#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ZNF658	26149	broad.mit.edu	37	9	40772411	40772411	+	Frame_Shift_Del	DEL	A	A	-			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr9:40772411delA	ENST00000602553.1	-	5	3158	c.2864delT	c.(2863-2865)gtafs	p.V955fs	ZNF658_ENST00000377626.3_Frame_Shift_Del_p.V955fs|ZNF658_ENST00000441795.1_Intron			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	955					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TCTTTGATGTACTCTGAGGGT	0.423																																						ENST00000602553.1	0.800000	5.800000e-01	0.750000	0.630000	0.690000	0.697158	0.690000	0.690000																										0				46						c.(2863-2865)gtafs		zinc finger protein 658							35.0	38.0	37.0					9																	40772411		1502	3165	4667	SO:0001589	frameshift_variant	26149	0	0					g.chr9:40772411delA	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.2864delT	chr9.hg19:g.40772411delA	ENSP00000473484:p.Val955fs	1					ZNF658_ENST00000377626.3_Frame_Shift_Del_p.V955fs|ZNF658_ENST00000441795.1_Intron	p.V955fs			0	0	0	1.770920	Q5TYW1	ZN658_HUMAN		5	3158	-			Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Frame_Shift_Del	DEL	ENST00000602553.1	0	1	hg19	c.2864delT	CCDS35023.1	0																																																																																								0.145399		TCGA-RB-A7B8-01A-12D-A33T-08	0.423	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	1	0	1		2	2		0	0	0	0	180	0	180	180	1	2.180000	-20.000000	1	0.270000	NM_033160		0	143	41	0	1156	182	0	0	1	0	0	0	0	180	0	0	1	2.194645e-01	0	0	0	8	0	143	1156
CTNNA3	29119	broad.mit.edu	37	10	67680252	67680252	+	Missense_Mutation	SNP	G	G	A	rs199852825		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr10:67680252G>A	ENST00000433211.2	-	18	2698	c.2524C>T	c.(2524-2526)Cgg>Tgg	p.R842W	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.R842W	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						ACTGGGTGCCGGGGCCCAGCA	0.478																																						ENST00000433211.2	0.170000	3.000000e-02	0.130000	0.060000	0.090000	0.100610	0.090000	0.090000																										0				95						c.(2524-2526)Cgg>Tgg		catenin (cadherin-associated protein), alpha 3		G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	89.0	88.0		2524,2524	2.9	1.0	10		88	0,8600		0,0,4300	no	missense,missense	CTNNA3	NM_001127384.1,NM_013266.2	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	842/896,842/896	67680252	1,13005	2203	4300	6503	SO:0001583	missense	29119	8	121412	46				g.chr10:67680252G>A	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2524C>T	chr10.hg19:g.67680252G>A	ENSP00000389714:p.Arg842Trp	0					CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.R842W	p.R842W	NM_013266.2	NP_037398.2	0	0	0	1.924992				18	2698	-				Missense_Mutation	SNP	ENST00000433211.2	0	1	hg19	c.2524C>T	CCDS7269.1	0	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709574	0.68730	2.27E-4	0.0	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.37235	1.21;1.21;1.21	5.92	2.87	0.33458	5.92	2.87	0.33458	.	0.000000	0.52532	D	0.000080	T	0.43875	0.1267	N	0.22421	0.69	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.44513	-0.9323	10	0.72032	D	0.01	-12.5285	13.3618	0.60661	0.0:0.0:0.423:0.577	.	842	Q9UI47	CTNA3_HUMAN	W	842;842;181	ENSP00000389714:R842W;ENSP00000362849:R842W;ENSP00000362840:R181W	ENSP00000362840:R181W	R	-	1	2	2	CTNNA3	67350258	67350258	1.000000	0.71417	0.980000	0.43619	0.984000	0.73092	2.574000	0.46016	0.779000	0.33543	-0.169000	0.13324	CGG	0.257979		TCGA-RB-A7B8-01A-12D-A33T-08	0.478	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	0	0	1	2	2	2	2	0	0	0	0	101	101	101	101	1	2.180000	-1.986958	0	0.270000	NM_013266		0	8	8	0	639	633	0		1			0	0	101	0	0	9.890169e-01	0	0	0	0	0	0	8	639
EIF4EBP2	1979	broad.mit.edu	37	10	72179709	72179709	+	Missense_Mutation	SNP	G	G	C	rs201220454		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr10:72179709G>C	ENST00000373218.4	+	2	208	c.185G>C	c.(184-186)cGt>cCt	p.R62P		NM_004096.4	NP_004087.1	Q13542	4EBP2_HUMAN	eukaryotic translation initiation factor 4E binding protein 2	62					cAMP-mediated signaling (GO:0019933)|insulin receptor signaling pathway (GO:0008286)|negative regulation of translational initiation (GO:0045947)|translation (GO:0006412)					large_intestine(1)	1						CTGTTGGATCGTCGCAATTCT	0.433																																						ENST00000373218.4	1.000000	7.700000e-01	1.000000	0.870000	0.980000	0.953232	0.980000	1.000000																										0				1						c.(184-186)cGt>cCt		eukaryotic translation initiation factor 4E binding protein 2							99.0	100.0	99.0					10																	72179709		2203	4300	6503	SO:0001583	missense	1979	0	0					g.chr10:72179709G>C		CCDS7303.1	10q21-q22	2008-08-01			ENSG00000148730	ENSG00000148730			3289	protein-coding gene	gene with protein product		602224				7935836, 8975712	Standard	NM_004096		Approved		uc001jrb.3	Q13542	OTTHUMG00000018409	ENST00000373218.4:c.185G>C	chr10.hg19:g.72179709G>C	ENSP00000362314:p.Arg62Pro	0						p.R62P	NM_004096.4	NP_004087.1	0	0	0	1.924992	Q13542	4EBP2_HUMAN		2	208	+				Missense_Mutation	SNP	ENST00000373218.4	1	1	hg19	c.185G>C	CCDS7303.1	1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628140	0.87560	.	.	ENSG00000148730	ENST00000373218	.	.	.	5.56	4.66	0.58398	5.56	4.66	0.58398	.	0.047741	0.85682	D	0.000000	T	0.68274	0.2983	L	0.56769	1.78	0.58432	D	0.999999	D	0.61697	0.99	P	0.59357	0.856	T	0.71258	-0.4646	9	0.59425	D	0.04	-6.3829	13.7427	0.62857	0.0756:0.0:0.9244:0.0	.	62	Q13542	4EBP2_HUMAN	P	62	.	ENSP00000362314:R62P	R	+	2	0	0	EIF4EBP2	71849715	71849715	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.117000	0.94347	1.498000	0.48600	0.650000	0.86243	CGT	0.257979		TCGA-RB-A7B8-01A-12D-A33T-08	0.433	EIF4EBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048513.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	62	1	2.180000	-20.000000	1	0.270000	NM_004096		0	63	63	0	399	389	1		1	1		0	0	63	0	0	1	9.992112e-01	0	14	0	55	0	63	399
ZC3H12C	85463	broad.mit.edu	37	11	110036119	110036119	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:110036119G>A	ENST00000278590.3	+	6	2360	c.2309G>A	c.(2308-2310)cGc>cAc	p.R770H	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.R739H|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.R771H	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	770							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CCTTATTCCCGCCAGGAAGGC	0.552																																						ENST00000278590.3	0.260000	7.000000e-02	0.210000	0.100000	0.150000	0.161509	0.150000	0.150000																										0				37						c.(2308-2310)cGc>cAc		zinc finger CCCH-type containing 12C							99.0	103.0	102.0					11																	110036119		1973	4173	6146	SO:0001583	missense	85463	1	120920	37				g.chr11:110036119G>A		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.2309G>A	chr11.hg19:g.110036119G>A	ENSP00000278590:p.Arg770His	0					ZC3H12C_ENST00000453089.2_Missense_Mutation_p.R739H|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.R771H	p.R770H	NM_033390.1	NP_203748.1	0	0	0	1.939489	Q9C0D7	ZC12C_HUMAN		6	2360	+		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	0	1	hg19	c.2309G>A	CCDS44727.1	0	.	.	.	.	.	.	.	.	.	.	G	10.83	1.459973	0.26248	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.31769	1.48;1.48;1.48	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.526358	0.22068	N	0.065080	T	0.26231	0.0640	L	0.29908	0.895	0.36328	D	0.858707	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.16778	-1.0391	10	0.14656	T	0.56	-14.1476	20.3206	0.98668	0.0:0.0:1.0:0.0	.	771;770;770	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	H	770;771;739	ENSP00000278590:R770H;ENSP00000431821:R771H;ENSP00000413094:R739H	ENSP00000278590:R770H	R	+	2	0	0	ZC3H12C	109541329	109541329	0.997000	0.39634	0.996000	0.52242	0.081000	0.17604	2.472000	0.45136	2.809000	0.96659	0.655000	0.94253	CGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.552	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	0	0	1	2	2	2	2	1	1	1	0	110	110	110	110	1	2.180000	-2.493307	0	0.270000	NM_033390		0	10	10	0	487	479	0		1	0		1	0	110	0	0	9.966758e-01	3.065673e-03	0	0	0	4	0	10	487
OR51A2	401667	broad.mit.edu	37	11	4976163	4976163	+	Missense_Mutation	SNP	C	C	T	rs75797492	byFrequency	TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:4976163C>T	ENST00000380371.1	-	1	780	c.781G>A	c.(781-783)Gtt>Att	p.V261I	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGGTGGACAACGGCCAGGTTG	0.468													.|||	3	0.000599042	0.0023	0.0	5008	,	,		12557	0.0		0.0	False		,,,				2504	0.0					ENST00000380371.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				17						c.(781-783)Gtt>Att		olfactory receptor, family 51, subfamily A, member 2			ILE/VAL	31,4207		5,21,2093	95.0	74.0	81.0		781	-2.5	0.0	11	dbSNP_131	81	1,7863		0,1,3931	no	missense	OR51A2	NM_001004748.1	29	5,22,6024	TT,TC,CC		0.0127,0.7315,0.2644	benign	261/314	4976163	32,12070	2119	3932	6051	SO:0001583	missense	401667	65	107788	53				g.chr11:4976163C>T	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.781G>A	chr11.hg19:g.4976163C>T	ENSP00000369729:p.Val261Ile	0					MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	p.V261I	NM_001004748.1	NP_001004748.1	0	0	0	1.943762	Q8NGJ7	O51A2_HUMAN		1	780	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Missense_Mutation	SNP	ENST00000380371.1	1	1	hg19	c.781G>A	CCDS31368.1	1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	-	1.405	-0.577068	0.03854	0.007315	1.27E-4	ENSG00000205496	ENST00000380371	T	0.34667	1.35	3.26	-2.5	0.06384	3.26	-2.5	0.06384	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.09113	0.0225	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.23762	-1.0179	9	0.25106	T	0.35	.	4.7352	0.12984	0.1471:0.3962:0.0:0.4567	.	261	Q8NGJ7	O51A2_HUMAN	I	261	ENSP00000369729:V261I	ENSP00000369729:V261I	V	-	1	0	0	OR51A2	4932739	4932739	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-6.751000	0.00055	-0.397000	0.07691	-0.367000	0.07326	GTT	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.468	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	60	1	2.180000	-2.844697	1	0.270000	NM_001004748		0	92	91	0	273	266	1		1			0	0	55	0	0	1	0	0	0	0	0	0	92	273
NUP160	23279	broad.mit.edu	37	11	47861533	47861533	+	Missense_Mutation	SNP	T	T	C			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:47861533T>C	ENST00000378460.2	-	4	656	c.610A>G	c.(610-612)Att>Gtt	p.I204V	NUP160_ENST00000530326.1_Missense_Mutation_p.I90V|NUP160_ENST00000528071.1_Missense_Mutation_p.I90V|NUP160_ENST00000532747.1_Intron|NUP160_ENST00000526870.1_3'UTR	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	204					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						ACTGCTGGAATTAACTGATAG	0.458																																						ENST00000378460.2	1.000000	9.100000e-01	1.000000	0.990000	0.990000	0.994626	0.990000	1.000000																										0				53						c.(610-612)Att>Gtt		nucleoporin 160kDa							114.0	108.0	110.0					11																	47861533		2201	4298	6499	SO:0001583	missense	23279	0	0					g.chr11:47861533T>C	D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.610A>G	chr11.hg19:g.47861533T>C	ENSP00000367721:p.Ile204Val	0					NUP160_ENST00000530326.1_Missense_Mutation_p.I90V|NUP160_ENST00000528071.1_Missense_Mutation_p.I90V|NUP160_ENST00000532747.1_Intron|NUP160_ENST00000526870.1_3'UTR	p.I204V	NM_015231.1	NP_056046.1	0	0	0	1.943762	Q12769	NU160_HUMAN		4	656	-			B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	1	1	hg19	c.610A>G	CCDS31484.1	1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.236417	0.79800	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.44881	0.91;0.91;0.91	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.052986	0.64402	D	0.000001	T	0.54029	0.1833	M	0.65975	2.015	0.80722	D	1	P	0.45126	0.851	P	0.51055	0.657	T	0.53563	-0.8421	10	0.39692	T	0.17	.	15.4885	0.75587	0.0:0.0:0.0:1.0	.	204	Q12769	NU160_HUMAN	V	204;90;90	ENSP00000367721:I204V;ENSP00000433590:I90V;ENSP00000432367:I90V	ENSP00000367721:I204V	I	-	1	0	0	NUP160	47818109	47818109	1.000000	0.71417	0.992000	0.48379	0.917000	0.54804	5.079000	0.64431	2.063000	0.61619	0.533000	0.62120	ATT	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.458	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	2.180000	-20.000000	1	0.270000	NM_015231		0	81	81	0	443	438	1		1	1		0	0	61	0	0	1	5.281107e-01	0	2	0	9	0	81	443
OR8H2	390151	broad.mit.edu	37	11	55872750	55872750	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:55872750G>A	ENST00000313503.1	+	1	232	c.232G>A	c.(232-234)Gtc>Atc	p.V78I		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTCAACTGTCGTCACACCTAA	0.438										HNSCC(53;0.14)																												ENST00000313503.1	0.120000	3.000000e-02	0.100000	0.050000	0.070000	0.076412	0.070000	0.080000																										0				61						c.(232-234)Gtc>Atc		olfactory receptor, family 8, subfamily H, member 2							248.0	248.0	248.0					11																	55872750		2201	4293	6494	SO:0001583	missense	390151	2	121412	39				g.chr11:55872750G>A	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.232G>A	chr11.hg19:g.55872750G>A	ENSP00000323982:p.Val78Ile	0	HNSCC(53;0.14)					p.V78I	NM_001005200.1	NP_001005200.1	0	0	0	1.943762	Q8N162	OR8H2_HUMAN		1	232	+	Esophageal squamous(21;0.00693)		Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	0	1	hg19	c.232G>A	CCDS31518.1	0	.	.	.	.	.	.	.	.	.	.	g	0.053	-1.245473	0.01481	.	.	ENSG00000181767	ENST00000313503	T	0.01406	4.93	3.58	1.05	0.20165	3.58	1.05	0.20165	GPCR, rhodopsin-like superfamily (1);	0.117869	0.38959	N	0.001502	T	0.00608	0.0020	N	0.03016	-0.435	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49123	-0.8972	10	0.02654	T	1	.	8.3388	0.32230	0.8257:0.0:0.1743:0.0	.	78	Q8N162	OR8H2_HUMAN	I	78	ENSP00000323982:V78I	ENSP00000323982:V78I	V	+	1	0	0	OR8H2	55629326	55629326	0.004000	0.15560	0.989000	0.46669	0.646000	0.38490	2.210000	0.42816	0.080000	0.16959	-0.573000	0.04149	GTC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.438	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	0	0	1	2	2	2	2	0	0	0	0	310	310	310	339	1	2.180000	-2.619821	1	0.270000	NM_001005200		0	15	13	0	1523	1399	0		1			0	0	310	0	0	9.997491e-01	0	0	0	0	0	0	15	1523
OR5T3	390154	broad.mit.edu	37	11	56020051	56020051	+	Missense_Mutation	SNP	G	G	A	rs543165988		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:56020051G>A	ENST00000303059.3	+	1	376	c.376G>A	c.(376-378)Gga>Aga	p.G126R		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TTCATTTATCGGATGTGCAAC	0.363													g|||	1	0.000199681	0.0008	0.0	5008	,	,		22195	0.0		0.0	False		,,,				2504	0.0					ENST00000303059.3	0.110000	0	0.080000	0.020000	0.040000	0.055980	0.040000	0.050000																										0				39						c.(376-378)Gga>Aga		olfactory receptor, family 5, subfamily T, member 3							172.0	171.0	171.0					11																	56020051		2201	4295	6496	SO:0001583	missense	390154	13	121410	46				g.chr11:56020051G>A	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.376G>A	chr11.hg19:g.56020051G>A	ENSP00000305403:p.Gly126Arg	0						p.G126R	NM_001004747.1	NP_001004747.1	0	0	0	1.943762	Q8NGG3	OR5T3_HUMAN		1	376	+	Esophageal squamous(21;0.00448)		Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	0	1	hg19	c.376G>A	CCDS31524.1	0	.	.	.	.	.	.	.	.	.	.	g	10.80	1.452159	0.26074	.	.	ENSG00000172489	ENST00000303059	T	0.09817	2.94	4.55	2.59	0.31030	4.55	2.59	0.31030	GPCR, rhodopsin-like superfamily (1);	0.542212	0.15279	U	0.270784	T	0.24812	0.0602	M	0.69358	2.11	0.09310	N	1	D	0.62365	0.991	P	0.58660	0.843	T	0.04216	-1.0968	10	0.87932	D	0	.	11.1733	0.48584	0.0:0.1392:0.716:0.1448	.	126	Q8NGG3	OR5T3_HUMAN	R	126	ENSP00000305403:G126R	ENSP00000305403:G126R	G	+	1	0	0	OR5T3	55776627	55776627	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	0.613000	0.24299	0.603000	0.29913	-0.189000	0.12847	GGA	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.363	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	0	0	1	2	2	2	2	0	0	0	0	142	142	142	142	1	2.180000	-1.839087	0	0.270000	NM_001004747		0	5	5	0	779	774	0		1			0	0	142	0	0	9.366554e-01	0	0	0	0	0	0	5	779
TNKS1BP1	85456	broad.mit.edu	37	11	57077417	57077417	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:57077417G>A	ENST00000532437.1	-	5	3079	c.2768C>T	c.(2767-2769)gCc>gTc	p.A923V	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.A923V|TNKS1BP1_ENST00000530920.1_5'UTR			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	923	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.A923V(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CTGCTCATCGGCATCCTGGCT	0.572																																						ENST00000532437.1	0.120000	2.000000e-02	0.090000	0.030000	0.060000	0.067897	0.060000	0.060000																										1	Substitution - Missense(1)	p.A923V(1)	kidney(1)	64						c.(2767-2769)gCc>gTc		tankyrase 1 binding protein 1, 182kDa							186.0	181.0	182.0					11																	57077417		2201	4296	6497	SO:0001583	missense	85456	0	0					g.chr11:57077417G>A	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2768C>T	chr11.hg19:g.57077417G>A	ENSP00000437271:p.Ala923Val	0					TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.A923V|TNKS1BP1_ENST00000530920.1_5'UTR	p.A923V			0	0	0	1.943762	Q9C0C2	TB182_HUMAN		5	3079	-		all_epithelial(135;0.21)	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	0	1	hg19	c.2768C>T	CCDS7951.1	0	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209903	0.39003	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.34472	1.36;1.36	5.47	1.3	0.21679	5.47	1.3	0.21679	.	0.803739	0.10698	N	0.644437	T	0.42223	0.1193	L	0.59436	1.845	0.09310	N	1	D	0.54964	0.969	P	0.55011	0.766	T	0.22977	-1.0201	10	0.46703	T	0.11	-0.6792	3.1082	0.06348	0.1593:0.1452:0.5597:0.1357	.	923	Q9C0C2	TB182_HUMAN	V	923	ENSP00000350990:A923V;ENSP00000437271:A923V	ENSP00000350990:A923V	A	-	2	0	0	TNKS1BP1	56833993	56833993	0.000000	0.05858	0.002000	0.10522	0.117000	0.20001	0.116000	0.15561	0.245000	0.21373	0.462000	0.41574	GCC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.572	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	0	0	1	2	20	6	2	1	1	1	1	166	166	166	164	1	2.180000	-1.695440	0	0.270000	NM_033396		0	8	8	0	964	953	0		0	0		1	0	166	0	0	1.584165e-02	1.463471e-02	0	0	0	184	0	8	964
RARRES3	5920	broad.mit.edu	37	11	63312120	63312120	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:63312120G>A	ENST00000255688.3	+	3	194	c.146G>A	c.(145-147)aGt>aAt	p.S49N	RARRES3_ENST00000439013.2_Missense_Mutation_p.S49N|RARRES3_ENST00000537871.1_3'UTR|RARRES3_ENST00000354445.2_Missense_Mutation_p.S49N	NM_004585.3	NP_004576.2	Q9UL19	HRSL4_HUMAN	retinoic acid receptor responder (tazarotene induced) 3	49					lipid catabolic process (GO:0016042)|negative regulation of cell proliferation (GO:0008285)|phospholipid metabolic process (GO:0006644)	integral component of membrane (GO:0016021)	phospholipase A2 activity (GO:0004623)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	6						GGCTCCTCCAGTGTCTTCTCA	0.567																																						ENST00000255688.3	0.250000	1.100000e-01	0.220000	0.140000	0.170000	0.183419	0.170000	0.180000																										0				6						c.(145-147)aGt>aAt		retinoic acid receptor responder (tazarotene induced) 3							130.0	138.0	135.0					11																	63312120		1950	4144	6094	SO:0001583	missense	5920	0	0					g.chr11:63312120G>A		CCDS41662.1	11q23	2008-05-02			ENSG00000133321	ENSG00000133321			9869	protein-coding gene	gene with protein product		605092				9270552	Standard	NM_004585		Approved	TIG3, HRASLS4	uc001nxf.4	Q9UL19	OTTHUMG00000167850	ENST00000255688.3:c.146G>A	chr11.hg19:g.63312120G>A	ENSP00000255688:p.Ser49Asn	0					RARRES3_ENST00000439013.2_Missense_Mutation_p.S49N|RARRES3_ENST00000537871.1_3'UTR|RARRES3_ENST00000354445.2_Missense_Mutation_p.S49N	p.S49N	NM_004585.3	NP_004576.2	0	1	1	1.944752	Q9UL19	HRSL4_HUMAN		3	194	+			B2R599|B4DDW2|E7ENZ7|O95200	Missense_Mutation	SNP	ENST00000255688.3	0	1	hg19	c.146G>A	CCDS41662.1	0	.	.	.	.	.	.	.	.	.	.	G	13.93	2.385443	0.42308	.	.	ENSG00000133321	ENST00000439013;ENST00000255688;ENST00000354445	T;T;T	0.24908	1.83;1.83;1.83	4.29	-3.33	0.04958	4.29	-3.33	0.04958	.	0.677062	0.13847	N	0.358591	T	0.26159	0.0638	M	0.87547	2.89	0.09310	N	1	B	0.25206	0.12	B	0.26094	0.066	T	0.40572	-0.9556	10	0.62326	D	0.03	.	1.3662	0.02202	0.301:0.276:0.2986:0.1245	.	49	Q9UL19	TIG3_HUMAN	N	49	ENSP00000402943:S49N;ENSP00000255688:S49N;ENSP00000346431:S49N	ENSP00000255688:S49N	S	+	2	0	0	RARRES3	63068696	63068696	0.977000	0.34250	0.000000	0.03702	0.008000	0.06430	1.927000	0.40094	-0.643000	0.05473	0.655000	0.94253	AGT	0.268024		TCGA-RB-A7B8-01A-12D-A33T-08	0.567	RARRES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396629.1	0	0	1	2	2	2	2	0	0	0	0	158	158	158	153	1	2.180000	-2.943408	1	0.270000			0	27	27	0	1096	1077	0		1	1		0	0	158	0	0	9.999999e-01	9.337539e-01	0	3	0	182	0	27	1096
NAA40	79829	broad.mit.edu	37	11	63721522	63721522	+	Splice_Site	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:63721522G>A	ENST00000377793.4	+	7	673		c.e7+1		NAA40_ENST00000539656.1_Splice_Site|NAA40_ENST00000456907.2_Splice_Site|NAA40_ENST00000542163.1_Splice_Site	NM_024771.2	NP_079047.2	Q86UY6	NAA40_HUMAN	N(alpha)-acetyltransferase 40, NatD catalytic subunit						lipid metabolic process (GO:0006629)		N-acetyltransferase activity (GO:0008080)			NS(1)|endometrium(1)|lung(2)|prostate(1)	5						AAGCGTTGCAGTAAGGAGCTG	0.512																																						ENST00000377793.4	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.062968	0.050000	0.050000																										0				5						c.e7+1		N(alpha)-acetyltransferase 40, NatD catalytic subunit							135.0	140.0	138.0					11																	63721522		2201	4297	6498	SO:0001630	splice_region_variant	79829	0	0					g.chr11:63721522G>A	AK023910	CCDS8053.1, CCDS73311.1	11q13.1	2013-10-11	2013-08-28	2010-01-14	ENSG00000110583	ENSG00000110583		"""N(alpha)-acetyltransferase subunits"""	25845	protein-coding gene	gene with protein product			"""N-acetyltransferase 11"", ""N-acetyltransferase 11 (GCN5-related, putative)"", ""N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)"""	NAT11		19660095	Standard	XM_005274296		Approved	FLJ13848	uc009yoz.3	Q86UY6	OTTHUMG00000167784	ENST00000377793.4:c.572+1G>A	chr11.hg19:g.63721522G>A		1					NAA40_ENST00000539656.1_Splice_Site|NAA40_ENST00000542163.1_Splice_Site|NAA40_ENST00000456907.2_Splice_Site		NM_024771.2	NP_079047.2	0	1	1	1.644030	Q86UY6	NAA40_HUMAN		7	673	+			B4DR03|B4DU10|Q5HYL5|Q9H897	Splice_Site	SNP	ENST00000377793.4	0	1	hg19		CCDS8053.1	0	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596843	0.86953	.	.	ENSG00000110583	ENST00000377793;ENST00000456907;ENST00000539656;ENST00000542163	.	.	.	5.28	5.28	0.74379	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6823	0.88247	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	NAA40	63478098	63478098	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.436000	0.97532	2.474000	0.83562	0.462000	0.41574	.	0.156069		TCGA-RB-A7B8-01A-12D-A33T-08	0.512	NAA40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396266.1	0	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	2.180000	-2.540337	1	0.270000	NM_024771	Intron	0	5	5	0	598	595	0		1	0		0	0	103	0	0	9.369527e-01	3.406511e-04	0	0	0	3	0	5	598
CCDC88B	283234	broad.mit.edu	37	11	64120219	64120219	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:64120219C>T	ENST00000356786.5	+	20	3404	c.3360C>T	c.(3358-3360)caC>caT	p.H1120H	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Silent_p.H272H|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1120						membrane (GO:0016020)		p.H1120H(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ATCCCAGGCACGAGCAGCTGC	0.677																																						ENST00000356786.5	1.000000	7.100000e-01	1.000000	0.830000	0.980000	0.937229	0.980000	1.000000																										1	Substitution - coding silent(1)	p.H1120H(1)	lung(1)	27						c.(3358-3360)caC>caT		coiled-coil domain containing 88B							27.0	31.0	30.0					11																	64120219		2201	4286	6487	SO:0001819	synonymous_variant	283234	2	121318	32				g.chr11:64120219C>T	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.3360C>T	chr11.hg19:g.64120219C>T		0					CCDC88B_ENST00000301897.4_5'UTR|CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Silent_p.H272H	p.H1120H	NM_032251.5	NP_115627.6	0	0	0	1.939489	A6NC98	CC88B_HUMAN		20	3404	+			A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Silent	SNP	ENST00000356786.5	1	1	hg19	c.3360C>T	CCDS8072.2	1																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.677	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	1	0	1	2	2	2	2	0	0	0	0	27	27	27	26	1	2.180000	-16.957830	1	0.270000	NM_032251		0	36	36	0	233	231	1		1	1		0	0	27	0	0	1	9.577772e-01	0	6	0	30	0	36	233
SCYL1	57410	broad.mit.edu	37	11	65299135	65299135	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:65299135G>A	ENST00000270176.5	+	8	1174	c.1097G>A	c.(1096-1098)cGc>cAc	p.R366H	SCYL1_ENST00000527009.1_Missense_Mutation_p.R223H|SCYL1_ENST00000533862.1_Missense_Mutation_p.R366H|SCYL1_ENST00000525364.1_Missense_Mutation_p.R366H|SCYL1_ENST00000279270.6_Missense_Mutation_p.R366H|SCYL1_ENST00000420247.2_Missense_Mutation_p.R366H|SCYL1_ENST00000524944.1_Missense_Mutation_p.R366H	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	366					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						CGGGCCATGCGCATCCGCCTC	0.617																																						ENST00000270176.5	0.340000	6.000000e-02	0.250000	0.100000	0.160000	0.184337	0.160000	0.160000																										0				2						c.(1096-1098)cGc>cAc		SCY1-like 1 (S. cerevisiae)							67.0	68.0	68.0					11																	65299135		2145	4260	6405	SO:0001583	missense	57410	2	121188	36				g.chr11:65299135G>A	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1097G>A	chr11.hg19:g.65299135G>A	ENSP00000270176:p.Arg366His	0					SCYL1_ENST00000524944.1_Missense_Mutation_p.R366H|SCYL1_ENST00000279270.6_Missense_Mutation_p.R366H|SCYL1_ENST00000527009.1_Missense_Mutation_p.R223H|SCYL1_ENST00000420247.2_Missense_Mutation_p.R366H|SCYL1_ENST00000525364.1_Missense_Mutation_p.R366H|SCYL1_ENST00000533862.1_Missense_Mutation_p.R366H	p.R366H	NM_020680.3	NP_065731.3	0	0	0	1.939489	Q96KG9	NTKL_HUMAN		8	1174	+			A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	0	1	hg19	c.1097G>A	CCDS41672.1	0	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925405	0.92319	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000527009	T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.17	5.17	0.71159	5.17	5.17	0.71159	Armadillo-like helical (1);Armadillo-type fold (1);	0.179297	0.45361	D	0.000375	T	0.74473	0.3721	M	0.90595	3.13	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.997;0.998	D;D;D;D;P	0.75484	0.949;0.986;0.981;0.928;0.85	T	0.80327	-0.1429	10	0.87932	D	0	-8.8898	16.593	0.84772	0.0:0.0:1.0:0.0	.	366;366;366;366;366	E9PS17;Q96KG9-4;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;.;NTKL_HUMAN	H	366;366;366;366;366;366;366;366;223	ENSP00000270176:R366H;ENSP00000431635:R366H;ENSP00000408192:R366H;ENSP00000437254:R366H;ENSP00000433450:R366H;ENSP00000279270:R366H;ENSP00000432175:R366H;ENSP00000436993:R223H	ENSP00000270176:R366H	R	+	2	0	0	SCYL1	65055711	65055711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.515000	0.90548	2.609000	0.88269	0.650000	0.86243	CGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.617	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	0	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	2.180000	-3.762525	1	0.270000	NM_020680		0	5	5	0	230	227	0		1	0		0	0	26	0	0	9.360826e-01	7.861242e-01	0	0	0	133	0	5	230
MYEOV	26579	broad.mit.edu	37	11	69063478	69063478	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:69063478G>A	ENST00000308946.3	+	3	1011	c.561G>A	c.(559-561)cgG>cgA	p.R187R	MYEOV_ENST00000441339.2_Silent_p.R187R|MYEOV_ENST00000535407.1_Silent_p.R129R	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	187										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		TGCATGGGCGGCATGGGCTCT	0.627																																						ENST00000308946.3	0.110000	1.000000e-02	0.090000	0.030000	0.050000	0.062401	0.050000	0.060000																										0				24						c.(559-561)cgG>cgA		myeloma overexpressed							151.0	142.0	145.0					11																	69063478		2200	4294	6494	SO:0001819	synonymous_variant	26579	0	0					g.chr11:69063478G>A	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.561G>A	chr11.hg19:g.69063478G>A		0					MYEOV_ENST00000535407.1_Silent_p.R129R|MYEOV_ENST00000441339.2_Silent_p.R187R	p.R187R	NM_138768.2	NP_620123.2	0	0	0	1.939489	Q96EZ4	MYEOV_HUMAN	LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	3	1011	+	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		Q9UGN6|Q9UGN7	Silent	SNP	ENST00000308946.3	0	1	hg19	c.561G>A	CCDS8190.1	0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.627	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1	0	0	1	2	2	2	2	0	0	0	0	137	137	137	134	1	2.180000	-1.887318	0	0.270000			0	6	7	0	816	811	0		1	0		0	0	137	0	0	9.645090e-01	3.168449e-01	0	0	0	136	0	6	816
SCN3B	55800	broad.mit.edu	37	11	123516310	123516310	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr11:123516310G>A	ENST00000392770.2	-	2	1006	c.204C>T	c.(202-204)ggC>ggT	p.G68G	SCN3B_ENST00000530277.1_Silent_p.G68G|SCN3B_ENST00000299333.3_Silent_p.G68G	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	68	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	AATCTTTACCGCCCTCGGGCC	0.592																																						ENST00000392770.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999848	0.990000	1.000000																										0				26						c.(202-204)ggC>ggT		sodium channel, voltage-gated, type III, beta subunit	Valproic Acid(DB00313)|Zonisamide(DB00909)						132.0	138.0	136.0					11																	123516310		2202	4299	6501	SO:0001819	synonymous_variant	55800	2	121412	33				g.chr11:123516310G>A	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.204C>T	chr11.hg19:g.123516310G>A		0					SCN3B_ENST00000299333.3_Silent_p.G68G|SCN3B_ENST00000530277.1_Silent_p.G68G	p.G68G	NM_018400.3	NP_060870.1	0	0	0	1.939489	Q9NY72	SCN3B_HUMAN		2	1006	-		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	A5H1I5|Q17RL3|Q9ULR2	Silent	SNP	ENST00000392770.2	1	1	hg19	c.204C>T	CCDS8442.1	1																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.592	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	1	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	2.180000	-20.000000	1	0.270000	NM_018400		0	109	109	0	525	521	1		1			0	0	84	0	0	1	0	0	0	0	0	0	109	525
