#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
UBC	7316	broad.mit.edu	37	12	125396390	125396393	+	Frame_Shift_Del	DEL	CCTT	CCTT	-	rs144126075		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			CCTT	-	CCTT	CCTT		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:125396390_125396393delCCTT	ENST00000538617.1	-	4	1101_1104	c.785_788delAAGG	c.(784-789)gaaggcfs	p.EG262fs	UBC_ENST00000536769.1_Frame_Shift_Del_p.EG642fs|UBC_ENST00000339647.5_Frame_Shift_Del_p.EG642fs|UBC_ENST00000536661.1_5'Flank|UBC_ENST00000546120.1_Frame_Shift_Del_p.EG566fs			P0CG48	UBC_HUMAN	ubiquitin C	642	Ubiquitin-like 4. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		AGGAGGGATGCCTTCCTTATCTTG	0.51																																						ENST00000538617.1	0.520000	3.900000e-01	0.490000	4.200000e-01	0.450000	0.458624	0.450000	0.460000																										0				36						c.(784-789)gaaggcfs		ubiquitin C																																				SO:0001589	frameshift_variant	7316	0	0					g.chr12:125396390_125396393delCCTT		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.785_788delAAGG	chr12.hg19:g.125396394_125396397delCCTT	ENSP00000443053:p.Glu262fs	0					UBC_ENST00000536661.1_5'Flank|UBC_ENST00000339647.5_Frame_Shift_Del_p.EG642fs|UBC_ENST00000536769.1_Frame_Shift_Del_p.EG642fs|UBC_ENST00000546120.1_Frame_Shift_Del_p.EG566fs	p.EG262fs			0	0	0	1.993499	P0CG48	UBC_HUMAN		4	1101_1104	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Frame_Shift_Del	DEL	ENST00000538617.1	1	0	hg19	c.785_788delAAGG		0																																																																																								0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.510	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	1	0	0		64	2		0	0	0	10	257	0	257	266	1	1.980000	-20.000000	1	0.640000	NM_021009		0	188	227	0	1089	974	0	0	1	1		0	0	257	0	0	1.000000	1		47	0	7932	0	188	1089
SMAD4	4089	broad.mit.edu	37	18	48604715	48604716	+	Frame_Shift_Ins	INS	-	-	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			-	A	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr18:48604715_48604716insA	ENST00000342988.3	+	12	2075_2076	c.1537_1538insA	c.(1537-1539)tacfs	p.Y513fs	SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000588745.1_Frame_Shift_Ins_p.Y417fs|SMAD4_ENST00000398417.2_Frame_Shift_Ins_p.Y513fs	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	513	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGGACCGGATTACCCAAGACAG	0.48																																						ENST00000342988.3	0.670000	4.700000e-01	0.620000	5.100000e-01	0.560000	0.573204	0.560000	0.570000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1537-1539)tacfs		SMAD family member 4																																				SO:0001589	frameshift_variant	4089	0	0					g.chr18:48604715_48604716insA	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1538dupA	chr18.hg19:g.48604716_48604716dupA	ENSP00000341551:p.Tyr513fs	1					SMAD4_ENST00000588745.1_Frame_Shift_Ins_p.Y417fs|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Frame_Shift_Ins_p.Y513fs	p.Y513fs	NM_005359.5	NP_005350.1	0	1	1	1.440698	Q13485	SMAD4_HUMAN		12	2075_2076	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Frame_Shift_Ins	INS	ENST00000342988.3	0	1	hg19	c.1537_1538insA	CCDS11950.1	0																																																																																								0.473068		TCGA-S4-A8RM-01A-11D-A377-08	0.480	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	2	0	0	0	0	62	0	62	61	1	1.980000	-20.000000	1	0.640000	NM_005359		0	93	93	0	254	248	0	0	1	0	1	0	0	62	508	0	1.000000	1	1	1	267	83	660	93	254
ZNF468	90333	broad.mit.edu	37	19	53344850	53344850	+	Frame_Shift_Del	DEL	G	G	-			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	-	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr19:53344850delG	ENST00000595646.1	-	4	817	c.697delC	c.(697-699)catfs	p.H233fs	ZNF28_ENST00000594602.1_Intron|ZNF468_ENST00000390651.4_Frame_Shift_Del_p.H180fs|ZNF468_ENST00000396409.4_Frame_Shift_Del_p.H180fs|ZNF468_ENST00000243639.4_3'UTR			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		ATTATCTGATGTTTTTTTAAG	0.353																																						ENST00000595646.1	0.770000	5.300000e-01	0.710000	5.800000e-01	0.640000	0.647184	0.640000	0.640000																										0				23						c.(697-699)catfs		zinc finger protein 468							79.0	73.0	75.0					19																	53344850		2203	4300	6503	SO:0001589	frameshift_variant	90333	0	0					g.chr19:53344850delG	AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.697delC	chr19.hg19:g.53344850delG	ENSP00000470381:p.His233fs	0					ZNF468_ENST00000396409.4_Frame_Shift_Del_p.H180fs|ZNF468_ENST00000243639.4_3'UTR|ZNF468_ENST00000390651.4_Frame_Shift_Del_p.H180fs|ZNF28_ENST00000594602.1_Intron	p.H233fs			1	2	3	2.032905	Q5VIY5	ZN468_HUMAN		4	817	-			A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Frame_Shift_Del	DEL	ENST00000595646.1	1	1	hg19	c.697delC	CCDS33094.1	0																																																																																								0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.353	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	1	0	1		12	2		0	0	0	1	155	0	155	156	1	1.980000	-20.000000	1	0.640000	NM_001008801		0	98	99	0	379	376	0	0	1	1		0	0	155	0	0	1.000000	9.900293e-01		3	0	27	0	98	379
A4GNT	51146	broad.mit.edu	37	3	137849766	137849767	+	Frame_Shift_Ins	INS	-	-	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr3:137849766_137849767insA	ENST00000236709.3	-	2	533_534	c.332_333insT	c.(331-333)atafs	p.I111fs		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	111					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						AAACGTTGTCTATTGCTGACAG	0.421																																						ENST00000236709.3	0.770000	5.500000e-01	0.720000	6.000000e-01	0.650000	0.665948	0.650000	0.660000																										0				16						c.(331-333)atafs		alpha-1,4-N-acetylglucosaminyltransferase																																				SO:0001589	frameshift_variant	51146	0	0					g.chr3:137849766_137849767insA	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.333dupT	chr3.hg19:g.137849767_137849767dupA	ENSP00000236709:p.Ile111fs	0						p.I111fs	NM_016161.2	NP_057245.1	0	0	0	2.015211	Q9UNA3	A4GCT_HUMAN		2	533_534	-			Q0VDK1|Q0VDK2	Frame_Shift_Ins	INS	ENST00000236709.3	0	1	hg19	c.332_333insT	CCDS3097.1	0																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.421	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	1	0	1		2	2		0	0	0	0	80	0	80	80	1	1.980000	-20.000000	1	0.640000	NM_016161		0	124	127	0	460	454	0	0	1	0		0	0	80	0	0	1.000000	9.788509e-01		0	0	25	0	124	460
LMLN	89782	broad.mit.edu	37	3	197687308	197687309	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr3:197687308_197687309delTG	ENST00000330198.4	+	1	238_239	c.216_217delTG	c.(214-219)actgagfs	p.E73fs	LMLN_ENST00000332636.5_Intron|IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000265239.6_5'Flank|LMLN_ENST00000482695.1_Intron|LMLN_ENST00000420910.2_Frame_Shift_Del_p.E73fs	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	73					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CCTCTGACACTGAGGTAGGGCG	0.639																																						ENST00000330198.4	0.480000	2.300000e-01	0.410000	2.800000e-01	0.330000	0.347583	0.330000	0.340000																										0				25						c.(214-219)actgagfs		leishmanolysin-like (metallopeptidase M8 family)																																				SO:0001589	frameshift_variant	89782	0	0					g.chr3:197687308_197687309delTG	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.216_217delTG	chr3.hg19:g.197687308_197687309delTG	ENSP00000328829:p.Glu73fs	0					LMLN_ENST00000420910.2_Frame_Shift_Del_p.E73fs|IQCG_ENST00000480302.1_5'Flank|LMLN_ENST00000482695.1_Intron|LMLN_ENST00000332636.5_Intron|IQCG_ENST00000265239.6_5'Flank	p.E73fs	NM_033029.3	NP_149018.2	1	2	3	2.028014	Q96KR4	LMLN_HUMAN	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	1	238_239	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Frame_Shift_Del	DEL	ENST00000330198.4	0	1	hg19	c.216_217delTG	CCDS3332.1	0																																																																																								0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.639	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	1	0	1		2	2		0	0	0	0	28	0	28	28	1	1.980000	-3.221905	1	0.640000	NM_033029		0	28	30	0	231	225	0	0	1	0		0	0	28	0	0	1.000000	9.986996e-02		0	0	5	0	28	231
SEMA3F	6405	broad.mit.edu	37	3	50222213	50222214	+	In_Frame_Ins	INS	-	-	GACGGGCGT	rs540596745		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr3:50222213_50222214insGACGGGCGT	ENST00000002829.3	+	13	1906_1907	c.1422_1423insGACGGGCGT	c.(1423-1425)gac>GACGGGCGTgac	p.475_475D>DGRD	SEMA3F_ENST00000434342.1_In_Frame_Ins_p.444_444D>DGRD|SEMA3F_ENST00000413852.1_In_Frame_Ins_p.376_376D>DGRD	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	475	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		TGGATGCAGCCGACGGGCGCTA	0.673																																						ENST00000002829.3	0.300000	1.000000e-01	0.250000	1.300000e-01	0.180000	0.197608	0.180000	0.180000																										0				17						c.(1423-1425)gac>GACGGGCGTgac		sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F																																				SO:0001652	inframe_insertion	6405	0	0					g.chr3:50222213_50222214insGACGGGCGT	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	Exception_encountered	chr3.hg19:g.50222213_50222214insGACGGGCGT	Exception_encountered	0					SEMA3F_ENST00000434342.1_In_Frame_Ins_p.444_444D>DGRD|SEMA3F_ENST00000413852.1_In_Frame_Ins_p.376_376D>DGRD	p.475_475D>DGRD	NM_004186.3	NP_004177.3	0	0	0	2.015211	Q13275	SEM3F_HUMAN		13	1906_1907	+			C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	In_Frame_Ins	INS	ENST00000002829.3	0	1	hg19	c.1422_1423insGACGGGCGT	CCDS2811.1	0																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.673	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	1	0	1		2	2		0	0	0	0	22	0	22	23	1	1.980000	-15.382830	1	0.640000	NM_004186		0	12	33	0	191	193	0	0	1	0		0	0	22	0	0	0.999597	4.258142e-01		0	0	23	0	12	191
SFMBT2	57713	broad.mit.edu	37	10	7218087	7218087	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr10:7218087G>A	ENST00000361972.4	-	17	1939	c.1849C>T	c.(1849-1851)Cgg>Tgg	p.R617W	SFMBT2_ENST00000397167.1_Missense_Mutation_p.R617W	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	617					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.R617G(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TCAGATGTCCGTACGATTTTG	0.468																																						ENST00000361972.4	0.080000	0	0.060000	1.000000e-02	0.030000	0.040412	0.030000	0.040000																										1	Substitution - Missense(1)	p.R617G(1)	breast(1)	99						c.(1849-1851)Cgg>Tgg		Scm-like with four mbt domains 2							108.0	107.0	107.0					10																	7218087		2203	4300	6503	SO:0001583	missense	57713	1	121412	31				g.chr10:7218087G>A	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1849C>T	chr10.hg19:g.7218087G>A	ENSP00000355109:p.Arg617Trp	0					SFMBT2_ENST00000397167.1_Missense_Mutation_p.R617W	p.R617W	NM_001018039.1	NP_001018049.1	1	2	3	2.029876	Q5VUG0	SMBT2_HUMAN		17	1939	-			A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	0	1	hg19	c.1849C>T	CCDS31138.1	0	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648095	0.67358	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.47528	0.84;0.84	5.96	5.04	0.67666	5.96	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.68522	0.3010	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72868	-0.4162	10	0.72032	D	0.01	.	16.3303	0.83006	0.0:0.0:0.8669:0.1331	.	617	Q5VUG0	SMBT2_HUMAN	W	617	ENSP00000355109:R617W;ENSP00000380353:R617W	ENSP00000355109:R617W	R	-	1	2	2	SFMBT2	7258093	7258093	1.000000	0.71417	0.041000	0.18516	0.283000	0.27025	5.140000	0.64807	1.468000	0.48064	0.655000	0.94253	CGG	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.468	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	0	0	1	2	2	2	2	0	0	0	0	84	84	84	82	1	1.980000	-2.221656	0	0.640000	NM_001029880		0	7	6	0	609	593	0		1	0		0	0	84	0	0	0.978666	1.101637e-03	0	0	0	4	0	7	609
ARHGEF12	23365	broad.mit.edu	37	11	120348235	120348235	+	Splice_Site	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr11:120348235G>T	ENST00000397843.2	+	36	3698	c.3532G>T	c.(3532-3534)Gac>Tac	p.D1178Y	ARHGEF12_ENST00000356641.3_Splice_Site_p.D1159Y|ARHGEF12_ENST00000532993.1_Splice_Site_p.D1075Y	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1178					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GCAGAGTCCAGGTACACTCTT	0.413			T	MLL	AML																																	ENST00000397843.2	1.000000	7.600000e-01	1.000000	8.400000e-01	0.930000	0.929513	0.930000	1.000000				Dom	yes			Dom	yes		11	11q23.3	11q23.3	23365	T	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)				L	L	MLL		AML		0				61						c.(3532-3534)Gac>Tac		Rho guanine nucleotide exchange factor (GEF) 12							89.0	90.0	90.0					11																	120348235		1900	4124	6024	SO:0001630	splice_region_variant	23365	0	0					g.chr11:120348235G>T	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.3532+1G>T	chr11.hg19:g.120348235G>T		0					ARHGEF12_ENST00000532993.1_Splice_Site_p.D1075Y|ARHGEF12_ENST00000356641.3_Splice_Site_p.D1159Y	p.D1178Y	NM_015313.2	NP_056128.1	1	2	3	2.027490	Q9NZN5	ARHGC_HUMAN		36	3698	+		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)	O15086|Q6P526	Splice_Site	SNP	ENST00000397843.2	1	0	hg19	c.3532G>T	CCDS41727.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045601	0.75846	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.72505	-0.55;-0.66;-0.53	4.85	4.85	0.62838	4.85	4.85	0.62838	.	0.141481	0.32357	N	0.006209	T	0.74794	0.3763	L	0.29908	0.895	0.46586	D	0.999111	D;D	0.71674	0.998;0.997	D;P	0.63192	0.912;0.819	T	0.77638	-0.2513	10	0.59425	D	0.04	-5.4223	16.4829	0.84162	0.0:0.0:1.0:0.0	.	1159;1178	Q9NZN5-2;Q9NZN5	.;ARHGC_HUMAN	Y	1178;1159;1075	ENSP00000380942:D1178Y;ENSP00000349056:D1159Y;ENSP00000432984:D1075Y	ENSP00000349056:D1159Y	D	+	1	0	0	ARHGEF12	119853445	119853445	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	5.638000	0.67861	2.392000	0.81423	0.585000	0.79938	GAC	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.413	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.980000	-7.089722	1	0.640000	NM_015313	Missense_Mutation	0	71	70	0	165	161	1		1	1		0	0	42	0	0	1.000000	1	0	19	0	84	0	71	165
KCNA4	3739	broad.mit.edu	37	11	30033579	30033579	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr11:30033579C>T	ENST00000328224.6	-	2	1880	c.647G>A	c.(646-648)cGc>cAc	p.R216H	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	216					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ATACTCATTGCGCAAAGGGTC	0.478																																						ENST00000328224.6	0.300000	1.400000e-01	0.260000	1.700000e-01	0.210000	0.220793	0.210000	0.220000																										0				78						c.(646-648)cGc>cAc		potassium voltage-gated channel, shaker-related subfamily, member 4	Dalfampridine(DB06637)						70.0	65.0	67.0					11																	30033579		1862	4106	5968	SO:0001583	missense	3739	0	0					g.chr11:30033579C>T	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.647G>A	chr11.hg19:g.30033579C>T	ENSP00000328511:p.Arg216His	0					KCNA4_ENST00000526518.1_5'Flank	p.R216H	NM_002233.3	NP_002224.1	1	2	3	2.027490	P22459	KCNA4_HUMAN		2	1880	-				Missense_Mutation	SNP	ENST00000328224.6	1	1	hg19	c.647G>A	CCDS41629.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410513	0.83340	.	.	ENSG00000182255	ENST00000328224	T	0.77358	-1.09	4.94	4.94	0.65067	4.94	4.94	0.65067	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.84156	2.68	0.80722	D	1	D	0.69078	0.997	P	0.49332	0.607	D	0.87784	0.2614	10	0.72032	D	0.01	.	18.1944	0.89817	0.0:1.0:0.0:0.0	.	216	P22459	KCNA4_HUMAN	H	216	ENSP00000328511:R216H	ENSP00000328511:R216H	R	-	2	0	0	KCNA4	29990155	29990155	1.000000	0.71417	0.981000	0.43875	0.887000	0.51463	7.787000	0.85759	2.297000	0.77311	0.655000	0.94253	CGC	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.478	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	1.980000	-8.455999	1	0.640000	NM_002233		0	32	32	0	434	429	0		1			0	0	72	0	0	1.000000	0	0	0	0	0	0	32	434
NFRKB	4798	broad.mit.edu	37	11	129739654	129739654	+	Missense_Mutation	SNP	C	C	T	rs377268467		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr11:129739654C>T	ENST00000446488.3	-	23	3369	c.3266G>A	c.(3265-3267)cGc>cAc	p.R1089H	NFRKB_ENST00000304521.5_Missense_Mutation_p.R1089H|NFRKB_ENST00000524746.1_Missense_Mutation_p.R1089H|NFRKB_ENST00000524794.1_Missense_Mutation_p.R1114H	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	1089					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		CTGCACGATGCGGATCGTGGC	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21384	0.0		0.0	False		,,,				2504	0.0					ENST00000446488.3	0.070000	0	0.050000	1.000000e-02	0.020000	0.034854	0.020000	0.030000																										0				32						c.(3265-3267)cGc>cAc		nuclear factor related to kappaB binding protein		C	HIS/ARG,HIS/ARG	0,4402		0,0,2201	132.0	120.0	124.0		3266,3341	5.3	1.0	11		124	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	NFRKB	NM_001143835.1,NM_006165.3	29,29	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1089/1300,1114/1325	129739654	1,12995	2201	4297	6498	SO:0001583	missense	4798	2	121412	36				g.chr11:129739654C>T		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.3266G>A	chr11.hg19:g.129739654C>T	ENSP00000400476:p.Arg1089His	0					NFRKB_ENST00000524746.1_Missense_Mutation_p.R1089H|NFRKB_ENST00000524794.1_Missense_Mutation_p.R1114H|NFRKB_ENST00000304521.5_Missense_Mutation_p.R1089H	p.R1089H	NM_001143835.1	NP_001137307.1	1	2	3	2.027490	Q6P4R8	NFRKB_HUMAN		23	3369	-	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	0	1	hg19	c.3266G>A	CCDS44770.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.063126	0.93898	0.0	1.16E-4	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746	.	.	.	5.31	5.31	0.75309	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	L	0.32530	0.975	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.997	T	0.69975	-0.4999	9	0.52906	T	0.07	-11.2341	18.9658	0.92695	0.0:1.0:0.0:0.0	.	1089;1088;1114	Q6P4R8;Q6P4R8-3;Q6P4R8-2	NFRKB_HUMAN;.;.	H	1089;1089;1114;1089	.	ENSP00000303800:R1089H	R	-	2	0	0	NFRKB	129244864	129244864	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.474000	0.83562	0.655000	0.94253	CGC	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.597	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	0	0	1	2	2	2	2	0	0	0	0	94	94	94	94	1	1.980000	-2.111172	0	0.640000	NM_006165		0	5	5	0	522	515	0		1	0		0	0	94	0	0	0.935596	5.854911e-02	0	0	0	33	0	5	522
