#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
JAGN1	84522	broad.mit.edu	37	3	9934929	9934930	+	Frame_Shift_Ins	INS	-	-	G			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			-	G	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr3:9934929_9934930insG	ENST00000307768.4	+	2	589_590	c.420_421insG	c.(421-423)ggtfs	p.G141fs		NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)											breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					GTTTCCTCTTTGGTTTTTCTGC	0.515																																						ENST00000307768.4	0.860000	0.620000	0.800000	0.670000	0.730000	0.743700	0.730000	0.740000																										0				10						c.(421-423)ggtfs		jagunal homolog 1 (Drosophila)																																				SO:0001589	frameshift_variant	84522	0	0					g.chr3:9934929_9934930insG	AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.422dupG	chr3.hg19:g.9934931_9934931dupG	ENSP00000306106:p.Gly141fs	0						p.G141fs	NM_032492.3	NP_115881.3	0	0	0	2.011262				2	589_590	+	Medulloblastoma(99;0.227)			Frame_Shift_Ins	INS	ENST00000307768.4	0	1	hg19	c.420_421insG	CCDS2588.1	0																																																																																								0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.515	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250335.1	1	0	1		2	2		0	0	0	0	93	0	93	91	1	1.960000	-3.418312	1	0.520000	NM_032492		0	116	120	0	483	476	0	0	1	0	0	0	0	93	0	0	1.000000	1	0	1	0	230	0	116	483
SGK1	6446	broad.mit.edu	37	6	134493456	134493460	+	Splice_Site	DEL	TGTAA	TGTAA	-			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			TGTAA	-	TGTAA	TGTAA		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr6:134493456_134493460delTGTAA	ENST00000237305.7	-	8	751		c.e8-2		SGK1_ENST00000475719.2_Splice_Site|SGK1_ENST00000367858.5_Splice_Site|SGK1_ENST00000489458.2_Splice_Site|SGK1_ENST00000367857.5_Splice_Site|SGK1_ENST00000528577.1_Splice_Site|SGK1_ENST00000413996.3_Splice_Site	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTTAAGTCTCTGTAAAAAAGTGAAT	0.356																																						ENST00000237305.7	0.660000	0.430000	0.600000	0.480000	0.540000	0.548407	0.540000	0.540000																										0				46						c.e8-2		serum/glucocorticoid regulated kinase 1																																				SO:0001630	splice_region_variant	6446	0	0					g.chr6:134493456_134493460delTGTAA	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.663-2TTACA>-	chr6.hg19:g.134493456_134493460delTGTAA		1					SGK1_ENST00000413996.3_Splice_Site|SGK1_ENST00000367858.5_Splice_Site|SGK1_ENST00000489458.2_Splice_Site|SGK1_ENST00000475719.2_Splice_Site|SGK1_ENST00000528577.1_Splice_Site|SGK1_ENST00000367857.5_Splice_Site		NM_005627.3	NP_005618.2	0	1	1	1.504111	O00141	SGK1_HUMAN		8	751	-	Colorectal(23;0.221)		B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Splice_Site	DEL	ENST00000237305.7	1	1	hg19		CCDS5170.1	0																																																																																								0.351351		TCGA-S4-A8RP-01A-11D-A36O-08	0.356	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2	1	0	0		2	2		0	0	0	0	65	0	65	63	1	1.960000	-2.974142	1	0.520000		Intron	0	72	86	0	303	307	0	0	1	1	0	0	0	65	0	0	1.000000	9.999883e-01	0	3	0	69	0	72	303
GTPBP4	23560	broad.mit.edu	37	10	1058521	1058521	+	Silent	SNP	T	T	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr10:1058521T>A	ENST00000360803.4	+	14	1543	c.1461T>A	c.(1459-1461)atT>atA	p.I487I	GTPBP4_ENST00000538293.1_Silent_p.I371I|GTPBP4_ENST00000545048.1_Silent_p.I440I	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	487					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		CAAAGCAAATTCGAGAGAAAA	0.443																																						ENST00000360803.4	1.000000	0.850000	1.000000	0.940000	0.990000	0.981772	0.990000	1.000000																										0				21						c.(1459-1461)atT>atA		GTP binding protein 4							69.0	78.0	75.0					10																	1058521		2203	4300	6503	SO:0001819	synonymous_variant	23560	0	0					g.chr10:1058521T>A	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1461T>A	chr10.hg19:g.1058521T>A		0					GTPBP4_ENST00000538293.1_Silent_p.I371I|GTPBP4_ENST00000545048.1_Silent_p.I440I	p.I487I	NM_012341.2	NP_036473.2	1	2	3	2.027623	Q9BZE4	NOG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	14	1543	+		all_epithelial(10;0.107)|Colorectal(49;0.14)	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Silent	SNP	ENST00000360803.4	1	1	hg19	c.1461T>A	CCDS31132.1	1																																																																																								0.521245		TCGA-S4-A8RP-01A-11D-A36O-08	0.443	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	1	0	1	2	2	2	2	0	0	0	0	40	40	40	38	1	1.960000	-20.000000	1	0.520000	NM_012341		0	76	73	0	202	200	1		1	1		0	0	40	0	0	1.000000	1	0	42	0	86	0	76	202
PITPNM2	57605	broad.mit.edu	37	12	123480179	123480179	+	Missense_Mutation	SNP	A	A	G			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr12:123480179A>G	ENST00000542749.1	-	12	1874	c.1811T>C	c.(1810-1812)cTg>cCg	p.L604P	PITPNM2_ENST00000320201.4_Missense_Mutation_p.L604P|PITPNM2_ENST00000280562.5_Missense_Mutation_p.L604P|PITPNM2_ENST00000392428.1_Missense_Mutation_p.L325P			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	604					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGCATTCATCAGGATGCCCGG	0.672																																						ENST00000542749.1	0.370000	0.050000	0.270000	0.100000	0.170000	0.195309	0.170000	0.160000																										0				39						c.(1810-1812)cTg>cCg		phosphatidylinositol transfer protein, membrane-associated 2							28.0	20.0	23.0					12																	123480179		2202	4299	6501	SO:0001583	missense	57605	0	0					g.chr12:123480179A>G	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1811T>C	chr12.hg19:g.123480179A>G	ENSP00000437611:p.Leu604Pro	0					PITPNM2_ENST00000280562.5_Missense_Mutation_p.L604P|PITPNM2_ENST00000320201.4_Missense_Mutation_p.L604P|PITPNM2_ENST00000392428.1_Missense_Mutation_p.L325P	p.L604P			0	0	0	2.002266	Q9BZ72	PITM2_HUMAN		12	1874	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		Q9P271	Missense_Mutation	SNP	ENST00000542749.1	0	1	hg19	c.1811T>C	CCDS9242.1	0	.	.	.	.	.	.	.	.	.	.	A	7.514	0.655371	0.14580	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.47528	1.16;1.16;0.84;1.16	4.83	2.46	0.29980	4.83	2.46	0.29980	.	1.317200	0.05113	N	0.489206	T	0.38026	0.1025	L	0.29908	0.895	0.50813	D	0.999895	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.0	T	0.08764	-1.0706	10	0.52906	T	0.07	-2.8824	7.1979	0.25864	0.7029:0.0:0.2971:0.0	.	604;604	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	P	604;604;325;604	ENSP00000280562:L604P;ENSP00000322218:L604P;ENSP00000376223:L325P;ENSP00000437611:L604P	ENSP00000280562:L604P	L	-	2	0	0	PITPNM2	122046132	122046132	1.000000	0.71417	0.067000	0.19924	0.223000	0.24884	2.220000	0.42908	0.223000	0.20920	0.459000	0.35465	CTG	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.672	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	15	1	1.960000	-7.915158	1	0.520000	NM_020845		0	4	4	0	91	90	0		1	0		0	0	16	0	0	0.889405	3.155902e-03	0	0	0	2	0	4	91
DDX55	57696	broad.mit.edu	37	12	124103244	124103244	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr12:124103244G>T	ENST00000238146.4	+	12	1243	c.1193G>T	c.(1192-1194)aGa>aTa	p.R398I	SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000538744.1_Missense_Mutation_p.R367I|DDX55_ENST00000421670.3_Missense_Mutation_p.R5I|DDX55_ENST00000541259.1_Intron	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	398	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		AAGCCCCAGAGAAACACAGCG	0.527											OREG0022230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000238146.4	1.000000	0.730000	1.000000	0.810000	0.900000	0.907190	0.900000	1.000000																										0				14						c.(1192-1194)aGa>aTa		DEAD (Asp-Glu-Ala-Asp) box polypeptide 55							125.0	112.0	116.0					12																	124103244		2203	4300	6503	SO:0001583	missense	57696	0	0					g.chr12:124103244G>T	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1193G>T	chr12.hg19:g.124103244G>T	ENSP00000238146:p.Arg398Ile	0		OREG0022230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1531	SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000421670.3_Missense_Mutation_p.R5I|DDX55_ENST00000541259.1_Intron|DDX55_ENST00000538744.1_Missense_Mutation_p.R367I	p.R398I	NM_020936.1	NP_065987.1	0	0	0	2.002266	Q8NHQ9	DDX55_HUMAN		12	1243	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	ENST00000238146.4	1	1	hg19	c.1193G>T	CCDS9251.1	1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279677	0.23307	.	.	ENSG00000111364	ENST00000238146;ENST00000538744;ENST00000421670	T;T;T	0.44482	4.02;3.74;0.92	6.06	-2.24	0.06909	6.06	-2.24	0.06909	Helicase, C-terminal (1);	38.690800	0.00644	U	0.000527	T	0.19525	0.0469	N	0.02916	-0.46	0.25732	N	0.985252	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.13282	-1.0515	10	0.34782	T	0.22	-21.4456	5.5124	0.16888	0.29:0.1477:0.4657:0.0966	.	398;367	Q8NHQ9;F5H5U2	DDX55_HUMAN;.	I	398;367;5	ENSP00000238146:R398I;ENSP00000443114:R367I;ENSP00000442332:R5I	ENSP00000238146:R398I	R	+	2	0	0	DDX55	122669197	122669197	0.014000	0.17966	0.001000	0.08648	0.636000	0.38137	0.389000	0.20751	-0.570000	0.06022	-0.290000	0.09829	AGA	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.527	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2	1	0	1	2	2	2	2	0	0	0	0	40	40	40	38	1	1.960000	-20.000000	1	0.520000			0	74	72	0	236	232	1		1	1		0	0	40	0	0	1.000000	9.999631e-01	0	19	0	32	0	74	236
CLSTN3	9746	broad.mit.edu	37	12	7301731	7301731	+	Missense_Mutation	SNP	C	C	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr12:7301731C>A	ENST00000266546.6	+	13	2461	c.2011C>A	c.(2011-2013)Caa>Aaa	p.Q671K	CLSTN3_ENST00000537408.1_Missense_Mutation_p.Q683K	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	671					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CCCTGATCTTCAAATCACCTG	0.562																																						ENST00000266546.6	0.580000	0.240000	0.490000	0.310000	0.390000	0.409300	0.390000	0.400000																										0				33						c.(2011-2013)Caa>Aaa		calsyntenin 3							67.0	58.0	61.0					12																	7301731		2203	4300	6503	SO:0001583	missense	9746	0	0					g.chr12:7301731C>A	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2011C>A	chr12.hg19:g.7301731C>A	ENSP00000266546:p.Gln671Lys	0					CLSTN3_ENST00000537408.1_Missense_Mutation_p.Q683K	p.Q671K	NM_014718.3	NP_055533.2	0	0	0	2.019861	Q9BQT9	CSTN3_HUMAN		13	2461	+			D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	1	1	hg19	c.2011C>A	CCDS8575.1	0	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945190	0.34283	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.36699	1.24;1.24	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.121175	0.56097	D	0.000022	T	0.18299	0.0439	N	0.04959	-0.14	0.46901	D	0.999246	B;B	0.12013	0.005;0.002	B;B	0.09377	0.002;0.004	T	0.12477	-1.0546	10	0.09590	T	0.72	-14.034	14.6704	0.68939	0.1452:0.8548:0.0:0.0	.	683;671	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	K	671;683	ENSP00000266546:Q671K;ENSP00000440679:Q683K	ENSP00000266546:Q671K	Q	+	1	0	0	CLSTN3	7192998	7192998	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	2.959000	0.49153	2.698000	0.92095	0.561000	0.74099	CAA	0.520000		TCGA-S4-A8RP-01A-11D-A36O-08	0.562	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.960000	-20.000000	1	0.520000	NM_014718		0	19	19	0	166	165	1		1	1		0	0	31	0	0	0.999993	9.993705e-01	0	12	0	96	0	19	166
