#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PAPSS2	9060	broad.mit.edu	37	10	89503202	89503202	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr10:89503202G>A	ENST00000361175.4	+	10	1649	c.1280G>A	c.(1279-1281)cGc>cAc	p.R427H	PAPSS2_ENST00000427144.2_Missense_Mutation_p.R431H|PAPSS2_ENST00000456849.1_Missense_Mutation_p.R432H	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	427					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		GACACTCGCCGCAGGCTCCTA	0.582																																						ENST00000361175.4	1.000000	0.090000	5.100000e-01	1.600000e-01	0.270000	0.367717	0.270000	0.220000																										0				20						c.(1279-1281)cGc>cAc		3'-phosphoadenosine 5'-phosphosulfate synthase 2							108.0	104.0	106.0					10																	89503202		2203	4300	6503	SO:0001583	missense	9060	1	121412	33				g.chr10:89503202G>A	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1280G>A	chr10.hg19:g.89503202G>A	ENSP00000354436:p.Arg427His	0					PAPSS2_ENST00000456849.1_Missense_Mutation_p.R432H|PAPSS2_ENST00000427144.2_Missense_Mutation_p.R431H	p.R427H	NM_004670.3	NP_004661.2	1	2	3	2.001811	O95340	PAPS2_HUMAN		10	1649	+		Melanoma(5;0.019)|Colorectal(252;0.123)	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	0	1	hg19	c.1280G>A	CCDS7385.1	0	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333777	0.81801	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.31247	1.5;1.5;1.5	5.33	3.49	0.39957	5.33	3.49	0.39957	Sulphate adenylyltransferase (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.094954	0.85682	D	0.000000	T	0.52517	0.1739	M	0.76328	2.33	0.58432	D	0.999998	D;D	0.89917	0.998;1.0	D;D	0.79784	0.938;0.993	T	0.53194	-0.8473	10	0.52906	T	0.07	-19.4179	11.5618	0.50780	0.1428:0.0:0.8572:0.0	.	427;432	O95340;O95340-2	PAPS2_HUMAN;.	H	427;432;431;431	ENSP00000354436:R427H;ENSP00000406157:R432H;ENSP00000397123:R431H	ENSP00000354436:R427H	R	+	2	0	0	PAPSS2	89493182	89493182	1.000000	0.71417	0.027000	0.17364	0.993000	0.82548	9.257000	0.95545	0.826000	0.34661	0.561000	0.74099	CGC	0.096909		TCGA-Q3-A5QY-01A-12D-A32N-08	0.582	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1	0	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	2.020000	-2.145249	0	0.090000			0	5	5	0	479	472	0		1	0		0	0	105	0	0	9.354227e-01	5.741555e-02	0	0	0	29	0	5	479
FAM111B	374393	broad.mit.edu	37	11	58892674	58892674	+	Silent	SNP	G	G	A	rs371989300		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr11:58892674G>A	ENST00000343597.3	+	4	1295	c.1104G>A	c.(1102-1104)ccG>ccA	p.P368P	FAM111B_ENST00000529618.1_Silent_p.P338P|FAM111B_ENST00000411426.1_Silent_p.P338P	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	368							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						GACGGAGGCCGCATCTGGGTA	0.383																																						ENST00000343597.3	1.000000	0.070000	4.600000e-01	1.300000e-01	0.220000	0.336839	0.220000	0.190000																										0				40						c.(1102-1104)ccG>ccA		family with sequence similarity 111, member B		G	,,	1,4401	2.1+/-5.4	0,1,2200	68.0	75.0	73.0		1014,1014,1104	-0.8	0.0	11		73	0,8588		0,0,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	FAM111B	NM_001142703.1,NM_001142704.1,NM_198947.3	,,	0,1,6494	AA,AG,GG		0.0,0.0227,0.0077	,,	338/705,338/705,368/735	58892674	1,12989	2201	4294	6495	SO:0001819	synonymous_variant	374393	1	121412	37				g.chr11:58892674G>A	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1104G>A	chr11.hg19:g.58892674G>A		0					FAM111B_ENST00000529618.1_Silent_p.P338P|FAM111B_ENST00000411426.1_Silent_p.P338P	p.P368P	NM_198947.3	NP_945185.1	1	2	3	2.004856	Q6SJ93	F111B_HUMAN		4	1295	+			B4E2G2|Q6P661	Silent	SNP	ENST00000343597.3	0	1	hg19	c.1104G>A	CCDS7972.1	0																																																																																								0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.383	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	0	0	1	2	2	2	2	0	0	0	0	114	114	114	114	1	2.020000	-2.109569	0	0.090000	NM_198947		0	5	5	0	584	584	0		1	0		0	0	114	0	0	9.377790e-01	1.164528e-03	0	0	0	5	0	5	584
HEPHL1	341208	broad.mit.edu	37	11	93800764	93800764	+	Missense_Mutation	SNP	A	A	G			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr11:93800764A>G	ENST00000315765.9	+	5	919	c.911A>G	c.(910-912)cAt>cGt	p.H304R		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	304	Plastocyanin-like 2.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ATAGACATCCATTCTATCTAT	0.463																																						ENST00000315765.9	1.000000	0.180000	6.000000e-01	2.600000e-01	0.360000	0.450809	0.360000	0.330000																										0				61						c.(910-912)cAt>cGt		hephaestin-like 1							178.0	178.0	178.0					11																	93800764		1953	4138	6091	SO:0001583	missense	341208	0	0					g.chr11:93800764A>G	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.911A>G	chr11.hg19:g.93800764A>G	ENSP00000313699:p.His304Arg	0						p.H304R	NM_001098672.1	NP_001092142.1	1	2	3	2.004856	Q6MZM0	HPHL1_HUMAN		5	919	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	0	1	hg19	c.911A>G	CCDS44710.1	0	.	.	.	.	.	.	.	.	.	.	A	23.4	4.413281	0.83449	.	.	ENSG00000181333	ENST00000315765	D	0.99824	-6.96	5.36	5.36	0.76844	5.36	5.36	0.76844	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99866	0.9937	M	0.93978	3.48	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96432	0.9320	10	0.87932	D	0	.	15.6458	0.77049	1.0:0.0:0.0:0.0	.	304	Q6MZM0	HPHL1_HUMAN	R	304	ENSP00000313699:H304R	ENSP00000313699:H304R	H	+	2	0	0	HEPHL1	93440412	93440412	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.991000	0.93514	2.158000	0.67659	0.459000	0.35465	CAT	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.463	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	0	0	1	2	2	2	2	0	0	0	0	157	157	157	157	1	2.020000	-8.619136	1	0.090000	XM_291947		0	12	12	0	792	787	0		1	0		0	0	157	0	0	9.990811e-01	2.791171e-04	0	0	0	2	0	12	792
LRTM2	654429	broad.mit.edu	37	12	1943759	1943759	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr12:1943759G>A	ENST00000543818.1	+	5	1827	c.985G>A	c.(985-987)Gct>Act	p.A329T	LRTM2_ENST00000535041.1_Missense_Mutation_p.A329T|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.A329T|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	329						integral component of membrane (GO:0016021)		p.A329T(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GGTGGTGGCCGCTGCCTATGG	0.662																																						ENST00000543818.1	0.620000	0.110000	4.600000e-01	1.900000e-01	0.310000	0.337160	0.310000	0.280000																										1	Substitution - Missense(1)	p.A329T(1)	endometrium(1)	20						c.(985-987)Gct>Act		leucine-rich repeats and transmembrane domains 2							47.0	43.0	44.0					12																	1943759		2193	4271	6464	SO:0001583	missense	654429	1	121182	35				g.chr12:1943759G>A	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.985G>A	chr12.hg19:g.1943759G>A	ENSP00000446278:p.Ala329Thr	0					LRTM2_ENST00000535041.1_Missense_Mutation_p.A329T|LRTM2_ENST00000543730.1_3'UTR|LRTM2_ENST00000299194.1_Missense_Mutation_p.A329T|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000382722.5_Intron	p.A329T	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	0	1	1	1.995946	Q8N967	LRTM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000834)	5	1827	+	Ovarian(42;0.107)		A7E2U6	Missense_Mutation	SNP	ENST00000543818.1	0	1	hg19	c.985G>A	CCDS31726.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.13|17.13	3.309844|3.309844	0.60414|0.60414	.|.	.|.	ENSG00000166159|ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041|ENST00000424079	T;T;T|.	0.59502|.	0.26;0.26;0.26|.	5.44|5.44	4.55|4.55	0.56014|0.56014	5.44|5.44	4.55|4.55	0.56014|0.56014	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71626|0.71626	0.3362|0.3362	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.68765|.	0.96|.	T|T	0.75010|0.75010	-0.3468|-0.3468	10|6	0.87932|0.87932	D|D	0|0	.|.	14.1474|14.1474	0.65360|0.65360	0.072:0.0:0.928:0.0|0.072:0.0:0.928:0.0	.|.	329|.	Q8N967|.	LRTM2_HUMAN|.	T|H	329|85	ENSP00000446278:A329T;ENSP00000299194:A329T;ENSP00000444737:A329T|.	ENSP00000299194:A329T|ENSP00000394967:R85H	A|R	+|+	1|2	0|0	0|0	LRTM2|LRTM2	1814020|1814020	1814020|1814020	1.000000|1.000000	0.71417|0.71417	0.934000|0.934000	0.37439|0.37439	0.010000|0.010000	0.07245|0.07245	9.869000|9.869000	0.99810|0.99810	1.302000|1.302000	0.44855|0.44855	-0.136000|-0.136000	0.14681|0.14681	GCT|CGC	0.082985		TCGA-Q3-A5QY-01A-12D-A32N-08	0.662	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1	0	0	0	2	2	2	2	0	0	0	0	95	95	95	95	1	2.020000	-4.419615	1	0.090000			0	5	4	0	374	370	0		1			0	0	95	0	0	9.357360e-01	0	0	0	0	0	0	5	374
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.890000	0.030000	5.600000e-01	1.200000e-01	0.280000	0.346071	0.280000	0.180000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	1	1	1.995946	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4			hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.082985		TCGA-Q3-A5QY-01A-12D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1		0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	2.020000	-3.209571	1	0.090000	NM_033360		133	1	1	7882	111	110		1	0	0	1	0	0	22	803	9.994317e-01	4.932735e-01	1.341435e-03	6.835965e-01	0	2	3	186	1	111
HERC2	8924	broad.mit.edu	37	15	28377973	28377973	+	Silent	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr15:28377973C>T	ENST00000261609.7	-	80	12342	c.12234G>A	c.(12232-12234)ccG>ccA	p.P4078P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGCGGTCACACGGACTGCAAA	0.463																																						ENST00000261609.7			0	0																														0				204						c.(12232-12234)ccG>ccA		HECT and RLD domain containing E3 ubiquitin protein ligase 2							64.0	70.0	68.0					15																	28377973		2203	4300	6503	SO:0001819	synonymous_variant	8924	3	121396	41				g.chr15:28377973C>T	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12234G>A	chr15.hg19:g.28377973C>T								p.P4078P	NM_004667.5	NP_004658.3								80	12342	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		Silent	SNP	ENST00000261609.7	0	1	hg19	c.12234G>A	CCDS10021.1																																																																																											TCGA-Q3-A5QY-01A-12D-A32N-08	0.463	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	0	0	1	2	2	2	2	0	0	0	0	121	121	121	118	1	2.020000	-2.416385	0	0.090000	NM_004667		0	5	5	0	570	560	0		1	0		0	0	121	0	0	9.348647e-01	2.850161e-02	0	0	0	24	0	5	570
CA12	771	broad.mit.edu	37	15	63632565	63632565	+	Silent	SNP	C	C	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr15:63632565C>A	ENST00000178638.3	-	7	1109	c.669G>T	c.(667-669)ggG>ggT	p.G223G	CA12_ENST00000422263.2_Silent_p.G163G|CA12_ENST00000344366.3_Silent_p.G223G	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	223					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	TGGTCAGGGACCCCCGGTAGC	0.562																																						ENST00000178638.3	1.000000	0.210000	8.600000e-01	3.300000e-01	0.500000	0.560459	0.500000	0.430000																										0				16						c.(667-669)ggG>ggT		carbonic anhydrase XII	Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)						77.0	73.0	75.0					15																	63632565		2203	4300	6503	SO:0001819	synonymous_variant	771	0	0					g.chr15:63632565C>A	AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.669G>T	chr15.hg19:g.63632565C>A		0					CA12_ENST00000422263.2_Silent_p.G163G|CA12_ENST00000344366.3_Silent_p.G223G	p.G223G	NM_001218.3	NP_001209.1	1	2	3	2.000691	O43570	CAH12_HUMAN		7	1109	-			B2RE24|Q53YE5|Q9BWG2	Silent	SNP	ENST00000178638.3	0	1	hg19	c.669G>T	CCDS10185.1	0																																																																																								0.096909		TCGA-Q3-A5QY-01A-12D-A32N-08	0.562	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	0	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	2.020000	-3.223503	1	0.090000	NM_001218		0	7	7	0	344	340	0		1	0		0	0	78	0	0	9.800639e-01	0	0	0	0	1	0	7	344
GRIN2A	2903	broad.mit.edu	37	16	10274159	10274159	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr16:10274159G>A	ENST00000396573.2	-	3	419	c.110C>T	c.(109-111)gCg>gTg	p.A37V	GRIN2A_ENST00000396575.2_Missense_Mutation_p.A37V|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A37V|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A37V|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A37V	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	37					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CAGCATCACCGCAATATTTAG	0.692																																						ENST00000396573.2	1.000000	0.110000	1	1.900000e-01	0.320000	0.434096	0.320000	0.270000																										0				198						c.(109-111)gCg>gTg		glutamate receptor, ionotropic, N-methyl D-aspartate 2A	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)						33.0	38.0	36.0					16																	10274159		2196	4296	6492	SO:0001583	missense	2903	0	0					g.chr16:10274159G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.110C>T	chr16.hg19:g.10274159G>A	ENSP00000379818:p.Ala37Val	0					GRIN2A_ENST00000396575.2_Missense_Mutation_p.A37V|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A37V|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A37V|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A37V	p.A37V	NM_000833.3	NP_000824.1	1	2	3	2.014171	Q12879	NMDE1_HUMAN		3	419	-			O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	0	1	hg19	c.110C>T	CCDS10539.1	0	.	.	.	.	.	.	.	.	.	.	G	37	6.015957	0.97205	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	4.54	4.54	0.55810	4.54	4.54	0.55810	.	0.140584	0.45361	N	0.000378	D	0.91439	0.7298	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.85130	0.997;0.87;0.983	D	0.91038	0.4869	9	.	.	.	.	16.2901	0.82747	0.0:0.0:1.0:0.0	.	37;37;37	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	V	37	ENSP00000379818:A37V;ENSP00000385872:A37V;ENSP00000332549:A37V;ENSP00000379820:A37V	.	A	-	2	0	0	GRIN2A	10181660	10181660	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.557000	0.98129	2.088000	0.63022	0.561000	0.74099	GCG	0.099723		TCGA-Q3-A5QY-01A-12D-A32N-08	0.692	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3	0	0	1	2	16	2	2	1	1	1	1	95	95	95	93	1	2.020000	-2.708509	1	0.090000			0	5	5	0	412	406	0		0			1	0	95	0	0	1.118170e-02	0	0	0	0	0	0	5	412