DUSP16	80824	broad.mit.edu	37	12	12639992	12639992	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:12639992G>A	ENST00000228862.2	-	5	1292	c.661C>T	c.(661-663)Ccg>Tcg	p.P221S	RP11-253I19.3_ENST00000544086.1_lincRNA|DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'UTR	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	221					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		TCCAACCACGGCAAAATTTTC	0.458																																					Ovarian(158;443 1896 15437 36069 46477)	ENST00000228862.2	0.070000	0	0.050000	1.000000e-02	0.020000	0.034714	0.020000	0.030000																										0				26						c.(661-663)Ccg>Tcg		dual specificity phosphatase 16							135.0	126.0	129.0					12																	12639992		2203	4300	6503	SO:0001583	missense	80824	0	0					g.chr12:12639992G>A	AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.661C>T	chr12.hg19:g.12639992G>A	ENSP00000228862:p.Pro221Ser	0					DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'UTR|RP11-253I19.3_ENST00000544086.1_lincRNA	p.P221S	NM_030640.2	NP_085143.1	1	2	3	2.030759	Q9BY84	DUS16_HUMAN		5	1292	-		Prostate(47;0.0687)	Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	0	1	hg19	c.661C>T	CCDS8650.1	0	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968201	0.92855	.	.	ENSG00000111266	ENST00000228862	D	0.85339	-1.97	5.27	5.27	0.74061	5.27	5.27	0.74061	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.128209	0.53938	D	0.000056	D	0.89525	0.6740	L	0.39326	1.205	0.80722	D	1	D;D	0.63880	0.993;0.966	D;D	0.72338	0.977;0.948	D	0.89322	0.3641	10	0.49607	T	0.09	.	19.2465	0.93904	0.0:0.0:1.0:0.0	.	221;221	Q9BY84;Q96N49	DUS16_HUMAN;.	S	221	ENSP00000228862:P221S	ENSP00000228862:P221S	P	-	1	0	0	DUSP16	12531259	12531259	1.000000	0.71417	0.734000	0.30879	0.975000	0.68041	9.516000	0.98017	2.621000	0.88768	0.561000	0.74099	CCG	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.458	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	0	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	1.980000	-1.930126	0	0.640000	NM_030640		0	5	5	0	524	519	0		1	0		0	0	106	0	0	0.936243	1.723071e-01	0	0	0	65	0	5	524
DDX47	51202	broad.mit.edu	37	12	12974195	12974195	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:12974195G>T	ENST00000358007.3	+	3	257	c.235G>T	c.(235-237)Gct>Tct	p.A79S	DDX47_ENST00000352940.4_Missense_Mutation_p.A79S|DDX47_ENST00000392155.2_3'UTR	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	79	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		AGGCGCCTTTGCTTTGCCCAT	0.488																																						ENST00000358007.3	0.060000	0	0.050000	1.000000e-02	0.020000	0.031808	0.020000	0.040000																										0				16						c.(235-237)Gct>Tct		DEAD (Asp-Glu-Ala-Asp) box polypeptide 47							120.0	118.0	119.0					12																	12974195		2203	4300	6503	SO:0001583	missense	51202	0	0					g.chr12:12974195G>T	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.235G>T	chr12.hg19:g.12974195G>T	ENSP00000350698:p.Ala79Ser	0					DDX47_ENST00000352940.4_Missense_Mutation_p.A79S|DDX47_ENST00000392155.2_3'UTR	p.A79S	NM_016355.3	NP_057439.2	1	2	3	2.030759	Q9H0S4	DDX47_HUMAN		3	257	+		Prostate(47;0.0526)	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	0	1	hg19	c.235G>T	CCDS8655.1	0	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703195	0.88924	.	.	ENSG00000213782	ENST00000352940;ENST00000358007	T;T	0.44083	0.93;2.57	5.6	4.71	0.59529	5.6	4.71	0.59529	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.53077	0.1774	L	0.49571	1.57	0.80722	D	1	B;B;B;B	0.30634	0.134;0.098;0.08;0.288	P;B;B;P	0.49387	0.609;0.326;0.34;0.475	T	0.48980	-0.8986	10	0.25106	T	0.35	-9.5993	14.6773	0.68989	0.0699:0.0:0.93:0.0	.	79;79;79;79	B4DYP6;Q9H4E3;G5E955;Q9H0S4	.;.;.;DDX47_HUMAN	S	79	ENSP00000319578:A79S;ENSP00000350698:A79S	ENSP00000319578:A79S	A	+	1	0	0	DDX47	12865462	12865462	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	9.201000	0.95017	1.370000	0.46153	0.555000	0.69702	GCT	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.488	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	0	0	1	2	2	2	2	0	0	0	0	150	150	150	148	1	1.980000	-2.878864	1	0.640000	NM_016355		0	10	9	0	1049	1036	0		1	0		0	0	150	0	0	0.996661	3.313435e-01	0	1	0	114	0	10	1049
LRMP	4033	broad.mit.edu	37	12	25232195	25232195	+	Silent	SNP	C	C	T	rs114104872	byFrequency	TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:25232195C>T	ENST00000354454.3	+	6	871	c.42C>T	c.(40-42)cgC>cgT	p.R14R	LRMP_ENST00000548766.1_Silent_p.R14R|LRMP_ENST00000547044.1_Silent_p.R14R	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	70					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GTGTTGAACGCGTGTGTCCTG	0.373													C|||	3	0.000599042	0.0	0.0	5008	,	,		19765	0.003		0.0	False		,,,				2504	0.0					ENST00000354454.3	0.980000	7.700000e-01	0.930000	8.200000e-01	0.870000	0.880645	0.870000	0.880000																										0				19						c.(40-42)cgC>cgT		lymphoid-restricted membrane protein		C	,,	1,4405	2.1+/-5.4	0,1,2202	288.0	260.0	270.0		42,42,42	0.8	0.0	12	dbSNP_132	270	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	LRMP	NM_001204126.1,NM_001204127.1,NM_006152.3	,,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,	14/500,14/500,14/500	25232195	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	4033	40	121412	49				g.chr12:25232195C>T		CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.42C>T	chr12.hg19:g.25232195C>T		0					LRMP_ENST00000547044.1_Silent_p.R14R|LRMP_ENST00000548766.1_Silent_p.R14R	p.R14R	NM_006152.3	NP_006143.2	1	2	3	2.030759	Q12912	LRMP_HUMAN		6	871	+	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)		A0AVM2|B4E077|Q8N301	Silent	SNP	ENST00000354454.3	1	1	hg19	c.42C>T	CCDS8701.1	1																																																																																								0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.373	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	1	0	1	2	2	2	2	0	0	0	0	152	152	152	150	1	1.980000	-20.000000	1	0.640000	NM_006152		0	220	217	0	564	556	1		1	1		0	0	152	0	0	1.000000	9.999242e-01	0	15	0	23	0	220	564
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.990000	6.700000e-01	0.910000	7.400000e-01	0.820000	0.831894	0.820000	0.830000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	2.030759	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.980000	-20.000000	1	0.640000	NM_033360		2492	82	82	5524	228	225	1	1	1	1	1	0	0	51	247	1	1.000000	9.999627e-01	1	27	111	18	310	82	228
STAT6	6778	broad.mit.edu	37	12	57492807	57492807	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:57492807G>A	ENST00000300134.3	-	17	2271	c.1946C>T	c.(1945-1947)aCc>aTc	p.T649I	STAT6_ENST00000454075.3_Missense_Mutation_p.T649I|STAT6_ENST00000543873.2_Missense_Mutation_p.T649I|STAT6_ENST00000537215.2_Missense_Mutation_p.T539I|STAT6_ENST00000556155.1_Missense_Mutation_p.T649I|STAT6_ENST00000538913.2_Missense_Mutation_p.T539I	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	649					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						CCTTTCCACGGTCATCTTGAT	0.532																																						ENST00000300134.3	0.060000	0	0.040000	0	0.020000	0.028882	0.020000	0.020000																										0				28						c.(1945-1947)aCc>aTc		signal transducer and activator of transcription 6, interleukin-4 induced							292.0	246.0	262.0					12																	57492807		2203	4300	6503	SO:0001583	missense	6778	0	0					g.chr12:57492807G>A	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1946C>T	chr12.hg19:g.57492807G>A	ENSP00000300134:p.Thr649Ile	0					STAT6_ENST00000556155.1_Missense_Mutation_p.T649I|STAT6_ENST00000538913.2_Missense_Mutation_p.T539I|STAT6_ENST00000537215.2_Missense_Mutation_p.T539I|STAT6_ENST00000454075.3_Missense_Mutation_p.T649I|STAT6_ENST00000543873.2_Missense_Mutation_p.T649I	p.T649I	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	0	0	0	1.993499	P42226	STAT6_HUMAN		17	2271	-			A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	0	1	hg19	c.1946C>T	CCDS8931.1	0	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894701	0.52121	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000555318;ENST00000542516	D;D;D;D;D;D;T	0.92048	-2.72;-2.96;-2.72;-2.72;-2.96;-2.72;-1.17	5.77	4.87	0.63330	5.77	4.87	0.63330	SH2 motif (1);	0.344421	0.30473	N	0.009541	D	0.86535	0.5956	N	0.19112	0.55	0.36500	D	0.868949	P;P	0.48694	0.914;0.844	B;B	0.43623	0.425;0.313	D	0.89133	0.3511	10	0.51188	T	0.08	-11.3662	12.7493	0.57300	0.0:0.1647:0.8353:0.0	.	649;649	A8K4S9;P42226	.;STAT6_HUMAN	I	649;539;539;649;649;539;649;539;77;649	ENSP00000300134:T649I;ENSP00000445409:T539I;ENSP00000438451:T649I;ENSP00000451742:T649I;ENSP00000444530:T539I;ENSP00000401486:T649I;ENSP00000450428:T77I	ENSP00000300134:T649I	T	-	2	0	0	STAT6	55779074	55779074	0.998000	0.40836	0.998000	0.56505	0.954000	0.61252	3.174000	0.50847	1.417000	0.47077	0.561000	0.74099	ACC	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.532	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	0	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	1.980000	-2.897311	1	0.640000	NM_003153		0	5	5	0	620	611	0		1	0		0	0	105	0	0	0.935358	9.377629e-01	0	0	0	624	0	5	620
TPI1	7167	broad.mit.edu	37	12	6979268	6979268	+	Missense_Mutation	SNP	C	C	T	rs139532537		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:6979268C>T	ENST00000229270.4	+	6	1047	c.710C>T	c.(709-711)gCg>gTg	p.A237V	TPI1_ENST00000535434.1_Missense_Mutation_p.A118V|TPI1_ENST00000396705.5_Missense_Mutation_p.A200V|TPI1_ENST00000488464.2_Missense_Mutation_p.A118V	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	237					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)			endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						GTCTCTGATGCGGTGGCTCAG	0.552											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.0		0.001	False		,,,				2504	0.0					ENST00000229270.4	0.070000	0	0.050000	1.000000e-02	0.020000	0.031381	0.020000	0.020000																										0				19						c.(709-711)gCg>gTg		triosephosphate isomerase 1		C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	124.0	120.0	121.0		599,710	3.6	0.0	12	dbSNP_134	121	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TPI1	NM_000365.5,NM_001159287.1	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	200/250,237/287	6979268	1,13005	2203	4300	6503	SO:0001583	missense	7167	4	121412	39				g.chr12:6979268C>T		CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.710C>T	chr12.hg19:g.6979268C>T	ENSP00000229270:p.Ala237Val	0		OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	638	TPI1_ENST00000396705.5_Missense_Mutation_p.A200V|TPI1_ENST00000535434.1_Missense_Mutation_p.A118V|TPI1_ENST00000488464.2_Missense_Mutation_p.A118V	p.A237V	NM_001159287.1	NP_001152759.1	1	2	3	2.031110	P60174	TPIS_HUMAN		6	1047	+			B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Missense_Mutation	SNP	ENST00000229270.4	0	1	hg19	c.710C>T	CCDS53740.1	0	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366735	0.41902	0.0	1.16E-4	ENSG00000111669	ENST00000229270;ENST00000396705;ENST00000535434	D;D;D	0.94330	-3.4;-3.4;-3.4	5.44	3.57	0.40892	5.44	3.57	0.40892	Aldolase-type TIM barrel (1);	0.213213	0.38837	U	0.001559	D	0.90748	0.7096	M	0.67569	2.06	0.18873	N	0.999984	B	0.17667	0.023	B	0.12156	0.007	T	0.83227	-0.0065	10	0.56958	D	0.05	.	8.4396	0.32808	0.4046:0.4513:0.144:0.0	.	237	P60174	TPIS_HUMAN	V	237;200;118	ENSP00000229270:A237V;ENSP00000379933:A200V;ENSP00000443599:A118V	ENSP00000229270:A237V	A	+	2	0	0	TPI1	6849529	6849529	0.989000	0.36119	0.048000	0.18961	0.889000	0.51656	2.951000	0.49089	0.626000	0.30322	0.462000	0.41574	GCG	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.552	TPI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258252.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	1.980000	-1.931661	0	0.640000	NM_000365		0	5	5	0	577	565	0		1	0		0	0	76	0	0	0.934302	9.940087e-01	0	1	0	1199	0	5	577
GDF3	9573	broad.mit.edu	37	12	7843026	7843026	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:7843026G>A	ENST00000329913.3	-	2	590	c.543C>T	c.(541-543)ttC>ttT	p.F181F		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	181					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						CCAGCAGGTTGAAGTGAACAG	0.507																																						ENST00000329913.3	0.980000	7.200000e-01	0.920000	7.800000e-01	0.840000	0.853793	0.840000	0.850000																										0				28						c.(541-543)ttC>ttT		growth differentiation factor 3							80.0	83.0	82.0					12																	7843026		2203	4300	6503	SO:0001819	synonymous_variant	9573	0	0					g.chr12:7843026G>A	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.543C>T	chr12.hg19:g.7843026G>A		0						p.F181F	NM_020634.1	NP_065685.1	1	2	3	2.031110	Q9NR23	GDF3_HUMAN		2	590	-			Q8NEJ4	Silent	SNP	ENST00000329913.3	1	1	hg19	c.543C>T	CCDS8581.1	0																																																																																								0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.507	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.980000	-20.000000	1	0.640000			0	137	135	0	367	360	0		1	0		0	0	79	0	0	1.000000	4.137300e-01	0	0	0	5	0	137	367
B4GALNT1	2583	broad.mit.edu	37	12	58021575	58021575	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:58021575G>T	ENST00000341156.4	-	10	1794	c.1210C>A	c.(1210-1212)Ccc>Acc	p.P404T	B4GALNT1_ENST00000418555.2_Missense_Mutation_p.P349T	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	404					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGGGCGCCGGGCTCCACGCTC	0.706																																						ENST00000341156.4	1.000000	5.600000e-01	1.000000	6.900000e-01	0.840000	0.844342	0.840000	1.000000																										0				20						c.(1210-1212)Ccc>Acc		beta-1,4-N-acetyl-galactosaminyl transferase 1							9.0	13.0	12.0					12																	58021575		2169	4276	6445	SO:0001583	missense	2583	0	0					g.chr12:58021575G>T	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.1210C>A	chr12.hg19:g.58021575G>T	ENSP00000341562:p.Pro404Thr	0					B4GALNT1_ENST00000418555.2_Missense_Mutation_p.P349T	p.P404T	NM_001478.3	NP_001469.1	0	0	0	1.993499	Q00973	B4GN1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.109)	10	1794	-	Melanoma(17;0.122)		B4DE26|Q8N636	Missense_Mutation	SNP	ENST00000341156.4	1	1	hg19	c.1210C>A	CCDS8950.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.01|10.01	1.234514|1.234514	0.22626|0.22626	.|.	.|.	ENSG00000135454|ENSG00000135454	ENST00000341156;ENST00000418555|ENST00000547741	T;T|.	0.18338|.	2.22;2.26|.	4.5|4.5	2.54|2.54	0.30619|0.30619	4.5|4.5	2.54|2.54	0.30619|0.30619	Glycosyl transferase, family 2 (1);|.	0.499457|.	0.21274|.	N|.	0.077269|.	T|T	0.49474|0.49474	0.1559|0.1559	L|L	0.33753|0.33753	1.03|1.03	0.80722|0.80722	D|D	1|1	B;B|.	0.29805|.	0.126;0.257|.	B;B|.	0.28916|.	0.096;0.082|.	T|T	0.36114|0.36114	-0.9761|-0.9761	10|5	0.12430|.	T|.	0.62|.	-7.0386|-7.0386	8.8722|8.8722	0.35323|0.35323	0.0874:0.1505:0.7621:0.0|0.0874:0.1505:0.7621:0.0	.|.	349;404|.	B4DE26;Q00973|.	.;B4GN1_HUMAN|.	T|R	404;349|86	ENSP00000341562:P404T;ENSP00000401601:P349T|.	ENSP00000341562:P404T|.	P|S	-|-	1|3	0|2	0|2	B4GALNT1|B4GALNT1	56307842|56307842	56307842|56307842	0.097000|0.097000	0.21791|0.21791	0.942000|0.942000	0.38095|0.38095	0.968000|0.968000	0.65278|0.65278	0.656000|0.656000	0.24948|0.24948	1.063000|1.063000	0.40649|0.40649	0.462000|0.462000	0.41574|0.41574	CCC|AGC	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.706	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	11	1	1.980000	-20.000000	1	0.640000	NM_001478		0	20	20	0	53	51	0		1			0	0	12	0	0	0.999998	0	0	0	0	0	0	20	53
NAV3	89795	broad.mit.edu	37	12	78604240	78604240	+	Silent	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:78604240C>T	ENST00000397909.2	+	40	7274	c.7101C>T	c.(7099-7101)agC>agT	p.S2367S	NAV3_ENST00000536525.2_Silent_p.S2345S|NAV3_ENST00000266692.7_Silent_p.S2168S|NAV3_ENST00000541270.1_Silent_p.S197S|NAV3_ENST00000228327.6_Silent_p.S2345S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2367						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GCTGCGACAGCGAAAGCACCA	0.393										HNSCC(70;0.22)																												ENST00000397909.2	1.000000	7.600000e-01	0.980000	8.300000e-01	0.900000	0.906308	0.900000	1.000000																										0				236						c.(7099-7101)agC>agT		neuron navigator 3							53.0	57.0	56.0					12																	78604240		1948	4171	6119	SO:0001819	synonymous_variant	89795	5	120858	39				g.chr12:78604240C>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.7101C>T	chr12.hg19:g.78604240C>T		0	HNSCC(70;0.22)				NAV3_ENST00000536525.2_Silent_p.S2345S|NAV3_ENST00000228327.6_Silent_p.S2345S|NAV3_ENST00000266692.7_Silent_p.S2168S|NAV3_ENST00000541270.1_Silent_p.S197S	p.S2367S			0	0	0	1.993499	Q8IVL0	NAV3_HUMAN		40	7274	+			Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	1	1	hg19	c.7101C>T		1	.	.	.	.	.	.	.	.	.	.	C	0.332	-0.955497	0.02267	.	.	ENSG00000067798	ENST00000552895;ENST00000551162	.	.	.	5.35	-5.24	0.02789	5.35	-5.24	0.02789	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.8606	16.3886	0.83524	0.0:0.3108:0.0:0.6892	.	.	.	.	X	1240;235	.	.	R	+	1	2	2	NAV3	77128371	77128371	0.488000	0.25996	0.415000	0.26534	0.199000	0.23934	-0.262000	0.08682	-0.911000	0.03843	-0.768000	0.03414	CGA	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.393	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	1.980000	-8.416818	1	0.640000	NM_001024383		0	110	108	0	266	262	1		1	0		0	0	62	0	0	1.000000	5.646561e-01	0	1	0	5	0	110	266
NDUFA12	55967	broad.mit.edu	37	12	95397439	95397439	+	Silent	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:95397439G>T	ENST00000327772.2	-	1	107	c.18C>A	c.(16-18)gtC>gtA	p.V6V	NDUFA12_ENST00000547157.1_Silent_p.V6V|NDUFA12_ENST00000547986.1_Silent_p.V6V	NM_018838.4	NP_061326.1	Q9UI09	NDUAC_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12	6					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|large_intestine(2)|lung(3)	6						CGCGTTTCAGGACCTGCACTA	0.647																																						ENST00000327772.2	0.140000	4.000000e-02	0.120000	6.000000e-02	0.080000	0.092124	0.080000	0.080000																										0				6						c.(16-18)gtC>gtA		NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12							78.0	83.0	82.0					12																	95397439		2203	4300	6503	SO:0001819	synonymous_variant	55967	0	0					g.chr12:95397439G>T	BC005936	CCDS9050.1, CCDS58263.1	12q22	2011-07-04			ENSG00000184752	ENSG00000184752		"""Mitochondrial respiratory chain complex / Complex I"""	23987	protein-coding gene	gene with protein product	"""complex I B17.2 subunit"""	614530				10830904, 9827566	Standard	NM_018838		Approved	DAP13, B17.2	uc001tdl.4	Q9UI09		ENST00000327772.2:c.18C>A	chr12.hg19:g.95397439G>T		0					NDUFA12_ENST00000547986.1_Silent_p.V6V|NDUFA12_ENST00000547157.1_Silent_p.V6V	p.V6V	NM_018838.4	NP_061326.1	0	0	0	1.993499	Q9UI09	NDUAC_HUMAN		1	107	-			F8VQS7|Q53XX0|Q9BRV6	Silent	SNP	ENST00000327772.2	0	1	hg19	c.18C>A	CCDS9050.1	0																																																																																								0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.647	NDUFA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407245.2	0	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.980000	-3.579756	1	0.640000	NM_018838		0	14	14	0	489	482	0		1	1		0	0	51	0	0	0.999735	9.852838e-01	0	12	0	233	0	14	489