ATP2A2	488	broad.mit.edu	37	12	110778541	110778541	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:110778541C>T	ENST00000539276.2	+	14	1948	c.1839C>T	c.(1837-1839)tgC>tgT	p.C613C	ATP2A2_ENST00000395494.2_Silent_p.C586C|ATP2A2_ENST00000308664.6_Silent_p.C613C			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	613					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TGAAGCTGTGCCGGCAAGCAG	0.572																																						ENST00000539276.2	1.000000	2.000000e-02	0.130000	0.040000	0.070000	0.154353	0.070000	0.070000																										0				38	GRCh37	CM014166	ATP2A2	M		c.(1837-1839)tgC>tgT		ATPase, Ca++ transporting, cardiac muscle, slow twitch 2							97.0	95.0	96.0					12																	110778541		2203	4300	6503	SO:0001819	synonymous_variant	488	0	0					g.chr12:110778541C>T		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1839C>T	chr12.hg19:g.110778541C>T		0					ATP2A2_ENST00000395494.2_Silent_p.C586C|ATP2A2_ENST00000308664.6_Silent_p.C613C	p.C613C			1	2	3	1.996640	P16615	AT2A2_HUMAN		14	1948	+			A6NDN7|B4DF05|P16614|Q86VJ2	Silent	SNP	ENST00000539276.2	0	1	hg19	c.1839C>T	CCDS9144.1	0	.	.	.	.	.	.	.	.	.	.	C	9.993	1.231362	0.22626	.	.	ENSG00000174437	ENST00000548169	.	.	.	5.93	-0.83	0.10792	5.93	-0.83	0.10792	.	.	.	.	.	T	0.63954	0.2555	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61178	-0.7115	4	.	.	.	.	12.8976	0.58108	0.0:0.5245:0.0:0.4755	.	.	.	.	S	504	.	.	P	+	1	0	0	ATP2A2	109262924	109262924	0.928000	0.31464	0.994000	0.49952	0.973000	0.67179	0.080000	0.14802	-0.056000	0.13221	-0.126000	0.14955	CCG	0.279724		TCGA-RB-A7B8-01A-12D-A33T-08	0.572	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	0	0	1	2	26	11	2	1	1	1	1	65	65	65	64	1	2.180000	-2.051129	0	0.270000	NM_001681		0	5	5	0	554	550	0		0	0		1	0	65	0	0	7.149995e-05	2.619409e-04	0	0	0	189	0	5	554
TMEM132D	121256	broad.mit.edu	37	12	129558549	129558549	+	Silent	SNP	G	G	A	rs74724941	byFrequency	TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:129558549G>A	ENST00000422113.2	-	9	3497	c.3171C>T	c.(3169-3171)gaC>gaT	p.D1057D	TMEM132D_ENST00000389441.4_Silent_p.D595D	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1057					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.D1057E(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGGGGTACTCGTCGTCTGAGG	0.512													G|||	13	0.00259585	0.0	0.0	5008	,	,		20710	0.0129		0.0	False		,,,				2504	0.0					ENST00000422113.2	1.000000	5.800000e-01	0.900000	0.670000	0.760000	0.785594	0.760000	0.760000																										1	Substitution - Missense(1)	p.D1057E(1)	ovary(1)	152						c.(3169-3171)gaC>gaT		transmembrane protein 132D		G		3,4403	6.2+/-15.9	0,3,2200	155.0	152.0	153.0		3171	-5.4	0.0	12	dbSNP_131	153	0,8600		0,0,4300	no	coding-synonymous	TMEM132D	NM_133448.2		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		1057/1100	129558549	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	121256	82	121412	52				g.chr12:129558549G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3171C>T	chr12.hg19:g.129558549G>A		0					TMEM132D_ENST00000389441.4_Silent_p.D595D	p.D1057D	NM_133448.2	NP_597705.2	1	2	3	1.996640	Q14C87	T132D_HUMAN		9	3497	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	1	0	hg19	c.3171C>T	CCDS9266.1	0																																																																																								0.279724		TCGA-RB-A7B8-01A-12D-A33T-08	0.512	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	98	1	2.180000	-12.552980	1	0.270000	NM_133448		0	57	57	0	506	503	1		1			0	0	99	0	0	1	0	0	0	0	0	0	57	506
SLC6A13	6540	broad.mit.edu	37	12	346453	346453	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:346453C>T	ENST00000343164.4	-	6	619	c.567G>A	c.(565-567)cgG>cgA	p.R189R	SLC6A13_ENST00000445055.2_Silent_p.R97R	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	189					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TCAAGACCCGCCGCCTGGGGA	0.622																																						ENST00000343164.4	1.000000	2.000000e-02	0.150000	0.050000	0.090000	0.150814	0.090000	0.080000																										0				28						c.(565-567)cgG>cgA		solute carrier family 6 (neurotransmitter transporter), member 13							47.0	53.0	51.0					12																	346453		2203	4300	6503	SO:0001819	synonymous_variant	6540	0	0					g.chr12:346453C>T	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.567G>A	chr12.hg19:g.346453C>T		0					SLC6A13_ENST00000445055.2_Silent_p.R97R	p.R189R	NM_016615.4	NP_057699.2	1	2	3	1.977682	Q9NSD5	S6A13_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)	6	619	-	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		B4DJL1|Q8TCC2|Q8WW56	Silent	SNP	ENST00000343164.4	0	1	hg19	c.567G>A	CCDS8502.1	0																																																																																								0.276834		TCGA-RB-A7B8-01A-12D-A33T-08	0.622	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	0	0	1	2	2	2	2	0	0	0	0	69	69	69	66	1	2.180000	-3.217084	1	0.270000	NM_016615		0	5	5	0	436	430	0		1			0	0	69	0	0	9.356030e-01	0	0	0	0	0	0	5	436
ZNF384	171017	broad.mit.edu	37	12	6782390	6782390	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:6782390C>T	ENST00000396801.3	-	7	1110	c.903G>A	c.(901-903)caG>caA	p.Q301Q	ZNF384_ENST00000355772.4_Silent_p.Q246Q|ZNF384_ENST00000319770.3_Silent_p.Q285Q|ZNF384_ENST00000361959.3_Silent_p.Q301Q|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000396799.2_Silent_p.Q301Q|ZNF384_ENST00000396795.1_Silent_p.Q301Q	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	301					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						ACCGGGTGTGCTGCTGAAGGT	0.542			T	"""EWSR1, TAF15 """	ALL																																	ENST00000396801.3	1.000000	6.000000e-02	0.350000	0.120000	0.210000	0.266299	0.210000	0.190000				Dom	yes			Dom	yes		12	12p13	12p13	171017	T	zinc finger protein 384 (CIZ/NMP4)				L	L	EWSR1, TAF15 		ALL	EWSR1/ZNF384(4)	0				18						c.(901-903)caG>caA		zinc finger protein 384							71.0	66.0	68.0					12																	6782390		2203	4300	6503	SO:0001819	synonymous_variant	171017	0	0					g.chr12:6782390C>T	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.903G>A	chr12.hg19:g.6782390C>T		0					ZNF384_ENST00000361959.3_Silent_p.Q301Q|ZNF384_ENST00000396799.2_Silent_p.Q301Q|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000355772.4_Silent_p.Q246Q|ZNF384_ENST00000396795.1_Silent_p.Q301Q|ZNF384_ENST00000319770.3_Silent_p.Q285Q	p.Q301Q	NM_001135734.2	NP_001129206.1	1	2	3	1.977682	Q8TF68	ZN384_HUMAN		7	1110	-			O15407|Q7Z722|Q8N938	Silent	SNP	ENST00000396801.3	0	1	hg19	c.903G>A	CCDS44817.1	0																																																																																								0.276834		TCGA-RB-A7B8-01A-12D-A33T-08	0.542	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1	0	0	1	2	2	2	2	0	0	0	0	21	21	21	20	1	2.180000	-6.060673	1	0.270000			0	4	4	0	159	159	0		1	0		0	0	21	0	0	8.913573e-01	4.942079e-01	0	0	0	58	0	4	159
CD163L1	283316	broad.mit.edu	37	12	7559219	7559219	+	Silent	SNP	G	G	A	rs143012538	byFrequency	TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:7559219G>A	ENST00000313599.3	-	5	1053	c.996C>T	c.(994-996)tcC>tcT	p.S332S	CD163L1_ENST00000396630.1_Silent_p.S332S|CD163L1_ENST00000416109.2_Silent_p.S342S			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	332	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ATTCATTACCGGAGCAGGAGA	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.001					ENST00000313599.3	1.000000	4.000000e-02	0.170000	0.070000	0.110000	0.166409	0.110000	0.100000																										0				96						c.(994-996)tcC>tcT		CD163 molecule-like 1		G		0,4406		0,0,2203	178.0	144.0	156.0		996	-3.5	0.0	12	dbSNP_134	156	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CD163L1	NM_174941.4		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		332/1454	7559219	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	283316	6	121412	40				g.chr12:7559219G>A	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.996C>T	chr12.hg19:g.7559219G>A		0					CD163L1_ENST00000396630.1_Silent_p.S332S|CD163L1_ENST00000416109.2_Silent_p.S342S	p.S332S			1	2	3	1.977682	Q9NR16	C163B_HUMAN		5	1053	-			B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	0	1	hg19	c.996C>T	CCDS8577.1	0																																																																																								0.276834		TCGA-RB-A7B8-01A-12D-A33T-08	0.473	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	2.180000	-2.708902	1	0.270000	NM_174941		0	6	6	0	436	434	0		1			0	0	70	0	0	9.649694e-01	0	0	0	0	0	0	6	436
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	4.100000e-01	1.000000	0.570000	0.770000	0.775878	0.770000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	2	3	1.990823	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.34G>C	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.278763		TCGA-RB-A7B8-01A-12D-A33T-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	2.180000	-7.059248	1	0.270000	NM_033360		1667	11	11	6368	100	96	1	1	1	1	1	0	0	11	285	1	9.982984e-01	4.031158e-01	9.999997e-01	4	41	8	302	11	100
DENND5B	160518	broad.mit.edu	37	12	31577541	31577541	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:31577541C>T	ENST00000389082.5	-	10	2583	c.2319G>A	c.(2317-2319)gaG>gaA	p.E773E	DENND5B_ENST00000306833.6_Silent_p.E808E|DENND5B_ENST00000536562.1_Silent_p.E808E	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	773	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AGGTGTTCTCCTCCAGGCCGG	0.517																																						ENST00000389082.5	1.000000	2.400000e-01	0.450000	0.290000	0.360000	0.409151	0.360000	0.350000																										0				38						c.(2317-2319)gaG>gaA		DENN/MADD domain containing 5B							214.0	208.0	210.0					12																	31577541		2085	4238	6323	SO:0001819	synonymous_variant	160518	0	0					g.chr12:31577541C>T	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2319G>A	chr12.hg19:g.31577541C>T		0					DENND5B_ENST00000536562.1_Silent_p.E808E|DENND5B_ENST00000306833.6_Silent_p.E808E	p.E773E	NM_144973.3	NP_659410.3	1	2	3	1.990823	Q6ZUT9	DEN5B_HUMAN		10	2583	-			B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	ENST00000389082.5	1	1	hg19	c.2319G>A	CCDS44857.1	0																																																																																								0.278763		TCGA-RB-A7B8-01A-12D-A33T-08	0.517	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	2.180000	-3.295405	1	0.270000	NM_144973		0	30	30	0	606	601	0		1	0		0	0	107	0	0	1	1.361586e-02	0	0	0	4	0	30	606
CNTN1	1272	broad.mit.edu	37	12	41422975	41422975	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:41422975G>A	ENST00000551295.2	+	23	3051	c.2934G>A	c.(2932-2934)gcG>gcA	p.A978A	CNTN1_ENST00000347616.1_Silent_p.A978A|CNTN1_ENST00000348761.2_Silent_p.A967A	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	978	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AGGTTCGCGCGCACAGTGATG	0.458																																						ENST00000551295.2	1.000000	2.000000e-02	0.110000	0.040000	0.060000	0.138051	0.060000	0.060000																										0				90						c.(2932-2934)gcG>gcA		contactin 1							231.0	215.0	221.0					12																	41422975		2203	4300	6503	SO:0001819	synonymous_variant	1272	2	121412	36				g.chr12:41422975G>A	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2934G>A	chr12.hg19:g.41422975G>A		0					CNTN1_ENST00000347616.1_Silent_p.A978A|CNTN1_ENST00000348761.2_Silent_p.A967A	p.A978A	NM_001843.3	NP_001834.2	1	2	3	1.990823	Q12860	CNTN1_HUMAN		23	3051	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	0	1	hg19	c.2934G>A	CCDS8737.1	0																																																																																								0.278763		TCGA-RB-A7B8-01A-12D-A33T-08	0.458	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	0	0	1	2	2	2	2	0	0	0	0	130	130	130	130	1	2.180000	-1.777108	0	0.270000	NM_001843		0	7	9	0	840	835	0		1	0		0	0	130	0	0	9.803857e-01	4.382955e-02	0	0	0	34	0	7	840
ADAMTS20	80070	broad.mit.edu	37	12	43860592	43860592	+	Silent	SNP	A	A	G			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:43860592A>G	ENST00000389420.3	-	9	1229	c.1230T>C	c.(1228-1230)ggT>ggC	p.G410G	ADAMTS20_ENST00000553158.1_Silent_p.G410G	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	410	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CATGTTGAACACCAAGTCTAA	0.294																																						ENST00000389420.3	1.000000	4.800000e-01	0.960000	0.610000	0.750000	0.770766	0.750000	1.000000																										0				95						c.(1228-1230)ggT>ggC		ADAM metallopeptidase with thrombospondin type 1 motif, 20							80.0	83.0	82.0					12																	43860592		2202	4299	6501	SO:0001819	synonymous_variant	80070	0	0					g.chr12:43860592A>G	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1230T>C	chr12.hg19:g.43860592A>G		0					ADAMTS20_ENST00000553158.1_Silent_p.G410G	p.G410G	NM_025003.3	NP_079279.3	1	2	3	1.990823	P59510	ATS20_HUMAN		9	1229	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	1	1	hg19	c.1230T>C	CCDS31778.2	0																																																																																								0.278763		TCGA-RB-A7B8-01A-12D-A33T-08	0.294	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	2.180000	-20.000000	1	0.270000	NM_025003		0	22	23	0	201	199	0		1			0	0	47	0	0	9.999990e-01	0	0	0	0	0	0	22	201
COQ10A	93058	broad.mit.edu	37	12	56662938	56662938	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:56662938G>A	ENST00000308197.5	+	3	638	c.377G>A	c.(376-378)cGt>cAt	p.R126H	RP11-977G19.14_ENST00000546464.1_RNA|COQ10A_ENST00000546544.1_Missense_Mutation_p.R109H|COQ10A_ENST00000433805.2_Missense_Mutation_p.R94H	NM_144576.3	NP_653177.3	Q96MF6	CQ10A_HUMAN	coenzyme Q10 homolog A (S. cerevisiae)	126						mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	8						GTATCCAGCCGTAAGGGTCAT	0.512																																						ENST00000308197.5	1.000000	3.000000e-02	0.140000	0.050000	0.080000	0.159810	0.080000	0.080000																										0				8						c.(376-378)cGt>cAt		coenzyme Q10 homolog A (S. cerevisiae)							132.0	130.0	131.0					12																	56662938		1958	4125	6083	SO:0001583	missense	93058	1	120890	36				g.chr12:56662938G>A	AK057003	CCDS41796.1, CCDS44921.1	12q13.3	2011-09-16	2006-04-04		ENSG00000135469	ENSG00000135469			26515	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog A (yeast)"""				Standard	NM_144576		Approved	FLJ32452	uc001sko.4	Q96MF6	OTTHUMG00000170283	ENST00000308197.5:c.377G>A	chr12.hg19:g.56662938G>A	ENSP00000312587:p.Arg126His	0					RP11-977G19.14_ENST00000546464.1_RNA|COQ10A_ENST00000546544.1_Missense_Mutation_p.R109H|COQ10A_ENST00000433805.2_Missense_Mutation_p.R94H	p.R126H	NM_144576.3	NP_653177.3	1	2	3	1.990823	Q96MF6	CQ10A_HUMAN		3	638	+			Q6GMR6|Q6UWB9|Q86X16|Q8TAL2|Q96MF1|Q9BUP4	Missense_Mutation	SNP	ENST00000308197.5	0	1	hg19	c.377G>A	CCDS41796.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.436623	0.96168	.	.	ENSG00000135469	ENST00000308197;ENST00000433805;ENST00000546544	T;T;T	0.26810	1.71;1.73;1.73	5.33	5.33	0.75918	5.33	5.33	0.75918	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.30166	0.0756	L	0.54965	1.715	0.80722	D	1	P;P;P	0.47350	0.87;0.894;0.894	B;B;B	0.41571	0.245;0.258;0.36	T	0.06643	-1.0815	10	0.54805	T	0.06	.	18.1779	0.89767	0.0:0.0:1.0:0.0	.	109;131;126	Q96MF6-2;Q8TAL2;Q96MF6	.;.;CQ10A_HUMAN	H	126;94;109	ENSP00000312587:R126H;ENSP00000407843:R94H;ENSP00000446723:R109H	ENSP00000312587:R126H	R	+	2	0	0	COQ10A	54949205	54949205	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.651000	0.83577	2.665000	0.90641	0.561000	0.74099	CGT	0.278763		TCGA-RB-A7B8-01A-12D-A33T-08	0.512	COQ10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408332.1	0	0	1	2	22	2	2	1	1	1	1	92	92	92	90	1	2.180000	-2.221341	0	0.270000	NM_144576		0	7	8	0	627	624	0		0	0		1	0	92	0	0	3.580266e-03	1.845335e-02	0	0	0	16	0	7	627
PGAM5	192111	broad.mit.edu	37	12	133294121	133294121	+	Missense_Mutation	SNP	C	C	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr12:133294121C>A	ENST00000498926.2	+	3	525	c.467C>A	c.(466-468)aCc>aAc	p.T156N	PXMP2_ENST00000545677.1_3'UTR|PGAM5_ENST00000543955.1_Missense_Mutation_p.T7N|PGAM5_ENST00000317555.2_Missense_Mutation_p.T156N|PGAM5_ENST00000454808.2_Missense_Mutation_p.T7N	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	156					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		GCCATAGAGACCACCGATATC	0.632																																						ENST00000498926.2	1.000000	6.300000e-01	1.000000	0.760000	0.920000	0.898751	0.920000	1.000000																										0				5						c.(466-468)aCc>aAc		phosphoglycerate mutase family member 5							57.0	62.0	60.0					12																	133294121		2203	4299	6502	SO:0001583	missense	192111	0	0					g.chr12:133294121C>A	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.467C>A	chr12.hg19:g.133294121C>A	ENSP00000438465:p.Thr156Asn	0					PXMP2_ENST00000545677.1_3'UTR|PGAM5_ENST00000543955.1_Missense_Mutation_p.T7N|PGAM5_ENST00000317555.2_Missense_Mutation_p.T156N|PGAM5_ENST00000454808.2_Missense_Mutation_p.T7N	p.T156N	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	1	2	3	1.996640	Q96HS1	PGAM5_HUMAN		3	525	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		A9LN06|C9IZY7|Q96JB0	Missense_Mutation	SNP	ENST00000498926.2	1	1	hg19	c.467C>A	CCDS53845.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019366	0.75275	.	.	ENSG00000247077	ENST00000317555;ENST00000498926;ENST00000543955;ENST00000454808	T;D	0.88896	-0.78;-2.44	5.6	5.6	0.85130	5.6	5.6	0.85130	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.97225	0.9093	H	0.99042	4.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.98593	1.0655	10	0.87932	D	0	-3.1057	19.6338	0.95721	0.0:1.0:0.0:0.0	.	156;156	Q96HS1;Q96HS1-2	PGAM5_HUMAN;.	N	156;156;7;7	ENSP00000321503:T156N;ENSP00000438465:T156N	ENSP00000321503:T156N	T	+	2	0	0	PGAM5	131804194	131804194	1.000000	0.71417	0.978000	0.43139	0.113000	0.19764	7.255000	0.78338	2.636000	0.89361	0.591000	0.81541	ACC	0.279724		TCGA-RB-A7B8-01A-12D-A33T-08	0.632	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	27	1	2.180000	-20.000000	1	0.270000	NM_138575		0	28	28	0	203	202	0		1	1		0	0	28	0	0	1	9.156384e-01	0	7	0	25	0	28	203
SAP18	10284	broad.mit.edu	37	13	21721345	21721345	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr13:21721345C>T	ENST00000607003.1	+	4	358	c.326C>T	c.(325-327)aCc>aTc	p.T109I	SAP18_ENST00000382533.4_Missense_Mutation_p.T128I			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	109	Involved in splicing regulation activity.				mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		ATTGGCAGCACCATGTCTGGC	0.433																																						ENST00000607003.1	0.150000	2.000000e-02	0.110000	0.040000	0.070000	0.084307	0.070000	0.080000																										0				6						c.(325-327)aCc>aTc		Sin3A-associated protein, 18kDa							103.0	102.0	102.0					13																	21721345		2203	4300	6503	SO:0001583	missense	10284	0	0					g.chr13:21721345C>T	U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.326C>T	chr13.hg19:g.21721345C>T	ENSP00000475925:p.Thr109Ile	0					SAP18_ENST00000382533.4_Missense_Mutation_p.T128I	p.T109I			0	0	0	1.939761	O00422	SAP18_HUMAN		4	358	+		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)	B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Missense_Mutation	SNP	ENST00000607003.1	0	1	hg19	c.326C>T		0	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813017	0.70912	.	.	ENSG00000150459	ENST00000382533	.	.	.	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.75110	0.3805	M	0.69185	2.1	0.80722	D	1	B	0.27823	0.19	B	0.41666	0.363	T	0.70572	-0.4835	9	0.40728	T	0.16	-22.1376	20.2033	0.98269	0.0:1.0:0.0:0.0	.	109	O00422	SAP18_HUMAN	I	128	.	ENSP00000371973:T128I	T	+	2	0	0	SAP18	20619345	20619345	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.640000	0.83355	2.779000	0.95612	0.655000	0.94253	ACC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.433	SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470725.1	0	0	1	2	2	2	2	0	0	0	0	94	94	94	94	1	2.180000	-2.915686	1	0.270000	NM_005870		0	6	7	0	601	598	0		1	1		0	0	94	0	0	9.647541e-01	9.838105e-01	0	13	0	750	0	6	601
CCNA1	8900	broad.mit.edu	37	13	37007204	37007204	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr13:37007204G>A	ENST00000255465.4	+	2	407	c.143G>A	c.(142-144)aGc>aAc	p.S48N	CCNA1_ENST00000440264.1_Missense_Mutation_p.S4N|CCNA1_ENST00000418263.1_Missense_Mutation_p.S47N|CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000449823.1_Missense_Mutation_p.S4N			P78396	CCNA1_HUMAN	cyclin A1	48					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		ATGCACTGCAGCAACCCCAAG	0.602																																						ENST00000255465.4	0.260000	7.000000e-02	0.210000	0.110000	0.150000	0.165940	0.150000	0.150000																										0				35						c.(142-144)aGc>aAc		cyclin A1							116.0	115.0	115.0					13																	37007204		2203	4300	6503	SO:0001583	missense	8900	0	0					g.chr13:37007204G>A	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.143G>A	chr13.hg19:g.37007204G>A	ENSP00000255465:p.Ser48Asn	0					CCNA1_ENST00000440264.1_Missense_Mutation_p.S4N|CCNA1_ENST00000449823.1_Missense_Mutation_p.S4N|CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000418263.1_Missense_Mutation_p.S47N	p.S48N			0	0	0	1.939761	P78396	CCNA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	2	407	+		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	1	1	hg19	c.143G>A	CCDS9357.1	0	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311316	0.40895	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.17370	2.43;2.43;2.28;2.29	4.63	2.86	0.33363	4.63	2.86	0.33363	.	0.954771	0.08588	N	0.923463	T	0.18173	0.0436	L	0.54323	1.7	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.10450	0.005;0.002	T	0.27839	-1.0062	10	0.40728	T	0.16	.	7.931	0.29901	0.1899:0.0:0.8101:0.0	.	47;48	P78396-2;P78396	.;CCNA1_HUMAN	N	4;4;47;48	ENSP00000400666:S4N;ENSP00000409873:S4N;ENSP00000396479:S47N;ENSP00000255465:S48N	ENSP00000255465:S48N	S	+	2	0	0	CCNA1	35905204	35905204	0.291000	0.24352	0.014000	0.15608	0.121000	0.20230	0.587000	0.23909	0.466000	0.27193	0.555000	0.69702	AGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.602	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	0	0	1	2	2	2	2	0	0	0	0	67	67	67	66	1	2.180000	-2.902034	1	0.270000	NM_003914		0	11	11	0	517	511	0		1	0		0	0	67	0	0	9.982546e-01	0	0	0	0	1	0	11	517
POSTN	10631	broad.mit.edu	37	13	38145544	38145544	+	Missense_Mutation	SNP	A	A	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			A	T	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr13:38145544A>T	ENST00000379747.4	-	18	2258	c.2141T>A	c.(2140-2142)aTt>aAt	p.I714N	POSTN_ENST00000497145.1_5'UTR|POSTN_ENST00000541481.1_Intron|POSTN_ENST00000379749.4_Missense_Mutation_p.I714N|POSTN_ENST00000379742.4_Intron|POSTN_ENST00000379743.4_Missense_Mutation_p.I687N|POSTN_ENST00000541179.1_Missense_Mutation_p.I687N	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	714					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		ACCTTCTTTAATCAGTCTGAA	0.383																																						ENST00000379747.4	1.000000	7.700000e-01	1.000000	0.870000	0.980000	0.952952	0.980000	1.000000																										0				59						c.(2140-2142)aTt>aAt		periostin, osteoblast specific factor							224.0	191.0	202.0					13																	38145544		2203	4299	6502	SO:0001583	missense	10631	0	0					g.chr13:38145544A>T	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2141T>A	chr13.hg19:g.38145544A>T	ENSP00000369071:p.Ile714Asn	0					POSTN_ENST00000541179.1_Missense_Mutation_p.I687N|POSTN_ENST00000379742.4_Intron|POSTN_ENST00000497145.1_5'UTR|POSTN_ENST00000541481.1_Intron|POSTN_ENST00000379749.4_Missense_Mutation_p.I714N|POSTN_ENST00000379743.4_Missense_Mutation_p.I687N	p.I714N	NM_006475.2	NP_006466.2	0	0	0	1.939761	Q15063	POSTN_HUMAN		18	2258	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	1	1	hg19	c.2141T>A	CCDS9364.1	1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444763	0.63178	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743	D;D;D;D	0.93712	-3.26;-3.13;-3.16;-3.27	5.49	1.61	0.23674	5.49	1.61	0.23674	.	0.628327	0.15902	N	0.239022	D	0.91533	0.7326	L	0.36672	1.1	0.38885	D	0.956994	P;P;P	0.52692	0.523;0.955;0.93	B;P;P	0.54312	0.248;0.748;0.629	D	0.88467	0.3059	10	0.72032	D	0.01	-1.7243	6.9327	0.24449	0.74:0.1263:0.1337:0.0	.	687;687;714	B1ALD8;Q15063-3;Q15063	.;.;POSTN_HUMAN	N	687;714;714;687	ENSP00000437959:I687N;ENSP00000369073:I714N;ENSP00000369071:I714N;ENSP00000369067:I687N	ENSP00000369067:I687N	I	-	2	0	0	POSTN	37043544	37043544	0.980000	0.34600	0.107000	0.21349	0.993000	0.82548	2.741000	0.47426	0.108000	0.17862	0.477000	0.44152	ATT	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.383	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	1	0	1	2	2	2	2	0	0	0	0	72	72	72	71	1	2.180000	-20.000000	1	0.270000	NM_006475		0	61	61	0	391	390	1		1	0		0	0	72	0	0	1	1	0	0	0	523	0	61	391
PCDH17	27253	broad.mit.edu	37	13	58208306	58208306	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr13:58208306C>T	ENST00000377918.3	+	1	1652	c.1626C>T	c.(1624-1626)ttC>ttT	p.F542F		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CCTTTAACTTCGAGCAGACCA	0.582																																					Melanoma(72;952 1291 1619 12849 33676)	ENST00000377918.3	0.400000	1.100000e-01	0.320000	0.170000	0.230000	0.248752	0.230000	0.230000																										0				120						c.(1624-1626)ttC>ttT		protocadherin 17							48.0	47.0	47.0					13																	58208306		2203	4300	6503	SO:0001819	synonymous_variant	27253	0	0					g.chr13:58208306C>T	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1626C>T	chr13.hg19:g.58208306C>T		0						p.F542F	NM_001040429.2	NP_001035519.1	0	0	0	1.939761	O14917	PCD17_HUMAN		1	1652	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	1	1	hg19	c.1626C>T	CCDS31986.1	0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.582	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	0	0	1	2	2	2	2	0	0	0	0	56	56	56	54	1	2.180000	-10.470270	1	0.270000	NM_001040429		0	10	10	0	311	307	0		1	0		0	0	56	0	0	9.968018e-01	1.699687e-02	0	0	0	6	0	10	311
SGPP1	81537	broad.mit.edu	37	14	64152974	64152974	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr14:64152974C>T	ENST00000247225.6	-	3	1269	c.1175G>A	c.(1174-1176)tGc>tAc	p.C392Y		NM_030791.2	NP_110418.1	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1	392					extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate metabolic process (GO:0006668)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	10				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)		GAAGATTTTGCAGGCTAAAGG	0.378																																						ENST00000247225.6	0.170000	2.000000e-02	0.130000	0.050000	0.080000	0.092330	0.080000	0.080000																										0				10						c.(1174-1176)tGc>tAc		sphingosine-1-phosphate phosphatase 1							160.0	147.0	152.0					14																	64152974		2203	4300	6503	SO:0001583	missense	81537	0	0					g.chr14:64152974C>T	AJ293294	CCDS9760.1	14q23.1	2003-09-17			ENSG00000126821	ENSG00000126821			17720	protein-coding gene	gene with protein product		612826				10859351	Standard	NM_030791		Approved		uc001xgj.3	Q9BX95	OTTHUMG00000029080	ENST00000247225.6:c.1175G>A	chr14.hg19:g.64152974C>T	ENSP00000247225:p.Cys392Tyr	0						p.C392Y	NM_030791.2	NP_110418.1	0	0	0	1.943466	Q9BX95	SGPP1_HUMAN		3	1269	-			B2RAH0|Q9H189	Missense_Mutation	SNP	ENST00000247225.6	0	1	hg19	c.1175G>A	CCDS9760.1	0	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600744	0.46423	.	.	ENSG00000126821	ENST00000247225	.	.	.	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.75817	0.3901	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67581	-0.5634	9	0.02654	T	1	-10.149	20.6593	0.99626	0.0:1.0:0.0:0.0	.	392	Q9BX95	SGPP1_HUMAN	Y	392	.	ENSP00000247225:C392Y	C	-	2	0	0	SGPP1	63222727	63222727	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.416000	0.80143	2.885000	0.99019	0.655000	0.94253	TGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.378	SGPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072626.3	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	2.180000	-2.011348	0	0.270000	NM_030791		0	5	5	0	469	466	0		1	0		0	0	85	0	0	9.368026e-01	4.633913e-02	0	0	0	26	0	5	469