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.690000	0.940000	0.760000	0.850000	0.856722	0.850000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	0	0	0	2.002266	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.960000	-20.000000	1	0.520000	NM_033360		2314	80	78	5714	278	274	1	1	1	1	1	0	0	46	355	1	1.000000	8.213332e-01	1	2	70	11	334	80	278
OR6C76	390326	broad.mit.edu	37	12	55820043	55820043	+	Missense_Mutation	SNP	A	A	C			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr12:55820043A>C	ENST00000328314.3	+	1	6	c.6A>C	c.(4-6)aaA>aaC	p.K2N		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CAGAAATGAAAAATAGAACAT	0.353																																						ENST00000328314.3	0.320000	0.120000	0.270000	0.160000	0.210000	0.219010	0.210000	0.210000																										0				14						c.(4-6)aaA>aaC		olfactory receptor, family 6, subfamily C, member 76							102.0	99.0	100.0					12																	55820043		2203	4300	6503	SO:0001583	missense	390326	0	0					g.chr12:55820043A>C		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.6A>C	chr12.hg19:g.55820043A>C	ENSP00000328402:p.Lys2Asn	0						p.K2N	NM_001005183.1	NP_001005183.1	0	0	0	2.002266	A6NM76	O6C76_HUMAN		1	6	+				Missense_Mutation	SNP	ENST00000328314.3	1	1	hg19	c.6A>C	CCDS31823.1	0	.	.	.	.	.	.	.	.	.	.	a	14.40	2.524254	0.44866	.	.	ENSG00000185821	ENST00000328314	T	0.01455	4.87	4.35	0.417	0.16421	4.35	0.417	0.16421	.	0.826740	0.10355	U	0.684675	T	0.01523	0.0049	N	0.25992	0.78	0.09310	N	1	B	0.16603	0.018	B	0.17098	0.017	T	0.47959	-0.9076	10	0.72032	D	0.01	.	2.9347	0.05810	0.518:0.2723:0.0781:0.1316	.	2	A6NM76	O6C76_HUMAN	N	2	ENSP00000328402:K2N	ENSP00000328402:K2N	K	+	3	2	2	OR6C76	54106310	54106310	0.003000	0.15002	0.105000	0.21289	0.688000	0.40055	1.295000	0.33377	-0.019000	0.14055	0.487000	0.48397	AAA	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.353	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406675.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.960000	-5.208442	1	0.520000	NM_001005183		0	18	18	0	311	308	0		1			0	0	41	0	0	0.999982	0	0	0	0	0	0	18	311
GOLGA3	2802	broad.mit.edu	37	12	133384600	133384600	+	Missense_Mutation	SNP	G	G	C			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr12:133384600G>C	ENST00000450791.2	-	4	1238	c.1055C>G	c.(1054-1056)gCg>gGg	p.A352G	GOLGA3_ENST00000204726.3_Missense_Mutation_p.A352G|GOLGA3_ENST00000545875.1_Missense_Mutation_p.A352G|GOLGA3_ENST00000537452.1_Missense_Mutation_p.A352G|GOLGA3_ENST00000456883.2_Missense_Mutation_p.A352G			Q08378	GOGA3_HUMAN	golgin A3	352					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CAGGGTATCCGCAGGAATCTC	0.632																																						ENST00000450791.2	0.990000	0.660000	0.910000	0.740000	0.820000	0.832338	0.820000	0.830000																										0				64						c.(1054-1056)gCg>gGg		golgin A3							84.0	74.0	77.0					12																	133384600		2203	4300	6503	SO:0001583	missense	2802	0	0					g.chr12:133384600G>C	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1055C>G	chr12.hg19:g.133384600G>C	ENSP00000410378:p.Ala352Gly	0					GOLGA3_ENST00000545875.1_Missense_Mutation_p.A352G|GOLGA3_ENST00000204726.3_Missense_Mutation_p.A352G|GOLGA3_ENST00000456883.2_Missense_Mutation_p.A352G|GOLGA3_ENST00000537452.1_Missense_Mutation_p.A352G	p.A352G			0	0	0	2.002266	Q08378	GOGA3_HUMAN		4	1238	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	1	1	hg19	c.1055C>G	CCDS9281.1	0	.	.	.	.	.	.	.	.	.	.	g	9.288	1.049914	0.19827	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.43	1.61	0.23674	5.43	1.61	0.23674	.	0.752409	0.13598	N	0.376048	T	0.25975	0.0633	L	0.56769	1.78	0.21355	N	0.999713	P;P;B	0.43352	0.804;0.553;0.394	B;B;B	0.35727	0.148;0.148;0.209	T	0.07868	-1.0750	10	0.45353	T	0.12	.	9.2674	0.37650	0.3553:0.0:0.6447:0.0	.	352;352;352	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	G	352	ENSP00000204726:A352G;ENSP00000410378:A352G;ENSP00000409303:A352G;ENSP00000442143:A352G;ENSP00000442603:A352G	ENSP00000204726:A352G	A	-	2	0	0	GOLGA3	131894673	131894673	0.023000	0.18921	0.000000	0.03702	0.001000	0.01503	2.066000	0.41452	0.289000	0.22422	-0.232000	0.12228	GCG	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.632	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.960000	-20.000000	1	0.520000	NM_005895		0	75	73	0	271	263	1		1	1		0	0	61	0	0	1.000000	9.569960e-01	0	7	0	14	0	75	271
CRYL1	51084	broad.mit.edu	37	13	21006373	21006373	+	Silent	SNP	C	C	A	rs375851924		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr13:21006373C>A	ENST00000298248.7	-	5	563	c.501G>T	c.(499-501)acG>acT	p.T167T	MIR4499_ENST00000584834.1_RNA|CRYL1_ENST00000480748.1_5'UTR|CRYL1_ENST00000382812.1_Silent_p.T145T	NM_015974.2	NP_057058.2	Q9Y2S2	CRYL1_HUMAN	crystallin, lambda 1	167					fatty acid metabolic process (GO:0006631)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|L-gulonate 3-dehydrogenase activity (GO:0050104)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)			NS(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		TGTCCACTGTCGTAGGGGCCG	0.587																																						ENST00000298248.7	0.270000	0.070000	0.220000	0.110000	0.150000	0.166398	0.150000	0.150000																										0				14						c.(499-501)acG>acT		crystallin, lambda 1		C		1,4019		0,1,2009	58.0	60.0	59.0		501	-10.9	0.0	13		59	0,8318		0,0,4159	no	coding-synonymous	CRYL1	NM_015974.2		0,1,6168	AA,AC,CC		0.0,0.0249,0.0081		167/320	21006373	1,12337	2010	4159	6169	SO:0001819	synonymous_variant	51084	1	120936	35				g.chr13:21006373C>A	AF077049	CCDS41871.1	13q11	2008-07-18			ENSG00000165475	ENSG00000165475			18246	protein-coding gene	gene with protein product	"""crystallin, lamda 1"", ""L-gulonate 3-dehydrogenase"", ""lambda-crystallin homolog"""	609877				12527201	Standard	NM_015974		Approved	GDH, lambda-CRY, MGC149525, MGC149526	uc001une.3	Q9Y2S2	OTTHUMG00000016516	ENST00000298248.7:c.501G>T	chr13.hg19:g.21006373C>A		0					CRYL1_ENST00000382812.1_Silent_p.T145T|MIR4499_ENST00000584834.1_RNA|CRYL1_ENST00000480748.1_5'UTR	p.T167T	NM_015974.2	NP_057058.2	0	0	0	2.010459	Q9Y2S2	CRYL1_HUMAN		5	563	-		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)	A0PJ43|B3KN92|Q0VDI1|Q7Z4Z9|Q9P0G7	Silent	SNP	ENST00000298248.7	1	0	hg19	c.501G>T	CCDS41871.1	0																																																																																								0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.587	CRYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044071.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.960000	-3.318793	1	0.520000	NM_015974		0	9	9	0	218	212	0		1	0		0	0	37	0	0	0.993644	9.866219e-01	0	0	0	186	0	9	218
SPPL2A	84888	broad.mit.edu	37	15	51012246	51012246	+	Missense_Mutation	SNP	T	T	C			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr15:51012246T>C	ENST00000261854.5	-	14	1653	c.1379A>G	c.(1378-1380)aAg>aGg	p.K460R	SPPL2A_ENST00000559293.1_5'Flank	NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	460					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		AGGTTGCCCCTTTTTCATCAG	0.408																																					Melanoma(50;790 1209 4069 22965 33125)	ENST00000261854.5	1.000000	0.010000	1.000000	0.030000	0.060000	0.243357	0.060000	0.050000																										0				15						c.(1378-1380)aAg>aGg		signal peptide peptidase like 2A							128.0	111.0	117.0					15																	51012246		2196	4294	6490	SO:0001583	missense	84888	0	0					g.chr15:51012246T>C		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.1379A>G	chr15.hg19:g.51012246T>C	ENSP00000261854:p.Lys460Arg	1					SPPL2A_ENST00000559293.1_5'Flank	p.K460R	NM_032802.3	NP_116191.2	1	2	3	2.395965	Q8TCT8	SPP2A_HUMAN		14	1653	-			B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	ENST00000261854.5	0	1	hg19	c.1379A>G	CCDS10138.1	0	.	.	.	.	.	.	.	.	.	.	T	5.356	0.250885	0.10130	.	.	ENSG00000138600	ENST00000261854	T	0.17054	2.3	5.66	4.52	0.55395	5.66	4.52	0.55395	.	0.218396	0.51477	D	0.000088	T	0.06508	0.0167	N	0.04746	-0.17	0.20638	N	0.999871	P	0.41475	0.751	B	0.40982	0.345	T	0.14671	-1.0464	10	0.12766	T	0.61	-3.5127	1.9865	0.03437	0.2572:0.0784:0.1375:0.5268	.	460	Q8TCT8	PSL2_HUMAN	R	460	ENSP00000261854:K460R	ENSP00000261854:K460R	K	-	2	0	0	AC012100.1	48799538	48799538	1.000000	0.71417	0.976000	0.42696	0.949000	0.60115	2.041000	0.41213	0.955000	0.37878	0.477000	0.44152	AAG	0.595687		TCGA-S4-A8RP-01A-11D-A36O-08	0.408	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.960000	-2.614492	1	0.520000	NM_032802		0	5	5	0	434	422	0		1	0		0	0	48	0	0	0.933217	6.139203e-01	0	0	0	166	0	5	434
TM6SF1	53346	broad.mit.edu	37	15	83776476	83776476	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr15:83776476C>T	ENST00000322019.9	+	1	318	c.44C>T	c.(43-45)tCg>tTg	p.S15L	TM6SF1_ENST00000565774.1_Missense_Mutation_p.S15L|TM6SF1_ENST00000564988.1_3'UTR|TM6SF1_ENST00000379386.4_Missense_Mutation_p.S15L|TM6SF1_ENST00000379390.6_Missense_Mutation_p.S15L			Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1	15						integral component of membrane (GO:0016021)		p.S15W(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						CTGTCCCTCTCGGCCATCCCG	0.736																																						ENST00000322019.9	1.000000	0.200000	1.000000	0.290000	0.430000	0.523283	0.430000	0.380000																										1	Substitution - Missense(1)	p.S15W(1)	urinary_tract(1)	15						c.(43-45)tCg>tTg		transmembrane 6 superfamily member 1							29.0	27.0	27.0					15																	83776476		2200	4300	6500	SO:0001583	missense	53346	1	121026	25				g.chr15:83776476C>T	AF255922	CCDS10323.1, CCDS45338.1	15q24-q26	2003-04-04			ENSG00000136404	ENSG00000136404			11860	protein-coding gene	gene with protein product		606562				11124529	Standard	NM_001144903		Approved		uc002bjp.3	Q9BZW5	OTTHUMG00000147365	ENST00000322019.9:c.44C>T	chr15.hg19:g.83776476C>T	ENSP00000317000:p.Ser15Leu	1					TM6SF1_ENST00000564988.1_3'UTR|TM6SF1_ENST00000565774.1_Missense_Mutation_p.S15L|TM6SF1_ENST00000379390.6_Missense_Mutation_p.S15L|TM6SF1_ENST00000379386.4_Missense_Mutation_p.S15L	p.S15L			1	2	3	2.395965	Q9BZW5	TM6S1_HUMAN		1	318	+			A8K7T5|H3BU56|Q4U0U5	Missense_Mutation	SNP	ENST00000322019.9	0	1	hg19	c.44C>T	CCDS10323.1	0	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678630	0.47886	.	.	ENSG00000136404	ENST00000322019;ENST00000379386;ENST00000379384;ENST00000379390;ENST00000258909	T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24	3.12	2.19	0.27852	3.12	2.19	0.27852	.	0.244473	0.31847	U	0.006973	T	0.18551	0.0445	N	0.11927	0.2	0.28287	N	0.923729	B;B;B	0.16802	0.008;0.017;0.019	B;B;B	0.11329	0.002;0.002;0.006	T	0.12192	-1.0557	10	0.40728	T	0.16	-5.543	7.7752	0.29033	0.0:0.8663:0.0:0.1337	.	15;15;15	E9PD04;Q6P4D7;Q9BZW5	.;.;TM6S1_HUMAN	L	15	ENSP00000317000:S15L;ENSP00000368696:S15L;ENSP00000368693:S15L;ENSP00000368700:S15L;ENSP00000258909:S15L	ENSP00000258909:S15L	S	+	2	0	0	TM6SF1	81567480	81567480	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	3.405000	0.52630	0.318000	0.23185	0.306000	0.20318	TCG	0.595687		TCGA-S4-A8RP-01A-11D-A36O-08	0.736	TM6SF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000304009.1	1	0	1	2	2	2	2	0	0	0	0	13	13	13	12	1	1.960000	-13.963460	1	0.520000	NM_023003		0	9	9	0	100	99	0		1	0		0	0	13	0	0	0.994635	1.600310e-01	0	0	0	8	0	9	100