CCDC38	120935	broad.mit.edu	37	12	96292480	96292480	+	Silent	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr12:96292480G>T	ENST00000344280.3	-	6	956	c.399C>A	c.(397-399)atC>atA	p.I133I	SNRPF_ENST00000552085.1_Intron	NM_182496.2	NP_872302.2	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	133										breast(1)|endometrium(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CAAACTTTTTGATTGTGTTTC	0.373																																						ENST00000344280.3	1.000000	7.300000e-01	0.970000	8.000000e-01	0.880000	0.887777	0.880000	1.000000																										0				18						c.(397-399)atC>atA		coiled-coil domain containing 38							142.0	127.0	132.0					12																	96292480		2203	4300	6503	SO:0001819	synonymous_variant	120935	1	121412	33				g.chr12:96292480G>T	AK097408	CCDS9056.1	12q23.1	2005-11-02				ENSG00000165972			26843	protein-coding gene	gene with protein product							Standard	NM_182496		Approved	FLJ40089	uc001tek.2	Q502W7	OTTHUMG00000170352	ENST00000344280.3:c.399C>A	chr12.hg19:g.96292480G>T		0					SNRPF_ENST00000552085.1_Intron	p.I133I	NM_182496.2	NP_872302.2	0	0	0	1.993499	Q502W7	CCD38_HUMAN		6	956	-			Q8N835	Silent	SNP	ENST00000344280.3	1	1	hg19	c.399C>A	CCDS9056.1	1																																																																																								0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.373	CCDC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408634.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	1.980000	-20.000000	1	0.640000	NM_182496		0	89	85	0	222	217	1		1			0	0	76	0	0	1.000000	0	0	0	0	0	0	89	222
OR4N2	390429	broad.mit.edu	37	14	20295937	20295937	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr14:20295937G>A	ENST00000315947.1	+	1	330	c.330G>A	c.(328-330)ggG>ggA	p.G110G	OR4N2_ENST00000568211.1_Silent_p.G110G	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTGGAGGAGGGGAGGGATTAC	0.522																																						ENST00000315947.1	1.000000	4.000000e-02	1.000000	6.000000e-02	0.080000	0.302127	0.080000	0.080000																										0				52						c.(328-330)ggG>ggA		olfactory receptor, family 4, subfamily N, member 2							114.0	126.0	122.0					14																	20295937		2203	4297	6500	SO:0001819	synonymous_variant	390429	2	121412	39				g.chr14:20295937G>A		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.330G>A	chr14.hg19:g.20295937G>A		1					OR4N2_ENST00000568211.1_Silent_p.G110G	p.G110G	NM_001004723.1	NP_001004723.1	0	2	2	1.914286	Q8NGD1	OR4N2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	1	330	+	all_cancers(95;0.00108)		Q6IEY9|Q6IFA2	Silent	SNP	ENST00000315947.1	0	1	hg19	c.330G>A	CCDS32022.1	0																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.522	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2	0	0	1	2	13	2	2	1	1	1	1	206	206	206	237	1	1.980000	-2.093702	0	0.640000			0	22	19	0	866	786	0		1			1	0	206	0	0	0.922100	0	0	0	0	0	0	22	866
PRMT5	10419	broad.mit.edu	37	14	23391693	23391693	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr14:23391693G>A	ENST00000324366.8	-	15	1878	c.1655C>T	c.(1654-1656)gCc>gTc	p.A552V	PRMT5_ENST00000397440.4_Missense_Mutation_p.A381V|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5_ENST00000553897.1_Missense_Mutation_p.A508V|PRMT5_ENST00000216350.8_Missense_Mutation_p.A491V|PRMT5_ENST00000397441.2_Missense_Mutation_p.A535V|PRMT5-AS1_ENST00000587245.2_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.A446V|PRMT5-AS1_ENST00000609885.1_RNA|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5-AS1_ENST00000424245.2_RNA|PRMT5-AS1_ENST00000457443.2_RNA	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	552	Beta barrel. {ECO:0000269|PubMed:23071334}.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		AAAGTAGCCGGCAAAGCCATG	0.463																																						ENST00000324366.8	0.060000	0	0.050000	1.000000e-02	0.020000	0.032226	0.020000	0.040000																										0				25						c.(1654-1656)gCc>gTc		protein arginine methyltransferase 5							211.0	218.0	216.0					14																	23391693		2203	4300	6503	SO:0001583	missense	10419	0	0					g.chr14:23391693G>A	AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.1655C>T	chr14.hg19:g.23391693G>A	ENSP00000319169:p.Ala552Val	0					PRMT5-AS1_ENST00000587245.2_RNA|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.A446V|PRMT5_ENST00000553897.1_Missense_Mutation_p.A508V|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5_ENST00000397440.4_Missense_Mutation_p.A381V|PRMT5-AS1_ENST00000424245.2_RNA|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5_ENST00000216350.8_Missense_Mutation_p.A491V|PRMT5_ENST00000397441.2_Missense_Mutation_p.A535V|PRMT5-AS1_ENST00000457443.2_RNA|PRMT5-AS1_ENST00000609885.1_RNA	p.A552V	NM_006109.3	NP_006100.2	0	0	0	1.995992	O14744	ANM5_HUMAN		15	1878	-	all_cancers(95;2.76e-05)		A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	ENST00000324366.8	0	1	hg19	c.1655C>T	CCDS9579.1	0	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518793	0.85495	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000397440;ENST00000216350;ENST00000555454;ENST00000538452;ENST00000553897	T;T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02;2.02	5.79	5.79	0.91817	5.79	5.79	0.91817	.	0.046588	0.85682	D	0.000000	T	0.44286	0.1286	M	0.87547	2.89	0.80722	D	1	P;B;P;P;P	0.46142	0.694;0.416;0.792;0.832;0.873	B;B;P;B;P	0.48952	0.328;0.285;0.596;0.389;0.457	T	0.49542	-0.8929	10	0.66056	D	0.02	-12.7059	18.796	0.91994	0.0:0.0:1.0:0.0	.	508;491;381;552;535	G3V5W5;B4DX49;A8MTP3;O14744;A8MZ91	.;.;.;ANM5_HUMAN;.	V	552;535;381;491;151;446;508	ENSP00000319169:A552V;ENSP00000380583:A535V;ENSP00000380582:A381V;ENSP00000216350:A491V;ENSP00000451245:A151V;ENSP00000444915:A446V;ENSP00000452555:A508V	ENSP00000216350:A491V	A	-	2	0	0	PRMT5	22461533	22461533	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.655000	0.91098	2.750000	0.94351	0.561000	0.74099	GCC	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.463	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071674.3	0	0	1	2	2	2	2	0	0	0	0	160	160	160	155	1	1.980000	-2.094841	0	0.640000			0	9	8	0	934	928	0		1	0		0	0	160	0	0	0.993996	3.208989e-01	0	0	0	110	0	9	934
NID2	22795	broad.mit.edu	37	14	52505475	52505475	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr14:52505475G>A	ENST00000216286.5	-	9	2246	c.2247C>T	c.(2245-2247)ggC>ggT	p.G749G	NID2_ENST00000541773.1_Silent_p.G696G	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	749	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CTTTGACCGGGCCAATTTGAT	0.438																																						ENST00000216286.5	0.120000	0	0.090000	2.000000e-02	0.050000	0.061362	0.050000	0.050000																										0				87						c.(2245-2247)ggC>ggT		nidogen 2 (osteonidogen)							69.0	72.0	71.0					14																	52505475		2203	4300	6503	SO:0001819	synonymous_variant	22795	0	0					g.chr14:52505475G>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2247C>T	chr14.hg19:g.52505475G>A		0					NID2_ENST00000541773.1_Silent_p.G696G	p.G749G	NM_007361.3	NP_031387.3	0	0	0	1.995992	Q14112	NID2_HUMAN		9	2246	-	Breast(41;0.0639)|all_epithelial(31;0.123)		A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	0	1	hg19	c.2247C>T	CCDS9706.1	0	.	.	.	.	.	.	.	.	.	.	G	0.970	-0.700373	0.03279	.	.	ENSG00000087303	ENST00000556572	.	.	.	6.17	4.27	0.50696	6.17	4.27	0.50696	.	.	.	.	.	T	0.55577	0.1929	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53690	-0.8403	4	.	.	.	.	6.2489	0.20835	0.0705:0.2083:0.6002:0.1209	.	.	.	.	S	66	.	.	P	-	1	0	0	NID2	51575225	51575225	0.998000	0.40836	1.000000	0.80357	0.083000	0.17756	0.369000	0.20416	1.636000	0.50526	-0.136000	0.14681	CCC	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.438	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.980000	-2.981512	1	0.640000			0	4	4	0	246	243	0		1	0		0	0	45	0	0	0.888247	3.911369e-02	0	0	0	15	0	4	246
PAPLN	89932	broad.mit.edu	37	14	73733472	73733472	+	Missense_Mutation	SNP	C	C	G			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr14:73733472C>G	ENST00000554301.1	+	24	3596	c.3433C>G	c.(3433-3435)Cca>Gca	p.P1145A	PAPLN_ENST00000427855.1_Missense_Mutation_p.P1145A|PAPLN_ENST00000555445.1_Missense_Mutation_p.P1129A|PAPLN_ENST00000340738.5_Missense_Mutation_p.P1118A|PAPLN_ENST00000381166.3_Intron			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	1145	Ig-like C2-type 3.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		TGTGACAGTGCCAGAGGGTGA	0.547																																						ENST00000554301.1	1.000000	6.900000e-01	1.000000	8.100000e-01	0.940000	0.921762	0.940000	1.000000																										0				42						c.(3433-3435)Cca>Gca		papilin, proteoglycan-like sulfated glycoprotein							176.0	133.0	148.0					14																	73733472		2203	4300	6503	SO:0001583	missense	89932	0	0					g.chr14:73733472C>G	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.3433C>G	chr14.hg19:g.73733472C>G	ENSP00000451803:p.Pro1145Ala	0					PAPLN_ENST00000340738.5_Missense_Mutation_p.P1118A|PAPLN_ENST00000555445.1_Missense_Mutation_p.P1129A|PAPLN_ENST00000427855.1_Missense_Mutation_p.P1145A|PAPLN_ENST00000381166.3_Intron	p.P1145A			0	0	0	1.995992	O95428	PPN_HUMAN		24	3596	+			B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	1	1	hg19	c.3433C>G		1	.	.	.	.	.	.	.	.	.	.	C	0.066	-1.213152	0.01555	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000554301;ENST00000555445	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.07	2.17	0.27698	5.07	2.17	0.27698	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.35393	0.0930	N	0.05031	-0.125	0.53005	D	0.999961	B;B;B;B	0.19073	0.001;0.001;0.033;0.002	B;B;B;B	0.19946	0.004;0.008;0.027;0.007	T	0.04065	-1.0980	9	0.30854	T	0.27	.	5.6369	0.17542	0.1071:0.5598:0.2118:0.1213	.	1129;1145;344;1118	O95428-5;O95428;O95428-2;O95428-6	.;PPN_HUMAN;.;.	A	1118;1145;1145;1129	ENSP00000345395:P1118A;ENSP00000403403:P1145A;ENSP00000451803:P1145A;ENSP00000451729:P1129A	ENSP00000345395:P1118A	P	+	1	0	0	PAPLN	72803225	72803225	0.370000	0.25047	0.171000	0.22900	0.001000	0.01503	-0.021000	0.12504	0.030000	0.15379	-1.268000	0.01426	CCA	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.547	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	1.980000	-20.000000	1	0.640000	NM_173462		0	34	31	0	77	76	1		1	0		0	0	23	0	0	1.000000	9.623422e-01	0	0	0	15	0	34	77
EML5	161436	broad.mit.edu	37	14	89181392	89181392	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr14:89181392G>A	ENST00000380664.5	-	9	1334	c.1335C>T	c.(1333-1335)ggC>ggT	p.G445G	EML5_ENST00000554922.1_Silent_p.G445G|EML5_ENST00000352093.5_Silent_p.G445G			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	445						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCAAACACTCGCCAACTTTTT	0.383																																						ENST00000380664.5	1.000000	8.400000e-01	1.000000	9.300000e-01	0.990000	0.978016	0.990000	1.000000																										0				50						c.(1333-1335)ggC>ggT		echinoderm microtubule associated protein like 5							85.0	82.0	83.0					14																	89181392		1881	4108	5989	SO:0001819	synonymous_variant	161436	0	0					g.chr14:89181392G>A	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.1335C>T	chr14.hg19:g.89181392G>A		0					EML5_ENST00000352093.5_Silent_p.G445G|EML5_ENST00000554922.1_Silent_p.G445G	p.G445G			0	0	0	1.995992	Q05BV3	EMAL5_HUMAN		9	1334	-			B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	ENST00000380664.5	1	1	hg19	c.1335C>T	CCDS45148.1	1																																																																																								0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.383	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.980000	-20.000000	1	0.640000			0	72	72	0	143	142	1		1			0	0	51	0	0	1.000000	0	0	0	0	0	0	72	143
EIF5	1983	broad.mit.edu	37	14	103805083	103805083	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr14:103805083G>T	ENST00000216554.3	+	8	1273	c.597G>T	c.(595-597)gaG>gaT	p.E199D	SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000558506.1_Missense_Mutation_p.E199D|EIF5_ENST00000392715.2_Missense_Mutation_p.E199D	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	199	Asp/Glu-rich (highly acidic).				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			AAGAAGAGGAGGATGATGACT	0.413																																						ENST00000216554.3	1.000000	7.900000e-01	1.000000	8.600000e-01	0.940000	0.936814	0.940000	1.000000																										0				18						c.(595-597)gaG>gaT		eukaryotic translation initiation factor 5							117.0	107.0	111.0					14																	103805083		2203	4300	6503	SO:0001583	missense	1983	0	0					g.chr14:103805083G>T	U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.597G>T	chr14.hg19:g.103805083G>T	ENSP00000216554:p.Glu199Asp	0					EIF5_ENST00000558506.1_Missense_Mutation_p.E199D|SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000392715.2_Missense_Mutation_p.E199D	p.E199D	NM_001969.4	NP_001960.2	0	0	0	1.995992	P55010	IF5_HUMAN	Epithelial(46;0.182)	8	1273	+		Melanoma(154;0.155)	Q53XB3|Q9H5N2|Q9UG48	Missense_Mutation	SNP	ENST00000216554.3	1	1	hg19	c.597G>T	CCDS9980.1	1	.	.	.	.	.	.	.	.	.	.	.	1.304	-0.604076	0.03717	.	.	ENSG00000100664	ENST00000216554;ENST00000392715	D;D	0.82433	-1.61;-1.61	5.37	0.862	0.19056	5.37	0.862	0.19056	.	0.138874	0.64402	N	0.000008	T	0.57475	0.2056	N	0.16903	0.455	0.38094	D	0.937046	B	0.02656	0.0	B	0.01281	0.0	T	0.49570	-0.8926	10	0.02654	T	1	-4.7689	0.5359	0.00636	0.3386:0.1608:0.2956:0.2049	.	199	P55010	IF5_HUMAN	D	199	ENSP00000216554:E199D;ENSP00000376477:E199D	ENSP00000216554:E199D	E	+	3	2	2	EIF5	102874836	102874836	0.291000	0.24352	0.996000	0.52242	0.657000	0.38888	-0.406000	0.07187	-0.043000	0.13513	-0.259000	0.10710	GAG	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.413	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415329.2	1	0	0	2	2	2	2	0	0	0	0	65	65	65	65	1	1.980000	-20.000000	1	0.640000	NM_001969		0	113	102	0	258	270	1		1	1		0	0	65	0	0	1.000000	1	0	107	0	171	0	113	258
OCA2	4948	broad.mit.edu	37	15	28263652	28263652	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr15:28263652G>T	ENST00000354638.3	-	7	853	c.698C>A	c.(697-699)gCa>gAa	p.A233E	OCA2_ENST00000353809.5_Missense_Mutation_p.A233E|OCA2_ENST00000382996.2_Missense_Mutation_p.A233E	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	233					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TAGGGCCCCTGCCAGGTCCAC	0.647									Oculocutaneous Albinism																													ENST00000354638.3	1.000000	7.400000e-01	1.000000	8.500000e-01	0.980000	0.944432	0.980000	1.000000																										0				85						c.(697-699)gCa>gAa		oculocutaneous albinism II							27.0	24.0	25.0					15																	28263652		2201	4299	6500	SO:0001583	missense	4948	0	0		Oculocutaneous Albinism	Familial Cancer Database		g.chr15:28263652G>T		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.698C>A	chr15.hg19:g.28263652G>T	ENSP00000346659:p.Ala233Glu	0					OCA2_ENST00000382996.2_Missense_Mutation_p.A233E|OCA2_ENST00000353809.5_Missense_Mutation_p.A233E	p.A233E	NM_000275.2	NP_000266.2	1	2	3	2.043679	Q04671	P_HUMAN		7	853	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	1	1	hg19	c.698C>A	CCDS10020.1	1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.558383	0.27827	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996;ENST00000431101	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.54	2.47	0.30058	5.54	2.47	0.30058	.	0.354079	0.28130	N	0.016485	T	0.47746	0.1462	M	0.61703	1.905	0.24313	N	0.99508	P;B	0.35944	0.529;0.36	B;B	0.36567	0.228;0.09	T	0.41520	-0.9504	10	0.02654	T	1	-4.3929	3.9439	0.09339	0.1888:0.0:0.5739:0.2373	.	233;233	Q04671-2;Q04671	.;P_HUMAN	E	233	ENSP00000346659:A233E;ENSP00000261276:A233E;ENSP00000372457:A233E;ENSP00000415431:A233E	ENSP00000261276:A233E	A	-	2	0	0	OCA2	25937247	25937247	0.795000	0.28851	0.641000	0.29422	0.139000	0.21198	0.946000	0.29069	0.565000	0.29255	-0.136000	0.14681	GCA	0.642289		TCGA-S4-A8RM-01A-11D-A377-08	0.647	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	19	1	1.980000	-20.000000	1	0.640000	NM_000275		0	41	41	0	90	90	1		1	0		0	0	20	0	0	1.000000	1.013354e-01	0	0	0	2	0	41	90
ACAN	176	broad.mit.edu	37	15	89382106	89382106	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr15:89382106C>T	ENST00000561243.1	+	2	283	c.283C>T	c.(283-285)Cgg>Tgg	p.R95W	ACAN_ENST00000439576.2_Missense_Mutation_p.R95W|ACAN_ENST00000559004.1_Missense_Mutation_p.R95W|ACAN_ENST00000558207.1_Missense_Mutation_p.R95W|ACAN_ENST00000352105.7_Missense_Mutation_p.R95W			P16112	PGCA_HUMAN	aggrecan	95	G1-A.|Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGGGCGCGTGCGGGTCAACAG	0.622																																						ENST00000561243.1	0.080000	0	0.060000	1.000000e-02	0.030000	0.049595	0.030000	0.040000																										0				93						c.(283-285)Cgg>Tgg		aggrecan							136.0	159.0	151.0					15																	89382106		2141	4264	6405	SO:0001583	missense	176	2	121178	36				g.chr15:89382106C>T	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.283C>T	chr15.hg19:g.89382106C>T	ENSP00000453342:p.Arg95Trp	0					ACAN_ENST00000559004.1_Missense_Mutation_p.R95W|ACAN_ENST00000558207.1_Missense_Mutation_p.R95W|ACAN_ENST00000352105.7_Missense_Mutation_p.R95W|ACAN_ENST00000439576.2_Missense_Mutation_p.R95W	p.R95W			1	2	3	2.042131	P16112	PGCA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)	2	283	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	0	1	hg19	c.283C>T	CCDS53970.1	0	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407857	0.42715	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.66815	-0.23;-0.23	5.36	1.15	0.20763	5.36	1.15	0.20763	.	.	.	.	.	T	0.81074	0.4747	M	0.79011	2.435	0.36546	D	0.871562	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.987;0.987;0.993	D	0.84991	0.0894	9	0.87932	D	0	-12.5802	16.4177	0.83748	0.4344:0.5656:0.0:0.0	.	95;95;95	E7ENV9;E7EX88;Q6PID9	.;.;.	W	95	ENSP00000387356:R95W;ENSP00000341615:R95W	ENSP00000268134:R95W	R	+	1	2	2	ACAN	87183110	87183110	0.998000	0.40836	0.860000	0.33809	0.768000	0.43524	0.886000	0.28241	-0.170000	0.10816	-1.378000	0.01179	CGG	0.642289		TCGA-S4-A8RM-01A-11D-A377-08	0.622	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	0	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	1.980000	-1.916548	0	0.640000	NM_001135		0	7	7	0	614	609	0		1	0		0	0	103	0	0	0.980125	0	0	0	0	1	0	7	614
GP2	2813	broad.mit.edu	37	16	20329591	20329591	+	Missense_Mutation	SNP	C	C	T	rs145287300		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr16:20329591C>T	ENST00000381362.4	-	8	1254	c.1178G>A	c.(1177-1179)cGg>cAg	p.R393Q	GP2_ENST00000302555.5_Missense_Mutation_p.R390Q|GP2_ENST00000381360.5_Missense_Mutation_p.R246Q|GP2_ENST00000341642.5_Missense_Mutation_p.R243Q|GP2_ENST00000573897.1_5'Flank	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	393	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CAGGTTAAACCGGGAGGTGTC	0.498																																						ENST00000381362.4	1.000000	8.400000e-01	1.000000	9.100000e-01	0.970000	0.963986	0.970000	1.000000																										0				48						c.(1177-1179)cGg>cAg		glycoprotein 2 (zymogen granule membrane)							203.0	164.0	177.0					16																	20329591		2203	4300	6503	SO:0001583	missense	2813	6	121412	43				g.chr16:20329591C>T	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1178G>A	chr16.hg19:g.20329591C>T	ENSP00000370767:p.Arg393Gln	0					GP2_ENST00000302555.5_Missense_Mutation_p.R390Q|GP2_ENST00000573897.1_5'Flank|GP2_ENST00000381360.5_Missense_Mutation_p.R246Q|GP2_ENST00000341642.5_Missense_Mutation_p.R243Q	p.R393Q	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	1	2	3	2.025948	P55259	GP2_HUMAN		8	1254	-			A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	1	1	hg19	c.1178G>A	CCDS42128.1	1	.	.	.	.	.	.	.	.	.	.	C	9.634	1.137313	0.21123	.	.	ENSG00000169347	ENST00000302555;ENST00000381362;ENST00000381360;ENST00000341642;ENST00000537520	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	5.8	-0.158	0.13383	5.8	-0.158	0.13383	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	.	.	.	.	T	0.64560	0.2609	L	0.28192	0.835	0.09310	N	1	B;B;B;B	0.26147	0.012;0.122;0.135;0.143	B;B;B;B	0.23419	0.006;0.044;0.01;0.046	T	0.47433	-0.9118	9	0.11794	T	0.64	-6.5112	1.9729	0.03409	0.1244:0.4067:0.1377:0.3312	.	243;371;390;393	P55259-4;B7Z1G2;P55259-3;P55259	.;.;.;GP2_HUMAN	Q	390;393;246;243;371	ENSP00000304044:R390Q;ENSP00000370767:R393Q;ENSP00000370765:R246Q;ENSP00000343861:R243Q	ENSP00000304044:R390Q	R	-	2	0	0	GP2	20237092	20237092	0.033000	0.19621	0.017000	0.16124	0.778000	0.44026	0.163000	0.16520	0.089000	0.17243	-0.143000	0.13931	CGG	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.498	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	1	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	1.980000	-11.609830	1	0.640000	NM_016295		0	150	150	0	329	327	1		1	1		0	0	110	0	0	1.000000	1	0	326	0	463	0	150	329
