutation_p.T1251R|CACNA1E_ENST00000357570.5_Missense_Mutation_p.T1270R|CACNA1E_ENST00000367570.1_Missense_Mutation_p.T1319R	p.T1319R	NM_001205293.1	NP_001192222.1	1	2	3	2.165351	Q15878	CAC1E_HUMAN		28	3956	+			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	0	1	hg19	c.3956C>G	CCDS55664.1	0	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707504	0.89018	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95	5.29	5.29	0.74685	5.29	5.29	0.74685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98893	0.9625	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.982;0.998	D	0.99882	1.1115	10	0.87932	D	0	.	18.524	0.90965	0.0:1.0:0.0:0.0	.	1300;1319;1319	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	R	1319;1300;1270;1251;926;1300;1319	ENSP00000356542:T1319R;ENSP00000434814:T1300R;ENSP00000350183:T1270R;ENSP00000351101:T1251R;ENSP00000356539:T926R;ENSP00000353222:T1300R;ENSP00000356545:T1319R	ENSP00000350183:T1270R	T	+	2	0	0	CACNA1E	179991123	179991123	1.000000	0.71417	0.934000	0.37439	0.977000	0.68977	7.676000	0.84012	2.468000	0.83385	0.650000	0.86243	ACG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.453	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	0	0	1	2	2	2	2	0	0	0	0	149	149	149	147	1	1.770000	-2.512174	1	0.570000	NM_000721		0	11	11	0	676	667	0		1			0	0	149	0	0	0.998205	0	0	0	0	0	0	11	676
RGS16	6004	broad.mit.edu	37	1	182569575	182569575	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:182569575G>A	ENST00000367558.5	-	5	609	c.461C>T	c.(460-462)gCg>gTg	p.A154V		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	154	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						CCCCTGAGCCGCATCAAAGCA	0.602																																						ENST00000367558.5	0.090000	0	6.000000e-02	1.000000e-02	0.030000	0.052300	0.030000	0.040000																										0				11						c.(460-462)gCg>gTg		regulator of G-protein signaling 16							153.0	120.0	131.0					1																	182569575		2203	4300	6503	SO:0001583	missense	6004	1	121412	28				g.chr1:182569575G>A	U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.461C>T	chr1.hg19:g.182569575G>A	ENSP00000356529:p.Ala154Val	0						p.A154V	NM_002928.3	NP_002919.3	1	2	3	2.165351	O15492	RGS16_HUMAN		5	609	-			B2R4M4|Q5VYN9|Q99701	Missense_Mutation	SNP	ENST00000367558.5	0	1	hg19	c.461C>T	CCDS1348.1	0	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.927175	0.00493	.	.	ENSG00000143333	ENST00000367558	T	0.01998	4.51	5.38	-2.44	0.06502	5.38	-2.44	0.06502	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	1.166690	0.05992	N	0.646171	T	0.01320	0.0043	N	0.13198	0.31	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47086	-0.9144	10	0.06891	T	0.86	.	5.0723	0.14613	0.4925:0.0:0.2363:0.2712	.	154	O15492	RGS16_HUMAN	V	154	ENSP00000356529:A154V	ENSP00000356529:A154V	A	-	2	0	0	RGS16	180836198	180836198	0.000000	0.05858	0.065000	0.19835	0.001000	0.01503	-0.510000	0.06328	-0.202000	0.10268	-1.223000	0.01593	GCG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.602	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	0	0	1	2	2	2	2	0	0	0	0	98	98	98	97	1	1.770000	-1.819585	0	0.570000	NM_002928		0	6	6	0	564	556	0		1	0		0	0	98	0	0	0.963570	4.601121e-01	0	0	0	132	0	6	564
UBR4	23352	broad.mit.edu	37	1	19420503	19420503	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:19420503C>G	ENST00000375254.3	-	95	13904	c.13877G>C	c.(13876-13878)gGa>gCa	p.G4626A	UBR4_ENST00000375267.2_Missense_Mutation_p.G4626A|UBR4_ENST00000467272.2_5'UTR|UBR4_ENST00000543981.1_Missense_Mutation_p.G290A|UBR4_ENST00000375226.2_Missense_Mutation_p.G4602A|UBR4_ENST00000429347.2_Missense_Mutation_p.G149A|UBR4_ENST00000375217.2_Missense_Mutation_p.G4619A|UBR4_ENST00000375224.1_Missense_Mutation_p.G333A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4626					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTCCACCTCTCCAAAGGAAAG	0.468																																						ENST00000375254.3	0.200000	2.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.105247	0.090000	0.080000																										0				171						c.(13876-13878)gGa>gCa		ubiquitin protein ligase E3 component n-recognin 4							94.0	85.0	88.0					1																	19420503		2203	4300	6503	SO:0001583	missense	23352	0	0					g.chr1:19420503C>G	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.13877G>C	chr1.hg19:g.19420503C>G	ENSP00000364403:p.Gly4626Ala	0					UBR4_ENST00000375217.2_Missense_Mutation_p.G4619A|UBR4_ENST00000543981.1_Missense_Mutation_p.G290A|UBR4_ENST00000375267.2_Missense_Mutation_p.G4626A|UBR4_ENST00000429347.2_Missense_Mutation_p.G149A|UBR4_ENST00000375226.2_Missense_Mutation_p.G4602A|UBR4_ENST00000375224.1_Missense_Mutation_p.G333A|UBR4_ENST00000467272.2_5'UTR	p.G4626A	NM_020765.2	NP_065816.2	0	0	0	2.104551	Q5T4S7	UBR4_HUMAN		95	13904	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	0	1	hg19	c.13877G>C	CCDS189.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.134565	0.94517	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375224;ENST00000429347;ENST00000543981	T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.71896	0.3394	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.85130	0.995;0.995;0.997;0.992	T	0.76146	-0.3066	10	0.72032	D	0.01	.	18.7785	0.91922	0.0:1.0:0.0:0.0	.	290;149;4626;4602	B4DYV5;B4DPF6;Q5T4S7;Q5T4S7-3	.;.;UBR4_HUMAN;.	A	4626;4626;4619;4602;333;149;290	ENSP00000364403:G4626A;ENSP00000364416:G4626A;ENSP00000364365:G4619A;ENSP00000364374:G4602A;ENSP00000364372:G333A;ENSP00000394173:G149A;ENSP00000444070:G290A	ENSP00000364365:G4619A	G	-	2	0	0	UBR4	19293090	19293090	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.278000	0.78587	2.785000	0.95823	0.591000	0.81541	GGA	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.468	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	0	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.770000	-6.078562	1	0.570000	NM_020765		0	4	4	0	158	156	0		1	0		0	0	41	0	0	0.888428	1.612476e-01	0	1	0	22	0	4	158
UBR4	23352	broad.mit.edu	37	1	19464627	19464627	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:19464627G>A	ENST00000375254.3	-	60	8807	c.8780C>T	c.(8779-8781)cCg>cTg	p.P2927L	UBR4_ENST00000375267.2_Missense_Mutation_p.P2927L|UBR4_ENST00000375226.2_Missense_Mutation_p.P2903L|UBR4_ENST00000375217.2_Missense_Mutation_p.P2920L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2927					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGGTCCAGCCGGATGCCCCTC	0.542																																						ENST00000375254.3	0.210000	2.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.109226	0.090000	0.090000																										0				171						c.(8779-8781)cCg>cTg		ubiquitin protein ligase E3 component n-recognin 4							58.0	55.0	56.0					1																	19464627		2203	4300	6503	SO:0001583	missense	23352	5	121410	34				g.chr1:19464627G>A	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8780C>T	chr1.hg19:g.19464627G>A	ENSP00000364403:p.Pro2927Leu	0					UBR4_ENST00000375217.2_Missense_Mutation_p.P2920L|UBR4_ENST00000375267.2_Missense_Mutation_p.P2927L|UBR4_ENST00000375226.2_Missense_Mutation_p.P2903L	p.P2927L	NM_020765.2	NP_065816.2	0	0	0	2.104551	Q5T4S7	UBR4_HUMAN		60	8807	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	0	1	hg19	c.8780C>T	CCDS189.1	0	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867697	0.51588	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.27256	1.74;1.74;1.68;1.7	5.83	4.89	0.63831	5.83	4.89	0.63831	.	0.056992	0.64402	D	0.000001	T	0.25158	0.0611	L	0.57536	1.79	0.80722	D	1	P	0.36768	0.569	B	0.29663	0.105	T	0.05053	-1.0909	10	0.42905	T	0.14	.	15.9733	0.80036	0.0:0.0:0.8646:0.1354	.	2927	Q5T4S7	UBR4_HUMAN	L	2927;2927;2920;2903;535;1613	ENSP00000364403:P2927L;ENSP00000364416:P2927L;ENSP00000364365:P2920L;ENSP00000364374:P2903L	ENSP00000364365:P2920L	P	-	2	0	0	UBR4	19337214	19337214	1.000000	0.71417	0.967000	0.41034	0.793000	0.44817	7.308000	0.78929	2.770000	0.95276	0.655000	0.94253	CCG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.542	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	0	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.770000	-3.150066	1	0.570000	NM_020765		0	4	4	0	152	150	0		1			0	0	19	0	0	0.888342	0	0	0	0	0	0	4	152
HMCN1	83872	broad.mit.edu	37	1	186120449	186120449	+	Missense_Mutation	SNP	G	G	A	rs148097981		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:186120449G>A	ENST00000271588.4	+	94	14955	c.14726G>A	c.(14725-14727)cGt>cAt	p.R4909H	HMCN1_ENST00000367492.2_Missense_Mutation_p.R4909H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4909	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGAATAATACGTGCCAAAATT	0.318																																						ENST00000271588.4	1.000000	7.600000e-01	1	8.400000e-01	0.920000	0.922361	0.920000	1.000000																										0				308						c.(14725-14727)cGt>cAt		hemicentin 1		G	HIS/ARG	0,4406		0,0,2203	111.0	111.0	111.0		14726	-0.3	0.7	1	dbSNP_134	111	4,8596	3.7+/-12.6	0,4,4296	yes	missense	HMCN1	NM_031935.2	29	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	4909/5636	186120449	4,13002	2203	4300	6503	SO:0001583	missense	83872	23	121412	44				g.chr1:186120449G>A	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14726G>A	chr1.hg19:g.186120449G>A	ENSP00000271588:p.Arg4909His	0					HMCN1_ENST00000367492.2_Missense_Mutation_p.R4909H	p.R4909H	NM_031935.2	NP_114141.2	1	2	3	2.165351	Q96RW7	HMCN1_HUMAN		94	14955	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	1	1	hg19	c.14726G>A	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	8.309	0.821570	0.16678	0.0	4.65E-4	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.29397	1.57;1.57	5.13	-0.313	0.12754	5.13	-0.313	0.12754	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.353337	0.33272	N	0.005100	T	0.11452	0.0279	N	0.11201	0.11	0.27937	N	0.937675	B	0.02656	0.0	B	0.04013	0.001	T	0.26326	-1.0106	10	0.13853	T	0.58	.	5.0568	0.14537	0.6639:0.0:0.2126:0.1235	.	4909	Q96RW7	HMCN1_HUMAN	H	4909	ENSP00000271588:R4909H;ENSP00000356462:R4909H	ENSP00000271588:R4909H	R	+	2	0	0	HMCN1	184387072	184387072	1.000000	0.71417	0.714000	0.30535	0.586000	0.36452	3.507000	0.53371	-0.275000	0.09219	-1.311000	0.01308	CGT	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.318	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	1.770000	-20.000000	1	0.570000	NM_031935		0	89	89	0	249	247	1		1			0	0	71	0	0	1.000000	0	0	0	0	0	0	89	249
HSPG2	3339	broad.mit.edu	37	1	22186350	22186350	+	Silent	SNP	G	G	A	rs138980184	byFrequency	TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:22186350G>A	ENST00000374695.3	-	41	5239	c.5160C>T	c.(5158-5160)agC>agT	p.S1720S		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1720	Ig-like C2-type 2.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCTGGGTGCCGCTGGGCACAG	0.662													G|||	4	0.000798722	0.0	0.0	5008	,	,		17602	0.0		0.004	False		,,,				2504	0.0					ENST00000374695.3	0.310000	4.000000e-02	2.300000e-01	8.000000e-02	0.140000	0.160914	0.140000	0.140000																										0				127						c.(5158-5160)agC>agT		heparan sulfate proteoglycan 2	Palifermin(DB00039)	G		1,4403	2.1+/-5.4	0,1,2201	27.0	27.0	27.0		5160	4.0	1.0	1	dbSNP_134	27	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	HSPG2	NM_005529.5		0,6,6496	AA,AG,GG		0.0581,0.0227,0.0461		1720/4392	22186350	6,12998	2202	4300	6502	SO:0001819	synonymous_variant	3339	98	121094	47				g.chr1:22186350G>A	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5160C>T	chr1.hg19:g.22186350G>A		0						p.S1720S	NM_005529.5	NP_005520.4	0	0	0	2.104551	P98160	PGBM_HUMAN		41	5239	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	0	1	hg19	c.5160C>T	CCDS30625.1	0																																																																																								0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.662	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	0	0	1	2	2	2	2	0	0	0	0	26	26	26	24	1	1.770000	-6.996568	1	0.570000	NM_005529		0	4	4	0	101	101	0		1	0		0	0	26	0	0	0.891773	0	0	0	0	1	0	4	101
CR1	1378	broad.mit.edu	37	1	207790017	207790017	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:207790017C>T	ENST00000367049.4	+	41	6759	c.6759C>T	c.(6757-6759)tgC>tgT	p.C2253C	CR1_ENST00000367051.1_Silent_p.C1803C|CR1_ENST00000400960.2_Silent_p.C1803C|CR1_ENST00000367052.1_Silent_p.C1803C|CR1_ENST00000367053.1_Silent_p.C1803C	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1803					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTTACGCATGCGACACCCACC	0.498																																						ENST00000367049.4	0.070000	0	5.000000e-02	1.000000e-02	0.020000	0.044310	0.020000	0.040000																										0				82						c.(6757-6759)tgC>tgT		complement component (3b/4b) receptor 1 (Knops blood group)							142.0	137.0	139.0					1																	207790017		1924	4129	6053	SO:0001819	synonymous_variant	1378	4	120864	41				g.chr1:207790017C>T	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6759C>T	chr1.hg19:g.207790017C>T		0					CR1_ENST00000367051.1_Silent_p.C1803C|CR1_ENST00000367052.1_Silent_p.C1803C|CR1_ENST00000367053.1_Silent_p.C1803C|CR1_ENST00000400960.2_Silent_p.C1803C	p.C2253C	NM_000651.4	NP_000642.3	1	2	3	2.165351	P17927	CR1_HUMAN		41	6759	+			Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	0	1	hg19	c.6759C>T	CCDS44308.1	0	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.342195	0.01277	.	.	ENSG00000203710	ENST00000529814	.	.	.	4.15	-1.35	0.09114	4.15	-1.35	0.09114	.	.	.	.	.	T	0.31327	0.0793	.	.	.	0.20638	N	0.999873	.	.	.	.	.	.	T	0.33007	-0.9885	4	.	.	.	.	8.0389	0.30511	0.0:0.5164:0.0:0.4836	rs55775404	.	.	.	V	426	.	.	A	+	2	0	0	CR1	205856640	205856640	0.319000	0.24607	0.014000	0.15608	0.037000	0.13140	-0.190000	0.09615	-0.233000	0.09797	-0.320000	0.08662	GCG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.498	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	0	0	1	2	2	2	2	0	0	0	0	122	122	122	121	1	1.770000	-2.014208	0	0.570000	NM_000573		0	6	6	0	686	679	0		1			0	0	122	0	0	0.963962	0	0	0	0	0	0	6	686
ZC3H12A	80149	broad.mit.edu	37	1	37948876	37948876	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:37948876C>T	ENST00000373087.6	+	6	1580	c.1464C>T	c.(1462-1464)ggC>ggT	p.G488G		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGCCTTTGGCCGGGCCATGG	0.662																																						ENST00000373087.6	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.030143	0.020000	0.030000																										0				21						c.(1462-1464)ggC>ggT		zinc finger CCCH-type containing 12A							62.0	72.0	68.0					1																	37948876		2203	4300	6503	SO:0001819	synonymous_variant	80149	0	0					g.chr1:37948876C>T		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1464C>T	chr1.hg19:g.37948876C>T		1						p.G488G	NM_025079.2	NP_079355.2	0	1	1	1.593368				6	1580	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)		Silent	SNP	ENST00000373087.6	0	1	hg19	c.1464C>T	CCDS417.1	0																																																																																								0.403358		TCGA-OE-A75W-01A-12D-A32N-08	0.662	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	0	0	1	2	2	2	2	0	0	0	0	189	189	189	185	1	1.770000	-1.790340	0	0.570000	NM_025079		0	6	6	0	578	570	0		1	0		0	0	189	0	0	0.963605	3.360051e-01	0	0	0	102	0	6	578
MAST2	23139	broad.mit.edu	37	1	46491369	46491369	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:46491369C>T	ENST00000361297.2	+	16	2084	c.1801C>T	c.(1801-1803)Ctg>Ttg	p.L601L	MAST2_ENST00000372009.2_Silent_p.L531L	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TGCCACTCTGCTGAAGAATAT	0.547																																						ENST00000361297.2	1.000000	9.100000e-01	1	9.500000e-01	0.990000	0.984168	0.990000	1.000000																										0				11						c.(1801-1803)Ctg>Ttg		microtubule associated serine/threonine kinase 2							104.0	113.0	110.0					1																	46491369		2179	4290	6469	SO:0001819	synonymous_variant	23139	0	0					g.chr1:46491369C>T	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1801C>T	chr1.hg19:g.46491369C>T		1					MAST2_ENST00000372009.2_Silent_p.L531L	p.L601L	NM_015112.2	NP_055927.2	0	1	1	1.593368				16	2084	+	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)			Silent	SNP	ENST00000361297.2	1	1	hg19	c.1801C>T	CCDS41326.1	1																																																																																								0.403358		TCGA-OE-A75W-01A-12D-A32N-08	0.547	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	67	1	1.770000	-20.000000	1	0.570000	NM_015112		0	124	122	0	154	154	0		1	0		0	0	69	0	0	1.000000	8.896811e-01	0	1	0	6	0	124	154
ZCCHC11	23318	broad.mit.edu	37	1	52927392	52927392	+	Missense_Mutation	SNP	C	C	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:52927392C>A	ENST00000371544.3	-	17	3381	c.3119G>T	c.(3118-3120)aGa>aTa	p.R1040I	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.R1040I|ZCCHC11_ENST00000371541.1_5'Flank	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1040					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						ACCTGGATGTCTCTTAAGAAT	0.214																																						ENST00000371544.3	0.990000	3.900000e-01	8.900000e-01	5.400000e-01	0.710000	0.717604	0.710000	1.000000																										0				58						c.(3118-3120)aGa>aTa		zinc finger, CCHC domain containing 11							10.0	10.0	10.0					1																	52927392		2093	4183	6276	SO:0001583	missense	23318	0	0					g.chr1:52927392C>A	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.3119G>T	chr1.hg19:g.52927392C>A	ENSP00000360599:p.Arg1040Ile	1					ZCCHC11_ENST00000257177.4_Missense_Mutation_p.R1040I|ZCCHC11_ENST00000371541.1_5'Flank	p.R1040I	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	0	1	1	1.593368	Q5TAX3	TUT4_HUMAN		17	3381	-			A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	0	1	hg19	c.3119G>T	CCDS30716.1	0	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703685	0.68501	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.45	4.53	0.55603	5.45	4.53	0.55603	Nucleotidyl transferase domain (1);	0.053333	0.64402	D	0.000001	T	0.49712	0.1573	L	0.49640	1.575	0.80722	D	1	B;D	0.63046	0.112;0.992	B;D	0.67382	0.18;0.951	T	0.53201	-0.8472	10	0.56958	D	0.05	.	3.6343	0.08143	0.229:0.5995:0.0:0.1715	.	799;1040	E9PKX1;Q5TAX3	.;TUT4_HUMAN	I	1040;1040;969;799	ENSP00000257177:R1040I;ENSP00000360599:R1040I;ENSP00000433486:R969I;ENSP00000435256:R799I	ENSP00000257177:R1040I	R	-	2	0	0	ZCCHC11	52699980	52699980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.468000	0.60162	2.550000	0.86006	0.585000	0.79938	AGA	0.403358		TCGA-OE-A75W-01A-12D-A32N-08	0.214	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.770000	-19.907490	1	0.570000	XM_038288		0	9	9	0	21	20	1		1	0		0	0	9	0	0	0.996000	1.041667e-01	0	1	0	1	0	9	21
SSBP3	23648	broad.mit.edu	37	1	54708959	54708959	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:54708959C>T	ENST00000371320.3	-	10	1075	c.665G>A	c.(664-666)gGc>gAc	p.G222D	SSBP3_ENST00000417664.2_Missense_Mutation_p.G112D|SSBP3_ENST00000371319.3_Missense_Mutation_p.G195D|SSBP3_ENST00000357475.4_Missense_Mutation_p.G202D|SSBP3_ENST00000326956.7_5'UTR	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	222	Gly-rich.|Pro-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						TGGTCTCATGCCGCTGCCGTA	0.562																																						ENST00000371320.3	0.040000	0	3.000000e-02	0	0.010000	0.018688	0.010000	0.020000																										0				11						c.(664-666)gGc>gAc		single stranded DNA binding protein 3							145.0	153.0	150.0					1																	54708959		2203	4300	6503	SO:0001583	missense	23648	0	0					g.chr1:54708959C>T		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.665G>A	chr1.hg19:g.54708959C>T	ENSP00000360371:p.Gly222Asp	1					SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000357475.4_Missense_Mutation_p.G202D|SSBP3_ENST00000371319.3_Missense_Mutation_p.G195D|SSBP3_ENST00000417664.2_Missense_Mutation_p.G112D	p.G222D	NM_145716.2	NP_663768.1	0	1	1	1.593368	Q9BWW4	SSBP3_HUMAN		10	1075	-			A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	0	1	hg19	c.665G>A	CCDS591.1	0	.	.	.	.	.	.	.	.	.	.	c	25.8	4.676502	0.88445	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475;ENST00000444533;ENST00000525990	.	.	.	3.94	3.94	0.45596	3.94	3.94	0.45596	.	0.000000	0.85682	U	0.000000	T	0.78717	0.4327	M	0.75085	2.285	0.80722	D	1	D;P;P	0.89917	1.0;0.951;0.866	D;P;P	0.97110	1.0;0.743;0.686	T	0.81534	-0.0889	9	0.59425	D	0.04	-1.6526	17.3039	0.87189	0.0:1.0:0.0:0.0	.	195;202;222	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	D	112;222;195;202;53;85	.	ENSP00000350067:G202D	G	-	2	0	0	SSBP3	54481547	54481547	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.969000	0.76092	2.493000	0.84123	0.479000	0.44913	GGC	0.403358		TCGA-OE-A75W-01A-12D-A32N-08	0.562	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	0	0	1	2	2	2	2	0	0	0	0	296	296	296	296	1	1.770000	-1.725707	0	0.570000	NM_018070		0	6	6	0	924	898	0		1	0		0	0	296	0	0	0.961700	8.153054e-02	0	0	0	61	0	6	924
ARF1	375	broad.mit.edu	37	1	228285699	228285699	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr1:228285699C>T	ENST00000541182.1	+	5	793	c.531C>T	c.(529-531)ctC>ctT	p.L177L	ARF1_ENST00000478424.1_3'UTR|C1orf35_ENST00000472617.1_5'Flank|ARF1_ENST00000272102.5_Silent_p.L177L|MIR3620_ENST00000584469.1_RNA|ARF1_ENST00000540651.1_Silent_p.L177L	NM_001024227.1|NM_001024228.1	NP_001019398.1|NP_001019399.1	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	177					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular copper ion homeostasis (GO:0006878)|COPI coating of Golgi vesicle (GO:0048205)|dendritic spine organization (GO:0097061)|GTP catabolic process (GO:0006184)|long term synaptic depression (GO:0060292)|membrane organization (GO:0061024)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|regulation of defense response to virus by virus (GO:0050690)|regulation of receptor internalization (GO:0002090)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)	10		Prostate(94;0.0405)				CCAATCAGCTCCGGAACCAGA	0.602																																						ENST00000541182.1	0.430000	1.800000e-01	3.600000e-01	2.300000e-01	0.280000	0.303269	0.280000	0.290000																										0				10						c.(529-531)ctC>ctT		ADP-ribosylation factor 1							70.0	60.0	63.0					1																	228285699		2203	4300	6503	SO:0001819	synonymous_variant	375	0	0					g.chr1:228285699C>T	M84326	CCDS1565.1	1q42.13	2014-01-30			ENSG00000143761	ENSG00000143761		"""ADP-ribosylation factors"", ""Endogenous ligands"""	652	protein-coding gene	gene with protein product		103180				1577740	Standard	NM_001658		Approved		uc001hrr.3	P84077	OTTHUMG00000037595	ENST00000541182.1:c.531C>T	chr1.hg19:g.228285699C>T		0					C1orf35_ENST00000472617.1_5'Flank|ARF1_ENST00000540651.1_Silent_p.L177L|ARF1_ENST00000272102.5_Silent_p.L177L|ARF1_ENST00000478424.1_3'UTR|MIR3620_ENST00000584469.1_RNA	p.L177L	NM_001024227.1|NM_001024228.1	NP_001019398.1|NP_001019399.1	1	2	3	2.165351	P84077	ARF1_HUMAN		5	793	+		Prostate(94;0.0405)	P10947|P32889	Silent	SNP	ENST00000541182.1	1	1	hg19	c.531C>T	CCDS1565.1	0																																																																																								0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.602	ARF1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091650.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.770000	-20.000000	1	0.570000	NM_001024227		0	23	22	0	260	249	1		1	1		0	0	54	0	0	0.999999	1	0	113	0	676	0	23	260
TASP1	55617	broad.mit.edu	37	20	13514683	13514683	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr20:13514683C>T	ENST00000337743.4	-	9	901	c.781G>A	c.(781-783)Ggg>Agg	p.G261R	TASP1_ENST00000539805.1_Intron|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	261					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CCAACTCTCCCCGGATGTTTC	0.463																																						ENST00000337743.4	0.310000	1.600000e-01	2.700000e-01	1.900000e-01	0.220000	0.235261	0.220000	0.230000																										0				31						c.(781-783)Ggg>Agg		taspase, threonine aspartase, 1							105.0	105.0	105.0					20																	13514683		2203	4300	6503	SO:0001583	missense	55617	0	0					g.chr20:13514683C>T	AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.781G>A	chr20.hg19:g.13514683C>T	ENSP00000338624:p.Gly261Arg	0					TASP1_ENST00000539805.1_Intron|TASP1_ENST00000480436.1_5'UTR	p.G261R	NM_017714.2	NP_060184.2	0	0	0	2.102693	Q9H6P5	TASP1_HUMAN		9	901	-			B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	ENST00000337743.4	1	1	hg19	c.781G>A	CCDS13116.1	0	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976123	0.92982	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	D;D	0.97529	-4.42;-4.42	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.99180	0.9716	H	0.97829	4.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98931	1.0787	10	0.87932	D	0	-9.528	19.3476	0.94372	0.0:1.0:0.0:0.0	.	261;238	Q9H6P5;Q5JWM4	TASP1_HUMAN;.	R	238;261;238	ENSP00000338624:G261R;ENSP00000400580:G238R	ENSP00000338624:G261R	G	-	1	0	0	TASP1	13462683	13462683	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.031000	0.76491	2.666000	0.90696	0.563000	0.77884	GGG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.463	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	1	0	1	2	2	2	2	0	0	0	0	108	108	108	105	1	1.770000	-2.690403	1	0.570000	NM_017714		0	39	38	0	548	542	0		1	0		0	0	108	0	0	1.000000	9.930690e-02	0	0	0	8	0	39	548