MCTP2	55784	broad.mit.edu	37	15	94945245	94945245	+	Silent	SNP	C	C	T	rs200511099		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr15:94945245C>T	ENST00000357742.4	+	16	2082	c.2082C>T	c.(2080-2082)ttC>ttT	p.F694F	MCTP2_ENST00000451018.3_Silent_p.F694F|MCTP2_ENST00000331706.4_Silent_p.F282F|MCTP2_ENST00000557742.1_Silent_p.F282F	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	694					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CAATAGCATTCGCGGTAAGCT	0.383													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17739	0.0		0.0	False		,,,				2504	0.0					ENST00000357742.4	1.000000	0.700000	1.000000	0.770000	0.850000	0.873107	0.850000	0.840000																										0				49						c.(2080-2082)ttC>ttT		multiple C2 domains, transmembrane 2							107.0	104.0	105.0					15																	94945245		2197	4298	6495	SO:0001819	synonymous_variant	55784	5	121408	40				g.chr15:94945245C>T	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2082C>T	chr15.hg19:g.94945245C>T		1					MCTP2_ENST00000451018.3_Silent_p.F694F|MCTP2_ENST00000557742.1_Silent_p.F282F|MCTP2_ENST00000331706.4_Silent_p.F282F	p.F694F	NM_018349.3	NP_060819.3	1	2	3	2.395965	Q6DN12	MCTP2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)	16	2082	+	Lung NSC(78;0.0821)|all_lung(78;0.148)		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	ENST00000357742.4	1	1	hg19	c.2082C>T	CCDS32338.1	1																																																																																								0.595687		TCGA-S4-A8RP-01A-11D-A36O-08	0.383	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	1	0	1	2	2	2	2	0	0	0	0	69	69	69	68	1	1.960000	-3.103181	1	0.520000	NM_018349		0	102	102	0	453	448	0		1	1		0	0	69	0	0	1.000000	8.433548e-01	0	3	0	14	0	102	453
SRL	6345	broad.mit.edu	37	16	4245590	4245590	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr16:4245590G>A	ENST00000399609.3	-	5	586	c.574C>T	c.(574-576)Cca>Tca	p.P192S	SRL_ENST00000537996.1_Missense_Mutation_p.P150S	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	651	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						ATGATGCCTGGTGTATCCACA	0.448																																						ENST00000399609.3	1.000000	0.880000	1.000000	0.940000	0.990000	0.981759	0.990000	1.000000																										0				21						c.(574-576)Cca>Tca		sarcalumenin							141.0	138.0	139.0					16																	4245590		1915	4135	6050	SO:0001583	missense	6345	0	0					g.chr16:4245590G>A	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.574C>T	chr16.hg19:g.4245590G>A	ENSP00000382518:p.Pro192Ser	0					SRL_ENST00000537996.1_Missense_Mutation_p.P150S	p.P192S	NM_001098814.1	NP_001092284.1	1	2	3	2.041787	Q86TD4	SRCA_HUMAN		5	586	-				Missense_Mutation	SNP	ENST00000399609.3	1	1	hg19	c.574C>T	CCDS42113.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989453	0.93106	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.99769	-6.7;-6.7	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.000000	0.85682	U	0.000000	D	0.99880	0.9943	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96581	0.9430	10	0.72032	D	0.01	-8.2552	19.0659	0.93110	0.0:0.0:1.0:0.0	.	192	Q86TD4-2	.	S	192;650;150	ENSP00000382518:P192S;ENSP00000440350:P150S	ENSP00000333285:P650S	P	-	1	0	0	SRL	4185591	4185591	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.567000	0.98161	2.797000	0.96272	0.655000	0.94253	CCA	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.448	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	1	0	1	2	2	2	2	0	0	0	0	100	100	100	100	1	1.960000	-20.000000	1	0.520000	XM_064152		0	184	182	0	517	509	1		1			0	0	100	0	0	1.000000	0	0	0	0	0	0	184	517
XAF1	54739	broad.mit.edu	37	17	6674085	6674085	+	Missense_Mutation	SNP	C	C	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr17:6674085C>A	ENST00000361842.3	+	6	870	c.631C>A	c.(631-633)Cgt>Agt	p.R211S	XAF1_ENST00000441631.1_Missense_Mutation_p.R211S|XAF1_ENST00000346752.4_Missense_Mutation_p.R192S	NM_017523.3	NP_059993.2	Q6GPH4	XAF1_HUMAN	XIAP associated factor 1	211					apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|negative regulation of protein complex assembly (GO:0031333)|response to interferon-beta (GO:0035456)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	6						GAAAGATGTTCGTCCAAAGAC	0.368																																						ENST00000361842.3	0.210000	0.060000	0.170000	0.090000	0.120000	0.135670	0.120000	0.120000																										0				6						c.(631-633)Cgt>Agt		XIAP associated factor 1							87.0	88.0	88.0					17																	6674085		2203	4300	6503	SO:0001583	missense	54739	0	0					g.chr17:6674085C>A	X99699	CCDS11080.1, CCDS11081.1	17p13.2	2010-03-19			ENSG00000132530	ENSG00000132530			30932	protein-coding gene	gene with protein product		606717				12029096, 11175744	Standard	NM_199139		Approved	BIRC4BP, XIAPAF1, HSXIAPAF1	uc002gdn.3	Q6GPH4		ENST00000361842.3:c.631C>A	chr17.hg19:g.6674085C>A	ENSP00000354822:p.Arg211Ser	0					XAF1_ENST00000441631.1_Missense_Mutation_p.R211S|XAF1_ENST00000346752.4_Missense_Mutation_p.R192S	p.R211S	NM_017523.3	NP_059993.2	1	2	3	2.035207	Q6GPH4	XAF1_HUMAN		6	870	+			A2T931|A2T932|A8K2L1|A8K9Y3|D3DTM6|Q6MZE8|Q8N557|Q99982	Missense_Mutation	SNP	ENST00000361842.3	1	0	hg19	c.631C>A	CCDS11080.1	0	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119519	0.56505	.	.	ENSG00000132530	ENST00000361842;ENST00000441631;ENST00000346752;ENST00000431790	T;T;T	0.19394	4.15;2.15;2.17	4.79	3.82	0.43975	4.79	3.82	0.43975	.	0.415576	0.23340	N	0.049260	T	0.27967	0.0689	N	0.20986	0.625	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.73380	0.98;0.98;0.98;0.956;0.956	T	0.02539	-1.1144	10	0.46703	T	0.11	-21.6281	9.3008	0.37845	0.0:0.9044:0.0:0.0956	.	211;109;192;211;151	C9K044;Q6GPH4-6;Q6GPH4-2;Q6GPH4;B3KPW1	.;.;.;XAF1_HUMAN;.	S	211;211;192;109	ENSP00000354822:R211S;ENSP00000413199:R211S;ENSP00000341029:R192S	ENSP00000341029:R192S	R	+	1	0	0	XAF1	6614809	6614809	0.720000	0.27996	0.918000	0.36340	0.039000	0.13416	0.503000	0.22610	1.626000	0.50381	0.655000	0.94253	CGT	0.521245		TCGA-S4-A8RP-01A-11D-A36O-08	0.368	XAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439643.5	1	0	1	2	2	2	2	0	0	0	0	40	40	40	39	1	1.960000	-3.034592	1	0.520000	NM_017523		0	13	13	0	382	376	0		1	0		0	0	40	0	0	0.999504	7.198409e-01	0	0	0	75	0	13	382
GAS7	8522	broad.mit.edu	37	17	9923135	9923135	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr17:9923135G>A	ENST00000432992.2	-	2	423	c.263C>T	c.(262-264)tCg>tTg	p.S88L	GAS7_ENST00000323816.4_Missense_Mutation_p.S28L|GAS7_ENST00000578655.1_5'UTR|GAS7_ENST00000396115.2_Missense_Mutation_p.S24L|GAS7_ENST00000542249.1_Missense_Mutation_p.S24L|GAS7_ENST00000579158.1_Missense_Mutation_p.S24L|GAS7_ENST00000540214.1_Missense_Mutation_p.S24L|GAS7_ENST00000437099.2_Missense_Mutation_p.S24L|GAS7_ENST00000585266.1_Missense_Mutation_p.S28L	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	88	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						GCCCTGAGGCGACAGGTAGCT	0.597			T	MLL	AML*																																	ENST00000432992.2	1.000000	0.630000	0.940000	0.720000	0.820000	0.834200	0.820000	1.000000				Dom	yes			Dom	yes		17	17p	17p	8522	T	growth arrest-specific 7				L	L	MLL		AML*		0				39						c.(262-264)tCg>tTg		growth arrest-specific 7							55.0	57.0	57.0					17																	9923135		2203	4300	6503	SO:0001583	missense	8522	3	121412	36				g.chr17:9923135G>A	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.263C>T	chr17.hg19:g.9923135G>A	ENSP00000407552:p.Ser88Leu	0					GAS7_ENST00000542249.1_Missense_Mutation_p.S24L|GAS7_ENST00000540214.1_Missense_Mutation_p.S24L|GAS7_ENST00000585266.1_Missense_Mutation_p.S28L|GAS7_ENST00000578655.1_5'UTR|GAS7_ENST00000323816.4_Missense_Mutation_p.S28L|GAS7_ENST00000437099.2_Missense_Mutation_p.S24L|GAS7_ENST00000579158.1_Missense_Mutation_p.S24L|GAS7_ENST00000396115.2_Missense_Mutation_p.S24L	p.S88L	NM_201433.1	NP_958839.1	1	2	3	2.035207	O60861	GAS7_HUMAN		2	423	-			A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	ENST00000432992.2	1	1	hg19	c.263C>T	CCDS11152.1	0	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610775	0.87258	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000540214;ENST00000537970	T;D;D	0.83250	2.04;-1.7;-1.7	5.02	5.02	0.67125	5.02	5.02	0.67125	WW/Rsp5/WWP (6);	0.000000	0.85682	D	0.000000	D	0.90219	0.6942	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;P;D	0.68765	0.96;0.901;0.96	D	0.90263	0.4302	9	.	.	.	-21.8984	15.3829	0.74673	0.0:0.0:1.0:0.0	.	40;28;88	B7Z2L1;A8KAC2;O60861	.;.;GAS7_HUMAN	L	88;28;27;24;28	ENSP00000322608:S88L;ENSP00000379421:S28L;ENSP00000446214:S24L	.	S	-	2	0	0	GAS7	9863860	9863860	1.000000	0.71417	0.993000	0.49108	0.905000	0.53344	5.593000	0.67550	2.620000	0.88729	0.563000	0.77884	TCG	0.521245		TCGA-S4-A8RP-01A-11D-A36O-08	0.597	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	1	0	0	2	2	2	2	0	0	0	0	41	41	41	40	1	1.960000	-20.000000	1	0.520000	NM_003644, NM_201432, NM_201433		0	47	44	0	171	167	1		1	0		0	0	41	0	0	1.000000	9.012166e-01	0	0	0	17	0	47	171
CEP192	55125	broad.mit.edu	37	18	13100331	13100331	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr18:13100331G>T	ENST00000325971.8	+	36	6496	c.4903G>T	c.(4903-4905)Gat>Tat	p.D1635Y	CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000430049.2_Missense_Mutation_p.D1756Y|CEP192_ENST00000506447.1_Missense_Mutation_p.D2231Y			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1635					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AATTCGAGAAGATTTAACTCA	0.338																																						ENST00000325971.8	1.000000	0.040000	0.140000	0.060000	0.090000	0.133610	0.090000	0.090000																										0				71						c.(4903-4905)Gat>Tat		centrosomal protein 192kDa							58.0	56.0	57.0					18																	13100331		2203	4300	6503	SO:0001583	missense	55125	0	0					g.chr18:13100331G>T	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.4903G>T	chr18.hg19:g.13100331G>T	ENSP00000317156:p.Asp1635Tyr	0					CEP192_ENST00000430049.2_Missense_Mutation_p.D1756Y|CEP192_ENST00000506447.1_Missense_Mutation_p.D2231Y|CEP192_ENST00000540847.2_3'UTR	p.D1635Y			1	2	3	2.067673	Q8TEP8	CE192_HUMAN		36	6496	+			A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	0	1	hg19	c.4903G>T		0	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101103	0.76983	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.08458	3.09;3.09;3.1	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.109070	0.64402	D	0.000005	T	0.29458	0.0734	M	0.68952	2.095	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.991;0.988;0.995	T	0.00337	-1.1807	10	0.87932	D	0	-25.0451	18.5764	0.91157	0.0:0.0:1.0:0.0	.	1756;2231;235;833	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	Y	2231;1635;1635;1756;235	ENSP00000427550:D2231Y;ENSP00000317156:D1635Y;ENSP00000389190:D1756Y	ENSP00000317156:D1635Y	D	+	1	0	0	CEP192	13090331	13090331	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	4.233000	0.58651	2.756000	0.94617	0.655000	0.94253	GAT	0.526160		TCGA-S4-A8RP-01A-11D-A36O-08	0.338	CEP192-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	46	46	46	45	1	1.960000	-8.899888	1	0.520000	NM_032142		0	9	8	0	380	376	0		1	0		0	0	46	0	0	0.994001	7.207054e-02	0	0	0	17	0	9	380