P2RX1	5023	broad.mit.edu	37	17	3807664	3807664	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:3807664G>A	ENST00000225538.3	-	4	661	c.387C>T	c.(385-387)gaC>gaT	p.D129D		NM_002558.2	NP_002549.1	P51575	P2RX1_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 1	129					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ceramide biosynthetic process (GO:0046513)|insemination (GO:0007320)|ion transport (GO:0006811)|neuronal action potential (GO:0019228)|platelet activation (GO:0030168)|positive regulation of ion transport (GO:0043270)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of vascular smooth muscle contraction (GO:0003056)|response to ATP (GO:0033198)|serotonin secretion by platelet (GO:0002554)|signal transduction (GO:0007165)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|vasoconstriction (GO:0042310)	external side of cell outer membrane (GO:0031240)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	13				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		TACAGCCACTGTCTTCCTTGC	0.657																																						ENST00000225538.3	0.170000	4.000000e-02	0.130000	6.000000e-02	0.090000	0.103575	0.090000	0.090000																										0				13						c.(385-387)gaC>gaT		purinergic receptor P2X, ligand-gated ion channel, 1							72.0	57.0	62.0					17																	3807664		2203	4300	6503	SO:0001819	synonymous_variant	5023	0	0					g.chr17:3807664G>A	X83688	CCDS11040.1	17p13.3	2012-01-17				ENSG00000108405		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8533	protein-coding gene	gene with protein product		600845				8834001	Standard	NM_002558		Approved	P2X1	uc002fww.3	P51575		ENST00000225538.3:c.387C>T	chr17.hg19:g.3807664G>A		1						p.D129D	NM_002558.2	NP_002549.1	0	1	1	1.433139	P51575	P2RX1_HUMAN		4	661	-			Q9UK84	Silent	SNP	ENST00000225538.3	1	1	hg19	c.387C>T	CCDS11040.1	0																																																																																								0.473068		TCGA-S4-A8RM-01A-11D-A377-08	0.657	P2RX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438391.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.980000	-11.617700	1	0.640000	NM_002558		0	9	9	0	194	189	0		1	0		0	0	48	0	0	0.993869	2.604783e-03	0	0	0	2	0	9	194
SLC47A1	55244	broad.mit.edu	37	17	19480756	19480756	+	Missense_Mutation	SNP	G	G	A	rs547858729	byFrequency	TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:19480756G>A	ENST00000270570.4	+	17	1689	c.1603G>A	c.(1603-1605)Gct>Act	p.A535T	SLC47A1_ENST00000436810.2_3'UTR|SLC47A1_ENST00000395585.1_Missense_Mutation_p.A535T|SLC47A1_ENST00000457293.1_Missense_Mutation_p.A535T|SLC47A1_ENST00000575023.1_Missense_Mutation_p.A233T|SLC47A1_ENST00000571335.1_Missense_Mutation_p.A281T|AC025627.7_ENST00000420951.1_RNA|RP11-1113L8.1_ENST00000574267.1_RNA	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	535					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	ACAGGACGGCGCTAAATTGTC	0.512													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15798	0.0		0.0	False		,,,				2504	0.0					ENST00000270570.4	0.050000	0	0.030000	0	0.010000	0.024022	0.010000	0.020000																										0				23						c.(1603-1605)Gct>Act		solute carrier family 47 (multidrug and toxin extrusion), member 1	Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)						142.0	145.0	144.0					17																	19480756		2203	4300	6503	SO:0001583	missense	55244	4	121412	42				g.chr17:19480756G>A		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.1603G>A	chr17.hg19:g.19480756G>A	ENSP00000270570:p.Ala535Thr	1					SLC47A1_ENST00000395585.1_Missense_Mutation_p.A535T|RP11-1113L8.1_ENST00000574267.1_RNA|AC025627.7_ENST00000420951.1_RNA|SLC47A1_ENST00000457293.1_Missense_Mutation_p.A535T|SLC47A1_ENST00000575023.1_Missense_Mutation_p.A233T|SLC47A1_ENST00000436810.2_3'UTR|SLC47A1_ENST00000571335.1_Missense_Mutation_p.A281T	p.A535T	NM_018242.2	NP_060712.2	0	1	1	1.453406	Q96FL8	S47A1_HUMAN		17	1689	+	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)		Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	0	1	hg19	c.1603G>A	CCDS11209.1	0	.	.	.	.	.	.	.	.	.	.	G	6.205	0.406028	0.11754	.	.	ENSG00000142494	ENST00000270570;ENST00000457293;ENST00000395585;ENST00000455670;ENST00000424755	T;T;T	0.32023	1.49;1.47;1.47	5.16	-10.3	0.00346	5.16	-10.3	0.00346	.	2.640820	0.01350	N	0.011864	T	0.15219	0.0367	N	0.21448	0.665	0.09310	N	1	B;B;B;B	0.12013	0.0;0.0;0.001;0.005	B;B;B;B	0.09377	0.0;0.0;0.001;0.004	T	0.08597	-1.0714	10	0.15066	T	0.55	-11.0131	6.0981	0.20031	0.1985:0.1763:0.5331:0.0921	.	210;210;535;535	E7ENC3;B4DDH5;Q96FL8;Q96FL8-3	.;.;S47A1_HUMAN;.	T	535;535;535;210;247	ENSP00000270570:A535T;ENSP00000415586:A535T;ENSP00000378951:A535T	ENSP00000270570:A535T	A	+	1	0	0	SLC47A1	19421348	19421348	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.188000	0.01249	-3.020000	0.00270	-0.672000	0.03802	GCT	0.473068		TCGA-S4-A8RM-01A-11D-A377-08	0.512	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	0	0	1	2	2	2	2	0	0	0	0	98	98	98	96	1	1.980000	-1.916061	0	0.640000	NM_018242		0	5	5	0	523	516	0		1	0		0	0	98	0	0	0.935280	0	0	0	0	1	0	5	523
MAPT	4137	broad.mit.edu	37	17	44073913	44073913	+	Silent	SNP	G	G	A	rs115142761		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:44073913G>A	ENST00000571987.1	+	9	1656	c.1656G>A	c.(1654-1656)tcG>tcA	p.S552S	MAPT_ENST00000446361.3_Silent_p.S177S|MAPT_ENST00000351559.5_Silent_p.S235S|MAPT_ENST00000570299.1_3'UTR|MAPT_ENST00000344290.5_Silent_p.S570S|MAPT_ENST00000334239.8_Silent_p.S177S|MAPT_ENST00000415613.2_Silent_p.S570S|MAPT_ENST00000574436.1_Silent_p.S235S|MAPT_ENST00000340799.5_Silent_p.S206S|MAPT_ENST00000262410.5_Silent_p.S552S|MAPT_ENST00000420682.2_Silent_p.S206S|MAPT_ENST00000431008.3_Silent_p.S235S|MAPT_ENST00000347967.5_Silent_p.S141S|MAPT_ENST00000535772.1_Silent_p.S235S|STH_ENST00000537309.1_5'Flank|MAPT_ENST00000576518.1_Silent_p.S166S			P10636	TAU_HUMAN	microtubule-associated protein tau	552					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	CACCCAAGTCGCCGTCTTCCG	0.662													G|||	1	0.000199681	0.0008	0.0	5008	,	,		11450	0.0		0.0	False		,,,				2504	0.0					ENST00000571987.1	1.000000	8.000000e-02	0.260000	1.200000e-01	0.170000	0.218171	0.170000	0.170000																										0				38						c.(1654-1656)tcG>tcA		microtubule-associated protein tau	Docetaxel(DB01248)|Paclitaxel(DB01229)	G	,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	28.0	27.0	27.0		1710,618,618,705,705,531,1656,531	-2.6	1.0	17	dbSNP_132	27	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MAPT	NM_001123066.3,NM_001123067.3,NM_001203251.1,NM_001203252.1,NM_005910.5,NM_016834.4,NM_016835.4,NM_016841.4	,,,,,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,,,,,	570/777,206/413,206/382,235/411,235/442,177/384,552/759,177/353	44073913	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	4137	5	121388	37				g.chr17:44073913G>A	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.1656G>A	chr17.hg19:g.44073913G>A		0					MAPT_ENST00000431008.3_Silent_p.S235S|MAPT_ENST00000570299.1_3'UTR|MAPT_ENST00000334239.8_Silent_p.S177S|MAPT_ENST00000351559.5_Silent_p.S235S|MAPT_ENST00000535772.1_Silent_p.S235S|MAPT_ENST00000344290.5_Silent_p.S570S|MAPT_ENST00000574436.1_Silent_p.S235S|MAPT_ENST00000446361.3_Silent_p.S177S|MAPT_ENST00000347967.5_Silent_p.S141S|MAPT_ENST00000340799.5_Silent_p.S206S|MAPT_ENST00000576518.1_Silent_p.S166S|STH_ENST00000537309.1_5'Flank|MAPT_ENST00000420682.2_Silent_p.S206S|MAPT_ENST00000262410.5_Silent_p.S552S|MAPT_ENST00000415613.2_Silent_p.S570S	p.S552S			1	2	3	2.070324	P10636	TAU_HUMAN		9	1656	+		Melanoma(429;0.216)	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	ENST00000571987.1	0	1	hg19	c.1656G>A	CCDS11501.1	0																																																																																								0.645669		TCGA-S4-A8RM-01A-11D-A377-08	0.662	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.980000	-11.449430	1	0.640000	NM_016835		0	8	8	0	142	138	0		1	0		0	0	20	0	0	0.988809	3.869969e-03	0	0	0	2	0	8	142
RNF43	54894	broad.mit.edu	37	17	56440757	56440757	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:56440757G>A	ENST00000584437.1	-	4	2416	c.461C>T	c.(460-462)cCg>cTg	p.P154L	RNF43_ENST00000581868.1_Missense_Mutation_p.P27L|RNF43_ENST00000583753.1_Missense_Mutation_p.P113L|RNF43_ENST00000577716.1_Missense_Mutation_p.P154L|RNF43_ENST00000577625.1_Missense_Mutation_p.P27L|RNF43_ENST00000407977.2_Missense_Mutation_p.P154L|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000500597.2_Missense_Mutation_p.P113L			Q68DV7	RNF43_HUMAN	ring finger protein 43	154					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGCCCCAGCGGCTGCTGCAG	0.577																																						ENST00000584437.1	1.000000	8.200000e-01	1.000000	8.800000e-01	0.950000	0.945798	0.950000	1.000000																										0				60						c.(460-462)cCg>cTg		ring finger protein 43							96.0	101.0	99.0					17																	56440757		2203	4300	6503	SO:0001583	missense	54894	1	121412	37				g.chr17:56440757G>A		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.461C>T	chr17.hg19:g.56440757G>A	ENSP00000463069:p.Pro154Leu	0					RNF43_ENST00000407977.2_Missense_Mutation_p.P154L|RNF43_ENST00000583753.1_Missense_Mutation_p.P113L|RNF43_ENST00000500597.2_Missense_Mutation_p.P113L|RNF43_ENST00000581868.1_Missense_Mutation_p.P27L|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Missense_Mutation_p.P154L|RNF43_ENST00000577625.1_Missense_Mutation_p.P27L	p.P154L			1	2	3	2.070324	Q68DV7	RNF43_HUMAN		4	2416	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	1	1	hg19	c.461C>T	CCDS11607.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.475540	0.96291	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.27104	1.69;3.06	5.68	5.68	0.88126	5.68	5.68	0.88126	.	0.187766	0.47093	D	0.000257	T	0.30103	0.0754	N	0.19112	0.55	0.80722	D	1	D;D;D	0.69078	0.995;0.993;0.997	P;P;P	0.54140	0.743;0.721;0.551	T	0.01725	-1.1287	10	0.34782	T	0.22	-8.5077	18.7682	0.91881	0.0:0.0:1.0:0.0	.	113;154;154	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	L	154;113	ENSP00000385328:P154L;ENSP00000441969:P113L	ENSP00000385328:P154L	P	-	2	0	0	RNF43	53795756	53795756	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.661000	0.91125	2.684000	0.91462	0.591000	0.81541	CCG	0.645669		TCGA-S4-A8RM-01A-11D-A377-08	0.577	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.980000	-10.307860	1	0.640000	NM_017763		0	151	150	0	353	347	1		1	1	1	0	0	76	497	0	1.000000	9.998374e-01	1	8	274	25	609	151	353
CHD3	1107	broad.mit.edu	37	17	7807208	7807208	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:7807208G>A	ENST00000330494.7	+	24	3943	c.3793G>A	c.(3793-3795)Gac>Aac	p.D1265N	CHD3_ENST00000358181.4_Missense_Mutation_p.D1265N|CHD3_ENST00000380358.4_Missense_Mutation_p.D1324N|SCARNA21_ENST00000517026.1_RNA	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1265					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TCGGCTGTTGGACCGGAACCA	0.517																																						ENST00000330494.7	1.000000	8.700000e-01	1.000000	9.200000e-01	0.970000	0.966016	0.970000	1.000000																										0				65						c.(3793-3795)Gac>Aac		chromodomain helicase DNA binding protein 3							125.0	101.0	110.0					17																	7807208		2203	4300	6503	SO:0001583	missense	1107	0	0					g.chr17:7807208G>A	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.3793G>A	chr17.hg19:g.7807208G>A	ENSP00000332628:p.Asp1265Asn	1					SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000358181.4_Missense_Mutation_p.D1265N|CHD3_ENST00000380358.4_Missense_Mutation_p.D1324N	p.D1265N	NM_001005273.2	NP_001005273.1	0	1	1	1.433139	Q12873	CHD3_HUMAN		24	3943	+		Prostate(122;0.202)	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	1	1	hg19	c.3793G>A	CCDS32554.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723272	0.89298	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.91631	-2.88;-2.81;-2.81	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.000000	0.49305	D	0.000159	D	0.95242	0.8457	L	0.60957	1.885	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.81914	0.995;0.989;0.989	D	0.95103	0.8232	10	0.62326	D	0.03	-30.8593	19.1045	0.93287	0.0:0.0:1.0:0.0	.	1265;1265;1324	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	N	1324;1265;1265	ENSP00000369716:D1324N;ENSP00000350907:D1265N;ENSP00000332628:D1265N	ENSP00000332628:D1265N	D	+	1	0	0	CHD3	7747933	7747933	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.203000	0.95033	2.811000	0.96726	0.655000	0.94253	GAC	0.473068		TCGA-S4-A8RM-01A-11D-A377-08	0.517	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.980000	-20.000000	1	0.640000	NM_001005273		0	106	105	0	109	106	1		1	1		0	0	39	0	0	1.000000	1	0	124	0	46	0	106	109
RNF157	114804	broad.mit.edu	37	17	74148532	74148532	+	Missense_Mutation	SNP	C	C	T	rs537147365		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:74148532C>T	ENST00000269391.6	-	18	1957	c.1825G>A	c.(1825-1827)Gca>Aca	p.A609T	RNF157-AS1_ENST00000592748.1_RNA|RNF157-AS1_ENST00000586661.1_RNA|RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000585542.1_RNA|RNF157_ENST00000319945.6_Missense_Mutation_p.A587T|RNF157-AS1_ENST00000586627.1_RNA	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	609							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			CCTAGAAATGCGCACGTCCTC	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		21244	0.001		0.0	False		,,,				2504	0.0				GBM(186;507 2120 27388 27773 52994)	ENST00000269391.6	1.000000	1.000000e-02	0.080000	2.000000e-02	0.040000	0.090569	0.040000	0.050000																										0				25						c.(1825-1827)Gca>Aca		ring finger protein 157							259.0	210.0	227.0					17																	74148532		2203	4300	6503	SO:0001583	missense	114804	7	121412	43				g.chr17:74148532C>T	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1825G>A	chr17.hg19:g.74148532C>T	ENSP00000269391:p.Ala609Thr	0					RNF157-AS1_ENST00000592748.1_RNA|RNF157_ENST00000319945.6_Missense_Mutation_p.A587T|RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000586661.1_RNA|RNF157-AS1_ENST00000586627.1_RNA|RNF157-AS1_ENST00000585542.1_RNA	p.A609T	NM_052916.2	NP_443148.1	1	2	3	2.070324	Q96PX1	RN157_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.187)	18	1957	-			Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	0	1	hg19	c.1825G>A	CCDS32740.1	0	.	.	.	.	.	.	.	.	.	.	C	18.55	3.649353	0.67358	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.36699	1.7;1.24	5.71	4.68	0.58851	5.71	4.68	0.58851	.	0.088535	0.49305	D	0.000154	T	0.35335	0.0928	L	0.54323	1.7	0.80722	D	1	P;P	0.52170	0.951;0.84	B;B	0.41946	0.371;0.089	T	0.24835	-1.0149	10	0.52906	T	0.07	-1.2912	13.8657	0.63588	0.1522:0.8478:0.0:0.0	.	587;609	Q96PX1-2;Q96PX1	.;RN157_HUMAN	T	609;587	ENSP00000269391:A609T;ENSP00000321837:A587T	ENSP00000269391:A609T	A	-	1	0	0	RNF157	71660127	71660127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.443000	0.44881	2.684000	0.91462	0.655000	0.94253	GCA	0.645669		TCGA-S4-A8RM-01A-11D-A377-08	0.458	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	0	0	1	2	2	2	2	0	0	0	0	67	67	67	65	1	1.980000	-2.576342	1	0.640000	XM_290732		0	6	6	0	398	395	0		1	0		0	0	67	0	0	0.964435	1.001739e-03	0	0	0	3	0	6	398
RNF213	57674	broad.mit.edu	37	17	78321225	78321225	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr17:78321225G>A	ENST00000582970.1	+	29	9233	c.9090G>A	c.(9088-9090)ccG>ccA	p.P3030P	RNF213_ENST00000508628.2_Silent_p.P3079P|RNF213_ENST00000336301.6_Silent_p.P1103P	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3030					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGAAGGTGCCGGGTGGAGAGC	0.547																																						ENST00000582970.1	1.000000	7.500000e-01	1.000000	8.300000e-01	0.920000	0.920008	0.920000	1.000000																										0				130						c.(9088-9090)ccG>ccA		ring finger protein 213							60.0	54.0	56.0					17																	78321225		2203	4300	6503	SO:0001819	synonymous_variant	57674	5	121412	37				g.chr17:78321225G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9090G>A	chr17.hg19:g.78321225G>A		0					RNF213_ENST00000508628.2_Silent_p.P3079P|RNF213_ENST00000336301.6_Silent_p.P1103P	p.P3030P	NM_001256071.1	NP_001243000.1	1	2	3	2.070324	Q63HN8	RN213_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)	29	9233	+	all_neural(118;0.0538)		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	1	1	hg19	c.9090G>A	CCDS58606.1	1																																																																																								0.645669		TCGA-S4-A8RM-01A-11D-A377-08	0.547	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.980000	-6.107752	1	0.640000	NM_020914		0	74	74	0	180	179	1		1	1	1	0	0	42	274	0	1.000000	9.998978e-01	1	12	133	25	254	74	180
ZNF407	55628	broad.mit.edu	37	18	72347373	72347373	+	Silent	SNP	C	C	T	rs373149860		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr18:72347373C>T	ENST00000299687.5	+	1	4398	c.4398C>T	c.(4396-4398)gcC>gcT	p.A1466A	ZNF407_ENST00000309902.6_Silent_p.A1466A|ZNF407_ENST00000582337.1_Silent_p.A1466A|ZNF407_ENST00000577538.1_Silent_p.A1466A	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TGGCTAGTGCCGGCCACATGA	0.498																																						ENST00000299687.5	0.230000	4.000000e-02	0.170000	7.000000e-02	0.110000	0.125417	0.110000	0.110000																										0				67						c.(4396-4398)gcC>gcT		zinc finger protein 407		C	,,	0,3834		0,0,1917	37.0	40.0	39.0		4398,4398,4398	-0.1	1.0	18		39	1,8311		0,1,4155	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF407	NM_001146189.1,NM_001146190.1,NM_017757.2	,,	0,1,6072	TT,TC,CC		0.012,0.0,0.0082	,,	1466/1816,1466/1661,1466/2249	72347373	1,12145	1917	4156	6073	SO:0001819	synonymous_variant	55628	6	120840	38				g.chr18:72347373C>T	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4398C>T	chr18.hg19:g.72347373C>T		1					ZNF407_ENST00000309902.6_Silent_p.A1466A|ZNF407_ENST00000582337.1_Silent_p.A1466A|ZNF407_ENST00000577538.1_Silent_p.A1466A	p.A1466A	NM_017757.2	NP_060227.2	0	1	1	1.440698	Q9C0G0	ZN407_HUMAN		1	4398	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	ENST00000299687.5	1	1	hg19	c.4398C>T	CCDS45885.1	0																																																																																								0.473068		TCGA-S4-A8RM-01A-11D-A377-08	0.498	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.980000	-4.411144	1	0.640000	NM_017757		0	5	5	0	94	93	0		1	0		0	0	31	0	0	0.937535	2.201027e-02	0	0	0	4	0	5	94
