#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
KIF4B	285643	broad.mit.edu	37	5	154395466	154395466	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr5:154395466delC	ENST00000435029.4	+	1	2207	c.2047delC	c.(2047-2049)caafs	p.Q683fs		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	683	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCGTAAGAGGCAATATGAGCT	0.423																																						ENST00000435029.4	1.000000	0.770000	1.000000	0.940000	0.990000	0.974719	0.990000	1.000000																										0				58						c.(2047-2049)caafs		kinesin family member 4B							125.0	128.0	127.0					5																	154395466		2203	4300	6503	SO:0001589	frameshift_variant	285643	0	0					g.chr5:154395466delC	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2047delC	chr5.hg19:g.154395466delC	ENSP00000387875:p.Gln683fs	0						p.Q683fs	NM_001099293.1	NP_001092763.1	1	2	3	2.040345	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)	1	2207	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)		Frame_Shift_Del	DEL	ENST00000435029.4	0	1	hg19	c.2047delC	CCDS47324.1	1																																																																																								0.114610		TCGA-RB-AA9M-01A-11D-A397-08	0.423	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1	1	0	1		2			0	0	0	0	96	0	96	96	1	2	-5.981519	1	0.100001			0	32	32	0	567	563	0	0	1	0	0	0	0	0	0	0	1.000000	0	0	0	0	0	0	32	567
C10orf90	118611	broad.mit.edu	37	10	128147750	128147750	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr10:128147750G>A	ENST00000284694.7	-	6	1876	c.1756C>T	c.(1756-1758)Cgc>Tgc	p.R586C	C10orf90_ENST00000454341.1_Missense_Mutation_p.R489C|C10orf90_ENST00000480379.1_5'UTR|C10orf90_ENST00000356858.3_Missense_Mutation_p.R539C|C10orf90_ENST00000544758.1_Missense_Mutation_p.R683C	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	586	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TCTTGTGAGCGAGAAATGAAC	0.498																																						ENST00000284694.7	1.000000	0.690000	1.000000	0.870000	0.990000	0.954541	0.990000	1.000000																										0				65						c.(1756-1758)Cgc>Tgc		chromosome 10 open reading frame 90							162.0	137.0	145.0					10																	128147750		2203	4300	6503	SO:0001583	missense	118611	4	121412	37				g.chr10:128147750G>A	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1756C>T	chr10.hg19:g.128147750G>A	ENSP00000284694:p.Arg586Cys	0					C10orf90_ENST00000544758.1_Missense_Mutation_p.R683C|C10orf90_ENST00000480379.1_5'UTR|C10orf90_ENST00000356858.3_Missense_Mutation_p.R539C|C10orf90_ENST00000454341.1_Missense_Mutation_p.R489C	p.R586C	NM_001004298.2	NP_001004298.2	1	2	3	2.048307	Q96M02	CJ090_HUMAN		6	1876	-		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	1	1	hg19	c.1756C>T	CCDS31310.1	1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160951	0.78226	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	T;T;T;T	0.29917	1.7;1.81;1.74;1.55	5.01	5.01	0.66863	5.010000	5.010000	0.668630	.	0.000000	0.43919	D	0.000518	T	0.53965	0.1829	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.56475	-0.7973	10	0.87932	D	0	-27.713	15.1753	0.72907	0.0:0.0:1.0:0.0	.	683;586;489	F5GZL2;Q96M02;Q96M02-2	.;CJ090_HUMAN;.	C	539;586;489;683;586	ENSP00000284694:R586C;ENSP00000398786:R489C;ENSP00000444369:R683C;ENSP00000405995:R586C	ENSP00000284694:R586C	R	-	1	0	0	C10orf90	128137740	128137740	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.049000	0.71053	2.595000	0.87683	0.655000	0.94253	CGC	0.116349		TCGA-RB-AA9M-01A-11D-A397-08	0.498	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	71	0	71	71	1	2	-2.958988	1	0.100001	NM_001004298		0	24	22	0	453	449	0		1			0	0	71	0	0	1.000000	0	0	0	0	0	0	24	453
RASSF4	83937	broad.mit.edu	37	10	45467292	45467292	+	Missense_Mutation	SNP	G	G	A	rs61759871		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr10:45467292G>A	ENST00000340258.5	+	3	247	c.134G>A	c.(133-135)cGt>cAt	p.R45H	RASSF4_ENST00000334940.6_Intron|RASSF4_ENST00000374417.2_Missense_Mutation_p.R45H|RASSF4_ENST00000472561.1_3'UTR|C10orf10_ENST00000496638.1_Intron	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTGAGACACCGTGAGGTGAGC	0.522																																						ENST00000340258.5	1.000000	0.900000	1.000000	0.990000	0.990000	0.994285	0.990000	1.000000																										0				16						c.(133-135)cGt>cAt		Ras association (RalGDS/AF-6) domain family member 4		G	HIS/ARG	0,4406		0,0,2203	179.0	133.0	148.0		134	5.3	1.0	10	dbSNP_129	148	3,8597	3.0+/-9.4	0,3,4297	no	missense	RASSF4	NM_032023.3	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	45/322	45467292	3,13003	2203	4300	6503	SO:0001583	missense	83937	15	121400	40				g.chr10:45467292G>A	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.134G>A	chr10.hg19:g.45467292G>A	ENSP00000339692:p.Arg45His	0					RASSF4_ENST00000374417.2_Missense_Mutation_p.R45H|C10orf10_ENST00000496638.1_Intron|RASSF4_ENST00000334940.6_Intron|RASSF4_ENST00000472561.1_3'UTR	p.R45H	NM_032023.3	NP_114412.2	1	2	3	2.036269	Q8WYP3	RIN2_HUMAN		3	247	+			Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000340258.5	0	1	hg19	c.134G>A	CCDS7208.1	1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.792072	0.70452	0.0	3.49E-4	ENSG00000107551	ENST00000374417;ENST00000374414;ENST00000340258;ENST00000427758;ENST00000428466;ENST00000374411	T;T;T;T	0.29397	1.57;2.37;1.57;1.57	5.27	5.27	0.74061	5.270000	5.270000	0.740610	.	0.312435	0.30446	N	0.009610	T	0.28896	0.0717	L	0.49640	1.575	0.80722	D	1	B;B	0.28208	0.203;0.026	B;B	0.21151	0.033;0.008	T	0.03684	-1.1013	10	0.40728	T	0.16	-8.1958	14.7643	0.69626	0.0:0.0:1.0:0.0	rs61759871	136;45	Q59FL4;Q9H2L5	.;RASF4_HUMAN	H	45;45;45;45;38;136	ENSP00000363538:R45H;ENSP00000339692:R45H;ENSP00000409767:R45H;ENSP00000413468:R38H	ENSP00000339692:R45H	R	+	2	0	0	RASSF4	44787298	44787298	0.999000	0.42202	0.999000	0.59377	0.615000	0.37417	2.358000	0.44134	2.632000	0.89209	0.655000	0.94253	CGT	0.113738		TCGA-RB-AA9M-01A-11D-A397-08	0.522	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	1	0	1	2	20	9	2	1	0	1	1	37	0	37	36	1	2	-10.889140	1	0.100001	NM_032023		0	17	17	0	223	220	0		0	0		1	0	37	0	0	0.346423	1.464338e-01	0	1	0	76	0	17	223
MKI67	4288	broad.mit.edu	37	10	129906577	129906577	+	Missense_Mutation	SNP	G	G	A	rs117795868		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr10:129906577G>A	ENST00000368654.3	-	13	3902	c.3527C>T	c.(3526-3528)aCg>aTg	p.T1176M	MKI67_ENST00000368653.3_Missense_Mutation_p.T816M	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1176	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGGTTTGGGCGTAAGCATGGC	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		21842	0.001		0.0	False		,,,				2504	0.0					ENST00000368654.3	1.000000	0.050000	1.000000	0.080000	0.140000	0.332688	0.140000	0.120000																										0				159						c.(3526-3528)aCg>aTg		marker of proliferation Ki-67							292.0	278.0	283.0					10																	129906577		2203	4300	6503	SO:0001583	missense	4288	29	121412	52				g.chr10:129906577G>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3527C>T	chr10.hg19:g.129906577G>A	ENSP00000357643:p.Thr1176Met	0					MKI67_ENST00000368653.3_Missense_Mutation_p.T816M	p.T1176M	NM_002417.4	NP_002408.3	1	2	3	2.048307	P46013	KI67_HUMAN		13	3902	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	0	1	hg19	c.3527C>T	CCDS7659.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.05	1.822665	0.32237	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03301	3.98;3.98	2.74	1.83	0.25207	2.740000	1.830000	0.252070	.	1.848640	0.03443	N	0.209516	T	0.15998	0.0385	M	0.72118	2.19	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.96;0.991;0.989	T	0.06058	-1.0848	10	0.52906	T	0.07	.	5.4955	0.16799	0.1565:0.0:0.8435:0.0	.	1175;816;1176	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	M	1176;816;1175	ENSP00000357643:T1176M;ENSP00000357642:T816M	ENSP00000357642:T816M	T	-	2	0	0	MKI67	129796567	129796567	0.005000	0.15991	0.002000	0.10522	0.005000	0.04900	0.110000	0.15437	0.740000	0.32651	0.462000	0.41574	ACG	0.116349		TCGA-RB-AA9M-01A-11D-A397-08	0.463	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	0	0	1	2	2	2	2	0	0	0	0	140	0	140	140	1	2	-2.032788	0	0.100001	NM_002417		0	6	6	0	1014	1006	0		1	0		0	0	140	0	0	0.964138	2.300177e-03	0	0	0	10	0	6	1014
CSTF3	1479	broad.mit.edu	37	11	33120306	33120306	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr11:33120306C>T	ENST00000323959.4	-	13	1197	c.1058G>A	c.(1057-1059)cGc>cAc	p.R353H	TCP11L1_ENST00000324357.9_Intron	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	353					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						ATACTTCATGCGACTCTAAGG	0.398																																						ENST00000323959.4	1.000000	0.060000	1.000000	0.100000	0.180000	0.338860	0.180000	0.140000																										0				19						c.(1057-1059)cGc>cAc		cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa							174.0	182.0	179.0					11																	33120306		2202	4298	6500	SO:0001583	missense	1479	0	0					g.chr11:33120306C>T	U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.1058G>A	chr11.hg19:g.33120306C>T	ENSP00000315791:p.Arg353His	0					TCP11L1_ENST00000324357.9_Intron	p.R353H	NM_001326.2	NP_001317.1	1	2	3	2.032382	Q12996	CSTF3_HUMAN		13	1197	-			A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	ENST00000323959.4	0	1	hg19	c.1058G>A	CCDS7883.1	0	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599320	0.66332	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	T	0.35421	1.31	5.71	4.79	0.61399	5.710000	4.790000	0.613990	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.40956	0.1138	M	0.84846	2.72	0.80722	D	1	P	0.46457	0.878	B	0.32980	0.156	T	0.55667	-0.8105	10	0.54805	T	0.06	.	15.992	0.80214	0.1358:0.8642:0.0:0.0	.	353	Q12996	CSTF3_HUMAN	H	353;286	ENSP00000315791:R353H	ENSP00000315791:R353H	R	-	2	0	0	CSTF3	33076882	33076882	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.813000	0.86123	1.394000	0.46624	0.650000	0.86243	CGC	0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.398	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388801.1	0	0	1	2	2	2	2	0	0	0	0	108	0	108	108	1	2	-1.898617	0	0.100001	NM_001326		0	5	5	0	678	673	0		1	0		0	0	108	0	0	0.936529	2.085783e-02	0	0	0	24	0	5	678
DDB2	1643	broad.mit.edu	37	11	47259552	47259552	+	Splice_Site	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr11:47259552G>A	ENST00000256996.4	+	8	1383	c.1188G>A	c.(1186-1188)tcG>tcA	p.S396S	DDB2_ENST00000378600.3_Splice_Site_p.S207S|DDB2_ENST00000378603.3_Splice_Site_p.S332S|DDB2_ENST00000378601.3_3'UTR|ACP2_ENST00000525230.1_5'Flank	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	396					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						GCATCAGTTCGGTGAGGCTTG	0.463			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													ENST00000256996.4	1.000000	0.370000	1.000000	0.540000	0.790000	0.779574	0.790000	1.000000			yes	Rec		Xeroderma pigmentosum (E)	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	11p12	1643	Mis, N	damage-specific DNA binding protein 2				E	E		skin basal cell, skin squamous cell, melanoma			0				17						c.(1186-1188)tcG>tcA	Direct reversal of damage;Nucleotide excision repair (NER)	damage-specific DNA binding protein 2, 48kDa							87.0	73.0	78.0					11																	47259552		2201	4298	6499	SO:0001630	splice_region_variant	1643	2	121412	34	Xeroderma Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	g.chr11:47259552G>A		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.1188+1G>A	chr11.hg19:g.47259552G>A		0					DDB2_ENST00000378600.3_Splice_Site_p.S207S|ACP2_ENST00000525230.1_5'Flank|DDB2_ENST00000378603.3_Splice_Site_p.S332S|DDB2_ENST00000378601.3_3'UTR	p.S396S	NM_000107.2	NP_000098.1	1	2	3	2.032382	Q92466	DDB2_HUMAN		8	1383	+			B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Splice_Site	SNP	ENST00000256996.4	1	0	hg19	c.1188G>A	CCDS7927.1	0																																																																																								0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.463	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	40	0	40	39	1	2	-2.737534	1	0.100001	NM_000107	Silent	0	9	9	0	253	253	0		1	0		0	0	40	0	0	0.994446	7.307775e-01	0	0	0	73	0	9	253
SF3B2	10992	broad.mit.edu	37	11	65820570	65820570	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr11:65820570G>A	ENST00000322535.6	+	3	302	c.253G>A	c.(253-255)Gca>Aca	p.A85T	snoU13_ENST00000459530.1_RNA|SF3B2_ENST00000528302.1_Missense_Mutation_p.A85T	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	85					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						TCCCATGTCGGCACAGGTAGG	0.493																																						ENST00000322535.6	1.000000	0.060000	1.000000	0.110000	0.180000	0.341978	0.180000	0.160000																										0				41						c.(253-255)Gca>Aca		splicing factor 3b, subunit 2, 145kDa							142.0	148.0	146.0					11																	65820570		2201	4296	6497	SO:0001583	missense	10992	0	0					g.chr11:65820570G>A	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.253G>A	chr11.hg19:g.65820570G>A	ENSP00000318861:p.Ala85Thr	0					SF3B2_ENST00000528302.1_Missense_Mutation_p.A85T|snoU13_ENST00000459530.1_RNA	p.A85T	NM_006842.2	NP_006833.2	1	2	3	2.032382	Q13435	SF3B2_HUMAN		3	302	+			A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	ENST00000322535.6	0	1	hg19	c.253G>A	CCDS31612.1	0	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059249	0.36373	.	.	ENSG00000087365	ENST00000528302;ENST00000322535;ENST00000533595;ENST00000524627;ENST00000355456;ENST00000530322;ENST00000524475	.	.	.	4.55	3.64	0.41730	4.550000	3.640000	0.417300	.	0.317215	0.34291	N	0.004088	T	0.38878	0.1057	N	0.08118	0	0.30748	N	0.745392	D;D	0.57571	0.98;0.98	D;P	0.68192	0.956;0.811	T	0.36529	-0.9744	9	0.52906	T	0.07	-5.6862	8.6598	0.34086	0.1041:0.0:0.8959:0.0	.	85;85	Q13435;E9PJ04	SF3B2_HUMAN;.	T	85;85;85;85;87;80;3	.	ENSP00000318861:A85T	A	+	1	0	0	SF3B2	65577146	65577146	0.997000	0.39634	0.994000	0.49952	0.846000	0.48090	5.333000	0.65917	1.270000	0.44297	0.655000	0.94253	GCA	0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.493	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2	0	0	1	2	2	2	2	0	0	0	0	134	0	134	132	1	2	-2.180734	0	0.100001			0	6	6	0	775	764	0		1	0		0	0	134	0	0	0.963481	3.545936e-01	0	0	0	142	0	6	775