CBFA2T2	9139	broad.mit.edu	37	20	32232202	32232202	+	Missense_Mutation	SNP	A	A	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr20:32232202A>T	ENST00000346541.3	+	12	2102	c.1565A>T	c.(1564-1566)aAt>aTt	p.N522I	CBFA2T2_ENST00000492345.1_Missense_Mutation_p.N493I|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.N513I|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.N522I|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.N493I|CBFA2T2_ENST00000543126.1_Missense_Mutation_p.N70I|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.N532I	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	522					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						AGTGGCTGCAATATCGCGCGA	0.602																																					Esophageal Squamous(174;142 1955 14837 21276 28041)	ENST00000346541.3	1.000000	7.400000e-01	9.500000e-01	8.000000e-01	0.870000	0.881970	0.870000	0.880000																										0				20						c.(1564-1566)aAt>aTt		core-binding factor, runt domain, alpha subunit 2; translocated to, 2							75.0	71.0	73.0					20																	32232202		2203	4300	6503	SO:0001583	missense	9139	0	0					g.chr20:32232202A>T	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.1565A>T	chr20.hg19:g.32232202A>T	ENSP00000262653:p.Asn522Ile	0					CBFA2T2_ENST00000397800.1_Missense_Mutation_p.N493I|CBFA2T2_ENST00000543126.1_Missense_Mutation_p.N70I|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.N513I|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.N493I|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.N532I|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.N522I	p.N522I	NM_005093.3	NP_005084.1	0	0	0	2.102693	O43439	MTG8R_HUMAN		12	2102	+			B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	1	1	hg19	c.1565A>T	CCDS13221.1	1	.	.	.	.	.	.	.	.	.	.	A	31	5.091645	0.94149	.	.	ENSG00000078699	ENST00000397803;ENST00000375279;ENST00000342704;ENST00000346541;ENST00000397800;ENST00000359606;ENST00000543126	T;T;T;T;T	0.51325	0.71;0.72;0.71;0.72;1.3	5.79	5.79	0.91817	5.79	5.79	0.91817	Zinc finger, MYND-type (3);	0.000000	0.85682	D	0.000000	T	0.70325	0.3211	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.74518	-0.3639	10	0.87932	D	0	-4.7166	16.1193	0.81336	1.0:0.0:0.0:0.0	.	522;513	O43439;F8W6D7	MTG8R_HUMAN;.	I	296;522;513;522;493;532;70	ENSP00000364428:N522I;ENSP00000345810:N513I;ENSP00000262653:N522I;ENSP00000380902:N493I;ENSP00000352622:N532I	ENSP00000345810:N513I	N	+	2	0	0	CBFA2T2	31695863	31695863	1.000000	0.71417	0.996000	0.52242	0.903000	0.53119	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	AAT	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.602	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	1	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	1.770000	-20.000000	1	0.570000	NM_001032999		0	125	124	0	367	362	1		1	1		0	0	105	0	0	1.000000	9.998292e-01	0	13	0	27	0	125	367
CDH4	1002	broad.mit.edu	37	20	60448850	60448850	+	Missense_Mutation	SNP	G	G	A	rs371856199		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr20:60448850G>A	ENST00000360469.5	+	7	1032	c.944G>A	c.(943-945)cGg>cAg	p.R315Q	CDH4_ENST00000543233.1_Missense_Mutation_p.R241Q	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	315	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GGGATGGTGCGGTACCGGATC	0.612																																						ENST00000360469.5	0.070000	0	5.000000e-02	1.000000e-02	0.020000	0.033465	0.020000	0.030000																										0				74						c.(943-945)cGg>cAg		cadherin 4, type 1, R-cadherin (retinal)		G	GLN/ARG	0,4406		0,0,2203	163.0	127.0	139.0		944	4.0	1.0	20		139	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDH4	NM_001794.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	315/917	60448850	1,13005	2203	4300	6503	SO:0001583	missense	1002	5	121410	39				g.chr20:60448850G>A	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.944G>A	chr20.hg19:g.60448850G>A	ENSP00000353656:p.Arg315Gln	0					CDH4_ENST00000543233.1_Missense_Mutation_p.R241Q	p.R315Q	NM_001794.3	NP_001785.2	0	0	0	2.102693	P55283	CADH4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.36e-08)	7	1032	+			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	0	1	hg19	c.944G>A	CCDS13488.1	0	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949030	0.73787	0.0	1.16E-4	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.53206	0.63;0.63	4.92	3.97	0.46021	4.92	3.97	0.46021	Cadherin (4);Cadherin-like (1);	0.230798	0.40640	N	0.001048	T	0.45816	0.1361	L	0.58354	1.805	0.36334	D	0.859075	D	0.53745	0.962	P	0.46208	0.507	T	0.54886	-0.8226	9	.	.	.	.	8.4155	0.32668	0.0789:0.0:0.7685:0.1527	.	315	P55283	CADH4_HUMAN	Q	315;223;241	ENSP00000353656:R315Q;ENSP00000443301:R241Q	.	R	+	2	0	0	CDH4	59882245	59882245	1.000000	0.71417	0.967000	0.41034	0.735000	0.41995	6.559000	0.73946	1.068000	0.40764	0.585000	0.79938	CGG	0.565041		TCGA-OE-A75W-01A-12D-A32N-08	0.612	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	0	0	1	2	2	2	2	0	0	0	0	116	116	116	116	1	1.770000	-2.515517	1	0.570000	NM_001794		0	5	5	0	602	601	0		1			0	0	116	0	0	0.937501	0	0	0	0	0	0	5	602
COL6A2	1292	broad.mit.edu	37	21	47532333	47532333	+	Silent	SNP	C	C	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr21:47532333C>A	ENST00000300527.4	+	3	660	c.556C>A	c.(556-558)Cgg>Agg	p.R186R	COL6A2_ENST00000310645.5_Silent_p.R186R|COL6A2_ENST00000357838.4_Silent_p.R186R|COL6A2_ENST00000397763.1_Silent_p.R186R|COL6A2_ENST00000460886.1_3'UTR|COL6A2_ENST00000409416.1_Silent_p.R186R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	186	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGAGGGCATCCGGCTCTTCGC	0.701																																						ENST00000300527.4	0.270000	4.000000e-02	2.000000e-01	7.000000e-02	0.120000	0.140065	0.120000	0.120000																										0				43						c.(556-558)Cgg>Agg		collagen, type VI, alpha 2							14.0	21.0	19.0					21																	47532333		2185	4265	6450	SO:0001819	synonymous_variant	1292	0	0					g.chr21:47532333C>A	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.556C>A	chr21.hg19:g.47532333C>A		1					COL6A2_ENST00000357838.4_Silent_p.R186R|COL6A2_ENST00000397763.1_Silent_p.R186R|COL6A2_ENST00000310645.5_Silent_p.R186R|COL6A2_ENST00000409416.1_Silent_p.R186R|COL6A2_ENST00000460886.1_3'UTR	p.R186R	NM_001849.3	NP_001840.3	0	1	1	1.552496	P12110	CO6A2_HUMAN		3	660	+	Breast(49;0.245)		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	0	1	hg19	c.556C>A	CCDS13728.1	0																																																																																								0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.701	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1	0	0	1	2	2	2	2	0	0	0	0	43	43	43	41	1	1.770000	-7.546148	1	0.570000			0	4	4	0	82	82	0		1	0		0	0	43	0	0	0.892036	9.997067e-01	0	0	0	519	0	4	82
DGCR8	54487	broad.mit.edu	37	22	20096497	20096497	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr22:20096497G>A	ENST00000351989.3	+	13	2638	c.2209G>A	c.(2209-2211)Gag>Aag	p.E737K	AC006547.8_ENST00000412713.1_RNA|DGCR8_ENST00000407755.1_Missense_Mutation_p.E704K|DGCR8_ENST00000383024.2_Missense_Mutation_p.E704K	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	737	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					CAAGCTCCAAGAGGAGATGAA	0.577																																						ENST00000351989.3	1.000000	4.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.182554	0.090000	0.090000																										0				22						c.(2209-2211)Gag>Aag		DGCR8 microprocessor complex subunit							153.0	120.0	131.0					22																	20096497		2203	4300	6503	SO:0001583	missense	54487	0	0					g.chr22:20096497G>A	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.2209G>A	chr22.hg19:g.20096497G>A	ENSP00000263209:p.Glu737Lys	0					AC006547.8_ENST00000412713.1_RNA|DGCR8_ENST00000407755.1_Missense_Mutation_p.E704K|DGCR8_ENST00000383024.2_Missense_Mutation_p.E704K	p.E737K	NM_022720.6	NP_073557.3	2	2	4	2.275507	Q8WYQ5	DGCR8_HUMAN		13	2638	+	Colorectal(54;0.0993)		B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	0	1	hg19	c.2209G>A	CCDS13773.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.181797	0.94885	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.33216	1.42;1.51;1.51	5.22	5.22	0.72569	5.22	5.22	0.72569	.	0.048942	0.85682	D	0.000000	T	0.45115	0.1326	L	0.34521	1.04	0.80722	D	1	D;D	0.67145	0.996;0.99	D;P	0.76071	0.987;0.824	T	0.21314	-1.0249	10	0.33141	T	0.24	-10.5121	17.5395	0.87843	0.0:0.0:1.0:0.0	.	704;737	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	K	737;704;704	ENSP00000263209:E737K;ENSP00000372488:E704K;ENSP00000384726:E704K	ENSP00000263209:E737K	E	+	1	0	0	DGCR8	18476497	18476497	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.096000	0.94182	2.428000	0.82296	0.462000	0.41574	GAG	0.595370		TCGA-OE-A75W-01A-12D-A32N-08	0.577	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.770000	-3.591107	1	0.570000			0	9	8	0	351	349	0		1	0		0	0	70	0	0	0.994142	1.836840e-01	0	0	0	28	0	9	351
ZNF70	7621	broad.mit.edu	37	22	24086056	24086056	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr22:24086056G>A	ENST00000341976.3	-	2	1732	c.1272C>T	c.(1270-1272)tgC>tgT	p.C424C		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						AGGACTTGCCGCACAGATTGC	0.547																																						ENST00000341976.3			0	0																														0				21						c.(1270-1272)tgC>tgT		zinc finger protein 70							113.0	111.0	112.0					22																	24086056		2203	4300	6503	SO:0001819	synonymous_variant	7621	1	121412	33				g.chr22:24086056G>A	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.1272C>T	chr22.hg19:g.24086056G>A								p.C424C	NM_021916.2	NP_068735.1					Q9UC06	ZNF70_HUMAN		2	1732	-				Silent	SNP	ENST00000341976.3	0	1	hg19	c.1272C>T	CCDS13812.1																																																																																											TCGA-OE-A75W-01A-12D-A32N-08	0.547	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	0	0	1	2	17	2	2	1	1	1	1	181	181	181	179	1	1.770000	-1.930780	0	0.570000	NM_021916		0	6	8	0	857	844	0		0			1	0	181	0	0	0.015404	0	0	0	0	0	0	6	857
CRYBB1	1414	broad.mit.edu	37	22	27003917	27003917	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr22:27003917C>T	ENST00000215939.2	-	4	498	c.368G>A	c.(367-369)cGc>cAc	p.R123H		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	123	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						TGTGTTCCAGCGAGGGTACTC	0.592																																						ENST00000215939.2	0.780000	4.700000e-01	7.000000e-01	5.400000e-01	0.620000	0.630119	0.620000	0.620000																										0				31						c.(367-369)cGc>cAc		crystallin, beta B1							99.0	74.0	82.0					22																	27003917		2203	4300	6503	SO:0001583	missense	1414	0	0					g.chr22:27003917C>T		CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.368G>A	chr22.hg19:g.27003917C>T	ENSP00000215939:p.Arg123His	0						p.R123H	NM_001887.3	NP_001878.1	0	1	1	1.977177	P53674	CRBB1_HUMAN		4	498	-				Missense_Mutation	SNP	ENST00000215939.2	1	1	hg19	c.368G>A	CCDS13840.1	0	.	.	.	.	.	.	.	.	.	.	C	24.9	4.582400	0.86748	.	.	ENSG00000100122	ENST00000215939	T	0.76060	-0.99	4.4	3.36	0.38483	4.4	3.36	0.38483	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.105598	0.64402	D	0.000003	T	0.82157	0.4976	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83373	0.0008	10	0.66056	D	0.02	.	13.3936	0.60836	0.0:0.8408:0.1592:0.0	.	123	P53674	CRBB1_HUMAN	H	123	ENSP00000215939:R123H	ENSP00000215939:R123H	R	-	2	0	0	CRYBB1	25333917	25333917	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	2.906000	0.48735	1.041000	0.40125	0.585000	0.79938	CGC	0.529798		TCGA-OE-A75W-01A-12D-A32N-08	0.592	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.770000	-20.000000	1	0.570000	NM_001887		0	52	51	0	215	212	1		1	0		0	0	56	0	0	1.000000	3.911439e-02	0	0	0	2	0	52	215
L3MBTL2	83746	broad.mit.edu	37	22	41625557	41625557	+	Silent	SNP	G	G	A	rs540563633		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr22:41625557G>A	ENST00000216237.5	+	16	2060	c.1902G>A	c.(1900-1902)ccG>ccA	p.P634P	CHADL_ENST00000216241.9_3'UTR	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	634					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAAGAATCCCGCCCACTAAGA	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17370	0.0		0.0	False		,,,				2504	0.0					ENST00000216237.5	1.000000	8.200000e-01	1	9.200000e-01	0.990000	0.973512	0.990000	1.000000																										0				24						c.(1900-1902)ccG>ccA		l(3)mbt-like 2 (Drosophila)							47.0	49.0	48.0					22																	41625557		2203	4300	6503	SO:0001819	synonymous_variant	83746	1	121410	31				g.chr22:41625557G>A	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1902G>A	chr22.hg19:g.41625557G>A		0					CHADL_ENST00000216241.9_3'UTR	p.P634P	NM_031488.4	NP_113676.2	0	1	1	1.977177	Q969R5	LMBL2_HUMAN		16	2060	+			Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Silent	SNP	ENST00000216237.5	1	1	hg19	c.1902G>A	CCDS14011.1	1																																																																																								0.529798		TCGA-OE-A75W-01A-12D-A32N-08	0.542	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.770000	-20.000000	1	0.570000	NM_031488		0	62	62	0	130	129	1		1	1		0	0	44	0	0	1.000000	1	0	31	0	62	0	62	130
ALG12	79087	broad.mit.edu	37	22	50303671	50303671	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr22:50303671C>T	ENST00000330817.6	-	5	808	c.535G>A	c.(535-537)Gcc>Acc	p.A179T		NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	179					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		ACGATGATGGCGAAGGCTGAC	0.637																																						ENST00000330817.6	0.910000	4.300000e-01	7.900000e-01	5.400000e-01	0.650000	0.671167	0.650000	0.650000																										0				12						c.(535-537)Gcc>Acc		ALG12, alpha-1,6-mannosyltransferase							51.0	48.0	49.0					22																	50303671		2203	4300	6503	SO:0001583	missense	79087	0	0					g.chr22:50303671C>T	AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.535G>A	chr22.hg19:g.50303671C>T	ENSP00000333813:p.Ala179Thr	0						p.A179T	NM_024105.3	NP_077010.1	0	1	1	1.977177	Q9BV10	ALG12_HUMAN		5	808	-		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)	A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Missense_Mutation	SNP	ENST00000330817.6	1	1	hg19	c.535G>A	CCDS14081.1	0	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939391	0.52972	.	.	ENSG00000182858	ENST00000330817	T	0.64991	-0.13	4.44	3.42	0.39159	4.44	3.42	0.39159	.	0.161366	0.53938	D	0.000044	T	0.65729	0.2719	L	0.58302	1.8	0.42474	D	0.992838	D	0.54772	0.968	P	0.51079	0.658	T	0.66559	-0.5893	10	0.35671	T	0.21	-16.6342	13.9771	0.64279	0.0:0.9236:0.0:0.0764	.	179	Q9BV10	ALG12_HUMAN	T	179	ENSP00000333813:A179T	ENSP00000333813:A179T	A	-	1	0	0	ALG12	48689675	48689675	0.995000	0.38212	0.008000	0.14137	0.008000	0.06430	3.331000	0.52075	1.166000	0.42689	-0.205000	0.12727	GCC	0.529798		TCGA-OE-A75W-01A-12D-A32N-08	0.637	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317405.2	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	1.770000	-20.000000	1	0.570000	NM_024105		0	22	22	0	85	85	0		1	1		0	0	26	0	0	1.000000	9.290455e-01	0	5	0	15	0	22	85
SCN3A	6328	broad.mit.edu	37	2	165997338	165997338	+	Silent	SNP	C	C	T	rs370922010		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:165997338C>T	ENST00000360093.3	-	13	2333	c.1842G>A	c.(1840-1842)ccG>ccA	p.P614P	SCN3A_ENST00000409101.3_Silent_p.P614P|SCN3A_ENST00000283254.7_Silent_p.P614P	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	614					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATGTCTGTGCGGCACAAACA	0.507																																						ENST00000360093.3	0.190000	3.000000e-02	1.300000e-01	5.000000e-02	0.080000	0.105436	0.080000	0.080000																										0				120						c.(1840-1842)ccG>ccA		sodium channel, voltage-gated, type III, alpha subunit	Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	C	,,	0,4406		0,0,2203	230.0	167.0	188.0		1842,1842,1842	-12.1	0.0	2		188	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	SCN3A	NM_001081676.1,NM_001081677.1,NM_006922.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	614/1952,614/1952,614/2001	165997338	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6328	1	121410	35				g.chr2:165997338C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1842G>A	chr2.hg19:g.165997338C>T		0					SCN3A_ENST00000283254.7_Silent_p.P614P|SCN3A_ENST00000409101.3_Silent_p.P614P	p.P614P	NM_001081677.1	NP_001075146.1	1	2	3	2.171289	Q9NY46	SCN3A_HUMAN		13	2333	-			Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	0	1	hg19	c.1842G>A		0																																																																																								0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.507	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	35	35	35	34	1	1.770000	-2.590124	1	0.570000	NM_006922		0	6	6	0	247	241	0		1			0	0	35	0	0	0.962825	0	0	0	0	0	0	6	247
NOSTRIN	115677	broad.mit.edu	37	2	169716142	169716142	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:169716142G>C	ENST00000317647.7	+	13	1403	c.1174G>C	c.(1174-1176)Gaa>Caa	p.E392Q	NOSTRIN_ENST00000444448.2_Missense_Mutation_p.E449Q|NOSTRIN_ENST00000397206.2_Missense_Mutation_p.E314Q|NOSTRIN_ENST00000421711.2_Missense_Mutation_p.E364Q|NOSTRIN_ENST00000445023.2_Missense_Mutation_p.E314Q|NOSTRIN_ENST00000397209.2_Missense_Mutation_p.E364Q|NOSTRIN_ENST00000458381.2_Missense_Mutation_p.E449Q	NM_001039724.3	NP_001034813.2	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficking	392					endocytosis (GO:0006897)|negative regulation of transcription, DNA-templated (GO:0045892)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoskeleton (GO:0005856)|endocytic vesicle membrane (GO:0030666)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						CAGGTGGAGGGAAAAGGTAAC	0.438																																						ENST00000317647.7	0.090000	0	7.000000e-02	2.000000e-02	0.030000	0.055877	0.030000	0.040000																										0				9						c.(1174-1176)Gaa>Caa		nitric oxide synthase trafficking							125.0	119.0	121.0					2																	169716142		1914	4130	6044	SO:0001583	missense	115677	0	0					g.chr2:169716142G>C	AJ532842	CCDS42771.1, CCDS42772.1, CCDS54415.1, CCDS54416.1	2q31.1	2013-08-05	2013-08-05		ENSG00000163072	ENSG00000163072			20203	protein-coding gene	gene with protein product		607496	"""nitric oxide synthase trafficker"""			12446846	Standard	NM_001171631		Approved	MGC20702	uc002ueg.3	Q8IVI9	OTTHUMG00000153990	ENST00000317647.7:c.1174G>C	chr2.hg19:g.169716142G>C	ENSP00000318921:p.Glu392Gln	0					NOSTRIN_ENST00000397206.2_Missense_Mutation_p.E314Q|NOSTRIN_ENST00000445023.2_Missense_Mutation_p.E314Q|NOSTRIN_ENST00000421711.2_Missense_Mutation_p.E364Q|NOSTRIN_ENST00000397209.2_Missense_Mutation_p.E364Q|NOSTRIN_ENST00000444448.2_Missense_Mutation_p.E449Q|NOSTRIN_ENST00000458381.2_Missense_Mutation_p.E449Q	p.E392Q	NM_001039724.3	NP_001034813.2	1	2	3	2.171289	Q8IVI9	NOSTN_HUMAN		13	1403	+			A8K2I9|B3KSF5|E7EPT9|Q27HG3|Q53S62|Q96CJ9	Missense_Mutation	SNP	ENST00000317647.7	0	1	hg19	c.1174G>C	CCDS42771.1	0	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127768	0.77549	.	.	ENSG00000163072	ENST00000458381;ENST00000444448;ENST00000317647;ENST00000445023;ENST00000397206;ENST00000397209;ENST00000421711	T;T;T;T;T;T;T	0.38560	1.3;1.3;1.13;1.32;1.32;1.33;1.33	5.3	5.3	0.74995	5.3	5.3	0.74995	.	0.162747	0.53938	D	0.000056	T	0.59649	0.2209	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D;D	0.64830	0.98;0.991;0.994;0.994;0.969;0.987	P;P;P;P;P;P	0.58331	0.663;0.837;0.798;0.783;0.599;0.776	T	0.56275	-0.8006	10	0.28530	T	0.3	-0.2101	16.7834	0.85568	0.0:0.0:1.0:0.0	.	364;314;449;286;392;449	Q8IVI9-2;Q8IVI9-3;B3KSF5;D3DPB9;Q8IVI9;E7EPT9	.;.;.;.;NOSTN_HUMAN;.	Q	449;449;392;314;314;364;364	ENSP00000402140:E449Q;ENSP00000394051:E449Q;ENSP00000318921:E392Q;ENSP00000404413:E314Q;ENSP00000380390:E314Q;ENSP00000380392:E364Q;ENSP00000401316:E364Q	ENSP00000318921:E392Q	E	+	1	0	0	NOSTRIN	169424388	169424388	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	6.770000	0.74990	2.630000	0.89119	0.655000	0.94253	GAA	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.438	NOSTRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333356.4	0	0	1	2	2	2	2	0	0	0	0	83	83	83	81	1	1.770000	-2.919711	1	0.570000	NM_052946		0	6	6	0	521	516	0		1	0		0	0	83	0	0	0.964109	3.799201e-01	0	0	0	102	0	6	521
TTN	7273	broad.mit.edu	37	2	179412983	179412983	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:179412983C>T	ENST00000591111.1	-	289	88671	c.88447G>A	c.(88447-88449)Gat>Aat	p.D29483N	TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D31124N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D22184N|TTN_ENST00000460472.2_Missense_Mutation_p.D22059N|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D28556N|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D22251N|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29483	Fibronectin type-III 115. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCTAGTATCAACAACATCA	0.483																																						ENST00000591111.1	0.120000	3.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.075555	0.060000	0.070000																										0				1448						c.(88447-88449)Gat>Aat		titin							166.0	165.0	165.0					2																	179412983		2042	4196	6238	SO:0001583	missense	7273	0	0					g.chr2:179412983C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.88447G>A	chr2.hg19:g.179412983C>T	ENSP00000465570:p.Asp29483Asn	0					RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D28556N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.D22059N|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D31124N|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D22251N|TTN_ENST00000359218.5_Missense_Mutation_p.D22184N|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.D29483N			0	0	0	2.059777	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	289	88671	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.88447G>A		0	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869050	0.72065	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.65	5.65	0.86999	5.65	5.65	0.86999	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69860	0.3158	L	0.50919	1.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.71144	-0.4678	9	0.87932	D	0	.	19.7272	0.96168	0.0:1.0:0.0:0.0	.	22059;22184;22251;29483	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	28556;22059;22251;22184;22056	ENSP00000343764:D28556N;ENSP00000434586:D22059N;ENSP00000340554:D22251N;ENSP00000352154:D22184N	ENSP00000340554:D22251N	D	-	1	0	0	TTN	179121229	179121229	1.000000	0.71417	0.980000	0.43619	0.745000	0.42441	7.818000	0.86416	2.646000	0.89796	0.655000	0.94253	GAT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.483	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	149	149	149	148	1	1.770000	-2.624656	1	0.570000	NM_133378		0	14	13	0	652	645	0		1			0	0	149	0	0	0.999731	0	0	0	0	0	0	14	652