TNFSF9	8744	broad.mit.edu	37	19	6534843	6534843	+	Silent	SNP	C	C	T	rs370981091		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr19:6534843C>T	ENST00000245817.3	+	3	569	c.531C>T	c.(529-531)gcC>gcT	p.A177A		NM_003811.3	NP_003802.1	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily, member 9	177					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	5						CTGGGGCCGCCGCCCTGGCTT	0.692																																						ENST00000245817.3	1.000000	7.200000e-01	1.000000	8.600000e-01	0.990000	0.948828	0.990000	1.000000																										0				5						c.(529-531)gcC>gcT		tumor necrosis factor (ligand) superfamily, member 9				0,4382		0,0,2191	16.0	18.0	17.0		531	-7.6	0.0	19		17	1,8579		0,1,4289	no	coding-synonymous	TNFSF9	NM_003811.3		0,1,6480	TT,TC,CC		0.0117,0.0,0.0077		177/255	6534843	1,12961	2191	4290	6481	SO:0001819	synonymous_variant	8744	1	120038	29				g.chr19:6534843C>T	U03398	CCDS12169.1	19p13.3	2008-07-22				ENSG00000125657		"""Tumor necrosis factor (ligand) superfamily"""	11939	protein-coding gene	gene with protein product	"""receptor 4-1BB ligand"", ""homolog of mouse 4-1BB-L"""	606182				8405064, 8088337	Standard	NM_003811		Approved	4-1BB-L	uc002mfh.2	P41273		ENST00000245817.3:c.531C>T	chr19.hg19:g.6534843C>T		0						p.A177A	NM_003811.3	NP_003802.1	1	2	3	2.087110	P41273	TNFL9_HUMAN		3	569	+			Q2M3S2	Silent	SNP	ENST00000245817.3	1	1	hg19	c.531C>T	CCDS12169.1	1																																																																																								0.646782		TCGA-S4-A8RM-01A-11D-A377-08	0.692	TNFSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457856.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.980000	-20.000000	1	0.640000	NM_003811		0	30	29	0	65	64	0		1	0		0	0	20	0	0	1.000000	3.833312e-01	0	0	0	4	0	30	65
TRPM4	54795	broad.mit.edu	37	19	49684660	49684660	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr19:49684660C>T	ENST00000252826.5	+	10	1331	c.1205C>T	c.(1204-1206)gCt>gTt	p.A402V	TRPM4_ENST00000427978.2_Missense_Mutation_p.A402V|TRPM4_ENST00000601347.1_Intron|TRPM4_ENST00000355712.5_Intron	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	402					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TTGGCTGTGGCTTGGAACCGC	0.617																																						ENST00000252826.5	1.000000	7.100000e-01	0.940000	7.700000e-01	0.850000	0.859105	0.850000	0.850000																										0				49						c.(1204-1206)gCt>gTt		transient receptor potential cation channel, subfamily M, member 4							98.0	84.0	89.0					19																	49684660		2203	4300	6503	SO:0001583	missense	54795	0	0					g.chr19:49684660C>T	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1205C>T	chr19.hg19:g.49684660C>T	ENSP00000252826:p.Ala402Val	0					TRPM4_ENST00000427978.2_Missense_Mutation_p.A402V|TRPM4_ENST00000355712.5_Intron|TRPM4_ENST00000601347.1_Intron	p.A402V	NM_017636.3	NP_060106.2	1	2	3	2.032905	Q8TD43	TRPM4_HUMAN		10	1331	+		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	1	1	hg19	c.1205C>T	CCDS33073.1	1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611107	0.66558	.	.	ENSG00000130529	ENST00000252826;ENST00000427978	T;T	0.67865	-0.29;-0.29	3.92	3.92	0.45320	3.92	3.92	0.45320	.	0.070546	0.64402	D	0.000018	T	0.81621	0.4861	M	0.84948	2.725	0.80722	D	1	D;D;D	0.71674	0.987;0.994;0.998	P;D;P	0.64144	0.807;0.922;0.887	D	0.85892	0.1429	10	0.87932	D	0	-11.7547	15.0744	0.72066	0.0:1.0:0.0:0.0	.	228;402;402	Q8TD43-2;Q8TD43-3;Q8TD43	.;.;TRPM4_HUMAN	V	402	ENSP00000252826:A402V;ENSP00000407492:A402V	ENSP00000252826:A402V	A	+	2	0	0	TRPM4	54376472	54376472	1.000000	0.71417	1.000000	0.80357	0.233000	0.25261	6.665000	0.74442	1.899000	0.54978	0.455000	0.32223	GCT	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.617	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	1	0	1	2	2	2	2	0	0	0	0	34	34	34	32	1	1.980000	-5.227186	1	0.640000	NM_017636		0	93	93	0	247	242	1		1	1		0	0	34	0	0	1.000000	1	0	83	0	141	0	93	247
SMG7	9887	broad.mit.edu	37	1	183515464	183515464	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr1:183515464C>T	ENST00000347615.2	+	17	2853	c.2734C>T	c.(2734-2736)Ccg>Tcg	p.P912S	SMG7_ENST00000367537.3_Missense_Mutation_p.P895S|SMG7_ENST00000508461.1_Missense_Mutation_p.P870S|SMG7_ENST00000456731.2_Missense_Mutation_p.P824S|SMG7_ENST00000515829.2_Missense_Mutation_p.P866S|SMG7_ENST00000507469.1_Missense_Mutation_p.P866S	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	912					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						ACCCAGAATGCCGTTTGAGGT	0.458																																						ENST00000347615.2	0.120000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.065936	0.050000	0.060000																										0				46						c.(2734-2736)Ccg>Tcg		SMG7 nonsense mediated mRNA decay factor							82.0	89.0	87.0					1																	183515464		2203	4300	6503	SO:0001583	missense	9887	8	121406	39				g.chr1:183515464C>T	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2734C>T	chr1.hg19:g.183515464C>T	ENSP00000340766:p.Pro912Ser	1					SMG7_ENST00000508461.1_Missense_Mutation_p.P870S|SMG7_ENST00000507469.1_Missense_Mutation_p.P866S|SMG7_ENST00000515829.2_Missense_Mutation_p.P866S|SMG7_ENST00000367537.3_Missense_Mutation_p.P895S|SMG7_ENST00000456731.2_Missense_Mutation_p.P824S	p.P912S	NM_173156.2	NP_775179.1	1	2	3	2.680464	Q92540	SMG7_HUMAN		17	2853	+			B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	0	1	hg19	c.2734C>T	CCDS1355.1	0	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565506	0.45694	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.492382	0.20703	N	0.087223	T	0.29556	0.0737	N	0.24115	0.695	0.46458	D	0.99905	B;B;B;B;B;B	0.28713	0.22;0.19;0.084;0.137;0.191;0.19	B;B;B;B;B;B	0.29942	0.054;0.034;0.051;0.109;0.073;0.081	T	0.08722	-1.0708	10	0.27082	T	0.32	-9.5004	11.4831	0.50337	0.1457:0.7286:0.1256:0.0	.	870;895;824;866;912;866	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	S	824;895;870;912;866;866	ENSP00000407629:P824S;ENSP00000356507:P895S;ENSP00000426915:P870S;ENSP00000340766:P912S;ENSP00000425133:P866S;ENSP00000421358:P866S	ENSP00000340766:P912S	P	+	1	0	0	SMG7	181782087	181782087	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.030000	0.41108	2.620000	0.88729	0.655000	0.94253	CCG	0.727273		TCGA-S4-A8RM-01A-11D-A377-08	0.458	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.980000	-2.742843	1	0.640000	NM_014837		0	6	6	0	428	425	0		1	0		0	0	50	0	0	0.964463	5.031734e-01	0	0	0	110	0	6	428
OBSCN	84033	broad.mit.edu	37	1	228506686	228506686	+	Missense_Mutation	SNP	C	C	T	rs570545660		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr1:228506686C>T	ENST00000422127.1	+	54	14277	c.14233C>T	c.(14233-14235)Cgg>Tgg	p.R4745W	OBSCN_ENST00000366709.4_Missense_Mutation_p.R1864W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4745W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5702W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2379W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4745					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCCTGGCTCGGAAACGTCG	0.687																																						ENST00000422127.1	1.000000	3.500000e-01	0.910000	5.000000e-01	0.690000	0.707775	0.690000	1.000000																										0				223						c.(14233-14235)Cgg>Tgg		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							17.0	20.0	19.0					1																	228506686		2188	4278	6466	SO:0001583	missense	84033	3	120636	24				g.chr1:228506686C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14233C>T	chr1.hg19:g.228506686C>T	ENSP00000409493:p.Arg4745Trp	1					OBSCN_ENST00000284548.11_Missense_Mutation_p.R4745W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2379W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5702W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1864W	p.R4745W	NM_001098623.2	NP_001092093.2	1	2	3	2.685707	Q5VST9	OBSCN_HUMAN		54	14277	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	0	1	hg19	c.14233C>T	CCDS58065.1	0	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466374	0.63625	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.65364	0.26;-0.15;-0.09;0.41	4.03	1.89	0.25635	4.03	1.89	0.25635	.	0.207897	0.29139	N	0.013029	T	0.61702	0.2368	N	0.24115	0.695	0.31729	N	0.637237	D;D	0.76494	0.999;0.999	P;D	0.65140	0.857;0.932	T	0.66520	-0.5903	10	0.62326	D	0.03	.	10.3422	0.43884	0.6289:0.3711:0.0:0.0	.	4745;4745	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4745;4745;2379;1864	ENSP00000284548:R4745W;ENSP00000409493:R4745W;ENSP00000355668:R2379W;ENSP00000355670:R1864W	ENSP00000284548:R4745W	R	+	1	2	2	OBSCN	226573309	226573309	1.000000	0.71417	0.998000	0.56505	0.428000	0.31595	5.230000	0.65321	0.882000	0.36016	0.313000	0.20887	CGG	0.727273		TCGA-S4-A8RM-01A-11D-A377-08	0.687	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.980000	-17.537120	1	0.640000	NM_052843		0	9	8	0	46	47	0		1	0		0	0	9	0	0	0.995547	3.534299e-01	0	1	0	6	0	9	46
HCRTR1	3061	broad.mit.edu	37	1	32087188	32087188	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr1:32087188C>T	ENST00000373706.5	+	4	886	c.733C>T	c.(733-735)Cgc>Tgc	p.R245C	HCRTR1_ENST00000373705.1_Missense_Mutation_p.R245C|HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000403528.2_Missense_Mutation_p.R245C			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	245					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		GCTCTGGGGCCGCCAGGTGAG	0.597																																						ENST00000373706.5	0.110000	2.000000e-02	0.090000	3.000000e-02	0.050000	0.065468	0.050000	0.060000																										0				7						c.(733-735)Cgc>Tgc		hypocretin (orexin) receptor 1							67.0	68.0	68.0					1																	32087188		2203	4300	6503	SO:0001583	missense	3061	0	0					g.chr1:32087188C>T	AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.733C>T	chr1.hg19:g.32087188C>T	ENSP00000362810:p.Arg245Cys	1					HCRTR1_ENST00000403528.2_Missense_Mutation_p.R245C|HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000373705.1_Missense_Mutation_p.R245C	p.R245C			0	1	1	1.449678	O43613	OX1R_HUMAN		4	886	+		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	0	1	hg19	c.733C>T	CCDS344.1	0	.	.	.	.	.	.	.	.	.	.	c	29.2	4.987869	0.93106	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.38887	1.11;1.11;1.11	5.25	5.25	0.73442	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.129259	0.56097	D	0.000036	T	0.63674	0.2531	M	0.73430	2.235	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.63703	0.846;0.917	T	0.66622	-0.5877	10	0.87932	D	0	.	17.1746	0.86838	0.0:1.0:0.0:0.0	.	245;245	A6NMV7;O43613	.;OX1R_HUMAN	C	245	ENSP00000384387:R245C;ENSP00000362810:R245C;ENSP00000362809:R245C	ENSP00000362809:R245C	R	+	1	0	0	HCRTR1	31859775	31859775	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.354000	0.59417	2.836000	0.97738	0.651000	0.88453	CGC	0.475524		TCGA-S4-A8RM-01A-11D-A377-08	0.597	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	0	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	1.980000	-7.979174	1	0.640000	NM_001525		0	7	7	0	252	248	0		1			0	0	48	0	0	0.979916	0	0	0	0	0	0	7	252
BARHL2	343472	broad.mit.edu	37	1	91180182	91180182	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr1:91180182G>A	ENST00000370445.4	-	2	798	c.757C>T	c.(757-759)Cgg>Tgg	p.R253W		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	253					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		TACTTCTGCCGCTCAAAGCTA	0.567																																					GBM(199;3561 4100 22440)	ENST00000370445.4	0.050000	0	0.040000	1.000000e-02	0.020000	0.027753	0.020000	0.020000																										0				24						c.(757-759)Cgg>Tgg		BarH-like homeobox 2							169.0	154.0	159.0					1																	91180182		2203	4300	6503	SO:0001583	missense	343472	0	0					g.chr1:91180182G>A	AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.757C>T	chr1.hg19:g.91180182G>A	ENSP00000359474:p.Arg253Trp	1						p.R253W	NM_020063.1	NP_064447.1	0	1	1	1.449678	Q9NY43	BARH2_HUMAN		2	798	-		all_lung(203;0.0263)|Lung SC(238;0.128)	A0AVP2|Q7Z4N7	Missense_Mutation	SNP	ENST00000370445.4	0	1	hg19	c.757C>T	CCDS730.1	0	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481732	0.63849	.	.	ENSG00000143032	ENST00000370445	D	0.96427	-4.01	5.48	4.55	0.56014	5.48	4.55	0.56014	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.088225	0.53938	D	0.000059	D	0.97763	0.9266	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98465	1.0598	10	0.72032	D	0.01	.	14.0787	0.64907	0.0:0.0:0.848:0.1519	.	253	Q9NY43	BARH2_HUMAN	W	253	ENSP00000359474:R253W	ENSP00000359474:R253W	R	-	1	2	2	BARHL2	90952770	90952770	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.479000	0.35453	1.243000	0.43853	0.655000	0.94253	CGG	0.475524		TCGA-S4-A8RM-01A-11D-A377-08	0.567	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2	0	0	1	2	2	2	2	0	0	0	0	111	111	111	110	1	1.980000	-2.204897	0	0.640000			0	6	6	0	532	526	0		1			0	0	111	0	0	0.963704	0	0	0	0	0	0	6	532
OR2AK2	391191	broad.mit.edu	37	1	248129097	248129097	+	Missense_Mutation	SNP	T	T	G			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr1:248129097T>G	ENST00000366480.3	+	1	563	c.464T>G	c.(463-465)aTc>aGc	p.I155S	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			AGCAAGAAGATCTGCTGCCTC	0.438																																					Melanoma(45;390 1181 23848 28461 41504)	ENST00000366480.3	0.070000	0	0.050000	1.000000e-02	0.020000	0.033467	0.020000	0.030000																										0				36						c.(463-465)aTc>aGc		olfactory receptor, family 2, subfamily AK, member 2							262.0	233.0	243.0					1																	248129097		2203	4300	6503	SO:0001583	missense	391191	0	0					g.chr1:248129097T>G	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.464T>G	chr1.hg19:g.248129097T>G	ENSP00000355436:p.Ile155Ser	1					OR2L13_ENST00000366478.2_Intron	p.I155S	NM_001004491.1	NP_001004491.1	1	2	3	2.685707	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)	1	563	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	0	1	hg19	c.464T>G	CCDS31102.1	0	.	.	.	.	.	.	.	.	.	.	.	12.99	2.103841	0.37145	.	.	ENSG00000187080	ENST00000366480	T	0.00164	8.64	3.03	-3.31	0.04988	3.03	-3.31	0.04988	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	L	0.33485	1.01	0.09310	N	1	D	0.56746	0.977	P	0.60541	0.876	T	0.46303	-0.9201	9	0.87932	D	0	.	4.6463	0.12574	0.1485:0.3771:0.0:0.4744	.	155	Q8NG84	O2AK2_HUMAN	S	155	ENSP00000355436:I155S	ENSP00000355436:I155S	I	+	2	0	0	OR2AK2	246195720	246195720	0.001000	0.12720	0.000000	0.03702	0.024000	0.10985	0.382000	0.20635	-0.847000	0.04168	-0.475000	0.04921	ATC	0.727273		TCGA-S4-A8RM-01A-11D-A377-08	0.438	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	0	0	1	2	2	2	2	0	0	0	0	187	187	187	185	1	1.980000	-5.786677	1	0.640000	NM_001004491		0	9	9	0	1127	1117	0		1			0	0	187	0	0	0.993972	0	0	0	0	0	0	9	1127
ZSWIM3	140831	broad.mit.edu	37	20	44506675	44506675	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr20:44506675G>A	ENST00000255152.2	+	2	1687	c.1478G>A	c.(1477-1479)gGc>gAc	p.G493D	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.G487D	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	493							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				TCGCAGGTTGGCATGCTGGAC	0.582																																						ENST00000255152.2	0.140000	1.000000e-02	0.100000	3.000000e-02	0.050000	0.069377	0.050000	0.060000																										0				35						c.(1477-1479)gGc>gAc		zinc finger, SWIM-type containing 3							77.0	61.0	66.0					20																	44506675		2203	4300	6503	SO:0001583	missense	140831	0	0					g.chr20:44506675G>A	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1478G>A	chr20.hg19:g.44506675G>A	ENSP00000255152:p.Gly493Asp	0					ZSWIM3_ENST00000454862.2_Missense_Mutation_p.G487D	p.G493D	NM_080752.3	NP_542790.2	0	0	0	2.000980	Q96MP5	ZSWM3_HUMAN		2	1687	+		Myeloproliferative disorder(115;0.0122)	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	0	1	hg19	c.1478G>A	CCDS13381.1	0	.	.	.	.	.	.	.	.	.	.	G	0.793	-0.758013	0.03019	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.25414	1.84;1.8	5.65	2.51	0.30379	5.65	2.51	0.30379	.	0.603536	0.17459	N	0.173509	T	0.12092	0.0294	N	0.17082	0.46	0.27138	N	0.961732	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.29761	-1.0001	10	0.11794	T	0.64	-12.4254	6.0596	0.19830	0.2499:0.1427:0.6074:0.0	.	487;493	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	D	493;487	ENSP00000255152:G493D;ENSP00000406313:G487D	ENSP00000255152:G493D	G	+	2	0	0	ZSWIM3	43940082	43940082	0.515000	0.26210	0.928000	0.36995	0.504000	0.33889	0.453000	0.21811	0.941000	0.37499	0.655000	0.94253	GGC	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.582	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	0	0	1	2	15	2	2	1	1	1	1	49	49	49	49	1	1.980000	-5.343423	1	0.640000	NM_080752		0	4	4	0	217	212	0		0	0		1	0	49	0	0	0.006899	3.425885e-03	0	0	0	4	0	4	217
DIDO1	11083	broad.mit.edu	37	20	61511162	61511162	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr20:61511162G>A	ENST00000266070.4	-	16	6471	c.6146C>T	c.(6145-6147)gCg>gTg	p.A2049V	DIDO1_ENST00000395343.1_Missense_Mutation_p.A2049V	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	2049					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGAGGAGAGCGCGGAGGGCGG	0.716																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	ENST00000266070.4	1.000000	8.000000e-01	0.980000	8.500000e-01	0.910000	0.920609	0.910000	1.000000																										0				99						c.(6145-6147)gCg>gTg		death inducer-obliterator 1							38.0	46.0	43.0					20																	61511162		2000	3914	5914	SO:0001583	missense	11083	4	118202	39				g.chr20:61511162G>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.6146C>T	chr20.hg19:g.61511162G>A	ENSP00000266070:p.Ala2049Val	0					DIDO1_ENST00000395343.1_Missense_Mutation_p.A2049V	p.A2049V	NM_033081.2	NP_149072.2	0	0	0	2.000980	Q9BTC0	DIDO1_HUMAN		16	6471	-	Breast(26;5.68e-08)		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	1	1	hg19	c.6146C>T	CCDS33506.1	1	.	.	.	.	.	.	.	.	.	.	G	6.147	0.395336	0.11638	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09163	3.01;3.01	3.89	1.76	0.24704	3.89	1.76	0.24704	.	1.633200	0.04269	U	0.341785	T	0.07999	0.0200	N	0.22421	0.69	0.09310	N	0.999999	B	0.30211	0.273	B	0.15484	0.013	T	0.34576	-0.9823	10	0.56958	D	0.05	0.4278	6.5979	0.22685	0.088:0.0:0.5951:0.3169	.	2049	Q9BTC0	DIDO1_HUMAN	V	2049	ENSP00000266070:A2049V;ENSP00000378752:A2049V	ENSP00000266070:A2049V	A	-	2	0	0	DIDO1	60981607	60981607	0.027000	0.19231	0.002000	0.10522	0.013000	0.08279	2.240000	0.43088	0.084000	0.17077	0.563000	0.77884	GCG	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.716	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	106	1	1.980000	-20.000000	1	0.640000	NM_080796		0	177	173	0	419	410	0		1	1		0	0	109	0	0	1.000000	9.999491e-01	0	18	0	19	0	177	419
COL20A1	57642	broad.mit.edu	37	20	61950533	61950533	+	Silent	SNP	C	C	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr20:61950533C>A	ENST00000358894.6	+	22	2887	c.2787C>A	c.(2785-2787)ctC>ctA	p.L929L	COL20A1_ENST00000422202.1_Silent_p.L936L|COL20A1_ENST00000326996.6_Silent_p.L929L|COL20A1_ENST00000435874.1_Silent_p.L936L	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	929	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					TCCAGCCCCTCCTTGGGGTTC	0.667																																						ENST00000358894.6	1.000000	6.000000e-01	0.930000	7.000000e-01	0.810000	0.822544	0.810000	1.000000																										0				36						c.(2785-2787)ctC>ctA		collagen, type XX, alpha 1							30.0	34.0	33.0					20																	61950533		1964	4140	6104	SO:0001819	synonymous_variant	57642	0	0					g.chr20:61950533C>A	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2787C>A	chr20.hg19:g.61950533C>A		0					COL20A1_ENST00000422202.1_Silent_p.L936L|COL20A1_ENST00000435874.1_Silent_p.L936L|COL20A1_ENST00000326996.6_Silent_p.L929L	p.L929L	NM_020882.2	NP_065933.2	0	0	0	2.000980	Q9P218	COKA1_HUMAN		22	2887	+	all_cancers(38;1.39e-10)		Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	ENST00000358894.6	1	1	hg19	c.2787C>A	CCDS46628.1	0																																																																																								0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.667	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	1	0	1	2	2	2	2	0	0	0	0	12	12	12	10	1	1.980000	-20.000000	1	0.640000	NM_020882		0	38	38	0	106	104	1		1			0	0	12	0	0	1.000000	0	0	0	0	0	0	38	106