C2CD2L	9854	broad.mit.edu	37	11	118984833	118984833	+	Missense_Mutation	SNP	C	C	T	rs201072240	byFrequency	TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr11:118984833C>T	ENST00000528586.1	+	9	981	c.911C>T	c.(910-912)gCg>gTg	p.A304V	C2CD2L_ENST00000336702.3_Missense_Mutation_p.A557V			O14523	C2C2L_HUMAN	C2CD2-like	556						integral component of membrane (GO:0016021)		p.A557V(2)		NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						CTGGGCTATGCGGCATCCCTG	0.612													C|||	2	0.000399361	0.0	0.0	5008	,	,		18524	0.001		0.0	False		,,,				2504	0.001					ENST00000528586.1	1.000000	0.080000	1.000000	0.130000	0.220000	0.367732	0.220000	0.180000																										2	Substitution - Missense(2)	p.A557V(2)	large_intestine(1)|prostate(1)	13						c.(910-912)gCg>gTg		C2CD2-like							109.0	110.0	109.0					11																	118984833		2200	4295	6495	SO:0001583	missense	9854	5	121412	40				g.chr11:118984833C>T	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.911C>T	chr11.hg19:g.118984833C>T	ENSP00000433600:p.Ala304Val	0					C2CD2L_ENST00000336702.3_Missense_Mutation_p.A557V	p.A304V			1	2	3	2.032382	O14523	C2C2L_HUMAN		9	981	+			Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	0	1	hg19	c.911C>T		0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	24.6	4.548263	0.86127	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.49432	0.78;0.78	5.11	3.2	0.36748	5.110000	3.200000	0.367480	.	0.000000	0.85682	D	0.000000	T	0.61438	0.2347	M	0.61703	1.905	0.48135	D	0.999593	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.59490	-0.7445	10	0.46703	T	0.11	1.7815	9.4646	0.38804	0.1429:0.7824:0.0:0.0747	.	556;557	O14523;O14523-2	C2C2L_HUMAN;.	V	557;304	ENSP00000338885:A557V;ENSP00000433600:A304V	ENSP00000338885:A557V	A	+	2	0	0	C2CD2L	118490043	118490043	0.996000	0.38824	0.983000	0.44433	0.991000	0.79684	3.316000	0.51960	0.813000	0.34350	0.655000	0.94253	GCG	0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.612	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000388199.2	0	0	1	2	2	2	2	0	0	0	0	107	0	107	106	1	2	-1.684191	0	0.100001	NM_014807		0	6	6	0	655	650	0		1	0		0	0	107	0	0	0.964258	1.031172e-01	0	0	0	50	0	6	655
CLEC12A	160364	broad.mit.edu	37	12	10131591	10131591	+	Missense_Mutation	SNP	C	C	T	rs141455664		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr12:10131591C>T	ENST00000304361.4	+	2	300	c.118C>T	c.(118-120)Cgt>Tgt	p.R40C	CLEC12A_ENST00000355690.4_Missense_Mutation_p.R50C|CLEC12A_ENST00000434319.2_Missense_Mutation_p.R40C|CLEC12A_ENST00000350667.4_Intron	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						TCATGTATGGCGTCCAGCAGC	0.433													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16812	0.0		0.0	False		,,,				2504	0.0				Melanoma(197;1487 2125 16611 22221 34855)	ENST00000304361.4	1.000000	0.940000	1.000000	0.990000	0.990000	0.996545	0.990000	1.000000																										0				16						c.(118-120)Cgt>Tgt		C-type lectin domain family 12, member A		C	CYS/ARG,CYS/ARG,	0,4406		0,0,2203	207.0	192.0	197.0		148,118,	2.7	0.0	12	dbSNP_134	197	2,8598	1.2+/-3.3	0,2,4298	yes	missense,missense,intron	CLEC12A	NM_001207010.1,NM_138337.5,NM_201623.3	180,180,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,	50/276,40/266,	10131591	2,13004	2203	4300	6503	SO:0001583	missense	160364	8	121412	44				g.chr12:10131591C>T	AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.118C>T	chr12.hg19:g.10131591C>T	ENSP00000302804:p.Arg40Cys	0					CLEC12A_ENST00000434319.2_Missense_Mutation_p.R40C|CLEC12A_ENST00000355690.4_Missense_Mutation_p.R50C|CLEC12A_ENST00000350667.4_Intron	p.R40C	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	1	2	3	2.016832	Q5QGZ9	CL12A_HUMAN		2	300	+			B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Missense_Mutation	SNP	ENST00000304361.4	0	1	hg19	c.118C>T	CCDS8608.1	1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.584844	0.28268	0.0	2.33E-4	ENSG00000172322	ENST00000355690;ENST00000396507;ENST00000304361;ENST00000434319	T;T;T;T	0.09163	4.41;3.01;4.43;3.88	4.58	2.69	0.31865	4.580000	2.690000	0.318650	.	.	.	.	.	T	0.13586	0.0329	M	0.84219	2.685	0.19945	N	0.999945	B;B	0.33549	0.293;0.417	B;B	0.25759	0.029;0.063	T	0.15178	-1.0446	9	0.44086	T	0.13	.	6.7049	0.23244	0.0:0.718:0.1808:0.1011	.	40;50	Q5QGZ9;Q5QGZ9-1	CL12A_HUMAN;.	C	50;40;40;40	ENSP00000347916:R50C;ENSP00000379764:R40C;ENSP00000302804:R40C;ENSP00000405244:R40C	ENSP00000302804:R40C	R	+	1	0	0	CLEC12A	10022858	10022858	0.025000	0.19082	0.018000	0.16275	0.008000	0.06430	0.136000	0.15974	0.591000	0.29711	0.650000	0.86243	CGT	0.109353		TCGA-RB-AA9M-01A-11D-A397-08	0.433	CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399545.1	1	0	1	2	23	2	2	1	0	1	1	58	0	58	58	1	2	-3.318739	1	0.100001	NM_138337		0	29	29	0	404	401	0		1	0		1	0	58	0	0	0.833167	0	0	0	0	1	0	29	404
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.700000	1.000000	0.910000	0.990000	0.964314	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	2.024180	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.111112		TCGA-RB-AA9M-01A-11D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	17	2	2	2	0	2	0	0	31	7998	31	31	1	2	-5.560625	1	0.100001	NM_033360		617	18	18	7400	311	308	0	1	1	1	1	0	0	31	770	1	0.999982	4.935802e-01	9.999959e-01	9	11	20	369	18	311
HVCN1	84329	broad.mit.edu	37	12	111088053	111088053	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr12:111088053G>A	ENST00000356742.5	-	6	1429	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W	HVCN1_ENST00000242607.8_Missense_Mutation_p.R226W|HVCN1_ENST00000439744.2_Missense_Mutation_p.R206W|HVCN1_ENST00000548312.1_Missense_Mutation_p.R226W			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	226					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						AAGAGTTGCCGTTCTGAACGT	0.398																																						ENST00000356742.5	1.000000	0.100000	0.520000	0.170000	0.280000	0.377212	0.280000	0.240000																										0				19						c.(676-678)Cgg>Tgg		hydrogen voltage-gated channel 1							168.0	148.0	155.0					12																	111088053		2203	4300	6503	SO:0001583	missense	84329	1	121410	32				g.chr12:111088053G>A	BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.676C>T	chr12.hg19:g.111088053G>A	ENSP00000349181:p.Arg226Trp	0					HVCN1_ENST00000548312.1_Missense_Mutation_p.R226W|HVCN1_ENST00000439744.2_Missense_Mutation_p.R206W|HVCN1_ENST00000242607.8_Missense_Mutation_p.R226W	p.R226W			1	2	3	2.007791	Q96D96	HVCN1_HUMAN		6	1429	-			A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	ENST00000356742.5	0	1	hg19	c.676C>T	CCDS31900.1	0	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980869	0.53827	.	.	ENSG00000122986	ENST00000548312;ENST00000242607;ENST00000356742;ENST00000439744	T;T;T;T	0.50813	0.73;0.75;0.75;0.75	6.17	4.31	0.51392	6.170000	4.310000	0.513920	.	0.308268	0.36409	N	0.002616	T	0.64768	0.2628	M	0.76574	2.34	0.32053	N	0.596686	B;D	0.76494	0.068;0.999	B;P	0.60886	0.019;0.88	T	0.74870	-0.3517	10	0.87932	D	0	-25.0411	13.9148	0.63890	0.0:0.0:0.7229:0.2771	.	226;226	Q96D96;Q96D96-3	HVCN1_HUMAN;.	W	226;226;226;206	ENSP00000449601:R226W;ENSP00000242607:R226W;ENSP00000349181:R226W;ENSP00000412052:R206W	ENSP00000242607:R226W	R	-	1	2	2	HVCN1	109572436	109572436	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.967000	0.49216	0.882000	0.36016	-0.182000	0.12963	CGG	0.107144		TCGA-RB-AA9M-01A-11D-A397-08	0.398	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1	0	0	1	2	2	2	2	0	0	0	0	73	0	73	73	1	2	-3.140808	1	0.100001	NM_032369		0	5	5	0	405	402	0		1	0		0	0	73	0	0	0.936693	8.453255e-02	0	0	0	32	0	5	405
ZIC5	85416	broad.mit.edu	37	13	100617645	100617645	+	Missense_Mutation	SNP	G	G	A	rs577823767		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr13:100617645G>A	ENST00000267294.4	-	2	2211	c.1978C>T	c.(1978-1980)Cgg>Tgg	p.R660W		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	660					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTATCGTCCGCACAACTTCA	0.483													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13720	0.0		0.0	False		,,,				2504	0.0					ENST00000267294.4	1.000000	0.090000	1.000000	0.160000	0.270000	0.395986	0.270000	0.220000																										0				9						c.(1978-1980)Cgg>Tgg		Zic family member 5							66.0	66.0	66.0					13																	100617645		2203	4300	6503	SO:0001583	missense	85416	10	121412	40				g.chr13:100617645G>A	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1978C>T	chr13.hg19:g.100617645G>A	ENSP00000267294:p.Arg660Trp	0						p.R660W	NM_033132.3	NP_149123.2	1	2	3	2.022375	Q96T25	ZIC5_HUMAN		2	2211	-	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		Q5VYB0	Missense_Mutation	SNP	ENST00000267294.4	0	1	hg19	c.1978C>T	CCDS9494.2	0	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556755	0.65425	.	.	ENSG00000139800	ENST00000267294	T	0.18016	2.24	6.06	5.14	0.70334	6.060000	5.140000	0.703340	.	.	.	.	.	T	0.29321	0.0730	L	0.36672	1.1	0.35097	D	0.764889	D	0.89917	1.0	D	0.69654	0.965	T	0.18335	-1.0340	9	0.87932	D	0	.	11.1163	0.48262	0.0:0.0:0.7346:0.2654	.	660	Q96T25	ZIC5_HUMAN	W	660	ENSP00000267294:R660W	ENSP00000267294:R660W	R	-	1	2	2	ZIC5	99415646	99415646	0.998000	0.40836	0.997000	0.53966	0.991000	0.79684	2.915000	0.48805	2.871000	0.98454	0.655000	0.94253	CGG	0.110673		TCGA-RB-AA9M-01A-11D-A397-08	0.483	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	0	0	1	2	2	2	2	0	0	0	0	65	0	65	65	1	2	-2.212733	0	0.100001	NM_033132		0	5	5	0	437	432	0		1			0	0	65	0	0	0.935995	0	0	0	0	0	0	5	437
RNF17	56163	broad.mit.edu	37	13	25435469	25435469	+	Silent	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr13:25435469C>T	ENST00000255324.5	+	27	3890	c.3838C>T	c.(3838-3840)Ctg>Ttg	p.L1280L	RNF17_ENST00000339524.3_Silent_p.L332L|RNF17_ENST00000381921.1_Silent_p.L1280L	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1280	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CCCTATTTTGCTGTATCCTGA	0.318																																						ENST00000255324.5	1.000000	0.700000	1.000000	0.820000	0.970000	0.928698	0.970000	1.000000																										0				36						c.(3838-3840)Ctg>Ttg		ring finger protein 17							205.0	206.0	206.0					13																	25435469		2203	4300	6503	SO:0001819	synonymous_variant	56163	0	0					g.chr13:25435469C>T	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3838C>T	chr13.hg19:g.25435469C>T		0					RNF17_ENST00000339524.3_Silent_p.L332L|RNF17_ENST00000381921.1_Silent_p.L1280L	p.L1280L	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	1	2	3	2.036290	Q9BXT8	RNF17_HUMAN		27	3890	+		Lung SC(185;0.0225)|Breast(139;0.077)	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	1	1	hg19	c.3838C>T	CCDS9308.2	1																																																																																								0.113738		TCGA-RB-AA9M-01A-11D-A397-08	0.318	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	1	0	1	2	2	2	2	0	0	0	0	147	0	147	147	1	2	-5.239360	1	0.100001	NM_031994		0	46	46	0	960	951	0		1			0	0	147	0	0	1.000000	0	0	0	0	0	0	46	960
COL4A1	1282	broad.mit.edu	37	13	110822921	110822921	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr13:110822921C>T	ENST00000375820.4	-	42	3836	c.3715G>A	c.(3715-3717)Gga>Aga	p.G1239R		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1239	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCCTGAGGTCCGCGGTCTCCT	0.627																																						ENST00000375820.4	1.000000	0.300000	1.000000	0.540000	0.920000	0.814044	0.920000	1.000000																										0				105						c.(3715-3717)Gga>Aga		collagen, type IV, alpha 1																																				SO:0001583	missense	1282	0	0					g.chr13:110822921C>T	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3715G>A	chr13.hg19:g.110822921C>T	ENSP00000364979:p.Gly1239Arg	0						p.G1239R	NM_001845.4	NP_001836.2	1	2	3	2.022375	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)	42	3836	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	0	1	hg19	c.3715G>A	CCDS9511.1	1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862753	0.91511	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.99637	-6.29	4.79	4.79	0.61399	4.790000	4.790000	0.613990	.	0.057832	0.64402	D	0.000002	D	0.99813	0.9918	H	0.98089	4.145	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96593	0.9439	10	0.87932	D	0	.	17.9168	0.88954	0.0:1.0:0.0:0.0	.	1239	P02462	CO4A1_HUMAN	R	882;1239;888	ENSP00000364979:G1239R	ENSP00000364973:G882R	G	-	1	0	0	COL4A1	109620922	109620922	1.000000	0.71417	0.541000	0.28102	0.929000	0.56500	7.171000	0.77595	2.198000	0.70561	0.650000	0.86243	GGA	0.110673		TCGA-RB-AA9M-01A-11D-A397-08	0.627	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3	0	0	1	2	2	2	2	0	0	0	0	20	0	20	20	1	2	-7.366885	1	0.100001			0	4	4	0	101	101	0		1	0		0	0	20	0	0	0.891773	9.999345e-01	0	0	0	899	0	4	101