SMAD4	4089	broad.mit.edu	37	18	48591891	48591891	+	Nonsense_Mutation	SNP	G	G	T	rs121912581		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr18:48591891G>T	ENST00000342988.3	+	9	1592	c.1054G>T	c.(1054-1056)Gga>Tga	p.G352*	SMAD4_ENST00000398417.2_Nonsense_Mutation_p.G352*|SMAD4_ENST00000588745.1_Nonsense_Mutation_p.G256*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	352	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		G -> R (in JP/HHT and JPS; dbSNP:rs121912581). {ECO:0000269|PubMed:12417513, ECO:0000269|PubMed:15031030}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TACTGTTGATGGATACGTGGA	0.443																																						ENST00000342988.3	1.000000	0.830000	0.990000	0.890000	0.940000	0.941564	0.940000	0.990000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454	GRCh37	CM024126	SMAD4	M	rs121912581	c.(1054-1056)Gga>Tga		SMAD family member 4							237.0	199.0	212.0					18																	48591891		2203	4300	6503	SO:0001587	stop_gained	4089	0	0					g.chr18:48591891G>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1054G>T	chr18.hg19:g.48591891G>T	ENSP00000341551:p.Gly352*	1					SMAD4_ENST00000588745.1_Nonsense_Mutation_p.G256*|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.G352*	p.G352*	NM_005359.5	NP_005350.1	0	1	1	1.521161	Q13485	SMAD4_HUMAN		9	1592	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Nonsense_Mutation	SNP	ENST00000342988.3	0	1	hg19	c.1054G>T	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.484127	0.99413	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	.	.	.	5.86	5.86	0.93980	5.86	5.86	0.93980	.	0.048668	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	.	.	.	X	352	.	ENSP00000341551:G352X	G	+	1	0	0	SMAD4	46845889	46845889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.676000	0.98643	2.771000	0.95319	0.563000	0.77884	GGA	0.351351		TCGA-S4-A8RP-01A-11D-A36O-08	0.443	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.960000	-13.232870	1	0.520000	NM_005359		0	125	123	0	234	233	1		1	1	1	0	0	68	924	0	1.000000	1	1	9	222	42	489	125	234
ZNF516	9658	broad.mit.edu	37	18	74154961	74154961	+	Missense_Mutation	SNP	G	G	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr18:74154961G>A	ENST00000443185.2	-	3	367	c.50C>T	c.(49-51)cCc>cTc	p.P17L	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	17					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GGCCCTGGTGGGGCTGGGGCC	0.692																																						ENST00000443185.2	0.980000	0.550000	0.920000	0.670000	0.800000	0.802709	0.800000	0.830000																										0				32						c.(49-51)cCc>cTc		zinc finger protein 516							17.0	21.0	20.0					18																	74154961		1997	4158	6155	SO:0001583	missense	9658	0	0					g.chr18:74154961G>A	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.50C>T	chr18.hg19:g.74154961G>A	ENSP00000394757:p.Pro17Leu	1					ZNF516_ENST00000524431.2_5'UTR	p.P17L	NM_014643.3	NP_055458.1	0	1	1	1.521161	Q92618	ZN516_HUMAN		3	367	-		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		Missense_Mutation	SNP	ENST00000443185.2	1	1	hg19	c.50C>T		0	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825265	0.71143	.	.	ENSG00000101493	ENST00000443185;ENST00000532857	T;T	0.11495	2.77;3.12	4.3	4.3	0.51218	4.3	4.3	0.51218	.	0.095548	0.43919	D	0.000509	T	0.16514	0.0397	.	.	.	0.58432	D	0.999994	D	0.76494	0.999	D	0.64144	0.922	T	0.01757	-1.1280	9	0.02654	T	1	-13.6921	15.3131	0.74053	0.0:0.0:1.0:0.0	.	17	Q92618	ZN516_HUMAN	L	17	ENSP00000394757:P17L;ENSP00000446211:P17L	ENSP00000394757:P17L	P	-	2	0	0	ZNF516	72283949	72283949	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	5.885000	0.69736	2.106000	0.64143	0.561000	0.74099	CCC	0.351351		TCGA-S4-A8RP-01A-11D-A36O-08	0.692	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	12	12	12	11	1	1.960000	-20.000000	1	0.520000	NM_014643		0	22	19	0	52	51	0		1	1		0	0	12	0	0	1.000000	7.362017e-01	0	3	0	5	0	22	52
PPAP2C	8612	broad.mit.edu	37	19	291323	291323	+	Nonsense_Mutation	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr19:291323C>T	ENST00000269812.3	-	1	63	c.14G>A	c.(13-15)tGg>tAg	p.W5*	PPAP2C_ENST00000434325.2_Intron|PPAP2C_ENST00000327790.3_5'Flank	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	5					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGAAGACCCACCTCCGCTG	0.756																																						ENST00000269812.3	1.000000	0.640000	1.000000	0.750000	0.890000	0.885773	0.890000	1.000000																										0				5						c.(13-15)tGg>tAg		phosphatidic acid phosphatase type 2C							43.0	49.0	47.0					19																	291323		2177	4286	6463	SO:0001587	stop_gained	8612	0	0					g.chr19:291323C>T	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.14G>A	chr19.hg19:g.291323C>T	ENSP00000269812:p.Trp5*	1					PPAP2C_ENST00000327790.3_5'Flank|PPAP2C_ENST00000434325.2_Intron	p.W5*	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	1	2	3	2.168163	O43688	LPP2_HUMAN		1	63	-		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	A6NLV0|E9PAY8	Nonsense_Mutation	SNP	ENST00000269812.3	0	1	hg19	c.14G>A	CCDS12023.1	1	.	.	.	.	.	.	.	.	.	.	c	36	5.704477	0.96812	.	.	ENSG00000141934	ENST00000269812	.	.	.	3.51	2.13	0.27403	3.51	2.13	0.27403	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	6.8058	0.23777	0.0:0.8261:0.0:0.1739	.	.	.	.	X	5	.	ENSP00000269812:W5X	W	-	2	0	0	PPAP2C	242323	242323	0.980000	0.34600	1.000000	0.80357	0.754000	0.42855	-0.025000	0.12413	1.497000	0.48584	0.289000	0.19496	TGG	0.567256		TCGA-S4-A8RP-01A-11D-A36O-08	0.756	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.960000	-3.234261	1	0.520000			0	40	40	0	161	158	0		1	1		0	0	37	0	0	1.000000	1	0	9	0	167	0	40	161
PPAN	56342	broad.mit.edu	37	19	10220315	10220315	+	Silent	SNP	G	G	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr19:10220315G>T	ENST00000253107.7	+	6	628	c.522G>T	c.(520-522)ctG>ctT	p.L174L	PPAN_ENST00000556468.1_Silent_p.L174L|PPAN_ENST00000393793.1_Silent_p.L121L|PPAN-P2RY11_ENST00000428358.1_Silent_p.L174L|SNORD105_ENST00000386910.1_RNA|PPAN-P2RY11_ENST00000393796.4_Silent_p.L174L|SNORD105B_ENST00000458770.1_RNA|P2RY11_ENST00000321826.4_5'Flank	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	174	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			AGGTGAACCTGAACACCATCA	0.577																																						ENST00000253107.7	0.080000	0.010000	0.060000	0.020000	0.040000	0.047330	0.040000	0.040000																										0				15						c.(520-522)ctG>ctT		peter pan homolog (Drosophila)							250.0	263.0	258.0					19																	10220315		2203	4300	6503	SO:0001819	synonymous_variant	56342	0	0					g.chr19:10220315G>T	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.522G>T	chr19.hg19:g.10220315G>T		0					PPAN-P2RY11_ENST00000393796.4_Silent_p.L174L|P2RY11_ENST00000321826.4_5'Flank|PPAN_ENST00000556468.1_Silent_p.L174L|PPAN-P2RY11_ENST00000428358.1_Silent_p.L174L|PPAN_ENST00000393793.1_Silent_p.L121L|SNORD105_ENST00000386910.1_RNA|SNORD105B_ENST00000458770.1_RNA	p.L174L	NM_020230.5	NP_064615.3	1	2	3	2.033021	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)	6	628	+			C9J3F9|Q9BW97|Q9H170	Silent	SNP	ENST00000253107.7	0	1	hg19	c.522G>T	CCDS12225.1	0																																																																																								0.521245		TCGA-S4-A8RP-01A-11D-A36O-08	0.577	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	0	0	1	2	2	2	2	0	0	0	0	267	267	267	266	1	1.960000	-2.287386	0	0.520000	NM_020230		0	17	16	0	1437	1411	0		1	0		0	0	267	0	0	0.999957	2.556097e-01	0	0	0	79	0	17	1437
NFKBIB	4793	broad.mit.edu	37	19	39398260	39398260	+	Silent	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr19:39398260C>T	ENST00000313582.5	+	5	964	c.930C>T	c.(928-930)ccC>ccT	p.P310P	NFKBIB_ENST00000572515.1_Silent_p.P310P|NFKBIB_ENST00000392079.3_Silent_p.P278P	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	310					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			AATCCGGCCCCTGCAGCAGCA	0.692																																					Pancreas(165;1492 2005 6979 7739 34483)	ENST00000313582.5	1.000000	0.820000	1.000000	0.990000	0.990000	0.985623	0.990000	1.000000																										0				8						c.(928-930)ccC>ccT		nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta							10.0	12.0	11.0					19																	39398260		2182	4270	6452	SO:0001819	synonymous_variant	4793	0	0					g.chr19:39398260C>T	L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.930C>T	chr19.hg19:g.39398260C>T		0					NFKBIB_ENST00000392079.3_Silent_p.P278P|NFKBIB_ENST00000572515.1_Silent_p.P310P	p.P310P	NM_002503.4	NP_002494.2	1	2	3	2.033021	Q15653	IKBB_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)	5	964	+	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		A8K3F4|Q96BJ7	Silent	SNP	ENST00000313582.5	1	1	hg19	c.930C>T	CCDS12524.1	1																																																																																								0.521245		TCGA-S4-A8RP-01A-11D-A36O-08	0.692	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438155.1	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	1.960000	-20.000000	1	0.520000	NM_002503		0	25	24	0	56	53	0		1	1		0	0	14	0	0	1.000000	1	0	21	0	57	0	25	56
LRRC4B	94030	broad.mit.edu	37	19	51021095	51021095	+	Silent	SNP	G	G	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr19:51021095G>T	ENST00000599957.1	-	3	2072	c.1875C>A	c.(1873-1875)ccC>ccA	p.P625P	LRRC4B_ENST00000389201.3_Silent_p.P625P			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	625					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CCGAGGCGGCGGGCAGCTCGT	0.726																																						ENST00000599957.1	1.000000	0.760000	1.000000	0.880000	0.990000	0.959530	0.990000	1.000000																										0				30						c.(1873-1875)ccC>ccA		leucine rich repeat containing 4B							16.0	18.0	18.0					19																	51021095		2030	4164	6194	SO:0001819	synonymous_variant	94030	1	120148	30				g.chr19:51021095G>T	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1875C>A	chr19.hg19:g.51021095G>T		0					LRRC4B_ENST00000389201.3_Silent_p.P625P	p.P625P			1	2	3	2.045623	Q9NT99	LRC4B_HUMAN		3	2072	-		all_neural(266;0.131)	Q3ZCQ4|Q58F20	Silent	SNP	ENST00000599957.1	1	1	hg19	c.1875C>A	CCDS42595.1	1																																																																																								0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.726	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	28	1	1.960000	-4.588884	1	0.520000	NM_001080457		0	39	39	0	108	107	0		1			0	0	30	0	0	1.000000	0	0	0	0	0	0	39	108
CELSR2	1952	broad.mit.edu	37	1	109812124	109812124	+	Silent	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:109812124C>T	ENST00000271332.3	+	21	6952	c.6891C>T	c.(6889-6891)gcC>gcT	p.A2297A		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2297					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGCCCCGGGCCCTGGACAAAC	0.597																																					NSCLC(158;1285 2011 34800 34852 42084)	ENST00000271332.3	1.000000	0.760000	1.000000	0.850000	0.950000	0.936397	0.950000	1.000000																										0				82						c.(6889-6891)gcC>gcT		cadherin, EGF LAG seven-pass G-type receptor 2							70.0	65.0	67.0					1																	109812124		2203	4300	6503	SO:0001819	synonymous_variant	1952	0	0					g.chr1:109812124C>T	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.6891C>T	chr1.hg19:g.109812124C>T		0						p.A2297A	NM_001408.2	NP_001399.1	1	2	3	2.040192	Q9HCU4	CELR2_HUMAN		21	6952	+		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	1	1	hg19	c.6891C>T	CCDS796.1	1																																																																																								0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.597	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	0	0	1	2	2	2	2	0	0	0	0	40	40	40	39	1	1.960000	-20.000000	1	0.520000	NM_001408		0	66	66	0	201	200	1		1	1		0	0	40	0	0	1.000000	9.641100e-01	0	8	0	11	0	66	201