TTN	7273	broad.mit.edu	37	2	179597812	179597812	+	Missense_Mutation	SNP	C	C	T	rs200941841		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:179597812C>T	ENST00000591111.1	-	53	15364	c.15140G>A	c.(15139-15141)cGc>cAc	p.R5047H	TTN_ENST00000589042.1_Missense_Mutation_p.R5364H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R4120H|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12420	Ig-like 31.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCCACGTTGCGCAAGGGTTT	0.453																																						ENST00000591111.1	1.000000	5.600000e-01	9.400000e-01	6.700000e-01	0.790000	0.804195	0.790000	1.000000																										0				1448						c.(15139-15141)cGc>cAc		titin		C	HIS/ARG,,,	1,3881		0,1,1940	60.0	57.0	58.0		12359,,,	5.3	1.0	2		58	0,8284		0,0,4142	yes	missense,intron,intron,intron	TTN	NM_133378.4,NM_003319.4,NM_133432.3,NM_133437.3	29,,,	0,1,6082	TT,TC,CC		0.0,0.0258,0.0082	probably-damaging,,,	4120/33424,,,	179597812	1,12165	1941	4142	6083	SO:0001583	missense	7273	18	120876	41				g.chr2:179597812C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.15140G>A	chr2.hg19:g.179597812C>T	ENSP00000465570:p.Arg5047His	0					TTN_ENST00000342992.6_Missense_Mutation_p.R4120H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.R5364H|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron	p.R5047H			1	2	3	2.168169	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	53	15364	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.15140G>A		0	.	.	.	.	.	.	.	.	.	.	C	10.90	1.480091	0.26598	2.58E-4	0.0	ENSG00000155657	ENST00000342992	T	0.68331	-0.32	6.17	5.29	0.74685	6.17	5.29	0.74685	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71576	0.3356	M	0.75884	2.315	0.80722	D	1	D	0.57571	0.98	P	0.48921	0.595	T	0.75557	-0.3276	9	0.87932	D	0	.	12.1123	0.53846	0.0:0.8742:0.0:0.1258	.	5047	Q8WZ42	TITIN_HUMAN	H	4120	ENSP00000343764:R4120H	ENSP00000343764:R4120H	R	-	2	0	0	TTN	179306057	179306057	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	3.216000	0.51176	2.941000	0.99782	0.655000	0.94253	CGC	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	28	1	1.770000	-20.000000	1	0.570000	NM_133378		0	28	28	0	96	93	1		1			0	0	30	0	0	1.000000	0	0	0	0	0	0	28	96
MYT1L	23040	broad.mit.edu	37	2	1982980	1982980	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:1982980C>T	ENST00000399161.2	-	8	856	c.109G>A	c.(109-111)Gac>Aac	p.D37N	MYT1L_ENST00000428368.2_Missense_Mutation_p.D37N	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	37					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCACTGCCGTCACAGCCAGGG	0.512																																						ENST00000399161.2	0.990000	6.100000e-01	9.300000e-01	7.200000e-01	0.830000	0.829425	0.830000	0.850000																										0				97						c.(109-111)Gac>Aac		myelin transcription factor 1-like							37.0	40.0	39.0					2																	1982980		2196	4297	6493	SO:0001583	missense	23040	0	0					g.chr2:1982980C>T	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.109G>A	chr2.hg19:g.1982980C>T	ENSP00000382114:p.Asp37Asn	1					MYT1L_ENST00000428368.2_Missense_Mutation_p.D37N	p.D37N	NM_015025.2	NP_055840.2	0	1	1	1.536997	Q9UL68	MYT1L_HUMAN		8	856	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	1	1	hg19	c.109G>A		0	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935617	0.73442	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.43688	0.94;0.94	5.18	5.18	0.71444	5.18	5.18	0.71444	.	0.138574	0.46442	D	0.000293	T	0.52517	0.1739	N	0.24115	0.695	0.58432	D	0.999996	D;D	0.69078	0.997;0.996	D;D	0.77004	0.989;0.981	T	0.55749	-0.8092	10	0.51188	T	0.08	-38.9835	18.6852	0.91560	0.0:1.0:0.0:0.0	.	37;37	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	N	37	ENSP00000382114:D37N;ENSP00000396103:D37N	ENSP00000295067:D37N	D	-	1	0	0	MYT1L	1961987	1961987	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.604000	0.74150	2.405000	0.81733	0.655000	0.94253	GAC	0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.512	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	14	1	1.770000	-20.000000	1	0.570000	NM_015025		0	31	31	0	59	59	1		1			0	0	15	0	0	1.000000	0	0	0	0	0	0	31	59
TTN	7273	broad.mit.edu	37	2	179641336	179641336	+	Missense_Mutation	SNP	C	C	T	rs150737838		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:179641336C>T	ENST00000591111.1	-	28	5479	c.5255G>A	c.(5254-5256)cGt>cAt	p.R1752H	TTN_ENST00000589042.1_Missense_Mutation_p.R1752H|TTN_ENST00000360870.5_Missense_Mutation_p.R1752H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R1706H|TTN_ENST00000460472.2_Missense_Mutation_p.R1706H|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R1752H|TTN-AS1_ENST00000610005.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R1706H			Q8WZ42	TITIN_HUMAN	titin	12584	Ig-like 8.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTGATCATACGGAGCCTGTT	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		19405	0.0		0.001	False		,,,				2504	0.0					ENST00000591111.1	1.000000	9.800000e-01	1	9.900000e-01	0.990000	0.998847	0.990000	1.000000																										0				1448						c.(5254-5256)cGt>cAt		titin							69.0	62.0	64.0					2																	179641336		2203	4300	6503	SO:0001583	missense	7273	25	121408	45				g.chr2:179641336C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5255G>A	chr2.hg19:g.179641336C>T	ENSP00000465570:p.Arg1752His	0					TTN_ENST00000360870.5_Missense_Mutation_p.R1752H|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R1752H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R1706H|TTN_ENST00000589042.1_Missense_Mutation_p.R1752H|TTN_ENST00000342175.6_Missense_Mutation_p.R1706H|TTN_ENST00000359218.5_Missense_Mutation_p.R1706H|TTN-AS1_ENST00000584485.1_RNA	p.R1752H			1	2	3	2.168169	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	28	5479	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.5255G>A		1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.20	2.166946	0.38217	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.05	5.05	0.67936	5.05	5.05	0.67936	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76877	0.4049	L	0.41079	1.255	0.38775	D	0.954622	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.80984	-0.1138	9	0.87932	D	0	.	18.3911	0.90484	0.0:1.0:0.0:0.0	.	1706;1706;1706;1752;1752	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	1752;1706;1706;1706;1706;1752	ENSP00000343764:R1752H;ENSP00000434586:R1706H;ENSP00000340554:R1706H;ENSP00000352154:R1706H;ENSP00000354117:R1752H	ENSP00000340554:R1706H	R	-	2	0	0	TTN	179349581	179349581	1.000000	0.71417	0.980000	0.43619	0.972000	0.66771	4.864000	0.62990	2.363000	0.80096	0.561000	0.74099	CGT	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	70	1	1.770000	-20.000000	1	0.570000	NM_133378		0	92	91	0	183	182	1		1			0	0	71	0	0	1.000000	0	0	0	0	0	0	92	183
NDUFB3	4709	broad.mit.edu	37	2	201943722	201943722	+	Silent	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:201943722A>G	ENST00000237889.4	+	2	440	c.117A>G	c.(115-117)aaA>aaG	p.K39K	NDUFB3_ENST00000433898.1_Silent_p.K39K|RNU6-1206P_ENST00000516339.1_RNA|NDUFB3_ENST00000454214.1_Silent_p.K39K	NM_001257102.1|NM_002491.2	NP_001244031.1|NP_002482.1	O43676	NDUB3_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa	39					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			large_intestine(1)|lung(1)|urinary_tract(1)	3						TGGCTGCAAAAGGGCTAAGGG	0.393																																						ENST00000237889.4	0.170000	1.000000e-02	1.200000e-01	3.000000e-02	0.070000	0.088540	0.070000	0.060000																										0				3						c.(115-117)aaA>aaG		NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa							75.0	77.0	76.0					2																	201943722		2203	4300	6503	SO:0001819	synonymous_variant	4709	0	0					g.chr2:201943722A>G	AF047183	CCDS2336.1	2q33.1	2011-07-04	2002-08-29		ENSG00000119013	ENSG00000119013		"""Mitochondrial respiratory chain complex / Complex I"""	7698	protein-coding gene	gene with protein product	"""complex I B12 subunit"""	603839	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (12kD, B12)"""			9425316, 11474204	Standard	NM_002491		Approved	B12	uc002uwx.4	O43676	OTTHUMG00000132820	ENST00000237889.4:c.117A>G	chr2.hg19:g.201943722A>G		0					NDUFB3_ENST00000433898.1_Silent_p.K39K|RNU6-1206P_ENST00000516339.1_RNA|NDUFB3_ENST00000454214.1_Silent_p.K39K	p.K39K	NM_001257102.1|NM_002491.2	NP_001244031.1|NP_002482.1	1	2	3	2.168169	O43676	NDUB3_HUMAN		2	440	+			Q6IB80	Silent	SNP	ENST00000237889.4	0	1	hg19	c.117A>G	CCDS2336.1	0																																																																																								0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.393	NDUFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256277.1	0	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.770000	-2.995412	1	0.570000	NM_002491		0	4	4	0	215	211	0		1	0		0	0	29	0	0	0.885690	9.979281e-01	0	1	0	817	0	4	215
NRP2	8828	broad.mit.edu	37	2	206581077	206581077	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:206581077C>T	ENST00000357785.5	+	3	443	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C	NRP2_ENST00000355117.4_Missense_Mutation_p.R138C|NRP2_ENST00000360409.3_Missense_Mutation_p.R138C|NRP2_ENST00000412873.2_Missense_Mutation_p.R138C|NRP2_ENST00000357118.4_Missense_Mutation_p.R138C|NRP2_ENST00000417189.1_Missense_Mutation_p.R138C|NRP2_ENST00000540841.1_Missense_Mutation_p.R138C|NRP2_ENST00000540178.1_Missense_Mutation_p.R138C|NRP2_ENST00000272849.3_Missense_Mutation_p.R138C			Q99435	NELL2_HUMAN	neuropilin 2	0	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CTTCTCTCTGCGCTACGAGAT	0.617																																						ENST00000357785.5	0.090000	0	7.000000e-02	2.000000e-02	0.040000	0.055967	0.040000	0.040000																										0				52						c.(412-414)Cgc>Tgc		neuropilin 2							72.0	72.0	72.0					2																	206581077		2203	4300	6503	SO:0001583	missense	8828	1	121412	29				g.chr2:206581077C>T	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.412C>T	chr2.hg19:g.206581077C>T	ENSP00000350432:p.Arg138Cys	0					NRP2_ENST00000360409.3_Missense_Mutation_p.R138C|NRP2_ENST00000417189.1_Missense_Mutation_p.R138C|NRP2_ENST00000540841.1_Missense_Mutation_p.R138C|NRP2_ENST00000355117.4_Missense_Mutation_p.R138C|NRP2_ENST00000357118.4_Missense_Mutation_p.R138C|NRP2_ENST00000540178.1_Missense_Mutation_p.R138C|NRP2_ENST00000272849.3_Missense_Mutation_p.R138C|NRP2_ENST00000412873.2_Missense_Mutation_p.R138C	p.R138C			1	2	3	2.168169	Q99435	NELL2_HUMAN		3	443	+			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	0	1	hg19	c.412C>T	CCDS46496.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.331934	0.95733	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000355117;ENST00000417189;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	T;T;T;T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14	6.17	6.17	0.99709	6.17	6.17	0.99709	CUB (5);	0.000000	0.85682	D	0.000000	T	0.59142	0.2172	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;P;D;D;D	0.79108	0.983;0.983;0.9;0.992;0.992;0.971	T	0.65187	-0.6229	10	0.87932	D	0	-22.1386	20.8794	0.99867	0.0:1.0:0.0:0.0	.	138;138;138;138;138;138	O60462-2;O60462-3;O60462;O60462-4;O60462-5;E9PF66	.;.;NRP2_HUMAN;.;.;.	C	138	ENSP00000353582:R138C;ENSP00000439658:R138C;ENSP00000439261:R138C;ENSP00000347238:R138C;ENSP00000387519:R138C;ENSP00000349632:R138C;ENSP00000350432:R138C;ENSP00000407626:R138C;ENSP00000272849:R138C	ENSP00000272849:R138C	R	+	1	0	0	NRP2	206289322	206289322	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGC	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.617	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1	0	0	1	2	2	2	2	0	0	0	0	95	95	95	91	1	1.770000	-2.773521	1	0.570000			0	6	6	0	520	515	0		1	0		0	0	95	0	0	0.964106	5.946687e-04	0	0	0	3	0	6	520
LRRTM1	347730	broad.mit.edu	37	2	80529763	80529763	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:80529763G>A	ENST00000295057.3	-	2	1838	c.1182C>T	c.(1180-1182)ctC>ctT	p.L394L	CTNNA2_ENST00000540488.1_Intron|LRRTM1_ENST00000409148.1_Silent_p.L394L|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	394					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CGCCGTCCGCGAGCGTGGTGG	0.716										HNSCC(69;0.2)																												ENST00000295057.3	0.210000	4.000000e-02	1.600000e-01	7.000000e-02	0.100000	0.119552	0.100000	0.100000																										0				63						c.(1180-1182)ctC>ctT		leucine rich repeat transmembrane neuronal 1							18.0	20.0	19.0					2																	80529763		2186	4273	6459	SO:0001819	synonymous_variant	347730	0	0					g.chr2:80529763G>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1182C>T	chr2.hg19:g.80529763G>A		0	HNSCC(69;0.2)				LRRTM1_ENST00000409148.1_Silent_p.L394L|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000541047.1_Intron	p.L394L	NM_178839.4	NP_849161.2	0	0	0	2.138019	Q86UE6	LRRT1_HUMAN		2	1838	-			A8K397|D6W5K1|Q96DN1	Silent	SNP	ENST00000295057.3	0	1	hg19	c.1182C>T	CCDS1966.1	0																																																																																								0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.716	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.770000	-8.803212	1	0.570000	NM_178839		0	7	7	0	225	222	0		1	0		0	0	39	0	0	0.980165	9.613978e-02	0	0	0	15	0	7	225
NCAPH	23397	broad.mit.edu	37	2	97007560	97007560	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:97007560G>A	ENST00000240423.4	+	2	243	c.200G>A	c.(199-201)cGg>cAg	p.R67Q	NCAPH_ENST00000455200.1_Missense_Mutation_p.R56Q|NCAPH_ENST00000427946.1_Intron	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	67					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				CGGCTGCAGCGGAGGCGCTCG	0.592																																						ENST00000240423.4	0.930000	6.900000e-01	8.600000e-01	7.400000e-01	0.790000	0.807003	0.790000	0.800000																										0				28						c.(199-201)cGg>cAg		non-SMC condensin I complex, subunit H							75.0	82.0	79.0					2																	97007560		2203	4300	6503	SO:0001583	missense	23397	1	121412	33				g.chr2:97007560G>A	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.200G>A	chr2.hg19:g.97007560G>A	ENSP00000240423:p.Arg67Gln	0					NCAPH_ENST00000455200.1_Missense_Mutation_p.R56Q|NCAPH_ENST00000427946.1_Intron	p.R67Q	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	1	2	3	2.171444	Q15003	CND2_HUMAN		2	243	+		Ovarian(717;0.0221)	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	1	1	hg19	c.200G>A	CCDS2021.1	0	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639751	0.87760	.	.	ENSG00000121152	ENST00000240423;ENST00000435975;ENST00000456906;ENST00000455200	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.66	4.78	0.61160	5.66	4.78	0.61160	.	0.106857	0.64402	N	0.000006	T	0.71467	0.3343	M	0.80183	2.485	0.48975	D	0.999732	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.74595	-0.3613	10	0.66056	D	0.02	-21.3725	10.5775	0.45235	0.0891:0.0:0.9109:0.0	.	43;56;56;67	B4DRG7;E9PHA2;C9J470;Q15003	.;.;.;CND2_HUMAN	Q	67;56;67;56	ENSP00000240423:R67Q;ENSP00000405237:R56Q;ENSP00000401227:R67Q;ENSP00000407308:R56Q	ENSP00000240423:R67Q	R	+	2	0	0	NCAPH	96371287	96371287	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	8.515000	0.90548	1.400000	0.46741	0.650000	0.86243	CGG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.592	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	1	0	1	2	2	2	2	0	0	0	0	133	133	133	131	1	1.770000	-4.469609	1	0.570000	NM_015341		0	155	155	0	526	514	1		1			0	0	133	0	0	1.000000	0	0	0	0	0	0	155	526
CXCR1	3577	broad.mit.edu	37	2	219029099	219029099	+	Missense_Mutation	SNP	C	C	T	rs56030518	byFrequency	TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr2:219029099C>T	ENST00000295683.2	-	2	956	c.836G>A	c.(835-837)cGc>cAc	p.R279H		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	279					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)			endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	GTTGTTGCGGCGCTCACAGCT	0.572													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19230	0.0		0.001	False		,,,				2504	0.0					ENST00000295683.2	1.000000	8.000000e-01	1	8.700000e-01	0.950000	0.944854	0.950000	1.000000																										0				13						c.(835-837)cGc>cAc		chemokine (C-X-C motif) receptor 1	Ketoprofen(DB01009)	C	HIS/ARG	0,4406		0,0,2203	76.0	74.0	75.0		836	3.9	1.0	2	dbSNP_129	75	3,8597	3.0+/-9.4	0,3,4297	yes	missense	CXCR1	NM_000634.2	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	279/351	219029099	3,13003	2203	4300	6503	SO:0001583	missense	3577	23	121412	46				g.chr2:219029099C>T	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.836G>A	chr2.hg19:g.219029099C>T	ENSP00000295683:p.Arg279His	0						p.R279H	NM_000634.2	NP_000625.1	1	2	3	2.168169	P25024	CXCR1_HUMAN		2	956	-			B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	ENST00000295683.2	1	1	hg19	c.836G>A	CCDS2409.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.25	2.778988	0.49891	0.0	3.49E-4	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.71934	-0.61	4.89	3.94	0.45596	4.89	3.94	0.45596	GPCR, rhodopsin-like superfamily (1);	0.392430	0.28482	N	0.015186	T	0.65923	0.2738	M	0.62154	1.92	0.31690	N	0.641996	P	0.40083	0.702	B	0.37780	0.258	T	0.72276	-0.4341	10	0.33940	T	0.23	.	13.1692	0.59589	0.1603:0.8397:0.0:0.0	rs56030518	279	P25024	CXCR1_HUMAN	H	279;223	ENSP00000295683:R279H	ENSP00000295683:R279H	R	-	2	0	0	CXCR1	218737344	218737344	0.005000	0.15991	0.967000	0.41034	0.149000	0.21700	1.489000	0.35562	2.406000	0.81754	0.561000	0.74099	CGC	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.572	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256773.2	1	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	1.770000	-3.017840	1	0.570000	NM_000634		0	116	116	0	312	308	1		1			0	0	90	0	0	1.000000	0	0	0	0	0	0	116	312
GPR156	165829	broad.mit.edu	37	3	119886046	119886046	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:119886046G>A	ENST00000464295.1	-	10	2723	c.2278C>T	c.(2278-2280)Cgg>Tgg	p.R760W	GPR156_ENST00000461057.1_Missense_Mutation_p.R756W|GPR156_ENST00000315843.3_Missense_Mutation_p.R760W			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	760						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		CAGTAGGGCCGGTGGCAGCGG	0.572																																						ENST00000464295.1	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.031722	0.020000	0.030000																										0				32						c.(2278-2280)Cgg>Tgg		G protein-coupled receptor 156							92.0	105.0	100.0					3																	119886046		2203	4300	6503	SO:0001583	missense	165829	7	121412	43				g.chr3:119886046G>A	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2278C>T	chr3.hg19:g.119886046G>A	ENSP00000417261:p.Arg760Trp	0					GPR156_ENST00000461057.1_Missense_Mutation_p.R756W|GPR156_ENST00000315843.3_Missense_Mutation_p.R760W	p.R760W			0	0	0	2.052927	Q8NFN8	GP156_HUMAN		10	2723	-			B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	0	1	hg19	c.2278C>T	CCDS2997.1	0	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874542	0.72180	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.63417	-0.04;-0.04;-0.0	4.97	2.03	0.26663	4.97	2.03	0.26663	.	0.000000	0.64402	D	0.000008	T	0.67069	0.2854	L	0.34521	1.04	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.62473	-0.6847	9	.	.	.	-23.5143	13.1849	0.59675	0.0:0.0:0.4344:0.5656	.	756;760	E9PFZ4;Q8NFN8	.;GP156_HUMAN	W	760;760;756	ENSP00000417261:R760W;ENSP00000324553:R760W;ENSP00000418758:R756W	.	R	-	1	2	2	GPR156	121368736	121368736	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.382000	0.34374	0.318000	0.23185	0.561000	0.74099	CGG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.572	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	0	0	1	2	2	2	2	0	0	0	0	152	152	152	151	1	1.770000	-1.898680	0	0.570000	NM_153002		0	7	6	0	824	815	0		1			0	0	152	0	0	0.979777	0	0	0	0	0	0	7	824
IQCB1	9657	broad.mit.edu	37	3	121489398	121489398	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:121489398C>T	ENST00000310864.6	-	15	1805	c.1591G>A	c.(1591-1593)Gaa>Aaa	p.E531K	IQCB1_ENST00000349820.6_Missense_Mutation_p.E398K	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	531					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		TCTTTCCCTTCTGCCTCCTTC	0.517																																						ENST00000310864.6	0.110000	2.000000e-02	9.000000e-02	4.000000e-02	0.060000	0.069054	0.060000	0.060000																										0				30						c.(1591-1593)Gaa>Aaa		IQ motif containing B1							163.0	159.0	160.0					3																	121489398		2203	4300	6503	SO:0001583	missense	9657	0	0					g.chr3:121489398C>T	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.1591G>A	chr3.hg19:g.121489398C>T	ENSP00000311505:p.Glu531Lys	0					IQCB1_ENST00000349820.6_Missense_Mutation_p.E398K	p.E531K	NM_001023570.2	NP_001018864.2	0	0	0	2.052927	Q15051	IQCB1_HUMAN		15	1805	-			Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	0	1	hg19	c.1591G>A	CCDS33837.1	0	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312378	0.23908	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.78595	-1.19;-1.19	5.34	3.4	0.38934	5.34	3.4	0.38934	.	0.261904	0.42420	N	0.000712	T	0.58308	0.2113	N	0.25647	0.755	0.28325	N	0.922048	B;P	0.36837	0.002;0.571	B;B	0.36608	0.003;0.229	T	0.51268	-0.8727	10	0.08381	T	0.77	-4.0249	6.4099	0.21686	0.0:0.782:0.0:0.218	.	531;398	Q15051;Q15051-2	IQCB1_HUMAN;.	K	531;398	ENSP00000311505:E531K;ENSP00000323756:E398K	ENSP00000311505:E531K	E	-	1	0	0	IQCB1	122972088	122972088	0.999000	0.42202	1.000000	0.80357	0.902000	0.53008	1.277000	0.33167	1.482000	0.48325	0.650000	0.86243	GAA	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.517	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	0	0	1	2	2	2	2	0	0	0	0	146	146	146	145	1	1.770000	-2.737766	1	0.570000	NM_014642		0	14	14	0	715	709	0		1	1		0	0	146	0	0	0.999739	4.020814e-01	0	3	0	65	0	14	715
CAND2	23066	broad.mit.edu	37	3	12858310	12858310	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:12858310C>T	ENST00000456430.2	+	10	1920	c.1879C>T	c.(1879-1881)Cgg>Tgg	p.R627W	CAND2_ENST00000295989.5_Missense_Mutation_p.R534W	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	627					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)		p.R534W(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TGAGATCACCCGGCTGCCCGC	0.632																																					GBM(43;676 868 1633 6395 37496)	ENST00000456430.2	0.100000	2.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.060231	0.050000	0.060000																										1	Substitution - Missense(1)	p.R534W(1)	large_intestine(1)	37						c.(1879-1881)Cgg>Tgg		cullin-associated and neddylation-dissociated 2 (putative)							67.0	76.0	73.0					3																	12858310		2100	4217	6317	SO:0001583	missense	23066	1	121052	33				g.chr3:12858310C>T		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1879C>T	chr3.hg19:g.12858310C>T	ENSP00000387641:p.Arg627Trp	0					CAND2_ENST00000295989.5_Missense_Mutation_p.R534W	p.R627W	NM_001162499.1	NP_001155971.1	0	0	0	2.052927	O75155	CAND2_HUMAN		10	1920	+			B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	0	1	hg19	c.1879C>T	CCDS54554.1	0	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386485	0.61956	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.71341	-0.56;-0.56	4.82	4.82	0.62117	4.82	4.82	0.62117	Armadillo-like helical (1);Armadillo-type fold (1);	0.068282	0.56097	D	0.000033	D	0.87884	0.6290	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.91089	0.4905	10	0.87932	D	0	-35.2501	15.7833	0.78281	0.0:1.0:0.0:0.0	.	627;534	O75155;O75155-2	CAND2_HUMAN;.	W	534;627	ENSP00000295989:R534W;ENSP00000387641:R627W	ENSP00000295989:R534W	R	+	1	2	2	CAND2	12833310	12833310	0.317000	0.24589	1.000000	0.80357	0.837000	0.47467	0.913000	0.28611	2.395000	0.81488	0.561000	0.74099	CGG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.632	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	0	0	1	2	15	2	2	1	1	1	1	179	179	179	176	1	1.770000	-2.184270	0	0.570000	XM_371617		0	12	12	0	712	704	0		0			1	0	179	0	0	0.337077	0	0	0	0	0	0	12	712
MUC13	56667	broad.mit.edu	37	3	124632520	124632520	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:124632520G>A	ENST00000311075.3	-	7	1008	c.970C>T	c.(970-972)Cgg>Tgg	p.R324W		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	325	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.|SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)	p.R324W(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						TAATCACACCGAAGGGTCACT	0.423																																						ENST00000311075.3	0.160000	3.000000e-02	1.300000e-01	5.000000e-02	0.080000	0.095998	0.080000	0.090000																										1	Substitution - Missense(1)	p.R324W(1)	large_intestine(1)	18						c.(970-972)Cgg>Tgg		mucin 13, cell surface associated							72.0	68.0	69.0					3																	124632520		2203	4300	6503	SO:0001583	missense	56667	1	121412	28				g.chr3:124632520G>A	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.970C>T	chr3.hg19:g.124632520G>A	ENSP00000312235:p.Arg324Trp	0						p.R324W	NM_033049.3	NP_149038	0	0	0	2.052927	Q9H3R2	MUC13_HUMAN		7	1008	-			Q6UWD9|Q9NXT5	Missense_Mutation	SNP	ENST00000311075.3	0	1	hg19	c.970C>T		0	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733931	0.30684	.	.	ENSG00000173702	ENST00000311075	D	0.87491	-2.26	3.93	-4.04	0.04010	3.93	-4.04	0.04010	.	3.072470	0.01105	N	0.005470	D	0.89329	0.6684	L	0.48642	1.525	0.09310	N	1	D	0.76494	0.999	D	0.71184	0.972	T	0.79112	-0.1937	10	0.66056	D	0.02	0.2081	4.6867	0.12760	0.4045:0.0:0.3619:0.2336	.	324	Q9H3R2	MUC13_HUMAN	W	324	ENSP00000312235:R324W	ENSP00000312235:R324W	R	-	1	2	2	MUC13	126115210	126115210	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.076000	0.11412	-1.421000	0.02007	-2.157000	0.00329	CGG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.423	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.770000	-2.957200	1	0.570000	NM_033049		0	8	6	0	305	304	1		1	1		0	0	48	0	0	0.989189	7.156202e-01	0	11	0	84	0	8	305