PLEKHG3	26030	broad.mit.edu	37	14	65197580	65197580	+	Silent	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr14:65197580G>A	ENST00000394691.1	+	6	777	c.630G>A	c.(628-630)cgG>cgA	p.R210R	PLEKHG3_ENST00000247226.7_Silent_p.R154R			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	210	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		TTCGGGACCGGCAGGAGCTGC	0.642																																						ENST00000394691.1	1.000000	0.180000	1.000000	0.330000	0.580000	0.633416	0.580000	1.000000																										0				29						c.(628-630)cgG>cgA		pleckstrin homology domain containing, family G (with RhoGef domain) member 3							33.0	36.0	35.0					14																	65197580		2203	4300	6503	SO:0001819	synonymous_variant	26030	0	0					g.chr14:65197580G>A	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.630G>A	chr14.hg19:g.65197580G>A		0					PLEKHG3_ENST00000247226.7_Silent_p.R154R	p.R210R			1	2	3	2.033040	A1L390	PKHG3_HUMAN		6	777	+			A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	ENST00000394691.1	0	1	hg19	c.630G>A		0																																																																																								0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.642	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	0	0	1	2	2	2	2	0	0	0	0	31	0	31	31	1	2	-3.543912	1	0.100001	NM_015549		0	4	4	0	170	166	0		1	0		0	0	31	0	0	0.885772	5.303362e-01	0	0	0	67	0	4	170
AQR	9716	broad.mit.edu	37	15	35202432	35202432	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr15:35202432C>T	ENST00000156471.5	-	17	1792	c.1567G>A	c.(1567-1569)Gcc>Acc	p.A523T		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	523					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TTGGGTTTGGCCACTTCAACG	0.473																																						ENST00000156471.5	1.000000	0.120000	1.000000	0.200000	0.310000	0.433652	0.310000	0.250000																										0				57						c.(1567-1569)Gcc>Acc		aquarius intron-binding spliceosomal factor							138.0	136.0	137.0					15																	35202432		1929	4128	6057	SO:0001583	missense	9716	0	0					g.chr15:35202432C>T	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1567G>A	chr15.hg19:g.35202432C>T	ENSP00000156471:p.Ala523Thr	0						p.A523T	NM_014691.2	NP_055506.1	1	2	3	2.030819	O60306	AQR_HUMAN		17	1792	-		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	0	1	hg19	c.1567G>A	CCDS42013.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.798913	0.96960	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93953	-3.32	5.73	5.73	0.89815	5.730000	5.730000	0.898150	.	0.000000	0.85682	D	0.000000	D	0.96800	0.8955	M	0.91249	3.19	0.80722	D	1	D	0.54772	0.968	P	0.54664	0.758	D	0.96700	0.9517	10	0.52906	T	0.07	-13.1707	19.9112	0.97025	0.0:1.0:0.0:0.0	.	523	O60306	AQR_HUMAN	T	523	ENSP00000156471:A523T	ENSP00000156471:A523T	A	-	1	0	0	AQR	32989724	32989724	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.696000	0.84270	2.718000	0.92993	0.585000	0.79938	GCC	0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.473	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	0	0	1	2	2	2	2	0	0	0	0	74	0	74	73	1	2	-2.026521	0	0.100001	NM_014691		0	7	7	0	528	524	0		1	0		0	0	74	0	0	0.980204	1.695721e-01	0	0	0	49	0	7	528
INO80	54617	broad.mit.edu	37	15	41341604	41341604	+	Silent	SNP	C	C	T	rs181458553		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr15:41341604C>T	ENST00000361937.3	-	21	2881	c.2457G>A	c.(2455-2457)ccG>ccA	p.P819P	INO80_ENST00000401393.3_Silent_p.P819P			Q9ULG1	INO80_HUMAN	INO80 complex subunit	819	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CAAATAACTCCGGGTGATTAC	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		20105	0.001		0.0	False		,,,				2504	0.0					ENST00000361937.3	1.000000	0.730000	1.000000	0.930000	0.990000	0.971056	0.990000	1.000000																										0				49						c.(2455-2457)ccG>ccA		INO80 complex subunit		C		1,4405	2.1+/-5.4	0,1,2202	108.0	97.0	101.0		2457	0.9	1.0	15		101	0,8600		0,0,4300	no	coding-synonymous	INO80	NM_017553.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		819/1557	41341604	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54617	3	121412	35				g.chr15:41341604C>T	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.2457G>A	chr15.hg19:g.41341604C>T		0					INO80_ENST00000401393.3_Silent_p.P819P	p.P819P			1	2	3	2.030819	Q9ULG1	INO80_HUMAN		21	2881	-			A6H8X4|Q9NTG6	Silent	SNP	ENST00000361937.3	1	1	hg19	c.2457G>A	CCDS10071.1	1																																																																																								0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.408	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	1	0	1	2	2	2	2	0	0	0	0	47	0	47	47	1	2	-3.075967	1	0.100001	NM_017553		0	20	19	0	340	339	0		1	1		0	0	47	0	0	0.999996	5.510321e-01	0	4	0	28	0	20	340
SEMA6D	80031	broad.mit.edu	37	15	48056428	48056428	+	Silent	SNP	A	A	G			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr15:48056428A>G	ENST00000316364.5	+	11	1462	c.1023A>G	c.(1021-1023)aaA>aaG	p.K341K	SEMA6D_ENST00000389425.3_Silent_p.K341K|SEMA6D_ENST00000536845.2_Silent_p.K341K|SEMA6D_ENST00000355997.3_Silent_p.K341K|SEMA6D_ENST00000354744.4_Silent_p.K341K|SEMA6D_ENST00000389428.3_Silent_p.K341K|SEMA6D_ENST00000389432.2_Silent_p.K341K|SEMA6D_ENST00000389433.2_Silent_p.K341K|SEMA6D_ENST00000558014.1_Silent_p.K341K|SEMA6D_ENST00000537942.1_Silent_p.K341K|SEMA6D_ENST00000558816.1_Silent_p.K341K|SEMA6D_ENST00000358066.4_Silent_p.K341K	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	341	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AAGTATTCAAAGGACGGTTTA	0.413																																						ENST00000316364.5	1.000000	0.790000	1.000000	0.990000	0.990000	0.982951	0.990000	1.000000																										0				77						c.(1021-1023)aaA>aaG		sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D							104.0	99.0	101.0					15																	48056428		2198	4297	6495	SO:0001819	synonymous_variant	80031	0	0					g.chr15:48056428A>G	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1023A>G	chr15.hg19:g.48056428A>G		0					SEMA6D_ENST00000355997.3_Silent_p.K341K|SEMA6D_ENST00000358066.4_Silent_p.K341K|SEMA6D_ENST00000389428.3_Silent_p.K341K|SEMA6D_ENST00000389433.2_Silent_p.K341K|SEMA6D_ENST00000537942.1_Silent_p.K341K|SEMA6D_ENST00000389432.2_Silent_p.K341K|SEMA6D_ENST00000536845.2_Silent_p.K341K|SEMA6D_ENST00000558816.1_Silent_p.K341K|SEMA6D_ENST00000558014.1_Silent_p.K341K|SEMA6D_ENST00000354744.4_Silent_p.K341K|SEMA6D_ENST00000389425.3_Silent_p.K341K	p.K341K	NM_153618.1	NP_705871.1	1	2	3	2.030819	Q8NFY4	SEM6D_HUMAN		11	1462	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	1	1	hg19	c.1023A>G	CCDS32225.1	1																																																																																								0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.413	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	1	0	1	2	2	2	2	0	0	0	0	50	0	50	49	1	2	-6.077965	1	0.100001	NM_024966		0	24	24	0	388	385	0		1	0		0	0	50	0	0	1.000000	3.316428e-02	0	0	0	5	0	24	388
POLG	5428	broad.mit.edu	37	15	89864367	89864367	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr15:89864367G>A	ENST00000268124.5	-	17	3056	c.2723C>T	c.(2722-2724)gCc>gTc	p.A908V	POLG_ENST00000442287.2_Missense_Mutation_p.A908V	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	908					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ATGCATGCCGGCAAAGTGGGC	0.582								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	ENST00000268124.5	1.000000	0.080000	1.000000	0.130000	0.220000	0.363205	0.220000	0.180000																										0				33						c.(2722-2724)gCc>gTc	DNA polymerases (catalytic subunits)	polymerase (DNA directed), gamma							74.0	82.0	79.0					15																	89864367		2200	4299	6499	SO:0001583	missense	5428	0	0					g.chr15:89864367G>A	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2723C>T	chr15.hg19:g.89864367G>A	ENSP00000268124:p.Ala908Val	0					POLG_ENST00000442287.2_Missense_Mutation_p.A908V	p.A908V	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	1	2	3	2.030819	P54098	DPOG1_HUMAN	STAD - Stomach adenocarcinoma(125;0.165)	17	3056	-	Lung NSC(78;0.0472)|all_lung(78;0.089)		Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	0	1	hg19	c.2723C>T	CCDS10350.1	0	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651395	0.88056	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.96716	-4.1;-4.1	5.24	4.31	0.51392	5.240000	4.310000	0.513920	DNA-directed DNA polymerase, family A, palm domain (2);	0.050208	0.85682	D	0.000000	D	0.97343	0.9131	L	0.58583	1.82	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.97312	0.9938	10	0.51188	T	0.08	-3.644	15.2004	0.73132	0.0:0.0:0.858:0.142	.	908	P54098	DPOG1_HUMAN	V	908	ENSP00000268124:A908V;ENSP00000399851:A908V	ENSP00000268124:A908V	A	-	2	0	0	POLG	87665371	87665371	1.000000	0.71417	0.451000	0.26982	0.989000	0.77384	7.638000	0.83328	1.184000	0.42957	0.655000	0.94253	GCC	0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.582	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	0	0	1	2	2	2	2	0	0	0	0	109	0	109	109	1	2	-2.004086	0	0.100001	NM_002693		0	6	6	0	659	654	0		1	0		0	0	109	0	0	0.964262	2.191350e-01	0	0	0	83	0	6	659
SRL	6345	broad.mit.edu	37	16	4253174	4253174	+	Missense_Mutation	SNP	C	C	G	rs74003216	byFrequency	TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr16:4253174C>G	ENST00000399609.3	-	3	264	c.252G>C	c.(250-252)gaG>gaC	p.E84D	SRL_ENST00000537996.1_Missense_Mutation_p.E42D	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	543	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						TACCTGTGATCTCATGCTGCC	0.597													C|||	45	0.00898562	0.0318	0.0043	5008	,	,		18337	0.0		0.0	False		,,,				2504	0.0					ENST00000399609.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999989	0.990000	1.000000																										0				21						c.(250-252)gaG>gaC		sarcalumenin		C	ASP/GLU	73,4073		0,73,2000	176.0	173.0	174.0		252	4.1	1.0	16	dbSNP_130	174	2,8418		0,2,4208	yes	missense	SRL	NM_001098814.1	45	0,75,6208	GG,GC,CC		0.0238,1.7607,0.5968	benign	84/474	4253174	75,12491	2073	4210	6283	SO:0001583	missense	6345	210	121008	56				g.chr16:4253174C>G	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.252G>C	chr16.hg19:g.4253174C>G	ENSP00000382518:p.Glu84Asp	0					SRL_ENST00000537996.1_Missense_Mutation_p.E42D	p.E84D	NM_001098814.1	NP_001092284.1	1	2	3	2.057098	Q86TD4	SRCA_HUMAN		3	264	-				Missense_Mutation	SNP	ENST00000399609.3	1	0	hg19	c.252G>C	CCDS42113.1	1	14	0.00641025641025641	13	0.026422764227642278	1	0.0027624309392265192	0	0.0	0	0.0	C	10.72	1.428480	0.25726	0.017607	2.38E-4	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.95447	-3.71;-3.71	4.14	4.14	0.48551	4.140000	4.140000	0.485510	.	0.000000	0.64402	U	0.000001	D	0.83110	0.5183	L	0.53249	1.67	0.54753	D	0.999989	B	0.27559	0.181	B	0.26864	0.074	D	0.83958	0.0320	10	0.21540	T	0.41	-19.3002	10.6044	0.45386	0.0:0.9102:0.0:0.0898	.	84	Q86TD4-2	.	D	84;542;42	ENSP00000382518:E84D;ENSP00000440350:E42D	ENSP00000333285:E542D	E	-	3	2	2	SRL	4193175	4193175	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.559000	0.53756	2.277000	0.76020	0.650000	0.86243	GAG	0.118081		TCGA-RB-AA9M-01A-11D-A397-08	0.597	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	1	0	1	2	2	2	2	0	0	0	0	119	0	119	119	1	2	-13.426180	1	0.100001	XM_064152		0	60	59	0	721	718	0		1			0	0	119	0	0	1.000000	0	0	0	0	0	0	60	721
KIAA0556	23247	broad.mit.edu	37	16	27761391	27761391	+	Missense_Mutation	SNP	G	G	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr16:27761391G>T	ENST00000261588.4	+	16	3129	c.3110G>T	c.(3109-3111)gGg>gTg	p.G1037V		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1037						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CTCATCGACGGGGTGAACAGG	0.552																																						ENST00000261588.4	1.000000	0.760000	1.000000	0.990000	0.990000	0.981608	0.990000	1.000000																										0				76						c.(3109-3111)gGg>gTg		KIAA0556							75.0	66.0	69.0					16																	27761391		2197	4300	6497	SO:0001583	missense	23247	0	0					g.chr16:27761391G>T	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3110G>T	chr16.hg19:g.27761391G>T	ENSP00000261588:p.Gly1037Val	0						p.G1037V	NM_015202.2	NP_056017.2	1	2	3	2.057098	O60303	K0556_HUMAN		16	3129	+			A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	1	1	hg19	c.3110G>T	CCDS32415.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936532	0.73442	.	.	ENSG00000047578	ENST00000261588	T	0.24908	1.83	5.22	5.22	0.72569	5.220000	5.220000	0.725690	.	0.052178	0.85682	D	0.000000	T	0.64681	0.2620	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75869	-0.3165	10	0.87932	D	0	-20.8399	18.7608	0.91849	0.0:0.0:1.0:0.0	.	1037	O60303	K0556_HUMAN	V	1037	ENSP00000261588:G1037V	ENSP00000261588:G1037V	G	+	2	0	0	KIAA0556	27668892	27668892	1.000000	0.71417	0.995000	0.50966	0.686000	0.39977	7.850000	0.86915	2.578000	0.87016	0.655000	0.94253	GGG	0.118081		TCGA-RB-AA9M-01A-11D-A397-08	0.552	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	1	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	2	-2.842415	1	0.100001	NM_015202		0	15	15	0	230	229	1		1	1		0	0	49	0	0	0.999883	2.302530e-01	0	5	0	9	0	15	230