MYH11	4629	broad.mit.edu	37	16	15865513	15865513	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr16:15865513G>A	ENST00000300036.5	-	9	1055	c.946C>T	c.(946-948)Ccc>Tcc	p.P316S	MYH11_ENST00000576790.2_Missense_Mutation_p.P316S|MYH11_ENST00000396324.3_Missense_Mutation_p.P323S|MYH11_ENST00000452625.2_Missense_Mutation_p.P323S	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	316	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GCTGGGATGGGCACAAAGCCA	0.517			T	CBFB	AML																																	ENST00000300036.5	1.000000	0.150000	1	2.500000e-01	0.410000	0.505948	0.410000	0.340000				Dom	yes			Dom	yes		16	16p13.13-p13.12	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""				L	L	CBFB		AML		0				123						c.(946-948)Ccc>Tcc		myosin, heavy chain 11, smooth muscle							118.0	97.0	104.0					16																	15865513		2197	4300	6497	SO:0001583	missense	4629	0	0					g.chr16:15865513G>A	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.946C>T	chr16.hg19:g.15865513G>A	ENSP00000300036:p.Pro316Ser	0					MYH11_ENST00000576790.2_Missense_Mutation_p.P316S|MYH11_ENST00000452625.2_Missense_Mutation_p.P323S|MYH11_ENST00000396324.3_Missense_Mutation_p.P323S	p.P316S	NM_002474.2	NP_002465.1	1	2	3	2.014171	P35749	MYH11_HUMAN		9	1055	-			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	0	1	hg19	c.946C>T	CCDS10565.1	0	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854428	0.51376	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16	5.43	5.43	0.79202	5.43	5.43	0.79202	Myosin head, motor domain (2);	0.148440	0.47852	D	0.000204	T	0.75642	0.3877	N	0.04335	-0.225	0.52501	D	0.999951	B;B;B;B;B;B	0.10296	0.0;0.001;0.001;0.001;0.001;0.003	B;B;B;B;B;B	0.17098	0.007;0.017;0.017;0.017;0.017;0.017	T	0.69774	-0.5054	10	0.30854	T	0.27	.	17.7989	0.88580	0.0:0.0:1.0:0.0	.	323;316;316;323;316;323	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	S	316;316;323;323;323	ENSP00000300036:P316S;ENSP00000345136:P316S;ENSP00000379616:P323S;ENSP00000407821:P323S	ENSP00000300036:P316S	P	-	1	0	0	MYH11	15773014	15773014	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	3.491000	0.53252	2.538000	0.85594	0.561000	0.74099	CCC	0.099723		TCGA-Q3-A5QY-01A-12D-A32N-08	0.517	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	2.020000	-2.240150	0	0.090000	NM_001040113		0	5	5	0	319	319	0		1	0		0	0	61	0	0	9.380095e-01	1.111103e-01	0	0	0	30	0	5	319
CX3CL1	6376	broad.mit.edu	37	16	57415974	57415974	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr16:57415974C>T	ENST00000006053.6	+	3	335	c.224C>T	c.(223-225)gCc>gTc	p.A75V	CX3CL1_ENST00000563383.1_Missense_Mutation_p.A81V|CX3CL1_ENST00000564948.1_Missense_Mutation_p.P35S|CX3CL1_ENST00000565912.1_Missense_Mutation_p.A37V	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	75	Chemokine.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CTGTTCTGTGCCGACCCGAAG	0.602																																						ENST00000006053.6	1.000000	0.110000	1	2.000000e-01	0.330000	0.440304	0.330000	0.270000																										0				5						c.(223-225)gCc>gTc		chemokine (C-X3-C motif) ligand 1							65.0	65.0	65.0					16																	57415974		2198	4300	6498	SO:0001583	missense	6376	0	0					g.chr16:57415974C>T	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.224C>T	chr16.hg19:g.57415974C>T	ENSP00000006053:p.Ala75Val	0					CX3CL1_ENST00000564948.1_Missense_Mutation_p.P35S|CX3CL1_ENST00000563383.1_Missense_Mutation_p.A81V|CX3CL1_ENST00000565912.1_Missense_Mutation_p.A37V	p.A75V	NM_002996.3	NP_002987.1	1	2	3	2.014171	P78423	X3CL1_HUMAN		3	335	+			O00672	Missense_Mutation	SNP	ENST00000006053.6	0	1	hg19	c.224C>T	CCDS10779.1	0	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392360	0.62066	.	.	ENSG00000006210	ENST00000006053	T	0.05580	3.42	5.45	5.45	0.79879	5.45	5.45	0.79879	Chemokine interleukin-8-like domain (3);	0.000000	0.64402	D	0.000012	T	0.27169	0.0666	M	0.81682	2.555	0.41670	D	0.989234	D	0.89917	1.0	D	0.91635	0.999	T	0.00992	-1.1488	10	0.87932	D	0	-33.9119	14.8416	0.70230	0.0:1.0:0.0:0.0	.	75	P78423	X3CL1_HUMAN	V	75	ENSP00000006053:A75V	ENSP00000006053:A75V	A	+	2	0	0	CX3CL1	55973475	55973475	0.995000	0.38212	0.953000	0.39169	0.012000	0.07955	3.478000	0.53158	2.560000	0.86352	0.555000	0.69702	GCC	0.099723		TCGA-Q3-A5QY-01A-12D-A32N-08	0.602	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	0	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	2.020000	-2.472070	0	0.090000	NM_002996		0	5	5	0	402	395	0		1	0		0	0	89	0	0	9.350197e-01	1.036845e-01	0	1	0	35	0	5	402
MED1	5469	broad.mit.edu	37	17	37564496	37564496	+	Silent	SNP	G	G	A	rs569240327		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr17:37564496G>A	ENST00000300651.6	-	17	4201	c.3978C>T	c.(3976-3978)gaC>gaT	p.D1326D	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CCATCTGGCCGTCCAGTGGGT	0.512										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	ENST00000300651.6	0.440000	0.090000	3.300000e-01	1.500000e-01	0.220000	0.247136	0.220000	0.210000																										0				59						c.(3976-3978)gaC>gaT		mediator complex subunit 1							85.0	93.0	90.0					17																	37564496		2203	4299	6502	SO:0001819	synonymous_variant	5469	1	121408	30				g.chr17:37564496G>A	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3978C>T	chr17.hg19:g.37564496G>A		0	HNSCC(31;0.082)				CTB-131K11.1_ENST00000582842.1_RNA|MED1_ENST00000394287.3_Intron	p.D1326D	NM_004774.3	NP_004765.2	0	1	1	1.993443	O95243	MBD4_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	17	4201	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Silent	SNP	ENST00000300651.6	0	1	hg19	c.3978C>T	CCDS11336.1	0																																																																																								0.082569		TCGA-Q3-A5QY-01A-12D-A32N-08	0.512	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	0	0	1	2	2	2	2	0	0	0	0	123	123	123	123	1	2.020000	-2.284553	0	0.090000	NM_004774		0	6	6	0	605	600	0		1	0		0	0	123	0	0	9.642096e-01	2.378175e-02	0	0	0	20	0	6	605
CALCOCO2	10241	broad.mit.edu	37	17	46926637	46926637	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr17:46926637G>A	ENST00000258947.3	+	5	542	c.441G>A	c.(439-441)caG>caA	p.Q147Q	CALCOCO2_ENST00000509507.1_Silent_p.Q168Q|CALCOCO2_ENST00000416445.2_Intron|CALCOCO2_ENST00000448105.2_Silent_p.Q171Q|CALCOCO2_ENST00000508679.1_Silent_p.Q75Q	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	147					response to interferon-gamma (GO:0034341)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	15						AGATTGAGCAGCACAACAAGG	0.468																																						ENST00000258947.3	1.000000	0.130000	1	2.100000e-01	0.320000	0.442599	0.320000	0.280000																										0				15						c.(439-441)caG>caA		calcium binding and coiled-coil domain 2							128.0	128.0	128.0					17																	46926637		2203	4300	6503	SO:0001819	synonymous_variant	10241	0	0					g.chr17:46926637G>A	BC004130	CCDS11538.1, CCDS58558.1, CCDS58559.1, CCDS58560.1, CCDS58561.1	17q21.32	2006-02-09				ENSG00000136436			29912	protein-coding gene	gene with protein product		604587				7540613	Standard	NM_001261390		Approved	MGC17318, NDP52	uc010wlr.3	Q13137		ENST00000258947.3:c.441G>A	chr17.hg19:g.46926637G>A		0					CALCOCO2_ENST00000508679.1_Silent_p.Q75Q|CALCOCO2_ENST00000448105.2_Silent_p.Q171Q|CALCOCO2_ENST00000509507.1_Silent_p.Q168Q|CALCOCO2_ENST00000416445.2_Intron	p.Q147Q	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	1	2	3	2.021229	Q13137	CACO2_HUMAN		5	542	+			B2RBT0|B4DDC4|B4DDT4|B4DP36|B4E0C0|E7ENK0|E7ETP5|E9PBE5|Q53FQ5|Q53HB5|Q6IBN9|Q9BTF7	Silent	SNP	ENST00000258947.3	0	1	hg19	c.441G>A	CCDS11538.1	0																																																																																								0.101323		TCGA-Q3-A5QY-01A-12D-A32N-08	0.468	CALCOCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360866.1	0	0	1	2	2	2	2	0	0	0	0	121	121	121	121	1	2.020000	-2.445085	0	0.090000	NM_005831		0	7	7	0	565	560	0		1	0		0	0	121	0	0	9.800953e-01	4.992739e-01	0	0	0	125	0	7	565
DSG2	1829	broad.mit.edu	37	18	29122723	29122723	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr18:29122723G>A	ENST00000261590.8	+	14	2451	c.2242G>A	c.(2242-2244)Gca>Aca	p.A748T	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	748					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CACGAAGACCGCAAGGGCCAC	0.517																																						ENST00000261590.8	0.470000	0.100000	3.500000e-01	1.600000e-01	0.240000	0.262399	0.240000	0.220000																										0				49						c.(2242-2244)Gca>Aca		desmoglein 2							88.0	94.0	92.0					18																	29122723		2045	4203	6248	SO:0001583	missense	1829	4	120998	37				g.chr18:29122723G>A	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.2242G>A	chr18.hg19:g.29122723G>A	ENSP00000261590:p.Ala748Thr	0					RP11-75N4.2_ENST00000583706.1_RNA	p.A748T	NM_001943.3	NP_001934.2	0	1	1	1.995421	Q14126	DSG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0068)	14	2451	+			Q4KKU6	Missense_Mutation	SNP	ENST00000261590.8	0	1	hg19	c.2242G>A	CCDS42423.1	0	.	.	.	.	.	.	.	.	.	.	g	4.453	0.083827	0.08583	.	.	ENSG00000046604	ENST00000261590	T	0.58506	0.33	5.97	-2.61	0.06171	5.97	-2.61	0.06171	.	1.161370	0.06133	N	0.671107	T	0.20740	0.0499	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24119	-1.0169	10	0.02654	T	1	.	2.1079	0.03695	0.1819:0.1398:0.4044:0.274	.	748	Q14126	DSG2_HUMAN	T	748	ENSP00000261590:A748T	ENSP00000261590:A748T	A	+	1	0	0	DSG2	27376721	27376721	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.708000	0.05035	-0.360000	0.08138	-0.285000	0.09966	GCA	0.082985		TCGA-Q3-A5QY-01A-12D-A32N-08	0.517	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	2.020000	-1.970033	0	0.090000	NM_001943		0	6	6	0	569	562	0		1	0		0	0	115	0	0	9.637770e-01	2.181656e-02	0	0	0	18	0	6	569
GNA15	2769	broad.mit.edu	37	19	3151725	3151725	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr19:3151725G>A	ENST00000262958.3	+	4	764	c.506G>A	c.(505-507)cGc>cAc	p.R169H	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	169					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		CACCTGGAGCGCATCACCGAG	0.632																																						ENST00000262958.3	0.440000	0.090000	3.400000e-01	1.500000e-01	0.230000	0.249236	0.230000	0.220000																										0				18						c.(505-507)cGc>cAc		guanine nucleotide binding protein (G protein), alpha 15 (Gq class)							107.0	93.0	98.0					19																	3151725		2203	4300	6503	SO:0001583	missense	2769	6	121396	41				g.chr19:3151725G>A		CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.506G>A	chr19.hg19:g.3151725G>A	ENSP00000262958:p.Arg169His	0					AC005264.2_ENST00000587587.1_RNA	p.R169H	NM_002068.2	NP_002059.2	0	1	1	1.985301	P30679	GNA15_HUMAN		4	764	+		Hepatocellular(1079;0.137)	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	ENST00000262958.3	0	1	hg19	c.506G>A	CCDS12104.1	0	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027420	0.93518	.	.	ENSG00000060558	ENST00000262958	D	0.91996	-2.95	4.59	4.59	0.56863	4.59	4.59	0.56863	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	U	0.000000	D	0.96935	0.8999	M	0.94101	3.495	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	D	0.98010	1.0365	10	0.87932	D	0	.	14.9063	0.70721	0.0:0.0:1.0:0.0	.	169	P30679	GNA15_HUMAN	H	169	ENSP00000262958:R169H	ENSP00000262958:R169H	R	+	2	0	0	GNA15	3102725	3102725	1.000000	0.71417	0.987000	0.45799	0.995000	0.86356	6.643000	0.74334	2.093000	0.63338	0.546000	0.68486	CGC	0.080483		TCGA-Q3-A5QY-01A-12D-A32N-08	0.632	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	2.020000	-2.043793	0	0.090000	NM_002068		0	6	5	0	598	590	0		1	0		0	0	125	0	0	9.634541e-01	5.047811e-02	0	0	0	30	0	6	598
C19orf57	79173	broad.mit.edu	37	19	14000364	14000364	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr19:14000364G>A	ENST00000586783.1	-	5	1304	c.1305C>T	c.(1303-1305)tcC>tcT	p.S435S	C19orf57_ENST00000454313.1_Silent_p.S435S|C19orf57_ENST00000591586.1_Intron|C19orf57_ENST00000346736.2_Silent_p.S435S			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	435					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			ATGCATGACCGGAATCTCCAG	0.622																																						ENST00000586783.1	0.570000	0.100000	4.300000e-01	1.800000e-01	0.280000	0.309905	0.280000	0.260000																										0				14						c.(1303-1305)tcC>tcT		chromosome 19 open reading frame 57							52.0	54.0	53.0					19																	14000364		2203	4300	6503	SO:0001819	synonymous_variant	79173	4	121412	38				g.chr19:14000364G>A	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.1305C>T	chr19.hg19:g.14000364G>A		0					C19orf57_ENST00000346736.2_Silent_p.S435S|C19orf57_ENST00000454313.1_Silent_p.S435S|C19orf57_ENST00000591586.1_Intron	p.S435S			0	1	1	1.985301	Q0VDD7	CS057_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2e-21)	5	1304	-			Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	ENST00000586783.1	0	1	hg19	c.1305C>T		0																																																																																								0.080483		TCGA-Q3-A5QY-01A-12D-A32N-08	0.622	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	2.020000	-2.766049	1	0.090000	NM_024323		0	5	5	0	407	398	0		1	0		0	0	88	0	0	9.342092e-01	0	0	0	0	1	0	5	407