IL1RL1	9173	broad.mit.edu	37	2	102957161	102957161	+	Silent	SNP	G	G	A	rs142878092		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:102957161G>A	ENST00000233954.1	+	5	754	c.483G>A	c.(481-483)gcG>gcA	p.A161A	IL1RL1_ENST00000311734.2_Silent_p.A161A|IL1RL1_ENST00000409584.1_Silent_p.A161A|IL1RL1_ENST00000404917.2_Silent_p.A44A|IL1RL1_ENST00000393393.3_Silent_p.A161A	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	161	Ig-like C2-type 2.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						GGTACAGGGCGCACAAGTCAT	0.358																																						ENST00000233954.1	0.070000	0	0.050000	1.000000e-02	0.030000	0.035947	0.030000	0.040000																										0				16						c.(481-483)gcG>gcA		interleukin 1 receptor-like 1		G	,	4,4402	9.9+/-24.2	0,4,2199	144.0	138.0	140.0		483,483	-1.6	0.0	2	dbSNP_134	140	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	IL1RL1	NM_003856.2,NM_016232.4	,	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	,	161/329,161/557	102957161	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	9173	8	121410	44				g.chr2:102957161G>A	D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.483G>A	chr2.hg19:g.102957161G>A		0					IL1RL1_ENST00000404917.2_Silent_p.A44A|IL1RL1_ENST00000393393.3_Silent_p.A161A|IL1RL1_ENST00000311734.2_Silent_p.A161A|IL1RL1_ENST00000409584.1_Silent_p.A161A	p.A161A	NM_016232.4	NP_057316.3	0	0	0	2.007309	Q01638	ILRL1_HUMAN		5	754	+			A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Silent	SNP	ENST00000233954.1	0	1	hg19	c.483G>A	CCDS2057.1	0																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.358	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	0	0	1	2	2	2	2	0	0	0	0	112	112	112	111	1	1.980000	-2.056157	0	0.640000	NM_016232		0	6	6	0	590	585	0		1	0		0	0	112	0	0	0.964195	4.627791e-04	0	1	0	2	0	6	590
LRP1B	53353	broad.mit.edu	37	2	141571360	141571360	+	Missense_Mutation	SNP	T	T	C			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:141571360T>C	ENST00000389484.3	-	32	6196	c.5225A>G	c.(5224-5226)tAt>tGt	p.Y1742C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1742					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTTTTCCACATAGTCTATCGA	0.348										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	ENST00000389484.3	0.100000	0	0.070000	2.000000e-02	0.040000	0.051410	0.040000	0.040000																										0				606						c.(5224-5226)tAt>tGt		low density lipoprotein receptor-related protein 1B							122.0	109.0	113.0					2																	141571360		2201	4300	6501	SO:0001583	missense	53353	0	0					g.chr2:141571360T>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5225A>G	chr2.hg19:g.141571360T>C	ENSP00000374135:p.Tyr1742Cys	0	TSP Lung(27;0.18)					p.Y1742C	NM_018557.2	NP_061027.2	0	0	0	2.007309	Q9NZR2	LRP1B_HUMAN		32	6196	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	0	1	hg19	c.5225A>G	CCDS2182.1	0	.	.	.	.	.	.	.	.	.	.	T	17.43	3.388112	0.61956	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91295	-2.82	5.71	5.71	0.89125	5.71	5.71	0.89125	Six-bladed beta-propeller, TolB-like (1);	0.164731	0.41938	D	0.000793	D	0.94686	0.8286	M	0.85099	2.735	0.41501	D	0.988284	D	0.69078	0.997	P	0.57283	0.817	D	0.95215	0.8329	10	0.56958	D	0.05	.	15.9781	0.80086	0.0:0.0:0.0:1.0	.	1742	Q9NZR2	LRP1B_HUMAN	C	1742;1680	ENSP00000374135:Y1742C	ENSP00000374135:Y1742C	Y	-	2	0	0	LRP1B	141287830	141287830	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.982000	0.56909	2.171000	0.68590	0.533000	0.62120	TAT	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.348	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	0	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	1.980000	-3.038080	1	0.640000	NM_018557		0	4	4	0	296	294	0		1			0	0	62	0	0	0.889445	0	0	0	0	0	0	4	296
SCN9A	6335	broad.mit.edu	37	2	167133600	167133600	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:167133600C>T	ENST00000409435.1	-	15	2766	c.2767G>A	c.(2767-2769)Gtg>Atg	p.V923M	SCN9A_ENST00000409672.1_Missense_Mutation_p.V912M|SCN9A_ENST00000375387.4_Missense_Mutation_p.V924M|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.V924M			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	923					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCACACAGCACGCGGAACACA	0.478																																						ENST00000409435.1	0.240000	1.200000e-01	0.210000	1.500000e-01	0.180000	0.187425	0.180000	0.180000																										0				108						c.(2767-2769)Gtg>Atg		sodium channel, voltage-gated, type IX, alpha subunit	Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)						202.0	193.0	196.0					2																	167133600		2203	4297	6500	SO:0001583	missense	6335	3	121406	39				g.chr2:167133600C>T	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2767G>A	chr2.hg19:g.167133600C>T	ENSP00000386330:p.Val923Met	0					AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.V912M|SCN9A_ENST00000303354.6_Missense_Mutation_p.V924M|SCN9A_ENST00000375387.4_Missense_Mutation_p.V924M	p.V923M			0	0	0	2.007309	Q15858	SCN9A_HUMAN		15	2766	-			A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	1	1	hg19	c.2767G>A	CCDS46441.1	0	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703467	0.88924	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98602	-5.02;-5.02;-5.02;-5.02	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000013	D	0.98620	0.9538	L	0.55834	1.745	0.58432	D	0.999994	D	0.89917	1.0	D	0.81914	0.995	D	0.99865	1.1088	10	0.87932	D	0	.	20.096	0.97843	0.0:1.0:0.0:0.0	.	912	E7EUN6	.	M	912;924;924;923	ENSP00000386306:V912M;ENSP00000364536:V924M;ENSP00000304748:V924M;ENSP00000386330:V923M	ENSP00000304748:V924M	V	-	1	0	0	SCN9A	166841846	166841846	1.000000	0.71417	0.968000	0.41197	0.996000	0.88848	7.715000	0.84713	2.819000	0.97034	0.650000	0.86243	GTG	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.478	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	1	0	1	2	2	2	2	0	0	0	0	130	130	130	152	1	1.980000	-7.602644	1	0.640000	NM_002977		0	43	41	0	688	669	0		1	0		0	0	130	0	0	1.000000	8.013086e-02	0	1	0	7	0	43	688
COL5A2	1290	broad.mit.edu	37	2	189904090	189904090	+	Missense_Mutation	SNP	T	T	G			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			T	G	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:189904090T>G	ENST00000374866.3	-	51	4107	c.3833A>C	c.(3832-3834)cAg>cCg	p.Q1278P		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1278	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GGTTTCAATCTGACTACTGAG	0.522																																						ENST00000374866.3	1.000000	8.100000e-01	1.000000	8.800000e-01	0.960000	0.950781	0.960000	1.000000																										0				95						c.(3832-3834)cAg>cCg		collagen, type V, alpha 2							123.0	112.0	116.0					2																	189904090		2203	4300	6503	SO:0001583	missense	1290	0	0					g.chr2:189904090T>G	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3833A>C	chr2.hg19:g.189904090T>G	ENSP00000364000:p.Gln1278Pro	0						p.Q1278P	NM_000393.3	NP_000384.2	0	0	0	2.007309	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)	51	4107	-			P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	1	1	hg19	c.3833A>C	CCDS33350.1	1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.817476	0.70912	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.83914	-1.78	5.28	5.28	0.74379	5.28	5.28	0.74379	Fibrillar collagen, C-terminal (2);	0.000000	0.43747	D	0.000537	D	0.91781	0.7400	M	0.90369	3.11	0.80722	D	1	D;D	0.61697	0.99;0.99	D;D	0.70487	0.969;0.969	D	0.91360	0.5111	10	0.27082	T	0.32	.	15.1969	0.73100	0.0:0.0:0.0:1.0	.	918;1278	Q5PR22;P05997	.;CO5A2_HUMAN	P	1278;918	ENSP00000364000:Q1278P	ENSP00000364000:Q1278P	Q	-	2	0	0	COL5A2	189612335	189612335	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.977000	0.88081	1.983000	0.57843	0.533000	0.62120	CAG	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.522	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.980000	-20.000000	1	0.640000	NM_000393		0	111	109	0	248	246	1		1	0		0	0	52	0	0	1.000000	1	0	0	0	139	0	111	248
NRXN1	9378	broad.mit.edu	37	2	51254893	51254893	+	Silent	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:51254893C>T	ENST00000406316.2	-	2	1995	c.519G>A	c.(517-519)tcG>tcA	p.S173S	NRXN1_ENST00000402717.3_Silent_p.S173S|NRXN1_ENST00000405581.1_Silent_p.S173S|NRXN1_ENST00000404971.1_Silent_p.S173S|NRXN1_ENST00000401669.2_Silent_p.S173S|NRXN1_ENST00000405472.3_Silent_p.S173S|NRXN1_ENST00000406859.3_Silent_p.S173S	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	173	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCTCCCTCACCGAGGCCAGGG	0.672																																						ENST00000406316.2	1.000000	7.800000e-01	1.000000	9.000000e-01	0.990000	0.967091	0.990000	1.000000																										0				58						c.(517-519)tcG>tcA		neurexin 1							24.0	30.0	28.0					2																	51254893		2053	4178	6231	SO:0001819	synonymous_variant	9378	0	0					g.chr2:51254893C>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.519G>A	chr2.hg19:g.51254893C>T		0					NRXN1_ENST00000405581.1_Silent_p.S173S|NRXN1_ENST00000406859.3_Silent_p.S173S|NRXN1_ENST00000404971.1_Silent_p.S173S|NRXN1_ENST00000401669.2_Silent_p.S173S|NRXN1_ENST00000402717.3_Silent_p.S173S|NRXN1_ENST00000405472.3_Silent_p.S173S	p.S173S	NM_004801.4	NP_004792.1	0	0	0	2.007309	Q9ULB1	NRX1A_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)	2	1995	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	1	1	hg19	c.519G>A	CCDS54360.1	1																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.672	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2	1	0	1	2	2	2	2	0	0	0	0	19	19	19	18	1	1.980000	-20.000000	1	0.640000			0	35	33	0	69	67	0		1	0		0	0	19	0	0	1.000000	0	0	0	0	1	0	35	69
INPP4A	3631	broad.mit.edu	37	2	99163080	99163080	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:99163080G>A	ENST00000523221.1	+	11	1086	c.1086G>A	c.(1084-1086)gcG>gcA	p.A362A	INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409851.3_Silent_p.A362A|INPP4A_ENST00000409540.3_Silent_p.A362A|INPP4A_ENST00000545415.1_Silent_p.A362A|INPP4A_ENST00000409016.4_Silent_p.A362A|INPP4A_ENST00000074304.5_Silent_p.A362A			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	362					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						CCATTGGGGCGCCAGCAGCAC	0.493																																						ENST00000523221.1	0.130000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.064301	0.050000	0.060000																										0				43						c.(1084-1086)gcG>gcA		inositol polyphosphate-4-phosphatase, type I, 107kDa							74.0	74.0	74.0					2																	99163080		1969	4167	6136	SO:0001819	synonymous_variant	3631	7	120882	37				g.chr2:99163080G>A	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1086G>A	chr2.hg19:g.99163080G>A		0					INPP4A_ENST00000545415.1_Silent_p.A362A|INPP4A_ENST00000409851.3_Silent_p.A362A|INPP4A_ENST00000409540.3_Silent_p.A362A|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409016.4_Silent_p.A362A|INPP4A_ENST00000074304.5_Silent_p.A362A	p.A362A			0	0	0	2.007309	Q96PE3	INP4A_HUMAN		11	1086	+			O15326|Q13187|Q53TD8|Q8TC02	Silent	SNP	ENST00000523221.1	0	1	hg19	c.1086G>A	CCDS46369.1	0																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.493	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	0	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	1.980000	-2.894204	1	0.640000	NM_001566		0	4	4	0	236	232	0		1	0		0	0	26	0	0	0.886131	3.212255e-02	0	0	0	12	0	4	236
HDAC4	9759	broad.mit.edu	37	2	239975284	239975284	+	Silent	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr2:239975284G>A	ENST00000345617.3	-	26	3878	c.3087C>T	c.(3085-3087)cgC>cgT	p.R1029R	HDAC4_ENST00000543185.1_Silent_p.R613R	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	1029	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GCTGCAGGCAGCGCCAGTACT	0.627																																						ENST00000345617.3	1.000000	5.300000e-01	0.910000	6.400000e-01	0.770000	0.780974	0.770000	1.000000																										0				62						c.(3085-3087)cgC>cgT		histone deacetylase 4							29.0	33.0	32.0					2																	239975284		2203	4300	6503	SO:0001819	synonymous_variant	9759	0	0					g.chr2:239975284G>A	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.3087C>T	chr2.hg19:g.239975284G>A		0					HDAC4_ENST00000543185.1_Silent_p.R613R	p.R1029R	NM_006037.3	NP_006028.2	0	0	0	2.007309	P56524	HDAC4_HUMAN		26	3878	-		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)	Q9UND6	Silent	SNP	ENST00000345617.3	1	1	hg19	c.3087C>T	CCDS2529.1	0	.	.	.	.	.	.	.	.	.	.	G	7.965	0.747822	0.15710	.	.	ENSG00000068024	ENST00000430200	.	.	.	4.38	2.12	0.27331	4.38	2.12	0.27331	.	.	.	.	.	T	0.53190	0.1781	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46105	-0.9215	4	.	.	.	.	6.304	0.21129	0.3473:0.0:0.6527:0.0	.	.	.	.	V	120	.	.	A	-	2	0	0	HDAC4	239640221	239640221	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	1.786000	0.38694	0.972000	0.38314	-0.142000	0.14014	GCT	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.627	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.980000	-20.000000	1	0.640000	NM_006037		0	26	26	0	79	79	1		1	0		0	0	20	0	0	1.000000	4.687787e-01	0	1	0	5	0	26	79
CD86	942	broad.mit.edu	37	3	121822548	121822548	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr3:121822548G>A	ENST00000330540.2	+	3	370	c.254G>A	c.(253-255)cGc>cAc	p.R85H	CD86_ENST00000493101.1_Intron|CD86_ENST00000469710.1_Missense_Mutation_p.R3H|CD86_ENST00000264468.5_Intron|CD86_ENST00000393627.2_Missense_Mutation_p.R79H	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	85	Ig-like V-type.				aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	TATATGGGCCGCACAAGTTTT	0.423																																					GBM(67;1379 1389 36064 39806)	ENST00000330540.2	0.050000	0	0.040000	0	0.020000	0.027051	0.020000	0.020000																										0				23						c.(253-255)cGc>cAc		CD86 molecule	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)						143.0	142.0	142.0					3																	121822548		2203	4300	6503	SO:0001583	missense	942	0	0					g.chr3:121822548G>A		CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.254G>A	chr3.hg19:g.121822548G>A	ENSP00000332049:p.Arg85His	0					CD86_ENST00000264468.5_Intron|CD86_ENST00000493101.1_Intron|CD86_ENST00000469710.1_Missense_Mutation_p.R3H|CD86_ENST00000393627.2_Missense_Mutation_p.R79H	p.R85H	NM_175862.4	NP_787058	0	0	0	2.015211	P42081	CD86_HUMAN		3	370	+			A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	ENST00000330540.2	0	1	hg19	c.254G>A	CCDS3009.1	0	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619268	0.87460	.	.	ENSG00000114013	ENST00000469710;ENST00000330540;ENST00000482356;ENST00000393627	T;T;T;T	0.72505	1.2;-0.66;-0.66;-0.66	5.54	5.54	0.83059	5.54	5.54	0.83059	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000016	D	0.87414	0.6171	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89572	0.3814	10	0.87932	D	0	-18.8448	14.8575	0.70351	0.0:0.0:1.0:0.0	.	85	P42081	CD86_HUMAN	H	3;85;79;79	ENSP00000418988:R3H;ENSP00000332049:R85H;ENSP00000419116:R79H;ENSP00000377248:R79H	ENSP00000332049:R85H	R	+	2	0	0	CD86	123305238	123305238	0.999000	0.42202	0.958000	0.39756	0.915000	0.54546	4.887000	0.63156	2.884000	0.98904	0.655000	0.94253	CGC	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.423	CD86-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355671.1	0	0	1	2	18	2	9	1	1	1	1	152	152	152	152	1	1.980000	-1.804410	0	0.640000	NM_006889		0	6	7	0	766	756	0		0	0	0	1	1	152	710	0	0.009939	1.003833e-02	7.103134e-01	0	0	16	1338	6	766
SIAH2	6478	broad.mit.edu	37	3	150460176	150460176	+	Missense_Mutation	SNP	G	G	C			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr3:150460176G>C	ENST00000312960.3	-	2	1254	c.727C>G	c.(727-729)Cag>Gag	p.Q243E		NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	243	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AAAAACTGCTGGTGGCCTTCG	0.527																																						ENST00000312960.3	1.000000	8.900000e-01	1.000000	9.700000e-01	0.990000	0.989100	0.990000	1.000000																										0				16						c.(727-729)Cag>Gag		siah E3 ubiquitin protein ligase 2							100.0	88.0	92.0					3																	150460176		2203	4300	6503	SO:0001583	missense	6478	0	0					g.chr3:150460176G>C	U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.727C>G	chr3.hg19:g.150460176G>C	ENSP00000322457:p.Gln243Glu	0						p.Q243E	NM_005067.5	NP_005058.3	0	0	0	2.015211	O43255	SIAH2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)	2	1254	-			O43270	Missense_Mutation	SNP	ENST00000312960.3	1	1	hg19	c.727C>G	CCDS3152.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372610	0.82573	.	.	ENSG00000181788	ENST00000312960	T	0.25749	1.78	5.67	4.79	0.61399	5.67	4.79	0.61399	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	M	0.83603	2.65	0.54753	D	0.999986	B	0.27450	0.179	B	0.32805	0.153	T	0.19418	-1.0306	10	0.25106	T	0.35	.	15.8794	0.79193	0.0:0.0:0.8633:0.1367	.	243	O43255	SIAH2_HUMAN	E	243	ENSP00000322457:Q243E	ENSP00000322457:Q243E	Q	-	1	0	0	SIAH2	151942866	151942866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.848000	0.99507	1.349000	0.45751	0.591000	0.81541	CAG	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.527	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.980000	-11.521760	1	0.640000	NM_005067		0	103	103	0	200	198	1		1	1		0	0	57	0	0	1.000000	1	0	37	0	38	0	103	200
PCDHB7	56129	broad.mit.edu	37	5	140553506	140553506	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr5:140553506G>A	ENST00000231137.3	+	1	1264	c.1090G>A	c.(1090-1092)Gtc>Atc	p.V364I		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	364	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCCGAGACAGTCGTGGCTGT	0.473																																						ENST00000231137.3	1.000000	9.100000e-01	1.000000	9.900000e-01	0.990000	0.993822	0.990000	1.000000																										0				119						c.(1090-1092)Gtc>Atc		protocadherin beta 7							41.0	44.0	43.0					5																	140553506		2203	4300	6503	SO:0001583	missense	56129	0	0					g.chr5:140553506G>A	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1090G>A	chr5.hg19:g.140553506G>A	ENSP00000231137:p.Val364Ile	0						p.V364I	NM_018940.2	NP_061763.1	1	2	3	2.024827	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1264	+			A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	1	1	hg19	c.1090G>A	CCDS4249.1	1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765245	0.31228	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.51817	0.69	4.61	3.73	0.42828	4.61	3.73	0.42828	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.40979	0.1139	L	0.60845	1.875	0.09310	N	1	B	0.17038	0.02	B	0.20384	0.029	T	0.35475	-0.9787	9	0.41790	T	0.15	.	4.5756	0.12232	0.0834:0.1519:0.6079:0.1567	.	364	Q9Y5E2	PCDB7_HUMAN	I	364;147	ENSP00000231137:V364I	ENSP00000231137:V364I	V	+	1	0	0	PCDHB7	140533690	140533690	0.027000	0.19231	0.079000	0.20413	0.449000	0.32228	1.974000	0.40559	1.038000	0.40049	0.650000	0.86243	GTC	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.473	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	52	1	1.980000	-20.000000	1	0.640000	NM_018940		0	82	81	0	150	145	1		1	0		0	0	54	0	0	1.000000	5.788988e-01	0	0	0	5	0	82	150