TP53	7157	broad.mit.edu	37	17	7577082	7577082	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr17:7577082C>A	ENST00000269305.4	-	8	1045	c.856G>T	c.(856-858)Gaa>Taa	p.E286*	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.E286*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.E286*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E286*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E286*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286K(58)|p.E286*(22)|p.0?(8)|p.E286Q(5)|p.?(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.G279fs*59(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGATTCTCTTCCTCTGTGCGC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.640000	0.980000	0.780000	0.900000	0.888564	0.900000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		112	Substitution - Missense(63)|Substitution - Nonsense(22)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	p.E286K(58)|p.E286*(22)|p.0?(8)|p.E286Q(5)|p.?(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.G279fs*59(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)	lung(18)|upper_aerodigestive_tract(13)|breast(10)|large_intestine(9)|urinary_tract(9)|skin(9)|oesophagus(9)|haematopoietic_and_lymphoid_tissue(8)|liver(7)|central_nervous_system(6)|bone(4)|ovary(3)|stomach(2)|vulva(1)|soft_tissue(1)|eye(1)|biliary_tract(1)|endometrium(1)	24185	GRCh37	CM076567	TP53	M		c.(856-858)Gaa>Taa	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						95.0	81.0	86.0					17																	7577082		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577082C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.856G>T	chr17.hg19:g.7577082C>A	ENSP00000269305:p.Glu286*	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.E286*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.E286*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E286*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E286*|TP53_ENST00000413465.2_Intron	p.E286*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.915075	P04637	P53_HUMAN		8	1045	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.856G>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.072281	0.93950	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.99	4.99	0.66335	4.990000	4.990000	0.663350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.2961	15.807	0.78520	0.0:1.0:0.0:0.0	.	.	.	.	X	286;286;286;286;286;275;154	.	ENSP00000269305:E286X	E	-	1	0	0	TP53	7517807	7517807	1.000000	0.71417	0.972000	0.41901	0.455000	0.32408	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAA	0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	30	0	30	27	1	2	-7.026286	1	0.100001	NM_000546		0	14	14	0	154	152	0		1	0	1	0	0	30	2302	0	0.999778	9.780873e-01	1	1	76	72	1091	14	154
ZNF773	374928	broad.mit.edu	37	19	58017973	58017973	+	Silent	SNP	G	G	A	rs149516480		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr19:58017973G>A	ENST00000282292.4	+	4	650	c.510G>A	c.(508-510)acG>acA	p.T170T	ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Silent_p.T169T|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		TGACTCACACGGGAGAGAAGT	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		21189	0.0		0.0	False		,,,				2504	0.001					ENST00000282292.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999997	0.990000	1.000000																										0				22						c.(508-510)acG>acA		zinc finger protein 773		G		2,4404	2.1+/-5.4	0,2,2201	49.0	49.0	49.0		510	-2.4	0.0	19	dbSNP_134	49	4,8596	2.2+/-6.3	0,4,4296	no	coding-synonymous	ZNF773	NM_198542.1		0,6,6497	AA,AG,GG		0.0465,0.0454,0.0461		170/443	58017973	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	374928	19	121412	41				g.chr19:58017973G>A	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.510G>A	chr19.hg19:g.58017973G>A		1					ZNF773_ENST00000598770.1_Silent_p.T169T|ZNF773_ENST00000599847.1_Intron|ZNF773_ENST00000593916.1_Intron	p.T170T	NM_198542.1	NP_940944.1	0	3	3	2.057200	Q6PK81	ZN773_HUMAN		4	650	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	Q96DL8	Silent	SNP	ENST00000282292.4	0	1	hg19	c.510G>A	CCDS33134.1	1																																																																																								0.142450		TCGA-RB-AA9M-01A-11D-A397-08	0.488	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466475.1	1	0	1	2	2	2	2	0	0	0	0	23	0	23	23	1	2	-2.923011	1	0.100001	NM_198542		0	21	21	0	150	146	1		1	0		0	0	23	0	0	0.999998	1.735482e-01	0	0	0	6	0	21	150
FNDC5	252995	broad.mit.edu	37	1	33330257	33330257	+	Missense_Mutation	SNP	G	G	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr1:33330257G>T	ENST00000496770.1	-	5	629	c.416C>A	c.(415-417)gCa>gAa	p.A139E	FNDC5_ENST00000373471.3_Intron|FNDC5_ENST00000609187.1_Intron|FNDC5_ENST00000481487.1_Intron	NM_001171941.1	NP_001165412.1	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5	0					positive regulation of brown fat cell differentiation (GO:0090336)|response to muscle activity (GO:0014850)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCCAGGTCTTGCCCTCACCTT	0.602																																						ENST00000496770.1	0.670000	0.110000	0.490000	0.190000	0.320000	0.350674	0.320000	0.290000																										0				5						c.(415-417)gCa>gAa		fibronectin type III domain containing 5							115.0	99.0	105.0					1																	33330257		2203	4300	6503	SO:0001583	missense	252995	0	0					g.chr1:33330257G>T	AK092102	CCDS369.1, CCDS369.2, CCDS65483.1	1p34.3	2013-10-16			ENSG00000160097	ENSG00000160097		"""Fibronectin type III domain containing"""	20240	protein-coding gene	gene with protein product	"""irisin"""	611906				12384288, 22237023, 24120943	Standard	NM_153756		Approved	FRCP2	uc001bwg.3	Q8NAU1	OTTHUMG00000004015	ENST00000496770.1:c.416C>A	chr1.hg19:g.33330257G>T	ENSP00000476320:p.Ala139Glu	0					FNDC5_ENST00000481487.1_Intron|FNDC5_ENST00000373471.3_Intron|FNDC5_ENST00000609187.1_Intron	p.A139E	NM_001171941.1	NP_001165412.1	0	1	1	1.914001	Q8NAU1	FNDC5_HUMAN		5	629	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	A6NMC9|D3DPQ6|Q6P6D9|Q7Z676	Missense_Mutation	SNP	ENST00000496770.1	0	1	hg19	c.416C>A		0																																																																																								0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.602	FNDC5-006	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000011472.2	0	0	1	2	2	2	2	0	0	0	0	42	0	42	41	1	2	-3.275825	1	0.100001	NM_153756		0	4	4	0	245	243	0		1	0		0	0	42	0	0	0.889202	0	0	0	0	1	0	4	245
PRKACB	5567	broad.mit.edu	37	1	84668430	84668430	+	Missense_Mutation	SNP	A	A	G			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr1:84668430A>G	ENST00000370689.2	+	8	971	c.707A>G	c.(706-708)tAt>tGt	p.Y236C	PRKACB_ENST00000370680.1_Missense_Mutation_p.Y242C|PRKACB_ENST00000394839.2_Missense_Mutation_p.Y206C|PRKACB_ENST00000370688.3_Missense_Mutation_p.Y236C|PRKACB_ENST00000370685.3_Missense_Mutation_p.Y283C|PRKACB_ENST00000370682.3_Missense_Mutation_p.Y240C|PRKACB_ENST00000394838.2_Missense_Mutation_p.Y243C	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	236	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		GCAGCTGGCTATCCCCCATTC	0.368																																						ENST00000370689.2	1.000000	0.770000	0.990000	0.860000	0.940000	0.931798	0.940000	0.990000																										0				16						c.(706-708)tAt>tGt		protein kinase, cAMP-dependent, catalytic, beta							141.0	137.0	138.0					1																	84668430		2203	4300	6503	SO:0001583	missense	5567	0	0					g.chr1:84668430A>G	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.707A>G	chr1.hg19:g.84668430A>G	ENSP00000359723:p.Tyr236Cys	0					PRKACB_ENST00000370688.3_Missense_Mutation_p.Y236C|PRKACB_ENST00000370682.3_Missense_Mutation_p.Y240C|PRKACB_ENST00000370685.3_Missense_Mutation_p.Y283C|PRKACB_ENST00000370680.1_Missense_Mutation_p.Y242C|PRKACB_ENST00000394838.2_Missense_Mutation_p.Y243C|PRKACB_ENST00000394839.2_Missense_Mutation_p.Y206C	p.Y236C	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	0	1	1	1.914001	P22694	KAPCB_HUMAN		8	971	+			B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Missense_Mutation	SNP	ENST00000370689.2	1	1	hg19	c.707A>G	CCDS691.1	1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.558215	0.86231	.	.	ENSG00000142875	ENST00000370689;ENST00000370688;ENST00000370685;ENST00000370684;ENST00000394838;ENST00000370682;ENST00000370679;ENST00000370680;ENST00000394839;ENST00000370681	T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	5.54	5.54	0.83059	5.540000	5.540000	0.830590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	N	0.21545	0.675	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.996;0.991;0.999;0.995;0.999;0.994;1.0;0.99	D;D;D;D;P;D;D;D;D;D;D	0.91635	0.999;0.957;0.972;0.972;0.886;0.953;0.953;0.953;0.972;0.999;0.933	T	0.69767	-0.5056	10	0.87932	D	0	-9.6973	15.9801	0.80102	1.0:0.0:0.0:0.0	.	236;224;243;242;206;242;240;283;283;236;236	B2RB89;P22694-3;B4DKB0;B1APG3;B1APG4;P22694-6;P22694-7;P22694-2;B4E2L0;P22694;P22694-8	.;.;.;.;.;.;.;.;.;KAPCB_HUMAN;.	C	236;236;283;224;243;240;242;242;206;198	ENSP00000359723:Y236C;ENSP00000359722:Y236C;ENSP00000359719:Y283C;ENSP00000359718:Y224C;ENSP00000378314:Y243C;ENSP00000359716:Y240C;ENSP00000359714:Y242C;ENSP00000378315:Y206C	ENSP00000359713:Y242C	Y	+	2	0	0	PRKACB	84441018	84441018	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.229000	0.95273	2.230000	0.72887	0.528000	0.53228	TAT	0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.368	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	0	0	1	2	2	2	2	0	0	0	0	92	0	92	92	1	2	-20.000000	1	0.100001	NM_182948		0	36	36	0	484	483	0		1	0		0	0	92	0	0	1.000000	9.846336e-01	0	0	0	90	0	36	484
ZNF831	128611	broad.mit.edu	37	20	57767447	57767447	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr20:57767447C>T	ENST00000371030.2	+	1	1373	c.1373C>T	c.(1372-1374)gCg>gTg	p.A458V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	458							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GACATCCGCGCGCTGGAGCCA	0.677																																						ENST00000371030.2	1.000000	0.780000	1.000000	0.990000	0.990000	0.985185	0.990000	1.000000																										0				125						c.(1372-1374)gCg>gTg		zinc finger protein 831							31.0	39.0	36.0					20																	57767447		2047	4173	6220	SO:0001583	missense	128611	0	0					g.chr20:57767447C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1373C>T	chr20.hg19:g.57767447C>T	ENSP00000360069:p.Ala458Val	0						p.A458V	NM_178457.1	NP_848552.1	1	2	3	2.029886	Q5JPB2	ZN831_HUMAN		1	1373	+	all_lung(29;0.0085)		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	0	1	hg19	c.1373C>T	CCDS42894.1	1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850162	0.32699	.	.	ENSG00000124203	ENST00000371030	T	0.04809	3.55	5.21	5.21	0.72293	5.210000	5.210000	0.722930	.	.	.	.	.	T	0.14013	0.0339	L	0.47716	1.5	0.09310	N	0.999997	D	0.76494	0.999	P	0.56788	0.806	T	0.03060	-1.1077	9	0.62326	D	0.03	-11.9417	17.7439	0.88414	0.0:1.0:0.0:0.0	.	458	Q5JPB2	ZN831_HUMAN	V	458	ENSP00000360069:A458V	ENSP00000360069:A458V	A	+	2	0	0	ZNF831	57200842	57200842	0.910000	0.30920	0.257000	0.24404	0.026000	0.11368	4.059000	0.57470	2.423000	0.82170	0.655000	0.94253	GCG	0.111989		TCGA-RB-AA9M-01A-11D-A397-08	0.677	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	1	0	1	2	2	2	2	0	0	0	0	20	0	20	19	1	2	-16.253660	1	0.100001	NM_178457		0	12	12	0	165	162	0		1			0	0	20	0	0	0.999133	0	0	0	0	0	0	12	165
PCNT	5116	broad.mit.edu	37	21	47856946	47856946	+	Silent	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr21:47856946C>T	ENST00000359568.5	+	40	9158	c.9051C>T	c.(9049-9051)caC>caT	p.H3017H	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	3017	Interaction with NEK2.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CTTTACTGCACACGTTGGAGG	0.557																																						ENST00000359568.5	1.000000	0.870000	1.000000	0.990000	0.990000	0.992200	0.990000	1.000000																										0				104						c.(9049-9051)caC>caT		pericentrin							109.0	91.0	97.0					21																	47856946		2203	4300	6503	SO:0001819	synonymous_variant	5116	0	0					g.chr21:47856946C>T	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.9051C>T	chr21.hg19:g.47856946C>T		0					PCNT_ENST00000480896.1_3'UTR	p.H3017H	NM_006031.5	NP_006022.3	1	2	3	2.033801	O95613	PCNT_HUMAN		40	9158	+	Breast(49;0.112)		O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	1	1	hg19	c.9051C>T	CCDS33592.1	1																																																																																								0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.557	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	1	0	1	2	2	2	2	0	0	0	0	64	0	64	63	1	2	-6.990694	1	0.100001	NM_006031		0	28	28	0	424	420	0		1	1		0	0	64	0	0	1.000000	3.893809e-01	0	2	0	19	0	28	424
ZNF70	7621	broad.mit.edu	37	22	24087156	24087156	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr22:24087156C>T	ENST00000341976.3	-	2	632	c.172G>A	c.(172-174)Gaa>Aaa	p.E58K		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	58					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						TCATTTTCTTCGTCCTGCTCA	0.507																																						ENST00000341976.3	1.000000	0.870000	1.000000	0.990000	0.990000	0.991638	0.990000	1.000000																										0				21						c.(172-174)Gaa>Aaa		zinc finger protein 70							101.0	101.0	101.0					22																	24087156		2203	4300	6503	SO:0001583	missense	7621	1	121412	30				g.chr22:24087156C>T	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.172G>A	chr22.hg19:g.24087156C>T	ENSP00000339314:p.Glu58Lys	0						p.E58K	NM_021916.2	NP_068735.1	0	1	1	1.925720	Q9UC06	ZNF70_HUMAN		2	632	-				Missense_Mutation	SNP	ENST00000341976.3	1	1	hg19	c.172G>A	CCDS13812.1	1	.	.	.	.	.	.	.	.	.	.	C	4.116	0.019653	0.08006	.	.	ENSG00000187792	ENST00000341976	T	0.06294	3.32	3.26	0.946	0.19549	3.260000	0.946000	0.195490	.	.	.	.	.	T	0.05044	0.0135	L	0.36672	1.1	0.09310	N	1	B	0.24132	0.098	B	0.12837	0.008	T	0.38499	-0.9658	9	0.87932	D	0	.	3.5857	0.07970	0.4283:0.437:0.0:0.1346	.	58	Q9UC06	ZNF70_HUMAN	K	58	ENSP00000339314:E58K	ENSP00000339314:E58K	E	-	1	0	0	ZNF70	22417156	22417156	0.039000	0.19947	0.000000	0.03702	0.011000	0.07611	0.251000	0.18257	0.324000	0.23333	0.650000	0.86243	GAA	0.069768		TCGA-RB-AA9M-01A-11D-A397-08	0.507	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	1	0	1	2	2	2	2	0	0	0	0	85	0	85	84	1	2	-7.704658	1	0.100001	NM_021916		0	31	31	0	419	417	0		1	0		0	0	85	0	0	1.000000	2.794341e-02	0	0	0	4	0	31	419