VN1R2	317701	broad.mit.edu	37	19	53762737	53762737	+	Missense_Mutation	SNP	G	G	A	rs374144136		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr19:53762737G>A	ENST00000341702.3	+	1	1193	c.1109G>A	c.(1108-1110)cGt>cAt	p.R370H	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	370					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		CTCATGTGCCGTGACCCCAGC	0.428																																						ENST00000341702.3	1.000000	0.090000	1	1.500000e-01	0.240000	0.400344	0.240000	0.190000																										0				31						c.(1108-1110)cGt>cAt		vomeronasal 1 receptor 2		G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	159.0	151.0	154.0		1109	-0.6	0.0	19		154	0,8600		0,0,4300	no	missense	VN1R2	NM_173856.2	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	370/396	53762737	2,13004	2203	4300	6503	SO:0001583	missense	317701	7	121412	44				g.chr19:53762737G>A	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1109G>A	chr19.hg19:g.53762737G>A	ENSP00000351244:p.Arg370His	0					VN1R2_ENST00000598458.1_Intron	p.R370H	NM_173856.2	NP_776255.2	1	2	3	2.032425	Q8NFZ6	VN1R2_HUMAN		1	1193	+			A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	0	1	hg19	c.1109G>A	CCDS12862.1	0	.	.	.	.	.	.	.	.	.	.	G	4.482	0.089310	0.08632	4.54E-4	0.0	ENSG00000196131	ENST00000341702	T	0.41065	1.01	2.94	-0.602	0.11634	2.94	-0.602	0.11634	.	.	.	.	.	T	0.22399	0.0540	L	0.27053	0.805	0.09310	N	1	B	0.31879	0.344	B	0.29862	0.108	T	0.23154	-1.0196	9	0.12430	T	0.62	.	5.3114	0.15833	0.451:0.0:0.549:0.0	.	370	Q8NFZ6	VN1R2_HUMAN	H	370	ENSP00000351244:R370H	ENSP00000351244:R370H	R	+	2	0	0	VN1R2	58454549	58454549	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.212000	0.09319	-0.020000	0.14032	-0.234000	0.12200	CGT	0.104110		TCGA-Q3-A5QY-01A-12D-A32N-08	0.428	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	0	0	1	2	2	2	2	0	0	0	0	124	124	124	123	1	2.020000	-2.336937	0	0.090000	NM_173856		0	6	6	0	666	660	0		1			0	0	124	0	0	9.641011e-01	0	0	0	0	0	0	6	666
U2AF2	11338	broad.mit.edu	37	19	56185361	56185361	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr19:56185361G>A	ENST00000308924.4	+	12	1395	c.1355G>A	c.(1354-1356)cGc>cAc	p.R452H	U2AF2_ENST00000450554.2_Missense_Mutation_p.R448H|CTD-2537I9.13_ENST00000592252.1_RNA|EPN1_ENST00000411543.2_5'Flank|U2AF2_ENST00000590551.1_Missense_Mutation_p.R284H|CTD-2537I9.12_ENST00000589456.1_RNA|EPN1_ENST00000270460.6_5'Flank|EPN1_ENST00000085079.7_5'Flank|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	452	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CTGACGGGCCGCAAGTTCGCC	0.577																																						ENST00000308924.4	1.000000	0.100000	1	1.700000e-01	0.280000	0.402969	0.280000	0.230000																										0				21						c.(1354-1356)cGc>cAc		U2 small nuclear RNA auxiliary factor 2							83.0	81.0	82.0					19																	56185361		2203	4300	6503	SO:0001583	missense	11338	0	0					g.chr19:56185361G>A	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.1355G>A	chr19.hg19:g.56185361G>A	ENSP00000307863:p.Arg452His	0					EPN1_ENST00000411543.2_5'Flank|U2AF2_ENST00000450554.2_Missense_Mutation_p.R448H|U2AF2_ENST00000590551.1_Missense_Mutation_p.R284H|CTD-2537I9.12_ENST00000585940.1_RNA|CTD-2537I9.12_ENST00000589456.1_RNA|EPN1_ENST00000085079.7_5'Flank|EPN1_ENST00000270460.6_5'Flank|CTD-2537I9.13_ENST00000592252.1_RNA	p.R452H			1	2	3	2.016892	P26368	U2AF2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	12	1395	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	0	1	hg19	c.1355G>A	CCDS12933.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.397206	0.96009	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.16743	2.32;2.32	4.42	4.42	0.53409	4.42	4.42	0.53409	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	T	0.56963	0.2021	H	0.96996	3.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74518	-0.3639	10	0.87932	D	0	-18.4012	16.161	0.81712	0.0:0.0:1.0:0.0	.	452;448	P26368;P26368-2	U2AF2_HUMAN;.	H	452;448	ENSP00000307863:R452H;ENSP00000388475:R448H	ENSP00000307863:R452H	R	+	2	0	0	U2AF2	60877173	60877173	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	8.751000	0.91628	2.173000	0.68751	0.478000	0.44815	CGC	0.100524		TCGA-Q3-A5QY-01A-12D-A32N-08	0.577	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	2.020000	-2.005133	0	0.090000	NM_007279		0	6	6	0	570	561	0		1	0		0	0	125	0	0	9.633850e-01	7.917928e-01	0	0	0	278	0	6	570
TRIM28	10155	broad.mit.edu	37	19	59057217	59057217	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr19:59057217G>A	ENST00000253024.5	+	3	829	c.540G>A	c.(538-540)gcG>gcA	p.A180A	TRIM28_ENST00000341753.6_Intron|RN7SL525P_ENST00000579267.1_RNA	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	180	RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GTGTAGAGGCGCACCAGCGGG	0.577																																						ENST00000253024.5	1.000000	0.140000	1	2.300000e-01	0.390000	0.491408	0.390000	0.310000																										0				19						c.(538-540)gcG>gcA		tripartite motif containing 28							84.0	77.0	80.0					19																	59057217		2203	4300	6503	SO:0001819	synonymous_variant	10155	0	0					g.chr19:59057217G>A		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.540G>A	chr19.hg19:g.59057217G>A		0					RN7SL525P_ENST00000579267.1_RNA|TRIM28_ENST00000341753.6_Intron	p.A180A	NM_005762.2	NP_005753.1	1	2	3	2.016892	Q13263	TIF1B_HUMAN		3	829	+		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	O00677|Q7Z632|Q93040|Q96IM1	Silent	SNP	ENST00000253024.5	0	1	hg19	c.540G>A	CCDS12985.1	0																																																																																								0.100524		TCGA-Q3-A5QY-01A-12D-A32N-08	0.577	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	2.020000	-2.850338	1	0.090000	NM_005762		0	5	5	0	342	334	0		1	0		0	0	85	0	0	9.340755e-01	7.110816e-01	0	0	0	163	0	5	342
TCHH	7062	broad.mit.edu	37	1	152082631	152082631	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr1:152082631C>T	ENST00000368804.1	-	2	3061	c.3062G>A	c.(3061-3063)cGc>cAc	p.R1021H		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1021	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTTTTTTGCGGTActgcct	0.557																																						ENST00000368804.1	1.000000	0.080000	4.100000e-01	1.300000e-01	0.210000	0.327014	0.210000	0.180000																										0				105						c.(3061-3063)cGc>cAc		trichohyalin							99.0	101.0	101.0					1																	152082631		1983	4145	6128	SO:0001583	missense	7062	3	120964	36				g.chr1:152082631C>T	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3062G>A	chr1.hg19:g.152082631C>T	ENSP00000357794:p.Arg1021His	0						p.R1021H	NM_007113.2	NP_009044.2	1	2	3	2.004596	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	2	3061	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	0	1	hg19	c.3062G>A	CCDS41396.1	0	.	.	.	.	.	.	.	.	.	.	C	7.212	0.595657	0.13875	.	.	ENSG00000159450	ENST00000368804	T	0.14144	2.53	2.67	-1.04	0.10068	2.67	-1.04	0.10068	.	.	.	.	.	T	0.01489	0.0048	N	0.19112	0.55	0.09310	N	1	P	0.39624	0.681	B	0.24541	0.054	T	0.43032	-0.9416	9	0.41790	T	0.15	.	2.5479	0.04742	0.3961:0.3433:0.0:0.2606	.	1021	Q07283	TRHY_HUMAN	H	1021	ENSP00000357794:R1021H	ENSP00000357794:R1021H	R	-	2	0	0	TCHH	150349255	150349255	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.086000	0.14935	-0.613000	0.05694	0.462000	0.41574	CGC	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.557	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	0	0	1	2	16	2	2	1	1	1	1	156	156	156	155	1	2.020000	-1.917199	0	0.090000	NM_007113		0	6	6	0	721	708	0		0	0		1	0	156	0	0	2.277013e-02	0	0	0	0	1	0	6	721
KCNH1	3756	broad.mit.edu	37	1	211263994	211263994	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr1:211263994G>A	ENST00000271751.4	-	4	376	c.349C>T	c.(349-351)Cga>Tga	p.R117*	KCNH1_ENST00000367007.4_Nonsense_Mutation_p.R117*			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	117	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TGTTCGTTTCGAATTGGAGCA	0.378																																						ENST00000271751.4	1.000000	0.290000	1	4.300000e-01	0.630000	0.671910	0.630000	1.000000																										0				68						c.(349-351)Cga>Tga		potassium voltage-gated channel, subfamily H (eag-related), member 1							96.0	94.0	95.0					1																	211263994		2203	4300	6503	SO:0001587	stop_gained	3756	0	0					g.chr1:211263994G>A	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.349C>T	chr1.hg19:g.211263994G>A	ENSP00000271751:p.Arg117*	0					KCNH1_ENST00000367007.4_Nonsense_Mutation_p.R117*	p.R117*			1	2	3	2.004596	O95259	KCNH1_HUMAN		4	376	-			B1AQ26|O76035|Q14CL3	Nonsense_Mutation	SNP	ENST00000271751.4	0	1	hg19	c.349C>T	CCDS1496.1	0	.	.	.	.	.	.	.	.	.	.	G	38	7.239776	0.98157	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	.	.	.	5.22	4.28	0.50868	5.22	4.28	0.50868	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	11.8706	0.52519	0.0:0.0:0.6718:0.3282	.	.	.	.	X	117	.	ENSP00000271751:R117X	R	-	1	2	2	KCNH1	209330617	209330617	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.394000	0.44450	1.141000	0.42275	0.655000	0.94253	CGA	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.378	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	0	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	2.020000	-3.319839	1	0.090000	NM_002238		0	8	8	0	305	297	0		1			0	0	49	0	0	9.884484e-01	0	0	0	0	0	0	8	305
ADPRHL2	54936	broad.mit.edu	37	1	36557376	36557376	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr1:36557376C>T	ENST00000373178.4	+	3	496	c.466C>T	c.(466-468)Cgg>Tgg	p.R156W		NM_017825.2	NP_060295.1	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	156						mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(ADP-ribose) glycohydrolase activity (GO:0004649)			cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|pancreas(1)	8		Myeloproliferative disorder(586;0.0393)				AGGTGCCATGCGGGTGGCTGG	0.582																																						ENST00000373178.4	1.000000	0.100000	1	1.800000e-01	0.300000	0.424246	0.300000	0.250000																										0				8						c.(466-468)Cgg>Tgg		ADP-ribosylhydrolase like 2							62.0	61.0	61.0					1																	36557376		2203	4300	6503	SO:0001583	missense	54936	0	0					g.chr1:36557376C>T	AJ427295	CCDS402.1	1p34.3	2008-02-05			ENSG00000116863	ENSG00000116863			21304	protein-coding gene	gene with protein product		610624				12070318, 16278211	Standard	NM_017825		Approved	ARH3, FLJ20446	uc001bzt.3	Q9NX46	OTTHUMG00000007628	ENST00000373178.4:c.466C>T	chr1.hg19:g.36557376C>T	ENSP00000362273:p.Arg156Trp	0						p.R156W	NM_017825.2	NP_060295.1	1	2	3	2.020181	Q9NX46	ARHL2_HUMAN		3	496	+		Myeloproliferative disorder(586;0.0393)	Q53G94|Q6IAB8|Q9BY47	Missense_Mutation	SNP	ENST00000373178.4	0	1	hg19	c.466C>T	CCDS402.1	0	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766089	0.69878	.	.	ENSG00000116863	ENST00000373178;ENST00000540867;ENST00000543954	T	0.59906	0.23	5.35	2.31	0.28768	5.35	2.31	0.28768	.	0.000000	0.85682	D	0.000000	D	0.82444	0.5038	H	0.96269	3.795	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.88017	0.2766	10	0.87932	D	0	-16.3839	14.9511	0.71074	0.6175:0.3825:0.0:0.0	.	156	Q9NX46	ARHL2_HUMAN	W	156;76;2	ENSP00000362273:R156W	ENSP00000362273:R156W	R	+	1	2	2	ADPRHL2	36329963	36329963	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	4.643000	0.61390	0.608000	0.30000	-0.261000	0.10672	CGG	0.101323		TCGA-Q3-A5QY-01A-12D-A32N-08	0.582	ADPRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020199.1	0	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	2.020000	-2.628917	1	0.090000	NM_017825		0	5	5	0	456	449	0		1	0		0	0	99	0	0	9.353167e-01	3.327492e-01	0	0	0	93	0	5	456
PTGFR	5737	broad.mit.edu	37	1	79002208	79002208	+	Missense_Mutation	SNP	C	C	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr1:79002208C>A	ENST00000370757.3	+	3	1153	c.916C>A	c.(916-918)Ctt>Att	p.L306I	PTGFR_ENST00000370758.1_Missense_Mutation_p.L306I|PTGFR_ENST00000370756.3_3'UTR	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	306					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GGTATATATTCTTCTACGAAA	0.388																																						ENST00000370757.3	1.000000	0.130000	1	2.100000e-01	0.330000	0.450983	0.330000	0.280000																										0				33						c.(916-918)Ctt>Att		prostaglandin F receptor (FP)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)						131.0	134.0	133.0					1																	79002208		2203	4300	6503	SO:0001583	missense	5737	0	0					g.chr1:79002208C>A	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.916C>A	chr1.hg19:g.79002208C>A	ENSP00000359793:p.Leu306Ile	0					PTGFR_ENST00000370758.1_Missense_Mutation_p.L306I|PTGFR_ENST00000370756.3_3'UTR	p.L306I	NM_000959.3	NP_000950.1	1	2	3	2.020181	P43088	PF2R_HUMAN		3	1153	+			A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	0	1	hg19	c.916C>A	CCDS686.1	0	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743931	0.89663	.	.	ENSG00000122420	ENST00000370758;ENST00000370757	T;T	0.44881	0.91;0.91	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	M	0.65498	2.005	0.52501	D	0.999954	D	0.76494	0.999	D	0.78314	0.991	T	0.57551	-0.7792	10	0.54805	T	0.06	-21.887	20.1454	0.98074	0.0:1.0:0.0:0.0	.	306	P43088	PF2R_HUMAN	I	306	ENSP00000359794:L306I;ENSP00000359793:L306I	ENSP00000359793:L306I	L	+	1	0	0	PTGFR	78774796	78774796	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.903000	0.69877	2.840000	0.97914	0.655000	0.94253	CTT	0.101323		TCGA-Q3-A5QY-01A-12D-A32N-08	0.388	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	0	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	2.020000	-2.968589	1	0.090000	NM_000959		0	7	7	0	546	543	0		1	0		0	0	82	0	0	9.803414e-01	2.333269e-04	0	0	0	2	0	7	546