SYNE2	23224	broad.mit.edu	37	14	64685207	64685207	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr14:64685207C>T	ENST00000344113.4	+	108	19777	c.19565C>T	c.(19564-19566)gCc>gTc	p.A6522V	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.A2907V|SYNE2_ENST00000554584.1_Intron|SYNE2_ENST00000394768.2_Missense_Mutation_p.A2907V|SYNE2_ENST00000555002.1_Missense_Mutation_p.A3179V|SYNE2_ENST00000458046.2_Missense_Mutation_p.A179V|SYNE2_ENST00000358025.3_Missense_Mutation_p.A6545V|SYNE2_ENST00000555022.1_Missense_Mutation_p.A400V|SYNE2_ENST00000441438.2_Missense_Mutation_p.A53V|SYNE2_ENST00000554805.1_Missense_Mutation_p.A305V	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6522					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGGGGACTGGCCGGTATCACA	0.527																																						ENST00000344113.4	0.390000	7.000000e-02	0.290000	0.120000	0.190000	0.212716	0.190000	0.180000																										0				224						c.(19564-19566)gCc>gTc		spectrin repeat containing, nuclear envelope 2							60.0	63.0	62.0					14																	64685207		2203	4300	6503	SO:0001583	missense	23224	3	121410	34				g.chr14:64685207C>T	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.19565C>T	chr14.hg19:g.64685207C>T	ENSP00000341781:p.Ala6522Val	0					SYNE2_ENST00000357395.3_Missense_Mutation_p.A2907V|SYNE2_ENST00000358025.3_Missense_Mutation_p.A6545V|SYNE2_ENST00000555002.1_Missense_Mutation_p.A3179V|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555022.1_Missense_Mutation_p.A400V|SYNE2_ENST00000554584.1_Intron|SYNE2_ENST00000441438.2_Missense_Mutation_p.A53V|SYNE2_ENST00000394768.2_Missense_Mutation_p.A2907V|SYNE2_ENST00000458046.2_Missense_Mutation_p.A179V|SYNE2_ENST00000554805.1_Missense_Mutation_p.A305V	p.A6522V	NM_015180.4	NP_055995.4	0	0	0	1.943466	Q8WXH0	SYNE2_HUMAN		108	19777	+			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	0	1	hg19	c.19565C>T	CCDS41963.1	0	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028348	0.35797	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000555002;ENST00000394768;ENST00000555022;ENST00000554805;ENST00000458046;ENST00000441438	T;T;T;T;T;T;T;T;T	0.47177	0.86;4.09;0.85;4.15;4.09;3.72;3.25;2.92;2.74	4.83	4.83	0.62350	4.83	4.83	0.62350	.	0.300803	0.23782	N	0.044608	T	0.42743	0.1216	L	0.55481	1.735	0.80722	D	1	B;B;B;B;B;B;P	0.38048	0.03;0.03;0.107;0.107;0.009;0.192;0.616	B;B;B;B;B;B;B	0.34824	0.01;0.033;0.061;0.023;0.01;0.082;0.19	T	0.45833	-0.9234	10	0.51188	T	0.08	.	13.2847	0.60237	0.0:1.0:0.0:0.0	.	179;2907;53;179;910;6522;6545	B4DND7;Q8WXH0-7;Q8WXH0-6;Q8WXH0-5;Q7Z362;Q8WXH0;Q8WXH0-2	.;.;.;.;.;SYNE2_HUMAN;.	V	6545;2907;6522;3179;2907;400;305;179;53	ENSP00000350719:A6545V;ENSP00000349969:A2907V;ENSP00000341781:A6522V;ENSP00000450831:A3179V;ENSP00000378249:A2907V;ENSP00000451009:A400V;ENSP00000450605:A305V;ENSP00000391937:A179V;ENSP00000396794:A53V	ENSP00000341781:A6522V	A	+	2	0	0	SYNE2	63754960	63754960	0.417000	0.25432	0.013000	0.15412	0.004000	0.04260	1.003000	0.29809	2.489000	0.83994	0.561000	0.74099	GCC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.527	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	0	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	2.180000	-3.153617	1	0.270000	NM_182914		0	5	5	0	198	195	0		1	0		0	0	39	0	0	9.366879e-01	6.332597e-01	0	0	0	80	0	5	198
CCDC88C	440193	broad.mit.edu	37	14	91760540	91760540	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr14:91760540G>A	ENST00000389857.6	-	23	4175	c.4089C>T	c.(4087-4089)taC>taT	p.Y1363Y		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1363					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCTCCTCATGGTACTGCTCCT	0.542																																						ENST00000389857.6	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999834	0.990000	1.000000																										0				24						c.(4087-4089)taC>taT		coiled-coil domain containing 88C							258.0	272.0	267.0					14																	91760540		2139	4251	6390	SO:0001819	synonymous_variant	440193	0	0					g.chr14:91760540G>A		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4089C>T	chr14.hg19:g.91760540G>A		0						p.Y1363Y	NM_001080414.3	NP_001073883.2	0	0	0	1.943466	Q9P219	DAPLE_HUMAN		23	4175	-		all_cancers(154;0.0468)	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	1	1	hg19	c.4089C>T	CCDS45151.1	1																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.542	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	1	0	1	2	2	2	2	0	0	0	0	127	127	127	127	1	2.180000	-20.000000	1	0.270000	XM_029353		0	146	146	0	737	731	1		1	0		0	0	127	0	0	1	4.548277e-01	0	0	0	9	0	146	737
IGDCC3	9543	broad.mit.edu	37	15	65622967	65622967	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr15:65622967G>A	ENST00000327987.4	-	10	1925	c.1674C>T	c.(1672-1674)taC>taT	p.Y558Y	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	558	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTGCTGGGCGGTAAAACAGCT	0.652																																						ENST00000327987.4	1.000000	3.000000e-02	1.000000	0.060000	0.120000	0.325830	0.120000	0.100000																										0				30						c.(1672-1674)taC>taT		immunoglobulin superfamily, DCC subclass, member 3							73.0	77.0	76.0					15																	65622967		2201	4299	6500	SO:0001819	synonymous_variant	9543	1	121410	30				g.chr15:65622967G>A	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1674C>T	chr15.hg19:g.65622967G>A		1					IGDCC3_ENST00000559231.1_5'Flank	p.Y558Y	NM_004884.3	NP_004875.2	1	2	3	2.085874	Q8IVU1	IGDC3_HUMAN		10	1925	-			O95215	Silent	SNP	ENST00000327987.4	0	1	hg19	c.1674C>T	CCDS10205.1	0																																																																																								0.319601		TCGA-RB-A7B8-01A-12D-A33T-08	0.652	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	2.180000	-2.953612	1	0.270000	NM_004884		0	5	5	0	417	416	0		1			0	0	58	0	0	9.375019e-01	0	0	0	0	0	0	5	417
LRRC28	123355	broad.mit.edu	37	15	99874263	99874263	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr15:99874263G>A	ENST00000301981.3	+	6	761	c.521G>A	c.(520-522)cGc>cAc	p.R174H	LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000442993.2_Silent_p.A142A|LRRC28_ENST00000558879.1_Intron|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000422500.2_Intron|LRRC28_ENST00000447360.2_Missense_Mutation_p.R174H	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	174										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			TATGTGCCGCGCCATCTCTGC	0.488																																						ENST00000301981.3	1.000000	4.000000e-02	1.000000	0.070000	0.120000	0.326534	0.120000	0.100000																										0				12						c.(520-522)cGc>cAc		leucine rich repeat containing 28							146.0	124.0	131.0					15																	99874263		2197	4297	6494	SO:0001583	missense	123355	2	121412	34				g.chr15:99874263G>A	AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.521G>A	chr15.hg19:g.99874263G>A	ENSP00000304923:p.Arg174His	0					LRRC28_ENST00000447360.2_Missense_Mutation_p.R174H|LRRC28_ENST00000442993.2_Silent_p.A142A|LRRC28_ENST00000422500.2_Intron|LRRC28_ENST00000558879.1_Intron|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000559399.1_3'UTR	p.R174H	NM_144598.2	NP_653199.2	1	2	3	2.092368	Q86X40	LRC28_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00106)	6	761	+	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	ENST00000301981.3	0	1	hg19	c.521G>A	CCDS10380.1	0	.	.	.	.	.	.	.	.	.	.	G	29.9	5.047388	0.93740	.	.	ENSG00000168904	ENST00000301981;ENST00000447360	T;T	0.29655	1.56;1.56	5.83	4.91	0.64330	5.83	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.50497	0.1619	L	0.59436	1.845	0.80722	D	1	D;B	0.89917	1.0;0.027	D;B	0.79784	0.993;0.007	T	0.42172	-0.9467	10	0.48119	T	0.1	.	14.4478	0.67364	0.0716:0.0:0.9284:0.0	.	174;174	Q86X40-2;Q86X40	.;LRC28_HUMAN	H	174	ENSP00000304923:R174H;ENSP00000404520:R174H	ENSP00000304923:R174H	R	+	2	0	0	LRRC28	97691786	97691786	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	7.304000	0.78882	2.775000	0.95449	0.585000	0.79938	CGC	0.310052		TCGA-RB-A7B8-01A-12D-A33T-08	0.488	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313546.1	0	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	2.180000	-2.392077	0	0.270000	NM_144598		0	7	7	0	526	521	0		1	0		0	0	57	0	0	9.800675e-01	7.368039e-02	0	0	0	29	0	7	526
PRSS21	10942	broad.mit.edu	37	16	2871460	2871460	+	Missense_Mutation	SNP	C	C	T	rs146520280	byFrequency	TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr16:2871460C>T	ENST00000005995.3	+	6	841	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	PRSS21_ENST00000455114.1_Missense_Mutation_p.R265W|PRSS21_ENST00000575739.1_Intron|PRSS21_ENST00000450020.3_Missense_Mutation_p.R253W			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	267	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						TCGGCCCAATCGGCCCGGTGT	0.592													C|||	30	0.00599042	0.0219	0.0014	5008	,	,		18770	0.0		0.0	False		,,,				2504	0.0					ENST00000005995.3	1.000000	1.500000e-01	0.430000	0.220000	0.300000	0.356613	0.300000	0.290000																										0				15						c.(799-801)Cgg>Tgg		protease, serine, 21 (testisin)		C	TRP/ARG,TRP/ARG,TRP/ARG	54,4342	54.9+/-90.9	0,54,2144	73.0	78.0	76.0		799,793,757	1.9	0.6	16	dbSNP_134	76	0,8600		0,0,4300	yes	missense,missense,missense	PRSS21	NM_006799.2,NM_144956.1,NM_144957.1	101,101,101	0,54,6444	TT,TC,CC		0.0,1.2284,0.4155	probably-damaging,probably-damaging,probably-damaging	267/315,265/313,253/301	2871460	54,12942	2198	4300	6498	SO:0001583	missense	10942	147	121412	52				g.chr16:2871460C>T	AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.799C>T	chr16.hg19:g.2871460C>T	ENSP00000005995:p.Arg267Trp	0					PRSS21_ENST00000575739.1_Intron|PRSS21_ENST00000450020.3_Missense_Mutation_p.R253W|PRSS21_ENST00000455114.1_Missense_Mutation_p.R265W	p.R267W			1	2	3	1.985305	Q9Y6M0	TEST_HUMAN		6	841	+			Q9NS34|Q9P2V6	Missense_Mutation	SNP	ENST00000005995.3	1	0	hg19	c.799C>T	CCDS10478.1	0	14	0.00641025641025641	14	0.028455284552845527	0	0.0	0	0.0	0	0.0	c	12.48	1.950839	0.34471	0.012284	0.0	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	D;D;D	0.89746	-2.56;-2.56;-2.56	3.96	1.92	0.25849	3.96	1.92	0.25849	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.81992	0.4940	L	0.51853	1.615	0.19775	N	0.999955	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.991;0.991	T	0.77043	-0.2734	9	0.72032	D	0.01	.	10.2025	0.43094	0.3607:0.6393:0.0:0.0	.	267;265;253	Q9Y6M0;Q9Y6M0-2;Q9Y6M0-3	TEST_HUMAN;.;.	W	265;253;267	ENSP00000400632:R265W;ENSP00000407741:R253W;ENSP00000005995:R267W	ENSP00000005995:R267W	R	+	1	2	2	PRSS21	2811461	2811461	0.000000	0.05858	0.627000	0.29227	0.396000	0.30629	0.525000	0.22956	0.327000	0.23409	-0.333000	0.08304	CGG	0.277800		TCGA-RB-A7B8-01A-12D-A33T-08	0.592	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	50	1	2.180000	-12.202280	1	0.270000	NM_006799		0	11	11	0	272	267	0		1	1		0	0	52	0	0	9.982575e-01	2.074124e-01	0	2	0	18	0	11	272
SMG1	23049	broad.mit.edu	37	16	18841673	18841673	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr16:18841673G>A	ENST00000446231.2	-	52	9223	c.8811C>T	c.(8809-8811)taC>taT	p.Y2937Y	SMG1_ENST00000389467.3_Silent_p.Y2937Y			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2937					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TTAATTCACCGTACTGAGCAT	0.413																																						ENST00000446231.2	1.000000	5.000000e-02	0.300000	0.100000	0.180000	0.226085	0.180000	0.160000																										0				92						c.(8809-8811)taC>taT		SMG1 phosphatidylinositol 3-kinase-related kinase							75.0	70.0	72.0					16																	18841673		1871	4109	5980	SO:0001819	synonymous_variant	23049	7	120822	39				g.chr16:18841673G>A	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8811C>T	chr16.hg19:g.18841673G>A		0					SMG1_ENST00000389467.3_Silent_p.Y2937Y	p.Y2937Y			1	2	3	1.969257	Q96Q15	SMG1_HUMAN		52	9223	-			O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	0	1	hg19	c.8811C>T	CCDS45430.1	0																																																																																								0.274894		TCGA-RB-A7B8-01A-12D-A33T-08	0.413	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	2.180000	-3.141551	1	0.270000	NM_015092		0	4	4	0	182	180	0		1	0		0	0	39	0	0	8.887143e-01	2.041713e-02	0	0	0	8	0	4	182
C16orf93	90835	broad.mit.edu	37	16	30768893	30768893	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr16:30768893C>T	ENST00000543610.1	-	9	1861	c.900G>A	c.(898-900)cgG>cgA	p.R300R	PHKG2_ENST00000424889.3_Intron|PHKG2_ENST00000563588.1_3'UTR|C16orf93_ENST00000541260.1_Silent_p.R365R	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	300										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						TGGCCTTGAGCCGCTCCTCCA	0.607																																						ENST00000543610.1	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.063236	0.050000	0.060000																										0				11						c.(898-900)cgG>cgA		chromosome 16 open reading frame 93							91.0	89.0	90.0					16																	30768893		2197	4300	6497	SO:0001819	synonymous_variant	90835	0	0					g.chr16:30768893C>T	BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.900G>A	chr16.hg19:g.30768893C>T		0					C16orf93_ENST00000541260.1_Silent_p.R365R|PHKG2_ENST00000563588.1_3'UTR|PHKG2_ENST00000424889.3_Intron	p.R300R	NM_001014979.2	NP_001014979.2	0	0	0	1.944391	A1A4V9	CP093_HUMAN		9	1861	-			A1A4V8|F5GX13|Q569G2	Silent	SNP	ENST00000543610.1	0	1	hg19	c.900G>A	CCDS32434.2	0	.	.	.	.	.	.	.	.	.	.	C	4.971	0.180321	0.09443	.	.	ENSG00000196118	ENST00000535476	.	.	.	5.97	2.97	0.34412	5.97	2.97	0.34412	.	.	.	.	.	T	0.54447	0.1859	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	T	0.45071	-0.9286	4	.	.	.	-7.5983	6.1942	0.20540	0.0:0.6832:0.1532:0.1635	.	.	.	.	D	167	.	.	G	-	2	0	0	C16orf93	30676394	30676394	0.922000	0.31269	0.134000	0.22075	0.562000	0.35680	0.541000	0.23207	0.421000	0.25980	0.655000	0.94253	GGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.607	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397089.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	2.180000	-2.762985	1	0.270000	NM_001014979		0	5	6	0	689	682	0		1	0		0	0	107	0	0	9.363032e-01	6.211975e-03	0	0	0	13	0	5	689
ZNF646	9726	broad.mit.edu	37	16	31089682	31089682	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr16:31089682C>T	ENST00000394979.2	+	1	2460	c.2037C>T	c.(2035-2037)ggC>ggT	p.G679G	ZNF646_ENST00000300850.5_Silent_p.G679G			O15015	ZN646_HUMAN	zinc finger protein 646	679					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						AGCGGGCTGGCGGTGCCAGCG	0.652																																						ENST00000394979.2	0.230000	3.000000e-02	0.170000	0.060000	0.110000	0.122524	0.110000	0.100000																										0				49						c.(2035-2037)ggC>ggT		zinc finger protein 646							26.0	33.0	30.0					16																	31089682		2195	4289	6484	SO:0001819	synonymous_variant	9726	5	121294	37				g.chr16:31089682C>T	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.2037C>T	chr16.hg19:g.31089682C>T		0					ZNF646_ENST00000300850.5_Silent_p.G679G	p.G679G			0	0	0	1.944391	O15015	ZN646_HUMAN		1	2460	+			Q8IVD8	Silent	SNP	ENST00000394979.2	0	1	hg19	c.2037C>T		0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.652	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	0	0	1	2	19	2	2	0	0	0	1	66	66	66	62	1	2.180000	-3.120263	1	0.270000	NM_014699		0	5	5	0	351	346	0		0	0		0	0	66	0	0	2.377141e-03	1.044397e-02	0	0	0	9	0	5	351
PRPF8	10594	broad.mit.edu	37	17	1585571	1585571	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr17:1585571G>A	ENST00000572621.1	-	3	551	c.286C>T	c.(286-288)Ccc>Tcc	p.P96S	PRPF8_ENST00000304992.6_Missense_Mutation_p.P96S			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	96					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ACTGCGTGGGGCATGTACTTT	0.507																																						ENST00000572621.1	0.170000	2.000000e-02	0.130000	0.050000	0.080000	0.092919	0.080000	0.080000																										0				77						c.(286-288)Ccc>Tcc		pre-mRNA processing factor 8							174.0	168.0	170.0					17																	1585571		2203	4300	6503	SO:0001583	missense	10594	0	0					g.chr17:1585571G>A	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.286C>T	chr17.hg19:g.1585571G>A	ENSP00000460348:p.Pro96Ser	0					PRPF8_ENST00000304992.6_Missense_Mutation_p.P96S	p.P96S			0	0	0	1.929070	Q6P2Q9	PRP8_HUMAN		3	551	-			O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	0	1	hg19	c.286C>T	CCDS11010.1	0	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656010	0.88056	.	.	ENSG00000174231	ENST00000304992	T	0.67698	-0.28	5.6	5.6	0.85130	5.6	5.6	0.85130	Pre-mRNA-processing-splicing factor 8 (2);	0.000000	0.85682	D	0.000000	D	0.86859	0.6034	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89501	0.3764	10	0.87932	D	0	.	19.616	0.95634	0.0:0.0:1.0:0.0	.	96	Q6P2Q9	PRP8_HUMAN	S	96	ENSP00000304350:P96S	ENSP00000304350:P96S	P	-	1	0	0	PRPF8	1532321	1532321	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	9.314000	0.96306	2.642000	0.89623	0.555000	0.69702	CCC	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.507	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2	0	0	1	2	2	2	2	0	0	0	0	69	69	69	68	1	2.180000	-2.358297	0	0.270000			0	5	5	0	462	459	0		1	0		0	0	69	0	0	9.367921e-01	5.754962e-02	0	0	0	29	0	5	462
FAM83G	644815	broad.mit.edu	37	17	18874844	18874844	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr17:18874844G>A	ENST00000388995.6	-	6	2523	c.2300C>T	c.(2299-2301)gCc>gTc	p.A767V	SLC5A10_ENST00000395643.2_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.A767V|FAM83G_ENST00000345041.4_Missense_Mutation_p.A767V|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	767					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CATGGGGCGGGCATTTTGGGC	0.652																																						ENST00000388995.6	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.060074	0.050000	0.060000																										0				22						c.(2299-2301)gCc>gTc		family with sequence similarity 83, member G							78.0	88.0	85.0					17																	18874844		1977	4145	6122	SO:0001583	missense	644815	0	0					g.chr17:18874844G>A	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.2300C>T	chr17.hg19:g.18874844G>A	ENSP00000373647:p.Ala767Val	0					FAM83G_ENST00000585154.2_Missense_Mutation_p.A767V|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395643.2_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.A767V|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395647.2_Intron	p.A767V			0	0	0	1.929070	A6ND36	FA83G_HUMAN		6	2523	-			Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	ENST00000388995.6	0	1	hg19	c.2300C>T	CCDS42276.1	0	.	.	.	.	.	.	.	.	.	.	G	7.947	0.743933	0.15642	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.12039	2.72;2.72	5.04	2.98	0.34508	5.04	2.98	0.34508	.	1.318120	0.05124	N	0.491337	T	0.15219	0.0367	L	0.51422	1.61	0.09310	N	1	B	0.20261	0.043	B	0.19946	0.027	T	0.33085	-0.9882	10	0.23891	T	0.37	-5.5706	8.3552	0.32327	0.089:0.1598:0.7512:0.0	.	767	A6ND36	FA83G_HUMAN	V	767	ENSP00000373647:A767V;ENSP00000343279:A767V	ENSP00000343279:A767V	A	-	2	0	0	FAM83G	18815569	18815569	0.002000	0.14202	0.001000	0.08648	0.069000	0.16628	1.162000	0.31786	1.209000	0.43321	0.561000	0.74099	GCC	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.652	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4	0	0	1	2	2	2	2	0	0	0	0	134	134	134	132	1	2.180000	-2.439846	0	0.270000			0	6	7	0	841	834	0		1	0		0	0	134	0	0	9.642563e-01	1.427627e-02	0	0	0	21	0	6	841
HAP1	9001	broad.mit.edu	37	17	39881124	39881124	+	Silent	SNP	G	G	A	rs370925764		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr17:39881124G>A	ENST00000310778.5	-	12	1854	c.1845C>T	c.(1843-1845)agC>agT	p.S615S	JUP_ENST00000540235.1_Intron|HAP1_ENST00000393939.2_Silent_p.S538S|HAP1_ENST00000347901.4_Silent_p.S563S|HAP1_ENST00000341193.5_Silent_p.S546S			P54257	HAP1_HUMAN	huntingtin-associated protein 1	615					anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GGCCCAAGCCGCTGGCCTCCA	0.607																																						ENST00000310778.5	1.000000	0	0.080000	0.020000	0.040000	0.134225	0.040000	0.040000																										0				21						c.(1843-1845)agC>agT		huntingtin-associated protein 1		G	,,	0,4406		0,0,2203	199.0	181.0	187.0		1638,1614,1689	-5.3	0.4	17		187	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	HAP1	NM_001079870.1,NM_001079871.1,NM_177977.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	546/603,538/595,563/620	39881124	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9001	3	121412	42				g.chr17:39881124G>A	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1845C>T	chr17.hg19:g.39881124G>A		0					JUP_ENST00000540235.1_Intron|HAP1_ENST00000393939.2_Silent_p.S538S|HAP1_ENST00000347901.4_Silent_p.S563S|HAP1_ENST00000341193.5_Silent_p.S546S	p.S615S			1	2	3	2.003532	P54257	HAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)	12	1854	-		Breast(137;0.000162)	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Silent	SNP	ENST00000310778.5	0	1	hg19	c.1845C>T		0																																																																																								0.280682		TCGA-RB-A7B8-01A-12D-A33T-08	0.607	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	0	0	1	2	2	2	2	0	0	0	0	182	182	182	174	1	2.180000	-2.363744	0	0.270000	NM_003949		0	7	7	0	1198	1184	0		1			0	0	182	0	0	9.797549e-01	0	0	0	0	0	0	7	1198
EZH1	2145	broad.mit.edu	37	17	40865346	40865346	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr17:40865346C>T	ENST00000428826.2	-	11	1206	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	EZH1_ENST00000435174.1_Missense_Mutation_p.R223Q|EZH1_ENST00000585893.1_Missense_Mutation_p.R322Q|EZH1_ENST00000592743.1_Missense_Mutation_p.R362Q|EZH1_ENST00000415827.2_Missense_Mutation_p.R353Q|EZH1_ENST00000590078.1_Missense_Mutation_p.R292Q			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	362					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GTGCCTTCTCCGGCGACGACC	0.552																																						ENST00000428826.2	1.000000	2.000000e-02	0.140000	0.040000	0.080000	0.180439	0.080000	0.070000																										0				27						c.(1084-1086)cGg>cAg		enhancer of zeste 1 polycomb repressive complex 2 subunit							119.0	102.0	108.0					17																	40865346		2203	4300	6503	SO:0001583	missense	2145	1	121412	32				g.chr17:40865346C>T		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1085G>A	chr17.hg19:g.40865346C>T	ENSP00000404658:p.Arg362Gln	0					EZH1_ENST00000585893.1_Missense_Mutation_p.R322Q|EZH1_ENST00000435174.1_Missense_Mutation_p.R223Q|EZH1_ENST00000590078.1_Missense_Mutation_p.R292Q|EZH1_ENST00000592743.1_Missense_Mutation_p.R362Q|EZH1_ENST00000415827.2_Missense_Mutation_p.R353Q	p.R362Q			1	2	3	2.008247	Q92800	EZH1_HUMAN		11	1206	-		Breast(137;0.00104)	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	0	1	hg19	c.1085G>A	CCDS32659.1	0	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008400	0.75046	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	D;D	0.86030	-2.06;-2.06	5.26	5.26	0.73747	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	L	0.46157	1.445	0.58432	D	0.999998	P;P;P;P;P	0.46656	0.764;0.882;0.882;0.72;0.812	B;B;B;B;B	0.35859	0.212;0.209;0.209;0.209;0.149	T	0.78558	-0.2158	10	0.22706	T	0.39	.	19.0657	0.93108	0.0:1.0:0.0:0.0	.	223;322;368;292;362	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	Q	365;362;322;223	ENSP00000404658:R362Q;ENSP00000404071:R223Q	ENSP00000264646:R365Q	R	-	2	0	0	EZH1	38118872	38118872	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.590000	0.74085	2.734000	0.93682	0.555000	0.69702	CGG	0.282591		TCGA-RB-A7B8-01A-12D-A33T-08	0.552	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	2.180000	-2.547753	1	0.270000	NM_001991		0	5	5	0	522	521	0		1	0		0	0	73	0	0	9.371887e-01	1.377477e-02	0	0	0	15	0	5	522
NFE2L1	4779	broad.mit.edu	37	17	46136986	46136986	+	Missense_Mutation	SNP	A	A	G			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr17:46136986A>G	ENST00000362042.3	+	6	2918	c.2302A>G	c.(2302-2304)Aag>Gag	p.K768E	NFE2L1_ENST00000583378.1_Missense_Mutation_p.K569E|NFE2L1_ENST00000582155.1_Missense_Mutation_p.K580E|NFE2L1_ENST00000361665.3_Missense_Mutation_p.K757E|NFE2L1_ENST00000536222.1_Missense_Mutation_p.K612E|RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000585291.1_Missense_Mutation_p.K738E|NFE2L1_ENST00000357480.5_Missense_Mutation_p.K738E	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	768					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GAGGAAGCCAAAGGACCGGAG	0.647																																						ENST00000362042.3	1.000000	3.300000e-01	0.800000	0.440000	0.580000	0.623008	0.580000	0.560000																										0				32						c.(2302-2304)Aag>Gag		nuclear factor, erythroid 2-like 1							23.0	27.0	26.0					17																	46136986		2203	4298	6501	SO:0001583	missense	4779	0	0					g.chr17:46136986A>G	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.2302A>G	chr17.hg19:g.46136986A>G	ENSP00000354855:p.Lys768Glu	0					RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000582155.1_Missense_Mutation_p.K580E|NFE2L1_ENST00000361665.3_Missense_Mutation_p.K757E|NFE2L1_ENST00000357480.5_Missense_Mutation_p.K738E|NFE2L1_ENST00000583378.1_Missense_Mutation_p.K569E|NFE2L1_ENST00000536222.1_Missense_Mutation_p.K612E|NFE2L1_ENST00000585291.1_Missense_Mutation_p.K738E	p.K768E	NM_003204.2	NP_003195.1	1	2	3	2.005347	Q14494	NF2L1_HUMAN		6	2918	+			D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	ENST00000362042.3	1	1	hg19	c.2302A>G	CCDS11524.1	0	.	.	.	.	.	.	.	.	.	.	A	18.91	3.723743	0.68959	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	T;T	0.29142	1.9;1.58	5.89	5.89	0.94794	5.89	5.89	0.94794	.	0.220853	0.48767	D	0.000174	T	0.47655	0.1457	L	0.43923	1.385	0.54753	D	0.999983	D;D;D;D	0.71674	0.994;0.989;0.958;0.998	P;P;P;D	0.75484	0.885;0.709;0.827;0.986	T	0.44847	-0.9301	10	0.66056	D	0.02	-12.13	13.8341	0.63400	1.0:0.0:0.0:0.0	.	612;580;738;768	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	E	787;768;738;612	ENSP00000350072:K738E;ENSP00000445811:K612E	ENSP00000350072:K738E	K	+	1	0	0	NFE2L1	43491985	43491985	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.390000	0.79816	2.257000	0.74773	0.460000	0.39030	AAG	0.281637		TCGA-RB-A7B8-01A-12D-A33T-08	0.647	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	2.180000	-19.876170	1	0.270000	NM_003204		0	15	15	0	187	186	0		1	1		0	0	28	0	0	9.998870e-01	9.999821e-01	0	17	0	235	0	15	187
TRIM37	4591	broad.mit.edu	37	17	57093004	57093004	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr17:57093004G>A	ENST00000262294.7	-	21	2802	c.2543C>T	c.(2542-2544)gCg>gTg	p.A848V	TRIM37_ENST00000393065.2_Missense_Mutation_p.A814V|TRIM37_ENST00000376149.3_Missense_Mutation_p.A726V|TRIM37_ENST00000393066.3_Missense_Mutation_p.A848V	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	848					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A848V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTCTCAACCGCAGGCAAGCC	0.398									Mulibrey Nanism																													ENST00000262294.7	1.000000	2.000000e-02	0.120000	0.040000	0.070000	0.163868	0.070000	0.070000																										1	Substitution - Missense(1)	p.A848V(1)	large_intestine(1)	37						c.(2542-2544)gCg>gTg		tripartite motif containing 37							125.0	133.0	130.0					17																	57093004		2203	4300	6503	SO:0001583	missense	4591	7	121412	43	Mulibrey Nanism	Familial Cancer Database	Perheentupa syndrome	g.chr17:57093004G>A	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.2543C>T	chr17.hg19:g.57093004G>A	ENSP00000262294:p.Ala848Val	0					TRIM37_ENST00000376149.3_Missense_Mutation_p.A726V|TRIM37_ENST00000393065.2_Missense_Mutation_p.A814V|TRIM37_ENST00000393066.3_Missense_Mutation_p.A848V	p.A848V	NM_015294.3	NP_056109.1	1	2	3	2.005347	O94972	TRI37_HUMAN		21	2802	-	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	0	1	hg19	c.2543C>T	CCDS32694.1	0	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661961	0.29515	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	4.93	2.9	0.33743	4.93	2.9	0.33743	.	0.843050	0.10578	N	0.658234	T	0.21267	0.0512	N	0.24115	0.695	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.17531	-1.0366	10	0.48119	T	0.1	-0.0368	9.163	0.37035	0.1801:0.0:0.8199:0.0	.	814;726;848	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	V	848;848;726;814	ENSP00000376785:A848V;ENSP00000262294:A848V;ENSP00000365319:A726V;ENSP00000376784:A814V	ENSP00000262294:A848V	A	-	2	0	0	TRIM37	54447786	54447786	0.197000	0.23362	0.437000	0.26809	0.721000	0.41392	1.507000	0.35758	1.082000	0.41137	0.313000	0.20887	GCG	0.281637		TCGA-RB-A7B8-01A-12D-A33T-08	0.398	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	0	0	1	2	23	2	2	1	1	1	1	114	114	114	113	1	2.180000	-1.937388	0	0.270000	NM_015294		0	7	6	0	798	785	0		0	0		1	0	114	0	0	2.052756e-03	2.168257e-02	0	0	0	22	0	7	798
CDH2	1000	broad.mit.edu	37	18	25572669	25572669	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr18:25572669C>T	ENST00000269141.3	-	9	1717	c.1294G>A	c.(1294-1296)Gcc>Acc	p.A432T	CDH2_ENST00000399380.3_Missense_Mutation_p.A401T	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	432	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTCTGGATGGCGAACCGTCCA	0.532																																						ENST00000269141.3	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.995337	0.990000	1.000000																										0				82						c.(1294-1296)Gcc>Acc		cadherin 2, type 1, N-cadherin (neuronal)							197.0	154.0	169.0					18																	25572669		2203	4300	6503	SO:0001583	missense	1000	0	0					g.chr18:25572669C>T	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1294G>A	chr18.hg19:g.25572669C>T	ENSP00000269141:p.Ala432Thr	0					CDH2_ENST00000399380.3_Missense_Mutation_p.A401T	p.A432T	NM_001792.3	NP_001783.2	0	0	0	1.925972	P19022	CADH2_HUMAN		9	1717	-			A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	1	1	hg19	c.1294G>A	CCDS11891.1	1	.	.	.	.	.	.	.	.	.	.	C	3.023	-0.201263	0.06219	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.49139	0.79;0.79	5.39	4.51	0.55191	5.39	4.51	0.55191	Cadherin (4);Cadherin-like (1);	0.160521	0.56097	D	0.000022	T	0.25975	0.0633	N	0.13140	0.3	0.46222	D	0.998936	B;B	0.13594	0.001;0.008	B;B	0.11329	0.003;0.006	T	0.09122	-1.0689	10	0.08381	T	0.77	.	10.1311	0.42680	0.0:0.8447:0.0:0.1553	.	401;432	A8MWK3;P19022	.;CADH2_HUMAN	T	432;401	ENSP00000269141:A432T;ENSP00000382312:A401T	ENSP00000269141:A432T	A	-	1	0	0	CDH2	23826667	23826667	1.000000	0.71417	0.993000	0.49108	0.455000	0.32408	3.907000	0.56348	2.674000	0.91012	0.655000	0.94253	GCC	0.257979		TCGA-RB-A7B8-01A-12D-A33T-08	0.532	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	2.180000	-2.934807	1	0.270000	NM_001792		0	62	62	0	321	315	1		1	0		0	0	58	0	0	1	7.247729e-01	0	1	0	14	0	62	321