PRAMEF1	65121	broad.mit.edu	37	1	12855916	12855916	+	Missense_Mutation	SNP	G	G	A	rs534609491		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:12855916G>A	ENST00000332296.7	+	4	1299	c.1196G>A	c.(1195-1197)cGc>cAc	p.R399H	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.R154H	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	399					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GACCTGCTGCGCCACACCAGT	0.557													.|||	1	0.000199681	0.0	0.0	5008	,	,		19644	0.0		0.0	False		,,,				2504	0.001					ENST00000332296.7	1.000000	0.760000	0.950000	0.820000	0.880000	0.888973	0.880000	0.890000																										0				35						c.(1195-1197)cGc>cAc		PRAME family member 1							49.0	46.0	47.0					1																	12855916		2201	4294	6495	SO:0001583	missense	65121	7	121386	36				g.chr1:12855916G>A	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1196G>A	chr1.hg19:g.12855916G>A	ENSP00000332134:p.Arg399His	1					PRAMEF1_ENST00000400814.3_Missense_Mutation_p.R154H	p.R399H	NM_023013.2	NP_075389.1	0	1	1	1.561689	O95521	PRAM1_HUMAN		4	1299	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	1	1	hg19	c.1196G>A	CCDS148.1	1	.	.	.	.	.	.	.	.	.	.	.	2.972	-0.212215	0.06140	.	.	ENSG00000116721	ENST00000332296;ENST00000400814	T;T	0.49432	0.78;0.78	1.56	-0.674	0.11369	1.56	-0.674	0.11369	.	1.571450	0.04233	N	0.335492	T	0.30008	0.0751	L	0.27053	0.805	0.09310	N	1	B	0.18166	0.026	B	0.11329	0.006	T	0.09357	-1.0678	10	0.12430	T	0.62	.	4.1186	0.10094	0.4747:0.0:0.5253:0.0	.	399	O95521	PRAM1_HUMAN	H	399;154	ENSP00000332134:R399H;ENSP00000383616:R154H	ENSP00000332134:R399H	R	+	2	0	0	PRAMEF1	12778503	12778503	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	-2.135000	0.01306	-0.196000	0.10366	0.205000	0.17691	CGC	0.360341		TCGA-S4-A8RP-01A-11D-A36O-08	0.557	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	1	0	0	2	2	2	2	0	0	0	0	109	109	109	162	1	1.960000	-10.785790	1	0.520000	NM_023013		0	133	107	0	297	153	0		1			0	0	109	0	0	1.000000	0	0	0	0	0	0	133	297
WNT2B	7482	broad.mit.edu	37	1	113059836	113059836	+	Missense_Mutation	SNP	C	C	T	rs201153849		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:113059836C>T	ENST00000369684.4	+	4	1260	c.775C>T	c.(775-777)Cgc>Tgc	p.R259C	WNT2B_ENST00000256640.5_Missense_Mutation_p.R167C|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Missense_Mutation_p.R240C	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	259					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCAGATTTCCGCCGCACAGG	0.617																																						ENST00000369684.4	1.000000	0.710000	1.000000	0.800000	0.890000	0.893684	0.890000	1.000000																										0				18						c.(775-777)Cgc>Tgc		wingless-type MMTV integration site family, member 2B							69.0	57.0	61.0					1																	113059836		2203	4300	6503	SO:0001583	missense	7482	0	0					g.chr1:113059836C>T	AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.775C>T	chr1.hg19:g.113059836C>T	ENSP00000358698:p.Arg259Cys	0					WNT2B_ENST00000256640.5_Missense_Mutation_p.R167C|WNT2B_ENST00000369686.5_Missense_Mutation_p.R240C|RP4-671G15.2_ENST00000608357.1_RNA	p.R259C	NM_024494.2	NP_078613.1	1	2	3	2.040192	Q93097	WNT2B_HUMAN		4	1260	+	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	ENST00000369684.4	1	1	hg19	c.775C>T	CCDS847.1	1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659360	0.88154	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	T;T;T	0.78924	-1.22;-1.22;-1.22	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.91593	0.7344	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	D	0.93785	0.7087	10	0.87932	D	0	.	19.0601	0.93090	0.0:1.0:0.0:0.0	.	259;240	Q93097;Q93097-2	WNT2B_HUMAN;.	C	167;240;259	ENSP00000256640:R167C;ENSP00000358700:R240C;ENSP00000358698:R259C	ENSP00000256640:R167C	R	+	1	0	0	WNT2B	112861359	112861359	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.367000	0.52350	2.599000	0.87857	0.555000	0.69702	CGC	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.617	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030692.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	43	1	1.960000	-3.920221	1	0.520000	NM_004185		0	67	65	0	222	219	1		1	0		0	0	44	0	0	1.000000	6.548984e-01	0	0	0	9	0	67	222
TAS1R2	80834	broad.mit.edu	37	1	19166741	19166741	+	Silent	SNP	C	C	T	rs112760365	byFrequency	TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:19166741C>T	ENST00000375371.3	-	6	1893	c.1872G>A	c.(1870-1872)ccG>ccA	p.P624P		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	624					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AGACCTTGGGCGGCCCCACGT	0.617													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16464	0.001		0.0	False		,,,				2504	0.0					ENST00000375371.3	0.160000	0.030000	0.130000	0.050000	0.080000	0.094868	0.080000	0.080000																										0				45						c.(1870-1872)ccG>ccA		taste receptor, type 1, member 2	Aspartame(DB00168)						72.0	72.0	72.0					1																	19166741		2203	4300	6503	SO:0001819	synonymous_variant	80834	3	121412	37				g.chr1:19166741C>T		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1872G>A	chr1.hg19:g.19166741C>T		1						p.P624P	NM_152232.2	NP_689418.2	0	1	1	1.525079	Q8TE23	TS1R2_HUMAN		6	1893	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	Q5TZ19	Silent	SNP	ENST00000375371.3	0	1	hg19	c.1872G>A	CCDS187.1	0																																																																																								0.353622		TCGA-S4-A8RP-01A-11D-A36O-08	0.617	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1	0	0	1	2	2	2	2	0	0	0	0	56	56	56	55	1	1.960000	-2.860462	1	0.520000			0	7	7	0	230	228	0		1			0	0	56	0	0	0.980473	0	0	0	0	0	0	7	230
CELF3	11189	broad.mit.edu	37	1	151681757	151681757	+	Missense_Mutation	SNP	A	A	C			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:151681757A>C	ENST00000290583.4	-	4	1138	c.345T>G	c.(343-345)ttT>ttG	p.F115L	CELF3_ENST00000290585.4_Missense_Mutation_p.F115L|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000392706.3_5'Flank|AL589765.1_ENST00000442233.2_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|RIIAD1_ENST00000326413.3_5'Flank	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	115	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						CGAAGGGCTCAAACATCTTCC	0.617																																						ENST00000290583.4	1.000000	0.290000	1.000000	0.330000	0.370000	0.498356	0.370000	0.370000																										0				21						c.(343-345)ttT>ttG		CUGBP, Elav-like family member 3							224.0	211.0	216.0					1																	151681757		2203	4300	6503	SO:0001583	missense	11189	0	0					g.chr1:151681757A>C	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.345T>G	chr1.hg19:g.151681757A>C	ENSP00000290583:p.Phe115Leu	1					CELF3_ENST00000290585.4_Missense_Mutation_p.F115L|RIIAD1_ENST00000326413.3_5'Flank|CELF3_ENST00000392706.3_5'Flank|AL589765.1_ENST00000442233.2_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR	p.F115L	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	0	4	4	2.346818	Q5SZQ8	CELF3_HUMAN		4	1138	-			B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	1	1	hg19	c.345T>G	CCDS1002.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	18.12|18.12	3.553835|3.553835	0.65425|0.65425	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000368833|ENST00000420342	T;T|.	0.43294|.	0.95;0.95|.	4.39|4.39	-2.57|-2.57	0.06248|0.06248	4.39|4.39	-2.57|-2.57	0.06248|0.06248	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60521|0.60521	0.2275|0.2275	M|M	0.83774|0.83774	2.66|2.66	0.80722|0.80722	D|D	1|1	D;P;D;D;D|.	0.76494|.	0.977;0.945;0.999;0.985;0.981|.	D;P;D;P;P|.	0.87578|.	0.962;0.7;0.998;0.843;0.756|.	T|T	0.67345|0.67345	-0.5694|-0.5694	10|5	0.66056|.	D|.	0.02|.	-8.3106|-8.3106	9.4317|9.4317	0.38615|0.38615	0.5746:0.0:0.4254:0.0|0.5746:0.0:0.4254:0.0	.|.	115;115;114;115;114|.	Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3|.	.;.;.;CELF3_HUMAN;.|.	L|W	115;115;114|116	ENSP00000290585:F115L;ENSP00000290583:F115L|.	ENSP00000290583:F115L|.	F|L	-|-	3|2	2|0	2|0	CELF3|CELF3	149948381|149948381	149948381|149948381	0.649000|0.649000	0.27322|0.27322	0.994000|0.994000	0.49952|0.49952	0.570000|0.570000	0.35934|0.35934	-0.097000|-0.097000	0.11042|0.11042	-0.328000|-0.328000	0.08539|0.08539	-0.624000|-0.624000	0.04008|0.04008	TTT|TTG	0.586635		TCGA-S4-A8RP-01A-11D-A36O-08	0.617	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	1	0	1	2	2	2	2	0	0	0	0	178	178	178	177	1	1.960000	-3.318794	1	0.520000	NM_007185		0	104	102	0	1167	1150	0		1	0		0	0	178	0	0	1.000000	6.412567e-01	0	0	0	26	0	104	1167
MACF1	23499	broad.mit.edu	37	1	39951311	39951311	+	Silent	SNP	T	T	C			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:39951311T>C	ENST00000372915.3	+	97	22099	c.22012T>C	c.(22012-22014)Tta>Cta	p.L7338L	MACF1_ENST00000567887.1_Silent_p.L7542L|MACF1_ENST00000361689.2_Silent_p.L5380L|MACF1_ENST00000564288.1_Silent_p.L7505L|MACF1_ENST00000539005.1_Silent_p.L5250L|MACF1_ENST00000289893.4_Silent_p.L5888L|MACF1_ENST00000317713.7_Silent_p.L5380L|MACF1_ENST00000545844.1_Silent_p.L5380L			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7338	C-terminal tail. {ECO:0000250}.|Ser-rich.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTTGACCTCTTAGAGACGCA	0.587																																						ENST00000372915.3	1.000000	0.790000	1.000000	0.880000	0.980000	0.953641	0.980000	1.000000																										0				203						c.(22012-22014)Tta>Cta		microtubule-actin crosslinking factor 1							69.0	75.0	73.0					1																	39951311		2203	4300	6503	SO:0001819	synonymous_variant	23499	0	0					g.chr1:39951311T>C	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.22012T>C	chr1.hg19:g.39951311T>C		0					MACF1_ENST00000564288.1_Silent_p.L7505L|MACF1_ENST00000289893.4_Silent_p.L5888L|MACF1_ENST00000361689.2_Silent_p.L5380L|MACF1_ENST00000539005.1_Silent_p.L5250L|MACF1_ENST00000567887.1_Silent_p.L7542L|MACF1_ENST00000317713.7_Silent_p.L5380L|MACF1_ENST00000545844.1_Silent_p.L5380L	p.L7338L			1	2	3	2.040192	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)	97	22099	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	1	1	hg19	c.22012T>C		1	.	.	.	.	.	.	.	.	.	.	T	4.373	0.068714	0.08436	.	.	ENSG00000127603	ENST00000372925;ENST00000446276	T;T	0.67865	1.42;-0.29	5.28	-1.78	0.07957	5.28	-1.78	0.07957	.	0.000000	0.44483	D	0.000443	T	0.59622	0.2207	.	.	.	0.30229	N	0.796068	.	.	.	.	.	.	T	0.59925	-0.7362	6	.	.	.	.	11.6204	0.51115	0.0:0.7097:0.0:0.2903	.	.	.	.	P	4383;404	ENSP00000362016:L4383P;ENSP00000391512:L404P	.	L	+	2	0	0	MACF1	39723898	39723898	0.036000	0.19791	0.951000	0.38953	0.993000	0.82548	0.258000	0.18387	-0.143000	0.11334	0.533000	0.62120	CTT	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.587	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	0	0	1	2	19	22	2	1	1	1	1	44	44	44	44	1	1.960000	-20.000000	1	0.520000	NM_033044		0	71	69	0	208	206	0		1	1	1	1	0	44	1161	0	1.000000	1	1	99	310	221	915	71	208