CEP63	80254	broad.mit.edu	37	3	134278028	134278028	+	Missense_Mutation	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:134278028G>T	ENST00000337090.3	+	14	1883	c.1710G>T	c.(1708-1710)aaG>aaT	p.K570N	CEP63_ENST00000383229.3_Intron|CEP63_ENST00000606977.1_Missense_Mutation_p.K570N|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000513612.2_Missense_Mutation_p.K570N|CEP63_ENST00000354446.3_Intron			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	570					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						ATGGAATAAAGACTGAGCACT	0.423																																						ENST00000337090.3	1.000000	8.600000e-01	1	9.200000e-01	0.980000	0.971125	0.980000	1.000000																										0				27						c.(1708-1710)aaG>aaT		centrosomal protein 63kDa							136.0	135.0	135.0					3																	134278028		2203	4300	6503	SO:0001583	missense	80254	0	0					g.chr3:134278028G>T	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1710G>T	chr3.hg19:g.134278028G>T	ENSP00000336524:p.Lys570Asn	0					CEP63_ENST00000354446.3_Intron|CEP63_ENST00000383229.3_Intron|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000513612.2_Missense_Mutation_p.K570N|CEP63_ENST00000606977.1_Missense_Mutation_p.K570N	p.K570N			0	0	0	2.052927	Q96MT8	CEP63_HUMAN		14	1883	+			D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	ENST00000337090.3	1	1	hg19	c.1710G>T	CCDS3086.1	1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944889	0.34283	.	.	ENSG00000182923	ENST00000337090;ENST00000513612	T;T	0.18338	2.22;2.22	4.77	3.89	0.44902	4.77	3.89	0.44902	.	0.724271	0.12624	N	0.452796	T	0.17238	0.0414	L	0.44542	1.39	0.32265	N	0.569604	P	0.44429	0.835	P	0.44990	0.466	T	0.02339	-1.1174	10	0.25751	T	0.34	-11.6316	8.2011	0.31426	0.1056:0.0:0.8944:0.0	.	570	Q96MT8	CEP63_HUMAN	N	570	ENSP00000336524:K570N;ENSP00000426129:K570N	ENSP00000336524:K570N	K	+	3	2	2	CEP63	135760718	135760718	1.000000	0.71417	0.880000	0.34516	0.885000	0.51271	1.319000	0.33655	2.611000	0.88343	0.650000	0.86243	AAG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.423	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	1.770000	-20.000000	1	0.570000	NM_025180		0	166	165	0	397	391	1		1	0		0	0	93	0	0	1.000000	7.938119e-01	0	1	0	8	0	166	397
CEP63	80254	broad.mit.edu	37	3	134278030	134278030	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:134278030C>T	ENST00000337090.3	+	14	1885	c.1712C>T	c.(1711-1713)aCt>aTt	p.T571I	CEP63_ENST00000383229.3_Intron|CEP63_ENST00000606977.1_Missense_Mutation_p.T571I|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000513612.2_Missense_Mutation_p.T571I|CEP63_ENST00000354446.3_Intron			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	571					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GGAATAAAGACTGAGCACTAC	0.428																																						ENST00000337090.3	1.000000	8.600000e-01	1	9.200000e-01	0.980000	0.970160	0.980000	1.000000																										0				27						c.(1711-1713)aCt>aTt		centrosomal protein 63kDa							138.0	137.0	137.0					3																	134278030		2203	4300	6503	SO:0001583	missense	80254	0	0					g.chr3:134278030C>T	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1712C>T	chr3.hg19:g.134278030C>T	ENSP00000336524:p.Thr571Ile	0					CEP63_ENST00000354446.3_Intron|CEP63_ENST00000383229.3_Intron|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000513612.2_Missense_Mutation_p.T571I|CEP63_ENST00000606977.1_Missense_Mutation_p.T571I	p.T571I			0	0	0	2.052927	Q96MT8	CEP63_HUMAN		14	1885	+			D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	ENST00000337090.3	1	1	hg19	c.1712C>T	CCDS3086.1	1	.	.	.	.	.	.	.	.	.	.	C	5.920	0.353755	0.11182	.	.	ENSG00000182923	ENST00000337090;ENST00000513612	T;T	0.18174	2.23;2.23	4.77	2.93	0.34026	4.77	2.93	0.34026	.	1.163120	0.06370	N	0.713479	T	0.16769	0.0403	L	0.47716	1.5	0.25605	N	0.986555	B	0.06786	0.001	B	0.09377	0.004	T	0.29549	-1.0008	10	0.35671	T	0.21	-0.0211	6.73	0.23379	0.0:0.7252:0.1782:0.0966	.	571	Q96MT8	CEP63_HUMAN	I	571	ENSP00000336524:T571I;ENSP00000426129:T571I	ENSP00000336524:T571I	T	+	2	0	0	CEP63	135760720	135760720	1.000000	0.71417	0.646000	0.29493	0.835000	0.47333	0.453000	0.21811	0.677000	0.31305	-0.143000	0.13931	ACT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.428	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.770000	-20.000000	1	0.570000	NM_025180		0	168	167	0	403	397	1		1	0		0	0	99	0	0	1.000000	8.403252e-01	0	1	0	9	0	168	403
SOX14	8403	broad.mit.edu	37	3	137483748	137483748	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:137483748G>A	ENST00000306087.1	+	1	170	c.122G>A	c.(121-123)cGc>cAc	p.R41H		NM_004189.3	NP_004180.1	O95416	SOX14_HUMAN	SRY (sex determining region Y)-box 14	41					entrainment of circadian clock (GO:0009649)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|regulation of neuron migration (GO:2001222)|visual perception (GO:0007601)	nuclear transcription factor complex (GO:0044798)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(2)|lung(12)	14						ATCAGCAAACGCCTAGGTGCC	0.597																																						ENST00000306087.1	0.350000	1.300000e-01	2.900000e-01	1.700000e-01	0.220000	0.238689	0.220000	0.220000																										0				14						c.(121-123)cGc>cAc		SRY (sex determining region Y)-box 14							103.0	100.0	101.0					3																	137483748		2203	4300	6503	SO:0001583	missense	8403	0	0					g.chr3:137483748G>A	AJ006230	CCDS3094.1	3q22-q23	2008-07-18			ENSG00000168875	ENSG00000168875		"""SRY (sex determining region Y)-boxes"""	11193	protein-coding gene	gene with protein product	"""HMG box transcription factor SOX-14"", ""SRY-box 14"""	604747				9925951	Standard	NM_004189		Approved	SOX28	uc003erm.2	O95416	OTTHUMG00000159757	ENST00000306087.1:c.122G>A	chr3.hg19:g.137483748G>A	ENSP00000305343:p.Arg41His	0						p.R41H	NM_004189.3	NP_004180.1	0	0	0	2.052927	O95416	SOX14_HUMAN		1	170	+			B2RAC0|Q3KPH7	Missense_Mutation	SNP	ENST00000306087.1	1	1	hg19	c.122G>A	CCDS3094.1	0	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711362	0.89112	.	.	ENSG00000168875	ENST00000306087	D	0.98060	-4.69	5.08	5.08	0.68730	5.08	5.08	0.68730	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	D	0.000001	D	0.98343	0.9450	M	0.82630	2.6	0.80722	D	1	D	0.69078	0.997	P	0.55508	0.777	D	0.99338	1.0911	10	0.87932	D	0	.	18.2699	0.90064	0.0:0.0:1.0:0.0	.	41	O95416	SOX14_HUMAN	H	41	ENSP00000305343:R41H	ENSP00000305343:R41H	R	+	2	0	0	SOX14	138966438	138966438	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.597000	0.98273	2.653000	0.90120	0.511000	0.50034	CGC	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.597	SOX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357182.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	45	1	1.770000	-3.318794	1	0.570000	NM_004189		0	15	15	0	208	205	0		1			0	0	46	0	0	0.999877	0	0	0	0	0	0	15	208
SLC25A36	55186	broad.mit.edu	37	3	140692616	140692616	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:140692616G>A	ENST00000324194.6	+	6	679	c.511G>A	c.(511-513)Gat>Aat	p.D171N	SLC25A36_ENST00000453248.2_Missense_Mutation_p.D145N|SLC25A36_ENST00000446041.2_Missense_Mutation_p.D171N|RP11-231L11.3_ENST00000513802.1_RNA			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	171					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GTATCAGACAGATGGACTAAA	0.353																																						ENST00000324194.6	1.000000	7.600000e-01	1	8.400000e-01	0.930000	0.930055	0.930000	1.000000																										0				6						c.(511-513)Gat>Aat		solute carrier family 25 (pyrimidine nucleotide carrier ), member 36							71.0	71.0	71.0					3																	140692616		2203	4300	6503	SO:0001583	missense	55186	0	0					g.chr3:140692616G>A	AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.511G>A	chr3.hg19:g.140692616G>A	ENSP00000320688:p.Asp171Asn	0					RP11-231L11.3_ENST00000513802.1_RNA|SLC25A36_ENST00000446041.2_Missense_Mutation_p.D171N|SLC25A36_ENST00000453248.2_Missense_Mutation_p.D145N	p.D171N			0	0	0	2.052927	Q96CQ1	S2536_HUMAN		6	679	+			A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Missense_Mutation	SNP	ENST00000324194.6	1	1	hg19	c.511G>A	CCDS46927.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347924	0.82022	.	.	ENSG00000114120	ENST00000446041;ENST00000324194;ENST00000453248	T;T;T	0.78816	-1.21;-1.21;-1.21	6.01	6.01	0.97437	6.01	6.01	0.97437	Mitochondrial carrier domain (2);	0.042314	0.85682	D	0.000000	D	0.83718	0.5315	L	0.46157	1.445	0.80722	D	1	B;B;D	0.55800	0.417;0.215;0.973	B;B;P	0.60117	0.213;0.135;0.869	D	0.84345	0.0529	10	0.87932	D	0	-25.1645	18.015	0.89236	0.0:0.0:1.0:0.0	.	145;171;171	B4DL01;Q96CQ1-3;Q96CQ1	.;.;S2536_HUMAN	N	171;171;145	ENSP00000401938:D171N;ENSP00000320688:D171N;ENSP00000391521:D145N	ENSP00000320688:D171N	D	+	1	0	0	SLC25A36	142175306	142175306	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.861000	0.98227	0.650000	0.86243	GAT	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.353	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359929.1	1	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	1.770000	-20.000000	1	0.570000	NM_018155		0	77	76	0	198	196	1		1	1		0	0	38	0	0	1.000000	3.164734e-01	0	3	0	1	0	77	198
P2RY1	5028	broad.mit.edu	37	3	152553971	152553971	+	Missense_Mutation	SNP	A	A	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:152553971A>T	ENST00000305097.3	+	1	1236	c.400A>T	c.(400-402)Aac>Tac	p.N134Y		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	134					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CTTTCATGTGAACCTCTATGG	0.507																																						ENST00000305097.3	0.110000	1.000000e-02	8.000000e-02	2.000000e-02	0.040000	0.057592	0.040000	0.050000																										0				23						c.(400-402)Aac>Tac		purinergic receptor P2Y, G-protein coupled, 1							79.0	75.0	77.0					3																	152553971		2203	4300	6503	SO:0001583	missense	5028	0	0					g.chr3:152553971A>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.400A>T	chr3.hg19:g.152553971A>T	ENSP00000304767:p.Asn134Tyr	0						p.N134Y	NM_002563.3	NP_002554.1	0	0	0	2.052927	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)	1	1236	+				Missense_Mutation	SNP	ENST00000305097.3	0	1	hg19	c.400A>T	CCDS3169.1	0	.	.	.	.	.	.	.	.	.	.	A	25.8	4.675868	0.88445	.	.	ENSG00000169860	ENST00000305097	T	0.38560	1.13	5.76	5.76	0.90799	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.71913	0.3396	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79165	-0.1916	10	0.87932	D	0	.	15.2728	0.73717	1.0:0.0:0.0:0.0	.	134	P47900	P2RY1_HUMAN	Y	134	ENSP00000304767:N134Y	ENSP00000304767:N134Y	N	+	1	0	0	P2RY1	154036661	154036661	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.210000	0.95106	2.186000	0.69663	0.533000	0.62120	AAC	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.507	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	0	0	0	2	2	2	2	0	0	0	0	78	78	78	78	1	1.770000	-5.871927	1	0.570000	NM_002563		0	5	5	0	343	343	0		1			0	0	78	0	0	0.937974	0	0	0	0	0	0	5	343
MECOM	2122	broad.mit.edu	37	3	168845679	168845679	+	Silent	SNP	C	C	T	rs150481592		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:168845679C>T	ENST00000464456.1	-	4	1419	c.219G>A	c.(217-219)acG>acA	p.T73T	MECOM_ENST00000264674.3_Silent_p.T137T|MECOM_ENST00000392736.3_Silent_p.T73T|MECOM_ENST00000433243.2_Silent_p.T73T|MECOM_ENST00000468789.1_Silent_p.T73T|MECOM_ENST00000460814.1_Silent_p.T73T|MECOM_ENST00000472280.1_Silent_p.T73T|MECOM_ENST00000494292.1_Silent_p.T261T	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						ACTCCTGGATCGTGTGTATCT	0.388													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20544	0.0		0.0	False		,,,				2504	0.0					ENST00000464456.1	1.000000	8.100000e-01	9.800000e-01	8.600000e-01	0.920000	0.923864	0.920000	1.000000																										0				85						c.(217-219)acG>acA		MDS1 and EVI1 complex locus		C	,,,,,,	4,4402	8.1+/-20.4	0,4,2199	176.0	165.0	169.0		411,219,219,219,219,783,219	-2.1	0.0	3	dbSNP_134	169	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MECOM	NM_001105077.3,NM_001105078.3,NM_001163999.1,NM_001164000.1,NM_001205194.1,NM_004991.3,NM_005241.3	,,,,,,	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	,,,,,,	137/1117,73/1052,73/1044,73/1043,73/1052,261/1240,73/1052	168845679	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	2122	4	121412	43				g.chr3:168845679C>T	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.219G>A	chr3.hg19:g.168845679C>T		0					MECOM_ENST00000472280.1_Silent_p.T73T|MECOM_ENST00000392736.3_Silent_p.T73T|MECOM_ENST00000460814.1_Silent_p.T73T|MECOM_ENST00000494292.1_Silent_p.T261T|MECOM_ENST00000433243.2_Silent_p.T73T|MECOM_ENST00000264674.3_Silent_p.T137T|MECOM_ENST00000468789.1_Silent_p.T73T	p.T73T	NM_001164000.1	NP_001157472.1	0	0	0	2.052927	Q13465	MDS1_HUMAN		4	1419	-			Q13466|Q6FH90	Silent	SNP	ENST00000464456.1	1	1	hg19	c.219G>A	CCDS54669.1	1																																																																																								0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.388	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	1	0	1	2	2	2	2	0	0	0	0	139	139	139	138	1	1.770000	-20.000000	1	0.570000	NM_005241, NM_004991		0	203	201	0	536	534	1		1	1		0	0	139	0	0	1.000000	1.855623e-01	0	2	0	1	0	203	536
FXR1	8087	broad.mit.edu	37	3	180675681	180675681	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:180675681G>C	ENST00000357559.4	+	10	1339	c.955G>C	c.(955-957)Gaa>Caa	p.E319Q	FXR1_ENST00000491062.1_Missense_Mutation_p.E270Q|FXR1_ENST00000305586.7_Missense_Mutation_p.E234Q|FXR1_ENST00000468861.1_Missense_Mutation_p.E234Q|FXR1_ENST00000445140.2_Missense_Mutation_p.E319Q|FXR1_ENST00000480918.1_Missense_Mutation_p.E306Q	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	319					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AGTGAGAATTGAAGGGGACAA	0.313																																						ENST00000357559.4	0.160000	3.000000e-02	1.200000e-01	5.000000e-02	0.080000	0.089589	0.080000	0.080000																										0				26						c.(955-957)Gaa>Caa		fragile X mental retardation, autosomal homolog 1							105.0	114.0	111.0					3																	180675681		2203	4300	6503	SO:0001583	missense	8087	0	0					g.chr3:180675681G>C	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.955G>C	chr3.hg19:g.180675681G>C	ENSP00000350170:p.Glu319Gln	0					FXR1_ENST00000445140.2_Missense_Mutation_p.E319Q|FXR1_ENST00000491062.1_Missense_Mutation_p.E270Q|FXR1_ENST00000480918.1_Missense_Mutation_p.E306Q|FXR1_ENST00000468861.1_Missense_Mutation_p.E234Q|FXR1_ENST00000305586.7_Missense_Mutation_p.E234Q	p.E319Q	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	0	0	0	2.052927	P51114	FXR1_HUMAN	Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)	10	1339	+	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	ENST00000357559.4	0	1	hg19	c.955G>C	CCDS3238.1	0	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985897	0.93044	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	5.44	5.44	0.79542	5.44	5.44	0.79542	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.84219	2.685	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.974;0.99;0.993	T	0.66372	-0.5940	10	0.87932	D	0	-16.7507	19.6264	0.95679	0.0:0.0:1.0:0.0	.	306;270;234;234;319;319	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	Q	319;234;270;234;319;306	ENSP00000350170:E319Q;ENSP00000307633:E234Q;ENSP00000420643:E270Q;ENSP00000420515:E234Q;ENSP00000388828:E319Q;ENSP00000418097:E306Q	ENSP00000307633:E234Q	E	+	1	0	0	FXR1	182158375	182158375	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.813000	0.99286	2.717000	0.92951	0.655000	0.94253	GAA	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.313	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5	0	0	1	2	2	2	2	0	0	0	0	50	50	50	49	1	1.770000	-2.860373	1	0.570000			0	7	6	0	291	285	0		1	0		0	0	50	0	0	0.979241	4.118954e-01	0	1	0	53	0	7	291
EIF4G1	1981	broad.mit.edu	37	3	184038482	184038482	+	Missense_Mutation	SNP	G	G	A	rs34838305	byFrequency	TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:184038482G>A	ENST00000346169.2	+	8	873	c.602G>A	c.(601-603)cGc>cAc	p.R201H	EIF4G1_ENST00000319274.6_Missense_Mutation_p.R201H|EIF4G1_ENST00000392537.2_Missense_Mutation_p.R114H|EIF4G1_ENST00000342981.4_Missense_Mutation_p.R201H|EIF4G1_ENST00000435046.2_Missense_Mutation_p.R5H|EIF4G1_ENST00000411531.1_Missense_Mutation_p.R161H|EIF4G1_ENST00000382330.3_Missense_Mutation_p.R208H|EIF4G1_ENST00000424196.1_Missense_Mutation_p.R208H|EIF4G1_ENST00000350481.5_Missense_Mutation_p.R37H|EIF4G1_ENST00000414031.1_Missense_Mutation_p.R161H|EIF4G1_ENST00000352767.3_Missense_Mutation_p.R208H|EIF4G1_ENST00000434061.2_Missense_Mutation_p.R5H|EIF4G1_ENST00000441154.1_Missense_Mutation_p.R37H|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000427845.1_Missense_Mutation_p.R114H	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	201					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGGGGCCCGCACTGCCTCC	0.547																																						ENST00000346169.2	0.110000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.063790	0.050000	0.060000																										0				75						c.(601-603)cGc>cAc		eukaryotic translation initiation factor 4 gamma, 1		G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	91.0	80.0	83.0		623,623,14,602,602,110,341	4.2	1.0	3	dbSNP_126	83	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense,missense,missense,missense,missense,missense	EIF4G1	NM_001194946.1,NM_001194947.1,NM_004953.4,NM_182917.4,NM_198241.2,NM_198242.2,NM_198244.2	29,29,29,29,29,29,29	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	208/1607,208/1607,5/1405,201/1601,201/1600,37/1436,114/1513	184038482	4,13002	2203	4300	6503	SO:0001583	missense	1981	21	121412	46				g.chr3:184038482G>A	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.602G>A	chr3.hg19:g.184038482G>A	ENSP00000316879:p.Arg201His	0					EIF4G1_ENST00000411531.1_Missense_Mutation_p.R161H|EIF4G1_ENST00000352767.3_Missense_Mutation_p.R208H|EIF4G1_ENST00000392537.2_Missense_Mutation_p.R114H|EIF4G1_ENST00000382330.3_Missense_Mutation_p.R208H|EIF4G1_ENST00000427845.1_Missense_Mutation_p.R114H|EIF4G1_ENST00000350481.5_Missense_Mutation_p.R37H|EIF4G1_ENST00000434061.2_Missense_Mutation_p.R5H|EIF4G1_ENST00000435046.2_Missense_Mutation_p.R5H|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000441154.1_Missense_Mutation_p.R37H|EIF4G1_ENST00000342981.4_Missense_Mutation_p.R201H|EIF4G1_ENST00000414031.1_Missense_Mutation_p.R161H|EIF4G1_ENST00000319274.6_Missense_Mutation_p.R201H|EIF4G1_ENST00000424196.1_Missense_Mutation_p.R208H	p.R201H	NM_198241.2	NP_937884	0	0	0	2.052927	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)	8	873	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	0	1	hg19	c.602G>A	CCDS3259.1	0	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213090	0.79352	0.0	4.65E-4	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000444134;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000456033;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000428387;ENST00000434061;ENST00000427607;ENST00000457456;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66460	1.11;1.11;1.11;0.19;1.11;1.11;1.11;1.11;3.39;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.95;3.37;0.07;3.31;-0.21;0.78;3.32	5.08	4.21	0.49690	5.08	4.21	0.49690	.	0.062143	0.64402	N	0.000015	T	0.53626	0.1808	L	0.32530	0.975	0.53688	D	0.999978	B;B;B;B	0.19073	0.033;0.033;0.033;0.033	B;B;B;B	0.15052	0.012;0.012;0.012;0.007	T	0.47749	-0.9093	10	0.20519	T	0.43	-3.7867	13.5567	0.61763	0.0749:0.0:0.9251:0.0	rs34838305	208;201;201;208	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	H	201;161;114;5;201;208;208;142;37;208;114;201;201;208;151;161;37;37;5;5;5;5;5	ENSP00000316879:R201H;ENSP00000391935:R161H;ENSP00000376320:R114H;ENSP00000407244:R5H;ENSP00000391412:R201H;ENSP00000413159:R208H;ENSP00000371767:R208H;ENSP00000403269:R142H;ENSP00000317600:R37H;ENSP00000338020:R208H;ENSP00000407682:R114H;ENSP00000343450:R201H;ENSP00000323737:R201H;ENSP00000416255:R208H;ENSP00000415943:R151H;ENSP00000395974:R161H;ENSP00000398145:R37H;ENSP00000399858:R37H;ENSP00000411707:R5H;ENSP00000411826:R5H;ENSP00000409545:R5H;ENSP00000399969:R5H;ENSP00000404754:R5H	ENSP00000323737:R201H	R	+	2	0	0	EIF4G1	185521176	185521176	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	7.439000	0.80444	1.377000	0.46286	0.655000	0.94253	CGC	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.547	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	0	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.770000	-2.552329	1	0.570000	NM_182917		0	6	6	0	361	353	0		1	0		0	0	74	0	0	0.962842	3.921854e-02	0	0	0	16	0	6	361
SCN5A	6331	broad.mit.edu	37	3	38592068	38592068	+	Missense_Mutation	SNP	G	G	A	rs371194826		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:38592068G>A	ENST00000333535.4	-	28	5944	c.5795C>T	c.(5794-5796)gCg>gTg	p.A1932V	SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Missense_Mutation_p.A1878V|SCN5A_ENST00000423572.2_Missense_Mutation_p.A1931V|SCN5A_ENST00000413689.1_Missense_Mutation_p.A1932V|SCN5A_ENST00000455624.2_Missense_Mutation_p.A1899V|SCN5A_ENST00000449557.2_Missense_Mutation_p.A1878V|SCN5A_ENST00000414099.2_Missense_Mutation_p.A1914V|SCN5A_ENST00000443581.1_Missense_Mutation_p.A1931V|SCN5A_ENST00000425664.1_Missense_Mutation_p.A1914V|SCN5A_ENST00000450102.2_Missense_Mutation_p.A1878V			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1932					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GCCGCTGCCCGCCTGCTGACG	0.622																																						ENST00000333535.4	0.500000	2.200000e-01	4.300000e-01	2.800000e-01	0.350000	0.364075	0.350000	0.350000																										0				107						c.(5794-5796)gCg>gTg		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	1,4127		0,1,2063	48.0	56.0	53.0		5792,5795,5741,5696,5633,5795	3.1	0.1	3		53	0,8370		0,0,4185	no	missense,missense,missense,missense,missense,missense	SCN5A	NM_000335.4,NM_001099404.1,NM_001099405.1,NM_001160160.1,NM_001160161.1,NM_198056.2	64,64,64,64,64,64	0,1,6248	AA,AG,GG		0.0,0.0242,0.0080	benign,benign,benign,benign,benign,benign	1931/2016,1932/2017,1914/1999,1899/1984,1878/1963,1932/2017	38592068	1,12497	2064	4185	6249	SO:0001583	missense	6331	8	121024	37				g.chr3:38592068G>A	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5795C>T	chr3.hg19:g.38592068G>A	ENSP00000328968:p.Ala1932Val	0					SCN5A_ENST00000450102.2_Missense_Mutation_p.A1878V|SCN5A_ENST00000451551.2_Missense_Mutation_p.A1878V|SCN5A_ENST00000413689.1_Missense_Mutation_p.A1932V|SCN5A_ENST00000423572.2_Missense_Mutation_p.A1931V|SCN5A_ENST00000455624.2_Missense_Mutation_p.A1899V|SCN5A_ENST00000443581.1_Missense_Mutation_p.A1931V|SCN5A_ENST00000425664.1_Missense_Mutation_p.A1914V|SCN5A_ENST00000449557.2_Missense_Mutation_p.A1878V|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000414099.2_Missense_Mutation_p.A1914V	p.A1932V			0	0	0	2.052927	Q14524	SCN5A_HUMAN		28	5944	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	1	1	hg19	c.5795C>T	CCDS46796.1	0	.	.	.	.	.	.	.	.	.	.	G	0.361	-0.939513	0.02322	2.42E-4	0.0	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.95949	-3.77;-3.8;-3.8;-3.81;-3.8;-3.77;-3.8;-3.86;-3.81;-3.81	4.86	3.08	0.35506	4.86	3.08	0.35506	.	0.586375	0.16484	N	0.212412	D	0.90157	0.6924	N	0.20685	0.6	0.09310	N	1	B;B;B;B;B;B	0.09022	0.0;0.001;0.0;0.001;0.002;0.001	B;B;B;B;B;B	0.12156	0.001;0.001;0.002;0.002;0.007;0.004	T	0.82226	-0.0562	10	0.52906	T	0.07	.	10.9373	0.47253	0.1517:0.0:0.8483:0.0	.	1878;1899;1914;1932;1931;1932	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	V	1914;1931;1932;1878;1931;1914;1932;1899;1878;1878	ENSP00000398962:A1914V;ENSP00000398266:A1931V;ENSP00000410257:A1932V;ENSP00000388797:A1878V;ENSP00000397915:A1931V;ENSP00000416634:A1914V;ENSP00000328968:A1932V;ENSP00000399524:A1899V;ENSP00000403355:A1878V;ENSP00000413996:A1878V	ENSP00000328968:A1932V	A	-	2	0	0	SCN5A	38567072	38567072	0.004000	0.15560	0.104000	0.21259	0.085000	0.17905	1.632000	0.37102	0.662000	0.31006	-0.218000	0.12543	GCG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.622	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.770000	-20.000000	1	0.570000	NM_198056		0	22	22	0	188	183	1		1			0	0	46	0	0	0.999999	0	0	0	0	0	0	22	188