TTN	7273	broad.mit.edu	37	2	179430078	179430078	+	Silent	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:179430078G>A	ENST00000591111.1	-	276	76082	c.75858C>T	c.(75856-75858)aaC>aaT	p.N25286N	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.N17987N|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.N17862N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Silent_p.N26927N|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.N18054N|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Silent_p.N24359N|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25286	Ig-like 124.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTTCAACGTTTACTCTTG	0.393																																						ENST00000591111.1	1.000000	0.820000	1.000000	0.970000	0.990000	0.983014	0.990000	1.000000																										0				1448						c.(75856-75858)aaC>aaT		titin							163.0	152.0	156.0					2																	179430078		1854	4099	5953	SO:0001819	synonymous_variant	7273	1	120816	35				g.chr2:179430078G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75858C>T	chr2.hg19:g.179430078G>A		0					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Silent_p.N24359N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.N17862N|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Silent_p.N26927N|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Silent_p.N18054N|TTN_ENST00000359218.5_Silent_p.N17987N|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.N25286N			1	2	3	2.030298	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	76082	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	1	1	hg19	c.75858C>T		1																																																																																								0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	108	0	108	108	1	2	-6.449671	1	0.100001	NM_133378		0	39	39	0	670	669	0		1			0	0	108	0	0	1.000000	0	0	0	0	0	0	39	670
TTN	7273	broad.mit.edu	37	2	179483095	179483095	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:179483095C>T	ENST00000591111.1	-	202	42391	c.42167G>A	c.(42166-42168)cGt>cAt	p.R14056H	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R6757H|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R6632H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R15697H|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R6824H|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R13129H|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14056	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTAATGTCACGTCTTTCAAC	0.438																																						ENST00000591111.1	1.000000	0.460000	1.000000	0.650000	0.920000	0.856392	0.920000	1.000000																										0				1448						c.(42166-42168)cGt>cAt		titin							76.0	74.0	74.0					2																	179483095		1923	4122	6045	SO:0001583	missense	7273	4	120812	37				g.chr2:179483095C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.42167G>A	chr2.hg19:g.179483095C>T	ENSP00000465570:p.Arg14056His	0					TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R13129H|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R6632H|TTN_ENST00000589042.1_Missense_Mutation_p.R15697H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R6824H|TTN_ENST00000359218.5_Missense_Mutation_p.R6757H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA	p.R14056H			1	2	3	2.030298	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	202	42391	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.42167G>A		1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955264	0.53293	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.75	5.75	0.90469	5.750000	5.750000	0.904690	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82499	0.5050	M	0.91140	3.18	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.85254	0.1046	9	0.87932	D	0	.	20.3046	0.98621	0.0:1.0:0.0:0.0	.	6632;6757;6824;14056	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	13129;6632;6824;6757;6632	ENSP00000343764:R13129H;ENSP00000434586:R6632H;ENSP00000340554:R6824H;ENSP00000352154:R6757H	ENSP00000340554:R6824H	R	-	2	0	0	TTN	179191340	179191340	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.878000	0.98634	0.650000	0.86243	CGT	0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	44	0	44	42	1	2	-3.902299	1	0.100001	NM_133378		0	11	11	0	258	256	0		1	0		0	0	44	0	0	0.998362	6.087837e-03	0	0	0	3	0	11	258
DNAH7	56171	broad.mit.edu	37	2	196825327	196825327	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:196825327G>A	ENST00000312428.6	-	18	2648	c.2548C>T	c.(2548-2550)Cgc>Tgc	p.R850C		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	850	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.R850C(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGCCTGGGGCGCAAACCAGGA	0.453																																						ENST00000312428.6	1.000000	0.090000	1.000000	0.160000	0.270000	0.407629	0.270000	0.210000																										1	Substitution - Missense(1)	p.R850C(1)	prostate(1)	205						c.(2548-2550)Cgc>Tgc		dynein, axonemal, heavy chain 7							124.0	126.0	125.0					2																	196825327		1935	4131	6066	SO:0001583	missense	56171	4	120856	40				g.chr2:196825327G>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2548C>T	chr2.hg19:g.196825327G>A	ENSP00000311273:p.Arg850Cys	0						p.R850C	NM_018897.2	NP_061720.2	1	2	3	2.036327	Q8WXX0	DYH7_HUMAN		18	2648	-			B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	0	1	hg19	c.2548C>T	CCDS42794.1	0	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952760	0.53293	.	.	ENSG00000118997	ENST00000312428	T	0.63417	-0.04	5.74	5.74	0.90152	5.740000	5.740000	0.901520	Dynein heavy chain, domain-2 (1);	0.125121	0.53938	D	0.000044	D	0.84392	0.5462	M	0.93375	3.41	0.80722	D	1	D	0.76494	0.999	D	0.64877	0.93	D	0.87323	0.2319	10	0.59425	D	0.04	.	19.9196	0.97082	0.0:0.0:1.0:0.0	.	850	Q8WXX0	DYH7_HUMAN	C	850	ENSP00000311273:R850C	ENSP00000311273:R850C	R	-	1	0	0	DNAH7	196533572	196533572	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.626000	0.61269	2.708000	0.92522	0.650000	0.86243	CGC	0.113738		TCGA-RB-AA9M-01A-11D-A397-08	0.453	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	0	0	1	2	2	2	2	0	0	0	0	79	0	79	78	1	2	-1.784081	0	0.100001	NM_018897		0	5	5	0	465	464	0		1	0		0	0	79	0	0	0.937501	0	0	0	0	1	0	5	465
C2orf44	80304	broad.mit.edu	37	2	24262247	24262247	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:24262247G>A	ENST00000295148.4	-	2	175	c.118C>T	c.(118-120)Cgg>Tgg	p.R40W	C2orf44_ENST00000406895.3_Missense_Mutation_p.R40W	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	40									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGTGAAGCCGCAAATCAGTT	0.507			T	ALK	NSCLC																																	ENST00000295148.4	1.000000	0.100000	1.000000	0.180000	0.310000	0.431727	0.310000	0.250000				Dom	yes			Dom	yes		2	2p23.3	2p23.3	80304	T	chromosome 2 open reading frame 44				E	E	ALK		NSCLC	C2orf44/ALK(2)	0				24						c.(118-120)Cgg>Tgg		chromosome 2 open reading frame 44							119.0	105.0	110.0					2																	24262247		2203	4300	6503	SO:0001583	missense	80304	9	121412	42				g.chr2:24262247G>A	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.118C>T	chr2.hg19:g.24262247G>A	ENSP00000295148:p.Arg40Trp	0					C2orf44_ENST00000406895.3_Missense_Mutation_p.R40W	p.R40W	NM_025203.2	NP_079479.1	1	2	3	2.031292	Q9H6R7	CB044_HUMAN		2	175	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		D6W532|Q8IYK0|Q9HBP5	Missense_Mutation	SNP	ENST00000295148.4	0	1	hg19	c.118C>T	CCDS1705.1	0	.	.	.	.	.	.	.	.	.	.	G	8.548	0.874935	0.17395	.	.	ENSG00000163026	ENST00000295148;ENST00000406895;ENST00000443232	T;T;T	0.43688	3.4;3.4;0.94	5.24	3.37	0.38596	5.240000	3.370000	0.385960	.	0.488094	0.24352	N	0.039266	T	0.20740	0.0499	N	0.08118	0	0.09310	N	1	P;P	0.49447	0.61;0.924	B;B	0.40782	0.275;0.34	T	0.05209	-1.0899	10	0.39692	T	0.17	2.1853	7.5072	0.27551	0.1561:0.0:0.7084:0.1355	.	40;40	Q9H6R7-2;Q9H6R7	.;CB044_HUMAN	W	40	ENSP00000295148:R40W;ENSP00000385816:R40W;ENSP00000413426:R40W	ENSP00000295148:R40W	R	-	1	2	2	C2orf44	24115751	24115751	0.973000	0.33851	0.336000	0.25522	0.420000	0.31355	1.353000	0.34045	0.660000	0.30964	0.655000	0.94253	CGG	0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.507	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	0	0	1	2	2	2	2	0	0	0	0	50	0	50	49	1	2	-1.887659	0	0.100001	NM_025203		0	5	5	0	397	394	0		1	0		0	0	50	0	0	0.936677	2.467431e-03	0	0	0	5	0	5	397
SOCS5	9655	broad.mit.edu	37	2	46986955	46986955	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:46986955G>A	ENST00000306503.5	+	2	1458	c.1286G>A	c.(1285-1287)cGa>cAa	p.R429Q	SOCS5_ENST00000394861.2_Missense_Mutation_p.R429Q	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	429	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)	p.R429L(1)|p.R429Q(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CTGCATGCCCGAATTGAGCAG	0.498																																						ENST00000306503.5	1.000000	0.240000	1.000000	0.320000	0.430000	0.531238	0.430000	0.390000																										2	Substitution - Missense(2)	p.R429L(1)|p.R429Q(1)	ovary(1)|lung(1)	22						c.(1285-1287)cGa>cAa		suppressor of cytokine signaling 5							103.0	101.0	102.0					2																	46986955		2203	4300	6503	SO:0001583	missense	9655	0	0					g.chr2:46986955G>A	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1286G>A	chr2.hg19:g.46986955G>A	ENSP00000305133:p.Arg429Gln	0					SOCS5_ENST00000394861.2_Missense_Mutation_p.R429Q	p.R429Q	NM_014011.4	NP_054730.1	1	2	3	2.031292	O75159	SOCS5_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.114)	2	1458	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	1	1	hg19	c.1286G>A	CCDS1830.1	0	.	.	.	.	.	.	.	.	.	.	G	16.21	3.060002	0.55325	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	D;D	0.89270	-2.49;-2.49	5.43	3.64	0.41730	5.430000	3.640000	0.417300	SH2 motif (4);	0.056973	0.64402	D	0.000001	D	0.93916	0.8053	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.93888	0.7177	10	0.87932	D	0	-11.2549	11.8239	0.52256	0.1425:0.0:0.8575:0.0	.	429	O75159	SOCS5_HUMAN	Q	429	ENSP00000305133:R429Q;ENSP00000378330:R429Q	ENSP00000305133:R429Q	R	+	2	0	0	SOCS5	46840459	46840459	1.000000	0.71417	0.715000	0.30552	0.898000	0.52572	9.657000	0.98554	0.867000	0.35654	-0.136000	0.14681	CGA	0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.498	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2	0	0	1	2	2	2	2	0	0	0	0	92	0	92	92	1	2	-2.519424	1	0.100001			0	15	15	0	750	747	0		1	1		0	0	92	0	0	0.999867	2.267176e-01	0	2	0	41	0	15	750
TSPYL6	388951	broad.mit.edu	37	2	54482353	54482353	+	Silent	SNP	C	C	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:54482353C>A	ENST00000317802.7	-	1	1056	c.936G>T	c.(934-936)gtG>gtT	p.V312V	ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000606865.1_Intron|ACYP2_ENST00000607452.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	312					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						TGACCTCATACACCTTTACAA	0.473																																						ENST00000317802.7	1.000000	0.060000	1.000000	0.120000	0.200000	0.351871	0.200000	0.160000																										0				20						c.(934-936)gtG>gtT		TSPY-like 6							91.0	90.0	90.0					2																	54482353		2074	4244	6318	SO:0001819	synonymous_variant	388951	0	0					g.chr2:54482353C>A	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.936G>T	chr2.hg19:g.54482353C>A		0					ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000606865.1_Intron|ACYP2_ENST00000303536.4_Intron	p.V312V	NM_001003937.2	NP_001003937.2	1	2	3	2.031292	Q8N831	TSYL6_HUMAN		1	1056	-			Q6NUJ3	Silent	SNP	ENST00000317802.7	0	1	hg19	c.936G>T	CCDS42682.1	0																																																																																								0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.473	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	0	0	1	2	2	2	2	0	0	0	0	89	0	89	89	1	2	-3.111406	1	0.100001	XM_371494		0	5	5	0	605	604	0		1			0	0	89	0	0	0.937769	0	0	0	0	0	0	5	605
MAP2	4133	broad.mit.edu	37	2	210558569	210558569	+	Missense_Mutation	SNP	G	G	C			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr2:210558569G>C	ENST00000360351.4	+	7	2181	c.1675G>C	c.(1675-1677)Gat>Cat	p.D559H	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.D555H|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	559					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AGCTGAGCTTGATATGCCATT	0.368																																					Pancreas(27;423 979 28787 29963)	ENST00000360351.4	1.000000	0.760000	1.000000	0.950000	0.990000	0.976339	0.990000	1.000000																										0				124						c.(1675-1677)Gat>Cat		microtubule-associated protein 2	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)						103.0	100.0	101.0					2																	210558569		2203	4300	6503	SO:0001583	missense	4133	0	0					g.chr2:210558569G>C		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1675G>C	chr2.hg19:g.210558569G>C	ENSP00000353508:p.Asp559His	0					MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.D555H|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	p.D559H	NM_002374.3	NP_002365.3	1	2	3	2.036327	P11137	MTAP2_HUMAN		7	2181	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	1	1	hg19	c.1675G>C	CCDS2384.1	1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362979	0.24684	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.19938	2.11;2.11	6.16	5.27	0.74061	6.160000	5.270000	0.740610	MAP2/Tau projection (1);	0.357573	0.27451	N	0.019304	T	0.30230	0.0758	L	0.50333	1.59	0.09310	N	0.999995	P;P	0.50819	0.925;0.939	P;P	0.54499	0.639;0.754	T	0.18209	-1.0344	10	0.87932	D	0	-4.3757	7.7851	0.29087	0.129:0.2609:0.6101:0.0	.	555;559	P11137-3;P11137	.;MAP2_HUMAN	H	559;555	ENSP00000353508:D559H;ENSP00000392164:D555H	ENSP00000353508:D559H	D	+	1	0	0	MAP2	210266814	210266814	0.358000	0.24947	0.809000	0.32408	0.394000	0.30568	1.674000	0.37544	1.561000	0.49584	0.650000	0.86243	GAT	0.113738		TCGA-RB-AA9M-01A-11D-A397-08	0.368	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	1	0	1	2	2	2	2	0	0	0	0	57	0	57	56	1	2	-5.963975	1	0.100001	NM_001039538		0	23	23	0	388	386	0		1	0		0	0	57	0	0	0.999999	3.509141e-03	0	0	0	2	0	23	388