FAM153B	202134	broad.mit.edu	37	5	175528575	175528575	+	Missense_Mutation	SNP	C	C	G			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr5:175528575C>G	ENST00000253490.4	+	12	712	c.655C>G	c.(655-657)Ctg>Gtg	p.L219V	FAM153B_ENST00000510151.1_Missense_Mutation_p.L142V|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000515817.1_Missense_Mutation_p.L142V			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	219										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CCCAGACACACTGGCCGAACG	0.453																																						ENST00000253490.4	0.980000	6.800000e-01	0.910000	7.500000e-01	0.820000	0.831287	0.820000	0.830000																										0				16						c.(655-657)Ctg>Gtg		family with sequence similarity 153, member B							130.0	138.0	135.0					5																	175528575		2203	4300	6503	SO:0001583	missense	202134	0	0					g.chr5:175528575C>G	AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.655C>G	chr5.hg19:g.175528575C>G	ENSP00000253490:p.Leu219Val	0					FAM153B_ENST00000515817.1_Missense_Mutation_p.L142V|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000510151.1_Missense_Mutation_p.L142V	p.L219V			1	2	3	2.024827	P0C7A2	F153B_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	12	712	+	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	A8MTI1	Missense_Mutation	SNP	ENST00000253490.4	1	1	hg19	c.655C>G		0	.	.	.	.	.	.	.	.	.	.	C	6.823	0.520995	0.13005	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	0.607	-1.05	0.10036	0.607	-1.05	0.10036	.	.	.	.	.	T	0.20333	0.0489	N	0.19112	0.55	0.09310	N	1	P	0.45594	0.862	P	0.46110	0.504	T	0.13361	-1.0512	7	0.46703	T	0.11	.	.	.	.	.	219	P0C7A2	F153B_HUMAN	V	142;219	.	ENSP00000253490:L219V	L	+	1	2	2	FAM153B	175461181	175461181	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	-0.346000	0.07760	-0.368000	0.08040	0.173000	0.16961	CTG	0.641148		TCGA-S4-A8RM-01A-11D-A377-08	0.453	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		1	0	0	2	2	2	2	0	0	0	0	61	61	61	61	1	1.980000	-20.000000	1	0.640000	NM_001079529		0	92	90	0	256	254	1		1	1		0	0	61	0	0	1.000000	9.999978e-01	0	15	0	41	0	92	256
MAK	4117	broad.mit.edu	37	6	10802169	10802169	+	Missense_Mutation	SNP	C	C	T	rs199689074		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr6:10802169C>T	ENST00000313243.2	-	8	1169	c.787G>A	c.(787-789)Gaa>Aaa	p.E263K	RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000538030.1_Missense_Mutation_p.E263K|MAK_ENST00000536370.1_Missense_Mutation_p.E263K|MAK_ENST00000354489.2_Missense_Mutation_p.E263K|MAK_ENST00000474039.1_Missense_Mutation_p.E263K|SYCP2L_ENST00000543878.1_Intron			P20794	MAK_HUMAN	male germ cell-associated kinase	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				TTCAACATTTCGGTCATGAGC	0.408											OREG0017187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000313243.2	0.110000	2.000000e-02	0.090000	4.000000e-02	0.060000	0.069816	0.060000	0.060000																										0				22						c.(787-789)Gaa>Aaa		male germ cell-associated kinase		C	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	115.0	111.0	112.0		787,787	5.4	0.9	6		112	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	MAK	NM_001242385.1,NM_005906.4	56,56	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	benign,benign	263/584,263/624	10802169	5,13001	2203	4300	6503	SO:0001583	missense	4117	26	121412	46				g.chr6:10802169C>T		CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.787G>A	chr6.hg19:g.10802169C>T	ENSP00000313021:p.Glu263Lys	1		OREG0017187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	667	MAK_ENST00000538030.1_Missense_Mutation_p.E263K|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000536370.1_Missense_Mutation_p.E263K|MAK_ENST00000474039.1_Missense_Mutation_p.E263K|MAK_ENST00000354489.2_Missense_Mutation_p.E263K|RP11-637O19.3_ENST00000480294.1_Intron	p.E263K			0	1	1	1.396540	P20794	MAK_HUMAN		8	1169	-	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)	F1T0K6|G1FL29|Q547D0|Q9NUH7	Missense_Mutation	SNP	ENST00000313243.2	1	1	hg19	c.787G>A	CCDS4516.1	0	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710536	0.89112	2.27E-4	4.65E-4	ENSG00000111837	ENST00000313243;ENST00000354489;ENST00000538030;ENST00000536370	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.42	5.42	0.78866	5.42	5.42	0.78866	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.146778	0.64402	D	0.000016	T	0.18923	0.0454	N	0.00399	-1.545	0.80722	D	1	B	0.20368	0.044	B	0.23419	0.046	T	0.19386	-1.0307	10	0.29301	T	0.29	.	19.6002	0.95559	0.0:1.0:0.0:0.0	.	263	P20794	MAK_HUMAN	K	263	ENSP00000313021:E263K;ENSP00000346484:E263K;ENSP00000442250:E263K;ENSP00000442221:E263K	ENSP00000313021:E263K	E	-	1	0	0	MAK	10910155	10910155	1.000000	0.71417	0.927000	0.36925	0.966000	0.64601	4.566000	0.60843	2.691000	0.91804	0.655000	0.94253	GAA	0.480370		TCGA-S4-A8RM-01A-11D-A377-08	0.408	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	0	0	1	2	13	2	2	1	1	1	1	97	97	97	97	1	1.980000	-2.817017	1	0.640000	NM_005906		0	10	10	0	328	326	0		0	0		1	0	97	0	0	0.328179	3.329006e-03	0	0	0	3	0	10	328
SLC17A3	10786	broad.mit.edu	37	6	25845701	25845701	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr6:25845701G>A	ENST00000360657.3	-	11	1457	c.1172C>T	c.(1171-1173)gCc>gTc	p.A391V	SLC17A3_ENST00000361703.6_Missense_Mutation_p.A391V|SLC17A3_ENST00000397060.4_Missense_Mutation_p.A469V			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	391					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						CAGGTTAACGGCAAACAGCAA	0.413																																						ENST00000360657.3	0.100000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.052561	0.040000	0.040000																										0				20						c.(1171-1173)gCc>gTc		solute carrier family 17 (organic anion transporter), member 3							150.0	137.0	141.0					6																	25845701		2203	4300	6503	SO:0001583	missense	10786	0	0					g.chr6:25845701G>A	U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.1172C>T	chr6.hg19:g.25845701G>A	ENSP00000353873:p.Ala391Val	0					SLC17A3_ENST00000397060.4_Missense_Mutation_p.A469V|SLC17A3_ENST00000361703.6_Missense_Mutation_p.A391V	p.A391V			0	0	0	1.994505	O00476	NPT4_HUMAN		11	1457	-			B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	ENST00000360657.3	0	1	hg19	c.1172C>T	CCDS4566.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.73|17.73	3.460762|3.460762	0.63513|0.63513	.|.	.|.	ENSG00000124564|ENSG00000124564	ENST00000505420;ENST00000397060;ENST00000360657;ENST00000361703|ENST00000481949	T;T;T;T|.	0.58940|.	0.38;0.3;0.3;0.3|.	4.78|4.78	3.91|3.91	0.45181|0.45181	4.78|4.78	3.91|3.91	0.45181|0.45181	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.141196|.	0.32533|.	N|.	0.005969|.	T|T	0.36880|0.36880	0.0983|0.0983	L|L	0.46741|0.46741	1.465|1.465	0.36016|0.36016	D|D	0.838379|0.838379	B;P|.	0.43973|.	0.165;0.823|.	B;P|.	0.48089|.	0.081;0.566|.	T|T	0.24119|0.24119	-1.0169|-1.0169	10|5	0.48119|.	T|.	0.1|.	.|.	9.3173|9.3173	0.37941|0.37941	0.1012:0.0:0.8988:0.0|0.1012:0.0:0.8988:0.0	.|.	469;391|.	B7Z511;O00476|.	.;NPT4_HUMAN|.	V|S	22;469;391;391|70	ENSP00000424027:A22V;ENSP00000380250:A469V;ENSP00000353873:A391V;ENSP00000355307:A391V|.	ENSP00000353873:A391V|.	A|P	-|-	2|1	0|0	0|0	SLC17A3|SLC17A3	25953680|25953680	25953680|25953680	0.135000|0.135000	0.22499|0.22499	0.305000|0.305000	0.25099|0.25099	0.036000|0.036000	0.12997|0.12997	1.724000|1.724000	0.38064|0.38064	1.130000|1.130000	0.42092|0.42092	0.591000|0.591000	0.81541|0.81541	GCC|CCG	0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.413	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040070.2	0	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	1.980000	-2.430920	0	0.640000			0	6	6	0	405	400	0		1			0	0	66	0	0	0.963896	0	0	0	0	0	0	6	405
SLC44A4	80736	broad.mit.edu	37	6	31832445	31832445	+	Silent	SNP	C	C	T	rs146889731		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr6:31832445C>T	ENST00000229729.6	-	20	2015	c.1995G>A	c.(1993-1995)acG>acA	p.T665T	NEU1_ENST00000375631.4_5'Flank|SLC44A4_ENST00000375562.4_Silent_p.T623T|SLC44A4_ENST00000544672.1_Silent_p.T589T	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	665					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	AGAGGAAGAGCGTGTCCACAC	0.522																																						ENST00000229729.6	0.850000	5.900000e-01	0.790000	6.500000e-01	0.720000	0.728635	0.720000	0.720000																										0				35						c.(1993-1995)acG>acA		solute carrier family 44, member 4	Choline(DB00122)	C	,,	1,3021		0,1,1510	108.0	115.0	112.0		1869,1767,1995	-9.7	0.7	6	dbSNP_134	112	0,5418		0,0,2709	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC44A4	NM_001178044.1,NM_001178045.1,NM_025257.2	,,	0,1,4219	TT,TC,CC		0.0,0.0331,0.0118	,,	623/669,589/635,665/711	31832445	1,8439	1511	2709	4220	SO:0001819	synonymous_variant	80736	1	121408	35				g.chr6:31832445C>T	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1995G>A	chr6.hg19:g.31832445C>T		0					SLC44A4_ENST00000544672.1_Silent_p.T589T|NEU1_ENST00000375631.4_5'Flank|SLC44A4_ENST00000375562.4_Silent_p.T623T	p.T665T	NM_025257.2	NP_079533.2	0	0	0	1.994505	Q53GD3	CTL4_HUMAN		20	2015	-			A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Silent	SNP	ENST00000229729.6	1	1	hg19	c.1995G>A	CCDS4724.2	0																																																																																								0.637681		TCGA-S4-A8RM-01A-11D-A377-08	0.522	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3	1	0	1	2	2	2	2	0	0	0	0	69	69	69	68	1	1.980000	-20.000000	1	0.640000			0	93	92	0	305	300	1		1	1		0	0	69	0	0	1.000000	1	0	687	0	818	0	93	305
CYP21A2	1589	broad.mit.edu	37	6	32008351	32008351	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr6:32008351C>T	ENST00000418967.2	+	8	1266	c.1108C>T	c.(1108-1110)Cgg>Tgg	p.R370W	CYP21A2_ENST00000435122.2_Missense_Mutation_p.R340W	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	369					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	CCGCACCACACGGCCCAGCAG	0.667																																					Melanoma(174;1669 1998 3915 34700 46447)	ENST00000418967.2	1.000000	3.700000e-01	0.630000	4.300000e-01	0.510000	0.561059	0.510000	0.510000																										0				11						c.(1108-1110)Cgg>Tgg		cytochrome P450, family 21, subfamily A, polypeptide 2	Ketoconazole(DB01026)						26.0	23.0	24.0					6																	32008351		2200	4294	6494	SO:0001583	missense	1589	2	121070	34				g.chr6:32008351C>T	X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.1108C>T	chr6.hg19:g.32008351C>T	ENSP00000408860:p.Arg370Trp	1					CYP21A2_ENST00000435122.2_Missense_Mutation_p.R340W	p.R370W	NM_000500.7	NP_000491.4	1	2	3	2.578348	P08686	CP21A_HUMAN		8	1266	+			A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Missense_Mutation	SNP	ENST00000418967.2	1	1	hg19	c.1108C>T	CCDS4735.1	0	.	.	.	.	.	.	.	.	.	.	c	15.70	2.911619	0.52439	.	.	ENSG00000231852	ENST00000418967;ENST00000435122	T;T	0.80123	-1.34;-1.34	4.75	2.87	0.33458	4.75	2.87	0.33458	.	0.508711	0.16495	N	0.211913	D	0.83940	0.5363	M	0.80847	2.515	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.986;0.996	T	0.75297	-0.3367	10	0.66056	D	0.02	.	9.7965	0.40737	0.3896:0.6104:0.0:0.0	.	340;370	Q5ST44;Q16874	.;.	W	370;340	ENSP00000408860:R370W;ENSP00000415043:R340W	ENSP00000408860:R370W	R	+	1	2	2	CYP21A2	32116330	32116330	0.000000	0.05858	0.073000	0.20177	0.715000	0.41141	0.215000	0.17562	0.656000	0.30886	0.651000	0.88453	CGG	0.719801		TCGA-S4-A8RM-01A-11D-A377-08	0.667	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	0	0	1	2	2	2	2	0	0	0	0	44	44	44	50	1	1.980000	-16.178910	1	0.640000	NM_000500		0	37	36	0	255	218	0		1			0	0	44	0	0	1.000000	0	0	0	0	0	0	37	255
SLC35A1	10559	broad.mit.edu	37	6	88216129	88216129	+	Silent	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr6:88216129C>T	ENST00000369552.4	+	5	564	c.537C>T	c.(535-537)ggC>ggT	p.G179G	SLC35A1_ENST00000369556.3_Silent_p.G179G|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000464978.1_Intron|SLC35A1_ENST00000544441.1_Silent_p.G45G|SLC35A1_ENST00000369557.5_Intron	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	179					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		TAGGGTTTGGCGCTATAGCTA	0.313																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	ENST00000369552.4	0.070000	0	0.050000	1.000000e-02	0.020000	0.034891	0.020000	0.030000																										0				9						c.(535-537)ggC>ggT		solute carrier family 35 (CMP-sialic acid transporter), member A1							194.0	189.0	191.0					6																	88216129		2203	4300	6503	SO:0001819	synonymous_variant	10559	0	0					g.chr6:88216129C>T	D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.537C>T	chr6.hg19:g.88216129C>T		1					SLC35A1_ENST00000369556.3_Silent_p.G179G|SLC35A1_ENST00000544441.1_Silent_p.G45G|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000464978.1_Intron|SLC35A1_ENST00000369557.5_Intron	p.G179G	NM_006416.4	NP_006407.1	0	1	1	1.396305	P78382	S35A1_HUMAN		5	564	+		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	Q5W1L8	Silent	SNP	ENST00000369552.4	0	1	hg19	c.537C>T	CCDS5010.1	0																																																																																								0.473068		TCGA-S4-A8RM-01A-11D-A377-08	0.313	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041446.1	0	0	1	2	2	2	2	0	0	0	0	89	89	89	89	1	1.980000	-2.180427	0	0.640000			0	5	5	0	359	357	0		1	0		0	0	89	0	0	0.937048	4.128829e-01	0	0	0	89	0	5	359
RPS6KA2	6196	broad.mit.edu	37	6	166844030	166844030	+	Missense_Mutation	SNP	T	T	G			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr6:166844030T>G	ENST00000265678.4	-	16	1715	c.1492A>C	c.(1492-1494)Atc>Ctc	p.I498L	RPS6KA2_ENST00000481261.2_Missense_Mutation_p.I409L|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.I506L|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.I523L|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.I409L	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	498	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		TGCCGGAGGATGCGGTCCAGG	0.587																																						ENST00000265678.4	0.220000	6.000000e-02	0.170000	9.000000e-02	0.120000	0.138123	0.120000	0.130000																										0				45						c.(1492-1494)Atc>Ctc		ribosomal protein S6 kinase, 90kDa, polypeptide 2							122.0	103.0	110.0					6																	166844030		2203	4300	6503	SO:0001583	missense	6196	0	0					g.chr6:166844030T>G	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1492A>C	chr6.hg19:g.166844030T>G	ENSP00000265678:p.Ile498Leu	1					RPS6KA2_ENST00000481261.2_Missense_Mutation_p.I409L|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.I409L|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.I506L|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.I523L	p.I498L	NM_021135.4	NP_066958.2	0	1	1	1.429478	Q15349	KS6A2_HUMAN		16	1715	-		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	1	1	hg19	c.1492A>C	CCDS5294.1	0	.	.	.	.	.	.	.	.	.	.	T	14.06	2.422481	0.43020	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	3.63	3.63	0.41609	3.63	3.63	0.41609	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.128885	0.50627	D	0.000112	T	0.53818	0.1820	N	0.25031	0.7	0.80722	D	1	B;B;B	0.31989	0.052;0.042;0.35	B;B;P	0.55545	0.413;0.166;0.778	T	0.58657	-0.7598	10	0.33940	T	0.23	.	11.8701	0.52515	0.0:0.0:0.0:1.0	.	523;506;498	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	L	498;523;506;409;409	ENSP00000265678:I498L;ENSP00000422435:I523L;ENSP00000427015:I506L;ENSP00000422484:I409L;ENSP00000386050:I409L	ENSP00000265678:I498L	I	-	1	0	0	RPS6KA2	166764020	166764020	1.000000	0.71417	0.998000	0.56505	0.526000	0.34562	7.272000	0.78516	1.661000	0.50771	0.402000	0.26972	ATC	0.480370		TCGA-S4-A8RM-01A-11D-A377-08	0.587	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	1	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	1.980000	-14.966800	1	0.640000	NM_021135		0	11	10	0	174	173	0		1	0		0	0	40	0	0	0.998395	5.099499e-01	0	0	0	27	0	11	174
TMEM176A	55365	broad.mit.edu	37	7	150498695	150498695	+	Silent	SNP	C	C	A	rs563766350		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr7:150498695C>A	ENST00000484928.1	+	2	638	c.57C>A	c.(55-57)atC>atA	p.I19I	TMEM176B_ENST00000450753.2_5'Flank|TMEM176A_ENST00000004103.3_Silent_p.I19I|TMEM176B_ENST00000492607.1_5'Flank|TMEM176B_ENST00000447204.2_5'Flank|TMEM176B_ENST00000434545.1_5'Flank|TMEM176B_ENST00000326442.5_5'Flank|TMEM176A_ENST00000461345.1_Intron			Q96HP8	T176A_HUMAN	transmembrane protein 176A	19					negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACACCCACATCGATGTGCACA	0.657																																						ENST00000484928.1	0.950000	5.700000e-01	0.840000	6.500000e-01	0.730000	0.747855	0.730000	0.740000																										0				12						c.(55-57)atC>atA		transmembrane protein 176A							49.0	45.0	46.0					7																	150498695		2203	4300	6503	SO:0001819	synonymous_variant	55365	0	0					g.chr7:150498695C>A	AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.57C>A	chr7.hg19:g.150498695C>A		1					TMEM176B_ENST00000492607.1_5'Flank|TMEM176A_ENST00000004103.3_Silent_p.I19I|TMEM176B_ENST00000450753.2_5'Flank|TMEM176B_ENST00000326442.5_5'Flank|TMEM176B_ENST00000447204.2_5'Flank|TMEM176B_ENST00000434545.1_5'Flank|TMEM176A_ENST00000461345.1_Intron	p.I19I			1	2	3	2.628128	Q96HP8	T176A_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	2	638	+			D3DX00|Q9NYC7	Silent	SNP	ENST00000484928.1	1	1	hg19	c.57C>A	CCDS5909.1	0																																																																																								0.725944		TCGA-S4-A8RM-01A-11D-A377-08	0.657	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350222.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	30	1	1.980000	-3.414216	1	0.640000	NM_018487		0	57	57	0	260	254	1		1	1		0	0	31	0	0	1.000000	1	0	253	0	1218	0	57	260
PURB	5814	broad.mit.edu	37	7	44924053	44924053	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr7:44924053C>T	ENST00000395699.2	-	1	907	c.895G>A	c.(895-897)Ggc>Agc	p.G299S	MIR4657_ENST00000578157.1_RNA|RP4-673M15.1_ENST00000608450.1_RNA	NM_033224.3	NP_150093.1	Q96QR8	PURB_HUMAN	purine-rich element binding protein B	299					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of myeloid cell differentiation (GO:0045637)|transcription, DNA-templated (GO:0006351)	DNA replication factor A complex (GO:0005662)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)|skin(1)	7						TCGCCGCCGCCGCTGCCCCCA	0.587																																						ENST00000395699.2	1.000000	0	0.050000	1.000000e-02	0.020000	0.062338	0.020000	0.030000																										0				7						c.(895-897)Ggc>Agc		purine-rich element binding protein B							72.0	77.0	76.0					7																	44924053		2203	4300	6503	SO:0001583	missense	5814	0	0					g.chr7:44924053C>T		CCDS5499.1	7p13	2008-07-18			ENSG00000146676	ENSG00000146676			9702	protein-coding gene	gene with protein product		608887				1448097	Standard	NM_033224		Approved	PURBETA	uc003tme.3	Q96QR8	OTTHUMG00000023578	ENST00000395699.2:c.895G>A	chr7.hg19:g.44924053C>T	ENSP00000379051:p.Gly299Ser	1					MIR4657_ENST00000578157.1_RNA|RP4-673M15.1_ENST00000608450.1_RNA	p.G299S	NM_033224.3	NP_150093.1	1	2	3	2.612313	Q96QR8	PURB_HUMAN		1	907	-			A4D2L7	Missense_Mutation	SNP	ENST00000395699.2	0	1	hg19	c.895G>A	CCDS5499.1	0	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923148	0.52653	.	.	ENSG00000146676	ENST00000395699	T	0.29655	1.56	3.06	3.06	0.35304	3.06	3.06	0.35304	.	0.137657	0.27549	U	0.018864	T	0.31104	0.0786	N	0.14661	0.345	0.35690	D	0.81476	D	0.89917	1.0	D	0.65684	0.937	T	0.19063	-1.0317	10	0.16896	T	0.51	.	12.3432	0.55105	0.0:1.0:0.0:0.0	.	299	Q96QR8	PURB_HUMAN	S	299	ENSP00000379051:G299S	ENSP00000379051:G299S	G	-	1	0	0	PURB	44890578	44890578	0.980000	0.34600	0.998000	0.56505	0.984000	0.73092	3.212000	0.51145	1.998000	0.58463	0.591000	0.81541	GGC	0.724602		TCGA-S4-A8RM-01A-11D-A377-08	0.587	PURB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251332.2	0	0	0	2	2	2	2	0	0	0	0	84	84	84	83	1	1.980000	-1.955223	0	0.640000	NM_033224		0	5	5	0	704	702	0		1	1		0	0	84	0	0	0.937268	8.693792e-02	0	2	0	54	0	5	704