DOCK7	85440	broad.mit.edu	37	1	62970389	62970389	+	Missense_Mutation	SNP	C	C	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:62970389C>A	ENST00000340370.5	-	36	4600	c.4583G>T	c.(4582-4584)cGa>cTa	p.R1528L	DOCK7_ENST00000251157.5_Missense_Mutation_p.R1550L	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1559					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GCTACAGTGTCGGAGAAGCCT	0.413																																						ENST00000340370.5	0.280000	0.080000	0.210000	0.110000	0.150000	0.174088	0.150000	0.160000																										0				92						c.(4582-4584)cGa>cTa		dedicator of cytokinesis 7							93.0	88.0	90.0					1																	62970389		2203	4300	6503	SO:0001583	missense	85440	0	0					g.chr1:62970389C>A		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4583G>T	chr1.hg19:g.62970389C>A	ENSP00000340742:p.Arg1528Leu	0					DOCK7_ENST00000251157.5_Missense_Mutation_p.R1550L	p.R1528L	NM_033407.2	NP_212132.2	1	2	3	2.040192	Q96N67	DOCK7_HUMAN		36	4600	-			Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	1	0	hg19	c.4583G>T	CCDS30734.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.151238	0.94645	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	T;T	0.64085	-0.08;-0.08	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.81555	0.4847	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;0.974;0.973	D;D;D;D;P;P	0.91635	0.981;0.973;0.999;0.999;0.851;0.907	D	0.84445	0.0585	10	0.72032	D	0.01	.	18.6147	0.91299	0.0:1.0:0.0:0.0	.	1559;1550;1528;1519;1519;1550	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	DOCK7_HUMAN;.;.;.;.;.	L	1559;1550;1528;289	ENSP00000251157:R1550L;ENSP00000340742:R1528L	ENSP00000251157:R1550L	R	-	2	0	0	DOCK7	62742977	62742977	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.814000	0.86154	2.398000	0.81561	0.655000	0.94253	CGA	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.413	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.960000	-4.228586	1	0.520000	NM_033407		0	12	12	0	288	286	0		1	0		0	0	37	0	0	0.999131	3.826640e-01	0	0	0	31	0	12	288
KDM5B	10765	broad.mit.edu	37	1	202724554	202724554	+	Missense_Mutation	SNP	C	C	A	rs76768289		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr1:202724554C>A	ENST00000367265.3	-	11	2547	c.1383G>T	c.(1381-1383)ttG>ttT	p.L461F	KDM5B_ENST00000367264.2_Missense_Mutation_p.L497F|KDM5B_ENST00000456180.1_5'UTR	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	461	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GCATGTTGTTCAAATTCCAGC	0.378																																						ENST00000367265.3	1.000000	0.080000	1.000000	0.110000	0.140000	0.298545	0.140000	0.140000																										0				6						c.(1381-1383)ttG>ttT		lysine (K)-specific demethylase 5B							95.0	101.0	99.0					1																	202724554		2203	4300	6503	SO:0001583	missense	10765	23	121390	41				g.chr1:202724554C>A	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.1383G>T	chr1.hg19:g.202724554C>A	ENSP00000356234:p.Leu461Phe	1					KDM5B_ENST00000456180.1_5'UTR|KDM5B_ENST00000367264.2_Missense_Mutation_p.L497F	p.L461F	NM_006618.3	NP_006609.3	0	5	5	2.415055	Q9UGL1	KDM5B_HUMAN		11	2547	-			O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	0	1	hg19	c.1383G>T	CCDS30974.1	0	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700822	0.68501	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	T;T;T	0.72505	-0.66;-0.66;-0.66	5.73	4.82	0.62117	5.73	4.82	0.62117	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.86351	0.5912	M	0.93328	3.405	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.961;0.999	D	0.88022	0.2769	10	0.87932	D	0	-12.7178	9.1277	0.36826	0.0:0.7688:0.0:0.2312	.	497;461	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	F	461;303;497;303	ENSP00000356234:L461F;ENSP00000356233:L497F;ENSP00000235790:L303F	ENSP00000235790:L303F	L	-	3	2	2	KDM5B	200991177	200991177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.022000	0.41030	1.425000	0.47237	0.655000	0.94253	TTG	0.598326		TCGA-S4-A8RP-01A-11D-A36O-08	0.378	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	68	1	1.960000	-1.775111	0	0.520000	NM_006618		0	20	17	0	642	625	0		1	0		0	0	70	0	0	0.999993	4.654317e-01	0	1	0	49	0	20	642
DCTN1	1639	broad.mit.edu	37	2	74597120	74597120	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr2:74597120C>T	ENST00000361874.3	-	13	1681	c.1364G>A	c.(1363-1365)cGc>cAc	p.R455H	DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409240.1_Missense_Mutation_p.R418H|DCTN1_ENST00000409567.3_Missense_Mutation_p.R435H|DCTN1_ENST00000409438.1_Missense_Mutation_p.R321H|DCTN1_ENST00000394003.3_Missense_Mutation_p.R448H|DCTN1_ENST00000407639.2_Missense_Mutation_p.R321H|DCTN1_ENST00000409868.1_Missense_Mutation_p.R438H	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	455					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CCTCAACTCGCGCACTTTCTC	0.537																																						ENST00000361874.3	1.000000	0.730000	0.950000	0.800000	0.870000	0.876787	0.870000	1.000000																										0				45						c.(1363-1365)cGc>cAc		dynactin 1							159.0	133.0	142.0					2																	74597120		2203	4300	6503	SO:0001583	missense	1639	3	121412	38				g.chr2:74597120C>T		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1364G>A	chr2.hg19:g.74597120C>T	ENSP00000354791:p.Arg455His	0					DCTN1_ENST00000409240.1_Missense_Mutation_p.R418H|DCTN1_ENST00000407639.2_Missense_Mutation_p.R321H|DCTN1_ENST00000409567.3_Missense_Mutation_p.R435H|DCTN1_ENST00000409868.1_Missense_Mutation_p.R438H|DCTN1_ENST00000409438.1_Missense_Mutation_p.R321H|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000394003.3_Missense_Mutation_p.R448H	p.R455H	NM_004082.4	NP_004073.2	0	0	0	2.004695	Q14203	DCTN1_HUMAN		13	1681	-			A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	1	1	hg19	c.1364G>A	CCDS1939.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.327848	0.95733	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.78707	-1.09;-1.09;-1.09;-1.09;-1.09;-1.2;-1.09	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.39615	N	0.001313	D	0.86062	0.5843	L	0.55834	1.745	0.80722	D	1	P;D;D;P;P;D	0.76494	0.745;0.999;0.999;0.522;0.678;0.999	B;P;D;B;B;D	0.78314	0.109;0.902;0.98;0.129;0.254;0.991	D	0.86070	0.1537	10	0.56958	D	0.05	-10.1178	18.4958	0.90864	0.0:1.0:0.0:0.0	.	435;418;455;448;321;321	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	H	455;448;438;321;321;418;438;435	ENSP00000354791:R455H;ENSP00000377571:R448H;ENSP00000384844:R321H;ENSP00000387270:R321H;ENSP00000386406:R418H;ENSP00000387327:R438H;ENSP00000386843:R435H	ENSP00000354791:R455H	R	-	2	0	0	DCTN1	74450628	74450628	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.615000	0.83006	2.659000	0.90383	0.655000	0.94253	CGC	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.537	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	1	0	0	2	2	2	2	0	0	0	0	80	80	80	80	1	1.960000	-20.000000	1	0.520000	NM_004082		0	114	112	0	384	372	1		1	1		0	0	80	0	0	1.000000	1	0	41	0	176	0	114	384
SETMAR	6419	broad.mit.edu	37	3	4345079	4345079	+	Missense_Mutation	SNP	A	A	G			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr3:4345079A>G	ENST00000358065.4	+	1	92	c.25A>G	c.(25-27)Aca>Gca	p.T9A	SUMF1_ENST00000534863.1_Intron|SETMAR_ENST00000430981.1_Missense_Mutation_p.T9A|SETMAR_ENST00000425863.1_Missense_Mutation_p.T9A	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	9	Histone-lysine N-methyltransferase.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		GGCAAAGACGACACGGCCTTG	0.647								Chromatin Structure																														ENST00000358065.4	1.000000	0.540000	1.000000	0.720000	0.930000	0.885546	0.930000	1.000000																										0				9						c.(25-27)Aca>Gca	Chromatin Structure	SET domain and mariner transposase fusion gene							38.0	35.0	36.0					3																	4345079		2203	4300	6503	SO:0001583	missense	6419	0	0					g.chr3:4345079A>G	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.25A>G	chr3.hg19:g.4345079A>G	ENSP00000373354:p.Thr9Ala	0					SETMAR_ENST00000430981.1_Missense_Mutation_p.T9A|SETMAR_ENST00000425863.1_Missense_Mutation_p.T9A|SUMF1_ENST00000534863.1_Intron	p.T9A	NM_006515.3	NP_006506.3	0	0	0	2.011262	Q53H47	SETMR_HUMAN		1	92	+		Melanoma(143;0.0657)	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	1	1	hg19	c.25A>G	CCDS2563.2	1	.	.	.	.	.	.	.	.	.	.	A	10.03	1.238717	0.22711	.	.	ENSG00000170364	ENST00000358065;ENST00000430981;ENST00000425863	D;D;T	0.95001	-3.52;-3.58;0.6	2.53	1.28	0.21552	2.53	1.28	0.21552	.	.	.	.	.	D	0.85673	0.5751	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.71735	-0.4503	7	0.07644	T	0.81	.	5.2353	0.15443	0.6963:0.3037:0.0:0.0	.	.	.	.	A	9	ENSP00000373354:T9A;ENSP00000403000:T9A;ENSP00000403145:T9A	ENSP00000373354:T9A	T	+	1	0	0	SETMAR	4320079	4320079	0.012000	0.17670	0.000000	0.03702	0.002000	0.02628	0.084000	0.14891	0.084000	0.17077	0.482000	0.46254	ACA	0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.647	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.960000	-19.999950	1	0.520000	NM_006515		0	12	12	0	37	36	1		1	0		0	0	10	0	0	0.999364	6.162891e-01	0	1	0	7	0	12	37
LIMCH1	22998	broad.mit.edu	37	4	41615603	41615603	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr4:41615603G>T	ENST00000313860.7	+	7	661	c.607G>T	c.(607-609)Gac>Tac	p.D203Y	LIMCH1_ENST00000508501.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000381753.4_Missense_Mutation_p.D49Y|LIMCH1_ENST00000509638.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000514096.1_Missense_Mutation_p.D56Y|LIMCH1_ENST00000512946.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000503057.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000512820.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000513024.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000509277.1_Missense_Mutation_p.D49Y|LIMCH1_ENST00000396595.3_Missense_Mutation_p.D49Y|LIMCH1_ENST00000509454.1_Missense_Mutation_p.D51Y|LIMCH1_ENST00000511496.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000512632.1_Missense_Mutation_p.D203Y	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	203					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						TGATTCCTTCGACAGCCTGGA	0.552																																						ENST00000313860.7	0.320000	0.110000	0.250000	0.140000	0.190000	0.210020	0.190000	0.190000																										0				41						c.(607-609)Gac>Tac		LIM and calponin homology domains 1							86.0	78.0	81.0					4																	41615603		2203	4300	6503	SO:0001583	missense	22998	0	0					g.chr4:41615603G>T	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.607G>T	chr4.hg19:g.41615603G>T	ENSP00000316891:p.Asp203Tyr	0					LIMCH1_ENST00000509638.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000514096.1_Missense_Mutation_p.D56Y|LIMCH1_ENST00000509454.1_Missense_Mutation_p.D51Y|LIMCH1_ENST00000509277.1_Missense_Mutation_p.D49Y|LIMCH1_ENST00000508501.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000396595.3_Missense_Mutation_p.D49Y|LIMCH1_ENST00000512820.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000512632.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000381753.4_Missense_Mutation_p.D49Y|LIMCH1_ENST00000512946.1_Missense_Mutation_p.D203Y|LIMCH1_ENST00000513024.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000503057.1_Missense_Mutation_p.D44Y|LIMCH1_ENST00000511496.1_Missense_Mutation_p.D44Y	p.D203Y	NM_014988.2	NP_055803.2	1	2	3	2.047020	Q9UPQ0	LIMC1_HUMAN		7	661	+			A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	1	0	hg19	c.607G>T	CCDS33977.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.197899	0.94997	.	.	ENSG00000064042	ENST00000513024;ENST00000509638;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000446625;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000509454;ENST00000396595;ENST00000381753	T;T;T;T;T;T;T;T;T;T;T;T	0.67171	-0.14;0.61;0.6;0.61;0.07;0.55;-0.25;0.01;-0.16;-0.16;0.01;-0.15	5.59	5.59	0.84812	5.59	5.59	0.84812	.	0.044471	0.85682	D	0.000000	T	0.82240	0.4994	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.998;0.999;0.999	D	0.83535	0.0093	10	0.87932	D	0	-23.1392	19.5966	0.95541	0.0:0.0:1.0:0.0	.	49;203;49;49;51;44;44;203;203;203;203	E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;Q6NVB9;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN	Y	44;44;203;203;203;203;203;44;44;44;43;56;49;51;49;49	ENSP00000425222:D44Y;ENSP00000424825:D203Y;ENSP00000424645:D203Y;ENSP00000316891:D203Y;ENSP00000427045:D203Y;ENSP00000424437:D203Y;ENSP00000425631:D44Y;ENSP00000421242:D44Y;ENSP00000426334:D56Y;ENSP00000422864:D49Y;ENSP00000379840:D49Y;ENSP00000371172:D49Y	ENSP00000316891:D203Y	D	+	1	0	0	LIMCH1	41310360	41310360	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.622000	0.88805	0.561000	0.74099	GAC	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.552	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.960000	-4.867502	1	0.520000	NM_014988		0	15	16	0	288	285	0		1	0		0	0	45	0	0	0.999876	1.865243e-01	0	0	0	15	0	15	288