EGLN1	54583	broad.mit.edu	37	1	231557097	231557097	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr1:231557097G>A	ENST00000366641.3	-	1	3693	c.538C>T	c.(538-540)Cgg>Tgg	p.R180W	EGLN1_ENST00000476717.1_5'Flank	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1											breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				CCGTTGGGCCGCAGGCCGCCG	0.687																																						ENST00000366641.3	1.000000	0.260000	1	4.700000e-01	0.800000	0.762988	0.800000	1.000000																										0				16						c.(538-540)Cgg>Tgg		egl-9 family hypoxia-inducible factor 1							9.0	9.0	9.0					1																	231557097		2106	4134	6240	SO:0001583	missense	54583	5	119718	24				g.chr1:231557097G>A	AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.538C>T	chr1.hg19:g.231557097G>A	ENSP00000355601:p.Arg180Trp	0					EGLN1_ENST00000476717.1_5'Flank	p.R180W	NM_022051.2	NP_071334.1	1	2	3	2.004596				1	3693	-		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)		Missense_Mutation	SNP	ENST00000366641.3	0	1	hg19	c.538C>T	CCDS1595.1	0	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352116	0.41700	.	.	ENSG00000135766	ENST00000366641	D	0.87256	-2.23	5.23	0.483	0.16820	5.23	0.483	0.16820	.	0.411550	0.22376	N	0.060876	T	0.75968	0.3922	L	0.43923	1.385	0.25462	N	0.98791	B	0.32800	0.385	B	0.16289	0.015	T	0.67237	-0.5721	10	0.87932	D	0	-11.8165	5.589	0.17291	0.0734:0.1143:0.5506:0.2617	.	180	Q9GZT9	EGLN1_HUMAN	W	180	ENSP00000355601:R180W	ENSP00000355601:R180W	R	-	1	2	2	EGLN1	229623720	229623720	1.000000	0.71417	0.056000	0.19401	0.369000	0.29798	0.806000	0.27126	0.175000	0.19841	0.557000	0.71058	CGG	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.687	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092879.1	0	0	1	2	2	2	2	0	0	0	0	32	32	32	31	1	2.020000	-6.547447	1	0.090000	NM_022051		0	4	4	0	127	127	0		1	0		0	0	32	0	0	8.915402e-01	1.526191e-01	0	0	0	18	0	4	127
EEF1A2	1917	broad.mit.edu	37	20	62122019	62122019	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr20:62122019G>A	ENST00000298049.7	-	5	912	c.842C>T	c.(841-843)gCg>gTg	p.A281V	EEF1A2_ENST00000217182.3_Missense_Mutation_p.A281V			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	281					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GTTCACTGGCGCAAAGGTCAC	0.637																																						ENST00000298049.7	1.000000	0.140000	1	2.300000e-01	0.370000	0.463850	0.370000	0.310000																										0				20						c.(841-843)gCg>gTg		eukaryotic translation elongation factor 1 alpha 2							61.0	56.0	58.0					20																	62122019		2197	4287	6484	SO:0001583	missense	1917	0	0					g.chr20:62122019G>A	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.842C>T	chr20.hg19:g.62122019G>A	ENSP00000298049:p.Ala281Val	0					EEF1A2_ENST00000217182.3_Missense_Mutation_p.A281V	p.A281V			1	2	3	2.009314	Q05639	EF1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.22e-05)	5	912	-	all_cancers(38;9.45e-12)		B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	ENST00000298049.7	0	1	hg19	c.842C>T	CCDS13522.1	0	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392399	0.62066	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.62364	0.03;0.03	3.82	3.82	0.43975	3.82	3.82	0.43975	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.060894	0.64402	D	0.000005	T	0.80919	0.4716	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.71414	0.973;0.824	D	0.85861	0.1410	10	0.87932	D	0	-14.6002	16.0768	0.80974	0.0:0.0:1.0:0.0	.	257;281	Q59GP5;Q05639	.;EF1A2_HUMAN	V	281	ENSP00000298049:A281V;ENSP00000217182:A281V	ENSP00000217182:A281V	A	-	2	0	0	EEF1A2	61592463	61592463	1.000000	0.71417	0.393000	0.26258	0.050000	0.14768	9.616000	0.98359	1.847000	0.53656	0.556000	0.70494	GCG	0.098921		TCGA-Q3-A5QY-01A-12D-A32N-08	0.637	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	0	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	2.020000	-2.701258	1	0.090000	NM_001958		0	6	6	0	420	417	0		1	0		0	0	113	0	0	9.644561e-01	9.961369e-03	0	0	0	9	0	6	420
BRWD1	54014	broad.mit.edu	37	21	40630429	40630429	+	Silent	SNP	T	T	C			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr21:40630429T>C	ENST00000333229.2	-	18	2382	c.2055A>G	c.(2053-2055)gaA>gaG	p.E685E	BRWD1_ENST00000342449.3_Silent_p.E685E|BRWD1_ENST00000380800.3_Silent_p.E685E	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	685					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GGGGTGTTTCTTCACCATTTG	0.388																																					Melanoma(170;988 1986 4794 16843 39731)	ENST00000333229.2	0.580000	0.200000	4.800000e-01	2.700000e-01	0.360000	0.380501	0.360000	0.360000																										0				58						c.(2053-2055)gaA>gaG		bromodomain and WD repeat domain containing 1							197.0	193.0	195.0					21																	40630429		2203	4300	6503	SO:0001819	synonymous_variant	54014	0	0					g.chr21:40630429T>C	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.2055A>G	chr21.hg19:g.40630429T>C		0					BRWD1_ENST00000342449.3_Silent_p.E685E|BRWD1_ENST00000380800.3_Silent_p.E685E	p.E685E	NM_018963.4	NP_061836.2	0	1	1	1.985676	Q9NSI6	BRWD1_HUMAN		18	2382	-		Prostate(19;8.44e-08)|all_epithelial(19;0.223)	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	0	1	hg19	c.2055A>G	CCDS13662.1	0	.	.	.	.	.	.	.	.	.	.	T	4.863	0.160340	0.09287	.	.	ENSG00000185658	ENST00000455867	.	.	.	5.46	1.8	0.24995	5.46	1.8	0.24995	.	.	.	.	.	T	0.57140	0.2033	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48031	-0.9070	4	.	.	.	-13.145	8.7115	0.34387	0.0:0.2966:0.0:0.7034	.	.	.	.	G	397	.	.	R	-	1	2	2	BRWD1	39552299	39552299	1.000000	0.71417	0.992000	0.48379	0.658000	0.38924	1.633000	0.37113	0.075000	0.16796	0.533000	0.62120	AGA	0.080901		TCGA-Q3-A5QY-01A-12D-A32N-08	0.388	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	0	0	1	2	2	2	2	0	0	0	0	170	170	170	167	1	2.020000	-3.080258	1	0.090000	NM_033656		0	13	13	0	783	775	0		1	0		0	0	170	0	0	9.994995e-01	9.749028e-04	0	0	0	3	0	13	783
TRIOBP	11078	broad.mit.edu	37	22	38120997	38120997	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr22:38120997C>T	ENST00000406386.3	+	7	2689	c.2434C>T	c.(2434-2436)Cag>Tag	p.Q812*		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	812					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGCCACCCAACAGGACAACCC	0.517																																						ENST00000406386.3	1.000000	0.210000	1	3.300000e-01	0.490000	0.568694	0.490000	0.430000																										0				12						c.(2434-2436)Cag>Tag		TRIO and F-actin binding protein							161.0	170.0	167.0					22																	38120997		1982	4174	6156	SO:0001587	stop_gained	11078	0	0					g.chr22:38120997C>T	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2434C>T	chr22.hg19:g.38120997C>T	ENSP00000384312:p.Gln812*	0						p.Q812*	NM_001039141.2	NP_001034230.1	1	2	3	2.016604	Q9H2D6	TARA_HUMAN		7	2689	+	Melanoma(58;0.0574)		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Nonsense_Mutation	SNP	ENST00000406386.3	0	1	hg19	c.2434C>T	CCDS43015.1	0	.	.	.	.	.	.	.	.	.	.	C	39	7.393041	0.98255	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	.	.	.	4.21	0.597	0.17504	4.21	0.597	0.17504	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	9.6691	0.40002	0.5296:0.4704:0.0:0.0	.	.	.	.	X	812	.	ENSP00000384312:Q812X	Q	+	1	0	0	TRIOBP	36450943	36450943	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-3.739000	0.00379	0.030000	0.15379	0.460000	0.39030	CAG	0.100524		TCGA-Q3-A5QY-01A-12D-A32N-08	0.517	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2	0	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	2.020000	-7.511531	1	0.090000			0	8	8	0	410	408	0		1	0		0	0	105	0	0	9.893118e-01	0	0	0	0	1	0	8	410
XRCC6	2547	broad.mit.edu	37	22	42018069	42018069	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr22:42018069G>A	ENST00000359308.4	+	1	716	c.61G>A	c.(61-63)Gaa>Aaa	p.E21K	XRCC6_ENST00000428575.2_5'UTR|XRCC6_ENST00000402580.3_Missense_Mutation_p.E21K|XRCC6_ENST00000405878.1_Missense_Mutation_p.E21K|XRCC6_ENST00000405506.1_Silent_p.K8K|XRCC6_ENST00000360079.3_Missense_Mutation_p.E21K|DESI1_ENST00000263256.6_5'Flank			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	21	Asp/Glu-rich (acidic).|Ser-rich (potentially targets for phosphorylation).				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						GGAAGAACAAGAAGAGAACCT	0.483								Non-homologous end-joining																														ENST00000359308.4	1.000000	0.210000	1	3.400000e-01	0.550000	0.608734	0.550000	0.450000																										0				31						c.(61-63)Gaa>Aaa	Non-homologous end-joining	X-ray repair complementing defective repair in Chinese hamster cells 6							217.0	185.0	196.0					22																	42018069		2203	4300	6503	SO:0001583	missense	2547	0	0					g.chr22:42018069G>A	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.61G>A	chr22.hg19:g.42018069G>A	ENSP00000352257:p.Glu21Lys	0					XRCC6_ENST00000360079.3_Missense_Mutation_p.E21K|XRCC6_ENST00000428575.2_5'UTR|XRCC6_ENST00000405878.1_Missense_Mutation_p.E21K|XRCC6_ENST00000405506.1_Silent_p.K8K|XRCC6_ENST00000402580.3_Missense_Mutation_p.E21K|DESI1_ENST00000263256.6_5'Flank	p.E21K			1	2	3	2.016604	P12956	XRCC6_HUMAN		1	716	+			B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	0	1	hg19	c.61G>A	CCDS14021.1	0	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350682	0.82132	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000359308;ENST00000405878;ENST00000402409	.	.	.	5.36	4.33	0.51752	5.36	4.33	0.51752	.	0.457363	0.21898	N	0.067499	T	0.58148	0.2102	M	0.61703	1.905	0.80722	D	1	B;B;B	0.16166	0.016;0.01;0.01	B;B;B	0.14578	0.011;0.007;0.007	T	0.53885	-0.8375	9	0.24483	T	0.36	-1.1576	13.523	0.61578	0.0:0.1562:0.8438:0.0	.	21;21;21	B1AHC7;B1AHC8;P12956	.;.;XRCC6_HUMAN	K	21	.	ENSP00000352257:E21K	E	+	1	0	0	XRCC6	40348015	40348015	0.996000	0.38824	0.051000	0.19133	0.208000	0.24298	2.401000	0.44513	1.229000	0.43630	0.655000	0.94253	GAA	0.100524		TCGA-Q3-A5QY-01A-12D-A32N-08	0.483	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	2.020000	-6.786469	1	0.090000	NM_001469		0	6	6	0	284	280	0		1	0		0	0	60	0	0	9.638869e-01	9.229783e-01	0	0	0	219	0	6	284
TTLL8	164714	broad.mit.edu	37	22	50487686	50487686	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr22:50487686C>T	ENST00000266182.6	-	3	255	c.256G>A	c.(256-258)Gac>Aac	p.D86N	TTLL8_ENST00000440475.1_Missense_Mutation_p.D86N|TTLL8_ENST00000477219.1_5'UTR			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	122					cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		ACCATCACGTCGTGGATGTTG	0.527																																						ENST00000266182.6	0.660000	0.220000	5.300000e-01	3.000000e-01	0.400000	0.423747	0.400000	0.390000																										0				12						c.(256-258)Gac>Aac		tubulin tyrosine ligase-like family, member 8							323.0	344.0	337.0					22																	50487686		2113	4232	6345	SO:0001583	missense	164714	1	121062	33				g.chr22:50487686C>T			22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.256G>A	chr22.hg19:g.50487686C>T	ENSP00000266182:p.Asp86Asn	0					TTLL8_ENST00000440475.1_Missense_Mutation_p.D86N|TTLL8_ENST00000477219.1_5'UTR	p.D86N			0	0	0	1.973348	A6PVC2	TTLL8_HUMAN		3	255	-		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)	B5MDV0	Missense_Mutation	SNP	ENST00000266182.6	0	1	hg19	c.256G>A		0	.	.	.	.	.	.	.	.	.	.	C	3.584	-0.084930	0.07097	.	.	ENSG00000138892	ENST00000266182;ENST00000440475;ENST00000433387	T;T;T	0.16743	2.32;2.32;2.32	4.67	2.56	0.30785	4.67	2.56	0.30785	.	0.851391	0.09565	U	0.785033	T	0.12050	0.0293	N	0.19112	0.55	0.20638	N	0.999876	B	0.13145	0.007	B	0.06405	0.002	T	0.33727	-0.9857	10	0.30078	T	0.28	.	11.2427	0.48979	0.0:0.8981:0.0:0.1019	.	86	B5MDV0	.	N	86;86;122	ENSP00000266182:D86N;ENSP00000387509:D86N;ENSP00000392252:D122N	ENSP00000266182:D86N	D	-	1	0	0	TTLL8	48829813	48829813	0.009000	0.17119	0.054000	0.19295	0.000000	0.00434	1.434000	0.34958	0.390000	0.25115	-1.149000	0.01842	GAC	0.071618		TCGA-Q3-A5QY-01A-12D-A32N-08	0.527	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	138	138	138	136	1	2.020000	-2.508987	1	0.090000	NM_001080447		0	12	12	0	641	630	0		1			0	0	138	0	0	9.990270e-01	0	0	0	0	0	0	12	641
FIGN	55137	broad.mit.edu	37	2	164467288	164467288	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:164467288G>A	ENST00000333129.3	-	3	1368	c.1054C>T	c.(1054-1056)Ccc>Tcc	p.P352S	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	352					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CTGTTGTCGGGCATTCTGTAC	0.448																																						ENST00000333129.3	1.000000	0.110000	5.400000e-01	1.800000e-01	0.290000	0.386585	0.290000	0.240000																										0				47						c.(1054-1056)Ccc>Tcc		fidgetin							130.0	125.0	127.0					2																	164467288		1937	4133	6070	SO:0001583	missense	55137	0	0					g.chr2:164467288G>A	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1054C>T	chr2.hg19:g.164467288G>A	ENSP00000333836:p.Pro352Ser	0					FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	p.P352S	NM_018086.2	NP_060556.2	1	2	3	2.001904	Q5HY92	FIGN_HUMAN		3	1368	-			B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	0	1	hg19	c.1054C>T	CCDS2221.2	0	.	.	.	.	.	.	.	.	.	.	G	3.349	-0.132926	0.06711	.	.	ENSG00000182263	ENST00000333129	D	0.91843	-2.92	5.94	4.15	0.48705	5.94	4.15	0.48705	.	0.456711	0.22595	N	0.058032	D	0.85375	0.5682	L	0.29908	0.895	0.54753	D	0.999989	B	0.17465	0.022	B	0.19666	0.026	T	0.76575	-0.2909	10	0.10636	T	0.68	-4.4398	12.098	0.53765	0.065:0.1212:0.8138:0.0	.	352	Q5HY92	FIGN_HUMAN	S	352	ENSP00000333836:P352S	ENSP00000333836:P352S	P	-	1	0	0	FIGN	164175534	164175534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.220000	0.51207	0.852000	0.35287	0.563000	0.77884	CCC	0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.448	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	0	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	2.020000	-1.801253	0	0.090000	NM_018086		0	6	6	0	528	524	0		1	0		0	0	99	0	0	9.641183e-01	0	0	0	0	1	0	6	528