CNTN4	152330	broad.mit.edu	37	3	2861248	2861248	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr3:2861248C>T	ENST00000397461.1	+	6	821	c.437C>T	c.(436-438)cCg>cTg	p.P146L	CNTN4_ENST00000418658.1_Missense_Mutation_p.P146L|CNTN4_ENST00000427331.1_Missense_Mutation_p.P146L	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	146	Ig-like C2-type 2.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CTGTGTGGCCCGCCACCCCAT	0.448																																						ENST00000397461.1	1.000000	0.570000	0.970000	0.720000	0.860000	0.850821	0.860000	0.990000																										0				61						c.(436-438)cCg>cTg		contactin 4							97.0	95.0	96.0					3																	2861248		1964	4160	6124	SO:0001583	missense	152330	0	0					g.chr3:2861248C>T	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.437C>T	chr3.hg19:g.2861248C>T	ENSP00000380602:p.Pro146Leu	1					CNTN4_ENST00000418658.1_Missense_Mutation_p.P146L|CNTN4_ENST00000427331.1_Missense_Mutation_p.P146L	p.P146L	NM_001206955.1	NP_001193884.1	0	1	1	1.898297	Q8IWV2	CNTN4_HUMAN		6	821	+		Ovarian(110;0.156)	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	1	1	hg19	c.437C>T	CCDS43041.1	1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708348	0.89018	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331	T;T;T	0.65178	-0.14;-0.14;-0.14	5.86	5.86	0.93980	5.860000	5.860000	0.939800	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82641	0.5081	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	D	0.85330	0.1089	10	0.87932	D	0	.	17.1044	0.86658	0.0:1.0:0.0:0.0	.	146;146	B3KTK4;Q8IWV2	.;CNTN4_HUMAN	L	146	ENSP00000396010:P146L;ENSP00000380602:P146L;ENSP00000413642:P146L	ENSP00000380602:P146L	P	+	2	0	0	CNTN4	2836248	2836248	1.000000	0.71417	0.872000	0.34217	0.971000	0.66376	5.939000	0.70179	2.765000	0.95021	0.655000	0.94253	CCG	0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.448	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2	1	0	1	2	2	2	2	0	0	0	0	42	0	42	41	1	2	-2.490115	0	0.100001			0	14	14	0	212	209	0		1	0		0	0	42	0	0	0.999761	2.112637e-01	0	0	0	13	0	14	212
ZBTB47	92999	broad.mit.edu	37	3	42703100	42703100	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr3:42703100G>A	ENST00000232974.6	+	3	1878	c.1597G>A	c.(1597-1599)Gcc>Acc	p.A533T	ZBTB47_ENST00000457842.3_Missense_Mutation_p.A157T|ZBTB47_ENST00000505904.1_Missense_Mutation_p.A79T			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	533					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		CTACACCATGGCCCACGTGCG	0.522																																						ENST00000232974.6	1.000000	0.670000	0.980000	0.810000	0.910000	0.901181	0.910000	0.990000																										0				13						c.(1597-1599)Gcc>Acc		zinc finger and BTB domain containing 47							62.0	62.0	62.0					3																	42703100		2010	4192	6202	SO:0001583	missense	92999	0	0					g.chr3:42703100G>A	AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.1597G>A	chr3.hg19:g.42703100G>A	ENSP00000232974:p.Ala533Thr	1					ZBTB47_ENST00000505904.1_Missense_Mutation_p.A79T|ZBTB47_ENST00000457842.3_Missense_Mutation_p.A157T	p.A533T			0	1	1	1.898297	Q9UFB7	ZBT47_HUMAN		3	1878	+			H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Missense_Mutation	SNP	ENST00000232974.6	1	1	hg19	c.1597G>A	CCDS46805.2	1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313988	0.81358	.	.	ENSG00000114853	ENST00000232974;ENST00000542870;ENST00000457842;ENST00000505904	T;T;T	0.07567	3.18;3.18;3.18	4.84	4.84	0.62591	4.840000	4.840000	0.625910	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.30541	0.0768	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.03514	-1.1029	10	0.52906	T	0.07	-29.8628	17.9286	0.88991	0.0:0.0:1.0:0.0	.	157	Q9UFB7	ZBT47_HUMAN	T	533;432;157;79	ENSP00000232974:A533T;ENSP00000411491:A157T;ENSP00000420968:A79T	ENSP00000232974:A533T	A	+	1	0	0	ZBTB47	42678104	42678104	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	9.785000	0.99042	2.230000	0.72887	0.561000	0.74099	GCC	0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.522	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343485.3	1	0	1	2	2	2	2	0	0	0	0	35	0	35	35	1	2	-3.221917	1	0.100001	NM_145166		0	17	17	0	192	191	0		1	1		0	0	35	0	0	0.999970	7.763571e-01	0	4	0	30	0	17	192
ARHGAP31	57514	broad.mit.edu	37	3	119101232	119101232	+	Silent	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr3:119101232G>A	ENST00000264245.4	+	5	1057	c.525G>A	c.(523-525)gcG>gcA	p.A175A		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	175	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TGGTGTGGGCGCCAAACCTCC	0.557																																					Pancreas(7;176 297 5394 51128 51241)	ENST00000264245.4	1.000000	0.140000	1.000000	0.240000	0.410000	0.507849	0.410000	0.320000																										0				67						c.(523-525)gcG>gcA		Rho GTPase activating protein 31							61.0	71.0	68.0					3																	119101232		1942	4142	6084	SO:0001819	synonymous_variant	57514	0	0					g.chr3:119101232G>A		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.525G>A	chr3.hg19:g.119101232G>A		0						p.A175A	NM_020754.2	NP_065805.2	1	2	3	2.030482	Q2M1Z3	RHG31_HUMAN		5	1057	+			Q9ULL6	Silent	SNP	ENST00000264245.4	0	1	hg19	c.525G>A	CCDS43135.1	0																																																																																								0.112427		TCGA-RB-AA9M-01A-11D-A397-08	0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2	0	0	1	2	2	2	2	0	0	0	0	34	0	34	34	1	2	-2.420032	0	0.100001			0	5	5	0	297	297	0		1	0		0	0	34	0	0	0.938047	4.772194e-02	0	0	0	17	0	5	297
FAM71B	153745	broad.mit.edu	37	5	156590151	156590151	+	Silent	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr5:156590151C>T	ENST00000302938.4	-	2	1220	c.1125G>A	c.(1123-1125)gcG>gcA	p.A375A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	375						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCCTGCAAACGCCGCACTCA	0.582																																						ENST00000302938.4	1.000000	0.810000	1.000000	0.990000	0.990000	0.987494	0.990000	1.000000																										0				68						c.(1123-1125)gcG>gcA		family with sequence similarity 71, member B							41.0	43.0	42.0					5																	156590151		2203	4300	6503	SO:0001819	synonymous_variant	153745	11	121412	41				g.chr5:156590151C>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1125G>A	chr5.hg19:g.156590151C>T		0						p.A375A	NM_130899.2	NP_570969.2	1	2	3	2.040345	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	2	1220	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	0	1	hg19	c.1125G>A	CCDS4335.1	1																																																																																								0.114610		TCGA-RB-AA9M-01A-11D-A397-08	0.582	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	1	0	0	2	21	2	2	1	0	1	1	34	0	34	32	1	2	-19.136370	1	0.100001	NM_130899		0	15	15	0	214	212	0		0			1	0	34	0	0	0.181686	0	0	0	0	0	0	15	214
PDZD2	23037	broad.mit.edu	37	5	32108081	32108081	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr5:32108081C>T	ENST00000438447.1	+	25	8748	c.8360C>T	c.(8359-8361)gCg>gTg	p.A2787V	PDZD2_ENST00000513490.1_3'UTR|CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000282493.3_Missense_Mutation_p.A2787V			O15018	PDZD2_HUMAN	PDZ domain containing 2	2787	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GTAGGTGGTGCGGCTGAACAA	0.348																																						ENST00000438447.1	1.000000	0.110000	1.000000	0.190000	0.300000	0.439996	0.300000	0.250000																										0				148						c.(8359-8361)gCg>gTg		PDZ domain containing 2							111.0	116.0	114.0					5																	32108081		2203	4300	6503	SO:0001583	missense	23037	2	121412	39				g.chr5:32108081C>T	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8360C>T	chr5.hg19:g.32108081C>T	ENSP00000402033:p.Ala2787Val	0					PDZD2_ENST00000282493.3_Missense_Mutation_p.A2787V|CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000513490.1_3'UTR	p.A2787V			1	2	3	2.040345	O15018	PDZD2_HUMAN		25	8748	+			Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	0	1	hg19	c.8360C>T	CCDS34137.1	0	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600307	0.87055	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.37411	1.2;1.2	5.88	5.88	0.94601	5.880000	5.880000	0.946010	PDZ/DHR/GLGF (4);	0.000000	0.56097	D	0.000030	T	0.51890	0.1701	L	0.39898	1.24	0.52501	D	0.999956	D	0.89917	1.0	D	0.97110	1.0	T	0.30149	-0.9988	10	0.29301	T	0.29	.	17.7218	0.88353	0.0:1.0:0.0:0.0	.	2787	O15018	PDZD2_HUMAN	V	2787;2588;2787	ENSP00000402033:A2787V;ENSP00000282493:A2787V	ENSP00000282493:A2787V	A	+	2	0	0	PDZD2	32143838	32143838	1.000000	0.71417	0.999000	0.59377	0.597000	0.36814	6.955000	0.76007	2.778000	0.95560	0.655000	0.94253	GCG	0.114610		TCGA-RB-AA9M-01A-11D-A397-08	0.348	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1	0	0	1	2	2	2	2	0	0	0	0	60	0	60	60	1	2	-1.894700	0	0.100001			0	6	6	0	478	474	0		1	0		0	0	60	0	0	0.964273	1.384985e-03	0	0	0	4	0	6	478
FYB	2533	broad.mit.edu	37	5	39127879	39127879	+	Missense_Mutation	SNP	A	A	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr5:39127879A>T	ENST00000351578.6	-	11	2061	c.1871T>A	c.(1870-1872)aTt>aAt	p.I624N	FYB_ENST00000515010.1_Missense_Mutation_p.I624N|FYB_ENST00000505428.1_Missense_Mutation_p.I624N|FYB_ENST00000540520.1_Missense_Mutation_p.I634N|FYB_ENST00000512982.1_Missense_Mutation_p.I624N	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	624					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CCCATCATAAATGTCATCATC	0.328																																						ENST00000351578.6	1.000000	0.990000	1.000000	0.990000	0.990000	0.998882	0.990000	1.000000																										0				45						c.(1870-1872)aTt>aAt		FYN binding protein							108.0	102.0	104.0					5																	39127879		1841	4094	5935	SO:0001583	missense	2533	0	0					g.chr5:39127879A>T	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1871T>A	chr5.hg19:g.39127879A>T	ENSP00000316460:p.Ile624Asn	0					FYB_ENST00000505428.1_Missense_Mutation_p.I624N|FYB_ENST00000515010.1_Missense_Mutation_p.I624N|FYB_ENST00000540520.1_Missense_Mutation_p.I634N|FYB_ENST00000512982.1_Missense_Mutation_p.I624N	p.I624N	NM_199335.3	NP_955367.1	1	2	3	2.040345	O15117	FYB_HUMAN	Epithelial(62;0.235)	11	2061	-	all_lung(31;0.000343)		A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	0	1	hg19	c.1871T>A	CCDS47200.1	1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.765303	0.49574	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.37915	1.47;1.47;1.17;1.17;1.17	5.38	5.38	0.77491	5.380000	5.380000	0.774910	.	0.067000	0.64402	D	0.000010	T	0.54208	0.1844	L	0.49126	1.545	0.43942	D	0.996602	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.995	T	0.56038	-0.8045	10	0.66056	D	0.02	-13.8248	14.2579	0.66065	1.0:0.0:0.0:0.0	.	634;624	B4DLN2;O15117	.;FYB_HUMAN	N	624;624;624;624;634;624	ENSP00000316460:I624N;ENSP00000426346:I624N;ENSP00000425845:I624N;ENSP00000427114:I624N;ENSP00000442840:I634N	ENSP00000316460:I624N	I	-	2	0	0	FYB	39163636	39163636	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.035000	0.70940	2.164000	0.68074	0.477000	0.44152	ATT	0.114610		TCGA-RB-AA9M-01A-11D-A397-08	0.328	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	1	0	1	2	2	2	2	0	0	0	0	19	0	19	19	1	2	-19.982870	1	0.100001	NM_001465		0	15	15	0	152	152	0		1	0		0	0	19	0	0	0.999897	2.448651e-01	0	0	0	10	0	15	152
CMYA5	202333	broad.mit.edu	37	5	79032394	79032394	+	Silent	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr5:79032394C>T	ENST00000446378.2	+	2	7837	c.7806C>T	c.(7804-7806)ctC>ctT	p.L2602L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2602					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAGCCATGCTCGCAGAGGCTC	0.398																																						ENST00000446378.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999654	0.990000	1.000000																										0				128						c.(7804-7806)ctC>ctT		cardiomyopathy associated 5							60.0	61.0	61.0					5																	79032394		1853	4106	5959	SO:0001819	synonymous_variant	202333	0	0					g.chr5:79032394C>T	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7806C>T	chr5.hg19:g.79032394C>T		0						p.L2602L	NM_153610.3	NP_705838.3	1	2	3	2.040345	Q8N3K9	CMYA5_HUMAN		2	7837	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	1	1	hg19	c.7806C>T	CCDS47238.1	1																																																																																								0.114610		TCGA-RB-AA9M-01A-11D-A397-08	0.398	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	1	0	1	2	2	2	2	0	0	0	0	32	0	32	32	1	2	-3.221906	1	0.100001	NM_153610		0	18	18	0	173	173	0		1	0		0	0	32	0	0	0.999986	0	0	0	0	1	0	18	173
FLT4	2324	broad.mit.edu	37	5	180048549	180048549	+	Silent	SNP	C	C	G	rs370019097		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr5:180048549C>G	ENST00000261937.6	-	13	2091	c.2013G>C	c.(2011-2013)tcG>tcC	p.S671S	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Silent_p.S671S|FLT4_ENST00000393347.3_Silent_p.S671S	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	671	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CACCCTGCACCGACAGGTACT	0.672																																					Colon(97;1075 1466 27033 27547 35871)	ENST00000261937.6	1.000000	0.630000	1.000000	0.870000	0.990000	0.952241	0.990000	1.000000																										0				71						c.(2011-2013)tcG>tcC		fms-related tyrosine kinase 4	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)						32.0	33.0	33.0					5																	180048549		2197	4293	6490	SO:0001819	synonymous_variant	2324	0	0					g.chr5:180048549C>G	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2013G>C	chr5.hg19:g.180048549C>G		0					FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Silent_p.S671S|FLT4_ENST00000393347.3_Silent_p.S671S	p.S671S	NM_182925.4	NP_891555.2	1	2	3	2.040345	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	13	2091	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	1	1	hg19	c.2013G>C	CCDS4457.1	1																																																																																								0.114610		TCGA-RB-AA9M-01A-11D-A397-08	0.672	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4	1	0	1	2	2	2	2	0	0	0	0	40	0	40	39	1	2	-2.929030	1	0.100001			0	12	12	0	211	207	0		1	0		0	0	40	0	0	0.999098	7.694994e-02	0	0	0	8	0	12	211