FYCO1	79443	broad.mit.edu	37	3	45996750	45996750	+	Missense_Mutation	SNP	G	G	A	rs140583635		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:45996750G>A	ENST00000296137.2	-	14	4140	c.3935C>T	c.(3934-3936)gCg>gTg	p.A1312V	FYCO1_ENST00000535325.1_Missense_Mutation_p.A1312V|FYCO1_ENST00000438446.1_5'UTR	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1312					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CTGTTCAGCCGCATTTGGGTC	0.498																																						ENST00000296137.2	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.033735	0.020000	0.040000																										0				54						c.(3934-3936)gCg>gTg		FYVE and coiled-coil domain containing 1		G	VAL/ALA	0,4406		0,0,2203	176.0	181.0	179.0		3935	3.4	0.2	3	dbSNP_134	179	1,8599	1.2+/-3.3	0,1,4299	no	missense	FYCO1	NM_024513.2	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1312/1479	45996750	1,13005	2203	4300	6503	SO:0001583	missense	79443	4	121412	45				g.chr3:45996750G>A	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3935C>T	chr3.hg19:g.45996750G>A	ENSP00000296137:p.Ala1312Val	0					FYCO1_ENST00000535325.1_Missense_Mutation_p.A1312V|FYCO1_ENST00000438446.1_5'UTR	p.A1312V	NM_024513.3	NP_078789.2	0	0	0	2.052927	Q9BQS8	FYCO1_HUMAN		14	4140	-			B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	0	1	hg19	c.3935C>T	CCDS2734.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	0.144|0.144	-1.099395|-1.099395	0.01843|0.01843	0.0|0.0	1.16E-4|1.16E-4	ENSG00000163820|ENSG00000163820	ENST00000296137;ENST00000535325|ENST00000433878	T;T|.	0.20598|.	2.06;2.13|.	5.82|5.82	3.37|3.37	0.38596|0.38596	5.82|5.82	3.37|3.37	0.38596|0.38596	.|.	1.153750|.	0.06193|.	N|.	0.681750|.	T|T	0.08088|0.08088	0.0202|0.0202	N|N	0.00436|0.00436	-1.5|-1.5	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.32955|0.32955	-0.9887|-0.9887	10|5	0.02654|.	T|.	1|.	-2.141|-2.141	9.5319|9.5319	0.39198|0.39198	0.8598:0.0:0.1402:0.0|0.8598:0.0:0.1402:0.0	.|.	1312;1312|.	B7ZKT7;Q9BQS8|.	.;FYCO1_HUMAN|.	V|W	1312|101	ENSP00000296137:A1312V;ENSP00000441178:A1312V|.	ENSP00000296137:A1312V|.	A|R	-|-	2|1	0|2	0|2	FYCO1|FYCO1	45971754|45971754	45971754|45971754	0.324000|0.324000	0.24652|0.24652	0.162000|0.162000	0.22713|0.22713	0.435000|0.435000	0.31806|0.31806	1.668000|1.668000	0.37481|0.37481	0.435000|0.435000	0.26365|0.26365	-0.285000|-0.285000	0.09966|0.09966	GCG|CGG	0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.498	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	0	0	1	2	2	2	2	0	0	0	0	154	154	154	152	1	1.770000	-1.630981	0	0.570000	NM_024513		0	7	7	0	780	764	0		1	0		0	0	154	0	0	0.979168	4.860049e-03	0	0	0	10	0	7	780
NISCH	11188	broad.mit.edu	37	3	52523640	52523640	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:52523640C>T	ENST00000479054.1	+	18	3474	c.3402C>T	c.(3400-3402)gtC>gtT	p.V1134V	NISCH_ENST00000345716.4_Silent_p.V1134V			Q9Y2I1	NISCH_HUMAN	nischarin	1134					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TCCGGCACGTCGCCAGCCTGC	0.672																																						ENST00000479054.1	0.550000	3.500000e-01	5.000000e-01	3.900000e-01	0.440000	0.455748	0.440000	0.450000																										0				33						c.(3400-3402)gtC>gtT		nischarin	Tizanidine(DB00697)						52.0	56.0	55.0					3																	52523640		2203	4298	6501	SO:0001819	synonymous_variant	11188	7	121276	40				g.chr3:52523640C>T	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.3402C>T	chr3.hg19:g.52523640C>T		0					NISCH_ENST00000345716.4_Silent_p.V1134V	p.V1134V			0	0	0	2.052927	Q9Y2I1	NISCH_HUMAN		18	3474	+			C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	ENST00000479054.1	1	1	hg19	c.3402C>T	CCDS33767.1	0																																																																																								0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.672	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	1	0	1	2	2	2	2	0	0	0	0	141	141	141	140	1	1.770000	-3.221905	1	0.570000	NM_007184		0	70	68	0	452	445	1		1	1		0	0	141	0	0	1.000000	9.980640e-01	0	11	0	51	0	70	452
NSUN3	63899	broad.mit.edu	37	3	93783283	93783283	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:93783283G>A	ENST00000314622.4	+	2	226	c.15G>A	c.(13-15)ctG>ctA	p.L5L	DHFRL1_ENST00000314636.2_5'Flank|DHFRL1_ENST00000481631.1_5'Flank|NSUN3_ENST00000485793.1_3'UTR|DHFRL1_ENST00000394221.2_5'Flank	NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	5							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						CGTCATAGCTGAAAGCAAAAT	0.353																																						ENST00000314622.4	0.240000	5.000000e-02	1.800000e-01	8.000000e-02	0.120000	0.137628	0.120000	0.120000																										0				18						c.(13-15)ctG>ctA		NOP2/Sun domain family, member 3							73.0	75.0	75.0					3																	93783283		2203	4300	6503	SO:0001819	synonymous_variant	63899	0	0					g.chr3:93783283G>A	BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.15G>A	chr3.hg19:g.93783283G>A		0					DHFRL1_ENST00000481631.1_5'Flank|DHFRL1_ENST00000314636.2_5'Flank|DHFRL1_ENST00000394221.2_5'Flank|NSUN3_ENST00000485793.1_3'UTR	p.L5L	NM_022072.3	NP_071355.1	0	0	0	2.052927	Q9H649	NSUN3_HUMAN		2	226	+			Q6PG41|Q8IXG9|Q9H6M2	Silent	SNP	ENST00000314622.4	1	1	hg19	c.15G>A	CCDS2927.1	0																																																																																								0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.353	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352934.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.770000	-9.031901	1	0.570000	NM_022072		0	7	7	0	186	185	0		1	0		0	0	24	0	0	0.980841	6.486699e-02	0	1	0	9	0	7	186
SENP5	205564	broad.mit.edu	37	3	196612958	196612958	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr3:196612958G>A	ENST00000323460.5	+	2	1155	c.906G>A	c.(904-906)cgG>cgA	p.R302R	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_Silent_p.R302R	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	302					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CTTCTTGTCGGCATCAGCCGT	0.532																																					Ovarian(47;891 1095 11174 13858 51271)	ENST00000323460.5	0.080000	0	6.000000e-02	1.000000e-02	0.030000	0.042447	0.030000	0.040000																										0				32						c.(904-906)cgG>cgA		SUMO1/sentrin specific peptidase 5							89.0	85.0	86.0					3																	196612958		2203	4300	6503	SO:0001819	synonymous_variant	205564	0	0					g.chr3:196612958G>A	BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.906G>A	chr3.hg19:g.196612958G>A		0					SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_Silent_p.R302R	p.R302R	NM_152699.4	NP_689912.2	0	0	0	2.052927	Q96HI0	SENP5_HUMAN	Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	2	1155	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		B4DY82|Q96SA5	Silent	SNP	ENST00000323460.5	0	1	hg19	c.906G>A	CCDS3322.1	0																																																																																								0.552130		TCGA-OE-A75W-01A-12D-A32N-08	0.532	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	0	0	1	2	19	2	2	0	0	0	1	79	79	79	78	1	1.770000	-2.383246	0	0.570000	NM_152699		0	5	6	0	466	460	0		0	0		0	0	79	0	0	0.002708	1.873311e-04	0	0	0	2	0	5	466
ZNF330	27309	broad.mit.edu	37	4	142150724	142150724	+	Splice_Site	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:142150724G>T	ENST00000262990.4	+	6	519		c.e6-1		ZNF330_ENST00000421169.2_Splice_Site	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330							chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					CTTGGTTACAGGGTGCAATAT	0.428																																						ENST00000262990.4	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.026992	0.020000	0.020000																										0				14						c.e6-1		zinc finger protein 330							364.0	311.0	329.0					4																	142150724		2203	4300	6503	SO:0001630	splice_region_variant	27309	0	0					g.chr4:142150724G>T	AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.292-1G>T	chr4.hg19:g.142150724G>T		1					ZNF330_ENST00000421169.2_Splice_Site		NM_014487.4	NP_055302.1	0	1	1	1.635240	Q9Y3S2	ZN330_HUMAN		6	519	+	all_hematologic(180;0.162)		B2RDA3	Splice_Site	SNP	ENST00000262990.4	0	1	hg19		CCDS3754.1	0	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778159	0.70107	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000503649;ENST00000512738;ENST00000421169	.	.	.	5.93	5.93	0.95920	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3437	0.98782	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ZNF330	142370174	142370174	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	9.864000	0.99589	2.802000	0.96397	0.563000	0.77884	.	0.410353		TCGA-OE-A75W-01A-12D-A32N-08	0.428	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257271.2	0	0	1	2	2	2	2	0	0	0	0	180	180	180	179	1	1.770000	-1.838574	0	0.570000	NM_014487	Intron	0	7	7	0	749	730	0		1			0	0	180	0	0	0.978809	0	0	0	0	0	0	7	749
FBXL5	26234	broad.mit.edu	37	4	15629518	15629518	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:15629518G>C	ENST00000341285.3	-	7	1155	c.1031C>G	c.(1030-1032)tCc>tGc	p.S344C	FBXL5_ENST00000412094.2_Missense_Mutation_p.S327C|FBXL5_ENST00000382358.4_Missense_Mutation_p.S218C	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	344					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						CATTTTGCTGGAAACTGCAGA	0.338																																						ENST00000341285.3	0.200000	2.000000e-02	1.400000e-01	5.000000e-02	0.080000	0.105636	0.080000	0.080000																										0				13						c.(1030-1032)tCc>tGc		F-box and leucine-rich repeat protein 5							83.0	80.0	81.0					4																	15629518		2202	4300	6502	SO:0001583	missense	26234	0	0					g.chr4:15629518G>C	AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.1031C>G	chr4.hg19:g.15629518G>C	ENSP00000344866:p.Ser344Cys	0					FBXL5_ENST00000412094.2_Missense_Mutation_p.S327C|FBXL5_ENST00000382358.4_Missense_Mutation_p.S218C	p.S344C	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	1	2	3	2.166255	Q9UKA1	FBXL5_HUMAN		7	1155	-			A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	ENST00000341285.3	0	1	hg19	c.1031C>G	CCDS3415.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.92|16.92	3.256719|3.256719	0.59321|0.59321	.|.	.|.	ENSG00000118564|ENSG00000118564	ENST00000513163|ENST00000341285;ENST00000412094;ENST00000382358	.|T;T;T	.|0.20598	.|2.06;2.06;2.06	5.47|5.47	5.47|5.47	0.80525|0.80525	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.103499	.|0.64402	.|D	.|0.000002	T|T	0.28466|0.28466	0.0704|0.0704	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	.|B;B	.|0.12630	.|0.006;0.003	.|B;B	.|0.13407	.|0.009;0.004	T|T	0.05194|0.05194	-1.0900|-1.0900	5|10	.|0.87932	.|D	.|0	-9.4228|-9.4228	17.5156|17.5156	0.87772|0.87772	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|327;344	.|Q9UKA1-2;Q9UKA1	.|.;FBXL5_HUMAN	L|C	264|344;327;218	.|ENSP00000344866:S344C;ENSP00000408679:S327C;ENSP00000371795:S218C	.|ENSP00000344866:S344C	F|S	-|-	3|2	2|0	2|0	FBXL5|FBXL5	15238616|15238616	15238616|15238616	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	8.856000|8.856000	0.92245|0.92245	2.570000|2.570000	0.86706|0.86706	0.460000|0.460000	0.39030|0.39030	TTC|TCC	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.338	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214235.2	0	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	1.770000	-6.545644	1	0.570000			0	5	5	0	211	211	0		1	0		0	0	38	0	0	0.938267	3.267467e-02	0	0	0	10	0	5	211
MND1	84057	broad.mit.edu	37	4	154318479	154318479	+	Nonsense_Mutation	SNP	G	G	T	rs201358684		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:154318479G>T	ENST00000504860.1	+	5	458	c.415G>T	c.(415-417)Gaa>Taa	p.E139*	MND1_ENST00000240488.3_Nonsense_Mutation_p.E154*					meiotic nuclear divisions 1 homolog (S. cerevisiae)											large_intestine(2)|lung(1)	3	all_hematologic(180;0.093)					AGTTGTGGAAGAAATACGTAA	0.373																																						ENST00000504860.1	0.740000	2.600000e-01	6.100000e-01	3.600000e-01	0.470000	0.491266	0.470000	0.470000																										0				3						c.(415-417)Gaa>Taa		meiotic nuclear divisions 1 homolog (S. cerevisiae)							84.0	79.0	81.0					4																	154318479		2203	4300	6503	SO:0001587	stop_gained	84057	0	0					g.chr4:154318479G>T	AY028916	CCDS3782.1, CCDS75202.1	4q31.3	2008-02-05			ENSG00000121211	ENSG00000121211			24839	protein-coding gene	gene with protein product		611422				11940665	Standard	NM_032117		Approved	GAJ	uc003ink.2	Q9BWT6	OTTHUMG00000161523	ENST00000504860.1:c.415G>T	chr4.hg19:g.154318479G>T	ENSP00000422933:p.Glu139*	1					MND1_ENST00000240488.3_Nonsense_Mutation_p.E154*	p.E139*			0	1	1	1.635240				5	458	+	all_hematologic(180;0.093)			Nonsense_Mutation	SNP	ENST00000504860.1	0	1	hg19	c.415G>T		0	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673305	0.67928	.	.	ENSG00000121211	ENST00000240488;ENST00000504860	.	.	.	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.090339	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-33.0793	16.5451	0.84443	0.0:0.0:1.0:0.0	.	.	.	.	X	154;139	.	ENSP00000240488:E154X	E	+	1	0	0	MND1	154537929	154537929	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	6.502000	0.73695	2.690000	0.91761	0.555000	0.69702	GAA	0.410353		TCGA-OE-A75W-01A-12D-A32N-08	0.373	MND1-002	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365195.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.770000	-19.951880	1	0.570000	NM_032117		0	11	11	0	48	48	0		1	1		0	0	16	0	0	0.998868	9.424177e-01	0	5	0	20	0	11	48
DGKQ	1609	broad.mit.edu	37	4	954958	954958	+	Missense_Mutation	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:954958A>G	ENST00000273814.3	-	22	2679	c.2606T>C	c.(2605-2607)aTc>aCc	p.I869T	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	869					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGCAATCCGGATTCCGGAGCG	0.726																																					Esophageal Squamous(17;537 645 4447 26373)	ENST00000273814.3	0.880000	4.600000e-01	7.600000e-01	5.500000e-01	0.640000	0.659005	0.640000	0.650000																										0				9						c.(2605-2607)aTc>aCc		diacylglycerol kinase, theta 110kDa							27.0	34.0	31.0					4																	954958		2193	4298	6491	SO:0001583	missense	1609	0	0					g.chr4:954958A>G	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2606T>C	chr4.hg19:g.954958A>G	ENSP00000273814:p.Ile869Thr	0					DGKQ_ENST00000502309.1_5'Flank	p.I869T	NM_001347.3	NP_001338.2	1	2	3	2.166255	P52824	DGKQ_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)	22	2679	-			Q6P3W4	Missense_Mutation	SNP	ENST00000273814.3	1	1	hg19	c.2606T>C	CCDS3342.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.63|17.63	3.437655|3.437655	0.62955|0.62955	.|.	.|.	ENSG00000145214|ENSG00000145214	ENST00000273814;ENST00000515182|ENST00000509465	T;T|.	0.47177|.	0.85;0.85|.	5.29|5.29	5.29|5.29	0.74685|0.74685	5.29|5.29	5.29|5.29	0.74685|0.74685	Diacylglycerol kinase, accessory domain (2);|.	0.049071|.	0.85682|.	D|.	0.000000|.	T|T	0.57681|0.57681	0.2070|0.2070	L|L	0.39633|0.39633	1.23|1.23	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	0.996;1.0|.	D;D|.	0.77557|.	0.967;0.99|.	T|T	0.55062|0.55062	-0.8199|-0.8199	10|5	0.44086|.	T|.	0.13|.	.|.	13.1628|13.1628	0.59554|0.59554	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	869;869|.	E9KL49;P52824|.	.;DGKQ_HUMAN|.	T|P	869;84|803	ENSP00000273814:I869T;ENSP00000421756:I84T|.	ENSP00000273814:I869T|.	I|S	-|-	2|1	0|0	0|0	DGKQ|DGKQ	944958|944958	944958|944958	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.825000|0.825000	0.46686|0.46686	5.430000|5.430000	0.66501|0.66501	2.008000|2.008000	0.58898|0.58898	0.454000|0.454000	0.30748|0.30748	ATC|TCC	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.726	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	1.770000	-20.000000	1	0.570000			0	35	34	0	156	155	0		1	1		0	0	39	0	0	1.000000	8.806734e-01	0	4	0	15	0	35	156
HGFAC	3083	broad.mit.edu	37	4	3445871	3445871	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:3445871G>A	ENST00000382774.3	+	5	696	c.581G>A	c.(580-582)gGc>gAc	p.G194D	HGFAC_ENST00000511533.1_Missense_Mutation_p.G194D	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	194	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCCTTCACCGGCAAGGACTGC	0.687																																						ENST00000382774.3	0.360000	5.000000e-02	2.500000e-01	1.000000e-01	0.160000	0.183408	0.160000	0.150000																										0				22						c.(580-582)gGc>gAc		HGF activator							13.0	15.0	15.0					4																	3445871		2191	4294	6485	SO:0001583	missense	3083	0	0					g.chr4:3445871G>A	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.581G>A	chr4.hg19:g.3445871G>A	ENSP00000372224:p.Gly194Asp	0					HGFAC_ENST00000511533.1_Missense_Mutation_p.G194D	p.G194D	NM_001528.2	NP_001519.1	1	2	3	2.166255	Q04756	HGFA_HUMAN		5	696	+			Q14726|Q2M1W7|Q53X47	Missense_Mutation	SNP	ENST00000382774.3	0	1	hg19	c.581G>A	CCDS3369.1	0	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169872	0.38315	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	D;D	0.99105	-5.43;-5.43	3.94	3.94	0.45596	3.94	3.94	0.45596	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	M	0.90650	3.135	0.45239	D	0.998246	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98698	1.0699	10	0.87932	D	0	.	13.5073	0.61491	0.0:0.0:1.0:0.0	.	194;194	D6RAR4;Q04756	.;HGFA_HUMAN	D	194	ENSP00000372224:G194D;ENSP00000421801:G194D	ENSP00000372224:G194D	G	+	2	0	0	HGFAC	3415669	3415669	0.004000	0.15560	0.189000	0.23252	0.168000	0.22595	0.771000	0.26633	2.023000	0.59567	0.313000	0.20887	GGC	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.687	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3	0	0	0	2	2	2	2	0	0	0	0	32	32	32	32	1	1.770000	-8.403799	1	0.570000			0	5	3	0	113	113	0		1			0	0	32	0	0	0.934659	0	0	0	0	0	0	5	113
FRAS1	80144	broad.mit.edu	37	4	79417989	79417989	+	Missense_Mutation	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:79417989G>T	ENST00000264895.6	+	60	9429	c.8989G>T	c.(8989-8991)Gac>Tac	p.D2997Y		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2993	Calx-beta 4.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TATCCACGATGACTCCATGTT	0.448																																						ENST00000264895.6	1.000000	3.000000e-02	1	4.000000e-02	0.070000	0.225336	0.070000	0.080000																										0				103						c.(8989-8991)Gac>Tac		Fraser extracellular matrix complex subunit 1							192.0	187.0	188.0					4																	79417989		1947	4158	6105	SO:0001583	missense	80144	0	0					g.chr4:79417989G>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.8989G>T	chr4.hg19:g.79417989G>T	ENSP00000264895:p.Asp2997Tyr	1						p.D2997Y	NM_025074.6	NP_079350.5	1	2	3	2.648177	Q86XX4	FRAS1_HUMAN		60	9429	+			A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	0	1	hg19	c.8989G>T	CCDS54771.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.113120|4.113120	0.77210|0.77210	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.57107|.	0.42|.	5.38|5.38	5.38|5.38	0.77491|0.77491	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86661|.	0.5986|.	M|M	0.92268|0.92268	3.29|3.29	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|.	0.89622|.	0.3849|.	10|.	0.87932|.	D|.	0|.	.|.	19.1434|19.1434	0.93455|0.93455	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2997|.	E9PHH6|.	.|.	Y|L	2997|1225	ENSP00000264895:D2997Y|.	ENSP00000264895:D2997Y|.	D|X	+|+	1|2	0|2	0|2	FRAS1|FRAS1	79637013|79637013	79637013|79637013	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.580000|0.580000	0.36256|0.36256	9.594000|9.594000	0.98254|0.98254	2.497000|2.497000	0.84241|0.84241	0.655000|0.655000	0.94253|0.94253	GAC|TGA	0.648204		TCGA-OE-A75W-01A-12D-A32N-08	0.448	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	106	106	106	105	1	1.770000	-2.645963	1	0.570000			0	13	13	0	793	785	0		1	0		0	0	106	0	0	0.999500	1.570166e-02	0	0	0	11	0	13	793
FSTL5	56884	broad.mit.edu	37	4	162307378	162307378	+	Missense_Mutation	SNP	A	A	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr4:162307378A>T	ENST00000306100.5	-	16	2501	c.2065T>A	c.(2065-2067)Ttc>Atc	p.F689I	FSTL5_ENST00000536695.1_Missense_Mutation_p.F688I|FSTL5_ENST00000379164.4_Missense_Mutation_p.F688I|FSTL5_ENST00000427802.2_Missense_Mutation_p.F679I|RP11-234O6.2_ENST00000508189.1_RNA	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	689						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TCACTATTGAACCCAATGACT	0.488																																						ENST00000306100.5	1.000000	7.100000e-01	9.500000e-01	7.800000e-01	0.860000	0.869617	0.860000	1.000000																										0				91						c.(2065-2067)Ttc>Atc		follistatin-like 5							132.0	120.0	124.0					4																	162307378		2203	4300	6503	SO:0001583	missense	56884	0	0					g.chr4:162307378A>T	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2065T>A	chr4.hg19:g.162307378A>T	ENSP00000305334:p.Phe689Ile	1					RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000379164.4_Missense_Mutation_p.F688I|FSTL5_ENST00000536695.1_Missense_Mutation_p.F688I|FSTL5_ENST00000427802.2_Missense_Mutation_p.F679I	p.F689I	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	0	1	1	1.635240	Q8N475	FSTL5_HUMAN		16	2501	-	all_hematologic(180;0.24)		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	1	1	hg19	c.2065T>A	CCDS3802.1	1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.422309	0.43020	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.71817	-0.58;-0.56;-0.6;-0.56	5.55	4.38	0.52667	5.55	4.38	0.52667	WD40/YVTN repeat-like-containing domain (1);	0.397737	0.31134	N	0.008186	T	0.48484	0.1502	N	0.08118	0	0.28959	N	0.889968	B;B;B	0.17268	0.021;0.007;0.01	B;B;B	0.20184	0.028;0.007;0.019	T	0.38112	-0.9676	10	0.22706	T	0.39	.	10.4916	0.44754	0.9243:0.0:0.0757:0.0	.	679;688;689	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	I	689;688;679;688	ENSP00000305334:F689I;ENSP00000368462:F688I;ENSP00000389270:F679I;ENSP00000440409:F688I	ENSP00000305334:F689I	F	-	1	0	0	FSTL5	162526828	162526828	1.000000	0.71417	0.663000	0.29738	0.888000	0.51559	3.708000	0.54845	0.952000	0.37798	0.533000	0.62120	TTC	0.410353		TCGA-OE-A75W-01A-12D-A32N-08	0.488	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.770000	-20.000000	1	0.570000	NM_020116		0	76	76	0	146	144	1		1			0	0	53	0	0	1.000000	0	0	0	0	0	0	76	146
FAM170A	340069	broad.mit.edu	37	5	118965470	118965470	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:118965470C>T	ENST00000515256.1	+	1	179	c.7C>T	c.(7-9)Cga>Tga	p.R3*				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	3					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						TATCATGAAACGACGACAAAA	0.458																																						ENST00000515256.1	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.036150	0.030000	0.040000																										0				24						c.(7-9)Cga>Tga		family with sequence similarity 170, member A							166.0	163.0	164.0					5																	118965470		1868	4114	5982	SO:0001587	stop_gained	340069	0	0					g.chr5:118965470C>T	AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.7C>T	chr5.hg19:g.118965470C>T	ENSP00000422684:p.Arg3*	0						p.R3*			0	1	1	2.009754	A1A519	F170A_HUMAN		1	179	+			Q66LM8|Q7Z4V2|Q8IW94	Nonsense_Mutation	SNP	ENST00000515256.1	0	1	hg19	c.7C>T		0	.	.	.	.	.	.	.	.	.	.	C	36	5.799191	0.96960	.	.	ENSG00000164334	ENST00000296787;ENST00000515256;ENST00000509264	.	.	.	4.24	3.36	0.38483	4.24	3.36	0.38483	.	0.000000	0.42172	D	0.000747	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.6887	9.5633	0.39383	0.2093:0.7907:0.0:0.0	.	.	.	.	X	3	.	.	R	+	1	2	2	FAM170A	118993369	118993369	0.821000	0.29204	0.659000	0.29680	0.781000	0.44180	1.696000	0.37773	1.368000	0.46115	0.561000	0.74099	CGA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.458	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371126.1	0	0	1	2	16	2	2	1	1	1	1	165	165	165	165	1	1.770000	-2.715705	1	0.570000	NM_182761		0	7	10	0	716	703	0		0			1	0	165	0	0	0.041855	0	0	0	0	0	0	7	716