UBR3	130507	broad.mit.edu	37	2	170814986	170814986	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:170814986C>T	ENST00000272793.5	+	24	3634	c.3584C>T	c.(3583-3585)gCg>gTg	p.A1195V	UBR3_ENST00000418381.1_Missense_Mutation_p.A1195V			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1195					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						AAATTGCTTGCGGAGTTTGCT	0.348																																						ENST00000272793.5	1.000000	0.510000	1	6.600000e-01	0.850000	0.838982	0.850000	1.000000																										0				33						c.(3583-3585)gCg>gTg		ubiquitin protein ligase E3 component n-recognin 3 (putative)							103.0	111.0	108.0					2																	170814986		2203	4300	6503	SO:0001583	missense	130507	0	0					g.chr2:170814986C>T	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.3584C>T	chr2.hg19:g.170814986C>T	ENSP00000272793:p.Ala1195Val	0					UBR3_ENST00000418381.1_Missense_Mutation_p.A1195V	p.A1195V			1	2	3	2.001904	Q6ZT12	UBR3_HUMAN		24	3634	+			B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	1	1	hg19	c.3584C>T		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.812118|5.812118	0.96975|0.96975	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381|ENST00000392632	T;T|.	0.57595|.	0.39;0.39|.	6.15|6.15	6.15|6.15	0.99193|0.99193	6.15|6.15	6.15|6.15	0.99193|0.99193	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.81842|0.81842	0.4908|0.4908	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.75484|.	0.986;0.986|.	T|T	0.79642|0.79642	-0.1718|-0.1718	10|5	0.59425|.	D|.	0.04|.	.|.	20.8387|20.8387	0.99724|0.99724	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1195;1195|.	Q6ZT12;E7EVK3|.	UBR3_HUMAN;.|.	V|W	1195|253	ENSP00000272793:A1195V;ENSP00000396068:A1195V|.	ENSP00000272793:A1195V|.	A|R	+|+	2|1	0|2	0|2	UBR3|UBR3	170523232|170523232	170523232|170523232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	7.786000|7.786000	0.85741|0.85741	2.932000|2.932000	0.99384|0.99384	0.643000|0.643000	0.83706|0.83706	GCG|CGG	0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.348	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	0	0	1	2	2	2	2	0	0	0	0	91	91	91	89	1	2.020000	-3.239632	1	0.090000	NM_172070		0	19	17	0	507	501	0		1	0		0	0	91	0	0	9.999895e-01	7.543373e-02	0	1	0	11	0	19	507
TTN	7273	broad.mit.edu	37	2	179476531	179476531	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:179476531G>A	ENST00000591111.1	-	218	45806	c.45582C>T	c.(45580-45582)ggC>ggT	p.G15194G	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Silent_p.G7962G|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.G16835G|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Silent_p.G14267G|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000460472.2_Silent_p.G7770G|TTN_ENST00000359218.5_Silent_p.G7895G|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15194	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTGGGTGGCCAACTCCAG	0.443																																						ENST00000591111.1	1.000000	0.090000	4.400000e-01	1.500000e-01	0.230000	0.342268	0.230000	0.200000																										0				1448						c.(45580-45582)ggC>ggT		titin							139.0	134.0	136.0					2																	179476531		1948	4148	6096	SO:0001819	synonymous_variant	7273	0	0					g.chr2:179476531G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45582C>T	chr2.hg19:g.179476531G>A		0					TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342992.6_Silent_p.G14267G|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.G7770G|TTN_ENST00000589042.1_Silent_p.G16835G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Silent_p.G7962G|TTN_ENST00000359218.5_Silent_p.G7895G|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA	p.G15194G			1	2	3	2.001904	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	218	45806	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	0	1	hg19	c.45582C>T		0																																																																																								0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	125	1	2.020000	-2.015166	0	0.090000	NM_133378		0	6	6	0	647	642	0		1	0		0	0	127	0	0	9.640804e-01	1.299328e-04	0	0	0	2	0	6	647
RNF25	64320	broad.mit.edu	37	2	219529962	219529962	+	Silent	SNP	G	G	A	rs200142823		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:219529962G>A	ENST00000295704.2	-	8	1022	c.582C>T	c.(580-582)gtC>gtT	p.V194V		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	194					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACTGCACACCGACTGCCTTCT	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		17867	0.0		0.001	False		,,,				2504	0.0					ENST00000295704.2	1.000000	0.250000	1	3.800000e-01	0.580000	0.626736	0.580000	1.000000																										0				24						c.(580-582)gtC>gtT		ring finger protein 25							85.0	79.0	81.0					2																	219529962		2203	4300	6503	SO:0001819	synonymous_variant	64320	2	121412	32				g.chr2:219529962G>A		CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.582C>T	chr2.hg19:g.219529962G>A		0						p.V194V	NM_022453.2	NP_071898.2	1	2	3	2.001904	Q96BH1	RNF25_HUMAN		8	1022	-		Renal(207;0.0474)	A8K0D6|Q53HQ5|Q9H874	Silent	SNP	ENST00000295704.2	0	1	hg19	c.582C>T	CCDS2420.1	0																																																																																								0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.532	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	0	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	2.020000	-3.052348	1	0.090000	NM_022453		0	7	7	0	296	293	1		1	1		0	0	65	0	0	9.802361e-01	4.756698e-01	0	12	0	51	0	7	296
IRS1	3667	broad.mit.edu	37	2	227662683	227662683	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:227662683G>A	ENST00000305123.5	-	1	1792	c.772C>T	c.(772-774)Cgg>Tgg	p.R258W	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	258	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CTCATGGCCCGCATGGCCTCC	0.637											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000305123.5	1.000000	0.100000	5.700000e-01	1.800000e-01	0.290000	0.390369	0.290000	0.240000																										0				69						c.(772-774)Cgg>Tgg		insulin receptor substrate 1							74.0	80.0	78.0					2																	227662683		2203	4300	6503	SO:0001583	missense	3667	0	0					g.chr2:227662683G>A		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.772C>T	chr2.hg19:g.227662683G>A	ENSP00000304895:p.Arg258Trp	0		OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2321	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	p.R258W	NM_005544.2	NP_005535.1	1	2	3	2.001904	P35568	IRS1_HUMAN		1	1792	-		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Missense_Mutation	SNP	ENST00000305123.5	0	1	hg19	c.772C>T	CCDS2463.1	0	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310295	0.60414	.	.	ENSG00000169047	ENST00000305123	T	0.47177	0.85	5.79	2.9	0.33743	5.79	2.9	0.33743	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (4);	0.117936	0.39146	N	0.001442	T	0.55800	0.1943	L	0.34521	1.04	0.47214	D	0.999354	D	0.89917	1.0	D	0.66716	0.946	T	0.57785	-0.7751	10	0.87932	D	0	-30.8633	14.6021	0.68447	0.0:0.0:0.4974:0.5026	.	258	P35568	IRS1_HUMAN	W	258	ENSP00000304895:R258W	ENSP00000304895:R258W	R	-	1	2	2	IRS1	227370927	227370927	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.388000	0.44398	0.306000	0.22856	0.561000	0.74099	CGG	0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.637	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	0	0	1	2	2	2	2	0	0	0	0	119	119	119	117	1	2.020000	-2.217217	0	0.090000	NM_005544		0	5	5	0	444	435	0		1	0		0	0	119	0	0	9.344885e-01	2.948144e-03	0	0	0	6	0	5	444
NRXN1	9378	broad.mit.edu	37	2	51254959	51254959	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:51254959G>A	ENST00000406316.2	-	2	1929	c.453C>T	c.(451-453)agC>agT	p.S151S	NRXN1_ENST00000401669.2_Silent_p.S151S|NRXN1_ENST00000405581.1_Silent_p.S151S|NRXN1_ENST00000405472.3_Silent_p.S151S|NRXN1_ENST00000404971.1_Silent_p.S151S|NRXN1_ENST00000406859.3_Silent_p.S151S|NRXN1_ENST00000402717.3_Silent_p.S151S	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	151	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CGAAAAGGCCGCTGAACACCG	0.672																																						ENST00000406316.2	1.000000	0.240000	1	4.400000e-01	0.750000	0.734778	0.750000	1.000000																										0				58						c.(451-453)agC>agT		neurexin 1							26.0	32.0	30.0					2																	51254959		2130	4244	6374	SO:0001819	synonymous_variant	9378	1	120970	24				g.chr2:51254959G>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.453C>T	chr2.hg19:g.51254959G>A		0					NRXN1_ENST00000405581.1_Silent_p.S151S|NRXN1_ENST00000406859.3_Silent_p.S151S|NRXN1_ENST00000404971.1_Silent_p.S151S|NRXN1_ENST00000401669.2_Silent_p.S151S|NRXN1_ENST00000402717.3_Silent_p.S151S|NRXN1_ENST00000405472.3_Silent_p.S151S	p.S151S	NM_004801.4	NP_004792.1	1	2	3	2.001904	Q9ULB1	NRX1A_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)	2	1929	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	0	1	hg19	c.453C>T	CCDS54360.1	0																																																																																								0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.672	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	2.020000	-6.547907	1	0.090000			0	4	4	0	136	136	0		1	0		0	0	50	0	0	8.914801e-01	0	0	0	0	1	0	4	136
RNF181	51255	broad.mit.edu	37	2	85824016	85824016	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:85824016C>T	ENST00000306368.4	+	3	319	c.289C>T	c.(289-291)Ctt>Ttt	p.L97F	RNF181_ENST00000441634.1_Missense_Mutation_p.L97F	NM_016494.3	NP_057578.1	Q9P0P0	RN181_HUMAN	ring finger protein 181	97					protein autoubiquitination (GO:0051865)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)|stomach(1)	2						TTGCCATCACCTTTTCCATTC	0.522																																						ENST00000306368.4	1.000000	0.190000	6.200000e-01	2.700000e-01	0.380000	0.466700	0.380000	0.350000																										0				2						c.(289-291)Ctt>Ttt		ring finger protein 181							201.0	188.0	192.0					2																	85824016		2203	4300	6503	SO:0001583	missense	51255	0	0					g.chr2:85824016C>T	AF151072	CCDS1981.1	2p11.2	2013-01-09			ENSG00000168894	ENSG00000168894		"""RING-type (C3HC4) zinc fingers"""	28037	protein-coding gene	gene with protein product		612490				11042152	Standard	XM_005264359		Approved	HSPC238	uc002spv.1	Q9P0P0	OTTHUMG00000130182	ENST00000306368.4:c.289C>T	chr2.hg19:g.85824016C>T	ENSP00000306906:p.Leu97Phe	0					RNF181_ENST00000441634.1_Missense_Mutation_p.L97F	p.L97F	NM_016494.3	NP_057578.1	1	2	3	2.001904	Q9P0P0	RN181_HUMAN		3	319	+			Q53H81	Missense_Mutation	SNP	ENST00000306368.4	0	1	hg19	c.289C>T	CCDS1981.1	0	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466170	0.43839	.	.	ENSG00000168894	ENST00000441634;ENST00000306368	T;T	0.44482	0.92;0.92	5.75	4.88	0.63580	5.75	4.88	0.63580	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.059226	0.64402	N	0.000002	T	0.23965	0.0580	N	0.11106	0.095	0.54753	D	0.999988	B	0.16603	0.018	B	0.21917	0.037	T	0.06716	-1.0811	10	0.14252	T	0.57	.	12.4863	0.55874	0.0:0.9193:0.0:0.0807	.	97	Q9P0P0	RN181_HUMAN	F	97	ENSP00000412025:L97F;ENSP00000306906:L97F	ENSP00000306906:L97F	L	+	1	0	0	RNF181	85677527	85677527	0.986000	0.35501	1.000000	0.80357	0.993000	0.82548	1.548000	0.36201	1.432000	0.47375	0.655000	0.94253	CTT	0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.522	RNF181-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252500.1	0	0	1	2	2	2	2	0	0	0	0	155	155	155	154	1	2.020000	-2.313619	0	0.090000	NM_016494		0	11	11	0	684	669	0		1	1		0	0	155	0	0	9.981323e-01	9.962398e-01	0	48	0	548	0	11	684
COL6A3	1293	broad.mit.edu	37	2	238305387	238305387	+	Missense_Mutation	SNP	G	G	A	rs398124134		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr2:238305387G>A	ENST00000295550.4	-	2	526	c.74C>T	c.(73-75)gCc>gTc	p.A25V	COL6A3_ENST00000392003.2_Missense_Mutation_p.A25V|COL6A3_ENST00000353578.4_Missense_Mutation_p.A25V|COL6A3_ENST00000347401.3_Missense_Mutation_p.A25V|COL6A3_ENST00000346358.4_Missense_Mutation_p.A25V|COL6A3_ENST00000472056.1_Missense_Mutation_p.A25V|COL6A3_ENST00000392004.3_Missense_Mutation_p.A25V|COL6A3_ENST00000409809.1_Missense_Mutation_p.A25V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	25					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTGCTGCTGGGCATGAGTTGT	0.423																																						ENST00000295550.4	1.000000	0.100000	5.600000e-01	1.700000e-01	0.280000	0.385554	0.280000	0.240000																										0				217						c.(73-75)gCc>gTc		collagen, type VI, alpha 3							121.0	124.0	123.0					2																	238305387		2203	4300	6503	SO:0001583	missense	1293	0	0					g.chr2:238305387G>A	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.74C>T	chr2.hg19:g.238305387G>A	ENSP00000295550:p.Ala25Val	0					COL6A3_ENST00000472056.1_Missense_Mutation_p.A25V|COL6A3_ENST00000409809.1_Missense_Mutation_p.A25V|COL6A3_ENST00000392004.3_Missense_Mutation_p.A25V|COL6A3_ENST00000353578.4_Missense_Mutation_p.A25V|COL6A3_ENST00000346358.4_Missense_Mutation_p.A25V|COL6A3_ENST00000392003.2_Missense_Mutation_p.A25V|COL6A3_ENST00000347401.3_Missense_Mutation_p.A25V	p.A25V	NM_004369.3	NP_004360.2	1	2	3	2.001904	P12111	CO6A3_HUMAN		2	526	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	0	1	hg19	c.74C>T	CCDS33412.1	0	.	.	.	.	.	.	.	.	.	.	G	10.40	1.339245	0.24339	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	T;T;T;D;T;T;T;T;T	0.88509	-1.09;-1.09;-1.08;-2.39;-1.08;-1.09;-1.08;-0.04;-1.09	5.46	3.62	0.41486	5.46	3.62	0.41486	.	0.124395	0.35805	N	0.002975	D	0.92446	0.7602	M	0.61703	1.905	0.25430	N	0.988196	D;B;B;D;D;P	0.71674	0.977;0.006;0.013;0.971;0.998;0.943	P;B;B;P;D;P	0.66602	0.597;0.004;0.017;0.659;0.945;0.5	D	0.86732	0.1949	10	0.56958	D	0.05	.	14.2564	0.66055	0.0:0.3088:0.6912:0.0	.	25;25;25;25;25;25	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	V	25	ENSP00000295550:A25V;ENSP00000315609:A25V;ENSP00000315873:A25V;ENSP00000418285:A25V;ENSP00000386844:A25V;ENSP00000295546:A25V;ENSP00000375861:A25V;ENSP00000375860:A25V;ENSP00000389539:A25V	ENSP00000295550:A25V	A	-	2	0	0	COL6A3	237970126	237970126	0.997000	0.39634	0.295000	0.24960	0.037000	0.13140	2.286000	0.43496	0.638000	0.30545	0.650000	0.86243	GCC	0.097312		TCGA-Q3-A5QY-01A-12D-A32N-08	0.423	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	0	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	2.020000	-2.274683	0	0.090000	NM_004369		0	5	6	0	453	448	0		1	0		0	0	81	0	0	9.364127e-01	9.365902e-02	0	0	0	38	0	5	453