GRIK2	2898	broad.mit.edu	37	6	102516294	102516294	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr6:102516294C>T	ENST00000421544.1	+	16	3125	c.2635C>T	c.(2635-2637)Cca>Tca	p.P879S	GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000369134.4_Missense_Mutation_p.P830S|GRIK2_ENST00000369137.3_Missense_Mutation_p.P803S	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	879					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AAAACATAAGCCACAGGCCCC	0.423																																						ENST00000421544.1	1.000000	0.720000	1.000000	0.850000	0.970000	0.942193	0.970000	1.000000																										0				83						c.(2635-2637)Cca>Tca		glutamate receptor, ionotropic, kainate 2	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)						113.0	102.0	106.0					6																	102516294		2203	4300	6503	SO:0001583	missense	2898	0	0					g.chr6:102516294C>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2635C>T	chr6.hg19:g.102516294C>T	ENSP00000397026:p.Pro879Ser	0					GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369137.3_Missense_Mutation_p.P803S|GRIK2_ENST00000369134.4_Missense_Mutation_p.P830S	p.P879S	NM_021956.4	NP_068775.1	0	0	0	1.920210	Q13002	GRIK2_HUMAN		16	3125	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	1	1	hg19	c.2635C>T	CCDS5048.1	1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886211	0.51908	.	.	ENSG00000164418	ENST00000421544;ENST00000369137;ENST00000369134	T;T;T	0.10288	2.89;3.11;2.9	5.79	5.79	0.91817	5.790000	5.790000	0.918170	.	0.049332	0.85682	D	0.000000	T	0.07863	0.0197	L	0.53249	1.67	0.58432	D	0.999999	B	0.16396	0.017	B	0.15484	0.013	T	0.10847	-1.0612	10	0.33141	T	0.24	.	20.0361	0.97558	0.0:1.0:0.0:0.0	.	879	Q13002	GRIK2_HUMAN	S	879;803;830	ENSP00000397026:P879S;ENSP00000358133:P803S;ENSP00000358130:P830S	ENSP00000358130:P830S	P	+	1	0	0	GRIK2	102622987	102622987	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.463000	0.80869	2.745000	0.94114	0.462000	0.41574	CCA	0.056604		TCGA-RB-AA9M-01A-11D-A397-08	0.423	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1	1	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	2	-7.060106	1	0.100001			0	22	22	0	300	296	0		1	0		0	0	51	0	0	0.999999	1.492248e-02	0	0	0	3	0	22	300
ZBED9	114821	broad.mit.edu	37	6	28543263	28543263	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr6:28543263G>A	ENST00000452236.2	-	3	1836	c.1219C>T	c.(1219-1221)Cgg>Tgg	p.R407W	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						TTTAATGACCGCAAAAAAGTT	0.373																																						ENST00000452236.2	1.000000	0.120000	1.000000	0.210000	0.360000	0.457661	0.360000	0.290000																										0				71						c.(1219-1221)Cgg>Tgg									47.0	50.0	49.0					6																	28543263		2200	4300	6500	SO:0001583	missense	0	0	0					g.chr6:28543263G>A																												ENST00000452236.2:c.1219C>T	chr6.hg19:g.28543263G>A	ENSP00000395259:p.Arg407Trp	0					SCAND3_ENST00000530247.1_5'Flank	p.R407W	NM_052923.1	NP_443155.1	1	2	3	2.021921				3	1836	-				Missense_Mutation	SNP	ENST00000452236.2	0	1	hg19	c.1219C>T	CCDS34355.1	0	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739153	0.49045	.	.	ENSG00000232040	ENST00000452236	T	0.41065	1.01	3.45	1.47	0.22746	3.450000	1.470000	0.227460	Integrase, catalytic core (2);Ribonuclease H-like (1);	.	.	.	.	T	0.45538	0.1347	M	0.71581	2.175	0.27885	N	0.939548	D	0.89917	1.0	D	0.75020	0.985	T	0.29027	-1.0025	9	0.87932	D	0	.	9.1527	0.36973	0.0:0.0:0.3848:0.6152	.	407	Q6R2W3	SCND3_HUMAN	W	407	ENSP00000395259:R407W	ENSP00000395259:R407W	R	-	1	2	2	SCAND3	28651242	28651242	0.490000	0.26012	0.999000	0.59377	0.981000	0.71138	0.152000	0.16302	0.208000	0.20626	0.655000	0.94253	CGG	0.110233		TCGA-RB-AA9M-01A-11D-A397-08	0.373	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3	0	0	1	2	2	2	2	0	0	0	0	57	0	57	57	1	2	-2.441249	0	0.100001			0	5	5	0	334	334	0		1	0		0	0	57	0	0	0.937987	3.601379e-04	0	0	0	2	0	5	334
GRM1	2911	broad.mit.edu	37	6	146480607	146480607	+	Missense_Mutation	SNP	G	G	A	rs553512718		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr6:146480607G>A	ENST00000282753.1	+	2	1059	c.824G>A	c.(823-825)cGc>cAc	p.R275H	GRM1_ENST00000507907.1_Missense_Mutation_p.R275H|GRM1_ENST00000392299.2_Missense_Mutation_p.R275H|GRM1_ENST00000492807.2_Missense_Mutation_p.R275H|GRM1_ENST00000355289.4_Missense_Mutation_p.R275H|GRM1_ENST00000361719.2_Missense_Mutation_p.R275H			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	275					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R275H(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CGACTCTTGCGCAAACTCCGA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18937	0.001		0.0	False		,,,				2504	0.0					ENST00000282753.1	0.760000	0.120000	0.560000	0.220000	0.360000	0.397873	0.360000	0.330000																										1	Substitution - Missense(1)	p.R275H(1)	large_intestine(1)	126						c.(823-825)cGc>cAc		glutamate receptor, metabotropic 1							93.0	84.0	87.0					6																	146480607		2203	4300	6503	SO:0001583	missense	2911	5	121410	38				g.chr6:146480607G>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.824G>A	chr6.hg19:g.146480607G>A	ENSP00000282753:p.Arg275His	0					GRM1_ENST00000492807.2_Missense_Mutation_p.R275H|GRM1_ENST00000355289.4_Missense_Mutation_p.R275H|GRM1_ENST00000507907.1_Missense_Mutation_p.R275H|GRM1_ENST00000361719.2_Missense_Mutation_p.R275H|GRM1_ENST00000392299.2_Missense_Mutation_p.R275H	p.R275H			0	0	0	1.920210	Q13255	GRM1_HUMAN		2	1059	+		Ovarian(120;0.0387)	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	0	1	hg19	c.824G>A	CCDS5209.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838921	0.91117	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.32	5.32	0.75619	5.320000	5.320000	0.756190	Extracellular ligand-binding receptor (1);	0.053988	0.64402	D	0.000002	D	0.82398	0.5028	L	0.53671	1.685	0.53688	D	0.999976	P;D;P;P	0.64830	0.932;0.994;0.945;0.932	P;P;P;P	0.58780	0.537;0.845;0.667;0.537	D	0.84833	0.0803	10	0.72032	D	0.01	.	9.6698	0.40006	0.1545:0.0:0.8455:0.0	.	275;275;270;275	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	H	275	ENSP00000354896:R275H;ENSP00000376119:R275H;ENSP00000424095:R275H;ENSP00000282753:R275H;ENSP00000347437:R275H;ENSP00000425599:R275H	ENSP00000282753:R275H	R	+	2	0	0	GRM1	146522300	146522300	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.432000	0.73400	2.495000	0.84180	0.655000	0.94253	CGC	0.056604		TCGA-RB-AA9M-01A-11D-A397-08	0.577	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	0	0	1	2	2	2	2	0	0	0	0	30	0	30	30	1	2	-2.674040	1	0.100001	NM_000838		0	4	4	0	215	214	0		1			0	0	30	0	0	0.890095	0	0	0	0	0	0	4	215
KIAA0895	23366	broad.mit.edu	37	7	36374693	36374693	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr7:36374693C>T	ENST00000297063.6	-	4	1012	c.962G>A	c.(961-963)cGt>cAt	p.R321H	KIAA0895_ENST00000480192.1_5'UTR|KIAA0895_ENST00000440378.1_Missense_Mutation_p.R318H|KIAA0895_ENST00000436884.1_Missense_Mutation_p.R218H|KIAA0895_ENST00000317020.6_Missense_Mutation_p.R270H|KIAA0895_ENST00000453212.1_Missense_Mutation_p.R76H|Y_RNA_ENST00000364562.1_RNA|KIAA0895_ENST00000338533.5_Missense_Mutation_p.R308H	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	321										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CCAATGCTCACGTGCAGTGGA	0.433																																						ENST00000297063.6	1.000000	0.660000	1.000000	0.820000	0.990000	0.937439	0.990000	1.000000																										0				26						c.(961-963)cGt>cAt		KIAA0895							113.0	109.0	110.0					7																	36374693		2035	4206	6241	SO:0001583	missense	23366	0	0					g.chr7:36374693C>T	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.962G>A	chr7.hg19:g.36374693C>T	ENSP00000297063:p.Arg321His	0					KIAA0895_ENST00000436884.1_Missense_Mutation_p.R218H|KIAA0895_ENST00000480192.1_5'UTR|KIAA0895_ENST00000440378.1_Missense_Mutation_p.R318H|KIAA0895_ENST00000317020.6_Missense_Mutation_p.R270H|Y_RNA_ENST00000364562.1_RNA|KIAA0895_ENST00000453212.1_Missense_Mutation_p.R76H|KIAA0895_ENST00000338533.5_Missense_Mutation_p.R308H	p.R321H	NM_001100425.1	NP_001093895.1	1	2	3	2.033721	Q8NCT3	K0895_HUMAN		4	1012	-			B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	ENST00000297063.6	1	1	hg19	c.962G>A	CCDS43570.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.530230	0.96446	.	.	ENSG00000164542	ENST00000297063;ENST00000338533;ENST00000317020;ENST00000440378;ENST00000436884;ENST00000453212;ENST00000431396	.	.	.	5.84	5.84	0.93424	5.840000	5.840000	0.934240	.	0.000000	0.85682	D	0.000000	D	0.83413	0.5249	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.999	D	0.84184	0.0441	9	0.72032	D	0.01	-11.6493	20.142	0.98061	0.0:1.0:0.0:0.0	.	318;218;321;308;270	B7ZLT4;B4DF35;Q8NCT3;Q8NCT3-2;Q8NCT3-3	.;.;K0895_HUMAN;.;.	H	321;308;270;318;218;76;76	.	ENSP00000297063:R321H	R	-	2	0	0	KIAA0895	36341218	36341218	1.000000	0.71417	0.994000	0.49952	0.962000	0.63368	7.393000	0.79851	2.754000	0.94517	0.655000	0.94253	CGT	0.112865		TCGA-RB-AA9M-01A-11D-A397-08	0.433	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337717.1	1	0	1	2	2	2	2	0	0	0	0	69	0	69	69	1	2	-4.886812	1	0.100001	NM_015314		0	24	24	0	474	471	1		1	1		0	0	69	0	0	1.000000	3.378364e-01	0	5	0	19	0	24	474
HGF	3082	broad.mit.edu	37	7	81358937	81358937	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr7:81358937C>A	ENST00000222390.5	-	8	1250	c.1024G>T	c.(1024-1026)Gaa>Taa	p.E342*	HGF_ENST00000457544.2_Nonsense_Mutation_p.E337*	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	342	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						TTGAAATTTTCAGGAGTCATG	0.418																																						ENST00000222390.5	1.000000	0.130000	1.000000	0.230000	0.380000	0.497041	0.380000	0.300000																										0				75						c.(1024-1026)Gaa>Taa		hepatocyte growth factor (hepapoietin A; scatter factor)							126.0	116.0	119.0					7																	81358937		2203	4300	6503	SO:0001587	stop_gained	3082	0	0					g.chr7:81358937C>A		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1024G>T	chr7.hg19:g.81358937C>A	ENSP00000222390:p.Glu342*	0					HGF_ENST00000457544.2_Nonsense_Mutation_p.E337*	p.E342*	NM_000601.4	NP_000592.3	1	2	3	2.042720	P14210	HGF_HUMAN		8	1250	-			A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Nonsense_Mutation	SNP	ENST00000222390.5	0	1	hg19	c.1024G>T	CCDS5597.1	0	.	.	.	.	.	.	.	.	.	.	C	38	6.828463	0.97869	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	.	.	.	5.76	5.76	0.90799	5.760000	5.760000	0.907990	.	0.095331	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	19.9767	0.97312	0.0:1.0:0.0:0.0	.	.	.	.	X	342;337	.	ENSP00000222390:E342X	E	-	1	0	0	HGF	81196873	81196873	0.982000	0.34865	1.000000	0.80357	0.997000	0.91878	2.444000	0.44890	2.702000	0.92279	0.655000	0.94253	GAA	0.115045		TCGA-RB-AA9M-01A-11D-A397-08	0.418	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	0	0	1	2	2	2	2	0	0	0	0	53	0	53	53	1	2	-5.424809	1	0.100001	NM_000601		0	5	5	0	326	325	0		1	0		0	0	53	0	0	0.937503	7.323604e-03	0	0	0	7	0	5	326
MUC17	140453	broad.mit.edu	37	7	100677537	100677537	+	Missense_Mutation	SNP	C	C	G			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr7:100677537C>G	ENST00000306151.4	+	3	2904	c.2840C>G	c.(2839-2841)aCt>aGt	p.T947S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	947	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTTTCAGCAACTCCTGTTGAC	0.507																																						ENST00000306151.4	1.000000	0.670000	1.000000	0.750000	0.860000	0.871606	0.860000	0.820000																										0				343						c.(2839-2841)aCt>aGt		mucin 17, cell surface associated							337.0	304.0	315.0					7																	100677537		2203	4300	6503	SO:0001583	missense	140453	0	0					g.chr7:100677537C>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2840C>G	chr7.hg19:g.100677537C>G	ENSP00000302716:p.Thr947Ser	0						p.T947S	NM_001040105.1	NP_001035194.1	1	2	3	2.042720	Q685J3	MUC17_HUMAN		3	2904	+	Lung NSC(181;0.136)|all_lung(186;0.182)		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	1	1	hg19	c.2840C>G	CCDS34711.1	1	.	.	.	.	.	.	.	.	.	.	C	2.823	-0.244331	0.05906	.	.	ENSG00000169876	ENST00000306151	T	0.02323	4.34	0.942	-0.333	0.12671	0.942000	-0.333000	0.126710	.	.	.	.	.	T	0.01730	0.0055	N	0.19112	0.55	0.09310	N	1	B	0.20459	0.045	B	0.08055	0.003	T	0.49062	-0.8978	9	0.08179	T	0.78	.	6.4664	0.21983	0.0:0.6919:0.3081:0.0	.	947	Q685J3	MUC17_HUMAN	S	947	ENSP00000302716:T947S	ENSP00000302716:T947S	T	+	2	0	0	MUC17	100464257	100464257	0.005000	0.15991	0.000000	0.03702	0.038000	0.13279	1.904000	0.39868	-0.070000	0.12908	0.134000	0.15878	ACT	0.115045		TCGA-RB-AA9M-01A-11D-A397-08	0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	0	0	1	2	2	2	2	0	0	0	0	334	0	334	350	1	2	-5.239423	1	0.100001	NM_001040105		0	84	80	0	1970	1725	0		1			0	0	334	0	0	1.000000	0	0	0	0	0	0	84	1970