KIF20A	10112	broad.mit.edu	37	5	137518869	137518869	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:137518869C>T	ENST00000394894.3	+	8	1070	c.844C>T	c.(844-846)Cga>Tga	p.R282*	KIF20A_ENST00000508792.1_Nonsense_Mutation_p.R264*	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	282	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AACAAGTCATCGATGGGCACA	0.498																																						ENST00000394894.3	0.940000	6.200000e-01	8.600000e-01	6.900000e-01	0.770000	0.783264	0.770000	0.780000																										0				27						c.(844-846)Cga>Tga		kinesin family member 20A							59.0	57.0	57.0					5																	137518869		2203	4300	6503	SO:0001587	stop_gained	10112	1	121412	33				g.chr5:137518869C>T	AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.844C>T	chr5.hg19:g.137518869C>T	ENSP00000378356:p.Arg282*	0					KIF20A_ENST00000508792.1_Nonsense_Mutation_p.R264*	p.R282*	NM_005733.2	NP_005724.1	0	1	1	2.009754	O95235	KI20A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)	8	1070	+			B4DL79|D3DQB6	Nonsense_Mutation	SNP	ENST00000394894.3	0	1	hg19	c.844C>T	CCDS4199.1	0	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306221	0.60305	.	.	ENSG00000112984	ENST00000394894;ENST00000508792	.	.	.	4.88	2.9	0.33743	4.88	2.9	0.33743	.	0.709223	0.11400	N	0.567885	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	0.0424	8.3654	0.32382	0.137:0.7029:0.0:0.1601	.	.	.	.	X	282;264	.	ENSP00000378356:R282X	R	+	1	2	2	KIF20A	137546768	137546768	0.005000	0.15991	0.518000	0.27811	0.964000	0.63967	1.560000	0.36331	1.264000	0.44198	0.655000	0.94253	CGA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.498	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251272.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	1.770000	-20.000000	1	0.570000	NM_005733		0	69	69	0	222	221	1		1	0		0	0	54	0	0	1.000000	0	0	0	0	1	0	69	222
PCDHA13	56136	broad.mit.edu	37	5	140263655	140263655	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:140263655C>T	ENST00000289272.2	+	1	1802	c.1802C>T	c.(1801-1803)tCg>tTg	p.S601L	PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.S601L|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	601	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCCGATTCGGGCTACAAT	0.697																																					Melanoma(147;1739 1852 5500 27947 37288)	ENST00000289272.2	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.034162	0.020000	0.030000																										0				95						c.(1801-1803)tCg>tTg		protocadherin alpha 13							68.0	73.0	71.0					5																	140263655		2202	4298	6500	SO:0001583	missense	56136	0	0					g.chr5:140263655C>T	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1802C>T	chr5.hg19:g.140263655C>T	ENSP00000289272:p.Ser601Leu	0					PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.S601L|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron	p.S601L	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	0	1	1	2.009754	Q9Y5I0	PCDAD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1802	+			O75277	Missense_Mutation	SNP	ENST00000289272.2	0	1	hg19	c.1802C>T	CCDS4240.1	0	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230086	0.58777	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.49432	0.78;0.78	4.21	4.21	0.49690	4.21	4.21	0.49690	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.71643	0.3364	M	0.84773	2.715	0.38022	D	0.934879	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.78314	0.966;0.991;0.99	T	0.80863	-0.1192	9	0.87932	D	0	.	16.3687	0.83346	0.0:1.0:0.0:0.0	.	601;601;601	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	601	ENSP00000386821:S601L;ENSP00000289272:S601L	ENSP00000289272:S601L	S	+	2	0	0	PCDHA13	140243839	140243839	0.000000	0.05858	0.966000	0.40874	0.123000	0.20343	0.579000	0.23788	2.144000	0.66660	0.655000	0.94253	TCG	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.697	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	0	0	1	2	2	2	2	0	0	0	0	158	158	158	156	1	1.770000	-2.591305	1	0.570000	NM_018904		0	6	7	0	658	652	0		1			0	0	158	0	0	0.964261	0	0	0	0	0	0	6	658
PCDHB6	56130	broad.mit.edu	37	5	140531689	140531689	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:140531689G>A	ENST00000231136.1	+	1	1851	c.1851G>A	c.(1849-1851)gcG>gcA	p.A617A	PCDHB6_ENST00000543635.1_Silent_p.A481A	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	617	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGTGTGGGCGCACAATGGCG	0.672																																						ENST00000231136.1	0.100000	1.000000e-02	8.000000e-02	2.000000e-02	0.040000	0.055732	0.040000	0.050000																										0				84						c.(1849-1851)gcG>gcA		protocadherin beta 6							23.0	26.0	25.0					5																	140531689		2038	4048	6086	SO:0001819	synonymous_variant	56130	0	0					g.chr5:140531689G>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1851G>A	chr5.hg19:g.140531689G>A		0					PCDHB6_ENST00000543635.1_Silent_p.A481A	p.A617A	NM_018939.2	NP_061762.1	0	1	1	2.009754	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1851	+			B2R8R9	Silent	SNP	ENST00000231136.1	0	1	hg19	c.1851G>A	CCDS4248.1	0																																																																																								0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.672	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	0	0	1	2	2	2	2	0	0	0	0	97	97	97	141	1	1.770000	-2.722834	1	0.570000	NM_018939		0	5	5	0	346	288	0		1			0	0	97	0	0	0.902817	0	0	0	0	0	0	5	346
PCDHB8	56128	broad.mit.edu	37	5	140558339	140558339	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:140558339G>A	ENST00000239444.2	+	1	969	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	242	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAATGCCCCTGAATTTGAGCA	0.502																																						ENST00000239444.2	0.530000	4.000000e-01	5.000000e-01	4.300000e-01	0.460000	0.472024	0.460000	0.470000																										0				83						c.(724-726)Gaa>Aaa		protocadherin beta 8							204.0	262.0	243.0					5																	140558339		2203	4300	6503	SO:0001583	missense	56128	0	0					g.chr5:140558339G>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.724G>A	chr5.hg19:g.140558339G>A	ENSP00000239444:p.Glu242Lys	0					PCDHB16_ENST00000361016.2_5'Flank	p.E242K	NM_019120.3	NP_061993.2	0	1	1	2.009754	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	969	+			B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	1	1	hg19	c.724G>A	CCDS4250.1	0	.	.	.	.	.	.	.	.	.	.	g	12.50	1.957802	0.34565	.	.	ENSG00000120322	ENST00000239444	T	0.61510	0.1	4.25	1.37	0.22104	4.25	1.37	0.22104	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.36054	0.0953	N	0.16266	0.395	0.23126	N	0.998252	B	0.26876	0.162	B	0.27608	0.081	T	0.21211	-1.0252	9	0.25106	T	0.35	.	5.6828	0.17786	0.26:0.1488:0.5912:0.0	.	242	Q9UN66	PCDB8_HUMAN	K	242	ENSP00000239444:E242K	ENSP00000239444:E242K	E	+	1	0	0	PCDHB8	140538523	140538523	0.000000	0.05858	0.995000	0.50966	0.983000	0.72400	0.137000	0.15995	-0.038000	0.13624	0.585000	0.79938	GAA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.502	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	1	0	1	2	2	2	2	0	0	0	0	282	282	282	282	1	1.770000	-20.000000	1	0.570000	NM_019120		0	218	217	0	1305	1291	1		1		0	0	0	282	0	0	1.000000	0	0	0	0	0	1	218	1305
CLINT1	9685	broad.mit.edu	37	5	157232960	157232960	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:157232960C>G	ENST00000411809.2	-	7	1060	c.856G>C	c.(856-858)Gat>Cat	p.D286H	CLINT1_ENST00000296951.5_Missense_Mutation_p.D268H|CLINT1_ENST00000523908.1_Missense_Mutation_p.D286H|CLINT1_ENST00000530742.1_Missense_Mutation_p.D268H|CLINT1_ENST00000523094.1_Missense_Mutation_p.D268H	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	286					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTCCAAGATCAATGGTTTTG	0.483																																					Colon(22;427 587 2170 6147 14291)	ENST00000411809.2	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.079046	0.070000	0.070000																										0				21						c.(856-858)Gat>Cat		clathrin interactor 1							273.0	274.0	274.0					5																	157232960		2139	4239	6378	SO:0001583	missense	9685	0	0					g.chr5:157232960C>G	AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.856G>C	chr5.hg19:g.157232960C>G	ENSP00000388340:p.Asp286His	0					CLINT1_ENST00000523908.1_Missense_Mutation_p.D286H|CLINT1_ENST00000523094.1_Missense_Mutation_p.D268H|CLINT1_ENST00000530742.1_Missense_Mutation_p.D268H|CLINT1_ENST00000296951.5_Missense_Mutation_p.D268H	p.D286H	NM_014666.3	NP_055481.1	0	1	1	2.009754	Q14677	EPN4_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	7	1060	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	ENST00000411809.2	0	1	hg19	c.856G>C	CCDS47330.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.742679|4.742679	0.89573|0.89573	.|.	.|.	ENSG00000113282|ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908|ENST00000521615	T;T;T;T;T|.	0.61040|.	0.14;0.14;0.25;0.14;0.22|.	5.63|5.63	5.63|5.63	0.86233|0.86233	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.75591|.	0.3870|.	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|.	0.73238|.	-0.4046|.	10|.	0.72032|.	D|.	0.01|.	-18.413|-18.413	19.6818|19.6818	0.95967|0.95967	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	286;286|.	B7Z6F8;Q14677|.	.;EPN4_HUMAN|.	H|S	268;268;286;268;286|2	ENSP00000429345:D268H;ENSP00000433419:D268H;ENSP00000388340:D286H;ENSP00000296951:D268H;ENSP00000429824:D286H|.	ENSP00000296951:D268H|.	D|X	-|-	1|2	0|2	0|2	CLINT1|CLINT1	157165538|157165538	157165538|157165538	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.786000|7.786000	0.85741|0.85741	2.656000|2.656000	0.90262|0.90262	0.557000|0.557000	0.71058|0.71058	GAT|TGA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.483	CLINT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374001.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	68	1	1.770000	-3.075884	1	0.570000	NM_014666		0	7	7	0	323	313	0		1	0		0	0	70	0	0	0.978667	2.500796e-02	0	1	0	9	0	7	323
SLIT3	6586	broad.mit.edu	37	5	168175367	168175367	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:168175367C>T	ENST00000519560.1	-	20	2629	c.2210G>A	c.(2209-2211)cGa>cAa	p.R737Q	SLIT3_ENST00000404867.3_Missense_Mutation_p.R737Q|SLIT3_ENST00000332966.8_Missense_Mutation_p.R737Q	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	737	LRRNT 4.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTTGCTGCATCGCACCACTGT	0.642																																					Ovarian(29;311 847 10864 17279 24903)	ENST00000519560.1	0.100000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.054862	0.040000	0.050000																										0				100						c.(2209-2211)cGa>cAa		slit homolog 3 (Drosophila)							72.0	71.0	71.0					5																	168175367		2203	4300	6503	SO:0001583	missense	6586	0	0					g.chr5:168175367C>T	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2210G>A	chr5.hg19:g.168175367C>T	ENSP00000430333:p.Arg737Gln	0					SLIT3_ENST00000404867.3_Missense_Mutation_p.R737Q|SLIT3_ENST00000332966.8_Missense_Mutation_p.R737Q	p.R737Q	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	0	1	1	2.009754	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	20	2629	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	0	1	hg19	c.2210G>A	CCDS4369.1	0	.	.	.	.	.	.	.	.	.	.	c	36	5.620461	0.96660	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.95918	-3.85;-3.85;-3.85	5.3	5.3	0.74995	5.3	5.3	0.74995	Leucine-rich repeat-containing N-terminal (2);	0.167150	0.53938	D	0.000050	D	0.96442	0.8839	L	0.38692	1.165	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.97301	0.9931	10	0.87932	D	0	.	19.0096	0.92868	0.0:1.0:0.0:0.0	.	737	O75094	SLIT3_HUMAN	Q	737	ENSP00000430333:R737Q;ENSP00000332164:R737Q;ENSP00000384890:R737Q	ENSP00000332164:R737Q	R	-	2	0	0	SLIT3	168107945	168107945	1.000000	0.71417	0.954000	0.39281	0.894000	0.52154	7.485000	0.81204	2.483000	0.83821	0.550000	0.68814	CGA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.642	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	0	0	1	2	2	2	2	0	0	0	0	122	122	122	121	1	1.770000	-3.085984	1	0.570000	NM_003062		0	7	7	0	470	466	0		1	0		0	0	122	0	0	0.980171	0	0	0	0	1	0	7	470
CDHR2	54825	broad.mit.edu	37	5	176008451	176008451	+	Silent	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:176008451C>G	ENST00000510636.1	+	17	2200	c.1926C>G	c.(1924-1926)ctC>ctG	p.L642L	CDHR2_ENST00000261944.5_Silent_p.L642L|CDHR2_ENST00000506348.1_Silent_p.L642L	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	642	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CAGGGCTCCTCAGAAACCTGG	0.627																																						ENST00000510636.1	0.120000	1.000000e-02	9.000000e-02	2.000000e-02	0.050000	0.062257	0.050000	0.050000																										0				56						c.(1924-1926)ctC>ctG		cadherin-related family member 2							54.0	53.0	53.0					5																	176008451		2203	4300	6503	SO:0001819	synonymous_variant	54825	0	0					g.chr5:176008451C>G	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.1926C>G	chr5.hg19:g.176008451C>G		0					CDHR2_ENST00000506348.1_Silent_p.L642L|CDHR2_ENST00000261944.5_Silent_p.L642L	p.L642L	NM_001171976.1	NP_001165447.1	0	1	1	2.009754	Q9BYE9	CDHR2_HUMAN		17	2200	+			A1L3U4|A6NC80|Q9NXP8	Silent	SNP	ENST00000510636.1	0	1	hg19	c.1926C>G	CCDS34297.1	0																																																																																								0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.627	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.770000	-5.167245	1	0.570000	NM_017675		0	4	4	0	257	253	0		1	1		0	0	68	0	0	0.887421	2.275312e-01	0	2	0	45	0	4	257
F12	2161	broad.mit.edu	37	5	176831274	176831274	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:176831274G>A	ENST00000253496.3	-	9	989	c.941C>T	c.(940-942)cCa>cTa	p.P314L	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	314	Pro-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	GGGCATGAGTGGGACATGAAG	0.711									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000253496.3	1.000000	5.700000e-01	9.000000e-01	6.700000e-01	0.780000	0.789892	0.780000	1.000000																										0				12						c.(940-942)cCa>cTa		coagulation factor XII (Hageman factor)	Ethanolamine Oleate(DB06689)						15.0	20.0	18.0					5																	176831274		2194	4290	6484	SO:0001583	missense	2161	0	0		Hereditary Angioedema	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	g.chr5:176831274G>A	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.941C>T	chr5.hg19:g.176831274G>A	ENSP00000253496:p.Pro314Leu	0		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1934	F12_ENST00000514943.1_5'Flank	p.P314L	NM_000505.3	NP_000496.2	0	1	1	2.009754	P00748	FA12_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	9	989	-	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	P78339	Missense_Mutation	SNP	ENST00000253496.3	1	1	hg19	c.941C>T	CCDS34302.1	0	.	.	.	.	.	.	.	.	.	.	G	8.380	0.837406	0.16891	.	.	ENSG00000131187	ENST00000253496	D	0.89050	-2.46	4.4	-4.43	0.03568	4.4	-4.43	0.03568	.	3.436950	0.00947	N	0.002906	T	0.72574	0.3477	N	0.05124	-0.11	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.67360	-0.5690	10	0.10377	T	0.69	.	5.3148	0.15850	0.486:0.0:0.374:0.14	.	314	P00748	FA12_HUMAN	L	314	ENSP00000253496:P314L	ENSP00000253496:P314L	P	-	2	0	0	F12	176763880	176763880	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.201000	0.09464	-0.948000	0.03668	-1.191000	0.01696	CCA	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.711	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1	0	0	1	2	14	4	2	1	1	1	1	38	38	38	38	1	1.770000	-20.000000	1	0.570000			0	37	37	0	118	117	0		1	1		1	0	38	0	0	0.999885	7.681109e-01	0	11	0	10	0	37	118
CEP72	55722	broad.mit.edu	37	5	633946	633946	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:633946C>T	ENST00000264935.5	+	5	665	c.575C>T	c.(574-576)gCg>gTg	p.A192V	CEP72_ENST00000444221.1_Intron	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	192					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GTCATGGATGCGGATGACGAG	0.612																																						ENST00000264935.5	1.000000	0	6.000000e-02	1.000000e-02	0.020000	0.158953	0.020000	0.020000																										0				20						c.(574-576)gCg>gTg		centrosomal protein 72kDa							132.0	133.0	133.0					5																	633946		2203	4300	6503	SO:0001583	missense	55722	2	121412	39				g.chr5:633946C>T	BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.575C>T	chr5.hg19:g.633946C>T	ENSP00000264935:p.Ala192Val	0					CEP72_ENST00000444221.1_Intron	p.A192V	NM_018140.3	NP_060610.2	1	2	3	2.259955	Q9P209	CEP72_HUMAN	Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)	5	665	+			B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	ENST00000264935.5	0	1	hg19	c.575C>T	CCDS34126.1	0	.	.	.	.	.	.	.	.	.	.	C	8.455	0.854063	0.17106	.	.	ENSG00000112877	ENST00000264935	T	0.09911	2.93	5.14	2.14	0.27477	5.14	2.14	0.27477	.	0.406531	0.25458	N	0.030523	T	0.11410	0.0278	M	0.65975	2.015	0.29054	N	0.884302	B	0.15473	0.013	B	0.12837	0.008	T	0.09662	-1.0664	10	0.40728	T	0.16	-11.1821	6.2359	0.20762	0.4236:0.4884:0.0:0.088	.	192	Q9P209	CEP72_HUMAN	V	192	ENSP00000264935:A192V	ENSP00000264935:A192V	A	+	2	0	0	CEP72	686946	686946	0.023000	0.18921	0.021000	0.16686	0.247000	0.25773	0.787000	0.26858	0.650000	0.30769	-0.355000	0.07637	GCG	0.589871		TCGA-OE-A75W-01A-12D-A32N-08	0.612	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365967.3	0	0	1	2	2	2	2	0	0	0	0	228	228	228	227	1	1.770000	-1.810234	0	0.570000	NM_018140		0	8	8	0	1020	1013	0		1	0		0	0	228	0	0	0.989020	2.269723e-03	0	0	0	8	0	8	1020
EGFLAM	133584	broad.mit.edu	37	5	38370412	38370412	+	Missense_Mutation	SNP	A	A	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:38370412A>T	ENST00000354891.3	+	6	906	c.560A>T	c.(559-561)aAg>aTg	p.K187M	EGFLAM_ENST00000322350.5_Missense_Mutation_p.K187M	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	187	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GATTTCGACAAGAAGTGGACC	0.448																																					Colon(62;485 1295 3347 17454)	ENST00000354891.3	1.000000	8.000000e-01	1	8.800000e-01	0.970000	0.955181	0.970000	1.000000																										0				85						c.(559-561)aAg>aTg		EGF-like, fibronectin type III and laminin G domains							89.0	86.0	87.0					5																	38370412		2203	4300	6503	SO:0001583	missense	133584	0	0					g.chr5:38370412A>T	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.560A>T	chr5.hg19:g.38370412A>T	ENSP00000346964:p.Lys187Met	1					EGFLAM_ENST00000322350.5_Missense_Mutation_p.K187M	p.K187M	NM_001205301.1	NP_001192230.1	0	2	2	2.176816	Q63HQ2	EGFLA_HUMAN		6	906	+	all_lung(31;0.000385)		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	1	1	hg19	c.560A>T	CCDS56363.1	1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.479053	0.26511	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.57595	0.39;0.39	5.82	0.571	0.17352	5.82	0.571	0.17352	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.578369	0.20260	N	0.095883	T	0.31071	0.0785	N	0.17922	0.545	0.45515	D	0.998477	B;B	0.18461	0.014;0.028	B;B	0.13407	0.009;0.008	T	0.06770	-1.0808	10	0.45353	T	0.12	-9.2271	5.5891	0.17291	0.325:0.4351:0.2399:0.0	.	187;187	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	M	187	ENSP00000346964:K187M;ENSP00000313084:K187M	ENSP00000313084:K187M	K	+	2	0	0	EGFLAM	38406169	38406169	1.000000	0.71417	0.897000	0.35233	0.776000	0.43924	0.897000	0.28390	0.462000	0.27095	-0.429000	0.05907	AAG	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.448	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	1.770000	-20.000000	1	0.570000	NM_152403		0	88	86	0	230	227	1		1	0		0	0	55	0	0	1.000000	0	0	0	0	1	0	88	230
NNT	23530	broad.mit.edu	37	5	43651892	43651892	+	Missense_Mutation	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:43651892A>G	ENST00000264663.5	+	13	1990	c.1769A>G	c.(1768-1770)gAc>gGc	p.D590G	NNT_ENST00000344920.4_Missense_Mutation_p.D590G|NNT_ENST00000512996.2_Missense_Mutation_p.D459G	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	590					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CGTCCCACTGACCCCCCAGAA	0.463																																						ENST00000264663.5	1.000000	0	6.000000e-02	1.000000e-02	0.030000	0.136732	0.030000	0.040000																										0				51						c.(1768-1770)gAc>gGc		nicotinamide nucleotide transhydrogenase							159.0	160.0	160.0					5																	43651892		2203	4300	6503	SO:0001583	missense	23530	0	0					g.chr5:43651892A>G	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.1769A>G	chr5.hg19:g.43651892A>G	ENSP00000264663:p.Asp590Gly	1					NNT_ENST00000512996.2_Missense_Mutation_p.D459G|NNT_ENST00000344920.4_Missense_Mutation_p.D590G	p.D590G	NM_012343.3	NP_036475.3	0	2	2	2.176816	Q13423	NNTM_HUMAN		13	1990	+	Lung NSC(6;2.58e-06)		Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	0	1	hg19	c.1769A>G	CCDS3949.1	0	.	.	.	.	.	.	.	.	.	.	A	27.7	4.854509	0.91355	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.96459	-4.02;-4.02;-3.87	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.99285	1.0897	10	0.87932	D	0	-27.7305	15.8513	0.78934	1.0:0.0:0.0:0.0	.	590	Q13423	NNTM_HUMAN	G	105;590;590;459	ENSP00000264663:D590G;ENSP00000343873:D590G;ENSP00000426343:D459G	ENSP00000264663:D590G	D	+	2	0	0	NNT	43687649	43687649	1.000000	0.71417	0.816000	0.32577	0.983000	0.72400	8.962000	0.93254	2.152000	0.67230	0.533000	0.62120	GAC	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.463	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	0	0	1	2	21	2	2	1	1	1	1	154	154	154	151	1	1.770000	-1.787495	0	0.570000	NM_182977		0	9	8	0	954	942	0		0	0		1	0	154	0	0	0.018672	3.137766e-03	0	0	0	8	0	9	954
RNF180	285671	broad.mit.edu	37	5	63509712	63509712	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:63509712C>T	ENST00000389100.4	+	4	631	c.559C>T	c.(559-561)Cga>Tga	p.R187*	RNF180_ENST00000296615.6_Nonsense_Mutation_p.R187*|RNF180_ENST00000381081.2_Intron	NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	187					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		CCTGGAGGTGCGACCAACATA	0.453																																						ENST00000389100.4	1.000000	9.600000e-01	1	9.900000e-01	0.990000	0.998027	0.990000	1.000000																										0				20						c.(559-561)Cga>Tga		ring finger protein 180							57.0	64.0	61.0					5																	63509712		2203	4300	6503	SO:0001587	stop_gained	285671	1	121406	32				g.chr5:63509712C>T	AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.559C>T	chr5.hg19:g.63509712C>T	ENSP00000373752:p.Arg187*	1					RNF180_ENST00000381081.2_Intron|RNF180_ENST00000296615.6_Nonsense_Mutation_p.R187*	p.R187*	NM_001113561.1	NP_001107033.1	0	2	2	2.176816	Q86T96	RN180_HUMAN		4	631	+		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)	Q0JSU3|Q495A8|Q8NBD1	Nonsense_Mutation	SNP	ENST00000389100.4	0	1	hg19	c.559C>T	CCDS47219.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987398	0.74589	.	.	ENSG00000164197	ENST00000296615;ENST00000389100	.	.	.	6.08	3.21	0.36854	6.08	3.21	0.36854	.	0.180087	0.38778	N	0.001574	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0471	14.6552	0.68828	0.5204:0.4796:0.0:0.0	.	.	.	.	X	187	.	ENSP00000296615:R187X	R	+	1	2	2	RNF180	63545468	63545468	0.452000	0.25713	0.552000	0.28243	0.998000	0.95712	0.245000	0.18142	0.381000	0.24851	0.655000	0.94253	CGA	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.453	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	0	0	1	2	17	2	2	1	1	1	1	48	48	48	48	1	1.770000	-20.000000	1	0.570000	NM_178532		0	82	82	0	165	163	0		1	0		1	0	48	0	0	1.000000	0	0	0	0	1	0	82	165