HMHA1	23526	broad.mit.edu	37	19	1073163	1073163	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr19:1073163G>A	ENST00000313093.2	+	3	668	c.437G>A	c.(436-438)cGc>cAc	p.R146H	HMHA1_ENST00000592335.1_Missense_Mutation_p.A27T|HMHA1_ENST00000539243.2_Missense_Mutation_p.R162H|HMHA1_ENST00000536472.1_5'UTR|HMHA1_ENST00000586866.1_Missense_Mutation_p.R150H|HMHA1_ENST00000590214.1_Missense_Mutation_p.R173H|HMHA1_ENST00000543365.1_Missense_Mutation_p.R29H	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	146					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGAGGCCCGCCGCCCGCGG	0.642																																						ENST00000313093.2	1.000000	3.000000e-02	0.140000	0.050000	0.080000	0.167752	0.080000	0.080000																										0				16						c.(436-438)cGc>cAc		histocompatibility (minor) HA-1							37.0	45.0	43.0					19																	1073163		2199	4295	6494	SO:0001583	missense	23526	1	121228	33				g.chr19:1073163G>A	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.437G>A	chr19.hg19:g.1073163G>A	ENSP00000316772:p.Arg146His	0					HMHA1_ENST00000590214.1_Missense_Mutation_p.R173H|HMHA1_ENST00000539243.2_Missense_Mutation_p.R162H|HMHA1_ENST00000592335.1_Missense_Mutation_p.A27T|HMHA1_ENST00000543365.1_Missense_Mutation_p.R29H|HMHA1_ENST00000536472.1_5'UTR|HMHA1_ENST00000586866.1_Missense_Mutation_p.R150H	p.R146H	NM_012292.3	NP_036424.2	1	2	3	1.996663	Q92619	HMHA1_HUMAN		3	668	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	0	1	hg19	c.437G>A	CCDS32863.1	0	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225757	0.39300	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000412039;ENST00000543365	T;T;T	0.25085	1.96;1.96;1.82	4.16	4.16	0.48862	4.16	4.16	0.48862	.	0.068586	0.64402	D	0.000017	T	0.43100	0.1232	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	P;D;P	0.68765	0.878;0.96;0.862	T	0.27054	-1.0085	10	0.45353	T	0.12	-29.6413	9.9138	0.41421	0.1043:0.0:0.8957:0.0	.	162;29;146	F6QP70;F5H1R4;Q92619	.;.;HMHA1_HUMAN	H	162;146;146;140;29	ENSP00000439601:R162H;ENSP00000316772:R146H;ENSP00000438979:R29H	ENSP00000316772:R146H	R	+	2	0	0	HMHA1	1024163	1024163	1.000000	0.71417	0.997000	0.53966	0.498000	0.33706	3.603000	0.54074	1.855000	0.53841	0.491000	0.48974	CGC	0.279724		TCGA-RB-A7B8-01A-12D-A33T-08	0.642	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1	0	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	2.180000	-2.442455	0	0.270000			0	7	7	0	624	620	0		1	0		0	0	82	0	0	9.802442e-01	3.574831e-03	0	0	0	7	0	7	624
SARS2	54938	broad.mit.edu	37	19	39421234	39421234	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr19:39421234G>A	ENST00000221431.6	-	1	302	c.143C>T	c.(142-144)gCg>gTg	p.A48V	SARS2_ENST00000600042.1_Missense_Mutation_p.A48V|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000430193.3_Missense_Mutation_p.A48V|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000594171.1_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	48					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCCCTCGCGCGCATACTCGTA	0.627											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000221431.6	1.000000	2.000000e-02	0.120000	0.040000	0.070000	0.126863	0.070000	0.080000																										0				15						c.(142-144)gCg>gTg		seryl-tRNA synthetase 2, mitochondrial							97.0	84.0	88.0					19																	39421234		2203	4300	6503	SO:0001583	missense	54938	2	121412	37				g.chr19:39421234G>A	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.143C>T	chr19.hg19:g.39421234G>A	ENSP00000221431:p.Ala48Val	0		OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	885	MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000600042.1_Missense_Mutation_p.A48V|SARS2_ENST00000430193.3_Missense_Mutation_p.A48V|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000448145.2_Intron|CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000594171.1_5'Flank	p.A48V	NM_017827.3	NP_060297.1	1	2	3	1.972107	Q9NP81	SYSM_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)	1	302	-	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	0	1	hg19	c.143C>T	CCDS33017.1	0	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512002	0.44660	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.55588	0.51;0.51;1.49	5.65	4.57	0.56435	5.65	4.57	0.56435	.	0.122893	0.53938	D	0.000045	T	0.40979	0.1139	L	0.43923	1.385	.	.	.	D;B;B	0.56746	0.977;0.206;0.257	B;B;B	0.43623	0.425;0.014;0.007	T	0.44952	-0.9294	9	0.16896	T	0.51	.	8.6175	0.33840	0.1027:0.0:0.8973:0.0	.	48;48;48	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	V	48	ENSP00000406754:A48V;ENSP00000221431:A48V;ENSP00000414954:A48V	ENSP00000221431:A48V	A	-	2	0	0	FBXO17	44113074	44113074	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	3.764000	0.55264	2.941000	0.99782	0.655000	0.94253	GCG	0.275865		TCGA-RB-A7B8-01A-12D-A33T-08	0.627	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	0	0	1	2	21	3	2	1	1	1	1	112	112	112	112	1	2.180000	-1.741208	0	0.270000	NM_017827		0	7	7	0	701	695	0		0	0		1	0	112	0	0	5.429036e-03	4.441061e-03	0	0	0	27	0	7	701
ZNF606	80095	broad.mit.edu	37	19	58490664	58490664	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr19:58490664C>T	ENST00000341164.4	-	7	2004	c.1384G>A	c.(1384-1386)Gga>Aga	p.G462R	ZNF606_ENST00000536132.1_Missense_Mutation_p.G372R	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		AAGGCTTTTCCACATTTATTA	0.358																																						ENST00000341164.4	1.000000	8.300000e-01	1.000000	0.970000	0.990000	0.984146	0.990000	1.000000																										0				26						c.(1384-1386)Gga>Aga		zinc finger protein 606							56.0	61.0	59.0					19																	58490664		2203	4299	6502	SO:0001583	missense	80095	0	0					g.chr19:58490664C>T	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.1384G>A	chr19.hg19:g.58490664C>T	ENSP00000343617:p.Gly462Arg	0					ZNF606_ENST00000536132.1_Missense_Mutation_p.G372R	p.G462R	NM_025027.3	NP_079303.2	1	2	3	1.991890	Q8WXB4	ZN606_HUMAN		7	2004	-		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	ENST00000341164.4	1	1	hg19	c.1384G>A	CCDS12968.1	1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223390	0.58668	.	.	ENSG00000166704	ENST00000341164;ENST00000536132;ENST00000551380	T;T;T	0.01484	4.84;4.84;4.84	4.55	4.55	0.56014	4.55	4.55	0.56014	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45361	D	0.000365	T	0.08935	0.0221	M	0.67517	2.055	0.53688	D	0.999976	D	0.89917	1.0	D	0.68483	0.958	T	0.01648	-1.1304	10	0.66056	D	0.02	.	16.585	0.84725	0.0:1.0:0.0:0.0	.	462	Q8WXB4	ZN606_HUMAN	R	462;372;462	ENSP00000343617:G462R;ENSP00000445624:G372R;ENSP00000446972:G462R	ENSP00000343617:G462R	G	-	1	0	0	ZNF606	63182476	63182476	0.976000	0.34144	1.000000	0.80357	0.997000	0.91878	2.375000	0.44283	2.515000	0.84797	0.655000	0.94253	GGA	0.278763		TCGA-RB-A7B8-01A-12D-A33T-08	0.358	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	41	1	2.180000	-3.153007	1	0.270000	NM_025027		0	39	39	0	220	218	1		1	0		0	0	42	0	0	1	2.929391e-01	0	0	0	7	0	39	220
COL11A1	1301	broad.mit.edu	37	1	103483426	103483426	+	Missense_Mutation	SNP	G	G	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:103483426G>T	ENST00000370096.3	-	11	1675	c.1363C>A	c.(1363-1365)Cct>Act	p.P455T	COL11A1_ENST00000512756.1_Missense_Mutation_p.P339T|COL11A1_ENST00000353414.4_Missense_Mutation_p.P416T|COL11A1_ENST00000358392.2_Missense_Mutation_p.P467T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	455	Collagen-like 1.|Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGACCTGGAGGACCCATAATA	0.418																																						ENST00000370096.3	1.000000	8.400000e-01	1.000000	0.950000	0.990000	0.981990	0.990000	1.000000																										0				258						c.(1363-1365)Cct>Act		collagen, type XI, alpha 1							98.0	101.0	100.0					1																	103483426		2203	4300	6503	SO:0001583	missense	1301	0	0					g.chr1:103483426G>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1363C>A	chr1.hg19:g.103483426G>T	ENSP00000359114:p.Pro455Thr	0					COL11A1_ENST00000512756.1_Missense_Mutation_p.P339T|COL11A1_ENST00000358392.2_Missense_Mutation_p.P467T|COL11A1_ENST00000353414.4_Missense_Mutation_p.P416T	p.P455T	NM_001854.3	NP_001845.3	1	2	3	2.068492	P12107	COBA1_HUMAN		11	1675	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	1	1	hg19	c.1363C>A	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322302	0.60634	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.94828	-3.53;-3.53;-3.53;-2.43;-2.43	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.110223	0.64402	D	0.000005	D	0.96935	0.8999	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.85130	0.995;0.991;0.994;0.997	D	0.95999	0.8992	10	0.44086	T	0.13	.	19.111	0.93317	0.0:0.0:1.0:0.0	.	339;416;467;455	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	T	455;467;416;339;467	ENSP00000359114:P455T;ENSP00000351163:P467T;ENSP00000302551:P416T;ENSP00000426533:P339T;ENSP00000408640:P467T	ENSP00000302551:P416T	P	-	1	0	0	COL11A1	103256014	103256014	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.281000	0.89905	2.673000	0.90976	0.650000	0.86243	CCT	0.294754		TCGA-RB-A7B8-01A-12D-A33T-08	0.418	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	2.180000	-20.000000	1	0.270000	NM_080630		0	75	73	0	473	467	1		1	0		0	0	69	0	0	1	9.999969e-01	0	0	0	115	0	75	473
ALX3	257	broad.mit.edu	37	1	110607330	110607330	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:110607330G>A	ENST00000369792.4	-	2	560	c.473C>T	c.(472-474)aCg>aTg	p.T158M	RP4-773N10.4_ENST00000554749.1_RNA	NM_006492.2	NP_006483.2	O95076	ALX3_HUMAN	ALX homeobox 3	158					embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|pattern specification process (GO:0007389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTGAAGGTCGTGCGGTTACG	0.597																																						ENST00000369792.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				6						c.(472-474)aCg>aTg		ALX homeobox 3							111.0	108.0	109.0					1																	110607330		2203	4300	6503	SO:0001583	missense	257	0	0					g.chr1:110607330G>A	AF008203	CCDS819.1	1p13.3	2014-02-04	2008-11-04		ENSG00000156150	ENSG00000156150		"""Homeoboxes / PRD class"""	449	protein-coding gene	gene with protein product		606014	"""aristaless-like homeobox 3"", ""frontonasal dysplasia"""	FND		15226305, 11807986, 19409524	Standard	NM_006492		Approved		uc001dzb.3	O95076	OTTHUMG00000011650	ENST00000369792.4:c.473C>T	chr1.hg19:g.110607330G>A	ENSP00000358807:p.Thr158Met	0					RP4-773N10.4_ENST00000554749.1_RNA	p.T158M	NM_006492.2	NP_006483.2	1	2	3	2.068492	O95076	ALX3_HUMAN		2	560	-		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	O95075|Q5T8M4	Missense_Mutation	SNP	ENST00000369792.4	1	1	hg19	c.473C>T	CCDS819.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087698	0.76642	.	.	ENSG00000156150	ENST00000369792	D	0.97352	-4.35	4.18	4.18	0.49190	4.18	4.18	0.49190	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.98960	0.9646	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99316	1.0905	10	0.87932	D	0	.	14.3494	0.66691	0.0:0.0:1.0:0.0	.	158	O95076	ALX3_HUMAN	M	158	ENSP00000358807:T158M	ENSP00000358807:T158M	T	-	2	0	0	ALX3	110408853	110408853	1.000000	0.71417	0.907000	0.35723	0.987000	0.75469	9.813000	0.99286	2.022000	0.59522	0.462000	0.41574	ACG	0.294754		TCGA-RB-A7B8-01A-12D-A33T-08	0.597	ALX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032232.2	0	0	1	2	22	2	2	1	1	1	1	65	65	65	65	1	2.180000	-20.000000	1	0.270000	NM_006492		0	112	112	0	350	349	1		1			1	0	65	0	0	1	0	0	0	0	0	0	112	350
FLG	2312	broad.mit.edu	37	1	152277587	152277587	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:152277587C>T	ENST00000368799.1	-	3	9810	c.9775G>A	c.(9775-9777)Gaa>Aaa	p.E3259K	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3259	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGTCTTCGTGATGGGAC	0.582									Ichthyosis																													ENST00000368799.1	1.000000	9.700000e-01	1.000000	0.990000	0.990000	0.998934	0.990000	1.000000																										0				424						c.(9775-9777)Gaa>Aaa		filaggrin							241.0	245.0	244.0					1																	152277587		2203	4300	6503	SO:0001583	missense	2312	3	121408	40	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152277587C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9775G>A	chr1.hg19:g.152277587C>T	ENSP00000357789:p.Glu3259Lys	1					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.E3259K	NM_002016.1	NP_002007.1	1	3	4	2.417547	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	9810	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	1	1	hg19	c.9775G>A	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424271	0.25639	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.02103	4.45	1.52	-3.04	0.05412	1.52	-3.04	0.05412	.	.	.	.	.	T	0.01287	0.0042	M	0.68317	2.08	0.09310	N	1	D	0.56287	0.975	P	0.55713	0.782	T	0.30416	-0.9979	9	0.07644	T	0.81	-0.6633	3.8186	0.08825	0.0:0.3025:0.4847:0.2128	.	3259	P20930	FILA_HUMAN	K	3259;197	ENSP00000357789:E3259K	ENSP00000357786:E197K	E	-	1	0	0	FLG	150544211	150544211	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.047000	0.03521	-0.855000	0.04125	-0.535000	0.04281	GAA	0.413984		TCGA-RB-A7B8-01A-12D-A33T-08	0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	0	0	1	2	2	2	2	0	0	0	0	345	345	345	343	1	2.180000	-20.000000	1	0.270000	NM_002016		0	290	288	0	2141	2115	1		1	0		0	0	345	0	0	1	0	0	0	0	1	0	290	2141
CELA2A	63036	broad.mit.edu	37	1	15783633	15783633	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:15783633C>T	ENST00000359621.4	+	2	118	c.93C>T	c.(91-93)ggC>ggT	p.G31G	CELA2A_ENST00000497590.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	31	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						GGGTGGTTGGCGGTGAAGAAG	0.577																																						ENST00000359621.4	0.230000	3.000000e-02	0.170000	0.060000	0.100000	0.119738	0.100000	0.100000																										0				16						c.(91-93)ggC>ggT		chymotrypsin-like elastase family, member 2A							106.0	98.0	100.0					1																	15783633		2203	4300	6503	SO:0001819	synonymous_variant	63036	4	121412	36				g.chr1:15783633C>T		CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.93C>T	chr1.hg19:g.15783633C>T		1					CELA2A_ENST00000497590.1_3'UTR	p.G31G	NM_033440.2	NP_254275.1	0	1	1	1.649643	P08217	CEL2A_HUMAN		2	118	+			B2R5I4|Q14243	Silent	SNP	ENST00000359621.4	0	1	hg19	c.93C>T	CCDS157.1	0																																																																																								0.156069		TCGA-RB-A7B8-01A-12D-A33T-08	0.577	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	0	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	2.180000	-2.811549	1	0.270000	NM_033440		0	4	4	0	256	247	0		1			0	0	31	0	0	8.826125e-01	0	0	0	0	0	0	4	256
AQP10	89872	broad.mit.edu	37	1	154295786	154295786	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:154295786C>T	ENST00000324978.3	+	4	480	c.440C>T	c.(439-441)gCc>gTc	p.A147V	AQP10_ENST00000484864.1_Missense_Mutation_p.A147V|AQP10_ENST00000355197.4_3'UTR|ATP8B2_ENST00000368487.3_5'Flank	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	147					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCATTTTTGCCACCTATCCT	0.557																																						ENST00000324978.3	1.000000	2.000000e-02	0.160000	0.050000	0.090000	0.190216	0.090000	0.080000																										0				23						c.(439-441)gCc>gTc		aquaporin 10							116.0	116.0	116.0					1																	154295786		2203	4300	6503	SO:0001583	missense	89872	0	0					g.chr1:154295786C>T	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.440C>T	chr1.hg19:g.154295786C>T	ENSP00000318355:p.Ala147Val	1					ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000484864.1_Missense_Mutation_p.A147V|AQP10_ENST00000355197.4_3'UTR	p.A147V	NM_080429.2	NP_536354.2	1	3	4	2.394335	Q96PS8	AQP10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)	4	480	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	ENST00000324978.3	0	1	hg19	c.440C>T	CCDS1065.1	0	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484892	0.84854	.	.	ENSG00000143595	ENST00000324978;ENST00000484864	T;T	0.11930	2.73;2.73	5.04	4.12	0.48240	5.04	4.12	0.48240	Aquaporin-like (2);	0.332186	0.32503	N	0.006010	T	0.19406	0.0466	M	0.83312	2.635	0.33617	D	0.604262	D;P	0.54047	0.964;0.912	P;P	0.56127	0.792;0.756	T	0.08722	-1.0708	10	0.87932	D	0	.	8.5573	0.33489	0.0:0.7645:0.1526:0.0828	.	147;147	Q96PS8-2;Q96PS8	.;AQP10_HUMAN	V	147	ENSP00000318355:A147V;ENSP00000420341:A147V	ENSP00000318355:A147V	A	+	2	0	0	AQP10	152562410	152562410	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.810000	0.55613	1.364000	0.46038	0.555000	0.69702	GCC	0.408859		TCGA-RB-A7B8-01A-12D-A33T-08	0.557	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	0	0	1	2	22	2	2	1	1	1	1	113	113	113	112	1	2.180000	-2.147296	0	0.270000	NM_080429		0	7	7	0	753	747	0		0			1	0	113	0	0	3.504678e-03	0	0	0	0	0	0	7	753
MYOC	4653	broad.mit.edu	37	1	171605766	171605766	+	Nonsense_Mutation	SNP	G	G	A	rs202176570		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:171605766G>A	ENST00000037502.6	-	3	885	c.814C>T	c.(814-816)Cga>Tga	p.R272*		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	272	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.		R -> G (in GLC1A; unknown pathological significance). {ECO:0000269|PubMed:11004290}.		bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)	p.R272*(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TTGGGGTCTCGCATCCACACA	0.512																																						ENST00000037502.6	1.000000	4.000000e-02	0.210000	0.080000	0.120000	0.220607	0.120000	0.110000																										1	Substitution - Nonsense(1)	p.R272*(1)	endometrium(1)	28	GRCh37	CM005409	MYOC	M		c.(814-816)Cga>Tga		myocilin, trabecular meshwork inducible glucocorticoid response		G	stop/ARG	0,4406		0,0,2203	94.0	95.0	95.0		814	-1.1	1.0	1		95	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	MYOC	NM_000261.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		272/505	171605766	1,13005	2203	4300	6503	SO:0001587	stop_gained	4653	1	121412	34				g.chr1:171605766G>A	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.814C>T	chr1.hg19:g.171605766G>A	ENSP00000037502:p.Arg272*	1						p.R272*	NM_000261.1	NP_000252.1	1	3	4	2.394335	Q99972	MYOC_HUMAN		3	885	-	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)		B2RD84|O00620|Q7Z6Q9	Nonsense_Mutation	SNP	ENST00000037502.6	0	1	hg19	c.814C>T	CCDS1297.1	0	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908515	0.92107	0.0	1.16E-4	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591;ENST00000537133	.	.	.	5.76	-1.13	0.09775	5.76	-1.13	0.09775	.	0.139314	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	16.4257	0.83814	0.0:0.0:0.6471:0.3529	.	.	.	.	X	272;225;205;272	.	ENSP00000037502:R272X	R	-	1	2	2	MYOC	169872389	169872389	1.000000	0.71417	0.991000	0.47740	0.951000	0.60555	1.127000	0.31357	-0.445000	0.07159	0.555000	0.69702	CGA	0.408859		TCGA-RB-A7B8-01A-12D-A33T-08	0.512	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	0	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	2.180000	-2.353732	0	0.270000	NM_000261		0	7	7	0	553	551	0		1			0	0	67	0	0	9.804696e-01	0	0	0	0	0	0	7	553
CACNA1E	777	broad.mit.edu	37	1	181690939	181690939	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:181690939C>T	ENST00000367573.2	+	16	2002	c.2002C>T	c.(2002-2004)Cgc>Tgc	p.R668C	CACNA1E_ENST00000526775.1_Missense_Mutation_p.R668C|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R619C|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R619C|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R275C|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R668C|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R668C	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	668					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R668C(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CAATGGGATCCGCTCCCAGGG	0.507																																						ENST00000367573.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										2	Substitution - Missense(2)	p.R668C(2)	endometrium(2)	204						c.(2002-2004)Cgc>Tgc		calcium channel, voltage-dependent, R type, alpha 1E subunit							206.0	209.0	208.0					1																	181690939		2041	4204	6245	SO:0001583	missense	777	0	0					g.chr1:181690939C>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2002C>T	chr1.hg19:g.181690939C>T	ENSP00000356545:p.Arg668Cys	1					CACNA1E_ENST00000367567.4_Missense_Mutation_p.R275C|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R668C|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R668C|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R619C|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R619C|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R668C	p.R668C	NM_001205293.1	NP_001192222.1	1	3	4	2.394335	Q15878	CAC1E_HUMAN		16	2002	+			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	1	1	hg19	c.2002C>T	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535986	0.85812	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38;-4.38;-4.38;-4.38	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.048724	0.85682	N	0.000000	D	0.98413	0.9472	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.977	D	0.99482	1.0948	10	0.72032	D	0.01	.	18.6084	0.91275	0.0:1.0:0.0:0.0	.	668;668	Q15878-2;Q15878-3	.;.	C	668;668;619;619;275;668;668	ENSP00000356542:R668C;ENSP00000434814:R668C;ENSP00000350183:R619C;ENSP00000351101:R619C;ENSP00000356539:R275C;ENSP00000353222:R668C;ENSP00000356545:R668C	ENSP00000350183:R619C	R	+	1	0	0	CACNA1E	179957562	179957562	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.705000	0.61838	2.465000	0.83290	0.563000	0.77884	CGC	0.408859		TCGA-RB-A7B8-01A-12D-A33T-08	0.507	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	2.180000	-2.991684	1	0.270000	NM_000721		0	150	150	0	693	679	1		1			0	0	96	0	0	1	0	0	0	0	0	0	150	693
KLHDC8A	55220	broad.mit.edu	37	1	205307704	205307704	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:205307704G>A	ENST00000367156.3	-	8	1594	c.778C>T	c.(778-780)Cga>Tga	p.R260*	KLHDC8A_ENST00000537168.1_Nonsense_Mutation_p.R147*|KLHDC8A_ENST00000367155.3_Nonsense_Mutation_p.R260*|KLHDC8A_ENST00000539253.1_Nonsense_Mutation_p.R260*|KLHDC8A_ENST00000460687.1_Nonsense_Mutation_p.R126*	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	260										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AAGAACGATCGTTCCATCTTC	0.517																																						ENST00000367156.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				14						c.(778-780)Cga>Tga		kelch domain containing 8A							89.0	82.0	85.0					1																	205307704		2203	4300	6503	SO:0001587	stop_gained	55220	0	0					g.chr1:205307704G>A		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.778C>T	chr1.hg19:g.205307704G>A	ENSP00000356124:p.Arg260*	1					KLHDC8A_ENST00000367155.3_Nonsense_Mutation_p.R260*|KLHDC8A_ENST00000537168.1_Nonsense_Mutation_p.R147*|KLHDC8A_ENST00000539253.1_Nonsense_Mutation_p.R260*|KLHDC8A_ENST00000460687.1_Nonsense_Mutation_p.R126*	p.R260*	NM_001271863.1	NP_001258792.1	1	3	4	2.395465	Q8IYD2	KLD8A_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.117)	8	1594	-	Breast(84;0.23)		B3KU70|Q9NVG5	Nonsense_Mutation	SNP	ENST00000367156.3	0	1	hg19	c.778C>T	CCDS30985.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.698759	0.97772	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253;ENST00000537168	.	.	.	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.216018	0.49305	D	0.000149	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-19.0544	19.2423	0.93888	0.0:0.0:1.0:0.0	.	.	.	.	X	260;260;260;147	.	ENSP00000356123:R260X	R	-	1	2	2	KLHDC8A	203574327	203574327	1.000000	0.71417	0.992000	0.48379	0.950000	0.60333	5.085000	0.64468	2.642000	0.89623	0.655000	0.94253	CGA	0.408859		TCGA-RB-A7B8-01A-12D-A33T-08	0.517	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	54	1	2.180000	-20.000000	1	0.270000	NM_018203		0	85	69	0	414	361	1		1	0		0	0	63	0	0	1	7.883851e-02	0	0	0	3	0	85	414
SLC6A9	6536	broad.mit.edu	37	1	44468618	44468618	+	Silent	SNP	A	A	G			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:44468618A>G	ENST00000360584.2	-	6	1040	c.849T>C	c.(847-849)ttT>ttC	p.F283F	SLC6A9_ENST00000372310.3_Silent_p.F210F|SLC6A9_ENST00000372306.3_Silent_p.F210F|SLC6A9_ENST00000357730.2_Silent_p.F229F|SLC6A9_ENST00000372307.3_Silent_p.F145F|SLC6A9_ENST00000475075.2_Silent_p.F99F|SLC6A9_ENST00000537678.1_Silent_p.F145F	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	283					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GCACCTCCCCAAAGTTCCCAA	0.592																																						ENST00000360584.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999663	0.990000	1.000000																										0				22						c.(847-849)ttT>ttC		solute carrier family 6 (neurotransmitter transporter, glycine), member 9	Glycine(DB00145)						125.0	133.0	130.0					1																	44468618		2203	4300	6503	SO:0001819	synonymous_variant	6536	0	0					g.chr1:44468618A>G	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.849T>C	chr1.hg19:g.44468618A>G		1					SLC6A9_ENST00000475075.2_Silent_p.F99F|SLC6A9_ENST00000357730.2_Silent_p.F229F|SLC6A9_ENST00000372306.3_Silent_p.F210F|SLC6A9_ENST00000372310.3_Silent_p.F210F|SLC6A9_ENST00000537678.1_Silent_p.F145F|SLC6A9_ENST00000372307.3_Silent_p.F145F	p.F283F	NM_201649.3	NP_964012.2	1	2	3	2.082796	P48067	SC6A9_HUMAN		6	1040	-	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	ENST00000360584.2	1	1	hg19	c.849T>C	CCDS41317.1	1																																																																																								0.317023		TCGA-RB-A7B8-01A-12D-A33T-08	0.592	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	0	0	1	2	23	2	2	1	1	1	1	130	130	130	128	1	2.180000	-20.000000	1	0.270000	NM_201649		0	142	141	0	803	799	1		1	0		1	0	130	0	0	1	1.112019e-01	0	1	0	3	0	142	803
HIST3H2BB	128312	broad.mit.edu	37	1	228646127	228646127	+	Silent	SNP	T	T	G	rs145799075		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr1:228646127T>G	ENST00000369160.2	+	1	320	c.297T>G	c.(295-297)gtT>gtG	p.V99V	HIST3H2A_ENST00000366695.2_5'Flank	NM_175055.2	NP_778225.1	Q8N257	H2B3B_HUMAN	histone cluster 3, H2bb	99					chromatin organization (GO:0006325)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			skin(1)	1		Prostate(94;0.183)				AGACGGCCGTTCGCCTGCTGC	0.652													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17921	0.0		0.0	False		,,,				2504	0.0					ENST00000369160.2	1.000000	5.000000e-02	0.240000	0.090000	0.140000	0.235493	0.140000	0.120000																										0				1						c.(295-297)gtT>gtG		histone cluster 3, H2bb		G		3,4403		0,3,2200	57.0	56.0	56.0		297	3.9	1.0	1	dbSNP_134	56	0,8600		0,0,4300	no	coding-synonymous	HIST3H2BB	NM_175055.2		0,3,6500	GG,GT,TT		0.0,0.0681,0.0231		99/127	228646127	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	128312	33	121402	46				g.chr1:228646127T>G	AY131981	CCDS1574.1	1q42.13	2011-01-27	2006-10-11		ENSG00000196890	ENSG00000196890		"""Histones / Replication-dependent"""	20514	protein-coding gene	gene with protein product		615046	"""histone 3, H2bb"""			12408966	Standard	NM_175055		Approved		uc001hsz.3	Q8N257	OTTHUMG00000040045	ENST00000369160.2:c.297T>G	chr1.hg19:g.228646127T>G		1					HIST3H2A_ENST00000366695.2_5'Flank	p.V99V	NM_175055.2	NP_778225.1	1	3	4	2.395465	Q8N257	H2B3B_HUMAN		1	320	+		Prostate(94;0.183)	A4FU05|Q3ZCP6|Q5TA30	Silent	SNP	ENST00000369160.2	0	1	hg19	c.297T>G	CCDS1574.1	0																																																																																								0.408859		TCGA-RB-A7B8-01A-12D-A33T-08	0.652	HIST3H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096597.1	0	0	1	2	2	2	2	0	0	0	0	71	71	71	70	1	2.180000	-6.444935	1	0.270000	NM_175055		0	7	7	0	489	484	0		1	0		0	0	71	0	0	9.800372e-01	0	0	0	0	1	0	7	489
JAG1	182	broad.mit.edu	37	20	10621878	10621878	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr20:10621878C>T	ENST00000254958.5	-	24	3446	c.2931G>A	c.(2929-2931)gaG>gaA	p.E977E	JAG1_ENST00000423891.2_Silent_p.E818E	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	977					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TGCAAATGTGCTCCGTAGTAA	0.408									Alagille Syndrome																													ENST00000254958.5	1.000000	6.700000e-01	1.000000	0.790000	0.920000	0.905318	0.920000	1.000000																										0				44						c.(2929-2931)gaG>gaA		jagged 1							83.0	83.0	83.0					20																	10621878		2203	4300	6503	SO:0001819	synonymous_variant	182	0	0		Alagille Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	g.chr20:10621878C>T	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2931G>A	chr20.hg19:g.10621878C>T		0					JAG1_ENST00000423891.2_Silent_p.E818E	p.E977E	NM_000214.2	NP_000205.1	1	2	3	1.954423	P78504	JAG1_HUMAN		24	3446	-			A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	1	1	hg19	c.2931G>A	CCDS13112.1	1																																																																																								0.270984		TCGA-RB-A7B8-01A-12D-A33T-08	0.408	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	2.180000	-20.000000	1	0.270000	NM_000214		0	40	40	0	281	277	1		1	1		0	0	41	0	0	1	9.999668e-01	0	18	0	92	0	40	281
RBM12	10137	broad.mit.edu	37	20	34241168	34241168	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr20:34241168G>A	ENST00000374114.3	-	3	2340	c.2077C>T	c.(2077-2079)Ccc>Tcc	p.P693S	CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000397446.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000397442.1_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.P693S|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000352393.4_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P693S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	693	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CCTGCACTGGGCATTCCCGCA	0.557																																						ENST00000374114.3	0.220000	3.000000e-02	0.160000	0.060000	0.100000	0.112186	0.100000	0.100000																										0				36						c.(2077-2079)Ccc>Tcc		RNA binding motif protein 12							49.0	47.0	48.0					20																	34241168		2199	4292	6491	SO:0001583	missense	10137	0	0					g.chr20:34241168G>A	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2077C>T	chr20.hg19:g.34241168G>A	ENSP00000363228:p.Pro693Ser	0					CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P693S|RBM12_ENST00000359646.1_Missense_Mutation_p.P693S|CPNE1_ENST00000397445.1_Intron	p.P693S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	1	2	3	1.954264	Q9NTZ6	RBM12_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00953)	3	2340	-	Lung NSC(9;0.00608)|all_lung(11;0.00918)		B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	0	1	hg19	c.2077C>T	CCDS13261.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.653504	0.96724	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.22336	1.96;1.96;1.96	4.03	4.03	0.46877	4.03	4.03	0.46877	.	0.000000	0.64402	D	0.000018	T	0.27663	0.0680	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.02365	-1.1170	10	0.19590	T	0.45	-3.377	14.4866	0.67622	0.0:0.0:1.0:0.0	.	693	Q9NTZ6	RBM12_HUMAN	S	693;693;693;492	ENSP00000363228:P693S;ENSP00000352668:P693S;ENSP00000363217:P693S	ENSP00000339879:P492S	P	-	1	0	0	RBM12	33704582	33704582	0.002000	0.14202	0.997000	0.53966	0.903000	0.53119	-0.160000	0.10041	2.528000	0.85240	0.563000	0.77884	CCC	0.270984		TCGA-RB-A7B8-01A-12D-A33T-08	0.557	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	0	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	2.180000	-2.184585	0	0.270000	NM_006047		0	5	5	0	387	386	0		1	0		0	0	55	0	0	9.375022e-01	1.605901e-01	0	1	0	45	0	5	387