FER1L6	654463	broad.mit.edu	37	8	125035751	125035751	+	Missense_Mutation	SNP	G	G	A	rs371597054		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr8:125035751G>A	ENST00000522917.1	+	18	2407	c.2201G>A	c.(2200-2202)cGc>cAc	p.R734H	FER1L6-AS1_ENST00000518567.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.R734H	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	734						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GCCTATGCCCGCATCGCCTCC	0.527																																						ENST00000522917.1	1.000000	0.130000	0.690000	0.210000	0.340000	0.434948	0.340000	0.290000																										0				118						c.(2200-2202)cGc>cAc		fer-1-like family member 6		G	HIS/ARG	0,3952		0,0,1976	100.0	103.0	102.0		2201	5.8	1.0	8		102	1,8321		0,1,4160	no	missense	FER1L6	NM_001039112.2	29	0,1,6136	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	734/1858	125035751	1,12273	1976	4161	6137	SO:0001583	missense	654463	9	120906	42				g.chr8:125035751G>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2201G>A	chr8.hg19:g.125035751G>A	ENSP00000428280:p.Arg734His	0					FER1L6-AS1_ENST00000518567.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.R734H	p.R734H	NM_001039112.2	NP_001034201.2	1	2	3	2.015428	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)	18	2407	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)			Missense_Mutation	SNP	ENST00000522917.1	0	1	hg19	c.2201G>A	CCDS43767.1	0	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971850	0.92919	0.0	1.2E-4	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.79352	-1.26;-1.26	5.81	5.81	0.92471	5.810000	5.810000	0.924710	Ferlin B-domain (1);	0.162857	0.34435	U	0.003970	D	0.89550	0.6747	M	0.91663	3.23	0.58432	D	0.999998	D	0.76494	0.999	D	0.70935	0.971	D	0.91017	0.4854	10	0.72032	D	0.01	.	12.8851	0.58038	0.0779:0.0:0.9221:0.0	.	734	Q2WGJ9	FR1L6_HUMAN	H	734	ENSP00000428280:R734H;ENSP00000381982:R734H	ENSP00000381982:R734H	R	+	2	0	0	FER1L6	125104932	125104932	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	9.072000	0.93986	2.751000	0.94390	0.555000	0.69702	CGC	0.108912		TCGA-RB-AA9M-01A-11D-A397-08	0.527	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	0	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	2	-2.105455	0	0.100001	NM_001039112		0	6	6	0	407	403	0		1	0		0	0	51	0	0	0.964173	0	0	0	0	1	0	6	407
SDCBP	6386	broad.mit.edu	37	8	59484848	59484848	+	Missense_Mutation	SNP	T	T	C			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr8:59484848T>C	ENST00000260130.4	+	4	365	c.215T>C	c.(214-216)gTg>gCg	p.V72A	SDCBP_ENST00000447182.2_Missense_Mutation_p.V72A|SDCBP_ENST00000422546.2_Missense_Mutation_p.V72A|SDCBP_ENST00000522243.1_3'UTR|SDCBP_ENST00000413219.2_Missense_Mutation_p.V72A|SDCBP_ENST00000447267.2_Missense_Mutation_p.V72A|SDCBP_ENST00000424270.2_Missense_Mutation_p.V66A|SDCBP_ENST00000523483.1_Missense_Mutation_p.V93A|SDCBP_ENST00000520168.1_Missense_Mutation_p.V72A	NM_001007068.1|NM_001007069.1|NM_005625.3	NP_001007069.1|NP_001007070.1|NP_005616.2	O00560	SDCB1_HUMAN	syndecan binding protein (syntenin)	72					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|intracellular signal transduction (GO:0035556)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|protein targeting to membrane (GO:0006612)|Ras protein signal transduction (GO:0007265)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic transmission (GO:0007268)	adherens junction (GO:0005912)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-5 receptor complex (GO:0005895)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	cytoskeletal adaptor activity (GO:0008093)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|interleukin-5 receptor binding (GO:0005137)|protein heterodimerization activity (GO:0046982)|protein N-terminus binding (GO:0047485)|syndecan binding (GO:0045545)			breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	8		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AATGTGGCCGTGGTTTCTGGT	0.363																																						ENST00000260130.4	1.000000	0.920000	1.000000	0.990000	0.990000	0.995673	0.990000	1.000000																										0				8						c.(214-216)gTg>gCg		syndecan binding protein (syntenin)							132.0	142.0	138.0					8																	59484848		2203	4300	6503	SO:0001583	missense	6386	0	0					g.chr8:59484848T>C	AF000652	CCDS6172.1, CCDS47862.1, CCDS47863.1	8q12.1	2012-12-04			ENSG00000137575	ENSG00000137575			10662	protein-coding gene	gene with protein product		602217				9391086	Standard	NM_001007067		Approved	SYCL	uc003xtq.3	O00560	OTTHUMG00000164303	ENST00000260130.4:c.215T>C	chr8.hg19:g.59484848T>C	ENSP00000260130:p.Val72Ala	0					SDCBP_ENST00000422546.2_Missense_Mutation_p.V72A|SDCBP_ENST00000424270.2_Missense_Mutation_p.V66A|SDCBP_ENST00000413219.2_Missense_Mutation_p.V72A|SDCBP_ENST00000522243.1_3'UTR|SDCBP_ENST00000447267.2_Missense_Mutation_p.V72A|SDCBP_ENST00000520168.1_Missense_Mutation_p.V72A|SDCBP_ENST00000447182.2_Missense_Mutation_p.V72A|SDCBP_ENST00000523483.1_Missense_Mutation_p.V93A	p.V72A	NM_001007068.1|NM_001007069.1|NM_005625.3	NP_001007069.1|NP_001007070.1|NP_005616.2	1	2	3	2.015428	O00560	SDCB1_HUMAN		4	365	+		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)	B2R5Q7|B4DUH3|B7ZLN2|O00173|O43391|Q14CP2	Missense_Mutation	SNP	ENST00000260130.4	1	1	hg19	c.215T>C	CCDS6172.1	1	.	.	.	.	.	.	.	.	.	.	T	2.468	-0.322502	0.05350	.	.	ENSG00000137575	ENST00000260130;ENST00000422546;ENST00000447182;ENST00000413219;ENST00000424270;ENST00000523483;ENST00000520168;ENST00000447267	T;T;T;T;T;T;T;T	0.34859	2.84;2.78;2.78;2.84;2.82;2.76;2.77;1.34	5.44	5.44	0.79542	5.440000	5.440000	0.795420	.	0.878949	0.10248	N	0.697502	T	0.32164	0.0820	N	0.24115	0.695	0.29452	N	0.858412	B;B;B;B	0.22541	0.0;0.071;0.0;0.0	B;B;B;B	0.31946	0.001;0.138;0.006;0.001	T	0.26503	-1.0101	9	.	.	.	0.0	15.7909	0.78364	0.0:0.0:0.0:1.0	.	72;93;66;72	B4DHN5;G5EA09;O00560-3;O00560	.;.;.;SDCB1_HUMAN	A	72;72;72;72;66;93;72;72	ENSP00000260130:V72A;ENSP00000391687:V72A;ENSP00000409288:V72A;ENSP00000411771:V72A;ENSP00000395351:V66A;ENSP00000428184:V93A;ENSP00000430730:V72A;ENSP00000397820:V72A	.	V	+	2	0	0	SDCBP	59647402	59647402	1.000000	0.71417	0.014000	0.15608	0.004000	0.04260	6.386000	0.73186	2.183000	0.69458	0.533000	0.62120	GTG	0.108912		TCGA-RB-AA9M-01A-11D-A397-08	0.363	SDCBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378193.1	1	0	1	2	2	2	2	0	0	0	0	82	0	82	80	1	2	-20.000000	1	0.100001	NM_005625		0	36	36	0	533	529	1		1	1		0	0	82	0	0	1.000000	1	0	60	0	358	0	36	533
SLC45A4	57210	broad.mit.edu	37	8	142228865	142228865	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr8:142228865C>T	ENST00000024061.3	-	4	1028	c.721G>A	c.(721-723)Gag>Aag	p.E241K	SLC45A4_ENST00000517878.1_Missense_Mutation_p.E292K|SLC45A4_ENST00000433583.2_Missense_Mutation_p.E234K|SLC45A4_ENST00000519067.1_Missense_Mutation_p.E241K	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGGGCCAGCTCGTGCTCCGAC	0.701																																						ENST00000024061.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999717	0.990000	1.000000																										0				31						c.(721-723)Gag>Aag		solute carrier family 45, member 4							86.0	90.0	89.0					8																	142228865		2203	4300	6503	SO:0001583	missense	57210	2	121382	39				g.chr8:142228865C>T	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.721G>A	chr8.hg19:g.142228865C>T	ENSP00000024061:p.Glu241Lys	0					SLC45A4_ENST00000517878.1_Missense_Mutation_p.E292K|SLC45A4_ENST00000519067.1_Missense_Mutation_p.E241K|SLC45A4_ENST00000433583.2_Missense_Mutation_p.E234K	p.E241K	NM_001080431.1	NP_001073900.1	1	2	3	2.015428	Q5BKX6	S45A4_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0493)	4	1028	-	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	1	1	hg19	c.721G>A	CCDS34948.1	1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.355746	0.61293	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	T;T;T;T	0.15834	2.44;2.42;2.42;2.39	5.75	5.75	0.90469	5.750000	5.750000	0.904690	.	0.057056	0.64402	D	0.000002	T	0.18676	0.0448	L	0.54323	1.7	0.39689	D	0.971018	B;B;B	0.33238	0.084;0.403;0.066	B;B;B	0.22601	0.016;0.04;0.023	T	0.03695	-1.1012	10	0.26408	T	0.33	-22.7247	20.0015	0.97412	0.0:1.0:0.0:0.0	.	292;241;241	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	K	241;292;234;241	ENSP00000429059:E241K;ENSP00000428137:E292K;ENSP00000400799:E234K;ENSP00000024061:E241K	ENSP00000024061:E241K	E	-	1	0	0	SLC45A4	142298047	142298047	0.997000	0.39634	1.000000	0.80357	0.545000	0.35147	3.460000	0.53028	2.731000	0.93534	0.555000	0.69702	GAG	0.108912		TCGA-RB-AA9M-01A-11D-A397-08	0.701	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	1	0	1	2	2	2	2	0	0	0	0	117	0	117	114	1	2	-3.017764	1	0.100001	XM_050325		0	58	56	0	788	779	0		1	1		0	0	117	0	0	1.000000	3.839344e-01	0	2	0	17	0	58	788
TMEM215	401498	broad.mit.edu	37	9	32784414	32784414	+	Missense_Mutation	SNP	G	G	A			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr9:32784414G>A	ENST00000342743.5	+	2	598	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	78						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CTGTGGGTCCGCAAATTGCCC	0.597																																						ENST00000342743.5	0.480000	0.100000	0.360000	0.160000	0.250000	0.269359	0.250000	0.230000																										0				12						c.(232-234)cGc>cAc		transmembrane protein 215							85.0	76.0	79.0					9																	32784414		2203	4300	6503	SO:0001583	missense	401498	0	0					g.chr9:32784414G>A		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.233G>A	chr9.hg19:g.32784414G>A	ENSP00000345468:p.Arg78His	0						p.R78H	NM_212558.2	NP_997723.2	0	1	1	1.902555	Q68D42	TM215_HUMAN		2	598	+			Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	0	1	hg19	c.233G>A	CCDS6530.1	0	.	.	.	.	.	.	.	.	.	.	G	8.409	0.843700	0.16963	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.18	4.28	0.50868	5.180000	4.280000	0.508680	.	0.113770	0.38326	N	0.001736	T	0.31040	0.0784	N	0.19112	0.55	0.30856	N	0.734062	B	0.25169	0.119	B	0.17433	0.018	T	0.31530	-0.9940	9	0.56958	D	0.05	-16.3167	9.7196	0.40295	0.0963:0.0:0.9037:0.0	.	78	Q68D42	TM215_HUMAN	H	78	.	ENSP00000345468:R78H	R	+	2	0	0	TMEM215	32774414	32774414	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	3.258000	0.51507	1.184000	0.42957	-0.258000	0.10820	CGC	0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.597	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	0	0	1	2	2	2	2	0	0	0	0	70	0	70	70	1	2	-2.066409	0	0.100001	NM_212558		0	6	6	0	467	464	0		1			0	0	70	0	0	0.964495	0	0	0	0	0	0	6	467
FCN1	2219	broad.mit.edu	37	9	137803031	137803031	+	Silent	SNP	G	G	A	rs145090957		TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chr9:137803031G>A	ENST00000371806.3	-	8	772	c.681C>T	c.(679-681)gaC>gaT	p.D227D		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	227	B domain; contributes to trimerization.|Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		TCTCTGCCTCGTCAGCCACCT	0.547																																						ENST00000371806.3	1.000000	0.810000	0.990000	0.890000	0.950000	0.944490	0.950000	0.990000																										0				37						c.(679-681)gaC>gaT		ficolin (collagen/fibrinogen domain containing) 1		G		1,4405	2.1+/-5.4	0,1,2202	258.0	246.0	250.0		681	-6.7	0.0	9	dbSNP_134	250	0,8600		0,0,4300	no	coding-synonymous	FCN1	NM_002003.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		227/327	137803031	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2219	5	121412	46				g.chr9:137803031G>A	D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.681C>T	chr9.hg19:g.137803031G>A		0						p.D227D	NM_002003.3	NP_001994.2	0	1	1	1.902555	O00602	FCN1_HUMAN		8	772	-		Myeloproliferative disorder(178;0.0333)	Q5VYV5|Q92596	Silent	SNP	ENST00000371806.3	1	1	hg19	c.681C>T	CCDS6985.1	1																																																																																								0.052632		TCGA-RB-AA9M-01A-11D-A397-08	0.547	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	1	0	1	2	2	2	2	0	0	0	0	186	0	186	185	1	2	-10.293830	1	0.100001	NM_002003		0	70	70	0	1090	1075	0		1	0		0	0	186	0	0	1.000000	2.084371e-02	0	0	0	4	0	70	1090
SAGE1	55511	broad.mit.edu	37	X	134993945	134993945	+	Missense_Mutation	SNP	C	C	T			TCGA-RB-AA9M-01A-11D-A397-08	TCGA-RB-AA9M-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bbf211a-67f7-4120-8fd4-3b3e56a3f1cc	3ca35289-4e81-450e-9e04-6bd0be0b1642	g.chrX:134993945C>T	ENST00000370709.3	+	17	2354	c.2354C>T	c.(2353-2355)gCg>gTg	p.A785V	SAGE1_ENST00000324447.3_Missense_Mutation_p.A785V|SAGE1_ENST00000537770.1_Missense_Mutation_p.A409V|SAGE1_ENST00000535938.1_Missense_Mutation_p.A785V			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	785						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					AATGAATTTGCGGTAGGCACC	0.443																																						ENST00000370709.3	0.190000	0.030000	0.140000	0.050000	0.090000	0.103056	0.090000	0.090000																										0				55						c.(2353-2355)gCg>gTg		sarcoma antigen 1							136.0	126.0	129.0					X																	134993945		2203	4300	6503	SO:0001583	missense	55511	0	0					g.chrX:134993945C>T	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2354C>T	chrX.hg19:g.134993945C>T	ENSP00000359743:p.Ala785Val						SAGE1_ENST00000324447.3_Missense_Mutation_p.A785V|SAGE1_ENST00000537770.1_Missense_Mutation_p.A409V|SAGE1_ENST00000535938.1_Missense_Mutation_p.A785V	p.A785V			0	1	1		Q9NXZ1	SAGE1_HUMAN		17	2354	+	Acute lymphoblastic leukemia(192;0.000127)		Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	0	1	hg19	c.2354C>T	CCDS14652.1	0	.	.	.	.	.	.	.	.	.	.	C	0.078	-1.188862	0.01607	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.30182	1.54;1.54;1.58;1.54	2.67	-5.34	0.02705	2.670000	-5.340000	0.027050	.	7.345260	0.00851	N	0.001834	T	0.08492	0.0211	N	0.00707	-1.245	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.08055	0.003;0.001	T	0.31251	-0.9950	10	0.07482	T	0.82	.	8.3271	0.32165	0.0:0.1179:0.2009:0.6812	.	409;785	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	V	785;785;409;785	ENSP00000323191:A785V;ENSP00000445959:A785V;ENSP00000438276:A409V;ENSP00000359743:A785V	ENSP00000323191:A785V	A	+	2	0	0	SAGE1	134821611	134821611	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-4.323000	0.00253	-2.402000	0.00577	-1.175000	0.01729	GCG	0.100001		TCGA-RB-AA9M-01A-11D-A397-08	0.443	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	0	0	1	2	2	2	2	0	0	0	0	81	0	81	80	1	2	-2.137665	0	0.100001	NM_018666		0	5	5	0	566	563	0		1	0		0	0	81	0	0	0.936923	0	0	0	0	1	0	5	566