HMGCR	3156	broad.mit.edu	37	5	74650437	74650437	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:74650437C>T	ENST00000287936.4	+	12	1634	c.1478C>T	c.(1477-1479)tCt>tTt	p.S493F	HMGCR_ENST00000343975.5_Missense_Mutation_p.S493F|HMGCR_ENST00000511206.1_Missense_Mutation_p.S493F	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	493	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CGTGGTGTATCTATTCGCCGA	0.408																																						ENST00000287936.4	0.170000	2.000000e-02	1.300000e-01	5.000000e-02	0.080000	0.094380	0.080000	0.090000																										0				20						c.(1477-1479)tCt>tTt		3-hydroxy-3-methylglutaryl-CoA reductase	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)						137.0	118.0	124.0					5																	74650437		2203	4300	6503	SO:0001583	missense	3156	0	0					g.chr5:74650437C>T		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1478C>T	chr5.hg19:g.74650437C>T	ENSP00000287936:p.Ser493Phe	1					HMGCR_ENST00000511206.1_Missense_Mutation_p.S493F|HMGCR_ENST00000343975.5_Missense_Mutation_p.S493F	p.S493F	NM_000859.2	NP_000850.1	1	2	3	2.675887	P04035	HMDH_HUMAN		12	1634	+		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	0	1	hg19	c.1478C>T	CCDS4027.1	0	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263447	0.59431	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.44881	0.91;0.91;0.96	5.14	5.14	0.70334	5.14	5.14	0.70334	Hydroxymethylglutaryl-CoA reductase, N-terminal (1);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);	0.166783	0.56097	D	0.000035	T	0.46946	0.1419	L	0.52905	1.665	0.46678	D	0.999152	B;P;B	0.42296	0.215;0.775;0.215	B;B;B	0.43274	0.102;0.414;0.102	T	0.50524	-0.8818	10	0.59425	D	0.04	-18.4228	18.978	0.92745	0.0:1.0:0.0:0.0	.	493;493;493	B2R649;P04035-2;P04035	.;.;HMDH_HUMAN	F	493;424;493;493	ENSP00000426745:S493F;ENSP00000287936:S493F;ENSP00000340816:S493F	ENSP00000287936:S493F	S	+	2	0	0	HMGCR	74686193	74686193	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	4.270000	0.58896	2.570000	0.86706	0.467000	0.42956	TCT	0.665370		TCGA-OE-A75W-01A-12D-A32N-08	0.408	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2	0	0	1	2	2	2	2	0	0	0	0	42	42	42	40	1	1.770000	-2.618065	1	0.570000			0	6	6	0	326	324	0		1	0		0	0	42	0	0	0.964681	9.557913e-03	0	0	0	7	0	6	326
CLK4	57396	broad.mit.edu	37	5	178045614	178045614	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr5:178045614C>G	ENST00000316308.4	-	3	495	c.327G>C	c.(325-327)agG>agC	p.R109S	CLK4_ENST00000522749.1_5'UTR|RN7SKP70_ENST00000516655.1_RNA	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	109					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		GACTGCTTCTCCTGCTGCGGA	0.413																																						ENST00000316308.4	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.032673	0.020000	0.030000																										0				21						c.(325-327)agG>agC		CDC-like kinase 4							226.0	214.0	218.0					5																	178045614		2203	4300	6503	SO:0001583	missense	57396	0	0					g.chr5:178045614C>G	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.327G>C	chr5.hg19:g.178045614C>G	ENSP00000316948:p.Arg109Ser	0					RN7SKP70_ENST00000516655.1_RNA|CLK4_ENST00000522749.1_5'UTR	p.R109S	NM_020666.2	NP_065717.1	0	1	1	2.009754	Q9HAZ1	CLK4_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	3	495	-	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)		Missense_Mutation	SNP	ENST00000316308.4	0	1	hg19	c.327G>C	CCDS4437.1	0	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845262	0.32606	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.68479	-0.33	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.111533	0.64402	D	0.000001	T	0.48390	0.1497	L	0.31578	0.945	0.80722	D	1	B;P;B;B;B	0.39782	0.002;0.688;0.006;0.293;0.293	B;B;B;B;B	0.31442	0.006;0.13;0.006;0.039;0.039	T	0.47548	-0.9109	10	0.15066	T	0.55	.	13.0251	0.58810	0.0:0.8381:0.1619:0.0	.	109;109;109;109;109	B7Z990;B7ZL31;Q4G0Z5;B9EG64;Q9HAZ1	.;.;.;.;CLK4_HUMAN	S	109	ENSP00000316948:R109S	ENSP00000316948:R109S	R	-	3	2	2	CLK4	177978220	177978220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.230000	0.32612	2.700000	0.92200	0.563000	0.77884	AGG	0.541235		TCGA-OE-A75W-01A-12D-A32N-08	0.413	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2	0	0	1	2	2	2	2	0	0	0	0	110	110	110	108	1	1.770000	-2.204181	0	0.570000			0	5	5	0	587	584	0		1	0		0	0	110	0	0	0.936942	9.721886e-03	0	0	0	14	0	5	587
RREB1	6239	broad.mit.edu	37	6	7246974	7246974	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr6:7246974G>A	ENST00000349384.6	+	11	4440	c.4126G>A	c.(4126-4128)Gag>Aag	p.E1376K	RREB1_ENST00000334984.6_Intron|RREB1_ENST00000379933.3_Missense_Mutation_p.E1376K|RREB1_ENST00000379938.2_Missense_Mutation_p.E1431K	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1376					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CAAGCTGGCGGAGGGCGACGG	0.687																																						ENST00000349384.6	1.000000	3.700000e-01	1	5.400000e-01	0.750000	0.754088	0.750000	1.000000																										0				58						c.(4126-4128)Gag>Aag		ras responsive element binding protein 1							19.0	20.0	20.0					6																	7246974		2171	4253	6424	SO:0001583	missense	6239	0	0					g.chr6:7246974G>A	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.4126G>A	chr6.hg19:g.7246974G>A	ENSP00000305560:p.Glu1376Lys	0					RREB1_ENST00000379938.2_Missense_Mutation_p.E1431K|RREB1_ENST00000334984.6_Intron|RREB1_ENST00000379933.3_Missense_Mutation_p.E1376K	p.E1376K	NM_001003698.3	NP_001003698.1	1	2	3	2.152451	Q92766	RREB1_HUMAN		11	4440	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	0	1	hg19	c.4126G>A	CCDS34336.1	0	.	.	.	.	.	.	.	.	.	.	G	10.08	1.252018	0.22880	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384	T;T;T	0.11495	2.8;2.77;2.8	5.6	2.79	0.32731	5.6	2.79	0.32731	.	.	.	.	.	T	0.03390	0.0098	L	0.52573	1.65	0.42564	D	0.993153	P;P	0.39022	0.524;0.655	B;B	0.30855	0.095;0.121	T	0.46857	-0.9161	9	0.29301	T	0.29	-19.3632	10.5135	0.44876	0.0679:0.2532:0.6789:0.0	.	1376;1431	Q92766;Q92766-2	RREB1_HUMAN;.	K	1376;1431;1376	ENSP00000369265:E1376K;ENSP00000369270:E1431K;ENSP00000305560:E1376K	ENSP00000305560:E1376K	E	+	1	0	0	RREB1	7191973	7191973	1.000000	0.71417	0.020000	0.16555	0.035000	0.12851	3.103000	0.50298	0.297000	0.22615	0.655000	0.94253	GAG	0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.687	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	0	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.770000	-17.555920	1	0.570000			0	8	8	0	30	30	0		1	0		0	0	9	0	0	0.992080	0	0	0	0	1	0	8	30
KIAA0319	9856	broad.mit.edu	37	6	24580108	24580108	+	Silent	SNP	C	C	T	rs138756394		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr6:24580108C>T	ENST00000378214.3	-	8	1874	c.1350G>A	c.(1348-1350)acG>acA	p.T450T	KIAA0319_ENST00000535378.1_Silent_p.T441T|KIAA0319_ENST00000543707.1_Silent_p.T450T|KIAA0319_ENST00000537886.1_Silent_p.T450T|KIAA0319_ENST00000430948.2_Silent_p.T405T	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	450	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TGAGGGCTGACGTCAAAGGCA	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17123	0.0		0.0	False		,,,				2504	0.0					ENST00000378214.3	0.970000	3.300000e-01	7.800000e-01	4.500000e-01	0.600000	0.621773	0.600000	0.590000																										0				53						c.(1348-1350)acG>acA		KIAA0319		C	,,,,	7,4399	12.9+/-30.5	0,7,2196	73.0	68.0	70.0		1323,1350,1215,1350,1350	-2.5	0.0	6	dbSNP_134	70	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KIAA0319	NM_001168374.1,NM_001168375.1,NM_001168376.1,NM_001168377.1,NM_014809.3	,,,,	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	,,,,	441/1064,450/1073,405/1028,450/1012,450/1073	24580108	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	9856	27	121334	42				g.chr6:24580108C>T	AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1350G>A	chr6.hg19:g.24580108C>T		0					KIAA0319_ENST00000430948.2_Silent_p.T405T|KIAA0319_ENST00000535378.1_Silent_p.T441T|KIAA0319_ENST00000543707.1_Silent_p.T450T|KIAA0319_ENST00000537886.1_Silent_p.T450T	p.T450T	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	1	2	3	2.152451	Q5VV43	K0319_HUMAN		8	1874	-			A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Silent	SNP	ENST00000378214.3	0	0	hg19	c.1350G>A	CCDS34348.1	0																																																																																								0.571222		TCGA-OE-A75W-01A-12D-A32N-08	0.458	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	1	0	0	2	2	2	2	0	0	0	0	12	12	12	12	1	1.770000	-19.693130	1	0.570000	NM_014809		0	11	11	0	54	54	1		1			0	0	12	0	0	0.998828	0	0	0	0	0	0	11	54
MOCS1	4337	broad.mit.edu	37	6	39881079	39881079	+	Missense_Mutation	SNP	C	C	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr6:39881079C>G	ENST00000340692.5	-	6	742	c.739G>C	c.(739-741)Gag>Cag	p.E247Q	MOCS1_ENST00000373188.2_Missense_Mutation_p.E247Q|MOCS1_ENST00000425303.2_Missense_Mutation_p.E247Q|MOCS1_ENST00000373186.4_Missense_Mutation_p.E247Q|MOCS1_ENST00000373195.3_Missense_Mutation_p.E160Q|MOCS1_ENST00000432280.2_Missense_Mutation_p.E218Q|MOCS1_ENST00000373175.4_Missense_Mutation_p.E218Q|MOCS1_ENST00000308559.7_Missense_Mutation_p.E247Q			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	247	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					GGCATATACTCTATGAAGCGC	0.582																																					NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)	ENST00000340692.5	1.000000	7.100000e-01	9.900000e-01	8.000000e-01	0.880000	0.890290	0.880000	1.000000																										0				21						c.(739-741)Gag>Cag		molybdenum cofactor synthesis 1							95.0	81.0	86.0					6																	39881079		2203	4300	6503	SO:0001583	missense	4337	0	0					g.chr6:39881079C>G	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.739G>C	chr6.hg19:g.39881079C>G	ENSP00000344794:p.Glu247Gln	0					MOCS1_ENST00000373175.4_Missense_Mutation_p.E218Q|MOCS1_ENST00000373195.3_Missense_Mutation_p.E160Q|MOCS1_ENST00000373186.4_Missense_Mutation_p.E247Q|MOCS1_ENST00000432280.2_Missense_Mutation_p.E218Q|MOCS1_ENST00000308559.7_Missense_Mutation_p.E247Q|MOCS1_ENST00000425303.2_Missense_Mutation_p.E247Q|MOCS1_ENST00000373188.2_Missense_Mutation_p.E247Q	p.E247Q			1	2	3	2.167841	Q9NZB8	MOCS1_HUMAN		6	742	-	Ovarian(28;0.0355)|Colorectal(47;0.196)		B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	1	1	hg19	c.739G>C		1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801911	0.90538	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000373195;ENST00000340692;ENST00000425303;ENST00000432280	D;D;D;D;D;D;D;D	0.98060	-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69	4.68	4.68	0.58851	4.68	4.68	0.58851	Elongator protein 3/MiaB/NifB (1);Molybdenum cofactor synthesis C-terminal (1);Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.99542	0.9836	H	0.99984	5.225	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.996;0.999;0.998;0.997	D	0.97279	0.9916	9	.	.	.	-29.1172	17.2165	0.86945	0.0:1.0:0.0:0.0	.	247;247;247;247;247	Q9NZB8-2;Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;.;MOCS1_HUMAN;.;.	Q	247;247;218;247;160;247;247;218	ENSP00000362282:E247Q;ENSP00000309843:E247Q;ENSP00000362270:E218Q;ENSP00000362284:E247Q;ENSP00000362291:E160Q;ENSP00000344794:E247Q;ENSP00000416478:E247Q;ENSP00000410809:E218Q	.	E	-	1	0	0	MOCS1	39989057	39989057	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.783000	0.85696	2.166000	0.68216	0.655000	0.94253	GAG	0.572437		TCGA-OE-A75W-01A-12D-A32N-08	0.582	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000040476.2	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.770000	-4.883959	1	0.570000	NM_005943		0	72	72	0	213	211	1		1	0		0	0	51	0	0	1.000000	7.058376e-01	0	0	0	9	0	72	213
GRIK2	2898	broad.mit.edu	37	6	102516276	102516276	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr6:102516276C>T	ENST00000421544.1	+	16	3107	c.2617C>T	c.(2617-2619)Cgt>Tgt	p.R873C	GRIK2_ENST00000369137.3_Missense_Mutation_p.R797C|GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000369134.4_Missense_Mutation_p.R824C	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	873					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GAAGTGCCAGCGTCGGTTAAA	0.398																																						ENST00000421544.1	0.990000	7.100000e-01	9.400000e-01	7.800000e-01	0.860000	0.866050	0.860000	0.880000																										0				83						c.(2617-2619)Cgt>Tgt		glutamate receptor, ionotropic, kainate 2	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)						117.0	109.0	112.0					6																	102516276		2203	4300	6503	SO:0001583	missense	2898	0	0					g.chr6:102516276C>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2617C>T	chr6.hg19:g.102516276C>T	ENSP00000397026:p.Arg873Cys	1					GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369137.3_Missense_Mutation_p.R797C|GRIK2_ENST00000369134.4_Missense_Mutation_p.R824C	p.R873C	NM_021956.4	NP_068775.1	0	1	1	1.573763	Q13002	GRIK2_HUMAN		16	3107	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	1	1	hg19	c.2617C>T	CCDS5048.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795302	0.90453	.	.	ENSG00000164418	ENST00000421544;ENST00000369137;ENST00000369134	T;T;T	0.12147	2.71;2.87;2.72	5.79	5.79	0.91817	5.79	5.79	0.91817	.	0.050411	0.85682	D	0.000000	T	0.20941	0.0504	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	P	0.55260	0.772	T	0.00276	-1.1855	10	0.59425	D	0.04	.	20.0361	0.97558	0.0:1.0:0.0:0.0	.	873	Q13002	GRIK2_HUMAN	C	873;797;824	ENSP00000397026:R873C;ENSP00000358133:R797C;ENSP00000358130:R824C	ENSP00000358130:R824C	R	+	1	0	0	GRIK2	102622969	102622969	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.745000	0.94114	0.462000	0.41574	CGT	0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.398	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.770000	-20.000000	1	0.570000			0	71	70	0	131	128	1		1			0	0	51	0	0	1.000000	0	0	0	0	0	0	71	131
DNAJC2	27000	broad.mit.edu	37	7	102960230	102960230	+	Missense_Mutation	SNP	T	T	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:102960230T>G	ENST00000379263.3	-	11	1395	c.1145A>C	c.(1144-1146)aAa>aCa	p.K382T	DNAJC2_ENST00000249270.7_Intron|PMPCB_ENST00000420236.2_Intron	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	382					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						ATCACAAAGTTTTTCCACTTC	0.353																																						ENST00000379263.3	1.000000	0	6.000000e-02	2.000000e-02	0.030000	0.070284	0.030000	0.040000																										0				21						c.(1144-1146)aAa>aCa		DnaJ (Hsp40) homolog, subfamily C, member 2							209.0	192.0	197.0					7																	102960230		1834	4093	5927	SO:0001583	missense	27000	0	0					g.chr7:102960230T>G	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1145A>C	chr7.hg19:g.102960230T>G	ENSP00000368565:p.Lys382Thr	0					DNAJC2_ENST00000249270.7_Intron|PMPCB_ENST00000420236.2_Intron	p.K382T	NM_014377.1	NP_055192.1	1	2	3	2.187475	Q99543	DNJC2_HUMAN		11	1395	-			A4VCI0|Q9BVX1	Missense_Mutation	SNP	ENST00000379263.3	0	1	hg19	c.1145A>C	CCDS43628.1	0	.	.	.	.	.	.	.	.	.	.	T	24.0	4.487186	0.84854	.	.	ENSG00000105821	ENST00000379263	T	0.44482	0.92	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.000000	0.85682	U	0.000000	T	0.60495	0.2273	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.55289	-0.8164	10	0.20046	T	0.44	-28.1622	16.2853	0.82717	0.0:0.0:0.0:1.0	.	382	Q99543	DNJC2_HUMAN	T	382	ENSP00000368565:K382T	ENSP00000368565:K382T	K	-	2	0	0	DNAJC2	102747466	102747466	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.665000	0.83852	2.236000	0.73375	0.528000	0.53228	AAA	0.574847		TCGA-OE-A75W-01A-12D-A32N-08	0.353	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1	0	0	1	2	2	2	2	0	0	0	0	116	116	116	116	1	1.770000	-3.318556	1	0.570000			0	8	8	0	739	726	0		1	0		0	0	116	0	0	0.988618	3.579704e-01	0	0	0	106	0	8	739
GRM8	2918	broad.mit.edu	37	7	126410092	126410092	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:126410092G>A	ENST00000339582.2	-	7	1992	c.1184C>T	c.(1183-1185)tCt>tTt	p.S395F	GRM8_ENST00000405249.1_Missense_Mutation_p.S395F|GRM8_ENST00000444921.2_Missense_Mutation_p.S395F|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000358373.3_Missense_Mutation_p.S395F			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	395					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CTGTTCATAAGATGAATCCCG	0.388										HNSCC(24;0.065)																												ENST00000339582.2	1.000000	9.500000e-01	1	9.900000e-01	0.990000	0.997232	0.990000	1.000000																										0				125						c.(1183-1185)tCt>tTt		glutamate receptor, metabotropic 8							80.0	70.0	73.0					7																	126410092		2203	4300	6503	SO:0001583	missense	2918	0	0					g.chr7:126410092G>A		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1184C>T	chr7.hg19:g.126410092G>A	ENSP00000344173:p.Ser395Phe	0	HNSCC(24;0.065)				GRM8_ENST00000405249.1_Missense_Mutation_p.S395F|GRM8_ENST00000358373.3_Missense_Mutation_p.S395F|GRM8_ENST00000444921.2_Missense_Mutation_p.S395F|GRM8_ENST00000480995.1_5'UTR	p.S395F			1	2	3	2.187475	O00222	GRM8_HUMAN		7	1992	-		Prostate(267;0.186)	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	1	1	hg19	c.1184C>T	CCDS5794.1	1	.	.	.	.	.	.	.	.	.	.	G	8.134	0.783695	0.16189	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	5.88	5.88	0.94601	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.247838	0.38217	N	0.001768	D	0.82848	0.5126	L	0.29908	0.895	0.44247	D	0.997094	B;B;B	0.29378	0.243;0.141;0.037	B;B;B	0.35114	0.196;0.054;0.043	T	0.80455	-0.1375	10	0.46703	T	0.11	.	14.7788	0.69749	0.0:0.1438:0.8562:0.0	.	395;395;395	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	F	395	ENSP00000344173:S395F;ENSP00000409790:S395F;ENSP00000351142:S395F;ENSP00000385731:S395F	ENSP00000344173:S395F	S	-	2	0	0	GRM8	126197328	126197328	0.998000	0.40836	0.781000	0.31783	0.040000	0.13550	2.992000	0.49417	2.769000	0.95229	0.655000	0.94253	TCT	0.574847		TCGA-OE-A75W-01A-12D-A32N-08	0.388	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.770000	-20.000000	1	0.570000			0	47	47	0	89	89	1		1	0		0	0	27	0	0	1.000000	0	0	0	0	1	0	47	89
SSPO	23145	broad.mit.edu	37	7	149523658	149523658	+	RNA	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:149523658G>C	ENST00000378016.2	+	0	14572							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGGCTGCCCTGGAGGGCAGGT	0.672																																						ENST00000378016.2	1.000000	6.700000e-01	1	8.200000e-01	0.980000	0.932000	0.980000	1.000000																										0												SCO-spondin							13.0	16.0	15.0					7																	149523658		2150	4239	6389			23145	0	0					g.chr7:149523658G>C	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149523658G>C		0									0	0	0	2.086752	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)	0	14572	+	Melanoma(164;0.165)|Ovarian(565;0.177)		Q76B61	RNA	SNP	ENST00000378016.2	0	1	hg19			1																																																																																								0.557385		TCGA-OE-A75W-01A-12D-A32N-08	0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript		0	0	1	2	2	2	2	0	0	0	0	23	23	23	22	1	1.770000	-20.000000	1	0.570000			0	23	23	0	56	53	0		1			0	0	23	0	0	1.000000	0	0	0	0	0	0	23	56
TMUB1	83590	broad.mit.edu	37	7	150779321	150779321	+	Silent	SNP	G	G	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:150779321G>T	ENST00000392818.3	-	2	687	c.330C>A	c.(328-330)ctC>ctA	p.L110L	FASTK_ENST00000297532.6_5'Flank|TMUB1_ENST00000482202.1_Silent_p.L110L|TMUB1_ENST00000297533.4_Silent_p.L110L|FASTK_ENST00000489884.1_5'Flank|TMUB1_ENST00000476627.1_Silent_p.L110L|TMUB1_ENST00000462940.1_Silent_p.L110L|FASTK_ENST00000540185.1_5'Flank|FASTK_ENST00000353841.2_5'Flank|FASTK_ENST00000482571.1_5'Flank	NM_031434.3	NP_113622.1	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain containing 1	110	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGAATCATTGAGGAATTTCA	0.607																																						ENST00000392818.3	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.031941	0.020000	0.040000																										0				2						c.(328-330)ctC>ctA		transmembrane and ubiquitin-like domain containing 1							123.0	146.0	138.0					7																	150779321		2203	4300	6503	SO:0001819	synonymous_variant	83590	0	0					g.chr7:150779321G>T	BC000936	CCDS5920.1	7q36.1	2006-06-27	2006-06-27	2006-06-27	ENSG00000164897	ENSG00000164897			21709	protein-coding gene	gene with protein product		614792	"""chromosome 7 open reading frame 21"""	C7orf21			Standard	NM_001136044		Approved	SB144	uc003wjd.3	Q9BVT8	OTTHUMG00000158621	ENST00000392818.3:c.330C>A	chr7.hg19:g.150779321G>T		0					TMUB1_ENST00000297533.4_Silent_p.L110L|FASTK_ENST00000482571.1_5'Flank|TMUB1_ENST00000482202.1_Silent_p.L110L|FASTK_ENST00000540185.1_5'Flank|TMUB1_ENST00000476627.1_Silent_p.L110L|TMUB1_ENST00000462940.1_Silent_p.L110L|FASTK_ENST00000297532.6_5'Flank|FASTK_ENST00000353841.2_5'Flank|FASTK_ENST00000489884.1_5'Flank	p.L110L	NM_031434.3	NP_113622.1	0	0	0	2.086752	Q9BVT8	TMUB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00989)	2	687	-			D3DX06|Q53AQ2	Silent	SNP	ENST00000392818.3	0	1	hg19	c.330C>A	CCDS5920.1	0																																																																																								0.557385		TCGA-OE-A75W-01A-12D-A32N-08	0.607	TMUB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351485.1	0	0	1	2	2	2	2	0	0	0	0	324	324	324	322	1	1.770000	-2.329838	0	0.570000	NM_031434		0	12	10	0	1380	1363	0		1	1		0	0	324	0	0	0.999024	9.483590e-01	0	7	0	573	0	12	1380
SDK1	221935	broad.mit.edu	37	7	4089014	4089014	+	Silent	SNP	A	A	G			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:4089014A>G	ENST00000404826.2	+	18	2776	c.2637A>G	c.(2635-2637)gaA>gaG	p.E879E	SDK1_ENST00000389531.3_Silent_p.E879E	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	879	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGCAGACGGAAGCCGTGAACT	0.582																																						ENST00000404826.2	1.000000	6.500000e-01	9.600000e-01	7.400000e-01	0.840000	0.849883	0.840000	1.000000																										0				153						c.(2635-2637)gaA>gaG		sidekick cell adhesion molecule 1							87.0	75.0	79.0					7																	4089014		2203	4300	6503	SO:0001819	synonymous_variant	221935	0	0					g.chr7:4089014A>G	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2637A>G	chr7.hg19:g.4089014A>G		0					SDK1_ENST00000389531.3_Silent_p.E879E	p.E879E	NM_152744.3	NP_689957.3	1	2	3	2.187475	Q7Z5N4	SDK1_HUMAN		18	2776	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	1	1	hg19	c.2637A>G	CCDS34590.1	0																																																																																								0.574847		TCGA-OE-A75W-01A-12D-A32N-08	0.582	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	44	1	1.770000	-20.000000	1	0.570000	NM_152744		0	53	53	0	170	169	1		1	0		0	0	46	0	0	1.000000	0	0	0	0	1	0	53	170
DDC	1644	broad.mit.edu	37	7	50595897	50595897	+	Missense_Mutation	SNP	G	G	C			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:50595897G>C	ENST00000444124.2	-	6	852	c.652C>G	c.(652-654)Cgt>Ggt	p.R218G	DDC_ENST00000489162.1_5'UTR|DDC_ENST00000426377.1_Missense_Mutation_p.R140G|DDC_ENST00000380984.4_Missense_Mutation_p.R218G|DDC_ENST00000431062.1_Intron|DDC_ENST00000357936.5_Missense_Mutation_p.R218G	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	218					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	GCAGACGCACGCATGGCGAAG	0.532																																						ENST00000444124.2	1.000000	7.600000e-01	9.800000e-01	8.200000e-01	0.890000	0.900253	0.890000	1.000000																										0				40						c.(652-654)Cgt>Ggt		dopa decarboxylase (aromatic L-amino acid decarboxylase)	Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)						100.0	98.0	98.0					7																	50595897		2203	4300	6503	SO:0001583	missense	1644	1	121412	37				g.chr7:50595897G>C		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.652C>G	chr7.hg19:g.50595897G>C	ENSP00000403644:p.Arg218Gly	0					DDC_ENST00000431062.1_Intron|DDC_ENST00000380984.4_Missense_Mutation_p.R218G|DDC_ENST00000489162.1_5'UTR|DDC_ENST00000426377.1_Missense_Mutation_p.R140G|DDC_ENST00000357936.5_Missense_Mutation_p.R218G	p.R218G	NM_001082971.1	NP_001076440	1	2	3	2.187475	P20711	DDC_HUMAN		6	852	-	Glioma(55;0.08)|all_neural(89;0.245)		C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	1	1	hg19	c.652C>G	CCDS5511.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.67|16.67	3.186512|3.186512	0.57909|0.57909	.|.	.|.	ENSG00000132437|ENSG00000132437	ENST00000430300|ENST00000357936;ENST00000426377;ENST00000444124;ENST00000380984	.|T;T;T;T	.|0.38560	.|1.13;1.13;1.13;1.13	6.06|6.06	4.2|4.2	0.49525|0.49525	6.06|6.06	4.2|4.2	0.49525|0.49525	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.102551	.|0.64402	.|D	.|0.000006	T|T	0.65186|0.65186	0.2667|0.2667	H|H	0.95187|0.95187	3.635|3.635	0.48632|0.48632	D|D	0.999681|0.999681	.|B;B	.|0.33103	.|0.397;0.397	.|B;B	.|0.43251	.|0.413;0.413	T|T	0.71807|0.71807	-0.4481|-0.4481	5|10	.|0.87932	.|D	.|0	-7.8105|-7.8105	14.373|14.373	0.66854|0.66854	0.0:0.0:0.7221:0.2779|0.0:0.0:0.7221:0.2779	.|.	.|218;218	.|Q53Y41;P20711	.|.;DDC_HUMAN	W|G	98|218;140;218;218	.|ENSP00000350616:R218G;ENSP00000395069:R140G;ENSP00000403644:R218G;ENSP00000370371:R218G	.|ENSP00000350616:R218G	C|R	-|-	3|1	2|0	2|0	DDC|DDC	50563391|50563391	50563391|50563391	1.000000|1.000000	0.71417|0.71417	0.906000|0.906000	0.35671|0.35671	0.564000|0.564000	0.35744|0.35744	1.378000|1.378000	0.34328|0.34328	0.826000|0.826000	0.34661|0.34661	0.650000|0.650000	0.86243|0.86243	TGC|CGT	0.574847		TCGA-OE-A75W-01A-12D-A32N-08	0.532	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	1.770000	-6.020745	1	0.570000			0	130	130	0	384	380	1		1	1	0	0	0	103	0	0	1.000000	3.742986e-01	0	3	0	2	1	130	384