EPB41L1	2036	broad.mit.edu	37	20	34773105	34773105	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr20:34773105G>A	ENST00000338074.2	+	7	794	c.633G>A	c.(631-633)acG>acA	p.T211T	EPB41L1_ENST00000441639.1_Silent_p.T149T|EPB41L1_ENST00000373941.1_Silent_p.T211T|EPB41L1_ENST00000202028.5_Silent_p.T149T|EPB41L1_ENST00000373946.3_Silent_p.T180T|EPB41L1_ENST00000373950.2_Silent_p.T114T	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	211	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CCTTTGTCACGCATGCCCTAC	0.612																																						ENST00000338074.2	0.200000	3.000000e-02	0.140000	0.050000	0.090000	0.102854	0.090000	0.080000																										0				37						c.(631-633)acG>acA		erythrocyte membrane protein band 4.1-like 1							75.0	67.0	70.0					20																	34773105		2203	4300	6503	SO:0001819	synonymous_variant	2036	2	121412	38				g.chr20:34773105G>A	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.633G>A	chr20.hg19:g.34773105G>A		0					EPB41L1_ENST00000441639.1_Silent_p.T149T|EPB41L1_ENST00000373950.2_Silent_p.T114T|EPB41L1_ENST00000373946.3_Silent_p.T180T|EPB41L1_ENST00000373941.1_Silent_p.T211T|EPB41L1_ENST00000202028.5_Silent_p.T149T	p.T211T	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	1	2	3	1.954264	Q9H4G0	E41L1_HUMAN		7	794	+	Breast(12;0.0239)		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	0	1	hg19	c.633G>A	CCDS13271.1	0																																																																																								0.270984		TCGA-RB-A7B8-01A-12D-A33T-08	0.612	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	0	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	2.180000	-2.400102	0	0.270000	NM_012156		0	5	5	0	423	417	0		1	0		0	0	76	0	0	9.355442e-01	2.654994e-01	0	0	0	72	0	5	423
GNAS	2778	broad.mit.edu	37	20	57430245	57430245	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr20:57430245C>T	ENST00000371100.4	+	1	2477	c.1925C>T	c.(1924-1926)gCg>gTg	p.A642V	GNAS_ENST00000371102.4_Missense_Mutation_p.A642V|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000306120.3_Missense_Mutation_p.R579W|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371099.2_Missense_Mutation_p.A642V	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GTACCCCTGGCGGAGAAGCGC	0.592			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371100.4	1.000000	8.800000e-01	1.000000	0.990000	0.990000	0.993482	0.990000	1.000000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		0				441						c.(1924-1926)gCg>gTg		GNAS complex locus							24.0	28.0	27.0					20																	57430245		2027	4202	6229	SO:0001583	missense	2778	0	0					g.chr20:57430245C>T	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.1925C>T	chr20.hg19:g.57430245C>T	ENSP00000360141:p.Ala642Val	0	TSP Lung(22;0.16)				GNAS_ENST00000371098.2_Intron|GNAS_ENST00000371099.2_Missense_Mutation_p.A642V|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000306120.3_Missense_Mutation_p.R579W|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.A642V|GNAS_ENST00000464624.2_3'UTR	p.A642V	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	1	2	3	1.954264	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	1	2477	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371100.4	1	0	hg19	c.1925C>T	CCDS46622.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.632|3.632	-0.075297|-0.075297	0.07184|0.07184	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102;ENST00000349036|ENST00000306120;ENST00000423897	D;D;D|.	0.89810|.	-2.41;-2.41;-2.57|.	3.84|3.84	-3.82|-3.82	0.04281|0.04281	3.84|3.84	-3.82|-3.82	0.04281|0.04281	.|.	11.375600|.	0.00166|.	N|.	0.000002|.	T|T	0.16981|0.16981	0.0408|0.0408	N|N	0.08118|0.08118	0|0	0.24069|0.24069	N|N	0.995984|0.995984	B|.	0.28178|.	0.202|.	B|.	0.17433|.	0.018|.	T|T	0.28332|0.28332	-1.0047|-1.0047	10|6	0.44086|0.87932	T|D	0.13|0	.|.	4.5295|4.5295	0.11997|0.11997	0.5251:0.2857:0.0:0.1892|0.5251:0.2857:0.0:0.1892	.|.	642|.	Q5JWF2|.	GNAS1_HUMAN|.	V|W	642;642;642;15|579;5	ENSP00000360141:A642V;ENSP00000360143:A642V;ENSP00000265621:A15V|.	ENSP00000265621:A15V|ENSP00000302237:R579W	A|R	+|+	2|1	0|2	0|2	GNAS|GNAS	56863640|56863640	56863640|56863640	0.002000|0.002000	0.14202|0.14202	0.204000|0.204000	0.23530|0.23530	0.101000|0.101000	0.19017|0.19017	-0.367000|-0.367000	0.07553|0.07553	-0.810000|-0.810000	0.04375|0.04375	-0.362000|-0.362000	0.07510|0.07510	GCG|CGG	0.270984		TCGA-RB-A7B8-01A-12D-A33T-08	0.592	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080417.3	1	0	1	2	2	2	6	0	0	0	0	14	14	14	14	1	2.180000	-20.000000	1	0.270000	NM_000516		0	15	15	0	60	58	0		1	0	1	0	1	14	364	0	9.999135e-01	5.751016e-01	1	0	86	9	339	15	60
TPTE	7179	broad.mit.edu	37	21	10970018	10970018	+	Missense_Mutation	SNP	G	G	A	rs368032413		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr21:10970018G>A	ENST00000361285.4	-	6	439	c.110C>T	c.(109-111)gCg>gTg	p.A37V	TPTE_ENST00000342420.5_Missense_Mutation_p.A37V|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.A37V	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	37					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCTTTCTTTCGCAGGTGCCTC	0.413																																						ENST00000361285.4	0.220000	7.000000e-02	0.180000	0.090000	0.130000	0.142510	0.130000	0.140000																										0				130						c.(109-111)gCg>gTg		transmembrane phosphatase with tensin homology		G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	269.0	245.0	253.0		110,110,110	-1.5	0.0	21		253	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TPTE	NM_199261.2,NM_199260.2,NM_199259.2	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	37/552,37/514,37/534	10970018	1,13005	2203	4300	6503	SO:0001583	missense	7179	11	121412	42				g.chr21:10970018G>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.110C>T	chr21.hg19:g.10970018G>A	ENSP00000355208:p.Ala37Val	0					TPTE_ENST00000298232.7_Missense_Mutation_p.A37V|TPTE_ENST00000342420.5_Missense_Mutation_p.A37V|TPTE_ENST00000415664.2_5'UTR	p.A37V	NM_199261.2	NP_954870	0	0	0	1.940250	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	6	439	-			B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	0	1	hg19	c.110C>T	CCDS13560.2	0	.	.	.	.	.	.	.	.	.	.	G	3.609	-0.080010	0.07141	0.0	1.16E-4	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.95137	-3.43;-3.62;-3.51	0.725	-1.45	0.08828	0.725	-1.45	0.08828	.	0.367802	0.19873	U	0.104151	T	0.82135	0.4971	N	0.14661	0.345	0.09310	N	1	B;B;B	0.18610	0.009;0.001;0.029	B;B;B	0.10450	0.003;0.0;0.005	T	0.70342	-0.4898	10	0.02654	T	1	.	4.7832	0.13213	0.0:0.0:0.5421:0.4579	.	37;37;37	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	V	37	ENSP00000298232:A37V;ENSP00000355208:A37V;ENSP00000344441:A37V	ENSP00000298232:A37V	A	-	2	0	0	TPTE	9991889	9991889	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.742000	0.01835	-1.132000	0.02907	0.194000	0.17425	GCG	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.413	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1	0	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	2.180000	-2.612478	1	0.270000			0	13	13	0	706	701	0		1			0	0	113	0	0	9.995118e-01	0	0	0	0	0	0	13	706
ERG	2078	broad.mit.edu	37	21	39755612	39755612	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr21:39755612G>A	ENST00000417133.2	-	12	1359	c.1174C>T	c.(1174-1176)Cgc>Tgc	p.R392C	ERG_ENST00000398905.1_Missense_Mutation_p.R361C|ERG_ENST00000398911.1_Missense_Mutation_p.R368C|ERG_ENST00000398897.1_Missense_Mutation_p.R269C|ERG_ENST00000398907.1_Missense_Mutation_p.R362C|ERG_ENST00000453032.2_Missense_Mutation_p.R293C|ERG_ENST00000398919.2_Missense_Mutation_p.R392C|ERG_ENST00000442448.1_Missense_Mutation_p.R368C|ERG_ENST00000288319.7_Missense_Mutation_p.R385C|ERG_ENST00000398910.1_Missense_Mutation_p.R369C	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TAGGCGTAGCGCTTCCCATGG	0.572			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)	ENST00000417133.2	0.310000	1.100000e-01	0.260000	0.150000	0.200000	0.210239	0.200000	0.200000				Dom	yes			Dom	yes		21	21q22.3	21q22.3	2078	T	v-ets erythroblastosis virus E26 oncogene like (avian)				"""M, E, L"""	M, E, L	EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1		Ewing sarcoma, prostate, AML	EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	0				4						c.(1174-1176)Cgc>Tgc		v-ets avian erythroblastosis virus E26 oncogene homolog	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)						140.0	118.0	126.0					21																	39755612		2203	4300	6503	SO:0001583	missense	2078	1	121412	33				g.chr21:39755612G>A		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.1174C>T	chr21.hg19:g.39755612G>A	ENSP00000414150:p.Arg392Cys	0					ERG_ENST00000442448.1_Missense_Mutation_p.R368C|ERG_ENST00000398919.2_Missense_Mutation_p.R392C|ERG_ENST00000398905.1_Missense_Mutation_p.R361C|ERG_ENST00000453032.2_Missense_Mutation_p.R293C|ERG_ENST00000398911.1_Missense_Mutation_p.R368C|ERG_ENST00000398897.1_Missense_Mutation_p.R269C|ERG_ENST00000288319.7_Missense_Mutation_p.R385C|ERG_ENST00000398910.1_Missense_Mutation_p.R369C|ERG_ENST00000398907.1_Missense_Mutation_p.R362C	p.R392C	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	0	0	0	1.940250	Q12809	KCNH2_HUMAN		12	1359	-		Prostate(19;3.6e-06)	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	1	1	hg19	c.1174C>T	CCDS46648.1	0	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728867	0.89390	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.2	5.2	0.72013	5.2	5.2	0.72013	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.992;1.0;1.0;0.957	T	0.70905	-0.4745	10	0.87932	D	0	.	18.7596	0.91845	0.0:0.0:1.0:0.0	.	392;361;368;385	P11308;B5MDW0;P11308-1;P11308-4	ERG_HUMAN;.;.;.	C	361;362;385;269;368;392;369;368;293;392	ENSP00000381877:R361C;ENSP00000381879:R362C;ENSP00000288319:R385C;ENSP00000381871:R269C;ENSP00000381882:R368C;ENSP00000414150:R392C;ENSP00000381881:R369C;ENSP00000394694:R368C;ENSP00000396268:R293C;ENSP00000381891:R392C	ENSP00000288319:R385C	R	-	1	0	0	ERG	38677482	38677482	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	2.404000	0.81709	0.655000	0.94253	CGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.572	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	0	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	2.180000	-3.004264	1	0.270000	NM_182918		0	17	17	0	609	599	0		1	0		0	0	82	0	0	9.999603e-01	6.128642e-02	0	0	0	14	0	17	609
PCNT	5116	broad.mit.edu	37	21	47786815	47786815	+	Missense_Mutation	SNP	C	C	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr21:47786815C>A	ENST00000359568.5	+	15	3033	c.2926C>A	c.(2926-2928)Ctc>Atc	p.L976I	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	976					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					ATCCTGTTACCTCTCTGAATT	0.537																																						ENST00000359568.5	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.067292	0.050000	0.060000																										0				104						c.(2926-2928)Ctc>Atc		pericentrin							84.0	92.0	89.0					21																	47786815		2203	4300	6503	SO:0001583	missense	5116	0	0					g.chr21:47786815C>A	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2926C>A	chr21.hg19:g.47786815C>A	ENSP00000352572:p.Leu976Ile	0					PCNT_ENST00000480896.1_3'UTR	p.L976I	NM_006031.5	NP_006022.3	0	0	0	1.940250	O95613	PCNT_HUMAN		15	3033	+	Breast(49;0.112)		O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	0	1	hg19	c.2926C>A	CCDS33592.1	0	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280740	0.40294	.	.	ENSG00000160299	ENST00000359568	T	0.24908	1.83	5.36	3.45	0.39498	5.36	3.45	0.39498	.	0.744958	0.10484	N	0.669220	T	0.40322	0.1112	M	0.64997	1.995	0.23700	N	0.99707	D;P	0.55800	0.973;0.954	P;P	0.53593	0.73;0.541	T	0.20840	-1.0263	10	0.36615	T	0.2	.	13.0171	0.58764	0.0:0.677:0.323:0.0	.	858;976	O95613-2;O95613	.;PCNT_HUMAN	I	976	ENSP00000352572:L976I	ENSP00000352572:L976I	L	+	1	0	0	PCNT	46611243	46611243	0.997000	0.39634	0.748000	0.31131	0.011000	0.07611	0.383000	0.20651	0.567000	0.29293	0.561000	0.74099	CTC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.537	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	0	0	1	2	18	2	2	1	1	1	1	123	123	123	122	1	2.180000	-2.403309	0	0.270000	NM_006031		0	5	5	0	647	643	0		0	0		1	0	123	0	0	4.724497e-03	5.787602e-04	0	0	0	4	0	5	647
ZNRF3	84133	broad.mit.edu	37	22	29439358	29439358	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr22:29439358G>A	ENST00000544604.2	+	4	748	c.573G>A	c.(571-573)ctG>ctA	p.L191L	ZNRF3_ENST00000332811.4_Silent_p.L91L|ZNRF3_ENST00000406323.3_Silent_p.L91L|ZNRF3_ENST00000402174.1_Silent_p.L91L	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	191					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						CCATTAAGCTGATGAACATCG	0.562																																						ENST00000544604.2	1.000000	4.000000e-02	1.000000	0.080000	0.140000	0.340006	0.140000	0.120000																										0				28						c.(571-573)ctG>ctA		zinc and ring finger 3							98.0	106.0	103.0					22																	29439358		2032	4186	6218	SO:0001819	synonymous_variant	84133	0	0					g.chr22:29439358G>A	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.573G>A	chr22.hg19:g.29439358G>A		1					ZNRF3_ENST00000406323.3_Silent_p.L91L|ZNRF3_ENST00000402174.1_Silent_p.L91L|ZNRF3_ENST00000332811.4_Silent_p.L91L	p.L191L	NM_001206998.1	NP_001193927.1	1	3	4	2.261605	Q9ULT6	ZNRF3_HUMAN		4	748	+			B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Silent	SNP	ENST00000544604.2	0	1	hg19	c.573G>A	CCDS56225.1	0																																																																																								0.368840		TCGA-RB-A7B8-01A-12D-A33T-08	0.562	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	0	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	2.180000	-3.325609	1	0.270000	XM_290972		0	6	6	0	431	422	0		1	0		0	0	55	0	0	9.629015e-01	4.118005e-03	0	0	0	6	0	6	431
SLC5A1	6523	broad.mit.edu	37	22	32481008	32481008	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr22:32481008G>A	ENST00000266088.4	+	9	1257	c.1007G>A	c.(1006-1008)cGc>cAc	p.R336H	SLC5A1_ENST00000543737.1_Missense_Mutation_p.R209H	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	336					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)	p.R336H(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	ATGATCAGCCGCATTCTGTAC	0.483																																						ENST00000266088.4	1.000000	2.000000e-02	1.000000	0.050000	0.080000	0.296820	0.080000	0.070000																										1	Substitution - Missense(1)	p.R336H(1)	prostate(1)	37						c.(1006-1008)cGc>cAc		solute carrier family 5 (sodium/glucose cotransporter), member 1	Canagliflozin(DB08907)						181.0	153.0	162.0					22																	32481008		2203	4300	6503	SO:0001583	missense	6523	1	121412	37				g.chr22:32481008G>A		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1007G>A	chr22.hg19:g.32481008G>A	ENSP00000266088:p.Arg336His	1					SLC5A1_ENST00000543737.1_Missense_Mutation_p.R209H	p.R336H	NM_000343.3	NP_000334.1	1	3	4	2.261605	P13866	SC5A1_HUMAN		9	1257	+			B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	0	1	hg19	c.1007G>A	CCDS13902.1	0	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907312	0.72868	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.89123	-2.47;-2.47	4.92	2.8	0.32819	4.92	2.8	0.32819	.	0.051673	0.85682	N	0.000000	D	0.95370	0.8497	H	0.95574	3.69	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94570	0.7770	10	0.87932	D	0	.	9.6601	0.39950	0.078:0.142:0.78:0.0	.	336	P13866	SC5A1_HUMAN	H	336;209	ENSP00000266088:R336H;ENSP00000444898:R209H	ENSP00000266088:R336H	R	+	2	0	0	SLC5A1	30811008	30811008	1.000000	0.71417	0.996000	0.52242	0.796000	0.44982	9.582000	0.98214	0.589000	0.29677	-0.229000	0.12294	CGC	0.368840		TCGA-RB-A7B8-01A-12D-A33T-08	0.483	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	0	0	1	2	25	4	2	1	1	1	1	103	103	103	103	1	2.180000	-1.732319	0	0.270000	NM_000343		0	7	7	0	852	842	0		0	0		1	0	103	0	0	8.460456e-04	3.607382e-03	0	0	0	59	0	7	852
CACNG2	10369	broad.mit.edu	37	22	36960745	36960745	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr22:36960745G>A	ENST00000300105.6	-	4	1606	c.625C>T	c.(625-627)Cgg>Tgg	p.R209W	RP5-1119A7.17_ENST00000562756.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	209					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						GCCGTGGCCCGCAGCTGTTTG	0.667																																						ENST00000300105.6	1.000000	3.100000e-01	1.000000	0.360000	0.410000	0.546701	0.410000	0.410000																										0				18						c.(625-627)Cgg>Tgg		calcium channel, voltage-dependent, gamma subunit 2							86.0	102.0	96.0					22																	36960745		2203	4300	6503	SO:0001583	missense	10369	0	0					g.chr22:36960745G>A	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.625C>T	chr22.hg19:g.36960745G>A	ENSP00000300105:p.Arg209Trp	1					RP5-1119A7.17_ENST00000562756.1_RNA	p.R209W	NM_006078.3	NP_006069.1	1	3	4	2.261605	Q9Y698	CCG2_HUMAN		4	1606	-			Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	1	1	hg19	c.625C>T	CCDS13931.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119367	0.77323	.	.	ENSG00000166862	ENST00000300105	T	0.40756	1.02	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.66590	-0.5885	10	0.66056	D	0.02	-7.8981	14.4754	0.67541	0.0:0.0:0.8529:0.1471	.	209	Q9Y698	CCG2_HUMAN	W	209	ENSP00000300105:R209W	ENSP00000300105:R209W	R	-	1	2	2	CACNG2	35290691	35290691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.656000	0.90262	0.655000	0.94253	CGG	0.368840		TCGA-RB-A7B8-01A-12D-A33T-08	0.667	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2	1	0	1	2	2	2	2	0	0	0	0	209	209	209	205	1	2.180000	-5.857161	1	0.270000			0	68	69	0	1382	1364	0		1			0	0	209	0	0	1	0	0	0	0	0	0	68	1382
NPAS2	4862	broad.mit.edu	37	2	101592029	101592029	+	Splice_Site	SNP	G	G	A	rs182348570		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:101592029G>A	ENST00000335681.5	+	14	1677	c.1392G>A	c.(1390-1392)ccG>ccA	p.P464P	AC016738.3_ENST00000433012.1_RNA|AC016738.3_ENST00000446644.1_RNA|AC016738.3_ENST00000439150.1_RNA|NPAS2_ENST00000542504.1_Splice_Site_p.P529P	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	464					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCACCATGCCGGTAAGTGTGT	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16138	0.0		0.0	False		,,,				2504	0.0					ENST00000335681.5	0.180000	3.000000e-02	0.140000	0.050000	0.090000	0.100382	0.090000	0.080000																										0				29						c.(1390-1392)ccG>ccA		neuronal PAS domain protein 2							65.0	62.0	63.0					2																	101592029		2203	4300	6503	SO:0001630	splice_region_variant	4862	7	121404	41				g.chr2:101592029G>A	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1392+1G>A	chr2.hg19:g.101592029G>A		0					AC016738.3_ENST00000433012.1_RNA|NPAS2_ENST00000542504.1_Splice_Site_p.P529P|AC016738.3_ENST00000439150.1_RNA|AC016738.3_ENST00000446644.1_RNA	p.P464P	NM_002518.3	NP_002509.2	0	0	0	1.939708	Q99743	NPAS2_HUMAN		14	1677	+			Q4ZFV9|Q53SQ3|Q86V96|Q99629	Splice_Site	SNP	ENST00000335681.5	0	1	hg19	c.1392G>A	CCDS2048.1	0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.622	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3	0	0	1	2	2	2	2	0	0	0	0	84	84	84	83	1	2.180000	-2.713821	1	0.270000		Silent	0	6	6	0	503	500	0		1	0		0	0	84	0	0	9.645197e-01	2.829292e-01	0	0	0	77	0	6	503
CKAP2L	150468	broad.mit.edu	37	2	113514269	113514269	+	Missense_Mutation	SNP	A	A	C			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:113514269A>C	ENST00000302450.6	-	4	757	c.679T>G	c.(679-681)Ttg>Gtg	p.L227V	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Missense_Mutation_p.L62V	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	227						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						CTTTTGCCCAAGGCTTGTTTA	0.373																																						ENST00000302450.6	0.590000	2.700000e-01	0.510000	0.340000	0.420000	0.431636	0.420000	0.420000																										0				28						c.(679-681)Ttg>Gtg		cytoskeleton associated protein 2-like							110.0	114.0	113.0					2																	113514269		2203	4300	6503	SO:0001583	missense	150468	0	0					g.chr2:113514269A>C	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.679T>G	chr2.hg19:g.113514269A>C	ENSP00000305204:p.Leu227Val	0					CKAP2L_ENST00000541405.1_Missense_Mutation_p.L62V|CKAP2L_ENST00000481732.1_5'Flank	p.L227V	NM_152515.3	NP_689728.3	0	0	0	1.939708	Q8IYA6	CKP2L_HUMAN		4	757	-			A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	1	1	hg19	c.679T>G	CCDS2100.1	0	.	.	.	.	.	.	.	.	.	.	A	10.37	1.330842	0.24167	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.12879	2.64;3.29	5.0	0.984	0.19773	5.0	0.984	0.19773	.	0.914293	0.09252	N	0.827794	T	0.14874	0.0359	M	0.64997	1.995	0.25552	N	0.987079	B	0.23540	0.087	B	0.26202	0.067	T	0.32929	-0.9888	10	0.42905	T	0.14	0.472	5.4096	0.16341	0.5372:0.1583:0.0:0.3044	.	227	Q8IYA6	CKP2L_HUMAN	V	62;227	ENSP00000438763:L62V;ENSP00000305204:L227V	ENSP00000305204:L227V	L	-	1	2	2	CKAP2L	113230740	113230740	0.000000	0.05858	0.169000	0.22859	0.861000	0.49209	-0.261000	0.08694	0.062000	0.16340	0.477000	0.44152	TTG	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.373	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	2.180000	-6.149242	1	0.270000	NM_152515		0	25	25	0	414	413	0		1	0		0	0	74	0	0	9.999998e-01	0	0	1	0	0	0	25	414
LCT	3938	broad.mit.edu	37	2	136575286	136575286	+	Silent	SNP	G	G	A	rs370939537		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:136575286G>A	ENST00000264162.2	-	6	1342	c.1332C>T	c.(1330-1332)tgC>tgT	p.C444C	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	444	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CCCGGAGGCCGCAAAGCAGGG	0.647																																						ENST00000264162.2	0.220000	5.000000e-02	0.170000	0.080000	0.120000	0.131620	0.120000	0.120000																										0				124						c.(1330-1332)tgC>tgT		lactase	Vitamin C(DB00126)	G		0,4406		0,0,2203	69.0	65.0	66.0		1332	-11.5	0.0	2		66	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LCT	NM_002299.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		444/1928	136575286	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3938	7	121412	40				g.chr2:136575286G>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1332C>T	chr2.hg19:g.136575286G>A		0					AC011893.3_ENST00000437007.1_RNA	p.C444C	NM_002299.2	NP_002290.2	0	0	0	1.939708	P09848	LPH_HUMAN		6	1342	-			Q4ZG58	Silent	SNP	ENST00000264162.2	0	1	hg19	c.1332C>T	CCDS2178.1	0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.647	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	0	0	1	2	2	2	2	0	0	0	0	81	81	81	80	1	2.180000	-2.342122	0	0.270000	NM_002299		0	8	7	0	491	488	0		1			0	0	81	0	0	9.891249e-01	0	0	0	0	0	0	8	491
SCN1A	6323	broad.mit.edu	37	2	166901827	166901827	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:166901827G>A	ENST00000303395.4	-	10	1387	c.1388C>T	c.(1387-1389)aCg>aTg	p.T463M	SCN1A_ENST00000423058.2_Missense_Mutation_p.T463M|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.T463M|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.T463M			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	463					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGCAGTTGCCGTTGCTGCCTG	0.443																																						ENST00000303395.4	0.180000	3.000000e-02	0.140000	0.050000	0.090000	0.101368	0.090000	0.090000																										0				200						c.(1387-1389)aCg>aTg		sodium channel, voltage-gated, type I, alpha subunit	Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)						71.0	74.0	73.0					2																	166901827		2203	4300	6503	SO:0001583	missense	6323	4	121408	37				g.chr2:166901827G>A	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1388C>T	chr2.hg19:g.166901827G>A	ENSP00000303540:p.Thr463Met	0					AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.T463M|SCN1A_ENST00000409050.1_Missense_Mutation_p.T463M|SCN1A_ENST00000423058.2_Missense_Mutation_p.T463M|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA	p.T463M			0	0	0	1.939708	P35498	SCN1A_HUMAN		10	1387	-			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	0	1	hg19	c.1388C>T	CCDS54413.1	0	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507602	0.27036	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.37	4.49	0.54785	5.37	4.49	0.54785	.	0.572471	0.15627	N	0.252583	T	0.13286	0.0322	N	0.04203	-0.255	0.24301	N	0.99512	B;B;B	0.30021	0.265;0.173;0.173	B;B;B	0.25759	0.063;0.029;0.029	T	0.16305	-1.0407	10	0.37606	T	0.19	.	14.4281	0.67230	0.0709:0.0:0.9291:0.0	.	463;463;463	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	M	463	ENSP00000407030:T463M;ENSP00000303540:T463M;ENSP00000364554:T463M;ENSP00000386312:T463M	ENSP00000303540:T463M	T	-	2	0	0	SCN1A	166610073	166610073	0.963000	0.33076	0.098000	0.21074	0.070000	0.16714	3.561000	0.53770	1.411000	0.46957	0.655000	0.94253	ACG	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.443	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	0	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	2.180000	-2.716045	1	0.270000	NM_006920		0	6	6	0	498	494	0		1			0	0	90	0	0	9.640746e-01	0	0	0	0	0	0	6	498
TTN	7273	broad.mit.edu	37	2	179418445	179418445	+	Missense_Mutation	SNP	C	C	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:179418445C>A	ENST00000591111.1	-	284	84588	c.84364G>T	c.(84364-84366)Ggc>Tgc	p.G28122C	TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G20698C|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G20890C|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G20823C|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G27195C|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G29763C			Q8WZ42	TITIN_HUMAN	titin	28122	Fibronectin type-III 105. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGCACTGCCCCCATCATAG	0.483																																						ENST00000591111.1	0.290000	5.000000e-02	0.220000	0.090000	0.140000	0.162795	0.140000	0.140000																										0				1448						c.(84364-84366)Ggc>Tgc		titin							83.0	83.0	83.0					2																	179418445		2032	4193	6225	SO:0001583	missense	7273	0	0					g.chr2:179418445C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.84364G>T	chr2.hg19:g.179418445C>A	ENSP00000465570:p.Gly28122Cys	0					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G27195C|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G20698C|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G29763C|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G20890C|TTN_ENST00000359218.5_Missense_Mutation_p.G20823C|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.G28122C			0	0	0	1.939708	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	284	84588	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.84364G>T		0	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939712	0.73557	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.6	5.6	0.85130	5.6	5.6	0.85130	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84297	0.5441	H	0.95079	3.62	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88293	0.2944	9	0.87932	D	0	.	19.9823	0.97331	0.0:1.0:0.0:0.0	.	20698;20823;20890;28122	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	27195;20698;20890;20823;20695	ENSP00000343764:G27195C;ENSP00000434586:G20698C;ENSP00000340554:G20890C;ENSP00000352154:G20823C	ENSP00000340554:G20890C	G	-	1	0	0	TTN	179126691	179126691	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.788000	0.95919	0.650000	0.86243	GGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.483	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	46	46	46	45	1	2.180000	-6.508263	1	0.270000	NM_133378		0	6	6	0	306	306	0		1	0		0	0	46	0	0	9.653717e-01	0	0	0	0	1	0	6	306
ITGA4	3676	broad.mit.edu	37	2	182360534	182360534	+	Silent	SNP	C	C	T	rs183217259		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:182360534C>T	ENST00000397033.2	+	14	1840	c.1410C>T	c.(1408-1410)gaC>gaT	p.D470D		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	470					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	TAATTGTTGACGCTTCTTTAA	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		21539	0.001		0.0	False		,,,				2504	0.0					ENST00000397033.2	1.000000	7.900000e-01	1.000000	0.900000	0.990000	0.964861	0.990000	1.000000																										0				58						c.(1408-1410)gaC>gaT		integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	Natalizumab(DB00108)|Tinzaparin(DB06822)						127.0	115.0	119.0					2																	182360534		1879	4112	5991	SO:0001819	synonymous_variant	3676	4	120818	37				g.chr2:182360534C>T		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1410C>T	chr2.hg19:g.182360534C>T		0						p.D470D	NM_000885.4	NP_000876.3	0	0	0	1.939708	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)	14	1840	+			D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	1	1	hg19	c.1410C>T	CCDS42788.1	1																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.358	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	2.180000	-19.999970	1	0.270000			0	55	54	0	339	338	1		1	0		0	0	63	0	0	1	1.501614e-01	0	0	0	5	0	55	339