NEK1	4750	broad.mit.edu	37	4	170327820	170327820	+	Missense_Mutation	SNP	G	G	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr4:170327820G>T	ENST00000439128.2	-	30	3857	c.3217C>A	c.(3217-3219)Cgt>Agt	p.R1073S	NEK1_ENST00000507142.1_Missense_Mutation_p.R1101S|NEK1_ENST00000511633.1_Missense_Mutation_p.R1057S|NEK1_ENST00000510533.1_Missense_Mutation_p.R1029S|NEK1_ENST00000512193.1_Missense_Mutation_p.R1004S	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1073					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TTGTCTTGACGAACATCTCCT	0.343																																						ENST00000439128.2	0.300000	0.060000	0.220000	0.100000	0.150000	0.172375	0.150000	0.140000																										0				45						c.(3217-3219)Cgt>Agt		NIMA-related kinase 1							78.0	73.0	74.0					4																	170327820		1823	4086	5909	SO:0001583	missense	4750	0	0					g.chr4:170327820G>T	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.3217C>A	chr4.hg19:g.170327820G>T	ENSP00000408020:p.Arg1073Ser	0					NEK1_ENST00000512193.1_Missense_Mutation_p.R1004S|NEK1_ENST00000511633.1_Missense_Mutation_p.R1057S|NEK1_ENST00000510533.1_Missense_Mutation_p.R1029S|NEK1_ENST00000507142.1_Missense_Mutation_p.R1101S	p.R1073S	NM_012224.2	NP_036356.1	1	2	3	2.047020	Q96PY6	NEK1_HUMAN		30	3857	-		Prostate(90;0.00601)|Renal(120;0.0183)	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	1	0	hg19	c.3217C>A	CCDS47162.1	0	.	.	.	.	.	.	.	.	.	.	G	5.931	0.355845	0.11239	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.03	2.21	0.28008	5.03	2.21	0.28008	.	1.020820	0.07793	N	0.955279	T	0.29458	0.0734	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.31625	0.034;0.332;0.067;0.332;0.006	B;B;B;B;B	0.30495	0.054;0.116;0.054;0.116;0.015	T	0.24154	-1.0168	10	0.13108	T	0.6	.	6.2799	0.21001	0.2397:0.1331:0.6273:0.0	.	1004;1057;1101;1029;1073	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	S	1073;1057;1029;1101;1004	ENSP00000408020:R1073S;ENSP00000423332:R1057S;ENSP00000427653:R1029S;ENSP00000424757:R1101S;ENSP00000424938:R1004S	ENSP00000408020:R1073S	R	-	1	0	0	NEK1	170564395	170564395	0.856000	0.29760	0.005000	0.12908	0.071000	0.16799	3.304000	0.51866	0.566000	0.29273	0.591000	0.81541	CGT	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.343	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.960000	-2.924718	1	0.520000			0	8	7	0	201	197	0		1	0		0	0	27	0	0	0.988718	9.396337e-02	0	0	0	12	0	8	201
HTR1A	3350	broad.mit.edu	37	5	63257207	63257207	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr5:63257207C>T	ENST00000323865.3	-	1	573	c.340G>A	c.(340-342)Gcc>Acc	p.A114T	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	114	Agonist binding. {ECO:0000250}.				adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	ACGTCGAGGGCGATGAACAGG	0.607																																						ENST00000323865.3	0.730000	0.290000	0.620000	0.380000	0.490000	0.506042	0.490000	0.480000																										0				56						c.(340-342)Gcc>Acc		5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)						69.0	63.0	65.0					5																	63257207		2202	4300	6502	SO:0001583	missense	3350	0	0					g.chr5:63257207C>T	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.340G>A	chr5.hg19:g.63257207C>T	ENSP00000316244:p.Ala114Thr	1					RP11-158J3.2_ENST00000502882.1_RNA	p.A114T	NM_000524.3	NP_000515.2	0	1	1	1.689880	P08908	5HT1A_HUMAN		1	573	-		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	0	1	hg19	c.340G>A	CCDS34168.1	0	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747595	0.49257	.	.	ENSG00000178394	ENST00000323865	T	0.37752	1.18	5.12	1.64	0.23874	5.12	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.060603	0.64402	D	0.000002	T	0.22044	0.0531	N	0.25426	0.745	0.41085	D	0.985551	P	0.41848	0.763	B	0.35655	0.207	T	0.03148	-1.1067	10	0.26408	T	0.33	.	12.99	0.58614	0.752:0.2479:0.0:0.0	.	114	P08908	5HT1A_HUMAN	T	114	ENSP00000316244:A114T	ENSP00000316244:A114T	A	-	1	0	0	HTR1A	63292963	63292963	0.996000	0.38824	0.989000	0.46669	0.928000	0.56348	2.510000	0.45468	0.399000	0.25367	0.561000	0.74099	GCC	0.418745		TCGA-S4-A8RP-01A-11D-A36O-08	0.607	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.960000	-19.999990	1	0.520000	NM_000524		0	15	14	0	82	81	1		1			0	0	15	0	0	0.999894	0	0	0	0	0	0	15	82
JADE2	23338	broad.mit.edu	37	5	133914244	133914244	+	Nonsense_Mutation	SNP	C	C	A			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr5:133914244C>A	ENST00000282605.4	+	12	1828	c.1742C>A	c.(1741-1743)tCg>tAg	p.S581*	PHF15_ENST00000402835.1_3'UTR|PHF15_ENST00000395003.1_Nonsense_Mutation_p.S537*|PHF15_ENST00000361895.2_Nonsense_Mutation_p.S538*																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGGCACAGTCGGTGCAGATC	0.607																																						ENST00000282605.4	1.000000	0.020000	1.000000	0.040000	0.070000	0.294825	0.070000	0.070000																										0				22						c.(1741-1743)tCg>tAg									113.0	110.0	111.0					5																	133914244		2203	4300	6503	SO:0001587	stop_gained	0	0	0					g.chr5:133914244C>A																												ENST00000282605.4:c.1742C>A	chr5.hg19:g.133914244C>A	ENSP00000282605:p.Ser581*	1					PHF15_ENST00000361895.2_Nonsense_Mutation_p.S538*|PHF15_ENST00000395003.1_Nonsense_Mutation_p.S537*|PHF15_ENST00000402835.1_3'UTR	p.S581*			0	3	3	2.192983			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	12	1828	+				Nonsense_Mutation	SNP	ENST00000282605.4	0	1	hg19	c.1742C>A		0	.	.	.	.	.	.	.	.	.	.	c	38	7.004263	0.97994	.	.	ENSG00000043143	ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000395003	.	.	.	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.654761	0.14755	N	0.300363	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4569	0.90724	0.0:1.0:0.0:0.0	.	.	.	.	X	581;597;581;538;538;537	.	ENSP00000282605:S581X	S	+	2	0	0	PHF15	133942143	133942143	1.000000	0.71417	0.926000	0.36857	0.861000	0.49209	5.489000	0.66875	2.367000	0.80283	0.306000	0.20318	TCG	0.577167		TCGA-S4-A8RP-01A-11D-A36O-08	0.607	PHF15-003	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251170.1	0	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	1.960000	-2.462800	0	0.520000			0	8	7	0	555	548	0		1	0		0	0	92	0	0	0.988736	1.751833e-01	0	0	0	47	0	8	555
ZNF451	26036	broad.mit.edu	37	6	57018799	57018799	+	Silent	SNP	A	A	G			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr6:57018799A>G	ENST00000370706.4	+	13	3268	c.3024A>G	c.(3022-3024)ggA>ggG	p.G1008G	RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|ZNF451_ENST00000491832.2_Silent_p.G1008G|ZNF451_ENST00000357489.3_Silent_p.G960G|RP11-203B9.4_ENST00000587815.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	1008					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ACTTAGAGGGAGATATGATGT	0.458																																						ENST00000370706.4	1.000000	0.760000	1.000000	0.840000	0.910000	0.916721	0.910000	1.000000																										0				32						c.(3022-3024)ggA>ggG		zinc finger protein 451							86.0	84.0	85.0					6																	57018799		2203	4300	6503	SO:0001819	synonymous_variant	26036	0	0					g.chr6:57018799A>G	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.3024A>G	chr6.hg19:g.57018799A>G		0					RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|ZNF451_ENST00000491832.2_Silent_p.G1008G|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|ZNF451_ENST00000357489.3_Silent_p.G960G	p.G1008G	NM_001031623.2	NP_001026794.1	0	0	0	2.004149	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)	13	3268	+	Lung NSC(77;0.145)		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Silent	SNP	ENST00000370706.4	1	1	hg19	c.3024A>G	CCDS43477.1	1																																																																																								0.517491		TCGA-S4-A8RP-01A-11D-A36O-08	0.458	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.960000	-20.000000	1	0.520000	NM_015555		0	105	104	0	331	324	1		1	1		0	0	62	0	0	1.000000	9.747737e-01	0	7	0	14	0	105	331
HBS1L	10767	broad.mit.edu	37	6	135300380	135300380	+	Missense_Mutation	SNP	C	C	A	rs562783458		TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr6:135300380C>A	ENST00000367837.5	-	14	1830	c.1624G>T	c.(1624-1626)Gac>Tac	p.D542Y	HBS1L_ENST00000367824.4_Missense_Mutation_p.D378Y|HBS1L_ENST00000527578.1_Missense_Mutation_p.D378Y|HBS1L_ENST00000445176.2_Missense_Mutation_p.D266Y|HBS1L_ENST00000415177.2_Missense_Mutation_p.D477Y|HBS1L_ENST00000367826.2_Missense_Mutation_p.D500Y	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase	542					signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		GCCGCCCAGTCGACAGGTTCA	0.428																																						ENST00000367837.5	0.280000	0.070000	0.220000	0.110000	0.150000	0.169764	0.150000	0.150000																										0				20						c.(1624-1626)Gac>Tac		HBS1-like translational GTPase							88.0	78.0	81.0					6																	135300380		2203	4299	6502	SO:0001583	missense	10767	0	0					g.chr6:135300380C>A	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.1624G>T	chr6.hg19:g.135300380C>A	ENSP00000356811:p.Asp542Tyr	1					HBS1L_ENST00000445176.2_Missense_Mutation_p.D266Y|HBS1L_ENST00000367826.2_Missense_Mutation_p.D500Y|HBS1L_ENST00000527578.1_Missense_Mutation_p.D378Y|HBS1L_ENST00000415177.2_Missense_Mutation_p.D477Y|HBS1L_ENST00000367824.4_Missense_Mutation_p.D378Y	p.D542Y	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	0	1	1	1.504111	Q9Y450	HBS1L_HUMAN		14	1830	-	Colorectal(23;0.221)		B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	1	0	hg19	c.1624G>T	CCDS5173.1	0	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248542	0.59103	.	.	ENSG00000112339	ENST00000367837;ENST00000527578;ENST00000415177;ENST00000367826;ENST00000367824;ENST00000533274;ENST00000445176	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.72	5.72	0.89469	5.72	5.72	0.89469	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.088162	0.85682	D	0.000000	D	0.87605	0.6219	H	0.97186	3.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	D	0.90934	0.4792	10	0.72032	D	0.01	-31.4881	19.8674	0.96824	0.0:1.0:0.0:0.0	.	500;542	Q9Y450-4;Q9Y450	.;HBS1L_HUMAN	Y	542;378;477;500;378;412;266	ENSP00000356811:D542Y;ENSP00000436256:D378Y;ENSP00000389826:D477Y;ENSP00000356800:D500Y;ENSP00000356798:D378Y;ENSP00000434533:D412Y;ENSP00000415305:D266Y	ENSP00000356798:D378Y	D	-	1	0	0	HBS1L	135342073	135342073	1.000000	0.71417	0.496000	0.27539	0.109000	0.19521	7.666000	0.83877	2.690000	0.91761	0.655000	0.94253	GAC	0.351351		TCGA-S4-A8RP-01A-11D-A36O-08	0.428	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2	1	0	0	2	2	2	2	0	0	0	0	32	32	32	31	1	1.960000	-11.271480	1	0.520000			0	8	10	0	139	137	0		1	0		0	0	32	0	0	0.990001	6.802806e-01	0	0	0	41	0	8	139