SHH	6469	broad.mit.edu	37	7	155604784	155604784	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr7:155604784G>A	ENST00000297261.2	-	1	183	c.33C>T	c.(31-33)gtC>gtT	p.V11V		NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	11					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGGAGACGAGGACTAGCAGCA	0.657																																						ENST00000297261.2	0.110000	2.000000e-02	9.000000e-02	4.000000e-02	0.060000	0.069979	0.060000	0.060000																										0				14						c.(31-33)gtC>gtT		sonic hedgehog							71.0	80.0	77.0					7																	155604784		2203	4300	6503	SO:0001819	synonymous_variant	6469	0	0					g.chr7:155604784G>A		CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.33C>T	chr7.hg19:g.155604784G>A		0						p.V11V	NM_000193.2	NP_000184.1	0	0	0	2.086752	Q15465	SHH_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	1	183	-	all_neural(206;0.101)	all_hematologic(28;0.0592)	A4D247|Q75MC9	Silent	SNP	ENST00000297261.2	0	1	hg19	c.33C>T	CCDS5942.1	0																																																																																								0.557385		TCGA-OE-A75W-01A-12D-A32N-08	0.657	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	112	1	1.770000	-8.265762	1	0.570000	NM_000193		0	10	10	0	523	516	0		1	0		0	0	119	0	0	0.996687	8.852774e-03	0	0	0	7	0	10	523
RP1L1	94137	broad.mit.edu	37	8	10470667	10470667	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr8:10470667C>T	ENST00000382483.3	-	4	1164	c.941G>A	c.(940-942)cGc>cAc	p.R314H		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	314					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTCATTCATGCGGACCTTCTT	0.662																																						ENST00000382483.3	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.030283	0.020000	0.030000																										0				148						c.(940-942)cGc>cAc		retinitis pigmentosa 1-like 1							83.0	92.0	89.0					8																	10470667		2131	4235	6366	SO:0001583	missense	94137	2	121092	40				g.chr8:10470667C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.941G>A	chr8.hg19:g.10470667C>T	ENSP00000371923:p.Arg314His	1						p.R314H	NM_178857.5	NP_849188.4	0	1	1	1.571413	Q8IWN7	RP1L1_HUMAN		4	1164	-			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	0	1	hg19	c.941G>A	CCDS43708.1	0	.	.	.	.	.	.	.	.	.	.	C	11.27	1.589738	0.28357	.	.	ENSG00000183638	ENST00000382483	T	0.03745	3.82	4.82	-5.91	0.02269	4.82	-5.91	0.02269	.	1.397370	0.05168	N	0.499120	T	0.03136	0.0092	N	0.19112	0.55	0.09310	N	1	B	0.23058	0.079	B	0.12837	0.008	T	0.35822	-0.9773	10	0.21014	T	0.42	-0.1093	16.5366	0.84374	0.0:0.105:0.0:0.895	.	314	A6NKC6	.	H	314	ENSP00000371923:R314H	ENSP00000371923:R314H	R	-	2	0	0	RP1L1	10508077	10508077	0.003000	0.15002	0.013000	0.15412	0.915000	0.54546	0.048000	0.14078	-1.353000	0.02191	0.591000	0.81541	CGC	0.400989		TCGA-OE-A75W-01A-12D-A32N-08	0.662	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1	0	0	1	2	13	2	2	1	1	1	1	174	174	174	174	1	1.770000	-2.022498	0	0.570000			0	6	6	0	573	565	0		0			1	0	174	0	0	0.076678	0	0	0	0	0	0	6	573
WISP1	8840	broad.mit.edu	37	8	134233083	134233083	+	Splice_Site	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr8:134233083C>T	ENST00000250160.6	+	3	715	c.609C>T	c.(607-609)ttC>ttT	p.F203F	WISP1_ENST00000519433.1_Intron|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000517423.1_Intron|WISP1_ENST00000220856.6_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	203					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.F203F(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CAGGAGCCTTCGGTGGGTGTG	0.632																																						ENST00000250160.6	1.000000	8.500000e-01	1	9.600000e-01	0.990000	0.984538	0.990000	1.000000																										1	Substitution - coding silent(1)	p.F203F(1)	large_intestine(1)	21						c.(607-609)ttC>ttT		WNT1 inducible signaling pathway protein 1							23.0	21.0	22.0					8																	134233083		2183	4282	6465	SO:0001630	splice_region_variant	8840	8	120958	36				g.chr8:134233083C>T	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.610+1C>T	chr8.hg19:g.134233083C>T		1					WISP1_ENST00000517423.1_Intron|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Intron	p.F203F	NM_003882.3	NP_003873.1	0	3	3	2.850194	O95388	WISP1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0107)	3	715	+	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Splice_Site	SNP	ENST00000250160.6	1	0	hg19	c.609C>T	CCDS6371.1	1																																																																																								0.665370		TCGA-OE-A75W-01A-12D-A32N-08	0.632	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.770000	-20.000000	1	0.570000	NM_003882	Silent	0	65	63	0	207	204	1		1	0		0	0	56	0	0	1.000000	1.471406e-01	0	0	0	3	0	65	207
PLEC	5339	broad.mit.edu	37	8	144993374	144993374	+	Missense_Mutation	SNP	G	G	A	rs201438739	byFrequency	TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr8:144993374G>A	ENST00000322810.4	-	32	11195	c.11026C>T	c.(11026-11028)Cgc>Tgc	p.R3676C	PLEC_ENST00000436759.2_Missense_Mutation_p.R3566C|PLEC_ENST00000354589.3_Missense_Mutation_p.R3539C|PLEC_ENST00000398774.2_Missense_Mutation_p.R3507C|PLEC_ENST00000357649.2_Missense_Mutation_p.R3543C|PLEC_ENST00000354958.2_Missense_Mutation_p.R3517C|PLEC_ENST00000356346.3_Missense_Mutation_p.R3525C|PLEC_ENST00000527096.1_Missense_Mutation_p.R3562C|PLEC_ENST00000345136.3_Missense_Mutation_p.R3539C	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3676	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGCAGAAGGCGCAAGCCCGTC	0.597													G|||	4	0.000798722	0.0	0.0	5008	,	,		16840	0.002		0.0	False		,,,				2504	0.002					ENST00000322810.4	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.032847	0.020000	0.030000																										0				137						c.(11026-11028)Cgc>Tgc		plectin							73.0	87.0	83.0					8																	144993374		2053	4201	6254	SO:0001583	missense	5339	20	120920	47				g.chr8:144993374G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11026C>T	chr8.hg19:g.144993374G>A	ENSP00000323856:p.Arg3676Cys	1					PLEC_ENST00000436759.2_Missense_Mutation_p.R3566C|PLEC_ENST00000354589.3_Missense_Mutation_p.R3539C|PLEC_ENST00000527096.1_Missense_Mutation_p.R3562C|PLEC_ENST00000357649.2_Missense_Mutation_p.R3543C|PLEC_ENST00000354958.2_Missense_Mutation_p.R3517C|PLEC_ENST00000345136.3_Missense_Mutation_p.R3539C|PLEC_ENST00000356346.3_Missense_Mutation_p.R3525C|PLEC_ENST00000398774.2_Missense_Mutation_p.R3507C	p.R3676C	NM_201380.2	NP_958782.1	0	3	3	2.850194	Q15149	PLEC_HUMAN		32	11195	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	0	1	hg19	c.11026C>T	CCDS43772.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	2.854	-0.237549	0.05944	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	4.72	2.67	0.31697	4.72	2.67	0.31697	.	0.448841	0.19000	U	0.125371	T	0.36248	0.0960	N	0.03115	-0.41	0.40996	D	0.984897	B;B;B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.0;0.001;0.001;0.001;0.001	B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.0;0.001;0.0;0.0	T	0.26883	-1.0090	10	0.59425	D	0.04	.	2.1195	0.03723	0.3623:0.0:0.392:0.2457	.	3566;3525;3517;3676;3507;3539;3543;3539	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	C	3539;3543;3539;3507;3676;3517;3525;3566;3562	ENSP00000344848:R3539C;ENSP00000350277:R3543C;ENSP00000346602:R3539C;ENSP00000381756:R3507C;ENSP00000323856:R3676C;ENSP00000347044:R3517C;ENSP00000348702:R3525C;ENSP00000388180:R3566C;ENSP00000434583:R3562C	ENSP00000323856:R3676C	R	-	1	0	0	PLEC	145065362	145065362	0.756000	0.28383	0.916000	0.36221	0.053000	0.15095	2.222000	0.42926	1.111000	0.41721	0.448000	0.29417	CGC	0.665370		TCGA-OE-A75W-01A-12D-A32N-08	0.597	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	0	0	1	2	20	5	2	1	1	1	1	217	217	217	213	1	1.770000	-2.025378	0	0.570000	NM_000445		0	9	9	0	1265	1246	0		0	0		1	0	217	0	0	0.027185	1.435946e-02	0	0	0	161	0	9	1265
MURC	347273	broad.mit.edu	37	9	103340638	103340638	+	Silent	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr9:103340638C>T	ENST00000307584.5	+	1	278	c.213C>T	c.(211-213)gaC>gaT	p.D71D	RN7SKP87_ENST00000364096.1_RNA	NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	71					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				TCCAGATTGACCTGTTGAAGC	0.418																																						ENST00000307584.5	0.140000	3.000000e-02	1.100000e-01	5.000000e-02	0.070000	0.086570	0.070000	0.080000																										0				16						c.(211-213)gaC>gaT		muscle-related coiled-coil protein							140.0	148.0	145.0					9																	103340638		2203	4300	6503	SO:0001819	synonymous_variant	347273	0	0					g.chr9:103340638C>T	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.213C>T	chr9.hg19:g.103340638C>T		0					RN7SKP87_ENST00000364096.1_RNA	p.D71D	NM_001018116.1	NP_001018126.1	0	0	0	2.021774	Q5BKX8	MURC_HUMAN		1	278	+		Acute lymphoblastic leukemia(62;0.0461)	B1PRL3|B4DT88	Silent	SNP	ENST00000307584.5	0	1	hg19	c.213C>T	CCDS35083.1	0																																																																																								0.544008		TCGA-OE-A75W-01A-12D-A32N-08	0.418	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053419.2	0	0	1	2	2	2	2	0	0	0	0	95	95	95	94	1	1.770000	-3.020032	1	0.570000	NM_001018116		0	12	13	0	482	471	0		1			0	0	95	0	0	0.999020	0	0	0	0	0	0	12	482
TNC	3371	broad.mit.edu	37	9	117791711	117791711	+	Missense_Mutation	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr9:117791711G>A	ENST00000350763.4	-	25	6508	c.6097C>T	c.(6097-6099)Cgc>Tgc	p.R2033C	TNC_ENST00000537320.1_Missense_Mutation_p.R1396C|TNC_ENST00000345230.3_Missense_Mutation_p.R1396C|TNC_ENST00000341037.4_Missense_Mutation_p.R1851C|TNC_ENST00000340094.3_Missense_Mutation_p.R1669C|TNC_ENST00000346706.3_Missense_Mutation_p.R1487C|TNC_ENST00000423613.2_Missense_Mutation_p.R1760C|TNC_ENST00000542877.1_Missense_Mutation_p.R1670C|TNC_ENST00000535648.1_Missense_Mutation_p.R1578C	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	2033	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AAGTTCTCGCGTCCGTTTTTG	0.463																																						ENST00000350763.4	0.140000	4.000000e-02	1.200000e-01	6.000000e-02	0.080000	0.094325	0.080000	0.090000																										0				120						c.(6097-6099)Cgc>Tgc		tenascin C							174.0	156.0	162.0					9																	117791711		2203	4300	6503	SO:0001583	missense	3371	9	121412	42				g.chr9:117791711G>A		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.6097C>T	chr9.hg19:g.117791711G>A	ENSP00000265131:p.Arg2033Cys	0					TNC_ENST00000535648.1_Missense_Mutation_p.R1578C|TNC_ENST00000346706.3_Missense_Mutation_p.R1487C|TNC_ENST00000345230.3_Missense_Mutation_p.R1396C|TNC_ENST00000423613.2_Missense_Mutation_p.R1760C|TNC_ENST00000340094.3_Missense_Mutation_p.R1669C|TNC_ENST00000341037.4_Missense_Mutation_p.R1851C|TNC_ENST00000542877.1_Missense_Mutation_p.R1670C|TNC_ENST00000537320.1_Missense_Mutation_p.R1396C	p.R2033C	NM_002160.3	NP_002151.2	0	0	0	1.991791	P24821	TENA_HUMAN		25	6508	-			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	0	1	hg19	c.6097C>T	CCDS6811.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.182544|3.182544	0.57800|0.57800	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877|ENST00000544972	T;T;T;T;T;T;T;T;T|.	0.21031|.	2.03;2.03;2.03;2.03;2.03;2.03;2.03;2.03;2.03|.	5.48|5.48	4.53|4.53	0.55603|0.55603	5.48|5.48	4.53|4.53	0.55603|0.55603	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);|.	0.340153|.	0.30401|.	N|.	0.009704|.	T|T	0.38054|0.38054	0.1026|0.1026	L|L	0.48362|0.48362	1.52|1.52	0.26177|0.26177	N|N	0.979773|0.979773	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.71414|.	0.973;0.93|.	T|T	0.32107|0.32107	-0.9919|-0.9919	10|5	0.72032|.	D|.	0.01|.	.|.	3.7527|3.7527	0.08573|0.08573	0.0839:0.1325:0.5337:0.2499|0.0839:0.1325:0.5337:0.2499	.|.	1760;2033|.	E9PC84;P24821|.	.;TENA_HUMAN|.	C|M	1669;1578;1487;1396;2033;1851;1760;1396;1670|595	ENSP00000344400:R1669C;ENSP00000438152:R1578C;ENSP00000344555:R1487C;ENSP00000345861:R1396C;ENSP00000265131:R2033C;ENSP00000339553:R1851C;ENSP00000411406:R1760C;ENSP00000443478:R1396C;ENSP00000442242:R1670C|.	ENSP00000344400:R1669C|.	R|T	-|-	1|2	0|0	0|0	TNC|TNC	116831532|116831532	116831532|116831532	0.934000|0.934000	0.31675|0.31675	0.986000|0.986000	0.45419|0.45419	0.442000|0.442000	0.32017|0.32017	4.235000|4.235000	0.58666|0.58666	2.587000|2.587000	0.87381|0.87381	0.655000|0.655000	0.94253|0.94253	CGC|ACG	0.538429		TCGA-OE-A75W-01A-12D-A32N-08	0.463	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	0	0	1	2	2	2	5	0	0	0	0	92	92	92	91	1	1.770000	-2.526147	1	0.570000	NM_002160		0	14	13	0	503	497	0		1	0	1	0	1	92	854	0	0.999735	8.195302e-01	9.989375e-01	0	14	115	704	14	503
OR1L4	254973	broad.mit.edu	37	9	125486388	125486388	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr9:125486388G>A	ENST00000259466.1	+	1	120	c.120G>A	c.(118-120)gcG>gcA	p.A40A		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A40A(1)		breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						TACTCACTGCGGTGGGGAATG	0.517																																						ENST00000259466.1	0.110000	2.000000e-02	9.000000e-02	4.000000e-02	0.060000	0.068434	0.060000	0.070000																										1	Substitution - coding silent(1)	p.A40A(1)	lung(1)	20						c.(118-120)gcG>gcA		olfactory receptor, family 1, subfamily L, member 4							200.0	182.0	188.0					9																	125486388		2203	4300	6503	SO:0001819	synonymous_variant	254973	0	0					g.chr9:125486388G>A		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.120G>A	chr9.hg19:g.125486388G>A		0						p.A40A	NM_001005235.1	NP_001005235.1	0	0	0	1.991791	Q8NGR5	OR1L4_HUMAN		1	120	+			Q6IFN0|Q96R81	Silent	SNP	ENST00000259466.1	0	1	hg19	c.120G>A	CCDS35129.1	0																																																																																								0.538429		TCGA-OE-A75W-01A-12D-A32N-08	0.517	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1	0	0	1	2	2	2	2	0	0	0	0	120	120	120	118	1	1.770000	-2.050768	0	0.570000			0	12	12	0	606	593	0		1			0	0	120	0	0	0.999004	0	0	0	0	0	0	12	606
GOLGA1	2800	broad.mit.edu	37	9	127644234	127644234	+	Splice_Site	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr9:127644234C>T	ENST00000373555.4	-	21	2299		c.e21-1			NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1						protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						GTCTGATTTTCTGAAAAACCA	0.493																																						ENST00000373555.4	0.500000	2.400000e-01	4.400000e-01	3.000000e-01	0.360000	0.373781	0.360000	0.370000																										0				20						c.e21-1		golgin A1							87.0	86.0	86.0					9																	127644234		2203	4300	6503	SO:0001630	splice_region_variant	2800	0	0					g.chr9:127644234C>T	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.1966-1G>A	chr9.hg19:g.127644234C>T		0							NM_002077.3	NP_002068	0	0	0	1.991791	Q92805	GOGA1_HUMAN		21	2299	-			Q5T164|Q8IYZ9	Splice_Site	SNP	ENST00000373555.4	1	1	hg19		CCDS6860.1	0	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633014	0.87660	.	.	ENSG00000136935	ENST00000373555	.	.	.	5.81	5.81	0.92471	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.051	0.93046	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	GOLGA1	126684055	126684055	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.772000	0.55325	2.745000	0.94114	0.655000	0.94253	.	0.538429		TCGA-OE-A75W-01A-12D-A32N-08	0.493	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.770000	-20.000000	1	0.570000	NM_002077	Intron	0	27	27	0	215	215	1		1	0		0	0	41	0	0	1.000000	0	0	1	0	0	0	27	215
CDKN2A	1029	broad.mit.edu	37	9	21971111	21971111	+	Missense_Mutation	SNP	G	G	A	rs121913385		TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr9:21971111G>A	ENST00000304494.5	-	2	517	c.247C>T	c.(247-249)Cac>Tac	p.H83Y	CDKN2A_ENST00000579122.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000494262.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000530628.2_Missense_Mutation_p.A97V|CDKN2A_ENST00000497750.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.A97V|CDKN2A_ENST00000498628.2_Missense_Mutation_p.H32Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000498124.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.A138V|CDKN2A_ENST00000479692.2_Missense_Mutation_p.H32Y	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	83			H -> N (in a lung tumor).|H -> Q (in dbSNP:rs34968276).|H -> Y (in a pancreas and a head and neck tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.H83Y(30)|p.A138V(2)|p.H83fs*2(2)|p.H83N(1)|p.V82fs*62(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCAGCGTCGTGCACGGGTCGG	0.741	H83Y(CALU3_LUNG)|H83Y(HS944T_SKIN)|H83Y(JHH2_LIVER)|H83Y(OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|H83Y(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	8.200000e-01	9.900000e-01	8.900000e-01	0.950000	0.945383	0.950000	0.990000	H83Y(CALU3_LUNG)|H83Y(HS944T_SKIN)|H83Y(JHH2_LIVER)|H83Y(OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|H83Y(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	17																								1403	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(33)|Deletion - Frameshift(6)|Deletion - In frame(3)|Complex - deletion inframe(1)	p.0?(1315)|p.?(44)|p.H83Y(30)|p.A138V(2)|p.H83fs*2(2)|p.H83N(1)|p.V82fs*62(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)	haematopoietic_and_lymphoid_tissue(284)|skin(175)|central_nervous_system(171)|lung(154)|urinary_tract(93)|bone(74)|oesophagus(59)|soft_tissue(58)|upper_aerodigestive_tract(56)|pleura(51)|ovary(36)|pancreas(34)|breast(33)|kidney(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	4199	GRCh37	CM053801|CM056557	CDKN2A	M	rs121913385	c.(247-249)Cac>Tac		cyclin-dependent kinase inhibitor 2A							12.0	15.0	14.0					9																	21971111		2176	4259	6435	SO:0001583	missense	1029	0	0					g.chr9:21971111G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.247C>T	chr9.hg19:g.21971111G>A	ENSP00000307101:p.His83Tyr	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.A97V|CDKN2A_ENST00000498124.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.A97V|CDKN2A_ENST00000494262.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000497750.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.A138V|CDKN2A_ENST00000498628.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000579122.1_Missense_Mutation_p.H83Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Missense_Mutation_p.H32Y	p.H83Y	NM_000077.4	NP_000068.1	0	1	1	1.541195	P42771	CD2A1_HUMAN		2	517	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	1	1	hg19	c.247C>T	CCDS6510.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.762523|4.762523	0.89932|0.89932	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|T;T	0.80393|0.71222	-1.37;-1.31|-0.55;-0.55	5.93|5.93	5.93|5.93	0.95920|0.95920	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Ankyrin repeat-containing domain (4);	0.000000|.	0.37261|.	N|.	0.002164|.	T|T	0.77579|0.77579	0.4151|0.4151	L|L	0.27053|0.27053	0.805|0.805	0.46521|0.46521	D|D	0.999085|0.999085	P|D	0.47191|0.76494	0.891|0.999	B|D	0.44044|0.75484	0.439|0.986	T|T	0.79024|0.79024	-0.1972|-0.1972	10|9	0.62326|0.66056	D|D	0.03|0.02	-15.192|-15.192	19.1026|19.1026	0.93279|0.93279	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	138|83	Q8N726|P42771	CD2A2_HUMAN|CD2A1_HUMAN	V|Y	138;97|83	ENSP00000355153:A138V;ENSP00000432664:A97V|ENSP00000307101:H83Y;ENSP00000394932:H83Y	ENSP00000355153:A138V|ENSP00000307101:H83Y	A|H	-|-	2|1	0|0	0|0	CDKN2A|CDKN2A	21961111|21961111	21961111|21961111	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	8.665000|8.665000	0.91144|0.91144	2.803000|2.803000	0.96430|0.96430	0.650000|0.650000	0.86243|0.86243	GCA|CAC	0.398601		TCGA-OE-A75W-01A-12D-A32N-08	0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	35	35	35	30	1	1.770000	-20.000000	1	0.570000	NM_000077		0	60	54	0	78	67	0		1	1	1	0	0	35	109	0	1.000000	1	1	307	39	15	53	60	78
NOTCH1	4851	broad.mit.edu	37	9	139412298	139412298	+	Silent	SNP	G	G	A			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chr9:139412298G>A	ENST00000277541.6	-	8	1422	c.1347C>T	c.(1345-1347)tgC>tgT	p.C449C	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	449	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CGTCGATCTCGCATCGGGGGC	0.647			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												ENST00000277541.6	0.980000	6.900000e-01	9.100000e-01	7.600000e-01	0.830000	0.840585	0.830000	0.830000				Dom	yes			Dom	yes		9	9q34.3	9q34.3	4851	T, Mis, O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""				L	L	TRB@		T-ALL		0				1359						c.(1345-1347)tgC>tgT		notch 1							51.0	58.0	56.0					9																	139412298		2180	4271	6451	SO:0001819	synonymous_variant	4851	0	0					g.chr9:139412298G>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1347C>T	chr9.hg19:g.139412298G>A		0	HNSCC(8;0.001)				MIR4673_ENST00000584777.1_RNA	p.C449C	NM_017617.3	NP_060087.3	0	0	0	1.991791	P46531	NOTC1_HUMAN		8	1422	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	1	1	hg19	c.1347C>T	CCDS43905.1	0																																																																																								0.538429		TCGA-OE-A75W-01A-12D-A32N-08	0.647	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	1	0	1	2	2	2	2	0	0	0	0	89	89	89	87	1	1.770000	-5.695908	1	0.570000	NM_017617		0	97	97	0	281	279	1		1			0	0	89	0	0	1.000000	0	0	0	0	0	0	97	281
ARHGAP4	393	broad.mit.edu	37	X	153187163	153187163	+	Missense_Mutation	SNP	C	C	T			TCGA-OE-A75W-01A-12D-A32N-08	TCGA-OE-A75W-10A-01D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fcfcc363-8ced-4979-967d-b42dac3fac8b	86bdd531-09be-40db-b941-b7a4273bdf4e	g.chrX:153187163C>T	ENST00000350060.5	-	2	208	c.167G>A	c.(166-168)cGc>cAc	p.R56H	ARHGAP4_ENST00000370028.3_Missense_Mutation_p.R56H|ARHGAP4_ENST00000393721.1_Missense_Mutation_p.R56H|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.R56H|ARHGAP4_ENST00000537206.1_Missense_Mutation_p.R33H	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	56	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCTCAGCGCGGCGCCGCAT	0.697																																						ENST00000350060.5	1.000000	7.000000e-01	9.700000e-01	8.000000e-01	0.900000	0.893053	0.900000	0.970000																										0				14						c.(166-168)cGc>cAc		Rho GTPase activating protein 4							9.0	10.0	10.0					X																	153187163		2187	4263	6450	SO:0001583	missense	393	1	120410	25				g.chrX:153187163C>T	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.167G>A	chrX.hg19:g.153187163C>T	ENSP00000203786:p.Arg56His						ARHGAP4_ENST00000393721.1_Missense_Mutation_p.R56H|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.R56H|ARHGAP4_ENST00000370028.3_Missense_Mutation_p.R56H|ARHGAP4_ENST00000537206.1_Missense_Mutation_p.R33H	p.R56H	NM_001666.4	NP_001657.3	0	1	1		P98171	RHG04_HUMAN		2	208	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	0	1	hg19	c.167G>A	CCDS14736.1	1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885319	0.51908	.	.	ENSG00000089820	ENST00000393721;ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206;ENST00000442262;ENST00000422091	T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.08	5.08	0.68730	5.08	5.08	0.68730	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.41194	D	0.000933	T	0.64853	0.2636	L	0.60455	1.87	0.19775	N	0.99996	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.58702	-0.7590	10	0.87932	D	0	.	7.4388	0.27171	0.0:0.8068:0.0:0.1932	.	56;56	Q86UY3;P98171	.;RHG04_HUMAN	H	56;56;56;56;33;33;33	ENSP00000377322:R56H;ENSP00000359045:R56H;ENSP00000203786:R56H;ENSP00000359033:R56H;ENSP00000444169:R33H;ENSP00000398259:R33H;ENSP00000413782:R33H	ENSP00000203786:R56H	R	-	2	0	0	ARHGAP4	152840357	152840357	0.630000	0.27155	0.141000	0.22245	0.297000	0.27493	2.726000	0.47302	2.262000	0.75019	0.436000	0.28706	CGC	0.570000		TCGA-OE-A75W-01A-12D-A32N-08	0.697	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.770000	-20.000000	1	0.570000	NM_001666		0	29	29	0	23	23	1		1	0		0	0	10	0	0	1.000000	9.926918e-01	0	0	0	10	0	29	23