COL6A3	1293	broad.mit.edu	37	2	238253001	238253001	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:238253001C>T	ENST00000295550.4	-	36	8112	c.7660G>A	c.(7660-7662)Gct>Act	p.A2554T	COL6A3_ENST00000353578.4_Missense_Mutation_p.A2348T|COL6A3_ENST00000347401.3_Missense_Mutation_p.A2353T|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2354T|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2348T|COL6A3_ENST00000472056.1_Missense_Mutation_p.A1947T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2554	Nonhelical region.|VWFA 11. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACCTGCAAAGCGTTGATGAGC	0.557																																						ENST00000295550.4	0.100000	2.000000e-02	0.080000	0.030000	0.050000	0.058377	0.050000	0.060000																										0				217						c.(7660-7662)Gct>Act		collagen, type VI, alpha 3							151.0	155.0	154.0					2																	238253001		2203	4300	6503	SO:0001583	missense	1293	0	0					g.chr2:238253001C>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7660G>A	chr2.hg19:g.238253001C>T	ENSP00000295550:p.Ala2554Thr	0					COL6A3_ENST00000472056.1_Missense_Mutation_p.A1947T|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2348T|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2348T|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2354T|COL6A3_ENST00000347401.3_Missense_Mutation_p.A2353T	p.A2554T	NM_004369.3	NP_004360.2	0	0	0	1.939708	P12111	CO6A3_HUMAN		36	8112	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	0	1	hg19	c.7660G>A	CCDS33412.1	0	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881687	0.51908	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.08	5.08	0.68730	5.08	5.08	0.68730	von Willebrand factor, type A (3);	0.000000	0.52532	D	0.000069	D	0.90335	0.6976	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	D	0.88468	0.3060	10	0.30854	T	0.27	.	18.8647	0.92287	0.0:1.0:0.0:0.0	.	1947;1947;2348;2554	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	T	2554;2353;2348;1947;2348;2354	ENSP00000295550:A2554T;ENSP00000315609:A2353T;ENSP00000315873:A2348T;ENSP00000418285:A1947T;ENSP00000386844:A2348T;ENSP00000295546:A2354T	ENSP00000295550:A2554T	A	-	1	0	0	COL6A3	237917740	237917740	1.000000	0.71417	0.210000	0.23637	0.878000	0.50629	7.308000	0.78929	2.507000	0.84556	0.655000	0.94253	GCT	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.557	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	0	0	1	2	2	2	2	0	0	0	0	213	213	213	210	1	2.180000	-2.597499	1	0.270000	NM_004369		0	9	9	0	1249	1242	0		1	0		0	0	213	0	0	9.940544e-01	9.874261e-01	0	0	0	1052	0	9	1249
CNNM4	26504	broad.mit.edu	37	2	97463316	97463316	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:97463316C>T	ENST00000377075.2	+	3	1711	c.1613C>T	c.(1612-1614)gCg>gTg	p.A538V	MIR3127_ENST00000583925.1_RNA|CNNM4_ENST00000540067.1_Missense_Mutation_p.A25V|CNNM4_ENST00000496186.1_3'UTR	NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	538					biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						TTCAAGGATGCGGACAATGAG	0.562																																						ENST00000377075.2	0.180000	2.000000e-02	0.140000	0.050000	0.080000	0.098064	0.080000	0.080000																										0				20						c.(1612-1614)gCg>gTg		cyclin and CBS domain divalent metal cation transport mediator 4							75.0	69.0	71.0					2																	97463316		2203	4300	6503	SO:0001583	missense	26504	2	121412	39				g.chr2:97463316C>T	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1613C>T	chr2.hg19:g.97463316C>T	ENSP00000366275:p.Ala538Val	0					CNNM4_ENST00000496186.1_3'UTR|CNNM4_ENST00000540067.1_Missense_Mutation_p.A25V|MIR3127_ENST00000583925.1_RNA	p.A538V	NM_020184.3	NP_064569.3	0	0	0	1.939708	Q6P4Q7	CNNM4_HUMAN		3	1711	+			B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	0	1	hg19	c.1613C>T	CCDS2024.2	0	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899383	0.33535	.	.	ENSG00000158158	ENST00000377075;ENST00000540067	T	0.72505	-0.66	5.25	5.25	0.73442	5.25	5.25	0.73442	.	0.737333	0.12913	N	0.428840	T	0.61350	0.2340	L	0.40543	1.245	0.18873	N	0.999981	P;B	0.47841	0.901;0.065	B;B	0.37601	0.254;0.01	T	0.59408	-0.7460	10	0.51188	T	0.08	-2.8163	13.5984	0.62004	0.156:0.844:0.0:0.0	.	25;538	B7Z1U0;Q6P4Q7	.;CNNM4_HUMAN	V	538;25	ENSP00000366275:A538V	ENSP00000366275:A538V	A	+	2	0	0	CNNM4	96827043	96827043	0.002000	0.14202	0.448000	0.26945	0.001000	0.01503	1.755000	0.38379	2.608000	0.88229	0.655000	0.94253	GCG	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.562	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	2.180000	-2.499394	0	0.270000	NM_020184		0	5	5	0	441	434	0		1	0		0	0	58	0	0	9.352416e-01	6.920286e-03	0	0	0	9	0	5	441
VWA3B	200403	broad.mit.edu	37	2	98736133	98736133	+	Missense_Mutation	SNP	G	G	A	rs200875707		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:98736133G>A	ENST00000477737.1	+	4	653	c.449G>A	c.(448-450)gGc>gAc	p.G150D	VWA3B_ENST00000451075.2_Intron|VWA3B_ENST00000435344.1_Missense_Mutation_p.G150D	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	150										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GATTTTGGCGGCATTCTGGAG	0.522																																						ENST00000477737.1	0.100000	1.000000e-02	0.070000	0.020000	0.040000	0.055162	0.040000	0.050000																										0				70						c.(448-450)gGc>gAc		von Willebrand factor A domain containing 3B							192.0	187.0	189.0					2																	98736133		1991	4149	6140	SO:0001583	missense	200403	0	0					g.chr2:98736133G>A	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.449G>A	chr2.hg19:g.98736133G>A	ENSP00000417955:p.Gly150Asp	0					VWA3B_ENST00000451075.2_Intron|VWA3B_ENST00000435344.1_Missense_Mutation_p.G150D	p.G150D	NM_144992.4	NP_659429.4	0	0	0	1.939708	Q502W6	VWA3B_HUMAN		4	653	+			B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	0	1	hg19	c.449G>A	CCDS42718.1	0	.	.	.	.	.	.	.	.	.	.	G	1.464	-0.561569	0.03939	.	.	ENSG00000168658	ENST00000435344;ENST00000477737	T;T	0.35973	1.28;1.28	6.02	-3.25	0.05079	6.02	-3.25	0.05079	.	1.332560	0.04551	N	0.389819	T	0.19967	0.0480	N	0.17474	0.49	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.13407	0.009;0.002	T	0.17501	-1.0367	10	0.32370	T	0.25	.	4.4567	0.11647	0.553:0.1139:0.2439:0.0893	.	150;150	Q502W6;Q502W6-8	VWA3B_HUMAN;.	D	150	ENSP00000401959:G150D;ENSP00000417955:G150D	ENSP00000411168:G150D	G	+	2	0	0	VWA3B	98102565	98102565	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	0.140000	0.16056	-0.462000	0.06984	-0.150000	0.13652	GGC	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.522	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	0	0	1	2	2	2	2	0	0	0	0	175	175	175	175	1	2.180000	-1.905977	0	0.270000	NM_144992		0	7	7	0	1058	1049	0		1	0		0	0	175	0	0	9.799996e-01	0	0	0	0	1	0	7	1058
D2HGDH	728294	broad.mit.edu	37	2	242695366	242695366	+	Missense_Mutation	SNP	G	G	A	rs371794611		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr2:242695366G>A	ENST00000321264.4	+	9	1452	c.1243G>A	c.(1243-1245)Gtg>Atg	p.V415M	D2HGDH_ENST00000486953.1_3'UTR|D2HGDH_ENST00000403782.1_Missense_Mutation_p.V281M|AC114730.7_ENST00000417267.1_RNA	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	415					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CTACGACATCGTGACTGACCT	0.687																																						ENST00000321264.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999007	0.990000	1.000000																										0				16						c.(1243-1245)Gtg>Atg		D-2-hydroxyglutarate dehydrogenase		G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	102.0	83.0	89.0		1243	5.3	0.1	2		89	0,8592		0,0,4296	no	missense	D2HGDH	NM_152783.3	21	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	415/522	242695366	1,12997	2203	4296	6499	SO:0001583	missense	728294	3	121390	41				g.chr2:242695366G>A	AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.1243G>A	chr2.hg19:g.242695366G>A	ENSP00000315351:p.Val415Met	0					D2HGDH_ENST00000486953.1_3'UTR|AC114730.7_ENST00000417267.1_RNA|D2HGDH_ENST00000403782.1_Missense_Mutation_p.V281M	p.V415M	NM_152783.3	NP_689996.4	0	0	0	1.939708	Q8N465	D2HDH_HUMAN		9	1452	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	ENST00000321264.4	1	1	hg19	c.1243G>A	CCDS33426.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.80|17.80	3.477180|3.477180	0.63849|0.63849	2.27E-4|2.27E-4	0.0|0.0	ENSG00000180902|ENSG00000180902	ENST00000432449|ENST00000321264;ENST00000403782;ENST00000542211	.|D;D	.|0.85773	.|-2.03;-2.03	5.31|5.31	5.31|5.31	0.75309|0.75309	5.31|5.31	5.31|5.31	0.75309|0.75309	.|FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);	.|0.071537	.|0.56097	.|D	.|0.000031	D|D	0.93585|0.93585	0.7952|0.7952	M|M	0.87381|0.87381	2.88|2.88	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	D|D	0.94453|0.94453	0.7669|0.7669	6|10	0.49607|0.87932	T|D	0.09|0	-3.3567|-3.3567	18.9757|18.9757	0.92735|0.92735	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|415	.|Q8N465	.|D2HDH_HUMAN	H|M	168|415;281;35	.|ENSP00000315351:V415M;ENSP00000384723:V281M	ENSP00000383580:R319H|ENSP00000315351:V415M	R|V	+|+	2|1	0|0	0|0	D2HGDH|D2HGDH	242344039|242344039	242344039|242344039	1.000000|1.000000	0.71417|0.71417	0.088000|0.088000	0.20740|0.20740	0.088000|0.088000	0.18126|0.18126	8.597000|8.597000	0.90847|0.90847	2.485000|2.485000	0.83878|0.83878	0.467000|0.467000	0.42956|0.42956	CGT|GTG	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.687	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322794.2	1	0	0	2	2	2	2	0	0	0	0	106	106	106	105	1	2.180000	-20.000000	1	0.270000	NM_152783		0	82	81	0	409	404	1		1	1		0	0	106	0	0	1	9.992473e-01	0	17	0	38	0	82	409
GTPBP8	29083	broad.mit.edu	37	3	112710121	112710121	+	Missense_Mutation	SNP	G	G	A	rs372770061		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:112710121G>A	ENST00000383678.2	+	1	357	c.275G>A	c.(274-276)cGc>cAc	p.R92H	GTPBP8_ENST00000383677.3_Missense_Mutation_p.R92H|RP11-484K9.4_ENST00000609673.1_RNA|GTPBP8_ENST00000467752.1_5'Flank|GTPBP8_ENST00000473129.1_5'Flank	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	92					barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						GAACGGAACCGCATCGACTAC	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		14687	0.0		0.0	False		,,,				2504	0.001					ENST00000383678.2	1.000000	4.000000e-02	1.000000	0.080000	0.150000	0.299346	0.150000	0.130000																										0				6						c.(274-276)cGc>cAc		GTP-binding protein 8 (putative)		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	41.0	39.0	40.0		275,275	5.2	1.0	3		40	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GTPBP8	NM_014170.2,NM_138485.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	92/285,92/252	112710121	1,13005	2203	4300	6503	SO:0001583	missense	29083	1	121376	34				g.chr3:112710121G>A	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.275G>A	chr3.hg19:g.112710121G>A	ENSP00000373176:p.Arg92His	1					GTPBP8_ENST00000467752.1_5'Flank|RP11-484K9.4_ENST00000609673.1_RNA|GTPBP8_ENST00000383677.3_Missense_Mutation_p.R92H|GTPBP8_ENST00000473129.1_5'Flank	p.R92H	NM_014170.2	NP_054889.2	1	4	5	2.528806	Q8N3Z3	GTPB8_HUMAN		1	357	+			A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	ENST00000383678.2	0	1	hg19	c.275G>A	CCDS33820.1	0	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494060	0.64186	0.0	1.16E-4	ENSG00000163607	ENST00000383678;ENST00000383677;ENST00000305485	T;T	0.48836	2.35;0.8	6.08	5.19	0.71726	6.08	5.19	0.71726	.	0.293519	0.38897	N	0.001533	T	0.61022	0.2314	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.67382	0.951;0.821	T	0.64093	-0.6488	10	0.56958	D	0.05	-1.0752	5.3975	0.16276	0.0749:0.1445:0.6305:0.1501	.	92;92	Q8N3Z3-2;Q8N3Z3	.;GTPB8_HUMAN	H	92	ENSP00000373176:R92H;ENSP00000373175:R92H	ENSP00000295864:R92H	R	+	2	0	0	GTPBP8	114192811	114192811	1.000000	0.71417	1.000000	0.80357	0.306000	0.27790	2.285000	0.43487	1.564000	0.49628	0.655000	0.94253	CGC	0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.647	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354260.2	0	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	2.180000	-3.128482	1	0.270000	NM_014170		0	5	5	0	388	383	0		1	0		0	0	37	0	0	9.358000e-01	6.815765e-02	0	0	0	27	0	5	388
GSK3B	2932	broad.mit.edu	37	3	119595270	119595270	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:119595270G>A	ENST00000264235.8	-	8	1881	c.899C>T	c.(898-900)cCt>cTt	p.P300L	GSK3B_ENST00000316626.5_Missense_Mutation_p.P300L|GSK3B_ENST00000473886.1_5'UTR	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	CTTAGTCCAAGGATGTGCCTT	0.333																																						ENST00000264235.8	1.000000	5.000000e-02	1.000000	0.090000	0.160000	0.307444	0.160000	0.130000																										0				18						c.(898-900)cCt>cTt		glycogen synthase kinase 3 beta	Lithium(DB01356)						152.0	142.0	145.0					3																	119595270		2203	4300	6503	SO:0001583	missense	2932	0	0					g.chr3:119595270G>A	BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.899C>T	chr3.hg19:g.119595270G>A	ENSP00000264235:p.Pro300Leu	1					GSK3B_ENST00000473886.1_5'UTR|GSK3B_ENST00000316626.5_Missense_Mutation_p.P300L	p.P300L	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	1	4	5	2.528806	P49841	GSK3B_HUMAN		8	1881	-			D3DN89|Q9BWH3|Q9UL47	Missense_Mutation	SNP	ENST00000264235.8	0	1	hg19	c.899C>T	CCDS54628.1	0	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414006	0.62511	.	.	ENSG00000082701	ENST00000264235;ENST00000316626;ENST00000539838	T;T	0.41400	1.0;1.0	4.62	4.62	0.57501	4.62	4.62	0.57501	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39118	0.1066	L	0.43152	1.355	0.80722	D	1	B;P	0.38129	0.416;0.619	B;B	0.36335	0.222;0.142	T	0.45789	-0.9237	10	0.72032	D	0.01	-6.4785	18.0111	0.89224	0.0:0.0:1.0:0.0	.	300;300	P49841;P49841-2	GSK3B_HUMAN;.	L	300;300;17	ENSP00000264235:P300L;ENSP00000324806:P300L	ENSP00000264235:P300L	P	-	2	0	0	GSK3B	121077960	121077960	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.142000	0.94618	2.561000	0.86390	0.650000	0.86243	CCT	0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.333	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2	0	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	2.180000	-2.838193	1	0.270000			0	6	6	0	424	420	0		1	0		0	0	52	0	0	9.642000e-01	4.247183e-01	0	0	0	92	0	6	424
MYLK	4638	broad.mit.edu	37	3	123428605	123428605	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:123428605G>A	ENST00000475616.1	-	11	1939	c.1940C>T	c.(1939-1941)tCa>tTa	p.S647L	MYLK_ENST00000360772.3_Missense_Mutation_p.S647L|MYLK_ENST00000359169.1_Missense_Mutation_p.S647L|MYLK_ENST00000346322.5_Missense_Mutation_p.S578L|MYLK_ENST00000360304.3_Missense_Mutation_p.S647L			Q15746	MYLK_HUMAN	myosin light chain kinase	647	Ig-like C2-type 5.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		AGACAGACCTGACACTTGGAC	0.537																																						ENST00000475616.1	1.000000	4.000000e-02	1.000000	0.060000	0.090000	0.256705	0.090000	0.090000																										0				113						c.(1939-1941)tCa>tTa		myosin light chain kinase							245.0	262.0	256.0					3																	123428605		2203	4300	6503	SO:0001583	missense	4638	0	0					g.chr3:123428605G>A	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1940C>T	chr3.hg19:g.123428605G>A	ENSP00000418335:p.Ser647Leu	1					MYLK_ENST00000360772.3_Missense_Mutation_p.S647L|MYLK_ENST00000359169.1_Missense_Mutation_p.S647L|MYLK_ENST00000346322.5_Missense_Mutation_p.S578L|MYLK_ENST00000360304.3_Missense_Mutation_p.S647L	p.S647L			1	4	5	2.528806	Q15746	MYLK_HUMAN		11	1939	-		Lung NSC(201;0.0496)	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	0	1	hg19	c.1940C>T	CCDS46896.1	0	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887908	0.91814	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	5.05	5.05	0.67936	5.05	5.05	0.67936	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70675	0.3251	L	0.28649	0.875	0.80722	D	1	P;B;D;P;P	0.55172	0.944;0.355;0.97;0.858;0.955	P;B;P;P;P	0.60541	0.804;0.171;0.804;0.491;0.876	T	0.66806	-0.5830	9	0.27082	T	0.32	.	18.5896	0.91204	0.0:0.0:1.0:0.0	.	647;578;647;578;647	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	L	647;647;647;578;647	ENSP00000354004:S647L;ENSP00000353452:S647L;ENSP00000352088:S647L;ENSP00000320622:S578L;ENSP00000418335:S647L	ENSP00000320622:S578L	S	-	2	0	0	MYLK	124911295	124911295	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.742000	0.68646	2.622000	0.88805	0.650000	0.86243	TCA	0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.537	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	0	0	1	2	2	2	2	0	0	0	0	235	235	235	234	1	2.180000	-2.559127	1	0.270000	NM_053025		0	19	19	0	2015	2000	0		1	0		0	0	235	0	0	9.999892e-01	1.011705e-04	0	0	0	2	0	19	2015
ZBTB38	253461	broad.mit.edu	37	3	141163339	141163339	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:141163339C>T	ENST00000514251.1	+	4	2388	c.2109C>T	c.(2107-2109)gcC>gcT	p.A703A	ZBTB38_ENST00000441582.2_Silent_p.A703A|ZBTB38_ENST00000321464.5_Silent_p.A704A					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						GTGAGAATGCCGCCTCTGTGA	0.498																																						ENST00000514251.1	1.000000	5.300000e-01	1.000000	0.620000	0.720000	0.761825	0.720000	0.690000																										0				41						c.(2107-2109)gcC>gcT		zinc finger and BTB domain containing 38							80.0	83.0	82.0					3																	141163339		2051	4205	6256	SO:0001819	synonymous_variant	253461	2	120978	37				g.chr3:141163339C>T	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.2109C>T	chr3.hg19:g.141163339C>T		1					ZBTB38_ENST00000441582.2_Silent_p.A703A|ZBTB38_ENST00000321464.5_Silent_p.A704A	p.A703A			1	4	5	2.528806				4	2388	+				Silent	SNP	ENST00000514251.1	1	1	hg19	c.2109C>T	CCDS43157.1	0																																																																																								0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.498	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	77	1	2.180000	-2.665581	1	0.270000			0	54	54	0	691	688	1		1	1		0	0	79	0	0	1	8.613664e-01	0	6	0	41	0	54	691
SLC7A14	57709	broad.mit.edu	37	3	170198095	170198095	+	Missense_Mutation	SNP	G	G	A	rs200600060		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:170198095G>A	ENST00000231706.5	-	7	2291	c.1976C>T	c.(1975-1977)gCg>gTg	p.A659V	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	659					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.A659V(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GCACCAGACCGCAAACCGGAT	0.498																																						ENST00000231706.5	1.000000	4.000000e-02	1.000000	0.070000	0.120000	0.277899	0.120000	0.120000																										1	Substitution - Missense(1)	p.A659V(1)	lung(1)	53						c.(1975-1977)gCg>gTg		solute carrier family 7, member 14		G	VAL/ALA	0,4406		0,0,2203	101.0	107.0	105.0		1976	4.9	0.9	3		105	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SLC7A14	NM_020949.2	64	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	659/772	170198095	2,13004	2203	4300	6503	SO:0001583	missense	57709	23	120976	48				g.chr3:170198095G>A	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1976C>T	chr3.hg19:g.170198095G>A	ENSP00000231706:p.Ala659Val	1					CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	p.A659V	NM_020949.2	NP_066000.2	1	4	5	2.528806	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)	7	2291	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		B3KV33|Q9HCF9	Missense_Mutation	SNP	ENST00000231706.5	0	1	hg19	c.1976C>T	CCDS33892.1	0	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525393	0.44969	0.0	2.33E-4	ENSG00000013293	ENST00000231706	D	0.87103	-2.21	5.81	4.94	0.65067	5.81	4.94	0.65067	.	0.154542	0.56097	D	0.000025	T	0.72867	0.3514	N	0.04203	-0.255	0.47065	D	0.999306	B	0.24576	0.106	B	0.15484	0.013	T	0.68349	-0.5432	10	0.25751	T	0.34	.	14.9962	0.71433	0.0683:0.0:0.9317:0.0	.	659	Q8TBB6	S7A14_HUMAN	V	659	ENSP00000231706:A659V	ENSP00000231706:A659V	A	-	2	0	0	SLC7A14	171680789	171680789	1.000000	0.71417	0.906000	0.35671	0.997000	0.91878	7.611000	0.82962	1.455000	0.47813	0.655000	0.94253	GCG	0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.498	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	0	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	2.180000	-1.895576	0	0.270000	NM_020949		0	9	8	0	793	787	0		1	0		0	0	103	0	0	9.940047e-01	0	0	0	0	1	0	9	793
PIK3CA	5290	broad.mit.edu	37	3	178952072	178952072	+	Missense_Mutation	SNP	A	A	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:178952072A>T	ENST00000263967.3	+	21	3284	c.3127A>T	c.(3127-3129)Atg>Ttg	p.M1043L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1043	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		M -> I (in MCAP and CRC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.M1043V(22)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CATGAAACAAATGAATGATGC	0.368		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	ENST00000263967.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000		57		Dom	yes			Dom	yes		3	3q26.3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""				"""E, O"""	E, O			colorectal, gastric, gliobastoma, breast		22	Substitution - Missense(22)	p.M1043V(22)	endometrium(9)|breast(6)|upper_aerodigestive_tract(3)|large_intestine(1)|central_nervous_system(1)|lung(1)|ovary(1)	5269						c.(3127-3129)Atg>Ttg		phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	Caffeine(DB00201)						97.0	87.0	91.0					3																	178952072		1905	4126	6031	SO:0001583	missense	5290	0	0					g.chr3:178952072A>T		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3127A>T	chr3.hg19:g.178952072A>T	ENSP00000263967:p.Met1043Leu	1	HNSCC(19;0.045)|TSP Lung(28;0.18)				RP11-245C23.3_ENST00000609807.1_RNA	p.M1043L	NM_006218.2	NP_006209.2	1	4	5	2.528806	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)	21	3284	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	1	1	hg19	c.3127A>T	CCDS43171.1	1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.313034	0.40895	.	.	ENSG00000121879	ENST00000263967	T	0.79845	-1.31	6.08	6.08	0.98989	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.61464	0.2349	N	0.01761	-0.735	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.59674	-0.7410	10	0.46703	T	0.11	-20.5202	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1043	P42336	PK3CA_HUMAN	L	1043	ENSP00000263967:M1043L	ENSP00000263967:M1043L	M	+	1	0	0	PIK3CA	180434766	180434766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	ATG	0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.368	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	2.180000	-20.000000	1	0.270000			0	160	158	0	318	315	1		1	1		0	0	51	0	0	1	1	0	22	0	35	0	160	318
SRGAP3	9901	broad.mit.edu	37	3	9100157	9100157	+	Splice_Site	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:9100157C>T	ENST00000383836.3	-	7	1229		c.e7-1		SRGAP3_ENST00000360413.3_Splice_Site|SRGAP3_ENST00000433332.3_Splice_Site	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		AATCACAGCACTTGGGGAGAG	0.577			T	RAF1	pilocytic astrocytoma																																	ENST00000383836.3	0.280000	7.000000e-02	0.220000	0.100000	0.150000	0.168169	0.150000	0.150000				Dom	yes			Dom	yes		3	3p25.3	3p25.3	9901	T	SLIT-ROBO Rho GTPase activating protein 3				M	M	RAF1		pilocytic astrocytoma	SRGAP3/RAF1(6)	0				54						c.e7-1		SLIT-ROBO Rho GTPase activating protein 3							68.0	64.0	65.0					3																	9100157		2203	4300	6503	SO:0001630	splice_region_variant	9901	0	0					g.chr3:9100157C>T	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.802-1G>A	chr3.hg19:g.9100157C>T		0					SRGAP3_ENST00000433332.3_Splice_Site|SRGAP3_ENST00000360413.3_Splice_Site		NM_014850.3	NP_055665.1	0	0	0	1.920345	O43295	SRGP3_HUMAN		7	1229	-			Q8IX13|Q8IZV8	Splice_Site	SNP	ENST00000383836.3	0	1	hg19		CCDS2572.1	0	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424679	0.83667	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	.	.	.	5.55	5.55	0.83447	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1098	0.93312	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	SRGAP3	9075157	9075157	1.000000	0.71417	0.998000	0.56505	0.868000	0.49771	7.663000	0.83820	2.596000	0.87737	0.650000	0.86243	.	0.255937		TCGA-RB-A7B8-01A-12D-A33T-08	0.577	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3	0	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	2.180000	-8.141846	1	0.270000		Intron	0	8	8	0	376	371	0		1			0	0	68	0	0	9.889666e-01	0	0	0	0	0	0	8	376
CACNA1D	776	broad.mit.edu	37	3	53769492	53769492	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:53769492G>A	ENST00000350061.5	+	20	3224	c.2713G>A	c.(2713-2715)Gca>Aca	p.A905T	CACNA1D_ENST00000288139.4_Missense_Mutation_p.A925T|CACNA1D_ENST00000422281.2_Missense_Mutation_p.A905T	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	905					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCCCTGGCCGCAGAGGACCC	0.627																																						ENST00000350061.5	0.200000	3.000000e-02	0.150000	0.060000	0.100000	0.110555	0.100000	0.100000																										0				90						c.(2713-2715)Gca>Aca		calcium channel, voltage-dependent, L type, alpha 1D subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						84.0	71.0	76.0					3																	53769492		2203	4300	6503	SO:0001583	missense	776	2	121412	39				g.chr3:53769492G>A	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2713G>A	chr3.hg19:g.53769492G>A	ENSP00000288133:p.Ala905Thr	0					CACNA1D_ENST00000288139.4_Missense_Mutation_p.A925T|CACNA1D_ENST00000422281.2_Missense_Mutation_p.A905T	p.A905T	NM_001128840.1	NP_001122312.1	0	1	1	1.948477	Q01668	CAC1D_HUMAN		20	3224	+			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	0	1	hg19	c.2713G>A	CCDS46848.1	0	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595482	0.66219	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.46	4.58	0.56647	5.46	4.58	0.56647	.	0.066144	0.64402	N	0.000015	D	0.98601	0.9532	M	0.89414	3.03	0.80722	D	1	D;D;D;D	0.89917	1.0;0.986;1.0;0.972	D;P;D;P	0.79108	0.988;0.659;0.992;0.816	D	0.99655	1.0992	10	0.87932	D	0	.	16.7269	0.85424	0.0:0.1292:0.8708:0.0	.	905;598;905;925	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	T	905;925;905;598	ENSP00000288133:A905T;ENSP00000288139:A925T;ENSP00000409174:A905T;ENSP00000418014:A598T	ENSP00000288139:A925T	A	+	1	0	0	CACNA1D	53744532	53744532	1.000000	0.71417	0.106000	0.21319	0.197000	0.23852	7.906000	0.87423	1.407000	0.46875	0.555000	0.69702	GCA	0.268024		TCGA-RB-A7B8-01A-12D-A33T-08	0.627	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	0	0	1	2	21	2	2	1	1	1	1	70	70	70	69	1	2.180000	-2.691434	1	0.270000	NM_000720		0	6	8	0	457	453	0		0	0		1	0	70	0	0	2.489373e-03	7.653401e-04	0	0	0	3	0	6	457
OPA1	4976	broad.mit.edu	37	3	193366601	193366601	+	Missense_Mutation	SNP	A	A	C			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr3:193366601A>C	ENST00000392438.3	+	19	2022	c.1788A>C	c.(1786-1788)aaA>aaC	p.K596N	OPA1_ENST00000361150.2_Missense_Mutation_p.K597N|OPA1_ENST00000361510.2_Missense_Mutation_p.K651N|OPA1_ENST00000361715.2_Missense_Mutation_p.K615N|OPA1_ENST00000361828.2_Missense_Mutation_p.K614N|OPA1_ENST00000361908.3_Missense_Mutation_p.K633N	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	596					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TATTTGAAAAAGCTAAAAATG	0.308																																						ENST00000392438.3	1.000000	4.000000e-01	1.000000	0.490000	0.600000	0.663433	0.600000	0.590000																										0				31						c.(1786-1788)aaA>aaC		optic atrophy 1 (autosomal dominant)							81.0	92.0	88.0					3																	193366601		2202	4295	6497	SO:0001583	missense	4976	0	0					g.chr3:193366601A>C	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.1788A>C	chr3.hg19:g.193366601A>C	ENSP00000376233:p.Lys596Asn	1					OPA1_ENST00000361908.3_Missense_Mutation_p.K633N|OPA1_ENST00000361715.2_Missense_Mutation_p.K615N|OPA1_ENST00000361828.2_Missense_Mutation_p.K614N|OPA1_ENST00000361510.2_Missense_Mutation_p.K651N|OPA1_ENST00000361150.2_Missense_Mutation_p.K597N	p.K596N	NM_015560.2	NP_056375.2	1	4	5	2.528806	O60313	OPA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	19	2022	+	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		D3DNW4	Missense_Mutation	SNP	ENST00000392438.3	1	1	hg19	c.1788A>C	CCDS43186.1	0	.	.	.	.	.	.	.	.	.	.	A	20.4	3.985177	0.74474	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.96041	-3.48;-3.47;-3.44;-3.46;-3.49;-3.89	6.08	-4.14	0.03892	6.08	-4.14	0.03892	.	0.000000	0.85682	D	0.000000	D	0.96207	0.8763	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.993;0.999;0.996;0.996;0.999;0.996;0.999;0.998	D;D;D;D;D;D;D;D	0.70487	0.933;0.922;0.969;0.969;0.942;0.969;0.941;0.969	D	0.94142	0.7398	10	0.56958	D	0.05	-27.0205	12.8665	0.57941	0.541:0.0:0.459:0.0	.	560;596;578;597;614;633;615;651	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	N	633;596;651;615;614;597	ENSP00000354681:K633N;ENSP00000376233:K596N;ENSP00000355324:K651N;ENSP00000355311:K615N;ENSP00000354429:K614N;ENSP00000354781:K597N	ENSP00000354781:K597N	K	+	3	2	2	OPA1	194849295	194849295	0.998000	0.40836	0.922000	0.36590	0.981000	0.71138	0.731000	0.26058	-1.012000	0.03387	-0.408000	0.06270	AAA	0.440077		TCGA-RB-A7B8-01A-12D-A33T-08	0.308	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	1	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	2.180000	-7.010273	1	0.270000	NM_130837		0	32	32	0	505	498	0		1	1		0	0	63	0	0	1	9.131675e-01	0	3	0	65	0	32	505
GPR78	27201	broad.mit.edu	37	4	8582937	8582937	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr4:8582937C>T	ENST00000382487.4	+	1	645	c.228C>T	c.(226-228)ccC>ccT	p.P76P	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	76					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						CGTCGGCGCCCGGCGCATGCC	0.687																																						ENST00000382487.4	1.000000	6.500000e-01	1.000000	0.840000	0.990000	0.945651	0.990000	1.000000																										0				26						c.(226-228)ccC>ccT		G protein-coupled receptor 78							15.0	18.0	17.0					4																	8582937		2200	4294	6494	SO:0001819	synonymous_variant	27201	0	0					g.chr4:8582937C>T	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.228C>T	chr4.hg19:g.8582937C>T		0					GPR78_ENST00000509216.1_Intron	p.P76P	NM_080819.4	NP_543009.2	0	0	0	1.930260	Q96P69	GPR78_HUMAN		1	645	+			Q8NGV3	Silent	SNP	ENST00000382487.4	0	1	hg19	c.228C>T	CCDS3403.1	1																																																																																								0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.687	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	15	1	2.180000	-19.999990	1	0.270000			0	15	15	0	86	85	1		1			0	0	16	0	0	9.999088e-01	0	0	0	0	0	0	15	86