ZIC1	7545	broad.mit.edu	37	3	147128819	147128819	+	Missense_Mutation	SNP	C	C	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:147128819C>A	ENST00000282928.4	+	1	1649	c.920C>A	c.(919-921)cCt>cAt	p.P307H		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	307					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						TGCCCCTTCCCTGGCTGTGGC	0.572																																						ENST00000282928.4	1.000000	0.110000	6.400000e-01	1.900000e-01	0.320000	0.415526	0.320000	0.260000																										0				63						c.(919-921)cCt>cAt		Zic family member 1							72.0	76.0	75.0					3																	147128819		2203	4300	6503	SO:0001583	missense	7545	0	0					g.chr3:147128819C>A	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.920C>A	chr3.hg19:g.147128819C>A	ENSP00000282928:p.Pro307His	0						p.P307H	NM_003412.3	NP_003403.2	1	2	3	2.004667	Q15915	ZIC1_HUMAN		1	1649	+			Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	0	1	hg19	c.920C>A	CCDS3136.1	0	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898249	0.72639	.	.	ENSG00000152977	ENST00000282928	D	0.91237	-2.81	3.89	3.89	0.44902	3.89	3.89	0.44902	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93331	0.7874	L	0.49350	1.555	0.80722	D	1	D	0.58970	0.984	D	0.71414	0.973	D	0.93988	0.7264	10	0.59425	D	0.04	.	16.2006	0.82071	0.0:1.0:0.0:0.0	.	307	Q15915	ZIC1_HUMAN	H	307	ENSP00000282928:P307H	ENSP00000282928:P307H	P	+	2	0	0	ZIC1	148611509	148611509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.736000	0.68597	1.862000	0.54008	0.561000	0.74099	CCT	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.572	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	0	0	1	2	2	2	2	0	0	0	0	81	81	81	80	1	2.020000	-2.871001	1	0.090000	NM_003412		0	5	5	0	409	405	0		1			0	0	81	0	0	9.362957e-01	0	0	0	0	0	0	5	409
WWTR1	25937	broad.mit.edu	37	3	149260145	149260145	+	Missense_Mutation	SNP	G	G	A	rs200641813		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:149260145G>A	ENST00000465804.1	-	5	1004	c.748C>T	c.(748-750)Cgc>Tgc	p.R250C	WWTR1_ENST00000360632.3_Missense_Mutation_p.R250C|WWTR1_ENST00000467467.1_Missense_Mutation_p.R250C	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	250					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TCCTCTTGGCGCATTCGAATC	0.552			T	CAMTA1	epitheliod hemangioendothelioma								G|||	1	0.000199681	0.0	0.0	5008	,	,		18468	0.001		0.0	False		,,,				2504	0.0					ENST00000465804.1	1.000000	0.150000	8.200000e-01	2.500000e-01	0.410000	0.491846	0.410000	0.350000				Dom	yes			Dom	yes		3	3q23-q24	3q23-q24	607392	T	WW domain containing transcription regulator 1				M	M	CAMTA1		epitheliod hemangioendothelioma		0				23						c.(748-750)Cgc>Tgc		WW domain containing transcription regulator 1							126.0	109.0	115.0					3																	149260145		2203	4300	6503	SO:0001583	missense	25937	1	121412	36				g.chr3:149260145G>A	AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.748C>T	chr3.hg19:g.149260145G>A	ENSP00000419465:p.Arg250Cys	0					WWTR1_ENST00000360632.3_Missense_Mutation_p.R250C|WWTR1_ENST00000467467.1_Missense_Mutation_p.R250C	p.R250C	NM_001168278.1	NP_001161750.1	1	2	3	2.004667	Q9GZV5	WWTR1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)	5	1004	-			D3DNH7|Q8N3P2|Q9Y3W6	Missense_Mutation	SNP	ENST00000465804.1	0	1	hg19	c.748C>T	CCDS3144.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	22.0	4.225035	0.79576	.	.	ENSG00000018408	ENST00000465804;ENST00000360632;ENST00000467467;ENST00000472417	T;T;T	0.55052	0.54;0.54;0.54	5.26	5.26	0.73747	5.26	5.26	0.73747	.	0.229595	0.38381	N	0.001711	T	0.74496	0.3724	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.77302	-0.2638	10	0.87932	D	0	-28.3108	19.0748	0.93156	0.0:0.0:1.0:0.0	.	250	Q9GZV5	WWTR1_HUMAN	C	250;250;250;108	ENSP00000419465:R250C;ENSP00000353847:R250C;ENSP00000419234:R250C	ENSP00000353847:R250C	R	-	1	0	0	WWTR1	150742835	150742835	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.272000	0.58908	2.733000	0.93635	0.655000	0.94253	CGC	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.552	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356498.1	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	2.020000	-3.138315	1	0.090000	NM_015472		0	5	5	0	315	312	0		1	0		0	0	69	0	0	9.364633e-01	1.567025e-01	0	0	0	37	0	5	315
PARL	55486	broad.mit.edu	37	3	183547482	183547482	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:183547482G>A	ENST00000317096.4	-	10	1104	c.1044C>T	c.(1042-1044)taC>taT	p.Y348Y	PARL_ENST00000311101.5_Silent_p.Y298Y|PARL_ENST00000435888.1_Silent_p.Y264Y	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	348					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.Y348Y(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GTTCATGACCGTAAGTAACAT	0.423																																						ENST00000317096.4	1.000000	0.070000	4.000000e-01	1.300000e-01	0.200000	0.320381	0.200000	0.180000																										1	Substitution - coding silent(1)	p.Y348Y(1)	prostate(1)	17						c.(1042-1044)taC>taT		presenilin associated, rhomboid-like							123.0	127.0	126.0					3																	183547482		2203	4300	6503	SO:0001819	synonymous_variant	55486	1	121410	32				g.chr3:183547482G>A	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.1044C>T	chr3.hg19:g.183547482G>A		0					PARL_ENST00000311101.5_Silent_p.Y298Y|PARL_ENST00000435888.1_Silent_p.Y264Y	p.Y348Y	NM_018622.5	NP_061092.3	1	2	3	2.004667	Q9H300	PARL_HUMAN	all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)	10	1104	-	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		Q96CQ4|Q9BTJ6|Q9P1E3	Silent	SNP	ENST00000317096.4	0	1	hg19	c.1044C>T	CCDS3248.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.66|11.66	1.706359|1.706359	0.30232|0.30232	.|.	.|.	ENSG00000175193|ENSG00000175193	ENST00000450375;ENST00000417784|ENST00000418450	T|.	0.51325|.	0.71|.	5.71|5.71	-6.81|-6.81	0.01704|0.01704	5.71|5.71	-6.81|-6.81	0.01704|0.01704	.|.	.|.	.|.	.|.	.|.	T|T	0.65883|0.65883	0.2734|0.2734	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.68981|0.68981	-0.5266|-0.5266	5|4	.|.	.|.	.|.	-19.5416|-19.5416	18.3207|18.3207	0.90237|0.90237	0.3327:0.0:0.6673:0.0|0.3327:0.0:0.6673:0.0	.|.	.|.	.|.	.|.	W|M	62;140|81	ENSP00000402689:R62W|.	.|.	R|T	-|-	1|2	2|0	2|0	PARL|PARL	185030176|185030176	185030176|185030176	0.001000|0.001000	0.12720|0.12720	0.801000|0.801000	0.32222|0.32222	0.966000|0.966000	0.64601|0.64601	-1.489000|-1.489000	0.02306|0.02306	-1.663000|-1.663000	0.01481|0.01481	-0.414000|-0.414000	0.06135|0.06135	CGG|ACG	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.423	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	0	0	1	2	2	2	2	0	0	0	0	159	159	159	159	1	2.020000	-1.822656	0	0.090000	NM_018622		0	6	5	0	749	741	0		1	0		0	0	159	0	0	9.637357e-01	6.658049e-01	0	0	0	270	0	6	749
CDCP1	64866	broad.mit.edu	37	3	45159953	45159953	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:45159953G>A	ENST00000296129.1	-	2	377	c.243C>T	c.(241-243)agC>agT	p.S81S	CDCP1_ENST00000490471.1_5'UTR|CDCP1_ENST00000425231.2_Silent_p.S81S	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	81						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GACTCTGGCAGCTAAAGGTAA	0.393																																						ENST00000296129.1	1.000000	0.100000	6.100000e-01	1.800000e-01	0.300000	0.401115	0.300000	0.250000																										0				29						c.(241-243)agC>agT		CUB domain containing protein 1							116.0	117.0	116.0					3																	45159953		2203	4300	6503	SO:0001819	synonymous_variant	64866	0	0					g.chr3:45159953G>A	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.243C>T	chr3.hg19:g.45159953G>A		0					CDCP1_ENST00000425231.2_Silent_p.S81S|CDCP1_ENST00000490471.1_5'UTR	p.S81S	NM_022842.3	NP_073753.3	1	2	3	2.004667	Q9H5V8	CDCP1_HUMAN		2	377	-			Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	ENST00000296129.1	0	1	hg19	c.243C>T	CCDS2727.1	0																																																																																								0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.393	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	2.020000	-3.068501	1	0.090000	NM_022842		0	5	5	0	433	426	0		1	0		0	0	87	0	0	9.351994e-01	6.415153e-04	0	0	0	3	0	5	433
SMARCC1	6599	broad.mit.edu	37	3	47651727	47651727	+	Missense_Mutation	SNP	T	T	C			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:47651727T>C	ENST00000254480.5	-	26	2991	c.2872A>G	c.(2872-2874)Atg>Gtg	p.M958V	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	958					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TGCTGTTCCATTTGCTGTCGT	0.542																																						ENST00000254480.5	1.000000	0.180000	5.300000e-01	2.400000e-01	0.330000	0.424002	0.330000	0.310000																										0				33						c.(2872-2874)Atg>Gtg		SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1							309.0	270.0	283.0					3																	47651727		2203	4300	6503	SO:0001583	missense	6599	0	0					g.chr3:47651727T>C	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2872A>G	chr3.hg19:g.47651727T>C	ENSP00000254480:p.Met958Val	0					SMARCC1_ENST00000425518.1_5'UTR	p.M958V	NM_003074.3	NP_003065.3	1	2	3	2.004667	Q92922	SMRC1_HUMAN		26	2991	-			Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	ENST00000254480.5	0	1	hg19	c.2872A>G	CCDS2758.1	0	.	.	.	.	.	.	.	.	.	.	T	2.078	-0.411502	0.04799	.	.	ENSG00000173473	ENST00000254480	T	0.62498	0.02	5.85	4.68	0.58851	5.85	4.68	0.58851	.	0.177402	0.64402	D	0.000018	T	0.31451	0.0797	N	0.02011	-0.69	0.38545	D	0.949318	B	0.06786	0.001	B	0.06405	0.002	T	0.17806	-1.0357	10	0.08837	T	0.75	-19.8043	11.3715	0.49702	0.0:0.0:0.2894:0.7106	.	958	Q92922	SMRC1_HUMAN	V	958	ENSP00000254480:M958V	ENSP00000254480:M958V	M	-	1	0	0	SMARCC1	47626731	47626731	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	3.897000	0.56273	1.014000	0.39417	-0.316000	0.08728	ATG	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.542	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1	0	0	1	2	2	2	2	0	0	0	0	205	205	205	204	1	2.020000	-2.921096	1	0.090000			0	14	14	0	1006	992	0		1	0		0	0	205	0	0	9.997248e-01	1.238906e-01	0	0	0	41	0	14	1006
GNAT1	2779	broad.mit.edu	37	3	50231284	50231284	+	Missense_Mutation	SNP	C	C	T	rs375795574		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:50231284C>T	ENST00000433068.1	+	5	604	c.548C>T	c.(547-549)aCg>aTg	p.T183M	GNAT1_ENST00000481246.1_3'UTR|GNAT1_ENST00000232461.3_Missense_Mutation_p.T183M	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	183					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		ATCATCGAGACGCAGTTCTCC	0.652																																						ENST00000433068.1	1.000000	0.200000	8.700000e-01	3.100000e-01	0.470000	0.542609	0.470000	0.410000																										0				17						c.(547-549)aCg>aTg		guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1		C	MET/THR,MET/THR	0,4406		0,0,2203	81.0	73.0	76.0		548,548	5.7	1.0	3		76	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GNAT1	NM_000172.3,NM_144499.2	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	183/351,183/351	50231284	1,13005	2203	4300	6503	SO:0001583	missense	2779	2	121396	32				g.chr3:50231284C>T		CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.548C>T	chr3.hg19:g.50231284C>T	ENSP00000387555:p.Thr183Met	0					GNAT1_ENST00000481246.1_3'UTR|GNAT1_ENST00000232461.3_Missense_Mutation_p.T183M	p.T183M	NM_000172.3	NP_000163.2	1	2	3	2.004667	P11488	GNAT1_HUMAN		5	604	+			Q4VBN2	Missense_Mutation	SNP	ENST00000433068.1	0	1	hg19	c.548C>T	CCDS2812.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407214	0.83230	0.0	1.16E-4	ENSG00000114349	ENST00000232461;ENST00000433068	D;D	0.89196	-2.48;-2.48	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.045321	0.85682	D	0.000000	D	0.94945	0.8365	M	0.83118	2.625	0.47374	D	0.999403	D	0.89917	1.0	D	0.77004	0.989	D	0.95088	0.8219	10	0.72032	D	0.01	.	18.6092	0.91277	0.0:1.0:0.0:0.0	.	183	P11488	GNAT1_HUMAN	M	183	ENSP00000232461:T183M;ENSP00000387555:T183M	ENSP00000232461:T183M	T	+	2	0	0	GNAT1	50206288	50206288	1.000000	0.71417	0.981000	0.43875	0.984000	0.73092	4.464000	0.60134	2.711000	0.92665	0.561000	0.74099	ACG	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.652	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	0	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	2.020000	-3.376190	1	0.090000	NM_000172		0	7	7	0	367	360	0		1			0	0	95	0	0	9.794984e-01	0	0	0	0	0	0	7	367
ATP13A5	344905	broad.mit.edu	37	3	193039478	193039478	+	Missense_Mutation	SNP	G	G	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr3:193039478G>T	ENST00000342358.4	-	16	2024	c.1907C>A	c.(1906-1908)tCt>tAt	p.S636Y		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	636						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.S636F(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		ACCTGTTTCAGATCTGCAGAA	0.463																																						ENST00000342358.4	1.000000	0.120000	7.200000e-01	2.200000e-01	0.350000	0.446630	0.350000	0.290000																										1	Substitution - Missense(1)	p.S636F(1)	skin(1)	76						c.(1906-1908)tCt>tAt		ATPase type 13A5							71.0	71.0	71.0					3																	193039478		2203	4300	6503	SO:0001583	missense	344905	0	0					g.chr3:193039478G>T	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1907C>A	chr3.hg19:g.193039478G>T	ENSP00000341942:p.Ser636Tyr	0						p.S636Y	NM_198505.2	NP_940907.2	1	2	3	2.004667	Q4VNC0	AT135_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	16	2024	-	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	0	1	hg19	c.1907C>A	CCDS33914.1	0	.	.	.	.	.	.	.	.	.	.	G	8.022	0.759846	0.15846	.	.	ENSG00000187527	ENST00000342358	T	0.71579	-0.58	5.5	4.62	0.57501	5.5	4.62	0.57501	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.676384	0.14815	N	0.296831	T	0.65852	0.2731	L	0.41124	1.26	0.20196	N	0.999929	P	0.37176	0.586	B	0.42495	0.389	T	0.60306	-0.7289	10	0.62326	D	0.03	-1.1021	9.2597	0.37605	0.0772:0.0:0.7782:0.1446	.	636	Q4VNC0	AT135_HUMAN	Y	636	ENSP00000341942:S636Y	ENSP00000341942:S636Y	S	-	2	0	0	ATP13A5	194522172	194522172	0.001000	0.12720	0.470000	0.27216	0.062000	0.15995	1.160000	0.31761	1.476000	0.48215	-0.140000	0.14226	TCT	0.097715		TCGA-Q3-A5QY-01A-12D-A32N-08	0.463	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	0	0	0	2	2	2	2	0	0	0	0	60	60	60	58	1	2.020000	-4.691728	1	0.090000	NM_198505		0	5	1	0	365	363	0		0			0	0	60	0	0	9.352304e-01	0	0	0	0	0	0	5	365