SEMA3E	9723	broad.mit.edu	37	7	83014659	83014659	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr7:83014659G>A	ENST00000307792.3	-	16	2293	c.1826C>T	c.(1825-1827)gCg>gTg	p.A609V	SEMA3E_ENST00000427262.1_Missense_Mutation_p.A549V	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	609	Ig-like C2-type.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GATAACTTTCGCTTGTAAAGA	0.398																																						ENST00000307792.3	1.000000	0	0.070000	1.000000e-02	0.030000	0.070787	0.030000	0.030000																										0				51						c.(1825-1827)gCg>gTg		sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E							196.0	180.0	185.0					7																	83014659		2203	4300	6503	SO:0001583	missense	9723	2	121410	37				g.chr7:83014659G>A	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1826C>T	chr7.hg19:g.83014659G>A	ENSP00000303212:p.Ala609Val	1					SEMA3E_ENST00000427262.1_Missense_Mutation_p.A549V	p.A609V	NM_012431.2	NP_036563.1	1	2	3	2.612313	O15041	SEM3E_HUMAN		16	2293	-		Medulloblastoma(109;0.109)	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	0	1	hg19	c.1826C>T	CCDS34674.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.430525	0.96150	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.19394	2.15;2.15	5.54	5.54	0.83059	5.54	5.54	0.83059	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.49440	0.1557	M	0.76838	2.35	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.49854	-0.8895	10	0.59425	D	0.04	.	19.4854	0.95027	0.0:0.0:1.0:0.0	.	609	O15041	SEM3E_HUMAN	V	609;549;609	ENSP00000303212:A609V;ENSP00000405052:A549V	ENSP00000303212:A609V	A	-	2	0	0	SEMA3E	82852595	82852595	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.255000	0.95524	2.597000	0.87782	0.650000	0.86243	GCG	0.724602		TCGA-S4-A8RM-01A-11D-A377-08	0.398	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	0	0	1	2	2	2	2	0	0	0	0	111	111	111	110	1	1.980000	-2.488768	0	0.640000	NM_012431		0	8	8	0	803	791	0		1	0		0	0	111	0	0	0.988671	2.407403e-02	0	1	0	20	0	8	803
CYP3A43	64816	broad.mit.edu	37	7	99454485	99454485	+	Silent	SNP	C	C	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr7:99454485C>A	ENST00000354829.2	+	9	931	c.828C>A	c.(826-828)atC>atA	p.I276I	CYP3A43_ENST00000312017.5_Silent_p.I276I|CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000417625.1_Silent_p.I166I|CYP3A43_ENST00000415413.1_Silent_p.I65I|CYP3A43_ENST00000444905.1_Silent_p.I23I|CYP3A43_ENST00000222382.5_Silent_p.I276I|CYP3A43_ENST00000342499.4_Silent_p.I136I	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	276			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	AACAGATGATCGACTCCCAGA	0.433																																						ENST00000354829.2	1.000000	1.200000e-01	0.220000	1.500000e-01	0.180000	0.209381	0.180000	0.180000																										0				19						c.(826-828)atC>atA		cytochrome P450, family 3, subfamily A, polypeptide 43	Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)						94.0	101.0	99.0					7																	99454485		2203	4300	6503	SO:0001819	synonymous_variant	64816	0	0					g.chr7:99454485C>A	AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.828C>A	chr7.hg19:g.99454485C>A		1					CYP3A43_ENST00000222382.5_Silent_p.I276I|CYP3A43_ENST00000417625.1_Silent_p.I166I|CYP3A43_ENST00000342499.4_Silent_p.I136I|CYP3A43_ENST00000415413.1_Silent_p.I65I|CYP3A43_ENST00000312017.5_Silent_p.I276I|CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000444905.1_Silent_p.I23I	p.I276I	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	1	2	3	2.612313	Q9HB55	CP343_HUMAN		9	931	+	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)		Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Silent	SNP	ENST00000354829.2	1	1	hg19	c.828C>A	CCDS5676.1	0																																																																																								0.724602		TCGA-S4-A8RM-01A-11D-A377-08	0.433	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000344379.1	1	0	1	2	2	2	2	0	0	0	0	147	147	147	147	1	1.980000	-4.878029	1	0.640000			0	50	50	0	1068	1061	0		1	0		0	0	147	0	0	1.000000	0	0	0	0	1	0	50	1068
PTPRN2	5799	broad.mit.edu	37	7	157929382	157929382	+	Missense_Mutation	SNP	C	C	T	rs144837405		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr7:157929382C>T	ENST00000389418.4	-	8	1147	c.1138G>A	c.(1138-1140)Gga>Aga	p.G380R	PTPRN2_ENST00000389413.3_Missense_Mutation_p.G380R|PTPRN2_ENST00000389416.4_Missense_Mutation_p.G363R|PTPRN2_ENST00000409483.1_Missense_Mutation_p.G342R|PTPRN2_ENST00000404321.2_Missense_Mutation_p.G403R	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	380					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TCCTGCACTCCGTCATCTGTA	0.448																																						ENST00000389418.4	0.680000	4.300000e-01	0.610000	4.800000e-01	0.540000	0.552771	0.540000	0.540000																										0				86						c.(1138-1140)Gga>Aga		protein tyrosine phosphatase, receptor type, N polypeptide 2			ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	187.0	147.0	160.0		1138,1087,1138	-4.7	0.0	7	dbSNP_134	160	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	PTPRN2	NM_002847.3,NM_130842.2,NM_130843.2	125,125,125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	380/1016,363/999,380/987	157929382	2,13004	2203	4300	6503	SO:0001583	missense	5799	6	121412	39				g.chr7:157929382C>T	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1138G>A	chr7.hg19:g.157929382C>T	ENSP00000374069:p.Gly380Arg	1					PTPRN2_ENST00000389413.3_Missense_Mutation_p.G380R|PTPRN2_ENST00000409483.1_Missense_Mutation_p.G342R|PTPRN2_ENST00000404321.2_Missense_Mutation_p.G403R|PTPRN2_ENST00000389416.4_Missense_Mutation_p.G363R	p.G380R	NM_002847.3	NP_002838.2	1	2	3	2.628128	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	8	1147	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	1	1	hg19	c.1138G>A	CCDS5947.1	0	.	.	.	.	.	.	.	.	.	.	C	5.514	0.279739	0.10458	0.0	2.33E-4	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.02656	4.21;4.22;4.24;4.23;4.23	4.54	-4.67	0.03319	4.54	-4.67	0.03319	.	.	.	.	.	T	0.01156	0.0038	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.001;0.0;0.0	T	0.49428	-0.8941	9	0.12430	T	0.62	.	6.5936	0.22659	0.0:0.4711:0.1567:0.3722	.	403;342;380;363;380	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	R	342;380;363;380;403	ENSP00000387114:G342R;ENSP00000374064:G380R;ENSP00000374067:G363R;ENSP00000374069:G380R;ENSP00000385464:G403R	ENSP00000374064:G380R	G	-	1	0	0	PTPRN2	157622143	157622143	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.284000	0.02793	-0.743000	0.04784	-1.056000	0.02311	GGA	0.725944		TCGA-S4-A8RM-01A-11D-A377-08	0.448	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1	1	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	1.980000	-2.443736	0	0.640000			0	80	80	0	524	514	1		1	1		0	0	83	0	0	1.000000	9.999986e-01	0	24	0	101	0	80	524
VPS13B	157680	broad.mit.edu	37	8	100493941	100493941	+	Missense_Mutation	SNP	C	C	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr8:100493941C>A	ENST00000358544.2	+	25	3892	c.3781C>A	c.(3781-3783)Cct>Act	p.P1261T	VPS13B_ENST00000357162.2_Missense_Mutation_p.P1261T|VPS13B_ENST00000395996.1_Missense_Mutation_p.P1261T	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1261					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGGGCCTGTTCCTACTTCTCC	0.468																																					Colon(161;2205 2542 7338 31318)	ENST00000358544.2	1.000000	5.000000e-02	0.150000	7.000000e-02	0.100000	0.174982	0.100000	0.110000																										0				193						c.(3781-3783)Cct>Act		vacuolar protein sorting 13 homolog B (yeast)							116.0	109.0	112.0					8																	100493941		2203	4300	6503	SO:0001583	missense	157680	0	0					g.chr8:100493941C>A	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3781C>A	chr8.hg19:g.100493941C>A	ENSP00000351346:p.Pro1261Thr	0					VPS13B_ENST00000357162.2_Missense_Mutation_p.P1261T|VPS13B_ENST00000395996.1_Missense_Mutation_p.P1261T	p.P1261T	NM_017890.4	NP_060360.3	2	2	4	2.124784	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)	25	3892	+	Breast(36;3.73e-07)		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	1	1	hg19	c.3781C>A	CCDS6280.1	0	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562912	0.65538	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.64260	-0.09;-0.09;-0.09	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.060752	0.64402	D	0.000004	T	0.77054	0.4074	M	0.63843	1.955	0.54753	D	0.999983	D;D;D;P	0.76494	0.994;0.999;0.998;0.669	D;D;P;B	0.83275	0.991;0.996;0.863;0.264	T	0.75001	-0.3471	10	0.33940	T	0.23	.	18.4942	0.90858	0.0:1.0:0.0:0.0	.	1260;1261;1261;1261	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	T	1261	ENSP00000349685:P1261T;ENSP00000351346:P1261T;ENSP00000379318:P1261T	ENSP00000349685:P1261T	P	+	1	0	0	VPS13B	100563117	100563117	1.000000	0.71417	0.778000	0.31720	0.391000	0.30476	6.906000	0.75719	2.365000	0.80145	0.655000	0.94253	CCT	0.659607		TCGA-S4-A8RM-01A-11D-A377-08	0.468	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	0	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.980000	-3.582072	1	0.640000	NM_184042		0	15	15	0	462	459	0		1	0		0	0	79	0	0	0.999869	6.097650e-02	0	0	0	12	0	15	462
SCARA5	286133	broad.mit.edu	37	8	27824044	27824044	+	Missense_Mutation	SNP	C	C	T	rs539920202		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr8:27824044C>T	ENST00000354914.3	-	3	613	c.128G>A	c.(127-129)cGg>cAg	p.R43Q	SCARA5_ENST00000380385.2_Missense_Mutation_p.R43Q|SCARA5_ENST00000301906.4_Intron|SCARA5_ENST00000524352.1_Missense_Mutation_p.R43Q|SCARA5_ENST00000518030.1_Intron	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	43					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GCTTGCCCGCCGTTTGTGACA	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		19900	0.001		0.0	False		,,,				2504	0.0					ENST00000354914.3	1.000000	0	0.060000	1.000000e-02	0.020000	0.103069	0.020000	0.020000																										0				18						c.(127-129)cGg>cAg		scavenger receptor class A, member 5							91.0	101.0	98.0					8																	27824044		2203	4300	6503	SO:0001583	missense	286133	3	121412	41				g.chr8:27824044C>T	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.128G>A	chr8.hg19:g.27824044C>T	ENSP00000346990:p.Arg43Gln	0					SCARA5_ENST00000524352.1_Missense_Mutation_p.R43Q|SCARA5_ENST00000380385.2_Missense_Mutation_p.R43Q|SCARA5_ENST00000518030.1_Intron|SCARA5_ENST00000301906.4_Intron	p.R43Q	NM_173833.5	NP_776194.2	2	2	4	2.124784	Q6ZMJ2	SCAR5_HUMAN		3	613	-		Ovarian(32;0.0218)	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	0	1	hg19	c.128G>A	CCDS6064.1	0	.	.	.	.	.	.	.	.	.	.	C	18.12	3.554049	0.65425	.	.	ENSG00000168079	ENST00000354914;ENST00000380385;ENST00000524352	D;D;D	0.92299	-2.56;-2.5;-3.01	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.128700	0.49305	D	0.000152	D	0.91043	0.7182	M	0.62723	1.935	0.80722	D	1	P;D;P	0.61697	0.927;0.99;0.949	P;P;B	0.44359	0.447;0.447;0.261	D	0.89580	0.3820	10	0.30078	T	0.28	.	15.8364	0.78801	0.0:1.0:0.0:0.0	.	43;43;43	Q6ZMJ2-4;Q6ZMJ2-2;Q6ZMJ2	.;.;SCAR5_HUMAN	Q	43	ENSP00000346990:R43Q;ENSP00000369746:R43Q;ENSP00000428663:R43Q	ENSP00000346990:R43Q	R	-	2	0	0	SCARA5	27879963	27879963	0.312000	0.24545	0.847000	0.33407	0.982000	0.71751	1.699000	0.37804	2.814000	0.96858	0.563000	0.77884	CGG	0.659607		TCGA-S4-A8RM-01A-11D-A377-08	0.522	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	0	0	1	2	2	2	2	0	0	0	0	86	86	86	81	1	1.980000	-2.302391	0	0.640000	NM_173833		0	5	6	0	582	568	0		1	0		0	0	86	0	0	0.934033	1.176250e-03	0	0	0	5	0	5	582
CSMD3	114788	broad.mit.edu	37	8	113277800	113277800	+	Silent	SNP	T	T	A			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr8:113277800T>A	ENST00000297405.5	-	60	9772	c.9528A>T	c.(9526-9528)ccA>ccT	p.P3176P	CSMD3_ENST00000343508.3_Silent_p.P3136P|CSMD3_ENST00000352409.3_Silent_p.P3106P|CSMD3_ENST00000455883.2_Silent_p.P3007P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3176	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTGGTATACCTGGGTCTCCAC	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												ENST00000297405.5	1.000000	7.400000e-01	0.960000	8.000000e-01	0.870000	0.882745	0.870000	0.870000																										0				646						c.(9526-9528)ccA>ccT		CUB and Sushi multiple domains 3							152.0	130.0	138.0					8																	113277800		2203	4300	6503	SO:0001819	synonymous_variant	114788	0	0					g.chr8:113277800T>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9528A>T	chr8.hg19:g.113277800T>A		0	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_ENST00000352409.3_Silent_p.P3106P|CSMD3_ENST00000455883.2_Silent_p.P3007P|CSMD3_ENST00000343508.3_Silent_p.P3136P	p.P3176P	NM_198123.1	NP_937756.1	2	2	4	2.124784	Q7Z407	CSMD3_HUMAN		60	9772	-			Q96PZ3	Silent	SNP	ENST00000297405.5	1	1	hg19	c.9528A>T	CCDS6315.1	1																																																																																								0.659607		TCGA-S4-A8RM-01A-11D-A377-08	0.418	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	1	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	1.980000	-20.000000	1	0.640000	NM_052900		0	133	133	0	371	367	1		1	0		0	0	83	0	0	1.000000	0	0	0	0	1	0	133	371
ADAMTSL1	92949	broad.mit.edu	37	9	18706844	18706844	+	Silent	SNP	C	C	T			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chr9:18706844C>T	ENST00000380548.4	+	14	2013	c.1674C>T	c.(1672-1674)tcC>tcT	p.S558S	ADAMTSL1_ENST00000276935.6_Silent_p.S558S	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	558	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TCTCTCAGTCCGTGGCTGACC	0.602																																						ENST00000380548.4	0.820000	4.700000e-01	0.740000	5.500000e-01	0.640000	0.651522	0.640000	0.640000																										0				42						c.(1672-1674)tcC>tcT		ADAMTS-like 1							53.0	43.0	46.0					9																	18706844		2203	4300	6503	SO:0001819	synonymous_variant	92949	2	121408	34				g.chr9:18706844C>T	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.1674C>T	chr9.hg19:g.18706844C>T		1					ADAMTSL1_ENST00000276935.6_Silent_p.S558S	p.S558S	NM_001040272.5	NP_001035362.3	0	1	1	2.001361	Q8N6G6	ATL1_HUMAN		14	2013	+			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	1	1	hg19	c.1674C>T	CCDS47954.1	0																																																																																								0.470588		TCGA-S4-A8RM-01A-11D-A377-08	0.602	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	16	1	1.980000	-20.000000	1	0.640000			0	34	35	0	77	76	1		1	0		0	0	17	0	0	1.000000	2.304935e-01	0	0	0	3	0	34	77
FOXR2	139628	broad.mit.edu	37	X	55650498	55650498	+	Silent	SNP	A	A	G			TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chrX:55650498A>G	ENST00000339140.3	+	1	666	c.354A>G	c.(352-354)gaA>gaG	p.E118E		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	118					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						AAAAAGACGAAGGGTCTAACT	0.527																																						ENST00000339140.3	1.000000	8.000000e-01	0.970000	8.600000e-01	0.920000	0.923310	0.920000	0.940000																										0				19						c.(352-354)gaA>gaG		forkhead box R2							65.0	61.0	62.0					X																	55650498		2203	4300	6503	SO:0001819	synonymous_variant	139628	0	0					g.chrX:55650498A>G	BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.354A>G	chrX.hg19:g.55650498A>G								p.E118E	NM_198451.3	NP_940853.1	0	1	1		Q6PJQ5	FOXR2_HUMAN		1	666	+				Silent	SNP	ENST00000339140.3	1	1	hg19	c.354A>G	CCDS35308.1	1																																																																																								0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.527	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056877.2	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.980000	-20.000000	1	0.640000	NM_198451		0	92	91	0	60	60	1		1			0	0	27	0	0	1.000000	0	0	0	0	0	0	92	60
KLHL4	56062	broad.mit.edu	37	X	86887279	86887279	+	Missense_Mutation	SNP	G	G	A	rs146910003		TCGA-S4-A8RM-01A-11D-A377-08	TCGA-S4-A8RM-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1fa9c9-fb3e-4ffb-b79d-9f79f2adbe3a	f9ea46fe-0a5b-46ab-a347-8fa786bdea4b	g.chrX:86887279G>A	ENST00000373119.4	+	7	1539	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	KLHL4_ENST00000373114.4_Missense_Mutation_p.R465H	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	465						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R465H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						ATGAATGGCCGTAGGCTTCAA	0.388													G|||	1	0.000264901	0.0	0.0	3775	,	,		13420	0.001		0.0	False		,,,				2504	0.0					ENST00000373119.4	1.000000	8.000000e-01	0.970000	8.600000e-01	0.910000	0.917623	0.910000	0.930000																										1	Substitution - Missense(1)	p.R465H(1)	large_intestine(1)	67						c.(1393-1395)cGt>cAt		kelch-like family member 4		G	HIS/ARG,HIS/ARG	1,3834		0,1,1631,571	108.0	91.0	97.0		1394,1394	3.5	0.8	X	dbSNP_134	97	0,6728		0,0,2428,1872	no	missense,missense	KLHL4	NM_019117.4,NM_057162.2	29,29	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging	465/719,465/721	86887279	1,10562	2203	4300	6503	SO:0001583	missense	56062	3	121404	40				g.chrX:86887279G>A	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1394G>A	chrX.hg19:g.86887279G>A	ENSP00000362211:p.Arg465His						KLHL4_ENST00000373114.4_Missense_Mutation_p.R465H	p.R465H	NM_019117.4	NP_061990.2	0	1	1		Q9C0H6	KLHL4_HUMAN		7	1539	+			B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	1	1	hg19	c.1394G>A	CCDS14457.1	1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165472	0.78339	2.61E-4	0.0	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.66815	-0.23;-0.23	5.32	3.55	0.40652	5.32	3.55	0.40652	Galactose oxidase, beta-propeller (1);	0.059533	0.64402	N	0.000005	T	0.65365	0.2684	M	0.69358	2.11	0.58432	D	0.999997	P;D	0.55605	0.692;0.972	B;P	0.44860	0.344;0.462	T	0.66396	-0.5934	10	0.87932	D	0	.	10.0307	0.42099	0.1676:0.0:0.8324:0.0	.	465;465	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	H	465	ENSP00000362211:R465H;ENSP00000362206:R465H	ENSP00000362206:R465H	R	+	2	0	0	KLHL4	86773935	86773935	1.000000	0.71417	0.760000	0.31359	0.976000	0.68499	6.184000	0.72008	0.448000	0.26722	0.506000	0.49869	CGT	0.640000		TCGA-S4-A8RM-01A-11D-A377-08	0.388	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	30	1	1.980000	-20.000000	1	0.640000			0	108	108	0	73	72	1		1			0	0	31	0	0	1.000000	0	0	0	0	0	0	108	73