DCAF4L1	285429	broad.mit.edu	37	4	41984154	41984154	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr4:41984154C>T	ENST00000333141.5	+	1	442	c.345C>T	c.(343-345)taC>taT	p.Y115Y		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	115										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						TCCACGTGTACGTGCTCAGAA	0.562																																						ENST00000333141.5	1.000000	8.200000e-01	1.000000	0.920000	0.990000	0.974019	0.990000	1.000000																										0				37						c.(343-345)taC>taT		DDB1 and CUL4 associated factor 4-like 1							105.0	97.0	100.0					4																	41984154		2203	4300	6503	SO:0001819	synonymous_variant	285429	1	121412	33				g.chr4:41984154C>T	BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.345C>T	chr4.hg19:g.41984154C>T		0						p.Y115Y	NM_001029955.3	NP_001025126.2	0	0	0	1.930260	Q3SXM0	DC4L1_HUMAN		1	442	+			B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Silent	SNP	ENST00000333141.5	1	1	hg19	c.345C>T	CCDS33978.1	1																																																																																								0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.562	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	2.180000	-20.000000	1	0.270000	NM_001029955		0	67	66	0	402	397	1		1			0	0	73	0	0	1	0	0	0	0	0	0	67	402
PCDHA12	56137	broad.mit.edu	37	5	140257259	140257259	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr5:140257259G>A	ENST00000398631.2	+	1	2202	c.2202G>A	c.(2200-2202)ccG>ccA	p.P734P	PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	734	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGCGCGCCGGGCAAGCCCA	0.682																																					Pancreas(113;759 1672 13322 24104 50104)	ENST00000398631.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				78						c.(2200-2202)ccG>ccA		protocadherin alpha 12							28.0	28.0	28.0					5																	140257259		2201	4300	6501	SO:0001819	synonymous_variant	56137	0	0					g.chr5:140257259G>A	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2202G>A	chr5.hg19:g.140257259G>A		0					PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron	p.P734P	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	0	1	1	1.948940	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2202	+			O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	1	1	hg19	c.2202G>A	CCDS47285.1	1																																																																																								0.268024		TCGA-RB-A7B8-01A-12D-A33T-08	0.682	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	1	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	2.180000	-3.933300	1	0.270000	NM_018903		0	55	55	0	177	177	1		1	0		0	0	36	0	0	1	0	0	0	0	1	0	55	177
PCDHB11	56125	broad.mit.edu	37	5	140581503	140581503	+	Missense_Mutation	SNP	C	C	T	rs200787309		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr5:140581503C>T	ENST00000354757.3	+	1	2156	c.2156C>T	c.(2155-2157)gCg>gTg	p.A719V	PCDHB11_ENST00000536699.1_Missense_Mutation_p.A354V	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	719					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGAGCAGGGCGGCCTCGGTG	0.652																																						ENST00000354757.3	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.993813	0.990000	1.000000																										0				63						c.(2155-2157)gCg>gTg		protocadherin beta 11		C	VAL/ALA	0,4406		0,0,2203	94.0	103.0	100.0		2156	0.7	0.0	5		100	2,8598	1.2+/-3.3	0,2,4298	no	missense	PCDHB11	NM_018931.2	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	719/798	140581503	2,13004	2203	4300	6503	SO:0001583	missense	56125	3	121412	39				g.chr5:140581503C>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.2156C>T	chr5.hg19:g.140581503C>T	ENSP00000346802:p.Ala719Val	0					PCDHB11_ENST00000536699.1_Missense_Mutation_p.A354V	p.A719V	NM_018931.2	NP_061754.1	0	1	1	1.948940	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	2156	+			B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	1	1	hg19	c.2156C>T	CCDS4253.1	1	.	.	.	.	.	.	.	.	.	.	c	12.20	1.867239	0.32977	0.0	2.33E-4	ENSG00000197479	ENST00000536699;ENST00000354757	T;T	0.17528	2.27;2.27	2.77	0.731	0.18277	2.77	0.731	0.18277	.	.	.	.	.	T	0.19846	0.0477	M	0.88031	2.925	0.09310	N	1	P	0.36599	0.56	B	0.22880	0.042	T	0.14952	-1.0454	9	0.72032	D	0.01	.	6.2507	0.20843	0.2201:0.5842:0.1957:0.0	.	719	Q9Y5F2	PCDBB_HUMAN	V	354;719	ENSP00000440344:A354V;ENSP00000346802:A719V	ENSP00000346802:A719V	A	+	2	0	0	PCDHB11	140561687	140561687	0.000000	0.05858	0.004000	0.12327	0.229000	0.25112	-0.444000	0.06854	0.020000	0.15106	0.549000	0.68633	GCG	0.268024		TCGA-RB-A7B8-01A-12D-A33T-08	0.652	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	1	0	1	2	2	2	2	0	0	0	0	181	181	181	183	1	2.180000	-20.000000	1	0.270000	NM_018931		0	165	162	0	969	943	1		1	0		0	0	181	0	0	1	2.146277e-02	0	1	0	1	0	165	969
PHACTR1	221692	broad.mit.edu	37	6	13206143	13206143	+	Missense_Mutation	SNP	C	C	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:13206143C>A	ENST00000379350.1	+	7	890	c.761C>A	c.(760-762)cCa>cAa	p.P254Q	PHACTR1_ENST00000457702.2_Missense_Mutation_p.P109Q|PHACTR1_ENST00000332995.7_Missense_Mutation_p.P254Q|PHACTR1_ENST00000379345.2_Intron			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	254					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GTGGGGGGGCCAGACCTCTCA	0.602																																						ENST00000379350.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999957	0.990000	1.000000																										0				26						c.(760-762)cCa>cAa		phosphatase and actin regulator 1							54.0	63.0	60.0					6																	13206143		2015	4156	6171	SO:0001583	missense	221692	0	0					g.chr6:13206143C>A	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.761C>A	chr6.hg19:g.13206143C>A	ENSP00000368655:p.Pro254Gln	0					PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000332995.7_Missense_Mutation_p.P254Q|PHACTR1_ENST00000457702.2_Missense_Mutation_p.P109Q	p.P254Q			0	0	0	1.929623	Q9C0D0	PHAR1_HUMAN	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)	7	890	+	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	1	1	hg19	c.761C>A		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.984897|3.984897	0.74474|0.74474	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000379350;ENST00000332995;ENST00000432934;ENST00000457702|ENST00000415087	T;T;T|.	0.31510|.	1.49;1.53;1.52|.	5.12|5.12	5.12|5.12	0.69794|0.69794	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	0.598284|.	0.18257|.	N|.	0.146764|.	T|T	0.37489|0.37489	0.1005|0.1005	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	D;P;P|.	0.61697|.	0.99;0.838;0.899|.	P;B;B|.	0.58780|.	0.845;0.276;0.367|.	T|T	0.29119|0.29119	-1.0022|-1.0022	10|5	0.15499|.	T|.	0.54|.	-7.9901|-7.9901	17.722|17.722	0.88355|0.88355	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	323;254;254|.	E7ESR5;Q9C0D0;Q9C0D0-2|.	.;PHAR1_HUMAN;.|.	Q|K	254;254;323;109|89	ENSP00000368655:P254Q;ENSP00000329880:P254Q;ENSP00000397669:P109Q|.	ENSP00000329880:P254Q|.	P|Q	+|+	2|1	0|0	0|0	PHACTR1|PHACTR1	13314122|13314122	13314122|13314122	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.973000|0.973000	0.67179|0.67179	3.146000|3.146000	0.50631|0.50631	2.653000|2.653000	0.90120|0.90120	0.561000|0.561000	0.74099|0.74099	CCA|CAG	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.602	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	2.180000	-20.000000	1	0.270000	XM_166420		0	83	82	0	358	354	1		1	0		0	0	72	0	0	1	3.597521e-02	0	0	0	2	0	83	358
ASCC3	10973	broad.mit.edu	37	6	101073182	101073182	+	Silent	SNP	A	A	G			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:101073182A>G	ENST00000369162.2	-	30	5015	c.4671T>C	c.(4669-4671)ccT>ccC	p.P1557P		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1557	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		ATATCAAAACAGGTTTGGCTG	0.378																																						ENST00000369162.2	0.440000	1.500000e-01	0.360000	0.210000	0.280000	0.293176	0.280000	0.280000																										0				92						c.(4669-4671)ccT>ccC		activating signal cointegrator 1 complex subunit 3							84.0	84.0	84.0					6																	101073182		2203	4300	6503	SO:0001819	synonymous_variant	10973	0	0					g.chr6:101073182A>G	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4671T>C	chr6.hg19:g.101073182A>G		0						p.P1557P	NM_006828.2	NP_006819.2	0	0	0	1.929623	Q8N3C0	ASCC3_HUMAN		30	5015	-		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Silent	SNP	ENST00000369162.2	1	1	hg19	c.4671T>C	CCDS5046.1	0																																																																																								0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.378	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	0	0	1	2	2	2	2	0	0	0	0	51	51	51	50	1	2.180000	-14.517800	1	0.270000	NM_006828		0	14	14	0	355	352	0		1	0		0	0	51	0	0	9.997531e-01	7.293107e-02	0	1	0	10	0	14	355
F13A1	2162	broad.mit.edu	37	6	6318801	6318801	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:6318801G>A	ENST00000264870.3	-	2	362	c.97C>T	c.(97-99)Cag>Tag	p.Q33*		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	33					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	ACCACGCCCTGAAGCTCCACT	0.602																																						ENST00000264870.3	0.150000	2.000000e-02	0.110000	0.040000	0.070000	0.085365	0.070000	0.080000																										0				62						c.(97-99)Cag>Tag		coagulation factor XIII, A1 polypeptide	L-Glutamine(DB00130)						141.0	124.0	129.0					6																	6318801		2203	4300	6503	SO:0001587	stop_gained	2162	0	0					g.chr6:6318801G>A	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.97C>T	chr6.hg19:g.6318801G>A	ENSP00000264870:p.Gln33*	0						p.Q33*	NM_000129.3	NP_000120.2	0	0	0	1.929623	P00488	F13A_HUMAN		2	362	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Nonsense_Mutation	SNP	ENST00000264870.3	0	1	hg19	c.97C>T	CCDS4496.1	0	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708509	0.30322	.	.	ENSG00000124491	ENST00000264870;ENST00000441301;ENST00000414279;ENST00000431222	.	.	.	4.64	2.72	0.32119	4.64	2.72	0.32119	.	0.685255	0.14021	N	0.346817	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	6.3836	0.21548	0.1029:0.3924:0.5047:0.0	.	.	.	.	X	33;33;33;71	.	ENSP00000264870:Q33X	Q	-	1	0	0	F13A1	6263800	6263800	0.009000	0.17119	0.141000	0.22245	0.004000	0.04260	1.095000	0.30964	1.130000	0.42092	0.643000	0.83706	CAG	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.602	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	0	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	2.180000	-2.773046	1	0.270000	NM_000129		0	7	7	0	673	664	0		1	0		0	0	84	0	0	9.797276e-01	8.793137e-02	0	0	0	41	0	7	673
DSP	1832	broad.mit.edu	37	6	7580347	7580347	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:7580347G>A	ENST00000379802.3	+	23	4265	c.3924G>A	c.(3922-3924)cgG>cgA	p.R1308R	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1308	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ACAATGCCCGGCACAAGCAGT	0.532																																						ENST00000379802.3	0.140000	2.000000e-02	0.110000	0.040000	0.060000	0.076538	0.060000	0.060000																										0				101						c.(3922-3924)cgG>cgA		desmoplakin							80.0	83.0	82.0					6																	7580347		2202	4300	6502	SO:0001819	synonymous_variant	1832	0	0					g.chr6:7580347G>A	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3924G>A	chr6.hg19:g.7580347G>A		0					DSP_ENST00000418664.2_Intron	p.R1308R	NM_004415.2	NP_004406.2	0	0	0	1.929623	P15924	DESP_HUMAN		23	4265	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	0	1	hg19	c.3924G>A	CCDS4501.1	0																																																																																								0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.532	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	0	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	2.180000	-2.239055	0	0.270000	NM_004415		0	5	5	0	563	556	0		1	0		0	0	106	0	0	9.357355e-01	5.703726e-02	0	0	0	35	0	5	563
GMPR	2766	broad.mit.edu	37	6	16279069	16279069	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:16279069C>T	ENST00000259727.4	+	6	716	c.602C>T	c.(601-603)gCc>gTc	p.A201V		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	201					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				CAGCTGAGTGCCGTCATTGAG	0.592																																						ENST00000259727.4	0.190000	3.000000e-02	0.140000	0.050000	0.090000	0.101995	0.090000	0.090000																										0				20						c.(601-603)gCc>gTc		guanosine monophosphate reductase							91.0	81.0	85.0					6																	16279069		2203	4300	6503	SO:0001583	missense	2766	0	0					g.chr6:16279069C>T		CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.602C>T	chr6.hg19:g.16279069C>T	ENSP00000259727:p.Ala201Val	0						p.A201V	NM_006877.3	NP_006868.3	0	0	0	1.929623	P36959	GMPR1_HUMAN		6	716	+	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Q96HQ6	Missense_Mutation	SNP	ENST00000259727.4	0	1	hg19	c.602C>T	CCDS4537.1	0	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883826	0.72410	.	.	ENSG00000137198	ENST00000259727	D	0.90385	-2.66	4.85	4.85	0.62838	4.85	4.85	0.62838	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.97554	0.9199	H	0.99815	4.805	0.80722	D	1	D	0.69078	0.997	D	0.64877	0.93	D	0.99605	1.0979	10	0.87932	D	0	-8.3541	16.7414	0.85460	0.0:1.0:0.0:0.0	.	201	P36959	GMPR1_HUMAN	V	201	ENSP00000259727:A201V	ENSP00000259727:A201V	A	+	2	0	0	GMPR	16387048	16387048	1.000000	0.71417	0.792000	0.32020	0.153000	0.21895	7.327000	0.79147	2.237000	0.73441	0.462000	0.41574	GCC	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.592	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039942.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	2.180000	-2.872093	1	0.270000			0	5	5	0	420	411	0		1	0		0	0	70	0	0	9.343130e-01	5.223545e-02	0	0	0	25	0	5	420
GNL1	2794	broad.mit.edu	37	6	30514571	30514571	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:30514571C>T	ENST00000376621.3	-	11	2454	c.1484G>A	c.(1483-1485)cGg>cAg	p.R495Q		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	495					cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CACATCATTCCGAGCCGCCTT	0.522																																						ENST00000376621.3	0.210000	4.000000e-02	0.160000	0.070000	0.100000	0.119090	0.100000	0.110000																										0				25						c.(1483-1485)cGg>cAg		guanine nucleotide binding protein-like 1							97.0	97.0	97.0					6																	30514571		1510	2709	4219	SO:0001583	missense	2794	0	0					g.chr6:30514571C>T		CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1484G>A	chr6.hg19:g.30514571C>T	ENSP00000365806:p.Arg495Gln	0						p.R495Q	NM_005275.3	NP_005266.2	0	0	0	1.929623	P36915	GNL1_HUMAN		11	2454	-			B0S838|Q96CT5	Missense_Mutation	SNP	ENST00000376621.3	0	1	hg19	c.1484G>A	CCDS4680.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.554718	0.96514	.	.	ENSG00000204590	ENST00000376621;ENST00000426875;ENST00000429126	T	0.49720	0.77	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.119786	0.56097	D	0.000022	T	0.45458	0.1343	L	0.37630	1.12	0.58432	D	0.999999	P;D;B	0.89917	0.889;1.0;0.052	P;D;B	0.74674	0.617;0.984;0.007	T	0.24512	-1.0158	10	0.09338	T	0.73	-40.1993	18.0176	0.89246	0.0:1.0:0.0:0.0	.	493;292;495	B4DYK6;B4DWZ0;P36915	.;.;GNL1_HUMAN	Q	495;317;292	ENSP00000365806:R495Q	ENSP00000365806:R495Q	R	-	2	0	0	GNL1	30622550	30622550	1.000000	0.71417	0.233000	0.24025	0.996000	0.88848	6.691000	0.74573	2.560000	0.86352	0.561000	0.74099	CGG	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.522	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2	0	0	1	2	2	2	2	0	0	0	0	63	63	63	59	1	2.180000	-2.712494	1	0.270000			0	7	7	0	479	469	0		1	1		0	0	63	0	0	9.792697e-01	8.073134e-01	0	3	0	207	0	7	479
ANKS1A	23294	broad.mit.edu	37	6	34985688	34985688	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:34985688G>A	ENST00000360359.3	+	11	2000	c.1862G>A	c.(1861-1863)cGc>cAc	p.R621H	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	621					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AAACTCAGCCGCAGCTTGTCC	0.597																																						ENST00000360359.3	0.120000	2.000000e-02	0.090000	0.040000	0.060000	0.070343	0.060000	0.060000																										0				31						c.(1861-1863)cGc>cAc		ankyrin repeat and sterile alpha motif domain containing 1A							129.0	146.0	140.0					6																	34985688		2203	4300	6503	SO:0001583	missense	23294	0	0					g.chr6:34985688G>A	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1862G>A	chr6.hg19:g.34985688G>A	ENSP00000353518:p.Arg621His	0					ANKS1A_ENST00000535627.1_Intron	p.R621H	NM_015245.2	NP_056060.2	0	0	0	1.929623	Q92625	ANS1A_HUMAN		11	2000	+			A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	0	1	hg19	c.1862G>A	CCDS4798.1	0	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388694	0.82902	.	.	ENSG00000064999	ENST00000360359	T	0.46819	0.86	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.000000	0.50627	D	0.000117	T	0.61640	0.2363	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.63314	-0.6665	10	0.72032	D	0.01	-18.3484	19.5669	0.95397	0.0:0.0:1.0:0.0	.	621	Q92625	ANS1A_HUMAN	H	621	ENSP00000353518:R621H	ENSP00000353518:R621H	R	+	2	0	0	ANKS1A	35093666	35093666	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.374000	0.97172	2.694000	0.91930	0.655000	0.94253	CGC	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.597	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	0	0	1	2	21	2	2	0	0	0	1	160	160	160	159	1	2.180000	-1.899855	0	0.270000	XM_166478		0	9	8	0	1025	1017	0		0	0		0	0	160	0	0	1.935047e-02	7.340053e-03	0	0	0	13	0	9	1025
RRAGD	58528	broad.mit.edu	37	6	90087442	90087442	+	Missense_Mutation	SNP	C	C	G			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:90087442C>G	ENST00000369415.4	-	5	1126	c.850G>C	c.(850-852)Gag>Cag	p.E284Q	RRAGD_ENST00000359203.3_Missense_Mutation_p.E133Q|RRAGD_ENST00000492783.1_5'UTR	NM_021244.4	NP_067067.1			Ras-related GTP binding D											breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		CAGCAGAGCTCATAGGTTTGC	0.353																																						ENST00000369415.4	1.000000	8.600000e-01	1.000000	0.970000	0.990000	0.986938	0.990000	1.000000																										0				15						c.(850-852)Gag>Cag		Ras-related GTP binding D							140.0	134.0	136.0					6																	90087442		2203	4300	6503	SO:0001583	missense	58528	0	0					g.chr6:90087442C>G	AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.850G>C	chr6.hg19:g.90087442C>G	ENSP00000358423:p.Glu284Gln	0					RRAGD_ENST00000492783.1_5'UTR|RRAGD_ENST00000359203.3_Missense_Mutation_p.E133Q	p.E284Q	NM_021244.4	NP_067067.1	0	0	0	1.929623				5	1126	-		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		Missense_Mutation	SNP	ENST00000369415.4	1	1	hg19	c.850G>C	CCDS5022.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.070456	0.93950	.	.	ENSG00000025039	ENST00000369415;ENST00000359203	.	.	.	5.43	5.43	0.79202	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86571	0.1847	9	0.66056	D	0.02	-13.7325	19.2342	0.93851	0.0:1.0:0.0:0.0	.	284	Q9NQL2	RRAGD_HUMAN	Q	284;133	.	ENSP00000352131:E133Q	E	-	1	0	0	RRAGD	90144161	90144161	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.771000	0.85420	2.553000	0.86117	0.462000	0.41574	GAG	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.353	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041484.1	1	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	2.180000	-3.224601	1	0.270000	NM_021244		0	62	61	0	348	346	1		1	0		0	0	70	0	0	1	9.564632e-01	0	1	0	29	0	62	348
STXBP5	134957	broad.mit.edu	37	6	147680320	147680320	+	Silent	SNP	G	G	A	rs142207202		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr6:147680320G>A	ENST00000321680.6	+	23	2406	c.2406G>A	c.(2404-2406)acG>acA	p.T802T	STXBP5_ENST00000367481.3_Silent_p.T766T|STXBP5_ENST00000367480.3_Silent_p.T749T|STXBP5_ENST00000179882.6_Silent_p.T457T	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	802					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TCTGTGAAACGTTTACTCGAA	0.488																																						ENST00000321680.6	0.990000	5.500000e-01	0.880000	0.640000	0.750000	0.768818	0.750000	0.760000																										0				42						c.(2404-2406)acG>acA		syntaxin binding protein 5 (tomosyn)		A	,	1,4405	826.1+/-416.6	0,1,2202	113.0	107.0	109.0		2406,2298	-8.6	0.0	6	dbSNP_134	109	3,8597	819.1+/-406.8	0,3,4297	yes	coding-synonymous,coding-synonymous	STXBP5	NM_001127715.2,NM_139244.4	,	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	,	802/1152,766/1116	147680320	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	134957	17	121406	46				g.chr6:147680320G>A	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2406G>A	chr6.hg19:g.147680320G>A		0					STXBP5_ENST00000367481.3_Silent_p.T766T|STXBP5_ENST00000179882.6_Silent_p.T457T|STXBP5_ENST00000367480.3_Silent_p.T749T	p.T802T	NM_001127715.2	NP_001121187.1	0	0	0	1.929623	Q5T5C0	STXB5_HUMAN		23	2406	+		Ovarian(120;0.0164)	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	ENST00000321680.6	1	1	hg19	c.2406G>A	CCDS47499.1	0	.	.	.	.	.	.	.	.	.	.	A	0.141	-1.102263	0.01828	2.27E-4	3.49E-4	ENSG00000164506	ENST00000367475	.	.	.	5.46	-8.64	0.00874	5.46	-8.64	0.00874	.	.	.	.	.	T	0.17959	0.0431	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38457	-0.9660	4	.	.	.	.	3.0411	0.06139	0.2097:0.1742:0.4436:0.1725	.	.	.	.	I	128	.	.	V	+	1	0	0	STXBP5	147722013	147722013	0.026000	0.19158	0.003000	0.11579	0.052000	0.14988	-0.885000	0.04161	-2.023000	0.00937	-2.952000	0.00084	GTT	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.488	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	2.180000	-9.575886	1	0.270000			0	38	38	0	327	323	1		1	0		0	0	47	0	0	1	4.446599e-01	0	1	0	13	0	38	327
EPHB4	2050	broad.mit.edu	37	7	100402884	100402884	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:100402884C>T	ENST00000358173.3	-	16	3206	c.2738G>A	c.(2737-2739)gGc>gAc	p.G913D	EPHB4_ENST00000360620.3_Intron	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	913	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					AAGCCACTCGCCCACAGAGCC	0.587																																					GBM(200;2113 3072 25865 52728)	ENST00000358173.3	1.000000	9.700000e-01	1.000000	0.990000	0.990000	0.997630	0.990000	1.000000																										0				47						c.(2737-2739)gGc>gAc		EPH receptor B4							33.0	32.0	33.0					7																	100402884		2203	4300	6503	SO:0001583	missense	2050	0	0					g.chr7:100402884C>T	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2738G>A	chr7.hg19:g.100402884C>T	ENSP00000350896:p.Gly913Asp	1					EPHB4_ENST00000360620.3_Intron	p.G913D	NM_004444.4	NP_004435.3	1	2	3	2.250672	P54760	EPHB4_HUMAN		16	3206	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	1	1	hg19	c.2738G>A	CCDS5706.1	1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549037	0.65311	.	.	ENSG00000196411	ENST00000358173	T	0.51325	0.71	5.07	5.07	0.68467	5.07	5.07	0.68467	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.51477	D	0.000085	T	0.53334	0.1790	L	0.33624	1.015	0.47374	D	0.999405	D	0.61080	0.989	P	0.59357	0.856	T	0.48328	-0.9045	10	0.32370	T	0.25	.	15.9362	0.79712	0.0:1.0:0.0:0.0	.	913	P54760	EPHB4_HUMAN	D	913	ENSP00000350896:G913D	ENSP00000350896:G913D	G	-	2	0	0	EPHB4	100240820	100240820	0.999000	0.42202	0.987000	0.45799	0.985000	0.73830	4.063000	0.57499	2.372000	0.80975	0.561000	0.74099	GGC	0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.587	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	21	1	2.180000	-20.000000	1	0.270000	NM_004444		0	26	26	0	128	128	1		1	1		0	0	24	0	0	1	9.999995e-01	0	30	0	95	0	26	128
SERPINE1	5054	broad.mit.edu	37	7	100780300	100780300	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:100780300G>A	ENST00000223095.4	+	8	1263	c.1106G>A	c.(1105-1107)cGc>cAc	p.R369H	SERPINE1_ENST00000445463.2_Missense_Mutation_p.R354H	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	369		Reactive bond.			angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	GTCTCAGCCCGCATGGCCCCC	0.582																																						ENST00000223095.4	0.150000	1.000000e-02	0.110000	0.040000	0.070000	0.079932	0.070000	0.060000																										0				20						c.(1105-1107)cGc>cAc		serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)						131.0	111.0	118.0					7																	100780300		2203	4300	6503	SO:0001583	missense	5054	2	121412	36				g.chr7:100780300G>A	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.1106G>A	chr7.hg19:g.100780300G>A	ENSP00000223095:p.Arg369His	1					SERPINE1_ENST00000445463.2_Missense_Mutation_p.R354H	p.R369H	NM_000602.4	NP_000593.1	1	2	3	2.250672	P05121	PAI1_HUMAN		8	1263	+	Lung NSC(181;0.136)|all_lung(186;0.182)		B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	0	1	hg19	c.1106G>A	CCDS5711.1	0	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432084	0.62844	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000536888	T;T	0.24350	1.86;1.86	5.67	5.67	0.87782	5.67	5.67	0.87782	Serpin domain (3);	0.000000	0.85682	D	0.000000	T	0.55114	0.1900	M	0.85945	2.785	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.70016	0.945;0.967	T	0.60505	-0.7250	10	0.72032	D	0.01	.	15.2607	0.73621	0.0:0.0:1.0:0.0	.	354;369	F8WD53;P05121	.;PAI1_HUMAN	H	369;354;146	ENSP00000223095:R369H;ENSP00000396766:R354H	ENSP00000223095:R369H	R	+	2	0	0	SERPINE1	100567020	100567020	1.000000	0.71417	0.998000	0.56505	0.024000	0.10985	7.941000	0.87700	2.664000	0.90586	0.555000	0.69702	CGC	0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.582	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	74	1	2.180000	-1.789342	0	0.270000	NM_000602		0	5	5	0	621	620	0		1	0		0	0	76	0	0	9.375008e-01	8.855814e-01	0	0	0	486	0	5	621
RNF133	168433	broad.mit.edu	37	7	122338189	122338189	+	Missense_Mutation	SNP	G	G	A	rs137950690		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:122338189G>A	ENST00000340112.2	-	1	1021	c.784C>T	c.(784-786)Cgc>Tgc	p.R262C	CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	262					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						GGCTTATAGCGTTCAAAGCAA	0.403																																					Colon(198;1778 2057 7449 19869 45985)	ENST00000340112.2	0.180000	3.000000e-02	0.140000	0.060000	0.090000	0.103130	0.090000	0.090000																										0				21						c.(784-786)Cgc>Tgc		ring finger protein 133		G	,,,CYS/ARG	0,4406		0,0,2203	159.0	148.0	152.0		,,,784	2.6	0.3	7	dbSNP_134	152	2,8598	2.2+/-6.3	0,2,4298	no	intron,intron,intron,missense	CADPS2,RNF133	NM_001009571.3,NM_001167940.1,NM_017954.10,NM_139175.1	,,,180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,benign	,,,262/377	122338189	2,13004	2203	4300	6503	SO:0001583	missense	168433	4	121412	41				g.chr7:122338189G>A	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.784C>T	chr7.hg19:g.122338189G>A	ENSP00000344489:p.Arg262Cys	1					CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000412584.2_Intron	p.R262C	NM_139175.1	NP_631914.1	1	2	3	2.250672	Q8WVZ7	RN133_HUMAN		1	1021	-			A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	0	1	hg19	c.784C>T	CCDS5784.1	0	.	.	.	.	.	.	.	.	.	.	G	0.871	-0.731875	0.03135	0.0	2.33E-4	ENSG00000188050	ENST00000340112	T	0.43294	0.95	5.53	2.62	0.31277	5.53	2.62	0.31277	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.713262	0.12945	U	0.426283	T	0.26011	0.0634	N	0.21282	0.65	0.09310	N	0.999999	B	0.23891	0.093	B	0.20767	0.031	T	0.20306	-1.0279	10	0.62326	D	0.03	.	4.5179	0.11945	0.091:0.4253:0.36:0.1236	.	262	Q8WVZ7	RN133_HUMAN	C	262	ENSP00000344489:R262C	ENSP00000344489:R262C	R	-	1	0	0	RNF133	122125425	122125425	0.051000	0.20477	0.293000	0.24932	0.004000	0.04260	0.822000	0.27352	0.672000	0.31204	-0.424000	0.05967	CGC	0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.403	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	0	0	1	2	2	2	2	0	0	0	0	98	98	98	98	1	2.180000	-2.598465	1	0.270000	NM_139175		0	8	7	0	722	718	0		1			0	0	98	0	0	9.891059e-01	0	0	0	0	0	0	8	722
PSMA2	5683	broad.mit.edu	37	7	42957275	42957275	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:42957275C>T	ENST00000223321.4	-	8	667	c.603G>A	c.(601-603)ggG>ggA	p.G201G	PSMA2_ENST00000442788.1_Silent_p.G201G|PSMA2_ENST00000445517.1_Silent_p.G131G	NM_002787.4	NP_002778.1	P25787	PSA2_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 2	201					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)	10						CTGTCATTTGCCCTTCAAAGC	0.378																																						ENST00000223321.4	0.270000	4.000000e-02	0.200000	0.080000	0.130000	0.146290	0.130000	0.120000																										0				10						c.(601-603)ggG>ggA		proteasome (prosome, macropain) subunit, alpha type, 2							106.0	93.0	97.0					7																	42957275		2203	4300	6503	SO:0001819	synonymous_variant	5683	0	0					g.chr7:42957275C>T	D00760	CCDS5467.1	7p13	2005-10-11			ENSG00000106588	ENSG00000106588		"""Proteasome (prosome, macropain) subunits"""	9531	protein-coding gene	gene with protein product		176842				2025653, 1888762	Standard	NM_002787		Approved	MU, HC3, PMSA2	uc003thy.3	P25787	OTTHUMG00000023916	ENST00000223321.4:c.603G>A	chr7.hg19:g.42957275C>T		1					PSMA2_ENST00000442788.1_Silent_p.G201G|PSMA2_ENST00000445517.1_Silent_p.G131G	p.G201G	NM_002787.4	NP_002778.1	1	2	3	2.250672	P25787	PSA2_HUMAN		8	667	-			Q6ICS6|Q9BU45	Silent	SNP	ENST00000223321.4	0	1	hg19	c.603G>A	CCDS5467.1	0																																																																																								0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.378	PSMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250816.1	0	0	1	2	27	39	2	1	1	1	1	35	35	35	35	1	2.180000	-2.957537	1	0.270000	NM_002787		0	5	5	0	336	334	0		0	0		1	0	35	0	0	3.549933e-05	3.382081e-05	0	2	0	530	0	5	336