RXRB	6257	broad.mit.edu	37	6	33166123	33166123	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr6:33166123C>T	ENST00000374680.3	-	3	813	c.602G>A	c.(601-603)gGc>gAc	p.G201D	SLC39A7_ENST00000374675.3_5'Flank|SLC39A7_ENST00000374677.3_5'Flank|RXRB_ENST00000413614.2_Missense_Mutation_p.G105D|RXRB_ENST00000374685.4_Missense_Mutation_p.G201D|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000544186.1_Missense_Mutation_p.G11D	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	201	Modulating. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TAGCCGTTTGCCAGCCCCAGG	0.622																																						ENST00000374680.3	0.280000	0.050000	2.100000e-01	9.000000e-02	0.140000	0.157888	0.140000	0.140000																										0				15						c.(601-603)gGc>gAc		retinoid X receptor, beta	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)						123.0	144.0	136.0					6																	33166123		1508	2707	4215	SO:0001583	missense	6257	0	0					g.chr6:33166123C>T	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.602G>A	chr6.hg19:g.33166123C>T	ENSP00000363812:p.Gly201Asp	0					RXRB_ENST00000374685.4_Missense_Mutation_p.G201D|SLC39A7_ENST00000374675.3_5'Flank|RXRB_ENST00000413614.2_Missense_Mutation_p.G105D|SLC39A7_ENST00000374677.3_5'Flank|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000544186.1_Missense_Mutation_p.G11D	p.G201D	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	0	1	1	1.994193	P28702	RXRB_HUMAN		3	813	-			P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	0	1	hg19	c.602G>A	CCDS4768.1	0	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864280	0.51482	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186;ENST00000413614	D;D;D;D	0.93189	-3.16;-3.16;-3.18;-3.0	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.376195	0.30649	N	0.009176	D	0.91553	0.7332	N	0.19112	0.55	0.43187	D	0.995017	D;D;D;B;B;P;P;P	0.69078	0.997;0.988;0.995;0.04;0.305;0.737;0.92;0.737	D;P;P;B;B;B;B;B	0.63597	0.916;0.837;0.72;0.045;0.109;0.22;0.345;0.22	D	0.92106	0.5692	10	0.45353	T	0.12	.	16.0896	0.81084	0.0:1.0:0.0:0.0	.	105;201;84;11;201;201;241;201	B7Z3E4;B7Z6J2;B7Z6X3;E9PK95;Q5STQ1;Q5STP9;Q59G65;P28702	.;.;.;.;.;.;.;RXRB_HUMAN	D	201;201;11;105	ENSP00000363817:G201D;ENSP00000363812:G201D;ENSP00000439222:G11D;ENSP00000415561:G105D	ENSP00000363812:G201D	G	-	2	0	0	RXRB	33274101	33274101	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.205000	0.42770	2.644000	0.89710	0.549000	0.68633	GGC	0.082569		TCGA-Q3-A5QY-01A-12D-A32N-08	0.622	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	0	0	1	2	15	3	2	1	1	1	1	228	228	228	227	1	2.020000	-1.713247	0	0.090000	NM_021976		0	6	6	0	958	946	0		0	0		1	0	228	0	0	3.583610e-02	1.786801e-02	0	0	0	69	0	6	958
GRIK2	2898	broad.mit.edu	37	6	102134137	102134137	+	Missense_Mutation	SNP	C	C	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr6:102134137C>T	ENST00000421544.1	+	6	1350	c.860C>T	c.(859-861)aCc>aTc	p.T287I	GRIK2_ENST00000358361.3_Missense_Mutation_p.T287I|GRIK2_ENST00000369138.1_Missense_Mutation_p.T287I|GRIK2_ENST00000369134.4_Missense_Mutation_p.T238I|GRIK2_ENST00000369137.3_Missense_Mutation_p.T287I|GRIK2_ENST00000318991.6_Missense_Mutation_p.T287I|GRIK2_ENST00000413795.1_Missense_Mutation_p.T287I	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	287					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ACAGAAAATACCCAAGTCTCC	0.423																																						ENST00000421544.1	1.000000	0.180000	1	3.000000e-01	0.470000	0.543423	0.470000	0.400000																										0				83						c.(859-861)aCc>aTc		glutamate receptor, ionotropic, kainate 2	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)						95.0	94.0	94.0					6																	102134137		2203	4300	6503	SO:0001583	missense	2898	0	0					g.chr6:102134137C>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.860C>T	chr6.hg19:g.102134137C>T	ENSP00000397026:p.Thr287Ile	0					GRIK2_ENST00000369138.1_Missense_Mutation_p.T287I|GRIK2_ENST00000413795.1_Missense_Mutation_p.T287I|GRIK2_ENST00000318991.6_Missense_Mutation_p.T287I|GRIK2_ENST00000369137.3_Missense_Mutation_p.T287I|GRIK2_ENST00000369134.4_Missense_Mutation_p.T238I|GRIK2_ENST00000358361.3_Missense_Mutation_p.T287I	p.T287I	NM_021956.4	NP_068775.1	1	2	3	2.007314	Q13002	GRIK2_HUMAN		6	1350	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	0	1	hg19	c.860C>T	CCDS5048.1	0	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092200	0.36952	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.84	4.03	0.46877	5.84	4.03	0.46877	Extracellular ligand-binding receptor (1);	0.157085	0.53938	D	0.000043	T	0.47857	0.1468	N	0.04508	-0.205	0.26912	N	0.966869	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.49082	-0.8976	10	0.66056	D	0.02	.	10.6595	0.45694	0.0:0.6482:0.2676:0.0843	.	287;287;287	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	I	287;287;287;287;287;287;287;238;249	ENSP00000397026:T287I;ENSP00000405596:T287I;ENSP00000358134:T287I;ENSP00000351128:T287I;ENSP00000358133:T287I;ENSP00000313276:T287I;ENSP00000358130:T238I	ENSP00000313276:T287I	T	+	2	0	0	GRIK2	102240830	102240830	0.997000	0.39634	0.911000	0.35937	0.907000	0.53573	2.346000	0.44027	1.471000	0.48121	0.655000	0.94253	ACC	0.098519		TCGA-Q3-A5QY-01A-12D-A32N-08	0.423	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	2.020000	-4.206827	1	0.090000			0	6	6	0	325	324	0		1			0	0	61	0	0	9.650124e-01	0	0	0	0	0	0	6	325
SRI	6717	broad.mit.edu	37	7	87840221	87840221	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr7:87840221G>A	ENST00000265729.2	-	4	277	c.225C>T	c.(223-225)tgC>tgT	p.C75C	SRI_ENST00000419179.1_Silent_p.C75C|SRI_ENST00000490437.1_Silent_p.C32C|SRI_ENST00000394641.3_Silent_p.C60C|SRI_ENST00000431660.1_Silent_p.C60C	NM_003130.3	NP_003121.1	P30626	SORCN_HUMAN	sorcin	75	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				action potential (GO:0001508)|calcium ion transport (GO:0006816)|cytoplasmic sequestering of transcription factor (GO:0042994)|heart development (GO:0007507)|intracellular sequestering of iron ion (GO:0006880)|muscle organ development (GO:0007517)|negative regulation of heart rate (GO:0010459)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|proteolysis (GO:0006508)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart contraction (GO:0008016)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of relaxation of muscle (GO:1901077)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of striated muscle contraction (GO:0006942)|signal transduction (GO:0007165)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|ion channel binding (GO:0044325)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(14;0.00202)					CCATAAGCCGGCAAGTCTCCA	0.284																																						ENST00000265729.2	1.000000	0.170000	1	2.900000e-01	0.480000	0.555811	0.480000	0.400000																										0				5						c.(223-225)tgC>tgT		sorcin							51.0	52.0	52.0					7																	87840221		2203	4295	6498	SO:0001819	synonymous_variant	6717	0	0					g.chr7:87840221G>A	M32886	CCDS5612.1, CCDS47638.1, CCDS59063.1	7q21.1	2014-09-17			ENSG00000075142	ENSG00000075142		"""EF-hand domain containing"""	11292	protein-coding gene	gene with protein product		182520				2901906	Standard	NM_001256891		Approved		uc003ujq.2	P30626	OTTHUMG00000157267	ENST00000265729.2:c.225C>T	chr7.hg19:g.87840221G>A		0					SRI_ENST00000419179.1_Silent_p.C75C|SRI_ENST00000490437.1_Silent_p.C32C|SRI_ENST00000431660.1_Silent_p.C60C|SRI_ENST00000394641.3_Silent_p.C60C	p.C75C	NM_003130.3	NP_003121.1	1	2	3	2.014809	P30626	SORCN_HUMAN		4	277	-	Esophageal squamous(14;0.00202)		A8MTH6|B4DKK2|D6W5Q0	Silent	SNP	ENST00000265729.2	0	1	hg19	c.225C>T	CCDS5612.1	0																																																																																								0.100124		TCGA-Q3-A5QY-01A-12D-A32N-08	0.284	SRI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253680.1	0	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	2.020000	-2.773713	1	0.090000	NM_003130		0	5	5	0	277	270	0		1	0		0	0	32	0	0	9.338797e-01	9.863947e-01	0	0	0	463	0	5	277
RNF133	168433	broad.mit.edu	37	7	122338787	122338787	+	Missense_Mutation	SNP	A	A	T			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr7:122338787A>T	ENST00000340112.2	-	1	423	c.186T>A	c.(184-186)ttT>ttA	p.F62L	CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	62					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						AGCTTCTTCCAAAGACTCCAG	0.423																																					Colon(198;1778 2057 7449 19869 45985)	ENST00000340112.2	1.000000	0.170000	7.700000e-01	2.600000e-01	0.380000	0.472356	0.380000	0.340000																										0				21						c.(184-186)ttT>ttA		ring finger protein 133							108.0	110.0	110.0					7																	122338787		2203	4300	6503	SO:0001583	missense	168433	0	0					g.chr7:122338787A>T	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.186T>A	chr7.hg19:g.122338787A>T	ENSP00000344489:p.Phe62Leu	0					CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000412584.2_Intron	p.F62L	NM_139175.1	NP_631914.1	1	2	3	2.008899	Q8WVZ7	RN133_HUMAN		1	423	-			A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	0	1	hg19	c.186T>A	CCDS5784.1	0	.	.	.	.	.	.	.	.	.	.	A	21.0	4.079128	0.76528	.	.	ENSG00000188050	ENST00000340112	T	0.24538	1.85	6.06	3.71	0.42584	6.06	3.71	0.42584	.	0.154247	0.43747	D	0.000537	T	0.42471	0.1204	M	0.65498	2.005	0.80722	D	1	D	0.55605	0.972	P	0.60012	0.867	T	0.25710	-1.0124	10	0.87932	D	0	.	9.7273	0.40339	0.8574:0.0:0.1426:0.0	.	62	Q8WVZ7	RN133_HUMAN	L	62	ENSP00000344489:F62L	ENSP00000344489:F62L	F	-	3	2	2	RNF133	122126023	122126023	1.000000	0.71417	0.997000	0.53966	0.845000	0.48019	0.994000	0.29693	0.542000	0.28846	0.533000	0.62120	TTT	0.098519		TCGA-Q3-A5QY-01A-12D-A32N-08	0.423	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	0	0	1	2	2	2	2	0	0	0	0	121	121	121	121	1	2.020000	-7.374735	1	0.090000	NM_139175		0	9	9	0	580	575	0		1			0	0	121	0	0	9.940486e-01	0	0	0	0	0	0	9	580
RAB11FIP1	80223	broad.mit.edu	37	8	37732058	37732058	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr8:37732058G>A	ENST00000330843.4	-	3	1609	c.1597C>T	c.(1597-1599)Ccc>Tcc	p.P533S	RAB11FIP1_ENST00000522727.1_Missense_Mutation_p.P385S|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.P533S|RAB11FIP1_ENST00000524118.1_Missense_Mutation_p.P385S|RAB11FIP1_ENST00000523182.1_5'Flank	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	533					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CTGGTCTGGGGAGCCCTCGGA	0.542																																						ENST00000330843.4	1.000000	0.160000	6.700000e-01	2.500000e-01	0.390000	0.467739	0.390000	0.330000																										0				49						c.(1597-1599)Ccc>Tcc		RAB11 family interacting protein 1 (class I)							60.0	59.0	59.0					8																	37732058		2203	4300	6503	SO:0001583	missense	80223	0	0					g.chr8:37732058G>A	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1597C>T	chr8.hg19:g.37732058G>A	ENSP00000331342:p.Pro533Ser	0					RAB11FIP1_ENST00000523182.1_5'Flank|RAB11FIP1_ENST00000522727.1_Missense_Mutation_p.P385S|RAB11FIP1_ENST00000524118.1_Missense_Mutation_p.P385S|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.P533S	p.P533S	NM_001002814.2	NP_001002814.2	1	2	3	2.000125	Q6WKZ4	RFIP1_HUMAN	LUSC - Lung squamous cell carcinoma(8;3.62e-11)	3	1609	-		Lung NSC(58;0.118)|all_lung(54;0.195)	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	0	1	hg19	c.1597C>T	CCDS34882.1	0	.	.	.	.	.	.	.	.	.	.	G	15.79	2.937277	0.52972	.	.	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000522727;ENST00000524118	T;T;T;T	0.31247	2.24;2.1;1.51;1.5	5.03	4.14	0.48551	5.03	4.14	0.48551	.	0.408600	0.23672	N	0.045718	T	0.16300	0.0392	L	0.32530	0.975	0.19300	N	0.999972	B;B;P;P	0.38148	0.068;0.194;0.617;0.62	B;B;B;B	0.33960	0.009;0.066;0.173;0.138	T	0.10428	-1.0630	10	0.12766	T	0.61	-6.1245	4.077	0.09909	0.0874:0.1748:0.5807:0.1571	.	385;385;533;533	E7EX40;Q6WKZ4-2;Q6WKZ4-3;Q6WKZ4	.;.;.;RFIP1_HUMAN	S	533;533;385;385	ENSP00000287263:P533S;ENSP00000331342:P533S;ENSP00000430009:P385S;ENSP00000430680:P385S	ENSP00000287263:P533S	P	-	1	0	0	RAB11FIP1	37851216	37851216	0.984000	0.35163	0.794000	0.32065	0.871000	0.50021	2.561000	0.45905	1.071000	0.40834	0.655000	0.94253	CCC	0.096909		TCGA-Q3-A5QY-01A-12D-A32N-08	0.542	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	0	0	1	2	2	2	2	0	0	0	0	110	110	110	109	1	2.020000	-3.238021	1	0.090000	NM_025151		0	7	7	0	445	439	0		1	1		0	0	110	0	0	9.798331e-01	1.250887e-01	0	2	0	31	0	7	445