RELN	5649	broad.mit.edu	37	7	103132427	103132427	+	Missense_Mutation	SNP	A	A	G			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr7:103132427A>G	ENST00000428762.1	-	58	9575	c.9416T>C	c.(9415-9417)gTa>gCa	p.V3139A	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.V3139A|RELN_ENST00000343529.5_Missense_Mutation_p.V3139A	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3139					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTCCAGCATTACGGAATGAAG	0.363																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	1.000000	0.690000	1.000000	0.780000	0.880000	0.886732	0.880000	1.000000																										0				227						c.(9415-9417)gTa>gCa		reelin							94.0	84.0	87.0					7																	103132427		2203	4300	6503	SO:0001583	missense	5649	0	0					g.chr7:103132427A>G		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9416T>C	chr7.hg19:g.103132427A>G	ENSP00000392423:p.Val3139Ala	0					RELN_ENST00000424685.2_Missense_Mutation_p.V3139A|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000343529.5_Missense_Mutation_p.V3139A	p.V3139A	NM_005045.3	NP_005036.2	0	0	0	2.017447	P78509	RELN_HUMAN		58	9575	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	1	1	hg19	c.9416T>C	CCDS47680.1	1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.658140	0.88154	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.34472	1.36;1.36;1.36	5.93	5.93	0.95920	5.93	5.93	0.95920	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.60011	0.2236	M	0.76170	2.325	0.58432	D	0.999999	D;B	0.55800	0.973;0.34	D;B	0.63957	0.92;0.224	T	0.63812	-0.6552	10	0.87932	D	0	.	16.3829	0.83481	1.0:0.0:0.0:0.0	.	3139;3139	P78509-2;P78509	.;RELN_HUMAN	A	3139;3139;3139;656;3139	ENSP00000392423:V3139A;ENSP00000345694:V3139A;ENSP00000388446:V3139A	ENSP00000345694:V3139A	V	-	2	0	0	RELN	102919663	102919663	1.000000	0.71417	0.843000	0.33291	0.866000	0.49608	8.558000	0.90704	2.271000	0.75665	0.459000	0.35465	GTA	0.520000		TCGA-S4-A8RP-01A-11D-A36O-08	0.363	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.960000	-20.000000	1	0.520000	NM_005045		0	54	54	0	179	175	0		1	0		0	0	36	0	0	1.000000	1.398933e-01	0	0	0	3	0	54	179
PRSS1	5644	broad.mit.edu	37	7	142458439	142458439	+	Missense_Mutation	SNP	T	T	C	rs564368252	byFrequency	TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr7:142458439T>C	ENST00000311737.7	+	2	80	c.74T>C	c.(73-75)gTt>gCt	p.V25A	PRSS1_ENST00000486171.1_Missense_Mutation_p.V25A	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	25	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GACAAGATCGTTGGGGGCTAC	0.547													T|||	2	0.000399361	0.0	0.0	5008	,	,		19800	0.0		0.0	False		,,,				2504	0.002					ENST00000311737.7	0.430000	0.290000	0.400000	0.320000	0.350000	0.363888	0.350000	0.360000																										0				38						c.(73-75)gTt>gCt		protease, serine, 1 (trypsin 1)	Aprotinin(DB06692)						157.0	155.0	155.0					7																	142458439		2203	4300	6503	SO:0001583	missense	5644	2	121412	39				g.chr7:142458439T>C	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.74T>C	chr7.hg19:g.142458439T>C	ENSP00000308720:p.Val25Ala	0					PRSS1_ENST00000486171.1_Missense_Mutation_p.V25A	p.V25A	NM_002769.4	NP_002760.1	0	0	0	2.017447	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)	2	80	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	1	1	hg19	c.74T>C	CCDS5872.1	0	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291402	0.40494	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.94457	-3.43;-3.43	3.49	2.29	0.28610	3.49	2.29	0.28610	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.057642	0.64402	D	0.000001	D	0.96457	0.8844	M	0.84773	2.715	0.42968	D	0.994423	P	0.38677	0.642	P	0.56960	0.81	D	0.95576	0.8642	10	0.87932	D	0	.	8.5187	0.33262	0.1739:0.0:0.0:0.8261	.	25	P07477	TRY1_HUMAN	A	25	ENSP00000417854:V25A;ENSP00000308720:V25A	ENSP00000308720:V25A	V	+	2	0	0	PRSS1	142138013	142138013	1.000000	0.71417	0.919000	0.36401	0.005000	0.04900	4.922000	0.63404	0.484000	0.27630	-0.794000	0.03295	GTT	0.520000		TCGA-S4-A8RP-01A-11D-A36O-08	0.547	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2	1	0	0	2	2	2	2	0	0	0	0	129	129	129	138	1	1.960000	-20.000000	1	0.520000			0	99	45	0	955	756	0		1	1	1	0	0	129	99	0	1.000000	1	9.999197e-01	28	4	2367	124	99	955
NUB1	51667	broad.mit.edu	37	7	151046243	151046243	+	Missense_Mutation	SNP	A	A	G			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr7:151046243A>G	ENST00000355851.4	+	3	279	c.202A>G	c.(202-204)Att>Gtt	p.I68V	NUB1_ENST00000568733.1_Missense_Mutation_p.I92V|NUB1_ENST00000413040.2_Missense_Mutation_p.I92V|NUB1_ENST00000566856.1_Missense_Mutation_p.I68V	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	68					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		TTGCAAGGCAATTGAGCGTGG	0.368																																						ENST00000355851.4	1.000000	0.860000	1.000000	0.930000	0.990000	0.977843	0.990000	1.000000																										0				11						c.(202-204)Att>Gtt		negative regulator of ubiquitin-like proteins 1							122.0	120.0	121.0					7																	151046243		1861	4102	5963	SO:0001583	missense	51667	0	0					g.chr7:151046243A>G	AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.202A>G	chr7.hg19:g.151046243A>G	ENSP00000348110:p.Ile68Val	0					NUB1_ENST00000568733.1_Missense_Mutation_p.I92V|NUB1_ENST00000413040.2_Missense_Mutation_p.I92V|NUB1_ENST00000566856.1_Missense_Mutation_p.I68V	p.I68V	NM_001243351.1	NP_001230280.1	1	2	3	2.043668	Q9Y5A7	NUB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00569)	3	279	+			O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	ENST00000355851.4	1	1	hg19	c.202A>G		1	.	.	.	.	.	.	.	.	.	.	A	11.23	1.576657	0.28092	.	.	ENSG00000013374	ENST00000413040;ENST00000355851;ENST00000470229;ENST00000490215;ENST00000483358	T;T;T	0.42900	0.96;0.96;0.96	5.95	2.18	0.27775	5.95	2.18	0.27775	.	0.222920	0.47093	N	0.000249	T	0.23249	0.0562	N	0.25201	0.72	0.35458	D	0.7963	B;B;B	0.24092	0.097;0.002;0.004	B;B;B	0.18263	0.021;0.002;0.004	T	0.19976	-1.0289	10	0.14252	T	0.57	-16.5287	8.2332	0.31610	0.7526:0.0:0.2474:0.0	.	68;68;68	F8WDL9;Q9Y5A7;Q9Y5A7-2	.;NUB1_HUMAN;.	V	68	ENSP00000348110:I68V;ENSP00000418234:I68V;ENSP00000420086:I68V	ENSP00000348110:I68V	I	+	1	0	0	NUB1	150677176	150677176	0.995000	0.38212	0.991000	0.47740	0.997000	0.91878	1.119000	0.31258	0.131000	0.18576	0.533000	0.62120	ATT	0.522483		TCGA-S4-A8RP-01A-11D-A36O-08	0.368	NUB1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	80	80	80	78	1	1.960000	-20.000000	1	0.520000	NM_016118		0	125	125	0	350	344	1		1	1		0	0	80	0	0	1.000000	1	0	21	0	70	0	125	350
SCRIB	23513	broad.mit.edu	37	8	144891881	144891881	+	Missense_Mutation	SNP	C	C	T	rs550678185	byFrequency	TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chr8:144891881C>T	ENST00000320476.3	-	14	1544	c.1538G>A	c.(1537-1539)cGg>cAg	p.R513Q	SCRIB_ENST00000377533.3_Missense_Mutation_p.R432Q|SCRIB_ENST00000356994.2_Missense_Mutation_p.R513Q	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	513	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGCACTCAGCCGCTTCTCCTG	0.687													C|||	2	0.000399361	0.0	0.0	5008	,	,		15539	0.001		0.0	False		,,,				2504	0.001				Pancreas(51;966 1133 10533 14576 29674)	ENST00000320476.3	1.000000	0.710000	1.000000	0.800000	0.900000	0.903893	0.900000	1.000000																										0				42						c.(1537-1539)cGg>cAg		scribbled planar cell polarity protein							34.0	30.0	32.0					8																	144891881		2200	4292	6492	SO:0001583	missense	23513	13	121316	40				g.chr8:144891881C>T	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1538G>A	chr8.hg19:g.144891881C>T	ENSP00000322938:p.Arg513Gln	1					SCRIB_ENST00000356994.2_Missense_Mutation_p.R513Q|SCRIB_ENST00000377533.3_Missense_Mutation_p.R432Q	p.R513Q	NM_015356.4	NP_056171	0	3	3	2.531440	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)	14	1544	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	1	1	hg19	c.1538G>A	CCDS6411.1	1	.	.	.	.	.	.	.	.	.	.	c	13.82	2.351523	0.41700	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.78924	-1.22;-1.22;-1.22	4.54	3.64	0.41730	4.54	3.64	0.41730	.	.	.	.	.	T	0.80649	0.4663	L	0.47716	1.5	0.46396	D	0.999022	D;D	0.76494	0.999;0.999	D;D	0.79784	0.984;0.993	T	0.74722	-0.3569	9	0.11485	T	0.65	.	11.3811	0.49757	0.0:0.9096:0.0:0.0904	.	513;513	Q14160;Q14160-3	SCRIB_HUMAN;.	Q	513;513;432	ENSP00000349486:R513Q;ENSP00000322938:R513Q;ENSP00000366756:R432Q	ENSP00000322938:R513Q	R	-	2	0	0	SCRIB	144963869	144963869	1.000000	0.71417	0.892000	0.35008	0.125000	0.20455	4.335000	0.59298	2.249000	0.74217	0.401000	0.26515	CGG	0.619048		TCGA-S4-A8RP-01A-11D-A36O-08	0.687	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	49	1	1.960000	-20.000000	1	0.520000	NM_015356		0	59	59	0	255	250	1		1	1		0	0	50	0	0	1.000000	9.999779e-01	0	17	0	54	0	59	255
NONO	4841	broad.mit.edu	37	X	70517747	70517747	+	Missense_Mutation	SNP	C	C	T			TCGA-S4-A8RP-01A-11D-A36O-08	TCGA-S4-A8RP-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	317e480a-3ba4-44b1-9920-557bc1b4c4ee	5f6753a1-efa7-4751-b4ae-2b230620b524	g.chrX:70517747C>T	ENST00000276079.8	+	9	1295	c.1090C>T	c.(1090-1092)Cgg>Tgg	p.R364W	NONO_ENST00000373841.1_Missense_Mutation_p.R364W|NONO_ENST00000535149.1_Missense_Mutation_p.R275W|NONO_ENST00000490044.1_3'UTR|NONO_ENST00000373856.3_Missense_Mutation_p.R364W	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	364	DBHS.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					AGAAATGATGCGGCGACAGCA	0.512			T	TFE3	papillary renal cancer																																	ENST00000276079.8	0.300000	0.050000	0.220000	0.090000	0.140000	0.163724	0.140000	0.140000				Dom	yes			Dom	yes		X	Xq13.1	Xq13.1	4841	T	"""non-POU domain containing, octamer-binding"""				E	E	TFE3		papillary renal cancer	NONO/TFE3(2)	0				19						c.(1090-1092)Cgg>Tgg		non-POU domain containing, octamer-binding							91.0	68.0	76.0					X																	70517747		2203	4300	6503	SO:0001583	missense	4841	0	0					g.chrX:70517747C>T	L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.1090C>T	chrX.hg19:g.70517747C>T	ENSP00000276079:p.Arg364Trp						NONO_ENST00000535149.1_Missense_Mutation_p.R275W|NONO_ENST00000490044.1_3'UTR|NONO_ENST00000373856.3_Missense_Mutation_p.R364W|NONO_ENST00000373841.1_Missense_Mutation_p.R364W	p.R364W	NM_007363.4	NP_031389.3	0	1	1		Q15233	NONO_HUMAN		9	1295	+	Renal(35;0.156)		B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Missense_Mutation	SNP	ENST00000276079.8	0	1	hg19	c.1090C>T	CCDS14410.1	0	.	.	.	.	.	.	.	.	.	.	c	16.85	3.235855	0.58886	.	.	ENSG00000147140	ENST00000535149;ENST00000276079;ENST00000373856;ENST00000373841	T;T;T;T	0.31510	1.54;1.49;1.49;1.49	5.23	4.35	0.52113	5.23	4.35	0.52113	.	0.050066	0.85682	D	0.000000	T	0.50548	0.1622	M	0.75085	2.285	0.80722	D	1	D	0.76494	0.999	P	0.62089	0.898	T	0.54576	-0.8273	10	0.87932	D	0	-11.2943	11.2281	0.48897	0.5288:0.4712:0.0:0.0	.	364	Q15233	NONO_HUMAN	W	275;364;364;364	ENSP00000441364:R275W;ENSP00000276079:R364W;ENSP00000362963:R364W;ENSP00000362947:R364W	ENSP00000276079:R364W	R	+	1	2	2	NONO	70434472	70434472	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.256000	0.51492	1.145000	0.42336	0.529000	0.55759	CGG	0.520000		TCGA-S4-A8RP-01A-11D-A36O-08	0.512	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057138.1	0	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.960000	-2.908823	1	0.520000	NM_007363		0	5	5	0	133	131	0		1	1		0	0	19	0	0	0.936303	9.992967e-01	0	4	0	471	0	5	133