TYW1	55253	broad.mit.edu	37	7	66479413	66479413	+	Silent	SNP	T	T	C			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:66479413T>C	ENST00000359626.5	+	5	599	c.435T>C	c.(433-435)acT>acC	p.T145T		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	145	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.T145T(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				GCCTACCAACTGAAAGTGCAG	0.428																																						ENST00000359626.5	0.150000	1.000000e-02	0.110000	0.040000	0.070000	0.080527	0.070000	0.060000																										1	Substitution - coding silent(1)	p.T145T(1)	urinary_tract(1)	46						c.(433-435)acT>acC		tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)																																				SO:0001819	synonymous_variant	55253	80	121412	43				g.chr7:66479413T>C	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.435T>C	chr7.hg19:g.66479413T>C		1						p.T145T	NM_018264.2	NP_060734.2	1	2	3	2.250672	Q9NV66	TYW1_HUMAN		5	599	+		Lung NSC(55;0.0846)|all_lung(88;0.183)	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Silent	SNP	ENST00000359626.5	0	1	hg19	c.435T>C	CCDS5538.1	0																																																																																								0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.428	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	2.180000	-1.817161	0	0.270000	NM_018264		0	6	6	0	721	710	0		1	0		0	0	107	0	0	9.633777e-01	9.939520e-03	0	0	0	15	0	6	721
VPS37D	155382	broad.mit.edu	37	7	73085559	73085559	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:73085559C>T	ENST00000324941.4	+	4	743	c.609C>T	c.(607-609)gcC>gcT	p.A203A	VPS37D_ENST00000451519.1_Silent_p.A118A	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)											central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				CCACTGGGGCCGCCCGGGGGC	0.766																																						ENST00000324941.4	1.000000	1.800000e-01	0.800000	0.320000	0.520000	0.560420	0.520000	1.000000																										0				2						c.(607-609)gcC>gcT		vacuolar protein sorting 37 homolog D (S. cerevisiae)							4.0	5.0	5.0					7																	73085559		1415	3308	4723	SO:0001819	synonymous_variant	155382	0	0					g.chr7:73085559C>T	AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	ENST00000324941.4:c.609C>T	chr7.hg19:g.73085559C>T		1					VPS37D_ENST00000451519.1_Silent_p.A118A	p.A203A	NM_001077621.1	NP_001071089.1	1	2	3	2.250672				4	743	+		Lung NSC(55;0.0908)|all_lung(88;0.198)		Silent	SNP	ENST00000324941.4	0	1	hg19	c.609C>T	CCDS43596.1	0																																																																																								0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.766	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348064.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	2.180000	-8.478669	1	0.270000	NM_152560		0	4	4	0	66	66	0		1	0		0	0	12	0	0	8.923721e-01	1.604344e-02	0	0	0	3	0	4	66
TAS2R38	5726	broad.mit.edu	37	7	141673468	141673468	+	Missense_Mutation	SNP	G	G	A	rs377342463		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr7:141673468G>A	ENST00000547270.1	-	1	105	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	8					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GACACAGTGCGGATGCGAGTT	0.443																																						ENST00000547270.1	1.000000	6.600000e-01	0.970000	0.750000	0.850000	0.862080	0.850000	1.000000																										0				21						c.(22-24)Cgc>Tgc		taste receptor, type 2, member 38		G	CYS/ARG	0,4406		0,0,2203	114.0	112.0	113.0		22	-9.6	0.0	7		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	TAS2R38	NM_176817.4	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	8/334	141673468	1,13005	2203	4300	6503	SO:0001583	missense	5726	1	121400	34				g.chr7:141673468G>A	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.22C>T	chr7.hg19:g.141673468G>A	ENSP00000448219:p.Arg8Cys	1						p.R8C	NM_176817.4	NP_789787	1	2	3	2.250672	P59533	T2R38_HUMAN		1	105	-	Melanoma(164;0.0171)		A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	0	1	hg19	c.22C>T	CCDS34765.1	1	.	.	.	.	.	.	.	.	.	.	G	3.866	-0.028883	0.07589	0.0	1.16E-4	ENSG00000257138	ENST00000547270	T	0.00816	5.66	5.1	-9.6	0.00553	5.1	-9.6	0.00553	.	4.375660	0.01228	N	0.008298	T	0.00412	0.0013	N	0.03608	-0.345	0.09310	N	1	B	0.22276	0.067	B	0.04013	0.001	T	0.51220	-0.8733	10	0.15066	T	0.55	.	1.5776	0.02627	0.1848:0.4484:0.1652:0.2016	.	8	P59533	T2R38_HUMAN	C	8	ENSP00000448219:R8C	ENSP00000331291:R8C	R	-	1	0	0	TAS2R38	141319937	141319937	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.787000	0.04618	-1.782000	0.01275	-0.294000	0.09567	CGC	0.356828		TCGA-RB-A7B8-01A-12D-A33T-08	0.443	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	1	0	1	2	24	2	2	1	1	1	1	74	74	74	73	1	2.180000	-2.376785	0	0.270000	NM_176817		0	59	59	0	518	515	1		1			1	0	74	0	0	9.999819e-01	0	0	0	0	0	0	59	518
TRHR	7201	broad.mit.edu	37	8	110099973	110099973	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr8:110099973G>A	ENST00000518632.1	+	2	583	c.232G>A	c.(232-234)Gca>Aca	p.A78T	TRHR_ENST00000311762.2_Missense_Mutation_p.A78T			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	78					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CTTGGTGGCCGCAGGCCTCCC	0.512																																						ENST00000518632.1	0.170000	2.000000e-02	0.120000	0.040000	0.070000	0.090072	0.070000	0.080000																										0				37						c.(232-234)Gca>Aca		thyrotropin-releasing hormone receptor							138.0	127.0	131.0					8																	110099973		2203	4300	6503	SO:0001583	missense	7201	1	121412	32				g.chr8:110099973G>A		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.232G>A	chr8.hg19:g.110099973G>A	ENSP00000430711:p.Ala78Thr	0					TRHR_ENST00000311762.2_Missense_Mutation_p.A78T	p.A78T			0	0	0	1.943555	P34981	TRFR_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)	2	583	+			Q2M339	Missense_Mutation	SNP	ENST00000518632.1	0	1	hg19	c.232G>A	CCDS6311.1	0	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571768	0.86542	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	T;T	0.71698	-0.59;-0.59	5.85	5.85	0.93711	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.78974	-0.1992	10	0.23302	T	0.38	-37.8444	19.1516	0.93491	0.0:0.0:1.0:0.0	.	78	P34981	TRFR_HUMAN	T	78	ENSP00000430711:A78T;ENSP00000309818:A78T	ENSP00000309818:A78T	A	+	1	0	0	TRHR	110169149	110169149	1.000000	0.71417	0.809000	0.32408	0.898000	0.52572	9.860000	0.99555	2.773000	0.95371	0.655000	0.94253	GCA	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.512	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1	0	0	1	2	2	2	2	0	0	0	0	78	78	78	76	1	2.180000	-2.216887	0	0.270000			0	5	5	0	481	477	0		1			0	0	78	0	0	9.364760e-01	0	0	0	0	0	0	5	481
EPHX2	2053	broad.mit.edu	37	8	27373915	27373915	+	Splice_Site	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr8:27373915G>A	ENST00000521400.1	+	8	1340	c.910G>A	c.(910-912)Gaa>Aaa	p.E304K	EPHX2_ENST00000521780.1_Splice_Site_p.E238K|EPHX2_ENST00000518379.1_Splice_Site_p.E272K|EPHX2_ENST00000380476.3_Splice_Site_p.E251K|EPHX2_ENST00000517536.1_Splice_Site_p.E121K	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	304	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		TGCTCCTCCCGGTGGGTGTGC	0.567											OREG0018668	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000521400.1	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.064345	0.050000	0.060000																										0				27						c.(910-912)Gaa>Aaa		epoxide hydrolase 2, cytoplasmic							290.0	250.0	264.0					8																	27373915		2203	4300	6503	SO:0001630	splice_region_variant	2053	9	121412	45				g.chr8:27373915G>A	L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.910+1G>A	chr8.hg19:g.27373915G>A		0		OREG0018668	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	793	EPHX2_ENST00000521780.1_Splice_Site_p.E238K|EPHX2_ENST00000517536.1_Splice_Site_p.E121K|EPHX2_ENST00000518379.1_Splice_Site_p.E272K|EPHX2_ENST00000380476.3_Splice_Site_p.E251K	p.E304K	NM_001979.5	NP_001970.2	0	0	0	1.939885	P34913	HYES_HUMAN		8	1340	+		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Splice_Site	SNP	ENST00000521400.1	0	1	hg19	c.910G>A	CCDS6060.1	0	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299688	0.40694	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	5.67	5.67	0.87782	5.67	5.67	0.87782	Alpha/beta hydrolase fold-1 (1);	0.288097	0.42821	D	0.000645	T	0.65749	0.2721	M	0.80183	2.485	0.80722	D	1	B;B;B	0.25521	0.026;0.109;0.128	B;B;B	0.20955	0.031;0.028;0.032	T	0.63761	-0.6564	10	0.39692	T	0.17	-5.1595	17.2762	0.87116	0.0:0.0:1.0:0.0	.	272;304;304	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	K	304;121;238;251;308;272	ENSP00000430269:E304K;ENSP00000428875:E121K;ENSP00000430302:E238K;ENSP00000369843:E251K;ENSP00000427956:E272K	ENSP00000369843:E251K	E	+	1	0	0	EPHX2	27429832	27429832	1.000000	0.71417	0.736000	0.30914	0.054000	0.15201	5.558000	0.67319	2.677000	0.91161	0.561000	0.74099	GAA	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.567	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219954.4	0	0	1	2	30	2	2	1	1	1	2	121	121	121	120	1	2.180000	-1.726731	0	0.270000		Missense_Mutation	0	6	9	0	791	786	0		0	0		1	0	121	0	0	2.772110e-05	9.474816e-03	0	0	0	16	0	6	791
RGS20	8601	broad.mit.edu	37	8	54791937	54791937	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr8:54791937C>T	ENST00000297313.3	+	2	377	c.285C>T	c.(283-285)ccC>ccT	p.P95P	RGS20_ENST00000522225.1_5'Flank|RP11-1070A24.2_ENST00000606037.1_RNA|RGS20_ENST00000276500.4_5'Flank|RGS20_ENST00000344277.6_Intron	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	95					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			GACCCCCTCCCGAGGCTCCCC	0.726																																						ENST00000297313.3	0.180000	4.000000e-02	0.140000	0.060000	0.090000	0.106641	0.090000	0.100000																										0				21						c.(283-285)ccC>ccT		regulator of G-protein signaling 20							37.0	48.0	44.0					8																	54791937		2203	4296	6499	SO:0001819	synonymous_variant	8601	0	0					g.chr8:54791937C>T	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.285C>T	chr8.hg19:g.54791937C>T		0					RGS20_ENST00000522225.1_5'Flank|RGS20_ENST00000344277.6_Intron|RGS20_ENST00000276500.4_5'Flank|RP11-1070A24.2_ENST00000606037.1_RNA	p.P95P	NM_170587.2	NP_733466.1	0	0	0	1.939885	O76081	RGS20_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)	2	377	+			Q96BG9	Silent	SNP	ENST00000297313.3	0	1	hg19	c.285C>T	CCDS6155.1	0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.726	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1	0	0	1	2	2	2	2	0	0	0	0	93	93	93	92	1	2.180000	-2.805586	1	0.270000			0	8	8	0	609	599	0		1			0	0	93	0	0	9.887066e-01	0	0	0	0	0	0	8	609
DNAJC5B	85479	broad.mit.edu	37	8	66988979	66988979	+	Silent	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr8:66988979C>T	ENST00000276570.5	+	4	491	c.204C>T	c.(202-204)caC>caT	p.H68H	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	68	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					membrane (GO:0016020)		p.H68H(1)		endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			ACAACGCCCACGCAATACTTA	0.428																																						ENST00000276570.5	0.140000	2.000000e-02	0.110000	0.040000	0.070000	0.081553	0.070000	0.080000																										1	Substitution - coding silent(1)	p.H68H(1)	large_intestine(1)	20						c.(202-204)caC>caT		DnaJ (Hsp40) homolog, subfamily C, member 5 beta							169.0	151.0	157.0					8																	66988979		2203	4300	6503	SO:0001819	synonymous_variant	85479	0	0					g.chr8:66988979C>T	AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.204C>T	chr8.hg19:g.66988979C>T		0					DNAJC5B_ENST00000519330.1_3'UTR	p.H68H	NM_033105.4	NP_149096.2	0	0	0	1.939885	Q9UF47	DNJ5B_HUMAN	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)	4	491	+		Lung NSC(129;0.114)|all_lung(136;0.188)	Q969Y8	Silent	SNP	ENST00000276570.5	0	1	hg19	c.204C>T	CCDS6183.1	0																																																																																								0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.428	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378915.1	0	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	2.180000	-2.917093	1	0.270000	NM_033105		0	7	7	0	711	708	0		1	0		0	0	93	0	0	9.803707e-01	1.386963e-04	0	0	0	2	0	7	711
WWP1	11059	broad.mit.edu	37	8	87423766	87423766	+	Splice_Site	SNP	G	G	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr8:87423766G>T	ENST00000517970.1	+	9	1031		c.e9-1		WWP1_ENST00000341922.2_Splice_Site|WWP1_ENST00000349423.2_Splice_Site|WWP1_ENST00000265428.4_Splice_Site	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1						central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						TCCCTTCTCAGTTAATGGAGA	0.368																																						ENST00000517970.1	0.300000	7.000000e-02	0.230000	0.110000	0.160000	0.176919	0.160000	0.160000																										0				31						c.e9-1		WW domain containing E3 ubiquitin protein ligase 1							84.0	82.0	82.0					8																	87423766		2203	4300	6503	SO:0001630	splice_region_variant	11059	0	0					g.chr8:87423766G>T	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.725-1G>T	chr8.hg19:g.87423766G>T		0					WWP1_ENST00000265428.4_Splice_Site|WWP1_ENST00000349423.2_Splice_Site|WWP1_ENST00000341922.2_Splice_Site		NM_007013.3	NP_008944.1	0	0	0	1.939885	Q9H0M0	WWP1_HUMAN		9	1031	+			O00307|Q5YLC1|Q96BP4	Splice_Site	SNP	ENST00000517970.1	0	1	hg19		CCDS6242.1	0	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930378	0.52866	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	.	.	.	5.31	5.31	0.75309	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1564	0.86792	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	WWP1	87492882	87492882	1.000000	0.71417	0.992000	0.48379	0.603000	0.37013	4.394000	0.59671	2.492000	0.84095	0.650000	0.86243	.	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.368	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	0	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	2.180000	-8.050176	1	0.270000	NM_007013	Intron	0	8	7	0	362	357	0		1			0	0	51	0	0	9.888312e-01	0	0	0	0	0	0	8	362
HAS2	3037	broad.mit.edu	37	8	122626809	122626809	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr8:122626809C>T	ENST00000303924.4	-	4	1736	c.1199G>A	c.(1198-1200)cGg>cAg	p.R400Q		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	400					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AATTTTACCCCGGTAGAAGAG	0.413																																						ENST00000303924.4	1.000000	9.800000e-01	1.000000	0.990000	0.990000	0.999050	0.990000	1.000000																									HAS2/PLAG1(10)	0				38						c.(1198-1200)cGg>cAg		hyaluronan synthase 2							123.0	119.0	120.0					8																	122626809		2203	4300	6503	SO:0001583	missense	3037	0	0					g.chr8:122626809C>T	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1199G>A	chr8.hg19:g.122626809C>T	ENSP00000306991:p.Arg400Gln	0						p.R400Q	NM_005328.2	NP_005319.1	0	0	0	1.943555	Q92819	HYAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)	4	1736	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	1	1	hg19	c.1199G>A	CCDS6335.1	1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837061	0.32421	.	.	ENSG00000170961	ENST00000303924	T	0.59083	0.29	6.04	6.04	0.98038	6.04	6.04	0.98038	.	0.096875	0.64402	N	0.000001	T	0.48114	0.1482	L	0.37630	1.12	0.50171	D	0.999857	B	0.19583	0.037	B	0.19666	0.026	T	0.48186	-0.9057	10	0.02654	T	1	-10.3761	20.5792	0.99380	0.0:1.0:0.0:0.0	.	400	Q92819	HAS2_HUMAN	Q	400	ENSP00000306991:R400Q	ENSP00000306991:R400Q	R	-	2	0	0	HAS2	122695990	122695990	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.848000	0.55903	2.873000	0.98535	0.561000	0.74099	CGG	0.266037		TCGA-RB-A7B8-01A-12D-A33T-08	0.413	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	1	0	1	2	2	2	2	0	0	0	0	147	147	147	146	1	2.180000	-2.416326	0	0.270000	NM_005328		0	130	129	0	688	682	1		1	0		0	0	147	0	0	1	5.416174e-01	0	0	0	11	0	130	688
MELK	9833	broad.mit.edu	37	9	36665452	36665452	+	Missense_Mutation	SNP	A	A	G			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr9:36665452A>G	ENST00000298048.2	+	14	1466	c.1282A>G	c.(1282-1284)Act>Gct	p.T428A	MELK_ENST00000545008.1_Missense_Mutation_p.T357A|MELK_ENST00000536987.1_Missense_Mutation_p.T297A|MELK_ENST00000543751.1_Missense_Mutation_p.T396A|MELK_ENST00000541717.1_Missense_Mutation_p.T387A|MELK_ENST00000536860.1_Missense_Mutation_p.T380A|MELK_ENST00000538311.1_Missense_Mutation_p.T234A|MELK_ENST00000536329.1_Missense_Mutation_p.T357A	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	428	Autoinhibitory region.			T -> A (in Ref. 3; BAH11482). {ECO:0000305}.	apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			AAATGTATATACTCCTAAGTC	0.368																																					Ovarian(82;980 1317 7225 14391 18624)	ENST00000298048.2	1.000000	9.800000e-01	1.000000	0.990000	0.990000	0.998608	0.990000	1.000000																										0				29						c.(1282-1284)Act>Gct		maternal embryonic leucine zipper kinase							82.0	84.0	83.0					9																	36665452		2203	4299	6502	SO:0001583	missense	9833	0	0					g.chr9:36665452A>G	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1282A>G	chr9.hg19:g.36665452A>G	ENSP00000298048:p.Thr428Ala	0					MELK_ENST00000541717.1_Missense_Mutation_p.T387A|MELK_ENST00000543751.1_Missense_Mutation_p.T396A|MELK_ENST00000536329.1_Missense_Mutation_p.T357A|MELK_ENST00000545008.1_Missense_Mutation_p.T357A|MELK_ENST00000538311.1_Missense_Mutation_p.T234A|MELK_ENST00000536987.1_Missense_Mutation_p.T297A|MELK_ENST00000536860.1_Missense_Mutation_p.T380A	p.T428A	NM_014791.3	NP_055606.1	0	0	0	1.933291	Q14680	MELK_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	14	1466	+		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	1	1	hg19	c.1282A>G	CCDS6606.1	1	.	.	.	.	.	.	.	.	.	.	A	11.72	1.722290	0.30503	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.71222	-0.37;0.61;0.41;0.94;0.32;-0.55;-0.37;-0.37	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.373797	0.33110	N	0.005277	T	0.64305	0.2586	L	0.54323	1.7	0.30079	N	0.809352	B;B;B;B;B;B;B	0.22276	0.001;0.015;0.002;0.001;0.014;0.067;0.001	B;B;B;B;B;B;B	0.20767	0.002;0.007;0.011;0.006;0.021;0.031;0.002	T	0.58470	-0.7631	10	0.15499	T	0.54	-1.347	13.825	0.63346	1.0:0.0:0.0:0.0	.	348;357;380;387;357;396;428	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	A	428;234;297;357;380;357;387;396	ENSP00000298048:T428A;ENSP00000438226:T234A;ENSP00000439184:T297A;ENSP00000445452:T357A;ENSP00000439792:T380A;ENSP00000443550:T357A;ENSP00000437804:T387A;ENSP00000441596:T396A	ENSP00000298048:T428A	T	+	1	0	0	MELK	36655452	36655452	0.976000	0.34144	0.997000	0.53966	0.749000	0.42624	3.706000	0.54830	2.146000	0.66826	0.528000	0.53228	ACT	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.368	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	2.180000	-20.000000	1	0.270000	NM_014791		0	68	67	0	332	332	1		1	1		0	0	65	0	0	1	6.323303e-01	0	5	0	7	0	68	332
ANXA1	301	broad.mit.edu	37	9	75775738	75775738	+	Missense_Mutation	SNP	A	A	T	rs111698970		TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr9:75775738A>T	ENST00000376911.1	+	5	1286	c.404A>T	c.(403-405)gAt>gTt	p.D135V	ANXA1_ENST00000257497.6_Missense_Mutation_p.D135V			P04083	ANXA1_HUMAN	annexin A1	135					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	ACTGATGAAGATACTCTAATT	0.358																																						ENST00000376911.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999981	0.990000	1.000000																										0				8						c.(403-405)gAt>gTt		annexin A1	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)						155.0	164.0	161.0					9																	75775738		2203	4299	6502	SO:0001583	missense	301	0	0					g.chr9:75775738A>T	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.404A>T	chr9.hg19:g.75775738A>T	ENSP00000366109:p.Asp135Val	0					ANXA1_ENST00000257497.6_Missense_Mutation_p.D135V	p.D135V			0	0	0	1.929503	P04083	ANXA1_HUMAN		5	1286	+		all_epithelial(88;2.54e-11)		Missense_Mutation	SNP	ENST00000376911.1	1	1	hg19	c.404A>T	CCDS6645.1	1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.544955	0.86022	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000376911	T;T;T	0.03689	3.84;3.84;3.84	5.86	5.86	0.93980	5.86	5.86	0.93980	Annexin repeat, conserved site (1);	0.087076	0.85682	D	0.000000	T	0.17323	0.0416	M	0.72353	2.195	0.80722	D	1	D	0.53885	0.963	D	0.69824	0.966	T	0.00150	-1.1986	10	0.44086	T	0.13	.	16.2565	0.82519	1.0:0.0:0.0:0.0	.	135	P04083	ANXA1_HUMAN	V	135;146;135	ENSP00000257497:D135V;ENSP00000412489:D146V;ENSP00000366109:D135V	ENSP00000257497:D135V	D	+	2	0	0	ANXA1	74965558	74965558	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	8.466000	0.90387	2.235000	0.73313	0.533000	0.62120	GAT	0.260010		TCGA-RB-A7B8-01A-12D-A33T-08	0.358	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	1	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	2.180000	-20.000000	1	0.270000	NM_000700		0	135	135	0	624	618	1		1	1		0	0	113	0	0	1	1	0	151	0	457	0	135	624
ABCA1	19	broad.mit.edu	37	9	107620844	107620844	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chr9:107620844G>A	ENST00000374736.3	-	7	1073	c.679C>T	c.(679-681)Cga>Tga	p.R227*	ABCA1_ENST00000423487.2_Nonsense_Mutation_p.R227*	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	227					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CGAAGTACTCGCTCTGCTGCA	0.468																																						ENST00000374736.3	1.000000	8.300000e-01	0.990000	0.890000	0.950000	0.949173	0.950000	0.990000																										0				115						c.(679-681)Cga>Tga		ATP-binding cassette, sub-family A (ABC1), member 1	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)						163.0	160.0	161.0					9																	107620844		2203	4300	6503	SO:0001587	stop_gained	19	0	0					g.chr9:107620844G>A	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.679C>T	chr9.hg19:g.107620844G>A	ENSP00000363868:p.Arg227*	1					ABCA1_ENST00000423487.2_Nonsense_Mutation_p.R227*	p.R227*	NM_005502.3	NP_005493.2	0	1	1	1.636751	O95477	ABCA1_HUMAN		7	1073	-			Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Nonsense_Mutation	SNP	ENST00000374736.3	0	1	hg19	c.679C>T	CCDS6762.1	1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915688	0.92178	.	.	ENSG00000165029	ENST00000374736;ENST00000423487	.	.	.	6.17	3.26	0.37387	6.17	3.26	0.37387	.	1.116260	0.06418	N	0.721847	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	8.0132	0.30365	0.0726:0.0:0.5413:0.3861	.	.	.	.	X	227	.	ENSP00000363868:R227X	R	-	1	2	2	ABCA1	106660665	106660665	0.015000	0.18098	0.018000	0.16275	0.002000	0.02628	0.895000	0.28363	0.924000	0.37069	0.655000	0.94253	CGA	0.156069		TCGA-RB-A7B8-01A-12D-A33T-08	0.468	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	0	0	1	2	18	2	2	1	1	1	1	103	103	103	103	1	2.180000	-20.000000	1	0.270000	NM_005502		0	90	89	0	439	436	1		1	0		1	0	103	0	0	1	2.059487e-01	0	0	0	5	0	90	439
ARMCX3	51566	broad.mit.edu	37	X	100880318	100880318	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chrX:100880318G>A	ENST00000341189.4	+	5	1215	c.349G>A	c.(349-351)Gtt>Att	p.V117I	RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3-AS1_ENST00000454228.1_RNA|ARMCX3_ENST00000537169.1_Missense_Mutation_p.V117I|ARMCX3_ENST00000471229.2_Missense_Mutation_p.V117I	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	117					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						AGATGATACCGTTTTGTCCCC	0.517																																						ENST00000341189.4	0.770000	4.200000e-01	0.680000	0.500000	0.580000	0.596982	0.580000	0.580000																										0				11						c.(349-351)Gtt>Att		armadillo repeat containing, X-linked 3							66.0	58.0	61.0					X																	100880318		2200	4295	6495	SO:0001583	missense	51566	0	0					g.chrX:100880318G>A	AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.349G>A	chrX.hg19:g.100880318G>A	ENSP00000340672:p.Val117Ile						ARMCX3_ENST00000471229.2_Missense_Mutation_p.V117I|ARMCX3-AS1_ENST00000454228.1_RNA|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3_ENST00000537169.1_Missense_Mutation_p.V117I	p.V117I	NM_016607.3	NP_057691.1	0	1	1		Q9UH62	ARMX3_HUMAN		5	1215	+			Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	1	1	hg19	c.349G>A	CCDS14489.1	0	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.915094	0.00503	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.28895	1.59;1.59	4.08	-5.45	0.02616	4.08	-5.45	0.02616	Armadillo-like helical (1);	0.708561	0.13313	N	0.397312	T	0.09113	0.0225	N	0.01640	-0.785	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.35748	-0.9776	9	.	.	.	-2.6702	12.8785	0.58003	0.2698:0.0:0.7302:0.0	.	117	Q9UH62	ARMX3_HUMAN	I	117	ENSP00000340672:V117I;ENSP00000439032:V117I	.	V	+	1	0	0	ARMCX3	100766974	100766974	0.031000	0.19500	0.318000	0.25279	0.907000	0.53573	-0.504000	0.06375	-1.484000	0.01856	-2.493000	0.00193	GTT	0.270000		TCGA-RB-A7B8-01A-12D-A33T-08	0.517	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	1	0	1	2	2	2	2	0	0	0	0	95	95	95	94	1	2.180000	-10.778100	1	0.270000	NM_016607		0	40	39	0	464	459	0		1	0		0	0	95	0	0	1	8.708759e-01	0	0	0	44	0	40	464
CXorf56	63932	broad.mit.edu	37	X	118699217	118699217	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chrX:118699217G>A	ENST00000371594.4	-	1	180	c.102C>T	c.(100-102)tgC>tgT	p.C34C	CXorf56_ENST00000320339.4_5'UTR|CXorf56_ENST00000536133.1_Silent_p.C34C	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	34										cervix(1)|endometrium(2)|lung(7)	10						CCATCTGGCCGCACAAACAGT	0.577																																						ENST00000371594.4	0.140000	2.000000e-02	0.110000	0.040000	0.060000	0.078592	0.060000	0.070000																										0				10						c.(100-102)tgC>tgT		chromosome X open reading frame 56							78.0	75.0	76.0					X																	118699217		2203	4300	6503	SO:0001819	synonymous_variant	63932	0	0					g.chrX:118699217G>A	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.102C>T	chrX.hg19:g.118699217G>A							CXorf56_ENST00000320339.4_5'UTR|CXorf56_ENST00000536133.1_Silent_p.C34C	p.C34C	NM_022101.3	NP_071384.1	0	1	1		Q9H5V9	CX056_HUMAN		1	180	-			A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Silent	SNP	ENST00000371594.4	0	1	hg19	c.102C>T	CCDS14579.1	0																																																																																								0.270000		TCGA-RB-A7B8-01A-12D-A33T-08	0.577	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	2.180000	-1.981537	0	0.270000	NM_022101		0	6	7	0	649	644	0		1	0		0	0	68	0	0	9.644229e-01	5.199959e-02	0	0	0	33	0	6	649
GPC3	2719	broad.mit.edu	37	X	132730547	132730547	+	Silent	SNP	G	G	A			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chrX:132730547G>A	ENST00000370818.3	-	7	1939	c.1494C>T	c.(1492-1494)tgC>tgT	p.C498C	GPC3_ENST00000394299.2_Silent_p.C521C|GPC3_ENST00000543339.1_Silent_p.C444C	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	498					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CATCATCACCGCAGTCTCCAC	0.463			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																													ENST00000370818.3	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.059967	0.050000	0.060000			yes	Rec/X		Simpson-Golabi-Behmel syndrome	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	Xq26.1	2719	T, D, Mis, N, F, S	glypican 3				O	O		Wilms tumour			0				36						c.(1492-1494)tgC>tgT		glypican 3							243.0	206.0	218.0					X																	132730547		2203	4300	6503	SO:0001819	synonymous_variant	2719	6	121410	41	Simpson-Golabi-Behmel syndrome	Familial Cancer Database	SGBS	g.chrX:132730547G>A	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.1494C>T	chrX.hg19:g.132730547G>A							GPC3_ENST00000394299.2_Silent_p.C521C|GPC3_ENST00000543339.1_Silent_p.C444C	p.C498C	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	0	1	1		P51654	GPC3_HUMAN		7	1939	-	Acute lymphoblastic leukemia(192;0.000127)		C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	0	1	hg19	c.1494C>T	CCDS14638.1	0	.	.	.	.	.	.	.	.	.	.	G	2.995	-0.207259	0.06180	.	.	ENSG00000147257	ENST00000406757	.	.	.	4.73	-9.46	0.00597	4.73	-9.46	0.00597	.	.	.	.	.	T	0.72803	0.3506	.	.	.	0.48040	D	0.999576	.	.	.	.	.	.	T	0.82566	-0.0393	4	.	.	.	.	22.4363	0.99971	0.2327:0.0:0.7673:0.0	.	.	.	.	V	228	.	.	A	-	2	0	0	GPC3	132558213	132558213	0.000000	0.05858	0.008000	0.14137	0.665000	0.39181	-3.320000	0.00513	-3.839000	0.00100	-1.679000	0.00737	GCG	0.270000		TCGA-RB-A7B8-01A-12D-A33T-08	0.463	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	0	0	1	2	2	2	2	0	0	0	0	109	109	109	109	1	2.180000	-2.115266	0	0.270000	NM_004484		0	6	6	0	854	853	0		1	0		0	0	109	0	0	9.649078e-01	1.058172e-01	0	0	0	66	0	6	854
MAGEC2	51438	broad.mit.edu	37	X	141291654	141291654	+	Silent	SNP	G	G	T			TCGA-RB-A7B8-01A-12D-A33T-08	TCGA-RB-A7B8-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e601f5b-bebf-4205-9a88-48e18d07178c	8244dc39-8b03-44b8-bdee-7bf0c4d51f66	g.chrX:141291654G>T	ENST00000247452.3	-	3	467	c.120C>A	c.(118-120)tcC>tcA	p.S40S		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	40	Ser-rich.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					AAGAGGCGGAGGAGGCTTCCT	0.522										HNSCC(46;0.14)																												ENST00000247452.3	0.590000	3.500000e-01	0.530000	0.400000	0.460000	0.474981	0.460000	0.470000																										0				47						c.(118-120)tcC>tcA		melanoma antigen family C, 2							118.0	117.0	117.0					X																	141291654		2203	4300	6503	SO:0001819	synonymous_variant	51438	0	0					g.chrX:141291654G>T	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.120C>A	chrX.hg19:g.141291654G>T			HNSCC(46;0.14)					p.S40S	NM_016249.3	NP_057333.1	0	1	1		Q9UBF1	MAGC2_HUMAN		3	467	-	Acute lymphoblastic leukemia(192;6.56e-05)		Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Silent	SNP	ENST00000247452.3	1	1	hg19	c.120C>A	CCDS14678.1	0																																																																																								0.270000		TCGA-RB-A7B8-01A-12D-A33T-08	0.522	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	1	0	1	2	2	2	2	0	0	0	0	140	140	140	139	1	2.180000	-9.367000	1	0.270000	NM_016249		0	54	51	0	799	791	0		1			0	0	140	0	0	1	0	0	0	0	0	0	54	799