ZC3H3	23144	broad.mit.edu	37	8	144547942	144547942	+	Missense_Mutation	SNP	C	C	T	rs113716075		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr8:144547942C>T	ENST00000262577.5	-	9	2283	c.2252G>A	c.(2251-2253)cGc>cAc	p.R751H		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	751					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CTCGGCCTTGCGGGACACGTA	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		19798	0.0		0.001	False		,,,				2504	0.0					ENST00000262577.5	1.000000	0.140000	7.200000e-01	2.300000e-01	0.380000	0.464827	0.380000	0.330000																										0				23						c.(2251-2253)cGc>cAc		zinc finger CCCH-type containing 3		C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	107.0	87.0	94.0		2252	2.7	1.0	8	dbSNP_132	94	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ZC3H3	NM_015117.2	29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging	751/949	144547942	3,13003	2203	4300	6503	SO:0001583	missense	23144	11	121408	42				g.chr8:144547942C>T	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2252G>A	chr8.hg19:g.144547942C>T	ENSP00000262577:p.Arg751His	0						p.R751H	NM_015117.2	NP_055932.2	1	2	3	2.000125	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)	9	2283	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	0	1	hg19	c.2252G>A	CCDS6402.1	0	.	.	.	.	.	.	.	.	.	.	C	15.71	2.915110	0.52546	4.54E-4	1.16E-4	ENSG00000014164	ENST00000262577	T	0.71341	-0.56	4.9	2.7	0.31948	4.9	2.7	0.31948	Zinc finger, CCCH-type (2);	0.132811	0.49305	D	0.000156	T	0.53174	0.1780	L	0.31526	0.94	0.38805	D	0.955289	P	0.39520	0.676	B	0.32022	0.139	T	0.60637	-0.7224	10	0.72032	D	0.01	-20.5515	10.588	0.45294	0.1341:0.7844:0.0:0.0815	.	751	Q8IXZ2	ZC3H3_HUMAN	H	751	ENSP00000262577:R751H	ENSP00000262577:R751H	R	-	2	0	0	ZC3H3	144619085	144619085	1.000000	0.71417	0.993000	0.49108	0.843000	0.47879	3.695000	0.54749	1.057000	0.40506	0.561000	0.74099	CGC	0.096909		TCGA-Q3-A5QY-01A-12D-A32N-08	0.632	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	0	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	2.020000	-2.994690	1	0.090000	NM_015117		0	5	5	0	334	332	0		1	0		0	0	81	0	0	9.370146e-01	4.291309e-01	0	0	0	86	0	5	334
ZBTB26	57684	broad.mit.edu	37	9	125681305	125681305	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr9:125681305G>A	ENST00000373656.3	-	2	982	c.909C>T	c.(907-909)tgC>tgT	p.C303C	ZBTB26_ENST00000373654.1_Silent_p.C303C	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						AAGTCTTGCCGCAGAGTAGAC	0.458																																						ENST00000373656.3	1.000000	0.120000	1	2.000000e-01	0.320000	0.438496	0.320000	0.270000																										0				11						c.(907-909)tgC>tgT		zinc finger and BTB domain containing 26							84.0	80.0	81.0					9																	125681305		2203	4300	6503	SO:0001819	synonymous_variant	57684	1	121412	27				g.chr9:125681305G>A	AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.909C>T	chr9.hg19:g.125681305G>A		0					ZBTB26_ENST00000373654.1_Silent_p.C303C	p.C303C	NM_020924.2	NP_065975.1	1	2	3	2.014814	Q9HCK0	ZBT26_HUMAN		2	982	-			B3KQ53|Q8WTR1	Silent	SNP	ENST00000373656.3	0	1	hg19	c.909C>T	CCDS6847.1	0																																																																																								0.100124		TCGA-Q3-A5QY-01A-12D-A32N-08	0.458	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053960.1	0	0	1	2	17	2	2	1	1	1	1	97	97	97	97	1	2.020000	-2.269370	0	0.090000	NM_020924		0	6	6	0	481	476	0		0	0		1	0	97	0	0	1.512280e-02	2.252751e-03	0	0	0	5	0	6	481
RLN2	6019	broad.mit.edu	37	9	5304440	5304440	+	Silent	SNP	G	G	A	rs544671340		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr9:5304440G>A	ENST00000381627.3	-	1	529	c.141C>T	c.(139-141)tgC>tgT	p.C47C	RLN2_ENST00000308420.3_Silent_p.C47C	NM_134441.2	NP_604390.1	P04090	REL2_HUMAN	relaxin 2	47					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	11	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.0987)		TGCTCATGCCGCAAATGGCAA	0.552													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18840	0.0		0.0	False		,,,				2504	0.0					ENST00000381627.3	0.810000	0.150000	6.100000e-01	2.600000e-01	0.410000	0.441984	0.410000	0.360000																										0				11						c.(139-141)tgC>tgT		relaxin 2							41.0	42.0	42.0					9																	5304440		2203	4297	6500	SO:0001819	synonymous_variant	6019	1	121400	34				g.chr9:5304440G>A		CCDS6460.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107014	ENSG00000107014		"""Endogenous ligands"""	10027	protein-coding gene	gene with protein product	"""relaxin H2"", ""prorelaxin H2"", ""relaxin, ovarian, of pregnancy"""	179740	"""relaxin 2 (H2)"""			6548703, 6548702	Standard	NM_134441		Approved	H2, RLXH2, bA12D24.1.1, bA12D24.1.2	uc003zja.2	P04090	OTTHUMG00000019496	ENST00000381627.3:c.141C>T	chr9.hg19:g.5304440G>A		0					RLN2_ENST00000308420.3_Silent_p.C47C	p.C47C	NM_134441.2	NP_604390.1	0	1	1	1.991205	P04090	REL2_HUMAN		1	529	-	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)	A0AVM0|Q99936|Q9UCX3|Q9UQJ2	Silent	SNP	ENST00000381627.3	0	1	hg19	c.141C>T	CCDS6460.1	0																																																																																								0.082152		TCGA-Q3-A5QY-01A-12D-A32N-08	0.552	RLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051619.1	0	0	1	2	2	2	2	0	0	0	0	63	63	63	0	1	2.020000	-3.030533	1	0.090000	NM_134441		0	5	0	0	280	0	0					0	0	63	0	0	0	0	0	0	0	0	0	5	280
KIAA1045	23349	broad.mit.edu	37	9	34972446	34972446	+	Missense_Mutation	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr9:34972446G>A	ENST00000242315.3	+	3	564	c.482G>A	c.(481-483)cGc>cAc	p.R161H	KIAA1045_ENST00000476115.2_3'UTR|KIAA1045_ENST00000544237.1_Missense_Mutation_p.R161H	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	161							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			TGCCTGCGCCGCATGGGCTAC	0.577																																						ENST00000242315.3	0.460000	0.090000	3.500000e-01	1.500000e-01	0.240000	0.259895	0.240000	0.220000																										0				19						c.(481-483)cGc>cAc		KIAA1045							108.0	116.0	113.0					9																	34972446		2060	4209	6269	SO:0001583	missense	23349	5	121006	42				g.chr9:34972446G>A	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.482G>A	chr9.hg19:g.34972446G>A	ENSP00000242315:p.Arg161His	0					KIAA1045_ENST00000544237.1_Missense_Mutation_p.R161H|KIAA1045_ENST00000476115.2_3'UTR	p.R161H	NM_015297.1	NP_056112.1	0	1	1	1.991205	Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)	3	564	+			B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	0	1	hg19	c.482G>A	CCDS43796.1	0	.	.	.	.	.	.	.	.	.	.	g	26.1	4.706470	0.89018	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.73	4.84	0.62591	5.73	4.84	0.62591	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, FYVE/PHD-type (1);	0.131353	0.53938	D	0.000049	T	0.51822	0.1697	M	0.62723	1.935	0.43304	D	0.995305	P	0.37141	0.584	B	0.29598	0.104	T	0.56195	-0.8019	9	0.51188	T	0.08	-11.7038	13.7849	0.63104	0.0733:0.0:0.9267:0.0	.	161	Q9UPV7	K1045_HUMAN	H	161	.	ENSP00000242315:R161H	R	+	2	0	0	KIAA1045	34962446	34962446	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.616000	0.67709	1.429000	0.47314	0.655000	0.94253	CGC	0.082152		TCGA-Q3-A5QY-01A-12D-A32N-08	0.577	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	0	0	1	2	16	2	2	1	1	1	1	139	139	139	136	1	2.020000	-1.989670	0	0.090000	XM_048592		0	6	6	0	574	574	0		0			1	0	139	0	0	2.490685e-02	0	0	0	0	0	0	6	574
C9orf131	138724	broad.mit.edu	37	9	35044336	35044336	+	Silent	SNP	G	G	A	rs115027328		TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr9:35044336G>A	ENST00000312292.5	+	2	1757	c.1710G>A	c.(1708-1710)ccG>ccA	p.P570P	C9orf131_ENST00000421362.2_Silent_p.P522P|C9orf131_ENST00000354479.5_Silent_p.P497P|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	570										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CTCTTGCACCGGAGCTGCTCA	0.527																																						ENST00000312292.5	0.360000	0.080000	2.700000e-01	1.200000e-01	0.190000	0.206068	0.190000	0.180000																										0				39						c.(1708-1710)ccG>ccA		chromosome 9 open reading frame 131							125.0	128.0	127.0					9																	35044336		2203	4300	6503	SO:0001819	synonymous_variant	138724	9	121410	46				g.chr9:35044336G>A	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1710G>A	chr9.hg19:g.35044336G>A		0					C9orf131_ENST00000354479.5_Silent_p.P497P|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000421362.2_Silent_p.P522P	p.P570P	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	0	1	1	1.991205	Q5VYM1	CI131_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)	2	1757	+	all_epithelial(49;0.22)		A6NLE6|E9PB26|Q86XC6|Q9UF74	Silent	SNP	ENST00000312292.5	0	1	hg19	c.1710G>A	CCDS6572.2	0																																																																																								0.082152		TCGA-Q3-A5QY-01A-12D-A32N-08	0.527	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	0	0	1	2	2	2	2	0	0	0	0	176	176	176	176	1	2.020000	-1.883202	0	0.090000	NM_203299		0	7	6	0	835	826	0		1			0	0	176	0	0	9.796999e-01	0	0	0	0	0	0	7	835
FUBP3	8939	broad.mit.edu	37	9	133499056	133499056	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chr9:133499056G>A	ENST00000319725.9	+	11	1008	c.933G>A	c.(931-933)caG>caA	p.Q311Q		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	311	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		ATCGGTGTCAGCATGCAGCGC	0.547																																						ENST00000319725.9	1.000000	0.100000	1	1.700000e-01	0.290000	0.412716	0.290000	0.240000																										0				21						c.(931-933)caG>caA		far upstream element (FUSE) binding protein 3							99.0	102.0	101.0					9																	133499056		2031	4205	6236	SO:0001819	synonymous_variant	8939	0	0					g.chr9:133499056G>A	U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.933G>A	chr9.hg19:g.133499056G>A		0						p.Q311Q	NM_003934.1	NP_003925.1	1	2	3	2.014814	Q96I24	FUBP3_HUMAN		11	1008	+			A3KFK8|A3KFL0|Q92946|Q9BVB6	Silent	SNP	ENST00000319725.9	0	1	hg19	c.933G>A	CCDS43893.1	0																																																																																								0.100124		TCGA-Q3-A5QY-01A-12D-A32N-08	0.547	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1	0	0	1	2	2	2	2	0	0	0	0	111	111	111	111	1	2.020000	-2.870389	1	0.090000			0	5	5	0	458	450	0		1	0		0	0	111	0	0	9.349555e-01	1.903740e-01	0	0	0	61	0	5	458
DMD	1756	broad.mit.edu	37	X	31222081	31222081	+	Silent	SNP	T	T	C	rs12690372	byFrequency	TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chrX:31222081T>C	ENST00000357033.4	-	67	10010	c.9804A>G	c.(9802-9804)caA>caG	p.Q3268Q	DMD_ENST00000343523.2_Silent_p.Q808Q|DMD_ENST00000361471.4_Silent_p.Q200Q|DMD_ENST00000474231.1_Silent_p.Q808Q|DMD_ENST00000378707.3_Silent_p.Q808Q|DMD_ENST00000359836.1_Silent_p.Q808Q|DMD_ENST00000378723.3_Silent_p.Q200Q|DMD_ENST00000378677.2_Silent_p.Q3264Q|DMD_ENST00000378702.4_Silent_p.Q200Q|DMD_ENST00000378680.2_Silent_p.Q200Q|DMD_ENST00000541735.1_Silent_p.Q808Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3268	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AACTTACAAATTGGAAGCAGC	0.383																																						ENST00000357033.4	0.600000	0.130000	4.600000e-01	2.100000e-01	0.310000	0.340105	0.310000	0.300000																										0				77						c.(9802-9804)caA>caG		dystrophin		T	,,,,,,,,,,,,,,,,,	2,3831		0,2,1629,571	58.0	51.0	53.0		9780,9804,9435,9792,9435,5781,5772,2424,1617,600,600,600,600,600,2424,2424,2424,2424	-7.0	0.6	X	dbSNP_120	53	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DMD	NM_000109.3,NM_004006.2,NM_004007.2,NM_004009.3,NM_004010.3,NM_004011.3,NM_004012.3,NM_004013.2,NM_004014.2,NM_004015.2,NM_004016.2,NM_004017.2,NM_004018.2,NM_004019.2,NM_004020.3,NM_004021.2,NM_004022.2,NM_004023.2	,,,,,,,,,,,,,,,,,	0,2,4057,2443	CC,CT,TT,T		0.0,0.0522,0.0189	,,,,,,,,,,,,,,,,,	3260/3678,3268/3686,3145/3563,3264/3682,3145/3563,1927/2345,1924/2342,808/1226,539/957,200/618,200/636,200/605,200/623,200/341,808/1116,808/1244,808/1231,808/1134	31222081	2,10559	2202	4300	6502	SO:0001819	synonymous_variant	1756	44	121410	46				g.chrX:31222081T>C	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9804A>G	chrX.hg19:g.31222081T>C							DMD_ENST00000378723.3_Silent_p.Q200Q|DMD_ENST00000343523.2_Silent_p.Q808Q|DMD_ENST00000474231.1_Silent_p.Q808Q|DMD_ENST00000378702.4_Silent_p.Q200Q|DMD_ENST00000378707.3_Silent_p.Q808Q|DMD_ENST00000359836.1_Silent_p.Q808Q|DMD_ENST00000378680.2_Silent_p.Q200Q|DMD_ENST00000541735.1_Silent_p.Q808Q|DMD_ENST00000361471.4_Silent_p.Q200Q|DMD_ENST00000378677.2_Silent_p.Q3264Q	p.Q3268Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	0	1	1		P11532	DMD_HUMAN		67	10010	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	0	1	hg19	c.9804A>G	CCDS14233.1	0	.	.	.	.	.	.	.	.	.	.	T	9.064	0.995258	0.19043	5.22E-4	0.0	ENSG00000198947	ENST00000465285	.	.	.	5.11	-6.97	0.01616	5.11	-6.97	0.01616	.	.	.	.	.	T	0.62221	0.2410	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66196	-0.5984	4	.	.	.	.	15.5819	0.76448	0.1098:0.7325:0.0:0.1577	rs12690372;rs12690372	.	.	.	V	997	.	.	I	-	1	0	0	DMD	31132002	31132002	0.975000	0.34042	0.629000	0.29254	0.985000	0.73830	0.181000	0.16880	-2.089000	0.00860	-0.323000	0.08544	ATT	0.090000		TCGA-Q3-A5QY-01A-12D-A32N-08	0.383	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	0	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	2.020000	-7.907222	1	0.090000	NM_004006		0	6	6	0	210	209	0		1	0		0	0	27	0	0	9.651049e-01	6.660461e-03	0	0	0	4	0	6	210
IRS4	8471	broad.mit.edu	37	X	107978822	107978822	+	Silent	SNP	G	G	A			TCGA-Q3-A5QY-01A-12D-A32N-08	TCGA-Q3-A5QY-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac05724b-42c0-4cb3-806b-aadc13554d38	db4aed26-55eb-44b7-91d4-d8c50b9ccce3	g.chrX:107978822G>A	ENST00000372129.2	-	1	829	c.753C>T	c.(751-753)agC>agT	p.S251S	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	251	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGAACACGCCGCTCAGCTCTT	0.627																																						ENST00000372129.2	0.480000	0.070000	3.500000e-01	1.300000e-01	0.220000	0.250611	0.220000	0.200000																										0				78						c.(751-753)agC>agT		insulin receptor substrate 4							47.0	42.0	44.0					X																	107978822		2203	4300	6503	SO:0001819	synonymous_variant	8471	0	0					g.chrX:107978822G>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.753C>T	chrX.hg19:g.107978822G>A							RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	p.S251S	NM_003604.2	NP_003595.1	0	1	1		O14654	IRS4_HUMAN		1	829	-				Silent	SNP	ENST00000372129.2	0	1	hg19	c.753C>T	CCDS14544.1	0																																																																																								0.090000		TCGA-Q3-A5QY-01A-12D-A32N-08	0.627	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	2.020000	-3.288630	1	0.090000	NM_003604		0	4	4	0	205	203	0		1			0	0	33	0	0	8.889266e-01	0	0	0	0	0	0	4	205
